Anti-CD3 aptamers for cell targeting and labeling
Aptamers targeting CD3ε/γ or CD3ε/δ protein complexes offer improved stability and specificity for T cell labeling and delivery, addressing the limitations of traditional antibodies by providing effective, non-immunogenic cell targeting and delivery solutions.
Patent Information
- Application Number
- JP2022531084
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-07-26
- Filing Date
- 2020-07-27
- Publication Date
- 2025-08-27
- Estimated Expiration
- 2040-07-27
AI Technical Summary
Existing antibodies used for targeting and labeling T cells suffer from immunogenicity, high cost, and limited stability, making them less effective for cell targeting and labeling applications.
Development of DNA and RNA aptamers that specifically bind to CD3ε/γ or CD3ε/δ protein complexes, allowing for targeted labeling, purification, or selection of T cells, and delivery vehicles for in vitro or in vivo targeting, using sequences such as CTGG, GGGX1TTGGCX2X3X4GGGX5CTGGC, and GGGTTTGGCAX1CGGGCCTGGC, with dissociation constants ranging from 0.2 pM to 800 nM.
The aptamers provide high specificity and stability, enabling effective labeling and targeting of T cells without activation, and can be used in pharmaceutical compositions and drug delivery vehicles, including polymeric nanoparticles and viral vectors, without the drawbacks of traditional antibodies.
Smart Images

Figure 0007730170000015 
Figure 0007730170000016 
Figure 0007730170000017
Abstract
Description
[Technical Field]
[0001] The present invention relates to DNA and RNA aptamers that bind to CD3 and can be used to target, label, or select T cells. CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 879,401, filed July 26, 2019, and U.S. Provisional Application No. 62 / 879,413, filed July 26, 2019, and PCT Application No. PCT / IB2019 / 000890, filed July 26, 2019. Each of the foregoing applications is incorporated herein by reference in its entirety. [Background technology]
[0002] CD3 is a protein complex containing one γ subunit, one δ subunit, and two ε subunits. It associates with the T cell receptor (TCR) to form CD3γε and CD3δε heterodimers, which transmit intracellular signals when the TCR binds to a peptide-MHC complex. The CD3 subunits are highly homologous, each possessing a small cytoplasmic domain and a transmembrane domain containing negatively charged residues, which associate with positively charged residues in the transmembrane region of the TCR. The TCR contains α, β, ζ, and η subunits and exists as either a ζζ homodimer or an αβ heterodimer associated with a ζη heterodimer. The TCR then associates with the CD3γε and CD3δε heterodimers.
[0003] Aptamers are short, single-stranded oligonucleotides with unique three-dimensional configurations. Like antibodies, aptamers bind to targets with high specificity and can often modulate the target's biological activity. Aptamers offer many advantages over antibodies, including lack of immunogenicity, well-controlled and inexpensive chemical synthesis, high stability, and good tissue penetration. Aptamers can also be conjugated to nanoparticles, drugs, imaging agents, and other nucleic acids for use as targeting moieties. Summary of the Invention [Problem to be solved by the invention]
[0004] They are required to have properties that antibodies lack, such as lack of immunogenicity, well-controlled and inexpensive chemical synthesis, high stability, and good tissue penetration. [Means for solving the problem]
[0005] The technology provides DNA and RNA aptamers that bind to CD3 and can be used to target, label, or select T cells. Thus, in one aspect, this technology provides aptamers that bind to the CD3ε / γ or CD3ε / δ protein complexes. Aptamers include polynucleotides having any of several nucleic acid sequences described herein.
[0006] Another aspect of the invention is a method for labeling, purifying, or selecting cells expressing CD3. Cells are cultured with an anti-CD3 aptamer bearing a label, such as a fluorescent label or a radioisotope. Another aspect of this technology is a delivery vehicle for in vitro or in vivo targeting of T cells that contains the anti-CD3 aptamers described above. Yet another aspect of the technology is a method of targeting a delivery vehicle to T cells in a subject, the method comprising administering the delivery vehicle to the subject. Additionally, the technology provides pharmaceutical compositions comprising the above drug delivery vehicles.
[0007] The present technology can be further summarized in the following list of features: 1. Array GX1X2TX3GX4X5X6X7X8X9GGX 10 An aptamer comprising CTGG, wherein X1 is G or A; X2 and X6 are A, T, or G; X3 is T or G; X4 and X9 are G or C; X5 is C or T; X7 is T, G, or C; and X8 and X9 are G or C. 10is C, T, or A (SEQ ID NO: 109) or a variant thereof, and the aptamer binds to CD3ε / γ or CD3ε / δ. 2. An aptamer comprising the sequence GGGX1TTGGCX2X3X4GGGX5CTGGC, wherein X1 and X2 are A, T, or G, X3 is T, C, or G, and X4 and X5 are A, T, or C (SEQ ID NO: 110) or a variant thereof, wherein the aptamer binds to CD3ε / γ or CD3ε / δ. An aptamer comprising the sequence GX1TTX2GX3X4X5X6CX7GGX8CTGGX9G, wherein X1 is A or G, X2 is T or G, X3, X7, and X9 are G or C, X4 is T or C, X5 is A or T, X6 is T, C, or G, and X8 is A or C (SEQ ID NO: 111) or a variant thereof, wherein the aptamer binds to CD3ε / γ or CD3ε / δ.
[0008] 4. An aptamer comprising the sequence GGGTTTGGCAX1CGGGCCTGGC, where X1 is G, C, or T (SEQ ID NO: 112) or a variant thereof, wherein said aptamer binds to CD3ε / γ or CD3ε / δ. 5. An aptamer comprising the sequence GCAGCGAUUCUX1GUUU, wherein X1 is U or a non-base (SEQ ID NO: 113) or a variant thereof, wherein said aptamer binds to CD3ε / γ or CD3ε / δ. 6. The aptamer according to any one of Features 1 to 5, wherein the aptamer binds to human CD3ε / γ and / or CD3ε / δ with a dissociation constant of about 0.2 pM to about 250 nM. 7. The aptamer according to any one of Features 1 to 5, wherein the aptamer binds to non-human CD3ε / γ and / or CD3ε / δ with a dissociation constant of about 20 nM to about 800 nM.
[0009] 8. The aptamer according to any one of Features 1 to 7, comprising a sequence selected from SEQ ID NOs: 1 to 108. 9. The aptamer of any one of Features 1 to 8, comprising a variant of the sequence in which one or more of the bases are substituted with a non-naturally occurring base, or one or more of the bases are omitted, or the corresponding nucleotide is replaced with a linker. 10. The aptamer of Feature 9, wherein one or more of the unnatural bases is selected from the group consisting of methylinosine, dihydrouridine, methylguanosine, and thiouridine. 11. An aptamer according to any one of features 1 to 10, which binds to CD3+ T cells but does not activate them.
[0010] 12. A vehicle for delivering a drug, a dye, a functional group for covalent attachment, or a biologically active agent to a T cell, said vehicle comprising an aptamer according to any one of Features 1-10. 13. The vehicle according to feature 11 or feature 12, comprising polymeric nanoparticles. 14. The vehicle according to Feature 13, wherein the polymeric nanoparticles comprise poly(beta amino ester) (PBAE). 15. The vehicle of feature 13 or feature 14, wherein the aptamer is covalently bound to the polymer. 16. The vehicle according to any one of features 13 to 15, wherein the agent is a T cell modulator or an imaging agent.
[0011] 17. The vehicle according to feature 16, wherein the T cell modulator is a viral vector carrying a transgene, the viral vector is coated with a polymer, and the aptamer is covalently bound to the polymer. 18. The vehicle according to feature 17, wherein the viral vector is a lentiviral vector. 19. The vehicle of feature 17 or feature 18, wherein the transgene encodes a chimeric antigen receptor. 20. The vehicle of feature 16, wherein the T cell modulator is selected from the group consisting of dasatinib, a MEK1 / 2 inhibitor, a PI3K inhibitor, an HDAC inhibitor, a kinase inhibitor, a metabolic inhibitor, a GSK3 beta inhibitor, an MAO-B inhibitor, and a Cdk5 inhibitor.
[0012] 21. A method for delivering a drug to T cells in a subject, the method comprising administering to the subject a vehicle described in any one of features 16 to 20. 22. A pharmaceutical composition comprising a vehicle according to any one of features 16 to 20 and one or more excipients. 23. A method for isolating T cells from a subject, the method comprising isolating T cells from the subject using a vehicle according to any one of features 1 to 12. [Brief explanation of the drawings]
[0013] [Figure 1] Figure 1 shows the first 45 nucleic acid sequences (SEQ ID NOS: 1-45, top to bottom) of anti-CD3 DNA aptamers (clusters) obtained by SELEX on a mixture of recombinant human CD3ε / γ and human CD3ε / δ proteins. Each complex was prepared as a C-terminal Fc fusion. hIgG1 Fc was used as the counter-target. The clusters are arranged from top to bottom in order of frequency of occurrence in a particular round of SELEX. [Figure 2] Figures 2A-2E are bar graphs showing the binding of aptamers Cluster_1 (SEQ ID NO: 1), Cluster_1s (SEQ ID NO: 46, corresponding to Cluster_1 with the 5' and 3' flanking regions removed), Cluster_2 (SEQ ID NO: 2), Cluster_3 (SEQ ID NO: 3), and Cluster_21 (SEQ ID NO: 21) to Jurkat cells (human CD3+ cells), obtained by the SELEX procedure (Figure 1). For comparison, binding of the aptamers to Ramos cells (human CD3- cells; control) is also shown. Binding was tested at three concentrations of aptamer (3 nM, 10 nM, and 30 nM). [Figure 3]Figures 3A-3E are bar graphs showing the binding results of aptamers CELTIC_1 (SEQ ID NO: 1), CELTIC_1s (SEQ ID NO: 46), CELTIC_2 (SEQ ID NO: 2), CELTIC_3 (SEQ ID NO: 3), and CELTIC_21 (SEQ ID NO: 21) to Jurkat cells (CD3+ cells), obtained by the SELEX procedure (Figure 1). For comparison, binding of the aptamers to Ramos cells (CD3- cells; control) is also shown. Binding was tested at the following aptamer concentrations: 1 nM, 2.5 nM, 5 nM, 7.5 nM, and 10 nM.
[0014] [Figure 4] Figures 4A-4C are sensorgrams showing the binding of biotinylated aptamers CELTIC_1 (SEQ ID NO: 1), CELTIC_3 (SEQ ID NO: 3), and CELTIC_21 (SEQ ID NO: 21) immobilized on a series sensor SA chip to CD3ε / γ (left column), CD3ε / δ (center column), and control hIgG1 Fc (right column), respectively. Binding was measured by surface plasmon resonance using a single-cycle kinetic protocol. Sequential injections of aptamers at concentrations of 3 nM, 10 nM, 30 nM, 50 nM, and 100 nM were performed. [Figure 5] Figures 5A-5F are bar graphs showing the binding of aptamers CELTIC_2 (SEQ ID NO: 2), CELTIC_3 (SEQ ID NO: 3), and CELTIC_21 (SEQ ID NO: 21), and their shorter versions lacking the flanking regions, CELTIC_2s (SEQ ID NO: 47), CELTIC_3s (SEQ ID NO: 48), and CELTIC_21s (SEQ ID NO: 49), to Jurkat cells (CD3+ cells). Binding was measured at aptamer concentrations of 3 nM, 10 nM, and 30 nM. Figures 5A and 5D show the binding of CELTIC_2 and CELTIC_2s, respectively. Figures 5B and 5E show the binding of CELTIC_3 and CELTIC_3s, respectively. Figures 5C and 5F show the binding of CELTIC_21 and CELTIC_21s, respectively. For comparison, binding of the aptamer to Ramos cells (CD3- cells; control) is shown. [Figure 6] Figure 6 shows the alignment of the sequences of clusters 1, 2, 3, and 21 (SEQ ID NOs: 1, 2, 3, and 21, respectively) with clusters 1, 2, and 3 showing the homologous core regions. Multiple sequence alignment was performed with the ClustalW algorithm. Nucleotides found to be conserved in each cluster are marked with an *.
[0015] [Figure 7] Figures 7A and 7B show the DNA sequences of several additional clusters (SEQ ID NOs: 11, 7, 5, 9, 22, 2, 17, 14, 15, 20, 18, 12, 1, 8, 13, 3, 4, 6, 19, 10, and 16 from top to bottom in Figure 7A; SEQ ID NOs: 1 to 22 from top to bottom in Figure 7B), the SELEX procedure (Figure 1), and alignments with or without the sequences of cluster 21 (Figures 7A and 7B, respectively). Multiple sequence alignments were performed using the ClustalW algorithm. Nucleotides found to be conserved in each cluster are marked with *. Figure 7C shows the core sequence (SEQ ID NO: 57) and base distribution identified by MEME (Multiple Em for Motif Elicitation) among the first 45 clusters obtained by the SELEX procedure (Figure 1). [Figure 8-1] Figures 8A-8G are bar graphs showing the binding results of the aptamers (without the 5' and 3' flanking regions) CELTIC_4s (SEQ ID NO: 50), CELTIC_5s (SEQ ID NO: 51), CELTIC_6s (SEQ ID NO: 52), CELTIC_9s (SEQ ID NO: 53), CELTIC_11s (SEQ ID NO: 54), CELTIC_19s (SEQ ID NO: 55), and CELTIC_22s (SEQ ID NO: 56) obtained by the SELEX procedure (Figure 1) to Jurkat cells (CD3+ cells) for saturation and KD estimation. Binding was tested at three concentrations of aptamer (3 nM, 10 nM, and 30 nM). For comparison, the binding of the aptamers to Ramos cells (CD3- cells; control) is also shown. [Figure 8-2]Figures 8A-8G are bar graphs showing the binding results of the aptamers (without the 5' and 3' flanking regions) CELTIC_4s (SEQ ID NO: 50), CELTIC_5s (SEQ ID NO: 51), CELTIC_6s (SEQ ID NO: 52), CELTIC_9s (SEQ ID NO: 53), CELTIC_11s (SEQ ID NO: 54), CELTIC_19s (SEQ ID NO: 55), and CELTIC_22s (SEQ ID NO: 56) obtained by the SELEX procedure (Figure 1) to Jurkat cells (CD3+ cells) for saturation and KD estimation. Binding was tested at three concentrations of aptamer (3 nM, 10 nM, and 30 nM). For comparison, the binding of the aptamers to Ramos cells (CD3- cells; control) is also shown.
[0016] [Figure 9] Figures 9A and 9B are bar graphs showing a comparison of the binding results of several selected aptamers to Jurkat cells (CD3+ cells) and Ramos cells (CD3- cells; control) at concentrations of 3 nM (Figure 9A) and 10 nM (Figure 9B). Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as a positive control. [Figure 10] Figures 10A-10D show the stability of aptamers CELTIC_1s (Figure 10A), CELTIC_4s (Figure 10B), CELTIC_11s (Figure 10C), and CELTIC_19s (Figure 10D) in the presence of serum. Aptamer integrity was determined by agarose gel electrophoresis after incubation in serum, SELEX buffer containing 5% serum, or RPMI medium containing 10% serum for different times at 37°C: 24 hours, 4 hours, 2 hours, 1 hour, 30 minutes, 10 minutes, or 0 hours. [Figure 11]Figures 11A and 11B are bar graphs showing the stability of aptamers CELTIC_1s, CELTIC_4s, CELTIC_9s, CELTIC_11s, CELTIC_19s, and CELTIC_22s in the presence of serum. Stability was determined by incubating the aptamers in serum or in SELEX buffer containing 5% serum at 37°C for different times: 24 hours, 4 hours, 2 hours, 1 hour, 0.5 hours, 10 minutes, or 0 hours. Binding of the aptamers to Jurkat cells (CD3+ cells) was then measured by flow cytometry. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as a positive control.
