Molecularly targeted nucleic acid medicine for gastric cancer

Antisense nucleic acids targeting SYT13 mRNA regions provide a more effective treatment for gastric cancer metastasis by specifically suppressing SYT13 expression, addressing the limitations of existing treatments and siRNA sequence unknowns.

JP7732637B2Active Publication Date: 2025-09-02NAT UNIV CORP TOKAI NAT HIGHER EDUCATION & RES SYST +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2021542986
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-08-27
Filing Date
2020-08-27
Publication Date
2025-09-02
Estimated Expiration
2040-08-27

AI Technical Summary

Technical Problem

Current treatments for peritoneal dissemination of gastric cancer, such as resection, radiation therapy, and systemic administration of anticancer drugs, are less effective, and the sequence information of siRNA targeting SYT13 to suppress metastasis is unknown, leading to incomplete suppression of SYT13 expression.

Method used

Development of antisense nucleic acids targeting specific regions of SYT13 mRNA to suppress its expression, including specific base sequences and modifications, which are delivered specifically to regions where SYT13 is highly expressed.

Benefits of technology

The antisense nucleic acids effectively suppress SYT13 expression, inhibiting metastasis and peritoneal dissemination of gastric cancer, offering a more targeted and effective treatment than siRNA.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007732637000008
    Figure 0007732637000008
  • Figure 0007732637000009
    Figure 0007732637000009
  • Figure 0007732637000010
    Figure 0007732637000010
Patent Text Reader

Abstract

Provided is a nucleic acid medicine having better efficacy than siRNA for targeting peritoneal dissemination of gastric cancer, by using antisense nucleic acids to inhibit the expression of SYT13. Provided are: an antisense oligonucleotide which comprises a base sequence substantially complementary to the base sequence of a specific region of human SYT13 mRNA and which can inhibit the expression of the human SYT13 mRNA; and a pharmaceutical composition containing said antisense oligonucleotide.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a molecularly targeted nucleic acid drug that targets gastric cancer, particularly peritoneal dissemination of gastric cancer, and more specifically to an antisense nucleic acid against SYT13 and a pharmaceutical composition containing the same. [Background technology]

[0002] Gastric cancer is common in Asia, including Japan, China, and Korea, as well as in South America. Although the spread of cancer screening has enabled early detection and treatment, and the mortality rate from gastric cancer has decreased, advanced gastric cancer still has a poor prognosis, and it remains an important disease that must be overcome.

[0003] Peritoneal dissemination is known as one of the forms of recurrent metastasis of gastric cancer. Peritoneal dissemination is most commonly seen in cases with stage IV disease at the time of diagnosis, and is also the most common form of recurrence after resection. Furthermore, peritoneal dissemination is a major problem because it is less effective in treatments such as resection, radiation therapy, and systemic administration of anticancer drugs.

[0004] The present inventors' group previously discovered that SYT13 is specifically highly expressed in gastric cancer that undergoes peritoneal dissemination and metastasis, and reported that its expression can be used as an indicator to predict peritoneal dissemination after gastrectomy, and that siRNA against SYT13 can suppress the proliferation, invasion, and migration abilities of gastric cancer cell lines, and can suppress metastasis due to peritoneal dissemination after gastrectomy (Patent Document 1 and Non-Patent Document 1).

[0005] SYT13 is a membrane protein belonging to the synaptotagmin (SYT) family. SYT family proteins were identified as calcium-phospholipid-binding molecules present on synaptic vesicles and have been suggested to function as calcium sensors. Seventeen isoforms have been reported in humans, distributed primarily in brain tissue. Unlike other synaptotagmins, SYT13 binds to phospholipids regardless of the presence or absence of calcium and is reported to be expressed in various tissues other than the brain (Non-Patent Document 2). [Prior art documents] [Patent documents]

[0006] [Patent Document 1] International Publication No. 2016 / 143697 [Non-patent literature]

[0007] [Non-Patent Document 1] M. Kanda et al., British Journal of Surgery, 2018; 108: 1349-1358 [Non-patent document 2] M. Fukuda and K. Mikoshiba, Biochem J., 2001; 354: 249-257 Summary of the Invention [Problem to be solved by the invention]

[0008] As mentioned above, it has been confirmed that the use of siRNA against SYT13 can suppress SYT13 expression and thus inhibit metastasis through peritoneal dissemination; however, the sequence information of the siRNA actually used is unknown, and the suppression of SYT13 expression has not been fully investigated.

[0009] Therefore, the present inventors set out to provide a more effective nucleic acid drug targeting peritoneal dissemination of gastric cancer by suppressing the expression of SYT13 using antisense nucleic acids, which are nucleic acid drugs different from siRNA. [Means for solving the problem]

[0010] In view of the above problems, the present inventors first focused on the base sequence of human SYT13 mRNA and conducted extensive research to obtain antisense nucleic acids that are effective as pharmaceuticals and have no potential side effects. As a result, they discovered that particularly effective antisense nucleic acids can be obtained by targeting specific regions in the base sequence of SYT13 mRNA, and thus completed the present invention.

[0011] That is, the present invention provides the following. 1. An antisense oligonucleotide capable of suppressing the expression of human SYT13 mRNA, comprising: nucleotides 348 to 366, 599 to 627, 997 to 1016, 1069 to 1088, 1419 to 1437, 1612 to 1641, 1775 to 1793, 2629 to 2647, 2810 to 2831, 3244 to 3262, 3315 to 3333, 3423 to 3442, 4266 to 4284, 4296 to 4298, 4300 to 4301, 4315 to 4316, 4317 to 4318, 4319 to 4321, 4322 to 4323, 4324 to 4325, 4326 to 4328, 4335 to 4339, 4340 to 4341, 4342 to 4342, 4344 to 4345, 4356 to 4357, 4358 to 4359, 4360 to 4361, 4362 to 4363, 4364 to 4365, 4366 to 4367, 4368 to 4369, 4370 to 4371, 4372 to 4373, 4374 to 4375, 4376 to 4378, 4378 to 4379, 4380 to 4381, 4382 to 4383, 4384 to 4385, 4386 to 4 An antisense oligonucleotide consisting of an 11 to 19 base sequence complementary to the base sequence of 328 to 4346, or 4365 to 4400, 4714 to 4751, 4776 to 4795, or 4949 to 4968, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to the antisense oligonucleotide. 2. An antisense oligonucleotide consisting of a base sequence selected from the group consisting of SEQ ID NOs: 3 to 43, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases have been substituted, deleted or inserted relative to the antisense oligonucleotide. 3. An antisense oligonucleotide consisting of a base sequence selected from the group consisting of SEQ ID NOs: 50 to 59, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases have been substituted, deleted or inserted relative to the antisense oligonucleotide. 4. An antisense oligonucleotide consisting of a base sequence selected from the group consisting of SEQ ID NOs: 60 to 69, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases have been substituted, deleted or inserted relative to the antisense oligonucleotide. 5. An antisense oligonucleotide consisting of a base sequence selected from the group consisting of SEQ ID NOs: 70 to 79, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases have been substituted, deleted or inserted relative to the antisense oligonucleotide. 6. An antisense oligonucleotide consisting of a base sequence selected from the group consisting of SEQ ID NOs: 4, 20, 29, 35, 39, 62, and 79, or an antisense oligonucleotide consisting of a base sequence in which 1 to 3 bases have been substituted, deleted, or inserted relative to the antisense oligonucleotide. 7. The antisense oligonucleotide according to any one of 1 to 6 above, which has an artificial nucleic acid region containing a bicyclic sugar. 8. The antisense oligonucleotide according to any one of 1 to 7 above, wherein at least one internucleoside bond is a phosphorothioate bond. 9. The antisense oligonucleotide according to any one of 1 to 8 above, which has an artificial nucleic acid region containing 5-methylcytosine. 10. The antisense oligonucleotide according to any one of 1 to 9 above, which is 15 to 19 nucleotides in length. 11. The antisense oligonucleotide according to any one of 1 to 10 above, which is a gapmer. 12. A conjugate comprising the antisense oligonucleotide according to any one of 1 to 11 above and a further functional moiety linked directly or indirectly to it. 13. The conjugate according to claim 12, wherein the further functional moiety is a targeting molecule or a drug with antitumor activity. 14. A pharmaceutical composition comprising the antisense oligonucleotide according to any one of 1 to 11 above, or the conjugate according to 12 or 13 above. 15. A pharmaceutical composition according to claim 14 for treating or preventing gastric cancer in humans. 16. The pharmaceutical composition described in 15 above for treating or preventing peritoneal dissemination after gastric cancer resection. This specification includes the disclosure of Japanese Patent Application No. 2019-154968, from which this application claims priority. [Effects of the Invention]

[0012] The present invention provides a molecularly targeted nucleic acid drug for gastric cancer that is significantly superior to siRNA by being delivered specifically to regions where SYT13 is highly expressed and suppressing its expression. [Brief explanation of the drawings]

