Benzopyrazole inhibitors of SARM1
Benzopyrazole compounds targeting SARM1 inhibit axonal degeneration by binding to its catalytic pocket, addressing the challenge of neurodegeneration in various neurological disorders and offering therapeutic benefits for conditions like Parkinson's disease and Alzheimer's.
Patent Information
- Application Number
- JP2023534601
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-12-08
- Filing Date
- 2021-12-03
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2041-12-03
AI Technical Summary
Axonal degeneration is a hallmark of neurological disorders such as peripheral neuropathy, traumatic brain injury, and neurodegenerative diseases, posing significant health and economic burdens, and existing treatments are inadequate.
Development of benzopyrazole compounds that inhibit SARM1, a key enzyme involved in axonal degeneration, by binding to its catalytic pocket and reducing NAD+ destruction, thereby stabilizing axons and preventing neurodegeneration.
The compounds effectively inhibit SARM1 activity, reducing axonal degeneration and potentially treating or preventing neurodegenerative diseases, including Parkinson's disease, multiple system atrophy, progressive supranuclear palsy, Alzheimer's disease, and other conditions associated with axonal damage.
Smart Images

Figure 0007746384000048 
Figure 0007746384000001 
Figure 0007746384000002
Abstract
Description
[Background technology]
[0001] Axonal degeneration is a hallmark of several neurological disorders, including peripheral neuropathy, traumatic brain injury, and neurodegenerative diseases (Gerdts et al., SARM1 activation triggers axon degeneration locally via NAD(+)destruction. Science 348 2016, pp. 453-457, incorporated herein by reference in its entirety). Neurodegenerative diseases and injuries are devastating to both patients and caregivers. The costs associated with these diseases currently exceed hundreds of billions of dollars annually in the United States alone. Because the incidence of many of these diseases and disorders increases with age, their incidence is rapidly increasing as demographics change. Summary of the Invention
[0002] The present disclosure provides, among other things, techniques useful for treating and / or preventing neurodegeneration (e.g., for reducing axonal degeneration). In some embodiments, the provided techniques inhibit SARM1.
[0003] In some embodiments, the present disclosure provides certain compounds and / or compositions that are useful in medicine, and in particular for treating neurodegeneration (e.g., for reducing axonal degeneration).
[0004] In some embodiments, the present disclosure provides a compound having a structure as set forth in Formula I: [ka] or a pharmaceutically acceptable salt thereof, wherein: Ring A, together with the carbon atom to which it is fused, is a 6-membered aryl ring or a 6-membered heteroaryl ring having 1 to 3 nitrogen atoms; L is optionally substituted C 1-4an aliphatic chain in which one carbon atom is optionally replaced by a group selected from -O-, -N(R)-, -S-, -C(O)-, -C(O)N(R)-, -N(R)C(O)-, -C(O)O-, -OC(O)-, -S(O)N(R)-, -N(R)S(O)-, and an optionally substituted divalent 3- to 6-membered monocyclic ring having 0-2 heteroatoms independently selected from oxygen, nitrogen, and sulfur; R 1 is an optionally substituted group selected from a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur, and a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; R 2 is an optionally substituted group, C 1-6 an optionally substituted group selected from aliphatic; a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; phenyl; a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; an 8- to 10-membered bicyclic saturated, partially unsaturated, or aryl carbocyclic ring; an 8- to 10-membered bicyclic saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; and an 8- to 10-membered bicyclic heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; Each R y are independently selected from halogen, cyano, OR, SR, N(R)2, and optionally substituted C 1-4 selected from aliphatic each R is independently hydrogen or an optionally substituted group; C 1-6 an optionally substituted group selected from aliphatic; a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; phenyl; and a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; or two R groups, together with the nitrogen atom to which they are attached, form an optionally substituted 3- to 7-membered monocyclic heterocyclic ring having 0-2 additional heteroatoms independently selected from oxygen, nitrogen, and sulfur; n is 0, 1, or 2, or a pharmaceutically acceptable salt thereof.