[0017] [Figure 12] Figure 12 is a bar graph showing the binding results of aptamers CELTIC_1s, CELTIC_4s, CELTIC_9s, and CELTIC_19s obtained by SELEX (Figure 1) to peripheral blood mononuclear cells isolated from healthy donors. Binding was tested at the following aptamer concentrations: 3 nM, 10 nM, 30 nM, 100 nM, and 300 nM. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as a positive control. [Figure 13] Figures 13A-13D are bar graphs showing the binding results of the aptamers CELTIC_1s, CELTIC_4s, CELTIC_9s, and CELTIC_19s obtained by the SELEX procedure (Figure 1) to mouse CD3+ EL4 cells, estimating the binding saturation and KD. Binding was tested at three aptamer concentrations: 3 nM, 10 nM, 30 nM, 100 nM, and 300 nM. For comparison, the binding of the aptamers at a concentration of 300 nM and the anti-CD3 145-2C11 monoclonal antibody (32 nM) to human Jurkat cells is also shown (gray bars).
[0018] [Figure 14-1]Figures 14A-14L are graphs showing the activation of human lymphocytes by anti-CD3 DNA aptamers at 1 μM concentration, as measured by cytokine secretion. Secreted cytokine levels were determined by ELISA after culturing the aptamers in RPMI medium containing 10% serum in the presence of costimulatory anti-CD28 antibodies for various times (0, 3, 19, 27, or 48 hours) at 37°C. Figures 14A, 14B, and 14C show the secretion of IFN-γ, IL-2, and TNF-α by aptamer CELTIC_1s, respectively. Figures 14D, 14E, and 14F show the secretion of IFN-γ, IL-2, and TNF-α by aptamer CELTIC_4s, respectively. Figures 14G, 14H, and 14I show the secretion of IFN-γ, IL-2, and TNF-α by aptamer CELTIC_11s, respectively. Figures 14J, 14K, and 14L show the secretion of IFN-γ, IL-2, and TNF-α by the aptamer CELTIC_19s, respectively. For comparison, activation by anti-CD3 monoclonal antibody with or without costimulatory anti-CD28 antibody is also shown. [Figure 14-2]Figures 14A-14L are graphs showing the activation of human lymphocytes by anti-CD3 DNA aptamers at 1 μM concentration, as measured by cytokine secretion. Secreted cytokine levels were determined by ELISA after culturing the aptamers in RPMI medium containing 10% serum in the presence of costimulatory anti-CD28 antibodies for various times (0, 3, 19, 27, or 48 hours) at 37°C. Figures 14A, 14B, and 14C show the secretion of IFN-γ, IL-2, and TNF-α by aptamer CELTIC_1s, respectively. Figures 14D, 14E, and 14F show the secretion of IFN-γ, IL-2, and TNF-α by aptamer CELTIC_4s, respectively. Figures 14G, 14H, and 14I show the secretion of IFN-γ, IL-2, and TNF-α by aptamer CELTIC_11s, respectively. Figures 14J, 14K, and 14L show the secretion of IFN-γ, IL-2, and TNF-α by the aptamer CELTIC_19s, respectively. For comparison, activation by anti-CD3 monoclonal antibody with or without costimulatory anti-CD28 antibody is also shown. [Figure 14-3]Figures 14A-14L are graphs showing the activation of human lymphocytes by anti-CD3 DNA aptamers at 1 μM concentration, as measured by cytokine secretion. Secreted cytokine levels were determined by ELISA after culturing the aptamers in RPMI medium containing 10% serum in the presence of costimulatory anti-CD28 antibodies for various times (0, 3, 19, 27, or 48 hours) at 37°C. Figures 14A, 14B, and 14C show the secretion of IFN-γ, IL-2, and TNF-α by aptamer CELTIC_1s, respectively. Figures 14D, 14E, and 14F show the secretion of IFN-γ, IL-2, and TNF-α by aptamer CELTIC_4s, respectively. Figures 14G, 14H, and 14I show the secretion of IFN-γ, IL-2, and TNF-α by aptamer CELTIC_11s, respectively. Figures 14J, 14K, and 14L show the secretion of IFN-γ, IL-2, and TNF-α by the aptamer CELTIC_19s, respectively. For comparison, activation by anti-CD3 monoclonal antibody with or without costimulatory anti-CD28 antibody is also shown. [Figure 14-4]Figures 14A-14L are graphs showing the activation of human lymphocytes by anti-CD3 DNA aptamers at 1 μM concentration, as measured by cytokine secretion. Secreted cytokine levels were determined by ELISA after culturing the aptamers in RPMI medium containing 10% serum in the presence of costimulatory anti-CD28 antibodies for various times (0, 3, 19, 27, or 48 hours) at 37°C. Figures 14A, 14B, and 14C show the secretion of IFN-γ, IL-2, and TNF-α by aptamer CELTIC_1s, respectively. Figures 14D, 14E, and 14F show the secretion of IFN-γ, IL-2, and TNF-α by aptamer CELTIC_4s, respectively. Figures 14G, 14H, and 14I show the secretion of IFN-γ, IL-2, and TNF-α by aptamer CELTIC_11s, respectively. Figures 14J, 14K, and 14L show the secretion of IFN-γ, IL-2, and TNF-α by the aptamer CELTIC_19s, respectively. For comparison, activation by anti-CD3 monoclonal antibody with or without costimulatory anti-CD28 antibody is also shown.
[0019] [Figure 15] Figures 15A-15C are bar graphs showing the activation of human lymphocytes by anti-CD3 DNA aptamers at 1 μM concentrations, as measured by the expression of CD25 and CD69 activation markers. The levels of CD25 and CD69 surface markers on CD4- and CD8-positive T lymphocytes were determined by flow cytometry after culturing the aptamers with or without costimulatory anti-CD28 antibodies for 48 h at 37 °C in RPMI medium containing 10% serum. Figure 15A shows the expression results obtained with cells treated with CELTIC_1s, CELTIC_4s, CELTIC_11s, or CELTIC_19s alone. Figure 15B shows the expression results obtained with cells treated with the same aptamers mixed with costimulatory anti-CD28 antibodies. Figure 15C shows the expression results obtained with cells treated with fresh aptamer solution mixed with anti-CD28 antibody added to the medium after 3, 19, and 27 hours of culture to keep the concentration of the reagent constant.
[0020] [Figure 16] Figures 16A-16C are bar graphs showing activation of human lymphocytes by anti-CD3 DNA aptamers at a 1 μM concentration, as measured by cytokine secretion. Secreted cytokine levels were measured by Human Th1 / Th2 cytometric bead arrays after culturing the aptamers in the presence of costimulatory anti-CD28 antibodies in RPMI medium containing 10% serum for 48 hours at 37°C. Figure 16A shows the secretion of IFN-γ, IL-2, IL-4, IL-5, IL-10, and TNF-α from cells treated with CELTIC_1s, CELTIC_4s, CELTIC_11s, or CELTIC_19s alone. Figure 16B shows the cytokine secretion profile of cells treated with the same aptamers mixed with costimulatory anti-CD28 antibodies. Figure 16C shows the cytokine secretion profile of cells treated with fresh aptamer solution mixed with anti-CD28 antibody added to the medium after 3, 19, and 27 hours of culture to keep the concentration of the reagent constant.
[0021] [Figure 17-1]Figures 17.1A-17.3B are bar graphs showing the results of binding of aptamers CELTIC_1s, CELTIC_4s, CELTIC_11s, and CELTIC_19s obtained by the SELEX procedure (Figure 1) to Jurkat cells (CD3+ cells) with antibodies specific for CD3 epitopes to map the region of CD3 recognized by the aptamers. Binding was performed in the presence of saturating concentrations of competitors. In Figures 17.1A, 17.2A, and 17.3A, binding of CD3-specific PE-labeled monoclonal OKT3, UCHT1, and HIT3a antibodies was tested at a single concentration (0.1 nM for OKT3 and HIT3a, 1 nM for UCHT1) in the absence or presence of saturating concentrations of unlabeled antibody (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) or biotinylated aptamer (300 nM). In Figures 17.1B, 17.2B, and 17.3B, binding of biotinylated aptamer was tested at a concentration of 300 nM in the presence or absence of saturating concentrations of unlabeled antibody (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) and in the presence of PE-labeled streptavidin. [Figure 17-2]Figures 17.1A-17.3B are bar graphs showing the results of binding of aptamers CELTIC_1s, CELTIC_4s, CELTIC_11s, and CELTIC_19s obtained by the SELEX procedure (Figure 1) to Jurkat cells (CD3+ cells) with antibodies specific for CD3 epitopes to map the region of CD3 recognized by the aptamers. Binding was performed in the presence of saturating concentrations of competitors. In Figures 17.1A, 17.2A, and 17.3A, binding of CD3-specific PE-labeled monoclonal OKT3, UCHT1, and HIT3a antibodies was tested at a single concentration (0.1 nM for OKT3 and HIT3a, 1 nM for UCHT1) in the absence or presence of saturating concentrations of unlabeled antibody (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) or biotinylated aptamer (300 nM). In Figures 17.1B, 17.2B, and 17.3B, binding of biotinylated aptamer was tested at a concentration of 300 nM in the presence or absence of saturating concentrations of unlabeled antibody (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) and in the presence of PE-labeled streptavidin. [Figure 17-3]Figures 17.1A-17.3B are bar graphs showing the results of binding of aptamers CELTIC_1s, CELTIC_4s, CELTIC_11s, and CELTIC_19s obtained by the SELEX procedure (Figure 1) to Jurkat cells (CD3+ cells) with antibodies specific for CD3 epitopes to map the region of CD3 recognized by the aptamers. Binding was performed in the presence of saturating concentrations of competitors. In Figures 17.1A, 17.2A, and 17.3A, binding of CD3-specific PE-labeled monoclonal OKT3, UCHT1, and HIT3a antibodies was tested at a single concentration (0.1 nM for OKT3 and HIT3a, 1 nM for UCHT1) in the absence or presence of saturating concentrations of unlabeled antibody (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) or biotinylated aptamer (300 nM). In Figures 17.1B, 17.2B, and 17.3B, binding of biotinylated aptamer was tested at a concentration of 300 nM in the presence or absence of saturating concentrations of unlabeled antibody (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) and in the presence of PE-labeled streptavidin.
[0022] [Figure 17-4] Figure 17.4 is a bar graph showing the binding results to Jurkat cells (CD3+ cells) of the aptamer CELTIC_core, which corresponds to the calculated conserved motifs found within the top 45 sequence families separated during SELEX (Figure 7C). For comparison, the binding of the aptamer to Ramos cells (CD3- cells; control) is also shown. Binding was tested at the following aptamer concentrations: 3 nM, 5 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 75 nM, and 100 nM. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as a positive control. [Figure 17-5]Figure 17.5 shows the sequences (SEQ ID NOS: 58-71, respectively) of different variants (1-13) of the aptamer CELTIC_core (top sequence, SEQ ID NOS: 57) corresponding to the calculated conserved motifs found in the top 45 sequence families isolated during SELEX (Figure 7C). Underscores indicate positions in the sequence where a base was replaced by a C3 spacer, thus creating an abasic site. Mutations introduced in the original core sequence are highlighted in bold.
[0023] [Figure 17-6] Figures 17.6A-17.6N are bar graphs showing binding results to Jurkat cells (CD3+ cells) for the aptamers CELTIC_core1, CELTIC_core2, CELTIC_core3, CELTIC_core4, CELTIC_core5, CELTIC_core6, CELTIC_core7, CELTIC_core8, CELTIC_core9, CELTIC_core10, CELTIC_core11, CELTIC_core12, CELTIC_core13, and CELTIC_coreT, which have denaturation compared to CELTIC_core (Figure 17.5). Binding was tested at two aptamer concentrations (50 nM and 100 nM) and compared to cell staining obtained with CELTIC_core (50 and 100 nM) and full-length CD3_CELTIC_1s (10 and 50 nM). For comparison, binding of the aptamer to Ramos cells (CD3- cells; control) is also shown. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as a positive control. [Figure 17-7]Figures 17.6A-17.6N are bar graphs showing binding results to Jurkat cells (CD3+ cells) for the aptamers CELTIC_core1, CELTIC_core2, CELTIC_core3, CELTIC_core4, CELTIC_core5, CELTIC_core6, CELTIC_core7, CELTIC_core8, CELTIC_core9, CELTIC_core10, CELTIC_core11, CELTIC_core12, CELTIC_core13, and CELTIC_coreT, which have denaturation compared to CELTIC_core (Figure 17.5). Binding was tested at two aptamer concentrations (50 nM and 100 nM) and compared to cell staining obtained with CELTIC_core (50 and 100 nM) and full-length CD3_CELTIC_1s (10 and 50 nM). For comparison, binding of the aptamer to Ramos cells (CD3- cells; control) is also shown. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as a positive control. [Figure 17-8] Figures 17.6A-17.6N are bar graphs showing binding results to Jurkat cells (CD3+ cells) for the aptamers CELTIC_core1, CELTIC_core2, CELTIC_core3, CELTIC_core4, CELTIC_core5, CELTIC_core6, CELTIC_core7, CELTIC_core8, CELTIC_core9, CELTIC_core10, CELTIC_core11, CELTIC_core12, CELTIC_core13, and CELTIC_coreT, which have denaturation compared to CELTIC_core (Figure 17.5). Binding was tested at two aptamer concentrations (50 nM and 100 nM) and compared to cell staining obtained with CELTIC_core (50 and 100 nM) and full-length CD3_CELTIC_1s (10 and 50 nM). For comparison, binding of the aptamer to Ramos cells (CD3- cells; control) is also shown. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as a positive control. [Figure 17-9]Figures 17.6A-17.6N are bar graphs showing binding results to Jurkat cells (CD3+ cells) for the aptamers CELTIC_core1, CELTIC_core2, CELTIC_core3, CELTIC_core4, CELTIC_core5, CELTIC_core6, CELTIC_core7, CELTIC_core8, CELTIC_core9, CELTIC_core10, CELTIC_core11, CELTIC_core12, CELTIC_core13, and CELTIC_coreT, which have denaturation compared to CELTIC_core (Figure 17.5). Binding was tested at two aptamer concentrations (50 nM and 100 nM) and compared to cell staining obtained with CELTIC_core (50 and 100 nM) and full-length CD3_CELTIC_1s (10 and 50 nM). For comparison, binding of the aptamer to Ramos cells (CD3- cells; control) is also shown. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as a positive control. [Figure 17-10] Figures 17.6A-17.6N are bar graphs showing binding results to Jurkat cells (CD3+ cells) for the aptamers CELTIC_core1, CELTIC_core2, CELTIC_core3, CELTIC_core4, CELTIC_core5, CELTIC_core6, CELTIC_core7, CELTIC_core8, CELTIC_core9, CELTIC_core10, CELTIC_core11, CELTIC_core12, CELTIC_core13, and CELTIC_coreT, which have denaturation compared to CELTIC_core (Figure 17.5). Binding was tested at two aptamer concentrations (50 nM and 100 nM) and compared to cell staining obtained with CELTIC_core (50 and 100 nM) and full-length CD3_CELTIC_1s (10 and 50 nM). For comparison, binding of the aptamer to Ramos cells (CD3- cells; control) is also shown. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as a positive control.