[0013] [Figure 1] Schematic diagrams of examples of the structures of antisense nucleic acids that can be used in the present invention are shown. [Figure 2] 1 shows that the antisense nucleic acid of the present invention inhibits the expression of SYT13 in KATOIII cells in a concentration-dependent manner. Control: no antisense nucleic acid added, NEG1: control antisense nucleic acid added. [Figure 3] 1 shows that the antisense nucleic acid of the present invention suppresses the expression of SYT13 in MKN1 cells in a concentration-dependent manner. Control: no antisense nucleic acid added, NEG1: control antisense nucleic acid added. [Figure 4] 1 shows that the antisense nucleic acid of the present invention suppresses the expression of SYT13 in MKN45 cells in a concentration-dependent manner. Control: no antisense nucleic acid added, NEG2: control antisense nucleic acid added. [Figure 5] 1 shows that the antisense nucleic acid of the present invention inhibits the expression of SYT13 in OCUM-1 cells in a concentration-dependent manner. Control: no antisense nucleic acid added, NEG2: control antisense nucleic acid added. [Figure 6] 1 shows that the antisense nucleic acid of the present invention inhibits the expression of SYT13 in OCUM-1 cells in a concentration-dependent manner. Control: no antisense nucleic acid added, NEG2: control antisense nucleic acid added. [Figure 7]This shows that the antisense nucleic acid of the present invention suppresses SYT13 expression in MKN1 cells in a concentration-dependent manner. The dotted and dashed lines indicate the expression suppression levels when the parent sequence, hSYT13-4729-AmNA(15), was used at 100 nM and 400 nM. Control: No antisense nucleic acid added. NEG2: Control antisense nucleic acid added. [Figure 8] This shows that the antisense nucleic acids of the present invention suppress SYT13 expression in NUGC-4 cells in a concentration-dependent manner. The dotted and dashed lines indicate the expression suppression levels when the parent sequence, hSYT13-4378-AmNA(15), was used at 100 nM and 400 nM, respectively. Control: No antisense nucleic acid added. NEG1 and NEG2: Control antisense nucleic acid added. [Figure 9] This shows that the antisense nucleic acids of the present invention suppress SYT13 expression in NUGC-4 cells in a concentration-dependent manner. The dotted and dashed lines indicate the expression suppression levels when the parent sequence, hSYT13-4729-AmNA(15), was used at 100 nM and 400 nM, respectively. Control: No antisense nucleic acid added. NEG1 and NEG2: Control antisense nucleic acid added. [Figure 10A] 1 shows the effect of the antisense nucleic acid of the present invention on the proliferation ability of MKN1 cells. Con: no antisense nucleic acid added, NEG1: control antisense nucleic acid added. [Figure 10B] 1 shows the effect of the antisense nucleic acid of the present invention on the proliferation ability of KATO-III cells. Con: no antisense nucleic acid added, NEG1: control antisense nucleic acid added. [Figure 10C] 1 shows the effect of the antisense nucleic acid of the present invention on the proliferation ability of OCUM-1 cells. Con: no antisense nucleic acid added, NEG1: control antisense nucleic acid added. [Figure 10D] 1 shows the effect of the antisense nucleic acid of the present invention on the proliferation ability of AGS cells. Con: no antisense nucleic acid added, NEG1: control antisense nucleic acid added. [Figure 10E] 1 shows the effect of the antisense nucleic acid of the present invention on the proliferation ability of N87 cells. Con: no antisense nucleic acid added, NEG1: control antisense nucleic acid added. [Figure 10F] 1 shows the effect of the antisense nucleic acid of the present invention on the proliferation ability of NUGC4 cells. Con: no antisense nucleic acid added, NEG1: control antisense nucleic acid added. [Figure 10G] 1 shows the effect of the antisense nucleic acid of the present invention on the proliferation ability of GSU cells. Con: no antisense nucleic acid added, NEG1: control antisense nucleic acid added. [Figure 11A] The effect of siRNA on the proliferation ability of MKN1 cells is shown. Control: No siRNA added, siControl: Control siRNA added. [Figure 11B] The effect of siRNA on the proliferation ability of NUGC4 cells is shown. Control: No siRNA added, siControl: Control siRNA added. [Figure 12A] This figure shows the effect of the antisense nucleic acid of the present invention on the migration ability of MKN1 / Luc cells. MKN1 / Luc cells (3 x 10 cells / well) were treated with the antisense nucleic acid at a final concentration of 400 nM. Images were taken every 6 hours for up to 18 hours at 20 evenly spaced locations and analyzed using Image-J. The average values ​​and standard deviations were calculated. Control: No antisense nucleic acid added. NEG1: Control antisense nucleic acid added. [Figure 12B] This shows the effect of the antisense nucleic acid of the present invention on the migration ability of N87 cells. N87 cells (30 × 10 cells / well) were treated with the antisense nucleic acid at a final concentration of 100 nM, and images were taken at 20 evenly spaced locations every 12 hours up to 60 hours. Images were then analyzed using Image-J, and the average and standard deviation were calculated. Control: No antisense nucleic acid added. NEG1: Control antisense nucleic acid added. [Figure 12C] This shows the effect of the antisense nucleic acid of the present invention on the migration ability of NUGC4 cells. NUGC4 cells (3.5 x 104 cells / well) were treated with the antisense nucleic acid at a final concentration of 100 nM. Images were taken every 6 hours for 24 hours at 20 evenly spaced locations and analyzed using Image-J. The average values ​​and standard deviations were calculated. Control: No antisense nucleic acid added. NEG1: Control antisense nucleic acid added. [Figure 13A]This figure shows the effect of the antisense nucleic acid of the present invention on the invasive ability of MKN1 cells. MKN1 / Luc cells (2.5 × 10 cells / well) were treated with the antisense nucleic acid at a final concentration of 400 nM. After cell collection 36 hours after seeding, the cells were counted in eight sections of each of four selected fields, for a total of 32 areas, and the average and standard deviation of the results were calculated. Control: No antisense nucleic acid added. NEG1: Control antisense nucleic acid added. [Figure 13B] The effect of the antisense nucleic acid of the present invention on the invasiveness of AGS cells is shown. AGS cells (5 x 10 cells / well) were treated with the antisense nucleic acid at a final concentration of 100 nM. After 48 hours of cell collection, the cells were counted in 8 sections in each of 4 selected fields, for a total of 32 areas, and the average and standard deviation of the results were calculated. Control: No antisense nucleic acid added. NEG1: Control antisense nucleic acid added. [Figure 13C] The effect of the antisense nucleic acid of the present invention on the invasiveness of GSU cells is shown. GSU cells (5 x 10 cells / well) were treated with the antisense nucleic acid at a final concentration of 100 nM. After 144 hours of cell collection, the cells were counted in 8 sections in each of 4 selected fields, for a total of 32 areas, and the average and standard deviation of the results were calculated. Control: No antisense nucleic acid added. NEG1: Control antisense nucleic acid added. [Figure 14A] 1 shows an outline of an in vivo test using a mouse model to examine the effect of the antisense nucleic acid of the present invention. [Figure 14B] 1 shows the effect of the antisense nucleic acid of the present invention on the total weight of peritoneal dissemination in MKN1-administered mice. Control: no antisense nucleic acid administered, NEG1: control antisense nucleic acid administered. [Figure 14C] 1 shows the effect of the antisense nucleic acid of the present invention on the total weight of peritoneal dissemination in NUGC4-administered mice. Control: no antisense nucleic acid administered, NEG1: control antisense nucleic acid administered. [Figure 15A]1 shows the effect of the antisense oligonucleotide of the present invention on the proliferation ability of MKN1 cells. Cont: no antisense oligonucleotide added, NEG1: control antisense nucleic acid added. [Figure 15B] 1 shows the effect of the antisense oligonucleotide of the present invention on the proliferation ability of NUGC4 cells. Cont: no antisense oligonucleotide added, NEG1: control antisense nucleic acid added. [Figure 16A] 1 shows the effect of the antisense oligonucleotide of the present invention on the migration ability of MKN1 cells. Cont: no antisense oligonucleotide added, NEG1: control antisense nucleic acid added. [Figure 16B] 1 shows the effect of the antisense oligonucleotide of the present invention on the migration ability of NUGC4 cells. Cont: no antisense oligonucleotide added, NEG1: control antisense nucleic acid added. [Figure 17A] 1 shows the effect of the antisense oligonucleotide of the present invention on the invasive ability of MKN1 cells. Control: no antisense oligonucleotide added, NEG1: control antisense nucleic acid added. [Figure 17B] 1 shows the effect of the antisense oligonucleotide of the present invention on the invasive ability of MKN1 cells. Cont: no antisense oligonucleotide added, NEG1: control antisense nucleic acid added. [Figure 18A] 1 shows an outline of an in vivo test on the effect of the antisense oligonucleotide of the present invention using a mouse model. [Figure 18B] 1 shows the effect of the antisense oligonucleotide of the present invention on the total weight of peritoneal dissemination in NUGC4-administered mice. Control: no antisense oligonucleotide administered, NEG1: control antisense nucleic acid administered. [Figure 18C] 1 shows the results of survival analysis with and without administration of the antisense oligonucleotide of the present invention, where CEM: no administration of antisense oligonucleotide, and NEG1: administration of a control antisense nucleic acid. [Figure 19]This shows that antisense oligonucleotides with different modifications suppress SYT13 expression in NUGC-4 cells in a concentration-dependent manner. Control: No antisense oligonucleotide added; NEG1: Addition of control antisense oligonucleotide. DETAILED DESCRIPTION OF THE INVENTION

[0014] The present invention will be described in detail below.

[0015] (antisense oligonucleotides) The present invention relates to antisense oligonucleotides. More specifically, the present invention relates to antisense oligonucleotides having a sequence substantially complementary to a portion of the nucleotide sequence of SYT13 mRNA, which inhibit the expression of human SYT13.

[0016] The SYT13 gene is present in mammals, such as primates (e.g., cynomolgus monkeys, chimpanzees, and humans) and non-primates (e.g., cows, pigs, sheep, horses, cats, dogs, guinea pigs, rats, and mice), and its nucleotide sequence and the amino acid sequence of the SYT13 protein encoded by the nucleotide sequence can be obtained from databases such as the National Center for Biotechnology Information (NCBI) database. It is also known that multiple isoforms of SYT13 exist, and examples of human SYT13 mRNA sequences include those shown in SEQ ID NO: 1 (NM_020826.2) and SEQ ID NO: 2 (NM_001247987.1) (SEQ ID NOs: 1 and 2 show DNA sequences).