[0005] In some embodiments, provided compounds have the structure of Formulas Ia, Iai, Ib, Ibi, Ic, Ici, Id, Ie, Iei, If, Ifi, Ig, Ih, Ihi, Ii, Ij, Iji, Ik, Il, Im, and In, as set forth below.
[0006] In some embodiments, one or more compounds of Formula I are provided and / or utilized in a solid form (eg, a crystalline or amorphous form).
[0007] In some embodiments, the present disclosure provides compositions that include and / or deliver a compound of formula I (e.g., in the form described herein), a prodrug, or an active metabolite thereof.
[0008] In some embodiments, the present disclosure provides compositions comprising and / or delivering a compound of Formula I. In some embodiments, such compositions are pharmaceutical compositions comprising at least one pharmaceutically acceptable carrier, diluent, or excipient.
[0009] In some embodiments, provided SARM1 inhibitors reduce or inhibit the binding of NAD+ by SARM1. In some embodiments, provided SARM1 inhibitors bind to SARM1 within a pocket that contains one or more catalytic residues (e.g., the catalytic cleft of SARM1).
[0010] In some embodiments, provided compounds and / or compositions inhibit the activity of SARM1. Alternatively or additionally, in some embodiments, provided compounds alleviate one or more attributes of neurodegeneration. In some embodiments, the present disclosure provides methods of treating a neurodegenerative disease or disorder associated with axonal degeneration.
[0011] In some embodiments, one or more compounds and / or compositions described herein are useful, for example, in the practice of medicine. In some embodiments, one or more compounds and / or compositions described herein are useful, for example, for treating, preventing, or ameliorating axonal degeneration (e.g., one or more properties or characteristics thereof). In some embodiments, one or more compounds and / or compositions described herein are useful, for example, for inhibiting axonal degeneration, including axonal degeneration resulting from NAD+ reduction or depletion. In some embodiments, one or more compounds and / or compositions described herein are useful, for example, for preventing axons distal to axonal injury from degenerating.
[0012] In some embodiments, one or more compounds and / or compositions described herein are useful for treating, for example, one or more neurodegenerative diseases, disorders, or conditions selected from the group consisting of neuropathy and axonopathy. In some embodiments, one or more compounds and / or compositions described herein are useful for treating, for example, neuropathy or axonopathy associated with axon degeneration. In some embodiments, the neuropathy associated with axon degeneration is a genetic or congenital neuropathy or axonopathy. In some embodiments, the neuropathy associated with axon degeneration results from a de novo or somatic mutation. In some embodiments, the neuropathy associated with axon degeneration is selected from the list contained herein. In some embodiments, the neurological or axonal disorder is associated with axonal degeneration, including, but not limited to, Parkinson's disease, parkinsonism, or parkinsonism-plus syndromes, such as multiple system atrophy (MSA), progressive supranuclear palsy (PSP), and corticobasal degeneration, Alzheimer's disease, herpes infection, diabetes, amyotrophic lateral sclerosis (ALS), demyelinating diseases such as multiple sclerosis, ischemia or stroke, chemical injury, thermal injury, and AIDS.
[0013] In some embodiments, the subject to which a compound or composition described herein is administered may be or include a subject suffering from or susceptible to a neurodegenerative disease, disorder, or condition. In some embodiments, the neurodegenerative disease, disorder, or condition may be or include traumatic nerve injury. In some embodiments, the traumatic nerve injury is blunt force trauma, closed head injury, open head injury, exposure to impact and / or explosive force, penetrating injury in or to the brain cavity or innervated area of the body. In some embodiments, the traumatic nerve injury is a force that deforms, stretches, crushes, or rotates axons.
[0014] In some embodiments, provided methods include administering a compound as described herein to a patient in need thereof. In some such embodiments, the patient is at risk of developing a condition characterized by axonal degeneration. In some embodiments, the patient has a condition characterized by axonal degeneration. In some embodiments, the patient has been diagnosed with a condition characterized by axonal degeneration.