[0024] [Figure 18] Figure 18 lists the sequences of different variants of the aptamer CELTIC_core ("0" SEQ ID NO: 57) corresponding to the calculated conserved motifs found within the top 45 sequence families obtained during SELEX (Figure 7C). These variants are numbered 1-44, SEQ ID NO: 58-102, and include the 13 mutants described in Figure 17.5 and evaluated in Figures 17.6A-17.6N. Underscores indicate positions in the sequence where a base has been replaced by a C3 spacer, thus creating an abasic site. Mutations introduced in the original core sequence are highlighted in bold. [Figure 19-1] Figures 19A-19D are bar graphs showing the binding of aptamers CELTIC_core14 to CELTIC_core44 to Jurkat cells, with denaturation compared to CELTIC_core (Figure 17.5). Binding was tested at two aptamer concentrations: 50 nM (Figure 19A for mutants 14-37 and 19C for mutants 38-44) and 100 nM (Figure 19B for mutants 14-37 and 19D for mutants 38-44) and compared to cell staining obtained with CELTIC_core (50 and 100 nM) and full-length CD3_CELTIC_1s and CD3_CELTIC_19s (10 and 50 nM). For comparison, binding of the aptamers to Ramos cells (CD3- cells; control) is also shown. Anti-CD3 OKT3 and anti-CD19 monoclonal antibodies (32 nM each) were included as positive controls. [Figure 19-2]Figures 19A-19D are bar graphs showing the binding of aptamers CELTIC_core14 to CELTIC_core44 to Jurkat cells, with denaturation compared to CELTIC_core (Figure 17.5). Binding was tested at two aptamer concentrations: 50 nM (Figure 19A for mutants 14-37 and 19C for mutants 38-44) and 100 nM (Figure 19B for mutants 14-37 and 19D for mutants 38-44) and compared to cell staining obtained with CELTIC_core (50 and 100 nM) and full-length CD3_CELTIC_1s and CD3_CELTIC_19s (10 and 50 nM). For comparison, binding of the aptamers to Ramos cells (CD3- cells; control) is also shown. Anti-CD3 OKT3 and anti-CD19 monoclonal antibodies (32 nM each) were included as positive controls.
[0025] [Figure 20] Figure 20 summarizes the results of binding of aptamers CELTIC_core1 to CELTIC_core44 (SEQ ID NOs: 58-102) with the above modifications compared to CELTIC_core (SEQ ID NO: 57) (Figure 17.5) to Jurkat cells (CD3+ cells). [Figure 21-1]Figures 21A-21F are bar graphs showing the binding of aptamers CELTIC_core12, CELTIC_core40HEGt, and CELTIC_core42HEGt to Jurkat cells (CD3+ cells) and antibodies specific for the CD3 epitope in the presence of saturating concentrations of competitors. In Figures 21A, 21C, and 21E, binding of CD3-specific PE-labeled monoclonal OKT3, UCHT1, and HIT3a antibodies was tested at a single concentration (0.1 nM for OKT3 and HIT3a, 1 nM for UCHT1) in the absence or presence of saturating concentrations of unlabeled antibody (32 nM for OKT3 and HIT3a, or 10 nM for UCHT1) or biotinylated aptamer (300 nM). In Figures 21B, 21D, and 21F, binding of biotinylated aptamers was tested at a concentration of 300 nM in the absence or presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) and in the presence of PE-labeled streptavidin. Results are compared to cell staining obtained with full-length CD3_CELTIC_1s. [Figure 21-2]Figures 21A-21F are bar graphs showing the binding of aptamers CELTIC_core12, CELTIC_core40HEGt, and CELTIC_core42HEGt to Jurkat cells (CD3+ cells) and antibodies specific for the CD3 epitope in the presence of saturating concentrations of competitors. In Figures 21A, 21C, and 21E, binding of CD3-specific PE-labeled monoclonal OKT3, UCHT1, and HIT3a antibodies was tested at a single concentration (0.1 nM for OKT3 and HIT3a, 1 nM for UCHT1) in the absence or presence of saturating concentrations of unlabeled antibody (32 nM for OKT3 and HIT3a, or 10 nM for UCHT1) or biotinylated aptamer (300 nM). In Figures 21B, 21D, and 21F, binding of biotinylated aptamers was tested at a concentration of 300 nM in the absence or presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) and in the presence of PE-labeled streptavidin. Results are compared to cell staining obtained with full-length CD3_CELTIC_1s. [Figure 21-3]Figures 21A-21F are bar graphs showing the binding of aptamers CELTIC_core12, CELTIC_core40HEGt, and CELTIC_core42HEGt to Jurkat cells (CD3+ cells) and antibodies specific for the CD3 epitope in the presence of saturating concentrations of competitors. In Figures 21A, 21C, and 21E, binding of CD3-specific PE-labeled monoclonal OKT3, UCHT1, and HIT3a antibodies was tested at a single concentration (0.1 nM for OKT3 and HIT3a, 1 nM for UCHT1) in the absence or presence of saturating concentrations of unlabeled antibody (32 nM for OKT3 and HIT3a, or 10 nM for UCHT1) or biotinylated aptamer (300 nM). In Figures 21B, 21D, and 21F, binding of biotinylated aptamers was tested at a concentration of 300 nM in the absence or presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) and in the presence of PE-labeled streptavidin. Results are compared to cell staining obtained with full-length CD3_CELTIC_1s.
[0026] [Figure 22-1] Figures 22A-22F show the stability of aptamers CELTIC_coreHEG (Figure 22A), CELTIC_core12 (Figure 22B), CELTIC_core24HEG (Figure 22C), CELTIC_core29HEG (Figure 22D), CELTIC_core40HEG (Figure 22E), and CELTIC_core42HEG (Figure 22F) in the presence of serum. Aptamer integrity was determined by agarose gel electrophoresis after incubating the aptamers in serum, SELEX buffer containing 5% serum, or RPMI medium containing 10% serum for different times at 37°C: 24 hours, 4 hours, 2 hours, 1 hour, 30 minutes, 10 minutes, or 0 hours. [Figure 22-2]Figures 22A-22F show the stability of aptamers CELTIC_coreHEG (Figure 22A), CELTIC_core12 (Figure 22B), CELTIC_core24HEG (Figure 22C), CELTIC_core29HEG (Figure 22D), CELTIC_core40HEG (Figure 22E), and CELTIC_core42HEG (Figure 22F) in the presence of serum. Aptamer integrity was determined by agarose gel electrophoresis after incubating the aptamers in serum, SELEX buffer containing 5% serum, or RPMI medium containing 10% serum for different times at 37°C: 24 hours, 4 hours, 2 hours, 1 hour, 30 minutes, 10 minutes, or 0 hours. [Figure 23-1] Figures 23A-C are bar graphs showing the stability of aptamers CELTIC_coreHEG, CELTIC_core12 (Figure 23A), CELTIC_core24HEG, CELTIC_core29HEG (Figure 23B), CELTIC_core40HEG, and CELTIC_core42HEG (Figure 23C) in the presence of serum. Stability was determined by incubating the aptamers in serum or in SELEX buffer containing 5% serum at 37°C for different times: 24 hours, 4 hours, 2 hours, 1 hour, 0.5 hours, 10 minutes, or 0 hours, followed by measuring the binding of the aptamers to Jurkat cells (CD3+ cells) by flow cytometry. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as a positive control. [Figure 23-2]Figures 23A-C are bar graphs showing the stability of aptamers CELTIC_coreHEG, CELTIC_core12 (Figure 23A), CELTIC_core24HEG, CELTIC_core29HEG (Figure 23B), CELTIC_core40HEG, and CELTIC_core42HEG (Figure 23C) in the presence of serum. Stability was determined by incubating the aptamers in serum or in SELEX buffer containing 5% serum at 37°C for different times: 24 hours, 4 hours, 2 hours, 1 hour, 0.5 hours, 10 minutes, or 0 hours, followed by measuring the binding of the aptamers to Jurkat cells (CD3+ cells) by flow cytometry. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as a positive control.
[0027] [Figure 24] Figures 24A-D show the stability of aptamers CELTIC_core40HEG (Figure 24A), CELTIC_core40HEGt (Figure 24B), CELTIC_core42HEG (Figure 24C), and CELTIC_core42HEGt (Figure 24D) in the presence of serum. Aptamer integrity was determined by agarose gel electrophoresis after incubating the aptamers in serum, SELEX buffer containing 5% serum, or RPMI medium containing 10% serum for different times at 37°C: 24 hours, 4 hours, 2 hours, 1 hour, 30 minutes, 10 minutes, or 0 hours. [Figure 25] Figures 25A-25B are bar graphs showing the stability of aptamers CELTIC_core40HEG, CELTIC_core40HEGt (Figure 25A), CELTIC_core42HEG, and CELTIC_core42HEGt (Figure 25B) in the presence of serum. Stability was determined by incubating the aptamers in serum or in SELEX buffer containing 5% serum at 37°C for different times: 24 hours, 4 hours, 2 hours, 1 hour, 0.5 hours, 10 minutes, or 0 hours. Binding of the aptamers to Jurkat cells (CD3+ cells) was then measured by flow cytometry. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as a positive control.
[0028] [Figure 26] Figure 26 is a bar graph showing the binding results of the aptamer CELTIC_core42HEG, which has a tetrazine group at the 5' end and a biotin at the 3' end chemically modified to Jurkat cells (CD3+ cells). Binding was tested at aptamer concentrations of 15 nM, 25 nM, 35 nM, 50 nM, and 75 nM and compared to cell staining obtained with the aptamer CELTIC_core42HEG modified with biotin at either the 3' or 5' end. For comparison, binding of the aptamer to Ramos cells (CD3- cells; control) is also shown. Anti-CD3 OKT3 and anti-CD19 monoclonal antibodies (32 nM each) were included as positive controls. [Figure 27] Figure 27 shows an alignment of the nucleic acid sequences (SEQ ID NOS: 103-107, from top to bottom) of the five most frequent nucleic acid sequences of anti-CD3 RNA aptamers (clusters) obtained by SELEX performed on a mixture of recombinant CD3ε / γ and CD3ε / δ proteins, each prepared as a C-terminal Fc fusion. hIgG1Fc was used as the counter-target. The final three rounds of SELEX were performed with Jurkat (CD3+) cells as the target and Ramos (CD3-) cells as the counter-target. Multiple sequence alignment was performed with the ClustalW algorithm. Nucleotides found to be conserved in each cluster are marked with an *.
[0029] [Figure 28] Figure 28 shows the core sequence (SEQ ID NO: 108) and base distribution identified by MEME (multiple Em for motif induction) among the first five clusters obtained by the SELEX procedure (Figure 27). [Figure 29]Figures 29A-29B show the sequences and Mfold-predicted secondary structures of ARACD3-0010209 (SEQ ID NO: 103), ARACD3-0270039 (SEQ ID NO: 105), ARACD3-2980001 (SEQ ID NO: 104), ARACD3-3130001 (SEQ ID NO: 106), and ARACD3-3700006 (SEQ ID NO: 107). Numbering indicates the base number of the aptamer lacking nucleotides from the flanking regions. The secondary structures of the core sequences found in the five clusters obtained by SELEX are also shown. The secondary structure and free energy of each aptamer were calculated at 37°C and 1 M Na+ using Quikfold 3.0 (Zuker, et al. 2003).
[0030] [Figure 30] Figures 30A-30E are bar graphs showing the binding results of aptamers ARACD3-0010209, ARACD3-0270039, ARACD3-2980001, ARACD3-3130001, and ARACD3-3700006 obtained by SELEX (Figure 27) to Jurkat cells (CD3+ cells). For comparison, binding of the aptamers to Ramos cells (CD3- cells; control) is also shown. Binding was tested at three concentrations of aptamer (30 nM, 100 nM, and 300 nM). [Figure 31] Figures 31A-31C are sensorgrams showing the binding of biotinylated aptamers ARACD3-3700006, ARACD3-0010209, and ARACD3-3130001 immobilized on a series sensor SA chip to CD3ε / γ (left column), CD3ε / δ (middle column), and control hIgG1 Fc (right column). Binding was measured by surface plasmon resonance using a single-cycle kinetic protocol. Sequential injections of aptamers were performed at concentrations of 3 nM, 10 nM, 30 nM, 10 nM, and 300 nM.
[0031] [Figure 32]Figures 32A-32C show the stability and integrity of the anti-CD3 RNA aptamers ARACD3-3700006 and ARACD3-0010209 in the presence of serum. In Figure 32A (bar graph), stability was determined by incubating the aptamers in serum or DPBS containing 5% serum for various times (24 hours, 4 hours, 2 hours, 1 hour, 30 minutes, 10 minutes, or 0 hours), followed by measuring the binding of the aptamers to Jurkat cells (CD3+ cells) by flow cytometry at 37°C. Figures 32B and C show the integrity measured by agarose gel electrophoresis after incubation in serum, DPBS buffer containing 5% serum, or RPMI medium containing 10% serum for various times (24 hours, 4 hours, 2 hours, 1 hour, 30 minutes, 10 minutes, or 0 hours at 37°C). [Figure 33] Figure 33 shows the results of binding of aptamers ARACD3-3700006 and ARACD3-0010209 obtained by the SELEX procedure (Figure 27) to peripheral blood mononuclear cells isolated from healthy donors. Binding was tested at the following aptamer concentrations: 3 nM, 10 nM, 30 nM, 100 nM, and 300 nM.
[0032] [Figure 34] Figures 34A-34B are bar graphs showing the binding results of aptamers ARACD3-3700006 and ARACD3-0010209 obtained by SELEX (Figure 27) to mouse CD3+EL4 cells, estimating binding saturation and KD. Binding was tested at the following aptamer concentrations: 3 nM, 10 nM, 30 nM, 100 nM, and 300 nM. For comparison, binding of the aptamer at a concentration of 300 nM to human Jurkat cells is also shown. [Figure 35-1]Figures 35A-35F are graphs showing lymphocyte activation by anti-CD3 RNA aptamers at a concentration of 1 μM, as measured by cytokine secretion. Secreted cytokine levels were determined by ELISA after culturing the aptamers in the presence of costimulatory anti-CD28 antibodies in RPMI medium containing 10% serum for various times (0 h, 16 h, 24 h, or 48 h) at 37 °C. Figures 35A, 35B, and 35C show the secretion of IFN-γ, IL-2, and TNF-α by aptamer ARACD3-3700006, respectively. Figures 35D, 35E, and 35F show the secretion of IFN-γ, IL-2, and TNF-α by aptamer ARACD3-0010209, respectively. For comparison, activation by anti-CD3 monoclonal antibodies with and without costimulatory anti-CD28 antibodies is also shown. [Figure 35-2] Figures 35A-35F are graphs showing lymphocyte activation by anti-CD3 RNA aptamers at a concentration of 1 μM, as measured by cytokine secretion. Secreted cytokine levels were determined by ELISA after culturing the aptamers in the presence of costimulatory anti-CD28 antibodies in RPMI medium containing 10% serum for various times (0 h, 16 h, 24 h, or 48 h) at 37 °C. Figures 35A, 35B, and 35C show the secretion of IFN-γ, IL-2, and TNF-α by aptamer ARACD3-3700006, respectively. Figures 35D, 35E, and 35F show the secretion of IFN-γ, IL-2, and TNF-α by aptamer ARACD3-0010209, respectively. For comparison, activation by anti-CD3 monoclonal antibodies with and without costimulatory anti-CD28 antibodies is also shown.
[0033] [Figure 36]Figures 36A-36C are bar graphs showing activation of human lymphocytes by anti-CD3 RNA aptamers at 1 μM concentrations, as measured by the expression of CD25 and CD69 activation markers. Levels of CD25 and CD69 surface markers on CD4- and CD8-positive T lymphocytes were determined by flow cytometry after incubation of the aptamers with or without costimulatory anti-CD28 antibodies in RPMI medium containing 10% serum for 48 hours at 37°C. Figure 36A shows expression results obtained in cells treated with ARACD3-3700006 or ARACD3-0010209 alone. Figure 36B shows expression results obtained in cells treated with the same aptamer mixed with costimulatory anti-CD28 antibodies. Figure 36C shows expression results obtained in cells treated with fresh aptamer solution mixed with anti-CD28 antibodies added to the medium after 3, 19, and 27 hours of incubation to keep the concentration of the reagent constant.