[0017] The term "antisense oligonucleotide" as used herein is used synonymously with the term "antisense nucleic acid" commonly used in the art, and refers to a single-stranded oligonucleotide containing a nucleic acid base sequence capable of hybridizing to (i.e., complementary to) a portion of the mRNA of the target gene SYT13. Without being bound by theory, in the present invention, the antisense oligonucleotide forms a DNA-RNA hybrid with the target RNA and degrades the target RNA by cleavage with RNase H, thereby suppressing the expression of the target gene. Generally, the region of the mRNA of the target gene to which the antisense oligonucleotide can hybridize may include the 3'UTR, 5'UTR, exon, intron, coding region, translation initiation region, translation termination region, or other nucleic acid region.

[0018] In the present invention, the antisense oligonucleotide is capable of suppressing the expression of human SYT13 mRNA. More specifically, the antisense oligonucleotide of the present invention consists of a nucleotide sequence substantially complementary to the nucleotide sequence of a specific region of human SYT13 mRNA. Although not particularly limited, when confirming the suppression of human SYT13 mRNA expression using a model animal transplanted with human cancer cells, it is preferable to use an antisense oligonucleotide consisting of a nucleotide sequence that is not complementary to the nucleotide sequence of the SYT13 mRNA of the animal (e.g., mouse) itself.

[0019] As used herein, "suppression" with respect to gene expression refers to reducing the amount (abundance) of mRNA produced by transcription of the gene. Suppression includes suppressing mRNA levels by 20% or more, 30% or more, or 40% or more, preferably 50% or more, and more preferably 80% or more, 90% or more, or 95% or more, compared to a control. Suppression of gene expression may be determined by any method known in the art, but particularly by PCR-based methods such as real-time PCR using cells, such as human or mouse cells.

[0020] As used herein, "nucleobase" or "base" refers to a heterocyclic moiety that is a base component of a nucleic acid and can pair with a base of another nucleic acid. As used herein, "nucleobase sequence" can refer to the sequence of consecutive nucleic acid bases, without taking into account the sugars, internucleoside linkages, or nucleobase modifications that make up the nucleic acid.

[0021] In one embodiment, the antisense oligonucleotide may comprise a sequence of 11 to 19 contiguous nucleic acid bases substantially complementary to the base sequence of human SYT13 mRNA, for example, the base sequence set forth in SEQ ID NO: 1 and / or SEQ ID NO: 2. The contiguous nucleic acid base sequence may be 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, or 19 bases, for example, 13, 15, 17, or 19 bases. The antisense oligonucleotide may consist of a sequence of 11 to 19 contiguous nucleic acid bases substantially complementary to the base sequence of human SYT13 mRNA, for example, the base sequence set forth in SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0022] Here, "substantially complementary" refers to a base sequence that is completely complementary to the target base sequence, as well as one that has one to several mismatches but can form complementary base pairs. That is, the antisense oligonucleotide may contain a nucleic acid base sequence in which one to several, for example, one, two, or three nucleic acid bases have been substituted, deleted, or inserted (particularly substituted) in a sequence of, for example, 11 to 19 consecutive bases that is complementary to the target base sequence.

[0023] In the present invention, the nucleic acid base sequence of the antisense oligonucleotide may have no mismatches, or 1 to 3, 1 to 2, or 1 mismatch with a portion of human SYT13 mRNA. The "portion" of mRNA refers to a target region in the mRNA to which the antisense oligonucleotide can hybridize by base pairing, and the target region may have the same base length as the antisense oligonucleotide. The term "mismatch" refers to the inability of the nucleic acid base of a first nucleic acid to base pair with the corresponding nucleic acid base of a second nucleic acid (non-complementary). In a preferred embodiment, the antisense oligonucleotide has a base sequence that is completely complementary to the base sequence shown in SEQ ID NO:1 and / or SEQ ID NO:2.

[0024] More specifically, the present invention relates to an antisense oligonucleotide capable of suppressing the expression of human SYT13 mRNA, which is an antisense oligonucleotide that inhibits the expression of human SYT13 mRNA at positions 348 to 366, 599 to 627, 997 to 1016, 1069 to 1088, 1419 to 1437, 1612 to 1641, 1775 to 1793, 2629 to 2647, 2810 to 2831, 3244 to 3262, 3315 to 3333, 3423 to 3442, 4266 to 4284, 43 The present invention provides an antisense oligonucleotide consisting of an 11-19 base sequence complementary to the base sequences of 28-4346, 4365-4400, 4714-4751, 4776-4795, and 4949-4968, or an antisense oligonucleotide consisting of a base sequence in which 1-3, 1-2, or 1 base has been substituted, deleted, or inserted relative to the antisense oligonucleotide.

[0025] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence 348-366 in the nucleotide sequence shown in SEQ ID NO: 1, or having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide, include antisense oligonucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 3, and antisense oligonucleotides consisting of a nucleotide sequence having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide. More specifically, examples include the antisense oligonucleotide shown in the Examples as hSYT13-350-AmNA(15).

[0026] Examples of antisense oligonucleotides consisting of an 11 to 19 base sequence complementary to the base sequence of positions 599 to 627 in the base sequence shown in SEQ ID NO: 1, or antisense oligonucleotides consisting of a base sequence in which 1 to 3 bases have been substituted, deleted or inserted relative to the antisense oligonucleotide, include antisense oligonucleotides consisting of the base sequence shown in any of SEQ ID NOs: 4 and 50 to 59, and antisense oligonucleotides consisting of a base sequence in which 1 to 3 bases have been substituted, deleted or inserted relative to the antisense oligonucleotide. More specifically, examples include the antisense oligonucleotides referred to in the Examples as hSYT13-605-AmNA(15), hSYT13-607-AmNA(13), hSYT13-609-AmNA(13), hSYT13-603-AmNA(15), hSYT13-607-AmNA(15), hSYT13-609-AmNA(15), hSYT13-601-AmNA(17), hSYT13-603-AmNA(17), hSYT13-605-AmNA(17), hSYT13-607-AmNA(17), or hSYT13-609-AmNA(17).

[0027] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence from 997 to 1016 in the nucleotide sequence shown in SEQ ID NO: 1, or having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide, include antisense oligonucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 5 or 6, and antisense oligonucleotides consisting of a nucleotide sequence having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide. More specific examples include the antisense oligonucleotides shown in the Examples as hSYT13-999-AmNA(15) and hSYT13-1000-AmNA(15).

[0028] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence from 1069 to 1088 in the nucleotide sequence shown in SEQ ID NO: 1, or having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide, include antisense oligonucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 7 or 8, and antisense oligonucleotides consisting of a nucleotide sequence having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide. More specific examples include the antisense oligonucleotides shown in the Examples as hSYT13-1071-AmNA(15) and hSYT13-1072-AmNA(15).

[0029] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence from 1419 to 1437 in the nucleotide sequence shown in SEQ ID NO: 1, or having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide, include an antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 9, or an antisense oligonucleotide having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide. More specifically, examples include the antisense oligonucleotide shown in the Examples as hSYT13-1421-AmNA(15).

[0030] Examples of antisense oligonucleotides consisting of an 11 to 19 base sequence complementary to the base sequence of 1612 to 1641 in the base sequence shown in SEQ ID NO: 1, or antisense oligonucleotides consisting of a base sequence in which 1 to 3 bases have been substituted, deleted or inserted relative to the antisense oligonucleotide, include antisense oligonucleotides consisting of the base sequence shown in any of SEQ ID NOs: 10 to 16, and antisense oligonucleotides consisting of a base sequence in which 1 to 3 bases have been substituted, deleted or inserted relative to the antisense oligonucleotide. More specifically, examples include the antisense oligonucleotides shown in the Examples as hSYT13-1614-AmNA(15), hSYT13-1617-AmNA(15), hSYT13-1618-AmNA(15), hSYT13-1619-AmNA(15), hSYT13-1622-AmNA(15), hSYT13-1623-AmNA(15), or hSYT13-1625-AmNA(15).

[0031] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence of positions 1775 to 1793 in the nucleotide sequence shown in SEQ ID NO: 1, or having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide, include the antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 17, and the antisense oligonucleotide having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide. More specifically, examples include the antisense oligonucleotide shown in the Examples as hSYT13-1777-AmNA(15).

[0032] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence at positions 2629 to 2647 in the nucleotide sequence shown in SEQ ID NO: 1, or having 1-3 nucleotide substitutions, deletions, or insertions relative to the antisense oligonucleotide, include the antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 18, and the antisense oligonucleotide having 1-3 nucleotide substitutions, deletions, or insertions relative to the antisense oligonucleotide. More specifically, examples include the antisense oligonucleotide shown in the Examples as hSYT13-2631-AmNA(15).

[0033] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence at positions 2810 to 2831 in the nucleotide sequence set forth in SEQ ID NO: 1, or having 1-3 nucleotide substitutions, deletions, or insertions relative to the antisense oligonucleotide, include antisense oligonucleotides consisting of the nucleotide sequence set forth in any of SEQ ID NOs: 19 to 22, and antisense oligonucleotides consisting of the nucleotide sequence set forth in SEQ ID NOs: 19 to 22. More specifically, examples of such antisense oligonucleotides include the antisense oligonucleotides shown in the Examples as hSYT13-2812-AmNA(15), hSYT13-2813-AmNA(15), hSYT13-2814-AmNA(15), and hSYT13-2815-AmNA(15).