[0015] In some embodiments, provided methods include administering a composition as described herein to a patient population in need thereof. In some embodiments, the population is taken from individuals who engage in activities with a high likelihood of traumatic nerve injury. In some embodiments, the population is taken from athletes who engage in contact sports or other high-risk activities.
[0016] In some embodiments, the patient is at risk of developing a neurodegenerative disorder, in some embodiments, the patient is elderly, in some embodiments, the patient is known to have a genetic risk factor for neurodegeneration.
[0017] In certain embodiments, the present disclosure provides compounds that are useful, for example, as analytical tools, as probes in biological assays, or as therapeutic agents according to the present disclosure. The compounds provided by the present disclosure are also useful for studying SARM1 function in biological and pathological phenomena, and for the comparative evaluation of novel inhibitors of SARM1 activity in vitro or in vivo.
[0018] In some embodiments, one or more compounds and / or compositions described herein are useful, for example, as methods for inhibiting the degradation of neurons derived from a subject. In some embodiments, one or more compounds and / or compositions described herein are useful for inhibiting the degeneration of in vitro cultured neurons or portions thereof. In some embodiments, one or more compounds and / or compositions described herein are useful as stabilizers for promoting the survival of in vitro neurons. [Brief explanation of the drawings]
[0019] [Figure 1] The structure of the SARM1 protein is shown.
[0020] definition Aliphatic: The term "aliphatic" refers to a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more units of unsaturation, or a monocyclic or bicyclic hydrocarbon that is fully saturated or contains one or more units of unsaturation, but is not aromatic (also referred to herein as "hydrocarbon" or "alicyclic"), and has a single point of attachment to the rest of the molecule. Unless otherwise specified, an aliphatic group contains 1-6 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-5 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-4 aliphatic carbon atoms. In still other embodiments, an aliphatic group contains 1-3 aliphatic carbon atoms, and in still other embodiments, an aliphatic group contains 1-2 aliphatic carbon atoms. In some embodiments, an "alicyclic" (or "carbocycle") refers to a monocyclic C3-C8 hydrocarbon or a bicyclic C7-C8 hydrocarbon that is fully saturated or contains one or more units of unsaturation, but is not aromatic. 10 Suitable aliphatic groups include, but are not limited to, straight or branched chain, substituted or unsubstituted alkyl, alkenyl, alkynyl, alkylene, alkenylene, alkynylene groups, and hybrids thereof.
[0021] Alkyl: The term "alkyl," used alone or as part of a larger moiety, refers to a saturated, optionally substituted, straight or branched chain, or cyclic hydrocarbon group having 1 to 12, 1 to 10, 1 to 8, 1 to 6, 1 to 4, 1 to 3, or 1 to 2 carbon atoms. The term "cycloalkyl" refers to an optionally substituted saturated ring system of about 3 to about 10 ring carbon atoms. Exemplary monocyclic cycloalkyl rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl.
[0022] Alkyl: The term "alkylene" refers to a divalent alkyl group. In some embodiments, an "alkylene" is a divalent straight or branched alkyl group. In some embodiments, an "alkylene chain" is a polymethylene group, i.e., -(CH) n -, where n is a positive integer, for example, 1 to 6, 1 to 4, 1 to 3, 1 to 2, or 2 to 3. An optionally substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms are optionally replaced with a substituent. Suitable substituents include those described below for substituted aliphatic groups, and also include those described herein. It will be understood that two substituents on an alkylene group can be joined together to form a ring system. In certain embodiments, two substituents can be joined together to form a 3- to 7-membered ring. The substituents can be on the same atom or different atoms.