[0034] [Figure 37] Figures 37A-37C are bar graphs showing activation of human lymphocytes by anti-CD3 RNA aptamers at a 1 μM concentration, as measured by cytokine secretion. Secreted cytokine levels were measured by Human Th1 / Th2 cytometric bead arrays after culturing the aptamers in the presence of costimulatory anti-CD28 antibodies in RPMI medium containing 10% serum for 48 hours at 37°C. Figure 37A shows the secretion of IFN-γ, IL-2, IL-4, IL-5, IL-10, and TNF-α from cells treated with ARACD3-3700006 or ARACD3-0010209 alone. Figure 37B shows the cytokine secretion profile of cells treated with the same aptamers mixed with costimulatory anti-CD28 antibodies. Figure 37C shows the cytokine secretion profile of cells treated with fresh aptamer solution mixed with anti-CD28 antibody added to the medium after 3, 19, and 27 hours of incubation to keep the concentration of the reagent constant.
[0035] [Figure 38-1]Figures 38A-38F are bar graphs showing the binding results of aptamers ARACD3-3700006 and ARACD3-0010209 obtained by the SELEX procedure (Figure 27) to Jurkat cells (CD3+ cells) and antibodies specific for the CD3 epitope in the presence of saturating concentrations of competitors to map the region of CD3 recognized by the aptamers. In Figures 38A, 38C, and 38E, binding of PE-labeled monoclonal OKT3, UCHT1, and HIT3a antibodies specific for CD3 was tested at a single concentration (0.1 nM for OKT3 and HIT3a, 1 nM for UCHT1) in the absence or presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) or biotinylated aptamers (300 nM). In Figures 38B, 38D and 38F, binding of biotinylated aptamers was tested at a concentration of 300 nM in the absence or presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) and in the presence of PE-labeled streptavidin. [Figure 38-2] Figures 38A-38F are bar graphs showing the binding results of aptamers ARACD3-3700006 and ARACD3-0010209 obtained by the SELEX procedure (Figure 27) to Jurkat cells (CD3+ cells) and antibodies specific for the CD3 epitope in the presence of saturating concentrations of competitors to map the region of CD3 recognized by the aptamers. In Figures 38A, 38C, and 38E, binding of PE-labeled monoclonal OKT3, UCHT1, and HIT3a antibodies specific for CD3 was tested at a single concentration (0.1 nM for OKT3 and HIT3a, 1 nM for UCHT1) in the absence or presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) or biotinylated aptamers (300 nM). In Figures 38B, 38D and 38F, binding of biotinylated aptamers was tested at a concentration of 300 nM in the absence or presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) and in the presence of PE-labeled streptavidin. [Figure 38-3] Figures 38A-38F are bar graphs showing the binding results of aptamers ARACD3-3700006 and ARACD3-0010209 obtained by the SELEX procedure (Figure 27) to Jurkat cells (CD3+ cells) and antibodies specific for the CD3 epitope in the presence of saturating concentrations of competitors to map the region of CD3 recognized by the aptamers. In Figures 38A, 38C, and 38E, binding of PE-labeled monoclonal OKT3, UCHT1, and HIT3a antibodies specific for CD3 was tested at a single concentration (0.1 nM for OKT3 and HIT3a, 1 nM for UCHT1) in the absence or presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) or biotinylated aptamers (300 nM). In Figures 38B, 38D and 38F, binding of biotinylated aptamers was tested at a concentration of 300 nM in the absence or presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) and in the presence of PE-labeled streptavidin. DETAILED DESCRIPTION OF THE INVENTION
[0036] Detailed Description The present technology relates to anti-CD3 aptamers.Disclosed are methods for isolating CD3-specific aptamers, and various uses of anti-CD3 aptamers, including as targeting moieties of delivery vehicles for therapeutic agents directed to T cells, and as components of pharmaceutical compositions.
[0037] Anti-CD3 aptamer embodiments of the present technology can be illustrated using several consensus sequences: DNA aptamers can include the following consensus sequences or variants thereof: 1. GX1X2TX3GX4X5X6X7X8X9GGX 10CTGG, where X1 is G or A, X2 and X6 are A, T, or G, X3 is T or G, X4 and X9 are G or C, X5 is C or T, X7 is T, G, or C, and X8 and X9 are G or C. 10 is C, T, or A (SEQ ID NO: 109).
[0038] 2. GGGX1TTGGCX2X3X4GGGX5CTGGC, where X1 and X2 are A, T, or G, X3 is T, C, or G, and X4 and X5 are A, T, or C (SEQ ID NO: 110).
[0039] 3. GX1TTX2GX3X4X5X6CX7GGX8CTGGX9G, where X1 is A or G, X2 is T or G, X3, X7, X9 are G or C, X4 is T or C, X5 is A or T, X6 is T, C, or G, and X8 is A or C (SEQ ID NO: 111).
[0040] 4. GGGTTGGCAX1CGGGCCTGGCG, where X1 is G, C, or T (SEQ ID NO: 112). 5. GCAGCGAUUCUX1GUUU, where X1 is U or no base (SEQ ID NO: 113).
[0041] Aptamers are DNA and RNA oligonucleotides with secondary and tertiary structures that confer high affinity and specific binding to target molecules. The generation of aptamers using molecular capture techniques is known (see AD Ellington and JW Szostak. Nature 346:818-822, 1990; and C. Tuerk and L. Gold. Science 249:505-510, 1990). Aptamers can be used as targeting devices to deliver molecular agents to specific target sites. Certain tumors associate with specific antigens, allowing tumor-binding aptamers to be designed to aid in tumor targeting for diagnostic or therapeutic purposes.
[0042] Generally, aptamers are identified and isolated from a pool of nucleic acid sequences using known methods. The pool of nucleic acid sequences is incubated with a target molecule, and bound oligonucleotides are selected and amplified in a subsequent step, for example, by polymerase chain reaction (PCR). The product is further purified using an affinity column composed of the target molecule. Aptamers can contain DNA, RNA, or PNA, and bases can be both natural and unnatural. Natural bases are adenine (A), guanine (G), cytosine (C), thymine (T), inosine (I), and uracil (U). Unnatural bases include, for example, methylinosine, dihydrouridine, methylguanosine, thiouridine, 2'-O-methylpurine, 2'-fluoropyrimidine, and many others familiar to those skilled in the art. PNA bases can include natural or unnatural bases attached to an amide (peptide-like backbone). The backbone of the nucleic acid sequence can be amide, such as PNA, or phosphodiester, thiophosphodiester, phosphorothioate, methylene phosphorothioate, as in DNA or RNA, or modifications of these chemical structures.
[0043] The nucleic acid sequence of an aptamer can contain only the target binding sequence, which can include both constant and variable regions, or only variable regions. The constant region sequence can be used to facilitate binding, amplification, replication, or cleavage of the sequence. Aptamers can be conjugated to agents that are delivered to a target or target site for various purposes, e.g., detection, imaging, diagnosis, treatment, or prevention. Agents include cells, nanoparticles, hormones, vaccines, haptens, toxins, enzymes, immune system modulators, antioxidants, vitamins, hematopoietic system functional agents, proteins such as streptavidin or avidin or their variants, metals and other inorganic substances, virus particles, antigens such as amino acids, peptides, sugars and polysaccharides, receptors, paramagnetic and fluorescent labels, pharmaceutical compounds, radioisotopes and radionuclides (93P, 95mTc, 99Tm, 186Re, 188Re, 189Re, 111In, 14C, 32P, 3H, 60C, 125I, 35S, 65Zn, 124I, 226 Ra, and stable isotopes such as 3He, 6Li, 10B, 113Cd, 135Xe, 149Sm, 151Eu, 155Gd, 174Hf, 199Hg, 235U, 241Pu, and 242Am).
[0044] Pharmaceutical compounds that can bind to aptamers include, for example, conventional chemotherapeutic agents, antibiotics, corticosteroids, mutagens (eg, nitroureas), antimetabolites, and hormone antagonists.
[0045] Macromolecules that can be conjugated to aptamers include mitogens, cytokines, and growth factors. Potentially useful cytokines include tumor necrosis factor (TNF), interleukins (IL-1, IL-2, IL-3, etc.), interferon proteins, IFN-α, IFN-β, and IFN-M, hormones such as glucocorticoid hormones, cytosine arabinoside, and antiviral agents such as acyclovir and ganciclovir.
[0046] Aptamers can be conjugated to drugs using well-known methods, including chemical and biological techniques. Both covalent and non-covalent bonds can be created (C.-PD Tu et al., Gene 10:177-83, 1980; AS Boutorine et al., Anal. Biochem. Bioconj. Chem. 1:350-56, 1990; SL Commerford Biochem, 10:1993-99, 1971; DJ Hnatowich et al., J. Nucl. Med. 36:2306-14, 1995). Covalent bonds can be formed, for example, using chemical conjugation reactions, chelators, or bonds formed from phosphodiester bonds. Non-covalent bonds include molecular interactions between streptavidin and biotin, hydrogen bonds, and other forms of ionic interactions. Exemplary chelators include DTPA, SHNH, and multidentate chelators such as N2S2 and N3S(AR) (AR Fritzberg et al., J. Nucl. Med. 23:592-98, 1982). Aptamers can also bind to cell surfaces or nanoparticles to direct the cells or nanoparticles to specific locations in vitro or in vivo.
[0047] Aptamers are selected using an approach called selective evolution of ligands by exponential enrichment (SELEX) (Ellington et al., 1990; Tuerk et al., 1990). SELEX is a method for screening very large combinatorial libraries of oligonucleotides through an iterative process of in vitro selection and amplification. This method involves stepwise iterations of selection from a mixture of candidates and structural improvement using the same general selection theme to achieve virtually any desired criteria of binding affinity and selectivity. Starting with a mixture of nucleic acids, preferably containing randomized sequence segments, the method involves contacting the mixture with a target under conditions that favor binding, partitioning (i.e., separating) unbound nucleic acids from those bound to the target molecule, dissociating the nucleic acid-target pairs, amplifying the nucleic acids dissociated from the nucleic acid-target pairs to generate a mixture enriched for nucleic acid ligands, and then repeating the binding, partitioning, dissociation, and amplification steps for as many cycles as desired.
[0048] SELEX is based on the insight that within a nucleic acid mixture containing a large number of possible sequences and structures, there is a wide range of binding affinities for a particular target. For example, a nucleic acid mixture containing randomized segments of 20 nucleotides may have 420 possible candidates. Those with higher affinity constants for the target are most likely to bind. After partitioning, dissociation, and amplification, a second nucleic acid mixture is generated, enriched for candidates with higher binding affinities. Additional rounds of selection gradually favor the best ligands until the resulting nucleic acid mixture consists primarily of only one or a few sequences. These can then be cloned, sequenced, and individually tested for binding affinity as pure ligands.
[0049] Cycles of selection and amplification are repeated until the desired goal is achieved. In the most common case, selection / amplification continues until no significant improvement in binding strength is achieved with repeated cycles. The iterative selection / amplification method is sensitive enough to allow the isolation of a single sequence variant in a mixture containing at least 65,000 sequence variants. This method has been used for over 10 14 It is even possible to isolate a small number of high affinity sequences in a mixture containing about 10 sequences. 18 The nucleic acids of the test mixture can be used to sample different nucleic acid species. The nucleic acids of the test mixture preferably contain a randomized sequence portion as well as conserved sequences necessary for efficient amplification. Nucleic acid sequence variants can be generated in many ways, including synthesis of randomized nucleic acid sequences and size selection from randomly cleaved cellular nucleic acids. The variable sequence portion can contain completely or partially random sequences, and may also contain subportions of conserved sequences incorporated into the randomized sequences. Sequence variation in the test nucleic acids can be introduced or increased by mutagenesis before or during the selection / amplification iterations.
[0050] In many cases, it is not necessarily desirable to perform the repeated steps of SELEX until a single nucleic acid ligand is identified. A target-specific nucleic acid ligand solution may contain a family of nucleic acid structures or motifs, some of which are conserved sequences, and some of which can be substituted or added without significantly affecting the affinity of the nucleic acid ligand for the target. By terminating the SELEX process before completion, it is possible to determine the sequences of several members of the nucleic acid ligand solution family, thereby allowing for the determination of a comprehensive description of the nucleic acid ligand solution.
[0051] After the description of a nucleic acid ligand family has been resolved by SELEX, in certain cases, it may be desirable to perform a further series of SELEX experiments, adjusted according to the information received during the SELEX experiment. For example, in a second series of SELEX, conserved regions of the nucleic acid ligand family can be fixed while all other positions in the ligand structure are randomized. In an alternative embodiment, the sequences of the most representative members of the nucleic acid ligand family can be used as the basis for a SELEX process in which the original pool of nucleic acid sequences is not completely randomized, but includes a bias toward the most well-known ligands. These methods allow the SELEX process to be optimized to arrive at the most preferred nucleic acid ligands.
[0052] The aptamers of the present invention can have any desired length. The aptamers can comprise at least about 15 oligonucleotides. Preferably, the aptamers can comprise up to about 80 nucleotides.
[0053] Modern technology allows the determination of any equilibrium constant (K D In some embodiments, the aptamer comprises an equilibrium constant (KD) of from about 1 pM to about 10.0 μM, from about 1 pM to about 1.0 μM; from about 1 pM to about 100 nM; from about 100 pM to about 10.0 μM; from about 100 pM to about 1.0 μM; from about 100 pM to about 100 nM; or from about 1.0 nM to about 10.0 μM; from about 1.0 nM to about 1.0 μM; from about 1 nM to about 200 nM; from about 1.0 nM to about 100 nM; from about 500 nM to about 10.0 μM; or from about 500 nM to about 1.0 μM.
[0054] Target molecules can include small molecules, proteins, or nucleic acids. In the case of the aptamers described herein, the target molecules are CD3ε / γ and / or CD3ε / δ proteins. The aptamers of the present invention can be used in pharmaceutical compositions.
[0055] definition Nucleic acid means single or double stranded DNA, RNA, XNA, and chemical modifications thereof.
[0056] Aptamer (or ligand) refers to a nucleic acid that binds to another molecule (target). In a population of candidate nucleic acids, an aptamer is one that binds with higher affinity than the bulk population. Among multiple candidate aptamer sequences, there may be multiple aptamers for a given target. Aptamers may differ from each other in their binding affinity to target molecules.
[0057] Variants of nucleic acid sequences, such as aptamer sequences, may contain at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity as determined by a sequence identity algorithm, such as the BLAST algorithm. Variants may also contain substitutions of one or more bases with non-naturally occurring bases, or removal of one or more bases, optionally with nucleotide replacement by a linker or linkage. Variants may also contain modified nucleic acid backbones, such as those found in peptide nucleic acids (PNAs).
[0058] The plurality of candidate aptamer sequences are a plurality of nucleic acids of different sequences from which a desired aptamer is selected. The source of the candidate sequences can be derived from naturally occurring nucleic acids or fragments thereof, chemically synthesized nucleic acids, enzymatically synthesized nucleic acids, or nucleic acids produced by a combination of the aforementioned techniques.