[0034] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence from 3244 to 3262 in the nucleotide sequence shown in SEQ ID NO: 1, or having 1-3 nucleotide substitutions, deletions, or insertions relative to the antisense oligonucleotide, include the antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 23, and the antisense oligonucleotide having 1-3 nucleotide substitutions, deletions, or insertions relative to the antisense oligonucleotide. More specifically, examples include the antisense oligonucleotide shown in the Examples as hSYT13-3246-AmNA(15).

[0035] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence from 3315 to 3333 in the nucleotide sequence of SEQ ID NO: 1, or having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide, include an antisense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 24, or an antisense oligonucleotide having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide. More specifically, examples include the antisense oligonucleotide referred to in the Examples as hSYT13-3317-AmNA(15).

[0036] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence from 3423 to 3442 in the nucleotide sequence set forth in SEQ ID NO: 1, or having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide, include antisense oligonucleotides consisting of the nucleotide sequence set forth in SEQ ID NO: 25 or 26, and antisense oligonucleotides consisting of a nucleotide sequence having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide. More specific examples include the antisense oligonucleotides shown in the Examples as hSYT13-3425-AmNA(15) and hSYT13-3426-AmNA(15).

[0037] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence 4266-4284 of the nucleotide sequence shown in SEQ ID NO: 1, or having 1-3 nucleotide substitutions, deletions, or insertions relative to the antisense oligonucleotide, include the antisense oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 27, and the antisense oligonucleotide consisting of the nucleotide sequence having 1-3 nucleotide substitutions, deletions, or insertions relative to the antisense oligonucleotide. More specifically, examples include the antisense oligonucleotide shown in the Examples as hSYT13-4268-AmNA(15).

[0038] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence at positions 4328 to 4346 in the nucleotide sequence set forth in SEQ ID NO: 1, or having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide, include an antisense oligonucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 28, or an antisense oligonucleotide consisting of a nucleotide sequence having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide. More specifically, examples include the antisense oligonucleotide referred to in the Examples as hSYT13-4330-AmNA(15).

[0039] Examples of antisense oligonucleotides consisting of an 11 to 19 base sequence complementary to the base sequence of 4365 to 4400 in the base sequence shown in SEQ ID NO: 1, or antisense oligonucleotides consisting of a base sequence in which 1 to 3 bases have been substituted, deleted or inserted relative to the antisense oligonucleotide, include antisense oligonucleotides consisting of the base sequence shown in any of SEQ ID NOs: 29 to 36 and 60 to 69, and antisense oligonucleotides consisting of a base sequence in which 1 to 3 bases have been substituted, deleted or inserted relative to the antisense oligonucleotide. More specifically, for example, in the Examples, hSYT13-4367-AmNA(15), hSYT13-4368-AmNA(15), hSYT13-4371-AmNA(15), hSYT13-4373-AmNA(15), hSYT13-4374-AmNA(15), hSYT13-4377-AmNA(15), hSYT13-4378-AmNA(15), hSYT13-4381-AmNA(15), hSYT13-4374-AmNA(13), hSYT13 -4376-AmNA(15), hSYT13-4380-AmNA(15), hSYT13-4382-AmNA(15), hSYT13-4374-AmNA(17), hSYT13-4376-AmNA(17), hSYT13-4378-AmNA(17), hSYT13-4380-AmNA(17), hSYT13-4382-AmNA(17), or hSYT13-4374-AmNA(19).

[0040] Examples of antisense oligonucleotides consisting of an 11 to 19 base sequence complementary to the base sequence of 4714 to 4751 in the base sequence shown in SEQ ID NO: 1, or antisense oligonucleotides consisting of a base sequence in which 1 to 3 bases have been substituted, deleted or inserted relative to the antisense oligonucleotide, include antisense oligonucleotides consisting of the base sequence shown in any of SEQ ID NOs: 37 to 39 and 70 to 79, and antisense oligonucleotides consisting of a base sequence in which 1 to 3 bases have been substituted, deleted or inserted relative to the antisense oligonucleotide. More specifically, for example, in the Examples, hSYT13-4716-AmNA(15), hSYT13-4717-AmNA(15), hSYT13-4729-AmNA(15), hSYT13-4725-AmNA(13), hSYT13-4727-AmNA(13), hSYT13-4725-AmNA(15), hSYT13-4727-AmNA( Examples of such antisense oligonucleotides include those designated as 4733-A, 4733-B, 4733-C, 4733-D, 4733-E, 4733-F, 4733-G, 4733-H, 4733-I, 4733-J, 4733-K, 4733-L, 4733-M, and 4733-N in the Examples.

[0041] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence at positions 4776 to 4795 in the nucleotide sequence set forth in SEQ ID NO: 1, or having 1-3 nucleotide substitutions, deletions, or insertions relative to the antisense oligonucleotide, include antisense oligonucleotides consisting of the nucleotide sequence set forth in SEQ ID NO: 40 or 41, and antisense oligonucleotides consisting of a nucleotide sequence having 1-3 nucleotide substitutions, deletions, or insertions relative to the antisense oligonucleotide. More specific examples include the antisense oligonucleotides shown in the Examples as hSYT13-4778-AmNA(15) and hSYT13-4779-AmNA(15).

[0042] Examples of antisense oligonucleotides consisting of an 11-19 nucleotide sequence complementary to the nucleotide sequence at positions 4949 to 4968 in the nucleotide sequence set forth in SEQ ID NO: 1, or having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide, include antisense oligonucleotides consisting of the nucleotide sequence set forth in SEQ ID NO: 42 or 43, and antisense oligonucleotides consisting of a nucleotide sequence having 1-3 nucleotides substituted, deleted, or inserted relative to the antisense oligonucleotide. More specific examples include the antisense oligonucleotides shown in the Examples as hSYT13-4951-AmNA(15) and hSYT13-4952-AmNA(15).

[0043] In a preferred embodiment, the base sequence of the antisense oligonucleotide may be a base sequence selected from the group consisting of SEQ ID NOs: 3 to 43, or a base sequence in which 1 to 3 bases have been substituted, deleted, or inserted relative to the base sequence. More specifically, in this embodiment, the antisense oligonucleotide is preferably one shown in Table 1 below.

[0044] In another preferred embodiment, the base sequence of the antisense oligonucleotide may be a base sequence selected from the group consisting of SEQ ID NOs: 50 to 59, or a base sequence in which 1 to 3 bases have been substituted, deleted, or inserted relative to the base sequence. More specifically, in this embodiment, the antisense oligonucleotide is preferably one shown in Table 2 below.

[0045] In another preferred embodiment, the base sequence of the antisense oligonucleotide may be a base sequence selected from the group consisting of SEQ ID NOs: 60 to 69, or a base sequence in which 1 to 3 bases have been substituted, deleted, or inserted relative to the base sequence. More specifically, in this embodiment, the antisense oligonucleotide is preferably one shown in Table 3 below.

[0046] In another preferred embodiment, the base sequence of the antisense oligonucleotide may be a base sequence selected from the group consisting of SEQ ID NOs: 70 to 79, or a base sequence in which 1 to 3 bases have been substituted, deleted, or inserted relative to the base sequence. More specifically, in this embodiment, the antisense oligonucleotide is preferably one shown in Table 4 below.

[0047] In another preferred embodiment, the base sequence of the antisense oligonucleotide may be a base sequence selected from the group consisting of SEQ ID NOs: 4, 20, 29, 35, 39, 62, and 79, or a base sequence in which 1 to 3 bases have been substituted, deleted, or inserted relative to the base sequence.

[0048] In another preferred embodiment, the base sequence of the antisense oligonucleotide may be a base sequence selected from the group consisting of SEQ ID NOs: 80 to 93, or a base sequence in which 1 to 3 bases have been substituted, deleted, or inserted relative to the base sequence. More specifically, in this embodiment, the antisense oligonucleotide is preferably one shown in Table 5 below.

[0049] Sequence homology can be analyzed using algorithms known in the art, for example, by BLAST analysis (see, for example, Altschul, SF, et al., Basic local alignment search tool. 1990, J. Mol. Biol. 215: 403-410).

[0050] The antisense oligonucleotide of the present invention may be in the range of 11 to 20 bases in length, for example, 12 to 19 bases in length, 14 to 18 bases in length, or 15 to 17 bases in length.

[0051] In the present invention, antisense oligonucleotides may contain natural (unmodified) nucleotides (deoxyribonucleotides, ribonucleotides, or both) and / or non-natural (modified) nucleotides.

[0052] Generally, a "nucleoside" is a combination of a sugar and a nucleobase. A "nucleotide" further comprises a phosphate group covalently attached to the sugar portion of the nucleoside. The phosphate group generally forms the internucleoside linkage of an oligonucleotide. An oligonucleotide is formed by the covalent linkage of adjacent nucleosides to one another to form a linear polymeric oligonucleotide.

[0053] As used herein, a "modified nucleoside" refers to a nucleoside having, independently, a modified sugar and / or a modified nucleobase. A "modified nucleotide" refers to a nucleotide having, independently, a modified internucleoside linkage, a modified sugar, and / or a modified nucleobase. Oligonucleotides containing modified nucleotides are preferred over unmodified forms due to desirable properties such as enhanced affinity for target nucleic acids and increased nuclease resistance.