[0023] Alkenyl: The term "alkenyl," used alone or as part of a larger moiety, refers to an optionally substituted straight or branched chain, or cyclic hydrocarbon group having at least one double bond and having 2 to 12, 2 to 10, 2 to 8, 2 to 6, 2 to 4, or 2 to 3 carbon atoms. The term "cycloalkenyl" refers to an optionally substituted non-aromatic monocyclic or polycyclic ring system containing at least one carbon-carbon double bond and having about 3 to about 10 carbon atoms. Exemplary monocyclic cycloalkenyl rings include cyclopentyl, cyclohexenyl, and cycloheptenyl.
[0024] Alkynyl: The term "alkynyl," used alone or as part of a larger moiety, refers to an optionally substituted straight or branched chain hydrocarbon group having at least one triple bond and having 2 to 12, 2 to 10, 2 to 8, 2 to 6, 2 to 4, or 2 to 3 carbon atoms.
[0025] Aryl: The term "aryl" refers to monocyclic and bicyclic ring systems having a total of 5 to 14 ring members, wherein at least one ring of the system is aromatic and each ring of the system contains 3 to 7 ring members. The term "aryl" may be used interchangeably with the term "aryl ring." In certain embodiments of the present invention, "aryl" refers to aromatic ring systems, including, but not limited to, phenyl, biphenyl, naphthyl, anthracyl, and the like, which may bear one or more substituents. Also included within the scope of the term "aryl," as used herein, are groups in which an aromatic ring is fused to one or more non-aromatic carbocyclic or heterocyclic rings, such as indanyl, phthalimidyl, naphthaimidyl, phenanthridinyl, tetrahydronaphthyl, imidazolidinyl, imidazolidin-2-one, and the like.
[0026] Binding: As used herein, the term "binding" is typically understood to refer to a non-covalent association between or among two or more entities. "Direct" binding includes physical contact between the entities or moieties, while indirect binding includes physical interaction through physical contact with one or more intermediate entities. Binding between two or more entities can typically be assessed in any of a variety of contexts, including when the interacting entities or moieties are studied in isolation or in the context of a more complex system (e.g., in covalent or other association with a carrier entity and / or in a biological system or cell).
[0027] Biological sample: As used herein, the term "biological sample" typically refers to a sample obtained or derived from a biological source of interest (e.g., a tissue or organism or cell culture), as described herein. In some embodiments, the source of interest includes an organism, such as an animal or a human. In some embodiments, the biological sample is or includes a biological tissue or fluid. In some embodiments, the biological sample can be or include bone marrow, blood, blood cells, ascites, tissue or fine needle biopsy sample, cell-containing body fluids, suspended nucleic acids, sputum, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural effusion, feces, lymph, gynecological fluid, skin swab, vaginal swab, oral swab, nasal swab, lavage or perfusion such as ductal irrigation or bronchoalveolar irrigation, aspirate, scraping, bone marrow specimen, tissue biopsy specimen, surgical specimen, feces, other body fluids, secretions, and / or excretions, and / or cells derived therefrom, and the like. In some embodiments, a biological sample is or comprises cells obtained from an individual. In some embodiments, the obtained cells are or comprise cells from the individual from whom the sample is obtained. In some embodiments, a sample is a "primary sample" obtained directly from a source of interest by any suitable means. For example, in some embodiments, a primary biological sample is obtained by a method selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of bodily fluids (e.g., blood, lymph, stool, etc.), and the like. In some embodiments, as is clear from the context, the term "sample" refers to a preparation obtained by processing a primary sample (e.g., by removing one or more components and / or adding one or more agents), such as filtering using a semipermeable membrane. Such a "processed sample" can include, for example, nucleic acids or proteins extracted from the sample or obtained by subjecting the primary sample to techniques such as amplification or reverse transcription of mRNA, isolation and / or purification of specific components, etc.