[0059] A target molecule refers to a compound of interest for which a ligand is desired. Target molecules can be, but are not limited to, proteins, peptides, carbohydrates, polysaccharides, glycoproteins, hormones, receptors, antigens, antibodies, viruses, substrates, metabolites, transition state analogs, cofactors, inhibitors, drugs, dyes, nutrients, growth factors, etc. A target can also be a cell expressing a desired protein to which an aptamer is specifically bound. Aptamer selection using cells can be referred to as cell-SELEX (Chen C et al., npj Precision Oncology (2017) 1-37). Cell-SELEX uses live cells as targets. Aptamers bind to membrane proteins of live cells. The cell-SELEX procedure involves positive and negative selection. For positive selection, a single-stranded DNA or RNA library is incubated with target cells, and binding sequences are collected. The binding sequences are then incubated with negative cells, and non-binding sequences are collected for amplification, sequencing, and cloning. Aptamers are obtained after several alternating cycles. The present disclosure involves the selection of anti-CD3 aptamers by incorporating the use of live cells as targets. CD3-positive Jurkat cells and CD3-negative Ramos cells were used for positive and negative selection, respectively.
[0060] Separation (or partitioning) refers to any process by which a ligand bound to a target molecule, referred to herein as an aptamer-target pair or sequence-target complex, can be separated from nucleic acids not bound to the target molecule. Separation can be achieved by a variety of methods known in the art. Nucleic acid-protein pairs can bind to nitrocellulose filters, but unbound nucleic acids cannot. Columns that specifically retain sequence-target complexes (or specifically retain bound aptamers complexed to bound targets) can be used for partitioning. Liquid-liquid partitioning can also be used, as can filtration gel retardation and density gradient centrifugation. The choice of separation method depends on the characteristics of the target and sequence-target complex and can be performed according to principles and characteristics known to those skilled in the art.
[0061] Amplification refers to a process or combination of process steps that increases the amount or number of copies of a molecule or class of molecules. In the disclosed examples, amplification of RNA molecules was achieved through a three-reaction sequence: creating cDNA copies of the selected RNA, using polymerase chain reaction to increase the number of copies of each cDNA, and transcribing the cDNA copies to obtain RNA molecules with the same sequence as the selected RNA. As will be recognized by those skilled in the art, any reaction or combination of reactions known to those skilled in the art can be used appropriately, including direct DNA replication, direct RNA amplification, and the like. The amplification method should result in an amplified mixture that is essentially representative of the proportions of distinct sequences in the initial mixture.
[0062] Randomization is a term used to describe a segment of nucleic acid that has, in principle, any possible sequence over a given length. Randomized sequences can be of various lengths, ranging from approximately 8 to 100 nucleotides, as desired. The chemical or enzymatic reactions by which random sequence segments are created may not produce mathematically random sequences due to unknown biases or nucleotide selection. The term "randomized" is used instead of "random" to reflect the possibility of such deviations from ideality. Currently known techniques, such as sequential chemical synthesis, are not known to produce large deviations. In short segments of 20 nucleotides or less, any minor bias that may exist will have negligible consequences. The longer the sequence of a single synthesis, the greater the effect of any bias.
[0063] Bias can be intentionally introduced into randomized sequences, for example, by varying the molar ratio of precursor nucleoside (or deoxynucleoside) triphosphates in the synthesis reaction. For example, intentional bias may be desirable to approximate the ratio of individual bases in a particular organism, to influence secondary structure, or to affect melting pH or pH sensitivity. Sequences can be biased to contain a higher proportion of AT than CG base pairs, thus decreasing their melting pH. [Example]
[0064] Example 1: Anti-CD3 DNA aptamer Libraries and primers A single-stranded DNA (ssDNA) library designed for DNA aptamer selection was purchased from TriLink Biotechnologies. The library consisted of a 40-nucleotide random region (N40) flanked by two constant regions: 5'-TAGGGAGAGAGAAGGACATATAT-(N40)-TTGACTACATGACCACTTGA-3' (SEQ ID NO: 114), which was used as a template for PCR amplification. The primer sequences for the PCR reaction were as follows: 5'-TAGGGAGAGAGAAGGACATATAT-3' (SEQ ID NO: 115) (forward primer) and 5'biotin-TCAGTTGTACTAGTCAA-3' (SEQ ID NO: 116) (reverse primer). During selection, the library was amplified in an Eppendorf Mastercycler Nexus using the AmpliTaq Gold 360 Polymerase Kit (Applied Biosystems) according to the manufacturer's protocol. Polymerase activation and initial denaturation at 95°C for 10 minutes were followed by denaturation at 95°C for 30 seconds, annealing at 45°C for 30 seconds (0.2°C increments per PCR cycle), extension at 72°C for 1.5 minutes, and a final extension at 72°C for 7 minutes. Modification of the reverse primer with biotin at the 5' end allowed for the generation of ssDNA libraries for each successive round of selection from amplified double-stranded DNA (dsDNA) using streptavidin-coupled magnetic beads. Both primers were purified, HPLC-grade, and purchased from Eurogentec.
[0065] Selection of DNA aptamers The SELEX process consisted of six selection rounds and was performed with the recombinant ε chain of the CD3 protein, consisting of CD3 epsilon / gamma (CD3ε / γ) and CD3 epsilon / delta (CD3ε / δ) dimers, purchased as C-terminal fusions with the constant Fc domain of human immunoglobulin G1. Consequently, the Fc fragment of human immunoglobulin G1 (IgG1 Fc) was used for negative selection. All proteins were purchased from AcroBiosystems. Each selection round included the steps of counterselection, incubation of the ssDNA library with the target, PCR amplification of the target-recognized sequence, and separation of the dsDNA on streptavidin-modified magnetic beads. Before each cycle, the ssDNA library (2.5 nmol for the initial cycle) was denatured at 95°C for 5 min and immediately cooled at 4°C for 5 min in selection (SELEX) buffer (20 mM HEPES, 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, and 1.5 mM CaCl2, pH 7.2, DNase- and RNase-free, purchased from Sigma-Aldrich). To eliminate Fc domain-specific sequences, the ssDNA library was incubated with IgG1-Fc protein (0.5 nmol, 1 μM) for 90 min at 37°C in a thermocycler (Eppendorf Mastercycler Nexus). The reaction mixture was filtered through a nitrocellulose acetate membrane (0.45 μm HAWP membrane, 25 mm diameter, Millipore) inserted into a 25 mm diameter support filter holder and washed with selection buffer. Before filtration, the HAWP membrane was soaked in selection buffer for at least 30 min. After filtration, the membrane containing the IgG1-Fc / ssDNA complex and the nonspecific ssDNA sequences bound to the filter were discarded. The filtrate containing the unbound sequences was concentrated using a 10 kDa AMICON Ultra-15 MWCO filter and subsequently incubated with the positive target.
[0066] In the first cycle, aptamers were selected against recombinant CD3 ε / γ (0.15 nmol, 0.3 μM) and CD3 ε / δ (0.15 nmol, 0.3 μM) domains at 37°C for 120 min in a volume of 500 μL. From the second round onward, CD3 ε / γ and CD3 ε / δ were alternately used in each cycle. The reaction mixture was then filtered through a nitrocellulose acetate membrane. The filter was washed with 8 mL of selection buffer to remove all low-affinity and low-specificity sequences bound to the protein. Protein-bound ssDNA retained on the filter was eluted by incubating the membrane twice in 1 mL of 7 M urea at 75°C for 5 min. The recovered ssDNA solution was diluted twice with DNase- and RNase-free water (Invitrogen) and concentrated using a 10 kDa AMICON Ultra-4 MWCO filter. The sequences were rediluted with water and reconcentrated. The resulting solution was purified using a Micro BioSpin P-6 column (SSC buffer, Bio-Rad) and precipitated in ethanol (HPLC grade, Fisher) and 3 M sodium acetate pH 5.2 (ThermoScientific, Waltham, MA, USA) in the presence of 5 μL of linear polyacrylamide (Invitrogen). After incubation at -25°C for approximately 1 hour, the eluted ssDNA was centrifuged at 21,000 xg for 20 minutes at 4°C. The supernatant was discarded, and the pellet containing the ssDNA was diluted with 200 μL of DNase- and RNase-free water and left in the air for 20 minutes to evaporate the ethanol.
[0067] The selected ssDNA sequences were amplified in PCR reactions (AmpliTaq Gold 360, Applied Biosystems) in the presence of an unmodified forward primer and a biotinylated reverse primer. The optimal number of PCR cycles was selected individually for each round of selection. To this end, the progression of the amplification was followed by migration of the dsDNA samples obtained after various numbers of PCR cycles on an agarose gel (3% SYBR Safe in TBE buffer, Invitrogen). The PCR reaction was stopped when a band corresponding to the dsDNA appeared on the agarose gel. The PCR mixture containing the amplified dsDNA was then collected, diluted with water to a final volume of 15 mL, and concentrated using a 10 kDa AMICON Ultra-15 MWCO membrane. Aliquots of the concentrated samples were stored at -20°C for sequencing analysis. To purify and generate the ssDNA strand for the next round of selection, the remaining sample was bound to streptavidin-coated magnetic beads (MyOne Streptavidin Dynabeads) via the biotin present on the amplified dsDNA. Incubation was performed at room temperature for 18 minutes in binding buffer (1 M NaCl, 5 mM Tris, 0.5 mM EDTA pH 8.0, DNase- and RNase-free, purchased from Sigma-Aldrich) according to the manufacturer's protocol. 3 mg of magnetic beads were used for 20 μg of dsDNA. The dsDNA-containing magnetic beads were then separated from the solution and washed five times with binding buffer (twice the volume used for incubation) to remove nonspecifically bound library species and PCR reaction residues. Strand separation occurred under basic conditions by denaturation, followed by incubation of the denatured beads in 50 mM NaOH (Sigma-Aldrich BioUltra) for 3 minutes.
[0068] As a result, the biotinylated DNA strand remained attached to the magnetic beads, while the target native strand was released into solution and recovered. The resulting ssDNA was then diluted with water to a final volume of 4 mL and concentrated using a 10 kDa AMICON Ultra-4 MWCO tube to remove NaOH. Exchange into selection buffer was performed using a microbio spin column (P-6; BioRad). The quality of the recovered ssDNA library was analyzed by migration on an agarose gel (3% in TBE buffer), and the concentration was calculated using a NanoDrop One (ThermoScientific, Waltham, MA, USA) by measuring absorbance at 260 nm.
[0069] During successive rounds of the SELEX process, the stringency of selection was gradually increased (see Table 1 ), e.g., the concentrations of target and ssDNA library were decreased, the incubation time with protein was shortened, the amount of buffer for membrane washing after selection was increased, and a nonspecific competitor (yeast total RNA, Sigma-Aldrich) was added in the last selection round.
[0070] [Table 1]
[0071] PCR aliquots obtained after each SELEX cycle and the initial ssDNA library were analyzed by next-generation sequencing using an Illumina NextSeq MidOutput (150 cycles) system. This analysis was performed at the New York University Genome Technology Center. High-throughput sequencing data were analyzed using the Galaxy Project website. Based on the sequencing results, aptamer candidates were selected for affinity and specificity testing.
[0072] The nucleic acid sequences of these aptamers are shown in Figures 1, 6, and 7A-7B. DNA aptamers with or without flanking regions used for PCR amplification were obtained from Eurogentec Kaneka (Liege, Belgium) as HPLC-purified single-stranded oligos synthesized by standard solid-phase phosphoramidite chemistry. Biotin was added to the 5' end of the aptamer as biotin-TEG, which introduces a 16-atom mixed-polarity spacer between the aptamer sequence and the biotin flag. The molecular weight, purity, and integrity of all aptamers were confirmed by HPLC-MS by the manufacturer.
[0073] The same synthetic approach was followed to introduce mutations into the core sequence CELTIC_core, as shown in Figures 17.5 and 18. Abasic sites were created at various positions along the core sequence by incorporating C3 spacer arms during solid-phase synthesis. Where necessary, a hexaethylene glycol (HEG) linker was inserted between the 5'-terminal modification functional group and the first nucleotide of the aptamer at the 5' position to minimize steric hindrance. Further modifications of the core sequence variants included the addition of 3'-3' deoxythymidine as a strategy to increase resistance to nuclease degradation.
[0074] Finally, the 5' end of the aptamer was functionalized with a primary amine via a C6 amino modifier added to the terminal phosphate. A tetrazine functional group was added as a tetrazine-PEG5-NHS ester via standard NHS / EDC chemistry, introducing a 16-atom mixed polar spacer between the aptamer sequence and the tetrazine flag.
[0075] Example 2: Anti-CD3 RNA aptamers Libraries and primers The initial RNA library template and primers were synthesized as single-stranded DNA by IDT (Coralville, IA, USA): 5'-CCTCTCTATGGGCAGTCGGTGAT-(N20)-TTTCTGCAGCGATTCTTGTTT-(N10)-GGAGAATGAGGAACCCAGTGCAG-3' (SEQ ID NO: 117), 5'-TAATACGACTCACTATAGGGCCTCTCTATGGGCAGTCGGTGAT-3' (SEQ ID NO: 118) (forward primer), 5'-CTGCACTGGGTTCCTCATTCTCC-3' (reverse primer) (SEQ ID NO: 119). To minimize the influence of the primers on secondary structure, two short "blocking" sequences (purchased from IDT) complementary to the 5'- and 3'-fixed primer regions were synthesized. 5'-ATCACCGACTGCCCATAGAGAGG-3', (SEQ ID NO: 120) (forward blocking sequence), 5'-CTGCACTGGGTTCCTCTCC-3', (SEQ ID NO: 121) (reverse blocking sequence). An additional biotinylated "capture" sequence complementary to the fixed central region of the library was also synthesized by IDT: 5'-biotin-GTC-PEG-6 spacer-CAAGAATCGCTGCAG-3' (SEQ ID NO: 122). All materials were ordered at the 250 nmol scale and underwent desalting and purification.
[0076] The RNA library for RNA aptamer selection was modified with 2'fluoro- (2'F-)pyrimidines to enhance stability in the final application. T7 primers were combined with Titanium Taq DNA polymerase (Clontech; Mountain View, CA, USA) and the library template sequence for primer extension. Primer extension material was purified on denaturing polyacrylamide gels in 8 M urea (Sequel NE Reagents, Parts A and B) using the Durascribe® T7 Transcription Kit (Epicentre; Madison, WI, USA) and purchased from American Bioanalytical (Natick, MA, USA). During selection, the library was reverse transcribed using SuperScript IV reverse transcriptase (Invitrogen; Carlsbad, CA, USA) according to the manufacturer's protocol and amplified using Titanium Taq DNA polymerase from Clontech. During selection, the library was amplified using the following PCR protocol: 95°C for 10 seconds, 60°C for 30 seconds, with an initial HotStart activation of 95°C for 60 seconds. The RNA library was then transcribed using the Durascribe® T7 Transcription Kit and purified on a polyacrylamide gel (PAGE). After overnight purification at 4°C, the gel elution buffer, Library Recovery, was adjusted to 0.5 M NH4OAc, 1 mM EDTA (both purchased from Teknova), and 0.2% SDS (purchased from Amresco), pH 7.4.
[0077] RNA aptamer selection RNA library screening was performed using a melting approach with nine rounds of selection. Rounds 1–6 of selection were performed using the same materials as for DNA aptamer selection, with the recombinant ε chain of the CD3 protein as the target and the IgG1 Fc fragment as the countertarget. From round 7 onward, a negative selection step (cell-SELEX) was performed with Ramos cells (a human Burkitt lymphoma cell line, ATCC CRL-1596) on Jurkat cells (an acute T-cell leukemia human cell line, ATCC TIB-152) expressing the CD3 protein. The cell lines were obtained from the American Type Cell Collection and cultured in RPMI-1640 medium (Gibco Invitrogen), supplemented with 10% FBS (Gibco Invitrogen) and 1% penicillin / streptomycin (Gibco Invitrogen). All selections were performed in 1X RPMI medium supplemented with 10% serum matrix, and each SELEX round included the following steps: immobilization of the RNA library on streptavidin-coated magnetic beads, counterselection, incubation with the target, reverse transcription of the target-recognized sequences, PCR amplification, and transcription into RNA.