[0054] As used herein, "modified internucleoside linkage" refers to an internucleoside linkage that is substituted or otherwise altered from a naturally occurring internucleoside linkage (i.e., a phosphodiester linkage). Modified internucleoside linkages include, but are not limited to, phosphorothioate linkages, phosphorodithioate linkages, phosphorodiamidate linkages, and phosphoramidate linkages. A phosphorothioate linkage refers to an internucleoside linkage in which the non-bridging oxygen atom of a phosphodiester bond is replaced with a sulfur atom. Preferably, the modified internucleoside linkage is more nuclease-resistant than a naturally occurring internucleoside linkage.

[0055] As used herein, "modified nucleobase" refers to any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. "Unmodified nucleobase" or "natural nucleobase" refers to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Examples of modified nucleobases include, but are not limited to, 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, or 5-iodocytosine; 5-fluorouracil, 5-bromouracil, 5-iodouracil, or 5-hydroxyuracil; 2-thiothymine; N6-methyladenine or 8-bromoadenine; and N2-methylguanine or 8-bromoguanine.

[0056] As used herein, the term "modified sugar" refers to a sugar that has a substitution or some other alteration from a natural sugar moiety (i.e., a sugar moiety found in DNA (2'-H) or RNA (2'-OH)). Modified sugars may confer upon an oligonucleotide enhanced affinity for a target nucleic acid, increased nuclease resistance, and the like. Examples of modified sugars include, for example, bicyclic sugars, 5'-vinyl, 5'-methyl, 4'-S, 2'-F, 2'-OCH3 (2'-methoxy or 2'-O-methyl groups), and 2'-O(CH2)2OCH3 substituents.

[0057] As used herein, the term "bicyclic sugar" refers to a sugar having two rings. Nucleic acids containing bicyclic sugar moieties are commonly referred to as bridged nucleic acids (BNAs). A bicyclic sugar may be a sugar in which the 2'- and 4'-carbon atoms are bridged by two or more atoms. Examples of bicyclic sugars include, but are not limited to, sugars with methyleneoxy (4'-CH2-O-2') bridges (LNA™, also known as 2',4'-BNA), sugars with ethyleneoxy (4'-(CH2)2-O-2') bridges (also known as ENA), sugars with 4'-CH(CH3)-O-2' bridges (cEt, constrained ethyl), sugars with 4'-CH(CHOCH3)-O-2' bridges (cMOE, constrained MOE), and sugars with amide bridges (AmNA, Amido-bridged nucleic acid).

[0058] An example of a sugar having an amide bridge is a sugar having a 4'-C(O)-N(CH3)-2' bridge. For the structure and preparation method of a sugar having an amide bridge, see, for example, Yahara, A., et al., Amido-bridged nucleic acids (AmNAs): synthesis, duplex stability, nuclease resistance, and in vitro antisense potency, ChemBioChem, 2012, 13(7): 2513-2516; Yamamoto, T., et al., Amido-bridged nucleic acids with small hydrophobic residues enhance hepatic tropism of antisense oligonucleotides in vivo, Org. Biomol. Chem., 2015, 13: 3757-3765; and International Publication No. WO2011 / 052436. For sugars with a 4'-CH(CH3)-O-2' bridge (cEt) and sugars with a 4'-CH(CHOCH3)-O-2' bridge (cMOE), see Punit, PS, et al., Short antisense oligonucleotides with novel 2'-4' conformationally restricted nucleoside analogues show improved potency without increased toxicity in animals, J. Med. Chem., 2009, 52(1): 10-13. Antisense oligonucleotides may also comprise nucleotide mimetics such as peptide nucleic acids and morpholino nucleic acids.

[0059] Generally, different nucleotides in the same strand can be independently modified. Also, for example, to enhance nuclease resistance, the same nucleotide can have a modified internucleoside linkage (e.g., phosphorothioate linkage) and a modified sugar (e.g., bicyclic sugar). The same nucleotide can also have a modified nucleobase (e.g., 5-methylcytosine) and a modified sugar (e.g., bicyclic sugar).

[0060] In one embodiment, the antisense oligonucleotide may comprise at least one modified nucleotide, which may comprise a modified internucleoside linkage, a modified sugar moiety, and / or a modified nucleobase.

[0061] In one embodiment, at least one internucleoside linkage of the antisense oligonucleotide may be a modified internucleoside linkage. At least 70%, at least 80%, at least 90%, or 100% of the internucleoside linkages of the antisense oligonucleotide may be modified internucleoside linkages. The modified internucleoside linkages may be phosphorothioate linkages.

[0062] In one embodiment, at least one sugar moiety of the antisense oligonucleotide may be a bicyclic sugar. The bicyclic sugar may have a methyleneoxy (4'-CH2-O-2') bridge or an amide bridge (e.g., a 4'-C(O)-N(CH3)-2' bridge). In the present invention, antisense oligonucleotides having an amide bridge may be preferably used.

[0063] In one embodiment, at least one of the nucleobases of the antisense oligonucleotide may be a modified nucleobase. The modified nucleobase may be 5-methylcytosine.

[0064] In certain embodiments, the antisense oligonucleotide may be a gapmer. As used herein, the term "gapmer" refers to an oligonucleotide consisting of a central region (DNA gap region) containing at least four consecutive deoxyribonucleosides, and regions (5' wing region and 3' wing region) containing unnatural nucleosides located on the 5'- and 3'-terminal sides of the central region. The length of the DNA gap region may be 4 to 16 bases, 5 to 14 bases, 6 to 12 bases, or 8 to 10 bases. The lengths of the 5' wing region and the 3' wing region may independently be 1 to 6 bases, 1 to 5 bases, or 2 to 4 bases. The 5' wing region and the 3' wing region may contain at least one unnatural nucleoside, and may also contain natural nucleosides. The 5' wing region and the 3' wing region may each contain one or more types of unnatural nucleosides. All nucleosides in the 5' and 3' wing regions may be unnatural nucleosides. Alternatively, the nucleosides at one or both of the 5' and 3' ends of the gapmer (particularly the 3' end) may be natural nucleosides (particularly deoxyribonucleosides). The unnatural nucleosides contained in the 5' and 3' wing regions may be nucleosides having a bicyclic sugar. The bicyclic sugar may be a sugar having a methyleneoxy (4'-CH2-O-2') bridge or an amide bridge (e.g., a 4'-C(O)-N(CH3)-2' bridge). The unnatural nucleosides contained in the 5' and 3' wing regions may contain modified nucleobases (e.g., 5-methylcytosine).

[0065] In a preferred embodiment, the antisense oligonucleotide is a gapmer, as used in the Examples described below. An example of the structure of an antisense oligonucleotide that can be suitably used in the present invention is shown in Figure 1, but suitable gapmer structures are not limited to this and may have different modification patterns of sugars, nucleobases, and / or internucleoside linkages.

[0066] The antisense oligonucleotide of the present invention can be produced by methods known in the art.For example, antisense oligonucleotide can be synthesized using a commercially available automated nucleic acid synthesizer, and then purified using a reversed-phase column or the like.Alternatively, antisense oligonucleotide can be ordered and obtained from a manufacturer (for example, Gene Design Co., Ltd.) by specifying the nucleic acid base sequence and the modification site and type.

[0067] The antisense oligonucleotide of the present invention can be used as a pharmaceutical agent for suppressing peritoneal dissemination and metastasis of gastric cancer by suppressing the expression of the human SYT13 gene.

[0068] The antisense oligonucleotides of the present invention can inhibit the proliferation, migration, and / or invasion of cancer cells expressing SYT13 in vitro or in vivo. Delivery of antisense oligonucleotides into cells can be performed using any method commonly used in the art, such as lipofection, electroporation, microinjection, particle gun technology, and transduction using viruses or plasmids as vectors. Alternatively, antisense oligonucleotides can be directly transfected into cells. For example, antisense oligonucleotides can be suitably delivered into cells in vitro and in vivo using the CEM method (Nucleic Acids Research, 2015, Vol. 43, No. 19, e128; doi: 10.1093 / nar / gkv626).

[0069] The antisense oligonucleotide of the present invention can be used as a pharmaceutical agent for suppressing peritoneal dissemination of gastric cancer by suppressing the expression of the human SYT13 gene. The effects of the present invention are demonstrated by the following examples.

[0070] (conjugate) The present invention also provides a conjugate comprising the above antisense oligonucleotide and a further functional moiety linked directly or indirectly to it.

[0071] Additional functional moieties contemplated in the present invention may be small molecules such as peptides, sugars, lipids, etc., and may be, for example, but not limited to, targeting molecules or drugs with antitumor activity. More specifically, functional molecules may be binding molecules such as antibodies or antigen-binding fragments thereof against proteins that may be highly expressed at tumor sites, GalNAc that can bind to glycoprotein receptors, lipids such as cholesterol or long-chain fatty acids that can increase cell membrane permeability, etc. Alternatively, functional molecules may be, for example, other drugs with antitumor activity.

[0072] The antisense oligonucleotide and the additional functional moiety may be directly bonded or may be bonded via a linker commonly used in the art. The bond is preferably, but not limited to, a covalent bond. Administration as a conjugate can promote delivery of the antisense oligonucleotide of the present invention to the target site and / or improve the effect of the antisense oligonucleotide of the present invention.

[0073] (Pharmaceutical composition) The present invention provides a pharmaceutical composition comprising the antisense oligonucleotide or conjugate of the present invention. The pharmaceutical composition of the present invention can be used, for example, to prevent or treat peritoneal dissemination after gastric cancer resection.

[0074] The pharmaceutical composition may further contain any formulation auxiliary commonly used in the field of formulation. As used herein, the formulation auxiliary can be any of a variety of pharmaceutically acceptable carriers or additives, such as carriers (solid or liquid carriers), excipients, stabilizers, disintegrants, surfactants, binders, lubricants, emulsifiers, suspending agents, antioxidants, flavoring agents, fillers, solubilizing agents, coating agents, coloring agents, flavoring agents, preservatives, and buffers. Specific examples of the formulation auxiliary include water, saline, other aqueous solvents, pharmaceutically acceptable organic solvents, mannitol, lactose, starch, microcrystalline cellulose, glucose, calcium, polyvinyl alcohol, collagen, polyvinylpyrrolidone, carboxyvinyl polymers, sodium alginate, water-soluble dextran, water-soluble dextrin, sodium carboxymethyl starch, pectin, gum arabic, xanthan gum, casein, gelatin, agar, propylene glycol, polyethylene glycol, petrolatum, paraffin, glycerin, stearyl alcohol, stearic acid, and sorbitol. The formulation adjuvants may be selected appropriately or in combination depending on the dosage form of the formulation.

[0075] The pharmaceutical composition can be administered to a subject orally or parenterally. Parenteral administration includes, but is not limited to, intraperitoneal administration. To achieve an efficient therapeutic effect, the pharmaceutical composition is preferably administered locally and directly to the injured area. Alternatively, the pharmaceutical composition can be continuously administered to the injured area using a continuous infusion pump. The pharmaceutical composition may be formulated as an injection, an intravenous drip, or the like. Those skilled in the art can prepare these formulations using conventional methods.

[0076] The pharmaceutical composition may be administered in a therapeutically effective amount. The specific dosage of the pharmaceutical composition is determined for each individual subject based on the severity of the disease, general health, age, sex, body weight, and tolerance to treatment, for example, by the physician's judgment. For example, the pharmaceutical composition may be administered in an amount such that the antisense oligonucleotide is administered at 0.000001 mg / kg body weight / day to 1000 mg / kg body weight / day, or 0.001 mg / kg body weight / day to 1 mg / kg body weight / day, or 0.005 mg / kg body weight / day to 0.5 mg / kg body weight / day, or 0.01 mg / kg body weight / day to 0.1 mg / kg body weight / day. The pharmaceutical composition may be administered in a single dose or multiple doses. For example, the pharmaceutical composition may be administered to a subject several times or several tens of times at regular intervals, for example, at intervals of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, or 1 month. Alternatively, the pharmaceutical composition may be administered continuously using a continuous infusion pump as described above. The dosage (rate), duration, etc. of continuous administration can be appropriately determined by those skilled in the art.

[0077] The subject to which the pharmaceutical composition is administered is a mammal, such as a primate (e.g., cynomolgus monkey, chimpanzee, and human) or a non-primate (e.g., cow, pig, sheep, horse, cat, dog, guinea pig, rat, and mouse), more preferably a human. The subject may be, for example, a gastric cancer model animal transplanted with human gastric cancer cells.

[0078] The present invention also provides a method for preventing or treating peritoneal dissemination after gastric cancer resection, comprising administering to a subject in need thereof an antisense oligonucleotide, conjugate, or pharmaceutical composition of the present invention. The present invention also provides use of the antisense oligonucleotide or conjugate of the present invention in the manufacture of a medicament for preventing or treating peritoneal dissemination after resection of gastric cancer. [Example]

[0079] The present invention will be described in more detail below using examples, although the technical scope of the present invention is not limited to these examples.

[0080] Example 1: Selection of candidate antisense oligonucleotide sequences As target regions for antisense oligonucleotides, regions sharing a common sequence were extracted from the mRNA sequences of two SYT13 variants, NM_020826.2 (SEQ ID NO: 1) and NM_001247987.1 (SEQ ID NO: 2). At this point, several thousand target sequence candidates were obtained.

[0081] Next, the homology with mouse SYT13 mRNA was confirmed using BLAST, and several hundred candidate sequences were selected by predicting the higher-order structure of the resulting antisense oligonucleotides and excluding sequences that were thought to have a high risk of toxicity.

[0082] The antisense strand sequences were obtained from the selected sequences, and the candidate sequences were further narrowed down based on their physical properties as antisense oligonucleotides. After excluding sequences with a high risk of off-target effects, 41 candidate sequences were selected. Antisense oligonucleotide molecules were then designed and synthesized based on these sequences.

[0083] The structure of the antisense oligonucleotide used in this example is shown in Figure 1. For example, when designing a 15-mer antisense oligonucleotide, three artificial nucleic acid regions were placed on the 5' side and two on the 3' side, with a natural nucleic acid region between them. In this example, the artificial nucleic acid used was an amide-bridged nucleic acid (AmNA) with the following sugar structure (A. Yahara et al., ChemBioChem, 2012, 13, 2513-2516; T. Yamamoto et al., Org. Biomol. Chem., 2015, 13, 3757-3765).

[0084] [ka]

[0085] In the above structure, "Base" refers to a base, and therefore adenine, cytosine, guanine, and thymine, but may contain modified bases such as 5-methylcytosine in the artificial nucleic acid region.

[0086] In Figure 1, the black circles in the artificial nucleic acid region indicate that AmNA is used as the sugar instead of the deoxyribose found in natural nucleic acids, while the white circles in the natural nucleic acid region indicate that deoxyribose is used. It was confirmed that the introduction of AmNA to both ends of the antisense oligonucleotide molecule can improve affinity with the target mRNA. Furthermore, in this example, 5-methylcytosine was used as the base in the artificial nucleic acid region instead of the cytosine found in natural nucleic acids.

[0087] Furthermore, the antisense oligonucleotide used in this example had phosphorothioate bonds instead of the phosphodiester bonds found in natural nucleic acids, thereby improving enzyme resistance.

[0088] Table 1 below shows the sequence information of antisense oligonucleotides designed based on the candidate sequences selected above, as well as control antisense oligonucleotides (NEG1 and NEG2) designed so as not to bind to any known genes. For example, "hSYT13-350-AmNA(15)" in Table 1 has a sequence complementary to 15 consecutive bases starting from the 350th base in SEQ ID NO: 1, which is the base sequence of human SYT13 mRNA. In Table 1, underlines indicate mismatched bases with respect to mouse SYT13 mRNA.

[0089] [Table 1] TIFF0007732637000003.tif182119The antisense oligonucleotides were synthesized according to methods commonly used in the art.

[0090] Example 2 Screening based on the effect of suppressing SYT13 mRNA expression The human gastric cancer cell line KATOIII (obtained from the American Type Culture Collection, ATCC) derived from a signet ring cell carcinoma was cultured at 37°C under 5% CO2 in a 1:1 mixture of RPMI1640 (Nacalai Tesque, Inc.) and DMEM (Nacalai Tesque, Inc., Low-Glucose) supplemented with 10% fetal bovine serum (FBS, BioWest) and 1% penicillin-streptomycin solution (Nacalai Tesque, Inc., Stabilized). The cells were seeded at a density of 10,000 cells / 100 μL per well into a 96-well plate containing 10% FBS-containing DMEM and cultured at 37°C under 5% CO2 for 24 hours.

[0091] The cells were transfected by the CEM method. Specifically, 900 mM calcium chloride was added to 10% FBS-containing DMEM to achieve a 100-fold dilution, and the antisense oligonucleotides synthesized in Example 1 were added to final concentrations of 6.25 nM, 25 nM, or 100 nM, followed by further incubation at 37°C under 5% CO for 24 hours.

[0092] From the transfected cells, the following was lysed using the Cell Lysis & RT Kit (TOYOBO Super Prep TM RNA was extracted using a Cell Lysis & RT Kit for qPCR and reverse transcribed into cDNA.

[0093] The obtained cDNA was analyzed using ABI PowerUp TM Real-time PCR (RT-PCR) was performed using SYBR® Green Master Mix and the following primers (200 nM each): TM The PCR was carried out using a Real-Time PCR System under the following conditions: 95°C for 30 seconds, followed by 45 cycles of 95°C for 3 seconds and 60°C for 30 seconds.

[0094] GAPDH forward primer: CGACAGTCAGCCGCATCTT (SEQ ID NO: 46) GAPDH reverse primer: CCCAATACGACCAAATCCGTTG (SEQ ID NO: 47) SYT13 forward primer: TGGTGGTGCTGATTAAAGCC (SEQ ID NO: 48) SYT13 reverse primer: TGCTTCTTCTTCAGCTTCCG (SEQ ID NO: 49)

[0095] The relative expression level of SYT13 mRNA was calculated from the measured values ​​of the expression levels of SYT13 mRNA and GAPDH mRNA (control). Some of the results are shown in Figure 2. As shown in FIG. 2, it was demonstrated that the tested antisense oligonucleotides suppressed the expression of SYT13 mRNA in a concentration-dependent manner.

[0096] [Example 3: Demonstration of concentration-dependent expression suppression in various cells] The effects of the antisense oligonucleotides synthesized in Example 1 were examined using human gastric cancer cell lines MKN1, MKN45, and OCUM-1 (obtained from the JCRB Cell Bank of the National Institutes of Biomedical Innovation, Health and Nutrition). Procedures for cell culture and other operations were essentially the same as those in Example 2, although procedures appropriate for each cell type were used as appropriate.

[0097] MKN1 cells were cultured at 37°C under 5% CO2 in RPMI1640 (Nacalai Tesque, Inc.) supplemented with 10% FBS (biowest) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque, Inc., Stabilized). MKN1 cells were seeded at a concentration of 8,000 cells / 100 μL per well into a 96-well plate containing 10% FBS-containing DMEM and cultured at 37°C under 5% CO2 for 24 hours. The antisense oligonucleotides synthesized in Example 1 were then added to the wells to a final concentration of 6.25 nM, 25 nM, or 100 nM, followed by further culture at 37°C under 5% CO2 for 24 hours. RNA was extracted from the transfected cells using a Cell Lysis & RT Kit (TOYOBO Super Prep). TM RNA was extracted using a Cell Lysis & RT Kit for qPCR and reverse transcribed into cDNA.