[0078] Before each round, aliquot streptavidin-coated magnetic beads (MyOne Streptavidin T1 Dynabeads) TM Typically, 1 pmol of biotinylated material is added to the Dynabeads TMThe RNA library (used every 20 μg, the amount varies depending on the required stringency) was pre-washed three times with 200 μL of PBS-T (final concentration 0.01% Tween 200, pH 7.4). The RNA library was refolded (denatured at 90°C for 1 minute, 60°C for 5 minutes, then annealed at 23°C for 5 minutes) in 1X RPMI medium without serum, with twice the library moles of both primer-blocking and capture sequences. This minimized the effect of the constant primer region on the secondary structure of the aptamer and allowed the library to be captured by magnetic beads through streptavidin-biotin binding interactions to protect the aptamer ends from exonucleases. After refolding was complete, the library was captured on the magnetic beads by incubation at room temperature for 15 minutes. The magnetic beads were then separated from the solution and washed three times with 200 μL of selection buffer at 37°C to remove residual PBS-T and nonspecifically bound library species. The magnetic beads with immobilized RNA libraries were subjected to counter-selection incubation in 200 μL of counter-target preparation for 30 min at 37°C, resulting in the release of non-specific sequences from the magnetic beads.
[0079] Next, nonspecific library members were discarded, and the magnetic beads were washed six times for 7 minutes with 200 μL of selection buffer. Positive selection consisted of incubating the magnetic bead RNA library with 200 μL of the positive preparation at 37°C for 30 minutes. In the first cycle, aptamers were selected against recombinant CD3ε / γ and CD3ε / δ domains (0.1 μM each), and from the second round onward, CD3ε / γ and CD3ε / δ were alternated. In the sixth round, prior to selection against cells, the library was split into two positive conditions (against CD3ε / γ or CD3ε / δ, respectively) to confirm that responses to both recombinant proteins could be observed. The positive libraries from the sixth round were then pooled together during recovery, followed by cell selection. For the cell-specific SELEX round, target and counter-target cells were thawed, pelleted by centrifugation at 5,000 x g, washed twice with selection buffer, and then suspended in 200 μL of selection buffer. The number of cells used for incubation is 15x10 with counter selection 6 , 1x10 for positive selection 6 ~15x10 6 Upon completion of positive selection, the supernatant containing the target-recognizing sequences was separated from the magnetic beads and collected. The supernatant underwent a second magnetic separation to ensure complete removal of the magnetic beads. For the cell-SELEX round, the targeted Jurkat cells were pelleted by centrifugation at 5,000 x g after the second magnetic separation. The pelleted cells were washed once with 200 μL of selection buffer to remove low-affinity and low-specificity aptamer species. The library was recovered from the cells by heat denaturation at 70°C. The libraries recovered in all rounds underwent protein precipitation using MPC reagent (Lucigen Corp, Middleton, WI, USA), ethanol precipitation, and the sample concentration, followed by purification by 10% denaturing PAGE with 8 M urea.
[0080] The library was then reverse transcribed using SuperScript IV reverse transcriptase according to the manufacturer's instructions, amplified using Titanium® Taq DNA polymerase, and transcribed using the Durascribe® T7 Transcription Kit according to the manufacturer's instructions. The transcription products were then purified by 10% denaturing polyacrylamide gel electrophoresis (PAGE) in 8 M urea. Gel slices were excised and eluted overnight at 4°C in gel elution buffer, and the concentration of the RNA library was calculated by measuring absorbance at 260 nm on a NanoDrop-1000.
[0081] During successive rounds of the SELEX process, the concentration of the RNA library was gradually decreased. Additional parallel evaluations and "crossover fitness tests" were performed to facilitate the identification of successful aptamer candidates during post-selection bioinformatics analysis.
[0082] Aptamer candidates were selected by next-generation sequencing using a MiniSeq Mid output (150 cycles) system (Iluumina). Several aptamers were selected for further testing. For this purpose, 2'-deoxy-2'-fluorothymidine-modified RNA aptamers were purchased from Integrated DNA Technologies (IDT, Coralville, USA). Biotin was added to the 5' end of the aptamer as biotin-TEG, which introduces a 16-atom mixed-polarity spacer between the aptamer sequence and the biotin flag. The molecular weight, purity, and integrity were verified by HPLC-MS. The nucleic acid sequences of these aptamers are shown in Figure 27. Example 3 Determination of affinity and specificity of anti-CD3 DNA aptamers for CD3 protein expressed on cells
[0083] The affinity and specificity of DNA aptamer candidates for the CD3 protein expressed on cells were assessed by flow cytometry. These studies were performed on CD3-positive Jurkat (acute T-cell leukemia human cell line - ATCC TIB-152), EL4 (lymphoma mouse cell line - ATCC CRL-2638), and CD3-negative Ramos (Burkitt lymphoma human cell line - ATCC CRL-1596) cells by culturing them with biotinylated candidate aptamers in selection (SELEX) buffer, supplemented with 5% FBS. Cells were cultured in RPMI-1640 medium (Gibco Invitrogen) supplemented with 10% FBS (Gibco Invitrogen) and 1% penicillin / steptomycin (Gibco Invitrogen) before use. Jurkat, EL4, and Ramos cells (2.5 x 10) were cultured at 4°C for 1 hour prior to the experiment. 5Cells (1000 μM / well) were seeded into a 96-well plate and centrifuged at 2500 rpm for 2 minutes. The supernatant was discarded, and the pelleted cells were washed twice with 200 μL of SELEX 5% FBS buffer preheated to 37°C. Each wash step was followed by centrifugation at 2500 rpm for 2 minutes. Candidate aptamers were denatured at 95°C for 5 minutes and immediately placed on ice at 4°C for 5 minutes. Test samples were then diluted to two different concentrations: 3, 10, and 30 nM and 1, 2.5, 5, 7.5, and 10 nM. 100 nM phycoerythrin-labeled streptavidin (Streptavidin-PE, eBioscience) was then added to each solution. For incubation with EL4 cells, the aptamer was diluted to 100 and 300 nM. Jurkat, EL4, and Ramos cells were resuspended in DNA dilution solution (100 μL / well) and incubated at 37°C for 30 minutes in a humidified atmosphere with 5% CO2. As controls, cells were incubated with a CD3 monoclonal antibody (PE-labeled, OKT3 human anti-CD3, Invitrogen), PE-streptavidin, or each buffer without additional reagents. After incubation, the cells were centrifuged at 2500 rpm for 2 minutes, and the supernatant containing unbound sequences was discarded. The pelleted cells were washed with SELEX-5% FBS buffer (200 μL / well) and centrifuged twice to remove all weakly and nonspecifically attached sequences. Next, the cells were washed with 1 mg / mL salmon sperm DNA solution (100 μL / well) at 37°C in a humidified atmosphere with 5% CO2. After 30 min, the salmon sperm solution was removed by centrifugation at 2500 rpm for 2 min, and the cells were washed twice more with SELEX-5% buffer (200 μL / well) followed by centrifugation. Jurkat, EL4, and Ramos cells were then fixed with the bound DNA sequences (BD CellFIX solution #340181), and fluorescent-positive cells were counted against the YL-1 channel by flow cytometry (AttuneNXT; Invitrogen Inc.).
[0084] The results of the binding studies are shown in Figures 2A-2E. Five aptamers were analyzed: CELTIC_1, CELTIC_1s, CELTIC_2, CELTIC_3, and CELTIC_21. CELTIC_1s differs from CELTIC_1 in that it lacks specific flanking region nucleotides. For comparison, binding of the aptamers to CD3-negative Ramos cells (a human Burkitt's lymphoma cell line—ATCC CRL-1596) was also measured. All aptamers show preferential binding to CD3-positive cells. CELTIC_3 showed saturable binding at 10 nM. It showed significant binding at 3 nM with greater specificity. Based on these results, the apparent K for CELTIC_3 binding to Jurkat cells was D is between 3 nM and 10 nM.
[0085] These aptamers were also tested for binding to Jurkat cells at low concentrations, confirming preferential binding to Jurkat cells (see Figures 3A–3E). In a separate cell-binding assay, the binding of aptamers CELTIC_2, CELTIC_3, and CELTIC_21 to cells was compared with that of their shorter versions, CELTIC_2s, CELTIC_3s, and CELTIC_21s. Improved aptamer specificity was observed upon removal of the flanking regions (see Figures 5A–5F). In a further cell-binding assay, the binding of aptamers CELTIC_4s, CELTIC_5s, CELTIC_6s, CELTIC_9s, CELTIC_11s, CELTIC_19s, and CELTIC_21s to Jurkat and Ramos cells was measured and demonstrated high specificity for Jurkat and Ramos cells. This binding was tested at aptamer concentrations of 3 nM, 10 nM, and 30 nM. See Figures 8A-8G. Binding results for all aptamers to Jurkat and Ramos cells at concentrations of 3 nM and 10 nM are shown in Figures 9A and 9B, respectively. In additional cell binding assays, the binding of aptamers CELTIC_1s, CELTIC_4s, CELTIC_9s, and CELTIC_19s to mouse EL4 cells was evaluated. The results of the binding studies are shown in Figures 13A-13D. The dose-dependent staining of cells obtained in this assay suggests that these aptamers are cross-specific and recognize both human and mouse CD3 proteins.
[0086] Using the same experimental setup, we evaluated the binding affinity and specificity of the aptamer CELTIC_core, which corresponds to the calculated conserved motifs found among the top 45 sequence families isolated during SELEX (Figure 7C). As shown in Figure 17.4, shortening the aptamer to 21 strictly conserved nucleotides resulted in a significant improvement in recognition specificity for the CD3 receptor. At each concentration tested, we measured a signal on CD3-positive Jurkat cells that was negligible on CD3-negative Ramos cells. This gain in specificity is due to the apparent K observed in this experiment. DHowever, this was achieved at the expense of affinity, as the parent sequences, such as CELTIC_1s, CELTIC_4s, CELTIC_9s, and CELTIC_19s, reached saturation of signals above 10 nM, exceeding 50 nM.
[0087] Because this conserved motif exhibits a GGG / C repeat that defines the so-called "G-quadruplex" organization, we designed a set of mutants to conclusively confirm the importance of the G residues in the predicted conformation, identify key positions involved in binding specificity and affinity, and introduce mutations that improve the aptamer's properties. Several sequence variants of CELTIC_core_1 to CELTIC_core_13 (Figure 17.5) were synthesized and tested on Jurkat and Ramos cells at concentrations of 50 and 100 nM, as previously described. For comparison, these analyses included the native core sequence CELTIC_core (50 and 100 nM) and the full CD3_CELTIC_1s (10 and 50 nM). The results, presented in Figures 17.6.A–17.6.N, demonstrate that each modification had a significant and unpredictable effect on the aptamer's biological activity. Namely, adding GC or G to the 3' end of the conserved motif (CELTIC_core_1 or CELTIC_core_4) resulted in a loss of specificity. Several mutations disrupted the interaction with the CD3 receptor (CELTIC_core_2, CELTIC_core_5, CELTIC_core_6, and CELTIC_core_13). Loss of binding also occurred when G / C nucleotides at some positions were replaced with abasic sites (CELTIC_core_7 to CELTIC_core_11), whereas creating an abasic site at position 16 resulted in an aptamer with higher affinity but reduced specificity.
[0088] Addition of a TTT triplet at the 5' end (CELTIC_core_T) did not affect the binding properties of the core sequence, indicating that it is possible to introduce some space between the biotin label and the aptamer without steric hindrance. This observation prompted us to evaluate additional sequence variants, all carrying a HEG linker at the 5' end, introducing a longer C18 spacer. Sequence variants CELTIC_core_14 to CELTIC_core_44 were synthesized (Figure 18) and tested on Jurkat and Ramos cells at concentrations of 50 and 100 nM as previously described (Figure 19A-D). For comparison, these analyses included the native core sequence CELTIC_core (50 and 100 nM) and the unaltered versions CD3_CELTIC_1s and CD3_CELTIC_19s (10 and 50 nM).
[0089] For most positions, abasic sites or base substitutions disrupted binding to the CD3 receptor expressed on the surface of Jurkat cells. Removal of nucleosides at positions 10 and 12 reduced affinity (CELTIC_core_23 and CELTIC_core_25), whereas the same modifications at positions 11 (CELTIC_core_24) or 16 (CELTIC_core_29), which are not part of the GGG / C triplet that defines the "G-quadruplex" architecture, generated aptamers with comparable or improved affinity and specificity, respectively. Unexpectedly, substituting a G for the original C at position 16 reduced the affinity of the aptamer (CELTIC_core_39), while an A had no effect (CELTIC_core_38) and a T translated into improved affinity and specificity (CELTIC_core_40). Simultaneous denaturation of positions 11 and 16 resulted in either a gain in affinity and specificity (CELTIC_core_42) or an increase in affinity loss (CELTIC_core_44). Together, the results of these conformation-function studies are summarized in Figure 20 and suggest that improved versions of the core sequence can be empirically designed by substituting and introducing abasic sites at positions outside the GGG / C triplet that forms the "G-quadruplex" structure.
[0090] Example 4 Determining the affinity and specificity of anti-CD3 RNA aptamers for CD3 protein expressed on cells Anti-CD3 RNA aptamers were evaluated for binding to Jurkat and EL4 cells, and their apparent K D The binding was determined as described in Example 3, except that SELEX buffer was used instead of DPBS. The aptamers were used at three concentrations: 30 nM, 100 nM, and 300 nM. For incubation with EL4 cells, the aptamers were also diluted to 3 nM and 10 nM. The results of the binding studies are shown in Figures 30A-E. Five aptamers were analyzed: ARACD3-3700006, ARACD3-0010209, ARACD3-3130001, ARACD3-2980001, and ARACD3-0270039. Aptamer binding to CD3-negative Ramos cells (control) was also measured to assess aptamer specificity. In a separate cell-binding assay, the binding of the aptamers ARACD3-3700006 and ARACD3-0010209 to mouse EL4 cells was assessed. The results of the binding studies are shown in Figures 34A-B. The dose-dependent staining of cells obtained in this assay suggests that these aptamers are cross-specific, recognizing both human and mouse CD3 proteins.
[0091] Example 5 Binding of anti-CD3 DNA aptamers measured by surface plasmon resonance Binding affinity measurements were performed using a BIAcore T200 instrument (GE Healthcare). To analyze the interaction between the aptamer and CD3 protein, 1000 resonance units of biotinylated aptamer were immobilized on a Series S Sensor Chip SA (GE Healthcare) according to the manufacturer's instructions (GE Healthcare). SELEX buffer was used as the running buffer. The interaction was measured by injecting various concentrations of human CD3ε / γ, CD3ε / δ, IgG1 Fc, and mouse CD3ε / δ (Sino Biological) at a flow rate of 30 μL / min in "single kinetic cycle" mode. The highest protein concentration used was 100 nM. Other concentrations were obtained by 3-fold dilution. All kinetic data of the interaction were evaluated using the BIAcore T200 evaluation software. Examples of binding profiles obtained from these measurements are shown in Figures 4A-4C. Table 3 below lists the K values obtained from surface plasmon resonance measurements. D A summary of the values is shown.