[0098] MKN45 cells were cultured in RPMI 1640 (Nacalai Tesque, Inc.) supplemented with 10% FBS (biowest) and 1% penicillin-streptomycin solution (Nacalai Tesque, Inc., Stabilized) at 37°C under 5% CO2. The cells were seeded at 30,000 cells / 500 μL per well into a 24-well plate containing DMEM containing 10% FBS. After 24 hours of culture at 37°C under 5% CO2, the antisense oligonucleotides synthesized in Example 1 were added to a final concentration of 50 nM or 200 nM. The cells were then cultured for an additional 24 hours at 37°C under 5% CO2. RNA was extracted from the transfected cells using the QIAGEN Rneasy® Mini Kit (QIAGEN®) and reverse transcribed to cDNA using the ABI High-Capacity cDNA Reverse Transcription Kit.

[0099] OCUM-1 cells were cultured in DMEM (Nacalai Tesque, Low-Glucose) supplemented with 10% FBS (biowest), 1% penicillin-streptomycin mixture (Nacalai Tesque, Stabilized), and 0.5 mM sodium pyruvate at 37°C under 5% CO2. OCUM-1 cells were seeded at a concentration of 7,500 cells / 100 μL per well into a 96-well plate containing 10% FBS-containing DMEM and cultured at 37°C under 5% CO2 for 24 hours. The antisense oligonucleotides synthesized in Example 1 were then added to the wells to a final concentration of 50 nM, 100 nM, or 200 nM, and the wells were cultured at 37°C under 5% CO2 for an additional 24 hours. RNA was extracted from the transfected cells using a Cell Lysis & RT Kit (TOYOBO Super Prep). TM RNA was extracted using Cell Lysis & RT Kit for qPCR and reverse transcribed into cDNA. As a result, as shown in FIGS. 3 to 6, it was demonstrated that the antisense oligonucleotide of the present invention inhibited expression in a concentration-dependent manner in all cell lines.

[0100] [Example 4: Study 1 on the optimization of antisense oligonucleotides] For each of the three antisense oligonucleotides hSYT13-605-AmNA(15), hSYT113-4378-AmNA(15), and hSYT13-4729-AmNA(15), which were confirmed to have particularly favorable effects in the screening test of Example 2, ten antisense oligonucleotides were designed and synthesized, varying the length and position of the natural nucleic acid region while fixing the number of artificial nucleic acids introduced. Table 2 below shows the sequence information for antisense oligonucleotides designed for optimization studies using hSYT13-605-AmNA(15) as the parent sequence. Table 3 shows the sequence information for antisense oligonucleotides designed for optimization studies using hSYT113-4378-AmNA(15) as the parent sequence. Table 4 shows the sequence information for antisense oligonucleotides designed for optimization studies using hSYT13-4729-AmNA(15) as the parent sequence.

[0101] [Table 2]

[0102] [Table 3]

[0103] [Table 4]

[0104] [Example 5] Inhibitory effect of SYT13 mRNA expression in cancer cells The antisense oligonucleotides synthesized in Example 4 were examined for their inhibitory effect on SYT13 expression in OCUM-1, MKN1, and NUGC-4 in the same manner as in Example 3. In this example, the final concentration of the antisense oligonucleotides was set to 100 nM or 400 nM. The procedure for OCUM-1 and MKN1 cells was the same as in Example 3.

[0105] NUGC-4 cells were cultured in RPMI1640 (Nacalai Tesque, Inc.) supplemented with 10% FBS (biowest) and 1% penicillin-streptomycin mixture (Nacalai Tesque, Inc., Stabilized) at 37°C under 5% CO2. NUGC-4 cells were seeded at a density of 8,000 cells / 100 μL per well into a 96-well plate containing DMEM containing 10% FBS and cultured at 37°C under 5% CO2 for 24 hours. RNA was extracted from the transfected cells using a Cell Lysis & RT Kit (TOYOBO Super Prep). TM RNA was extracted using a Cell Lysis & RT Kit for qPCR and reverse transcribed into cDNA.

[0106] As a result, as shown in Figures 7 to 9, among the antisense oligonucleotides designed for optimization using hSYT13-4729-AmNA(15) and hSYT113-4378-AmNA(15) as parent sequences, some were found to have higher SYT13 mRNA expression inhibitory activity than the parent sequences.

[0107] [Example 6: Inhibitory effect on proliferation ability 1] The sequence information of hSYT13-605-AmNA(15), hSYT13-2813-AmNA(15), hSYT13-4367-AmNA(15), hSYT13-4378-AmNA(15), and hSYT13-4729-AmNA(15) was shown in Table 1. These sequences were confirmed to have a high inhibitory effect on SYT13 mRNA expression in Example 2. The inhibitory effect on the in vitro proliferation ability of cancer cells was examined.

[0108] MKN1 / Luc, NUGC4, AGS, N87, and GSU cells were seeded at 3,000 cells / well, and KATO3 and OCUM1 cells at 5,000 cells / well in 96-well plates. Antisense oligonucleotides were transfected at a final concentration of 400 nM (MKN1 / Luc, NUGC4) or 100 nM (AGS, N87, GSU, KATO3, and OCUM1) by the CEM method and then cultured. Cell numbers were counted using Cell Counting Kit-8 (Dojindo Molecular Technologies, Inc.) on days 0, 1, 3, and 5, and the fold change relative to the initial cell number was calculated. Eight wells were measured for each sample, and the mean and standard deviation were calculated.

[0109] As a result, as shown in Figures 10A to 10G, although variations in results were observed depending on the cell line used, it was shown that the above five antisense oligonucleotides can have a significant inhibitory effect on the proliferation of human gastric cancer cell lines.

[0110] [Reference example: Growth suppression effect of siRNA] Accell SYT13 siRNA (Dharmacon) was used as an siRNA capable of targeting human SYT13 mRNA. MKN1 and NUGC4 cell lines were transfected at 400 nM at 50,000 cells / mL by the CEM method, as in Example 6, and the effect on the proliferation ability of these cell lines was examined. As a control, siRNA designed not to bind to any known genes (Accell Green Non-targeting, Dharmacon) was used for comparison.

[0111] As a result, as shown in FIGS. 11A and 11B, when 400 nM of siRNA was used on both the MKN1 and NUGC4 cell lines, no significant growth inhibitory effect was obtained compared to the control.

[0112] [Example 7 Inhibitory effect on migration ability 1] The inhibitory effect of the antisense oligonucleotides of the present invention on the migration ability of gastric cancer cell lines in vitro was examined using ibidi culture inserts (ibidi GmbH, Martinsried, Germany).

[0113] MKN1 / Luc cells (3 × 10 4 pcs / well), N87(30×10 4 pcs / well), NUGC4(3.5×10 4 The inhibitory effect of cell migration into gaps where no cells were present was confirmed using the antisense oligonucleotides of the present invention, hSYT13-605-AmNA(15), hSYT13-2813-AmNA(15), hSYT13-4367-AmNA(15), hSYT13-4378-AmNA(15), and hSYT13-4729-AmNA(15), or a control antisense oligonucleotide (NEG1).

[0114] As a result, as shown in Figures 12A to 12C, although the results varied depending on the cell line used, it was shown that the above five antisense oligonucleotides can have a significant inhibitory effect on the migration of human gastric cancer cell lines.

[0115] [Example 8: Inhibitory effect on invasive ability 1] The inhibitory effect of the antisense oligonucleotide of the present invention on the in vitro invasive ability of gastric cancer cell lines was examined using a BioCoat Matrigel Invasion Chamber (BD Biosciences, Bedford, MA, USA).

[0116] MKN1 / Luc cells (2.5 × 10 4 cells / well), AGS (5 × 10 4 pcs / well), GSU(5×10 4 The number of invaded cells in the chambers was compared using 150 cells / well of AmNA-1 cells per well, as well as using any of the antisense oligonucleotides of the present invention, hSYT13-605-AmNA(15), hSYT13-2813-AmNA(15), hSYT13-4367-AmNA(15), hSYT13-4378-AmNA(15), and hSYT13-4729-AmNA(15), or a control antisense oligonucleotide (NEG1).

[0117] As a result, as shown in Figures 13A to 13C, although the results varied depending on the cell line used, it was shown that the above five antisense oligonucleotides can have a significant inhibitory effect on the invasion of human gastric cancer cell lines.

[0118] [Example 9 In vivo test 1] Using a method similar to that described in WO 2016 / 143697, 1 × 10 MKN1-luc cells or NUGC4 cells, into which the luciferase gene had been introduced, were introduced into immunodeficient mice (10-week-old male BALBc-nu / nu). 6A peritoneal dissemination model was prepared by intraperitoneally administering 1 ml of each cell / ml, and the in vivo effect of the antisense oligonucleotide of the present invention was confirmed.

[0119] After cancer cell transplantation, 0.2 mg of hSYT13-4729(15) or hSYT13-4378(15) (both molecular weights approximately 5000) was administered twice weekly in 500 μL of 5% glucose solution for 6 weeks (equivalent to 10 mg / kg of mouse body weight, assuming a 20 g mouse body weight) (Figure 14A). As a control, 0.2 mg of a control antisense oligonucleotide (NEG1, SEQ ID NO: 44) or Accell SYT13 siRNA (Dharmacon) used in the Reference Example above was administered for 6 weeks (equivalent to 10 mg / kg of mouse body weight, assuming a 20 g mouse body weight) for 6 weeks.

[0120] Mice transplanted with MKN1-luc cells were subjected to in vivo imaging using an In Vivo Imaging System (IVIS®) Lumina (Xenogen, Alameda, California, USA). Specifically, 2, 4, or 6 weeks after cell transplantation, D-luciferin (150 mg / kg) (Summit Pharmaceuticals International, Tokyo, Japan) was intraperitoneally administered to the mice. Images were taken 15 minutes later using the IVIS® system, and signal intensity was measured using Living Image® version 2.6 software (Xenogen). Luminescence, indicating peritoneal dissemination-like cell engraftment, was observed in mice not administered with antisense oligonucleotides and in mice administered with control antisense oligonucleotides or siRNA. However, luminescence was either undetectable or significantly reduced in mice administered with the antisense oligonucleotides of the present invention (data not shown).

[0121] Six weeks after cancer cell transplantation, some mice were sacrificed and the total weight of peritoneal dissemination was compared for each group of mice. The results are shown in Figures 14B and 14C. Compared with mice not administered with antisense oligonucleotides, mice administered with control antisense oligonucleotides, and mice administered with siRNA, mice administered with the antisense oligonucleotides of the present invention (hSYT13-4729(15) and hSYT13-4378(15)) had significantly lower total weight of peritoneal dissemination, demonstrating that peritoneal dissemination can be effectively suppressed.

[0122] [Example 10: Inhibitory effect on proliferation ability 2] In addition to hSYT13-4378(15) and hSYT13-4729(15), four antisense oligonucleotides, hSYT13-4380(17) and hSYT13-4733(17) (sequence information is shown in Tables 3 and 4, respectively), which showed favorable activity in Example 5, were used to examine their inhibitory effects on the in vitro proliferation ability of MKN1 cells or NUGC4 cells, as in Example 6.

[0123] As a result, as shown in Figures 15A and 15B, under the conditions tested, hSYT13-4378(15), hSYT13-4729(15), and hSYT13-4380(17) showed significant growth inhibitory effects compared to the group without antisense oligonucleotide addition (Cont) and the group with control antisense oligonucleotide addition (NEG1).

[0124] [Example 11 Inhibitory effect on migration ability 2] Using four antisense oligonucleotides, hSYT13-4378(15), hSYT13-4729(15), hSYT13-4380(17), and hSYT13-4733(17), the inhibitory effect on the in vitro migration ability of MKN1 cells or NUGC4 cells was examined in the same manner as in Example 7.

[0125] As a result, as shown in Figures 16A and 16B, under the conditions tested, hSYT13-4378(15), hSYT13-4380(17), and hSYT13-4733(17) showed a significant migration-inhibitory effect compared to the group without antisense oligonucleotide (Cont) and the control antisense oligonucleotide-added group (NEG1).

[0126] [Example 12 Inhibitory effect on invasive ability 2] Using four antisense oligonucleotides, hSYT13-4378(15), hSYT13-4729(15), hSYT13-4380(17), and hSYT13-4733(17), the inhibitory effect on the in vitro invasive ability of MKN1 cells or NUGC4 cells was examined in the same manner as in Example 8.

[0127] As a result, as shown in Figure 17A, it was shown that the invasive ability was suppressed when the antisense oligonucleotide of the present invention was added, compared to the group without antisense oligonucleotide addition (Cont) and the group with control antisense oligonucleotide addition (NEG1).

[0128] As shown in Figure 17B, which compares the number of invasive cells, under the tested conditions, hSYT13-4378 (15), hSYT13-4729 (15), and hSYT13-4733 (17) showed a significant inhibitory effect on invasion compared to the group without antisense oligonucleotide addition (Cont) and the control antisense oligonucleotide addition group (NEG1).

[0129] [Example 13 In vivo test 2] An in vivo test was carried out using a peritoneal dissemination model mouse prepared in the same manner as in Example 9.

[0130] In this example, 2×10 6A peritoneal dissemination model mouse was prepared by intraperitoneally transplanting 1 ml of the NUGC4 cell line at 1 cell / ml. Antisense oligonucleotides, hSYT13-4378 (15) and hSYT13-4733 (17), and a control antisense oligonucleotide (NEG1, SEQ ID NO: 44), were administered twice a week for 12 weeks in 500 μL of 5% glucose solution at a dose of 0.2 mg (equivalent to 10 mg / kg, assuming a mouse body weight of 20 g) per administration (Figure 18A).

[0131] Eight weeks after cancer cell implantation, some mice were sacrificed and tumor growth was visually examined. The results showed that mice not treated with antisense oligonucleotides (Control) and mice treated with the control antisense oligonucleotide (NEG1) showed significant tumor growth resembling peritoneal dissemination, whereas mice treated with hSYT13-4378 (15) and hSYT13-4733 (17) showed almost no peritoneal dissemination (data not shown).

[0132] Figure 18B shows a comparison of the total weight of peritoneal dissemination for each group of mice. As confirmed by naked eye, the total weight of peritoneal dissemination was significantly smaller in the mice administered with the antisense oligonucleotide of the present invention than in the control mice (mice not administered with antisense oligonucleotide and mice administered with control antisense oligonucleotide), demonstrating that peritoneal dissemination can be effectively suppressed.

[0133] [Example 14 Survival analysis] In Example 13, the number of days that the mice survived after cancer cell transplantation (seeding) was measured for mice that had been administered with antisense oligonucleotide for 12 weeks and mice that had not been administered with antisense oligonucleotide (8 mice per group).

[0134] As a result, as shown in Figure 18C, mice administered the antisense oligonucleotide of the present invention had a significantly longer survival time compared to the group not administered the antisense oligonucleotide (CEM) and the group administered the control antisense oligonucleotide (NEG1), demonstrating that the antisense oligonucleotide has the effect of suppressing recurrence due to peritoneal dissemination.

[0135] [Example 15] Demonstration of the effect of suppressing SYT13 mRNA expression using antisense oligonucleotides with different modifications Fourteen antisense oligonucleotides (4733-A to 4733-N) were designed and synthesized with altered modification patterns of the sugar, nucleobase, and / or internucleoside bond based on hSYT13-4733-AmNA(17) (SEQ ID NO: 79), which was confirmed to have high SYT13 mRNA expression inhibitory activity in Example 5. The sequence information of these antisense oligonucleotides is shown in Table 5.

[0136] [Table 5]

[0137] As can be seen from Table 5 and the attached sequence listing, hSYT13-4733-AmNA(17) and 4733-A to 4733-N are all gapmers with a length of 17 bases. hSYT13-4733-AmNA(17) contains three unnatural nucleosides (referred to as "AmNA" in the table) with sugars having amide bridges at the 5'-terminus and two at the 3'-terminus, and all internucleoside linkages are phosphorothioate.

[0138] In contrast, in the six antisense oligonucleotides 4733-A to 4733-F, one or both of the wing regions on the 5'-end and 3'-end sides (5'-wing region and 3'-wing region), as well as some of the internucleoside bonds at the boundary between the wing region and the DNA gap region, are phosphodiester bonds.

[0139] In addition, the eight antisense oligonucleotides 4733-G to 4733-N have altered numbers and / or positions of unnatural nucleosides (AmNA) having sugars with amide bridges in either or both of the 5' wing region and the 3' wing region, and 4733-H, 4733-K, and 4733-M contain 5-methylcytosine in the 3' wing region.

[0140] The inhibitory effect of hSYT13-4733-AmNA(17) (SEQ ID NO: 79) and the above 14 types of antisense oligonucleotides (4733-A to 4733-N) on the expression of SYT13 in NUGC-4 cells was examined in the same manner as in Example 5.

[0141] As a result, as shown in Figure 19, all antisense oligonucleotides significantly suppressed SYT13 mRNA expression in vitro compared to the group without antisense oligonucleotide (Control) and the group with control antisense oligonucleotide (NEG1, antisense oligonucleotide of SEQ ID NO: 44). In particular, 4733-B, 4733-C, 4733-D, 4733-E, 4733-F, and 4733-M were confirmed to have an expression-suppressing effect equal to or greater than that of hSYT13-4733-AmNA(17), demonstrating that they exert antisense activity suitable for suppressing SYT13 expression.

[0142] All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety.

Claims

1. An antisense oligonucleotide consisting of a base sequence selected from the group consisting of SEQ ID NOs: 39 and 79 to 93.

2. A conjugate comprising the antisense oligonucleotide of claim 1 and a further functional moiety linked directly or indirectly to the antisense oligonucleotide.

3. The conjugate of claim 2 , wherein the further functional moiety is a targeting molecule or a drug with antitumor activity.

4. A pharmaceutical composition comprising the antisense oligonucleotide of claim 1 or the conjugate of claim 2 or 3.

5. 5. The pharmaceutical composition according to claim 4 for the treatment or prevention of gastric cancer in humans.

6. The pharmaceutical composition according to claim 5, for treating or preventing peritoneal dissemination of gastric cancer after resection.

Citation Information

Patent Citations

  • Method for testing peritoneal dissemination of gastric cancer by SYT13, SYT8, and ANOS1 expression levels, test kit, molecularly targeted therapeutic screening method, and therapeutic agent

    WO2016143697A1

  • Antisense nucleic acid for inhibiting biosynthesis of chondroitin sulfate

    WO2018180005A1

  • Antisense nucleic acid targeting PCSK9

    WO2018216785A1

  • α-synuclein expression inhibitor

    WO2019009298A1