[0092] [Table 2]
[0093] K for binding to human and mouse CD3 ε / δ D Comparison of the values indicates that the aptamer also binds to mouse CD3 ε / δ, but with lower affinity. Furthermore, compared to the aptamer CELTIC_1 (CD3-1 in Table 1), CELTIC_1s (CD3-1s) was observed to bind more strongly to the CD3 protein. Table 4 below shows the K obtained from another set of surface plasmon resonance measurements. D A summary of K values is shown for the first five aptamers with and without flanking regions. D Contains a value.
[0094] [Table 3]
[0095] Tables 5 and 6 below show the K values of several more aptamers. D A summary of the values is shown in Tables 4 and 5. D The values were obtained by measurements performed in steady-state analysis mode, whereas the values in Tables 3 and 6 were obtained by measurements performed in kinetic analysis mode. [Table 4] [Table 5]
[0096] Example 6 Binding of anti-CD3 RNA aptamers measured by surface plasmon resonance The binding of anti-CD3 RNA aptamers to each purified recombinant human CD3 ε / γ and CD3 ε / δ protein was measured using surface plasmon resonance. Binding studies were performed generally as described in Example 5, except that the SELEX buffer was replaced with DPBS. The highest protein concentration used was 300 nM. Other concentrations were obtained by 3-fold dilutions. Binding to hIgG1Fc was used as a control. Binding to mouse CD3 ε / δ (mCD3 ε / δ) was also measured. The results of these studies are shown in Table 7 below.
[0097] [Table 6] The binding profiles of aptamers ARACD3-3700006, ARACD3-0010209, and ARACD3-3130001 are shown in Figures 31A-32C.
[0098] Example 7 T cell activation by anti-CD3 DNA aptamer To measure T cell activation by anti-CD3 DNA aptamers, the aptamers were used at a concentration of 1 μM along with CD28 costimulation of T cells. Cytokines secreted by cells in response to activation were measured by ELISA and human Th1 / Th2 cytometry bead array (CBA). Expression of CD25 and CD69 activation markers on the surface of T cells was measured by flow cytometry. The results are shown in Figures 14A-14L, 15A-15C, and 16A-16C, respectively.
[0099] T cell activation assays were performed on peripheral blood mononuclear cells (PBMCs). Freshly prepared PBMCs were isolated from buffy coats obtained from healthy donors (Etablissement Français du Sang, Division Rhones-Alpes). After dilution of blood with DPBS, PBMCs were separated on a FICOLL density gradient (FICOLL-PAQUE PREMIUM 1.084, GE Healthcare), washed twice with DPBS, resuspended to obtain the desired cell density, and cultured in RPMI-1640 medium (Gibco Invitrogen) supplemented with 10% FBS (Gibco Invitrogen) and 1% penicillin / steptomycin (Gibco Invitrogen) at 37°C and 5% CO2.
[0100] Prior to assessing T cell activation properties, binding of anti-CD3 DNA aptamers to human PBMCs was first verified by flow cytometry as described in Example 3, except that the SELEX buffer was replaced with RPMI-1640 medium supplemented with 10% FBS and 1% penicillin / steptomycin. Four aptamers, CELTIC_1s, CELTIC_4s, CELTIC_9s, and CELTIC_19s, were used at concentrations of 3 nM, 10 nM, 30 nM, and 300 nM. The results of the binding studies are shown in Figure 12.
[0101] PBMC activation assays were performed with four aptamers, CELTIC_1s, CELTIC_4s, CELTIC_11s, and CELTIC_19s, with or without anti-CD28 monoclonal antibody (Invitrogen) as a costimulator. To keep the concentration of the reagent constant, a third condition was included in which fresh aptamer solution was added in the presence of anti-CD28 mAb after 3, 19, and 27 hours. Prior to the experiment, PBMCs were plated at 2.5 x 10 per well in a 24-well plate. 5 Cells were seeded at a density of 1000 μL in 400 μL of RPMI medium containing 10% FBS and 1% penicillin / streptomycin and cultured at 37°C under 5% CO2 for 4 hours. Candidate aptamers were denatured at 95°C for 5 minutes and immediately placed on ice at 4°C for 5 minutes. After sampling 100 μL of supernatant (basal cytokine level condition), 100 μL of stimulation solution containing 1 μM DNA aptamer and 0.5 μg / mL CD28 mAb diluted in RPMI was added to the wells. Cells were cultured at 37°C under 5% CO2 for 16, 24, or 48 hours.
[0102] PBMCs were also cultured with 100 μL of a mixture containing 2 μg / mL CD3 mAb and 5 μg / mL CD28 mAb (Invitrogen), 2 μg / mL CD3 mAb without reagent, or RPMI medium (negative control). The samples were then centrifuged at 320×g for 5 minutes, and the supernatants were collected. PBMC activation was assessed by measuring the levels of secreted interleukin-2 (IL-2), tumor necrosis factor-alpha (TNF-α), and interferon-gamma (IFN-γ) in culture supernatants collected at different intervals. A sandwich ELISA (DUOSET ELISA R&D Systems) was used for the measurements. 100 μL of undiluted sample or cytokine standard solution was added to each well, which had been pre-coated overnight with capture antibody. IL-2, TNF-α, or IFN-γ cytokine binding was detected with a biotinylated detection antibody revealed by streptavidin-HRP conjugate and TMB substrate. Following the addition of stop solution, ELISA plates were read at 450 nm on a VARIOSCAN LUX plate reader, and cytokine levels were determined against a reference standard curve. The results are shown in Figures 14A-14L. Secreted interleukin-2 (IL-2), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-10 (IL-10), tumor necrosis factor-alpha (TNF-α), and interferon-gamma (IFN-γ) levels in culture supernatants collected 48 hours later were measured using a Human Th1 / Th2 Cytometric Bead Array (CBA) (Becton Dickinson Biosciences) according to the manufacturer's instructions. The results are shown in Figures 16A-16C.
[0103] Finally, PBMC activation was assessed by analyzing the expression of CD25 and CD69 activation markers on the surface of CD4- and CD8-positive T cells. After 48 h of incubation in the presence of different test conditions and collection of culture supernatants for ELISA and CBA analysis, PBMCs were transferred to 96-well plates and centrifuged at 2500 rpm for 2 min. The supernatant was discarded, and the pelleted cells were washed twice with 200 μL of DPBS-0.2% BSA. Each wash step was followed by centrifugation at 2500 rpm for 2 min. Next, the cells were incubated with anti-CD4, anti-CD8, anti-CD25, and anti-CD69 monoclonal antibodies (Miltenyi) diluted in DPBS-0.2% BSA (1 μl per test). After 10 min of incubation at 4°C, the cells were centrifuged at 2500 rpm for 2 min and washed twice with DPBS-0.2% BSA (200 μL per well). Cells were fixed with CellFix solution (BD Biosciences), and fluorescent-positive cells were counted by flow cytometry (AttuneNXT; Invitrogen, Inc.) on the BL3 (anti-CD4-PerCP-Vio700), YL1 (CD69-PE), YL2 (CD8-PE-Vio-615), and YL4 (CD25-PE-Vio770) channels. The results are shown in Figures 15A-15C.
[0104] Cells treated with anti-CD3 monoclonal antibody, with or without anti-CD28 monoclonal antibody, showed increased secretion of all measured cytokines except for IL-5 and upregulation of surface expression of the CD25 and CD69 activation markers. None of the tested aptamers, even in combination with costimulatory anti-CD28 antibody, was able to activate cytokine secretion of surface marker expression. Keeping the aptamer concentration constant by repeatedly adding fresh solution to compensate for degradation in serum did not result in a more sustained activation profile.
[0105] Example 8: Activation of T cells by anti-CD3 RNA aptamers T cell activation by anti-CD3 RNA aptamers was measured by incubating cells with the aptamers at 1 μM concentration with CD28 costimulation using the procedure described in Example 7. Cytokines secreted by cells in response to activation were measured by ELISA and human Th1 / Th2 cell count bead array. Expression of CD25 and CD69 activation markers on the surface of T cells was measured by flow cytometry. The results are shown in Figures 35A-F, 37A-C, and 36A-C, respectively.
[0106] As previously observed in Example 7, cells treated with anti-CD3 monoclonal antibody, with or without anti-CD28 monoclonal antibody, showed increased secretion of all measured cytokines except for IL-5 and upregulation of surface expression of the CD25 and CD69 activation markers. None of the tested aptamers, even in combination with costimulatory anti-CD28 antibody, was able to activate cytokine secretion of surface marker expression. Keeping the aptamer concentration constant by repeatedly adding fresh solution to compensate for degradation in serum did not result in a more sustained activation profile.
[0107] Example 9: Functional stability of anti-CD3 DNA aptamers The stability of anti-CD3 DNA aptamers (CELTIC_1s, CELTIC_4s, CELTIC_9s, CELTIC_11s, CELTIC_19s, and CELTIC_22s) was measured in SELEX buffer containing 5% FBS or FBS alone. Biotinylated aptamers were denatured at 95°C for 5 minutes and then immediately cooled on an ice block at 4°C for 5 minutes. The sequences were then diluted to a final concentration of 2 μM in SELEX buffer supplemented with 5% FBS or pure FBS. Samples were incubated at 37°C for 10 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, or 24 hours. Control samples contained freshly prepared aptamers without incubation at 37°C. 100 nM streptavidin-PE was added to each solution, and the aptamers were incubated with positive CD3 Jurkat cells as previously described. Next, the half-lives of the aptamers in SELEX buffer containing 5% FBS or pure FBS were determined using flow cytometry in the YL-1 channel based on the variation in the number of fluorescent-positive cells as a function of incubation time at 37°C. The results are shown in Figures 11A and 11B. All aptamers incubated in SELEX buffer containing 5% serum were stable even after 24 hours of incubation. Dilution of the DNA aptamers in pure FBS showed gradual degradation of the sequences from 2 hours of incubation at 37°C.
[0108] Example 10: Functional stability of anti-CD3 RNA aptamers The stability of aptamers ARACD3-3700006 and ARACD3-0010209 was measured in Dulbecco's phosphate-buffered saline (DPBS) containing 5% FBS or FBS alone. The procedure described in Example 9 was used, except that denaturation was performed at 85°C. The results are shown in Figure 32-A. Both aptamers incubated in DPBS containing 5% serum were stable even after 24 hours of incubation. When incubated in pure serum, half of the binding activity was lost after 30 minutes.
[0109] Example 11: Serum stability of anti-CD3 DNA aptamers using gel electrophoresis The stability of anti-CD3 DNA aptamers (CELTIC_1s, CELTIC_4s, CELTIC_11s, and CELTIC_19s) was examined in selection (SELEX) buffer containing RPMI medium containing 5% fetal bovine serum (FBS), 10% FBS, or pure FBS. The aptamers were denatured at 95°C for 5 minutes and then immediately cooled on an ice block at 4°C for 5 minutes. The sequences were then diluted to a final concentration of 2 μM in SELEX buffer supplemented with 5% FBS, 10% FBS, or pure FBS serum. Samples were incubated at 37°C for 10 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, or 24 hours. Control samples contained freshly prepared aptamers without incubation at 37°C. The half-lives of the aptamers in each buffer were then measured as follows: aptamer samples from different incubation times were mixed with loading buffer (ThermoScientific, Waltham, MA, USA), and 15 μL of each sample was placed on a freshly prepared 3% agarose gel containing SYBRsafe (Invitrogen) as a DNA stain. Migration of the DNA aptamers on the agarose gel was performed in 1X TBE buffer (Invitrogen) by applying 100 V for 20 min. The gel was visualized using a Bio-Rad imaging system, and the results are shown in Figures 10A-10D. All tested aptamers were stable for at least 24 h in SELEX-5% FBS buffer. Incubation in RPMI medium containing 10% FBS caused degradation of CELTIC_4s and CELTIC_11s after 24 h at 37 °C. However, dilution of the DNA aptamer in pure serum resulted in a decrease in intensity after 1 hour of incubation. These results are in full agreement with the stability reported by flow cytometry in Example 9.
[0110] Example 12 Serum Stability of Anti-CD3 RNA Aptamers Using Gel Electrophoresis The stability of anti-CD3 RNA aptamers (ARACD3-3700006 and ARACD3-0010209) was examined in DPBS buffer containing RPMI medium containing 5% FBS, 10% FBS, or pure FBS. The aptamers were denatured at 85°C for 5 minutes and then immediately cooled on an ice block at 4°C for 5 minutes. The sequences were then diluted to a final concentration of 2 μM in DPBS buffer supplemented with 5% FBS, RPMI medium supplemented with 10% FBS, or pure FBS serum. Samples were incubated at 37°C for 10 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, or 24 hours. Control samples contained freshly prepared aptamers without incubation at 37°C. The half-life of the aptamers in each buffer was determined by migration on agarose gels using denaturing electrophoresis as follows: Aptamer samples from different incubation times were mixed with formamide-containing loading buffer (ThermoScientific, Waltham, MA, USA) and denatured at 85°C for 5 minutes. After denaturation, 15 μL of each sample was placed on a pre-prepared 3% agarose gel containing SYBRsafe (Invitrogen) as an RNA staining marker. Migration of the RNA aptamers on the agarose gel was performed in 1X TBE buffer (Invitrogen) by applying 100 V for 20 minutes. The gels were visualized using a Bio-Rad imaging system, and the results are shown in Figure 32B-C. Both aptamers were stable for at least 4 hours in DPBS-5% FBS and RPMI-10% FBS. Incubation of the RNA aptamer in pure serum resulted in a decrease in intensity after 0 minutes in Waltham. These results are in full agreement with the stability reported by flow cytometry in Example 10.
[0111] Example 13: Epitope mapping of anti-CD3 DNA aptamers by competitive binding assay with anti-CD3 monoclonal antibodies To gather more information about the regions recognized by the CELTIC_1s, CELTIC_4s, CELTIC_11s, and CELTIC_19s aptamers, competitive binding assays using reference monoclonal antibodies were performed on positive Jurkat cells essentially as previously described in Example 3, with the following modifications.
[0112] Jurkat cells were incubated with PE-labeled monoclonal antibodies (OKT3-PE, 0.1 nM; UCHT1-PE, 1 nM; or HIT3a-PE, 0.1 nM—all purchased from ThermoScientific, Waltham, MA, USA) for 30 min at 37°C in the presence of excess competitors (unlabeled OKT3, 32 nM; unlabeled UCHT1, 10 nM; unlabeled HIT3a, 32 nM—all purchased from ThermoScientific, Waltham, MA, USA; and aptamer, 300 nM). Binding of the labeled anti-CD3 monoclonal antibodies to the cells was then assessed by flow cytometry.
[0113] In a reverse experimental setup, Jurkat cells were incubated with CELTIC_1s, CELTIC_4s, CELTIC_11s, and CELTIC_19s DNA aptamers (fixed at 300 nM) with or without saturating concentrations of unlabeled monoclonal antibodies (OKT3 - 32 nM; UCHT1 - 10 nM; unlabeled HIT3a - 32 nM). Binding of the biotinylated aptamers on the cells was then assessed by flow cytometry after detection with streptavidin-PE.
[0114] The binding results for PE-labeled anti-CD3 monoclonal antibodies with and without saturating concentrations of competitors are shown in Figures 17.1A, 17.2A, and 17.3A. For each test antibody, an excess of its unlabeled form was used to inhibit or completely abolish binding of its PE-labeled version, validating experimental conditions. The maximum signal was measured when the aptamer was used as a competitor, suggesting that the tested candidates did not interfere with binding of the three reference antibodies.
[0115] The binding results for the anti-CD3 aptamer with and without saturating concentrations of monoclonal antibody are shown in Figures 17.1.B, 17.2.B, and 17.3.B. Similar signals were measured when the aptamer was incubated with and without competitor, suggesting that the antibody did not interfere with binding of the test sequence.
[0116] The lack of competition between the anti-CD3 aptamers and the reference monoclonal antibodies tested suggests that the region of the human CD3 receptor targeted by the aptamers is distinct from the OKT3, HIT3a, and UCHT1 epitopes. The OKT3 and UCHT1 antibodies have been reported to activate T lymphocytes upon binding. The recognition of alternative CD3 epitopes by CELTIC_1s, CELTIC_4s, CELTIC_11s, and CELTIC_19s is consistent with the lack of activation properties observed on human PBMCs in Example 7.
[0117] Example 14: Epitope mapping of anti-CD3 RNA aptamers by competitive binding assay with anti-CD3 monoclonal antibodies To gather more information about the regions recognized by the ARACD3-3700006 and ARACD3-0010209 aptamers, competitive binding assays with reference monoclonal antibodies were performed on CD3-positive Jurkat cells essentially as described above in Example 13, except that DPBS-5% FCS was used instead of SELEX buffer-5% FCS. The binding results of PE-labeled anti-CD3 monoclonal antibody with and without saturating concentrations of competitor are shown in Figures 38-A, 38-C and 38-E. For each test antibody, an excess of its unlabeled form was used to inhibit or completely abolish binding of its PE-labeled version, validating experimental conditions. The maximum signal was measured when the aptamer was used as a competitor, suggesting that the tested candidate did not interfere with binding of the three reference antibodies. The binding results for the anti-CD3 aptamer with and without saturating concentrations of monoclonal antibody are shown in Figures 38B, 38-D, and 38-F. Similar signals were measured when the aptamer was incubated with and without competitor, suggesting that the antibody did not interfere with binding of the test sequence. The lack of competition between the anti-CD3 aptamers and the reference monoclonal antibodies tested suggests that the region of the human CD3 receptor targeted by the aptamers is distinct from the OKT3, HIT3a, and UCHT1 epitopes. The OKT3 and UCHT1 antibodies have been reported to activate T lymphocytes upon binding. The recognition of alternative CD3 epitopes by ARACD3-3700006 and ARACD3-0010209 is consistent with the lack of activation properties observed on human PBMCs in Example 8.
[0118] Example 15: Engineering anti-CD3 DNA aptamers with improved stability derived from the core sequence Based on the results obtained in the binding studies performed on CD3-positive and CD3-negative cells and described in Example 3, a short list of sequence-optimized anti-CD3 aptamers derived from the core sequence and exhibiting improved apparent affinity and target specificity were selected for further investigation of their stability in serum. These analyses were performed using aptamers CELTIC_core, CELTIC_core_12, and CELTIC_core_12, as well as 5'-end HEG-modified CELTIC_core_24, CELTIC_core_29, CELTIC_core_40, and CELTIC_core_42, incubated in a selection (SELEX) buffer containing RPMI medium containing 5% fetal bovine serum (FBS), 10% FBS, or pure FBS. After various incubation times, the fraction of undegraded aptamer was quantified by flow cytometry and agarose gel electrophoresis, as described in Examples 11 and 13, respectively.
[0119] As shown in Figures 22A-F and 23A-C, aptamers CELTIC_core, CELTIC_core_24, and CELTIC_core_29 appeared highly unstable in each of the tested serum conditions, with no integrated / functional aptamer remaining after 4 hours of incubation in SELEX-5% FBS or 30 minutes in pure serum. As previously observed in Examples 11 and 13, there was complete consistency in the results obtained by both methods. In comparison, the parent uncut CELTIC_1s and CELTIC_19s sequences were stable for 24 hours in SELEX-5% FBS and at least 1 hour in pure serum. Meanwhile, CELTIC_core_12, CELTIC_core_40, and CELTIC_core_42 performed much better in both stability readouts. CELTIC_core_12 was the most stable aptamer, remaining completely undegraded after 24 hours of incubation in SELEX-5% FBS and RPMI medium containing 10% FBS. In pure serum, degradation only began after 4 hours. CELTIC_core_40 and CELTIC_core_42 were intermediate cases, more stable than the unmodified CELTIC_core sequence, but were completely degraded in pure serum after 4 hours of incubation. It is noteworthy that CELTIC_core_12, CELTIC_core_29, and CELTIC_core_42, which differ by only one nucleotide at position 11, exhibit completely different stabilities. Furthermore, the introduction of a second abasic site at position 16 within CELTIC_core_29, resulting in CELTIC_core_42, appeared to be a strategy to stabilize the sequence.
[0120] In another attempt to improve the stability of HEG-modified CELTIC_core_40 and CELTIC_core_42, the benefits of adding 3'-3' deoxythymidine were explored. This type of modification has been reported to increase the resistance of nucleotide sequences to nuclease degradation at the 3' end. As shown in Figures 32.1 A-D and 32.2 A-B, compared to CELTIC_core_40 and CELTIC_core_42, aptamers with 3'-3' deoxythymidine at the 3' end exhibited significantly improved stability. While not superior to CELTIC_core, these variants were stable for 24 hours in SELEX-5% FBS and for at least 2 hours in pure serum. It is worth noting that CELTIC_core_42 was more stable than CELTIC_core_40 despite the presence of two abasic sites commonly considered to be nuclease-sensitive sites.
[0121] Example 16: The most stable, sequence-optimized anti-CD3 core DNA sequence derivatives maintain cross-specificity Binding affinity measurements using the most interesting anti-CD3 aptamers derived from the core sequence were performed using a BIAcore T200 instrument (GE Healthcare) as previously described in Example 4. To analyze the interaction between the aptamer and the CD3 protein, biotinylated aptamers were immobilized on a Series S Sensor Chip SA (GE Healthcare) according to the manufacturer's instructions. Cynomolgus monkey CD3ε / δ was purchased from AcroBiosystems. For human proteins, the highest concentrations used for mouse and cynomolgus monkey antigens were 100 nM and 1 μM, respectively. Other concentrations were obtained by 3-fold dilutions.
[0122] Table 8 below shows the K obtained from surface plasmon resonance measurements. DA summary of the values is shown. These results confirm the reduced affinity observed in cell-binding assays with the core sequences compared to the parent sequences CELTIC_CD3_1s and CELTIC_CD3_19s. The core sequence variants identified in the cell-binding assay (CELTIC_core_12, CELTIC_core_24, CELTIC_core_29, CELTIC_core_40, and CELTIC_core_42) were all confirmed to have better affinity with human CD3 e / γ than the unmodified aptamer. As previously observed in Example 4, affinity was generally slightly lower with CD3 e / δ, a result of the SELEX strategy involving multiple rounds with the CD3 e / δ isoform. None of these sequences bound to the Fc region of human IgG1. Addition of 3'-3' deoxythymidine to the 3' end of CELTIC_core_24, CELTIC_core_40, and CELTIC_core_42 also reduced the K D The values did not change significantly.
[0123] [Table 7]
[0124] Table 9 below shows the K values obtained from surface plasmon resonance measurements performed on human CD3 e / γ and mouse and cynomolgus monkey CD3 e / δ. DA summary of the values is shown. In this new experimental setup, CELTIC_core again showed lower affinity for human CD3 e / γ compared to the parent sequences CELTIC_core_1s and CELTIC_core_19s, while the sequence variants CELTIC_core_12, CELTIC_core_24, CELTIC_core_29, CELTIC_core_40, and CELTIC_core_42 showed improved affinity. In these conditions, the 3'-3' deoxythymidine modified versions of the four updated aptamers performed equally well. All of these sequence-optimized aptamers were able to bind mouse and cynomolgus CD3 e / δ isoforms, confirming the cross-specificity of the CD3 aptamers already observed in Examples 3 and 5. In contrast to CELTIC_core, CELTIC_1s, or CELTIC_19s, the reported KD values for interactions with mouse and cynomolgus monkey CD3 e / δ isoforms were in the same range as the human CD3 protein, suggesting that the measured interactions are real. Based on these results, the anti-CD3 sequence-optimized aptamers remain cross-specific for mouse and bind to both mouse and cynomolgus monkey, even though they were selected against the human receptor.
[0125] [Table 8]
[0126] Example 17: The most stable, sequence-optimized anti-CD3 core DNA sequence derivatives still recognize different epitopes than the reference antibody To gather more detailed information about the regions recognized by the CELTIC_core_12, CELTIC_core_40t, and CELTIC_42t aptamers, competitive binding assays with reference monoclonal antibodies were performed on CD3-positive Jurkat cells essentially as previously described in Example 13. For comparison, uncut CD3_CELTIC_1s was included in these analyses. The binding results for PE-labeled anti-CD3 OKT3, UCHT1, and HIT3a monoclonal antibodies, with and without saturating concentrations of competitors, are shown in Figures 21-A, 21-C, and 21-E. For each test antibody, an excess of its unlabeled form was used to inhibit or completely abolish binding of its PE-labeled version, validating experimental conditions. The maximum signal was measured when the aptamer was used as a competitor, suggesting that the tested candidate did not interfere with binding of the three reference antibodies. The binding results for the anti-CD3 aptamer with and without the monoclonal antibody are shown in Figures 21-B, 21-D, and 21-E. Similar signals were measured when the aptamer was incubated with and without the competitor, suggesting that the antibody did not interfere with binding of the test sequence. The lack of competition observed between the anti-CD3 aptamers and the reference monoclonal antibodies tested suggests that the region of the human CD3 receptor targeted by the aptamers is distinct from the OKT3, HIT3a, and UCHT1 epitopes. Taken together, these results suggest that the sequence-optimized CELTIC_core_12, CELTIC_core_40t, and CELTIC_42t aptamers do not differ from their parent sequences in terms of epitope specificity, despite variations in nucleotide composition and chemical modifications at the 5' and 3' ends. Binding to CD3 regions instead of the OKT3 and UCHT1 epitopes, known to activate T lymphocytes upon binding, suggests that the CELTIC_core_12, CELTIC_core_40t, and CELTIC_42t aptamers may not exhibit activating properties.
[0127] Example 18: Functionalization of sequence-optimized anti-CD3 core DNA sequence derivatives for subsequent grafting via covalent chemistry does not alter biological properties We finally set out to evaluate the impact of 3' and 5' end modifications on the biological properties of specific anti-CD3 aptamers. This issue is particularly relevant when considering the covalent attachment of functionalized aptamers to supports, polymers or surfaces. To do this, we selected HEG-modified CELTIC_core_42, conjugated with TEG-biotin at the 5'- or 3'-end, and introduced tetrazine-PEG5 groups at the 5' end of CELTIC_core_42 by solid-phase synthesis as already described in Example 1. Each of these functional groups is responsible for the affinity interactions (10 15 K of M D This allows the conjugation of aptamers to biotin via covalent attachment (inverse electron demand Diels-Alder) to norbornene / alkene / alkyne modified partners via click chemistry (the strongest interaction reported to date). The interaction of these three versions of the same aptamer with the CD3 receptor expressed on Jurkat cells was investigated as previously described in Example 3. CD3-negative Ramos cells were included as a negative control to monitor nonspecific interactions mediated by the introduced chemical modifications. The results summarized in Figure 33 show that both ends of a particular aptamer can be modified with biotin without affecting the apparent affinity (KD<50 nM) and specificity. The introduction of a tetrazine function at the 5' end resulted in a slight decrease in affinity (apparent KD<50 nM) without losing specificity for the CD3 target. D <25 nM) was improved.
[0128] Taken together, these results suggest that functionalization of anti-CD3 aptamers for subsequent coupling can be performed without significantly inhibiting their biological properties. [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4] [Table 9-5] [Table 9-6] In the case of clusters 1 to 45, the flanking regions present at the 5'- and 3'-ends (TAGGGAAGAGAAGGAAGGATAT and TTGAGaCTAGATGACCACTTGA, respectively) and the nucleotide sequence of interest are listed in SEQ ID NO: 114 but are not shown.
[0129] As used herein, "consisting essentially of" allows for the inclusion of materials or steps that do not materially affect the basic and novel characteristics of the claim. Any reference to the term "comprising" herein can be interchanged with "consisting essentially of" or "consisting of," particularly in describing components of a composition or in describing elements of a device. While the present invention has been described in conjunction with certain preferred embodiments, one of ordinary skill, after reading the foregoing specification, will be able to make various modifications, substitutions of equivalents, and other alterations to the compositions and methods described herein.
Claims
1. An aptamer comprising a sequence selected from the group consisting of SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 3, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 21, SEQ ID NO: 49, and SEQ ID NO: 22, wherein the aptamer binds to CD3ε / γ or CD3ε / δ.
2. The aptamer of claim 1, wherein the aptamer binds to human CD3ε / γ and / or CD3ε / δ with a dissociation constant of 0.2 pM to 250 nM.
3. The aptamer according to claim 1 or 2, which binds to non-human CD3ε / γ and / or CD3ε / δ with a dissociation constant of 20 nM to 800 nM.
4. A mutant of the aptamer described in any one of claims 1 to 3, wherein one or more bases in the sequence are substituted with non-naturally occurring bases, or one or more bases in the sequence are omitted, or one or more bases in the sequence are omitted and a linker is inserted in place of the one or more omitted bases, the sequence of the mutant having at least 90% sequence identity with the sequence described in claim 1, and the mutant binds to CD3ε / γ or CD3ε / δ.
5. 5. The variant of claim 4, wherein the one or more non-naturally occurring bases are selected from the group consisting of methylinosine, dihydrouridine, methylguanosine, and thiouridine.
6. An aptamer according to any one of claims 1 to 3 or a variant according to claim 4 or 5, which binds to but does not activate CD3+ T cells.
7. A vehicle for delivering a drug, dye, or biologically active agent to a T cell, said vehicle comprising an aptamer according to any one of claims 1 to 3 or a variant according to any one of claims 4 to 6.
8. 8. The aptamer or variant of claim 6 or the vehicle of claim 7, comprising a polymeric nanoparticle.
9. The aptamer, variant, or vehicle of claim 8 , wherein the polymeric nanoparticle comprises poly(beta amino ester) (PBAE).
10. The aptamer, variant, or vehicle of claim 8 or 9, wherein the aptamer is covalently bound to the polymeric nanoparticle.
11. 11. The vehicle of claim 7, 8, 9, or 10, wherein the agent is a T cell modulator or an imaging agent.
12. 12. The vehicle of claim 11, wherein the vehicle comprises a polymeric nanoparticle, the T cell modulator is a viral vector carrying a transgene, the viral vector is coated with the polymeric nanoparticle, and the aptamer is covalently bound to the polymeric nanoparticle.
13. The vehicle of claim 12 , wherein the viral vector is a lentiviral vector.
14. 14. The vehicle of claim 12 or claim 13, wherein the transgene encodes a chimeric antigen receptor.
15. 12. The vehicle of claim 11, wherein the T cell modulator is selected from the group consisting of dasatinib, a MEK1 / 2 inhibitor, a PI3K inhibitor, a HD AC inhibitor, a kinase inhibitor, a metabolic inhibitor, a GSK3 beta inhibitor, a MAO-B inhibitor, and a Cdk5 inhibitor.
16. A vehicle according to any one of claims 11 to 15 for use as a medicine.
17. A pharmaceutical composition comprising a vehicle according to any one of claims 11 to 15 and one or more excipients.
18. An in vitro method for isolating T cells, said method comprising using an aptamer or variant according to any one of claims 1 to 6 to isolate T cells from a composition comprising T cells.
Citation Information
Patent Citations
Aptamer specifically combining CD3, screening method of aptamer and application
CN107129988A
Bispecific aptamers that mediate tumor cell lysis
JP2014500024A
Ligand-guided-selection method for screening antigen-specific ligands
US20190177716A1
Aptamers to von willebrand factor and their use as thrombotic disease therapeutics
WO2006033854A2
Aptamer-targeted costimulatory ligand aptamer
WO2010144295A1