[0028] Biomarker: The term "biomarker" is used herein to refer to an entity, event, or characteristic whose presence, level, degree, type, and / or form correlates with a particular biological event or condition of interest, and is therefore considered a "marker" for that event or condition. To name just a few examples, in some embodiments, a biomarker can be or include a marker for a particular disease state or the likelihood of a particular disease, disorder, or condition developing, occurring, or recurring. In some embodiments, a biomarker can be or include a marker for a particular disease or treatment outcome, or the likelihood thereof. Thus, in some embodiments, a biomarker is predictive, in some embodiments, a biomarker is prognostic, and in some embodiments, a biomarker is diagnostic for the relevant biological event or condition of interest. A biomarker can be or include any chemical class of entity, and can be or include a combination of entities. For example, in some embodiments, a biomarker can be or include a nucleic acid, a polypeptide, a lipid, a carbohydrate, a small molecule, an inorganic substance (e.g., a metal or ion), or a combination thereof. In some embodiments, the biomarker is a cell surface marker. In some embodiments, the biomarker is intracellular. In some embodiments, the biomarker is detected outside the cell (e.g., secreted or otherwise produced or present outside the cell in bodily fluids, such as blood, urine, tears, saliva, cerebrospinal fluid, etc.). In some embodiments, the biomarker may be or include a genetic or epigenetic signature. In some embodiments, the biomarker may be or include a gene expression signature.
[0029] In some embodiments, the biomarker may be or include a marker for neurodegeneration or the likelihood of onset, occurrence, or recurrence of a neurodegenerative disease, disorder, or condition. In some embodiments, the biomarker may be or include a marker for neurodegenerative treatment outcome or likelihood thereof. Thus, in some embodiments, the biomarker is predictive, in some embodiments, the biomarker is prognostic, and in some embodiments, the biomarker is diagnostic for a neurodegenerative disease, disorder, or condition. In some embodiments, changes in biomarker levels can be detected via cerebrospinal fluid (CSF), plasma, and / or serum.
[0030] In some embodiments, neurodegeneration can be assessed, for example, by detecting increases and / or decreases in the concentration of neurofilament protein light chain (NF-L) and / or neurofilament protein heavy chain (NF-H) (or its phosphorylated form (pNF-H)) contained in the cerebrospinal fluid of a subject. In some embodiments, the incidence and / or progression of neurodegeneration can be assessed via positron emission tomography (PET) using synaptic vesicle glycoprotein 2a (SV2A) ligand. In some embodiments, detectable changes in constitutive NAD and / or cADPR levels in neurons can be used to assess neurodegeneration.
[0031] In some embodiments, detectable changes in one or more neurodegeneration-associated proteins in a subject compared to a healthy reference population can be used as biomarkers of neurodegeneration. Such proteins include, but are not limited to, albumin, amyloid-β (Aβ)38, Aβ40, Aβ42, glial fibrillary acidic protein (GFAP), heart-type fatty acid-binding protein (hFABP), monocyte chemoattractant protein (MCP)-1, neurogranin, neuron-specific enolase (NSE), soluble amyloid precursor protein (sAPP)α, sAPPβ, soluble triggering receptor expressed on myeloid cells (sTREM)2, phospho-tau, and / or total tau. In some embodiments, increases in cytokines and / or chemokines, including, but not limited to, Ccl2, Ccl7, Ccl12, Csf1, and / or Il6, can be used as biomarkers of neurodegeneration.
[0032] Carrier: As used herein, the term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which a composition is administered. In some exemplary embodiments, a carrier can comprise sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. In some embodiments, a carrier is or comprises one or more solid ingredients.
[0033] Combination therapy: As used herein, the term "combination therapy" refers to a situation in which a subject is exposed to two or more treatment regimens (e.g., two or more therapeutic agents) simultaneously. In some embodiments, the two or more regimens may be administered simultaneously; in some embodiments, such regimens may be administered sequentially (e.g., all "doses" of a first regimen are administered before any dose of a second regimen); and in some embodiments, such agents are administered in overlapping dosing regimens. In some embodiments, "administration" of a combination therapy may include administration of one or more agents or modalities to a subject receiving other agents or modalities in combination. For clarity, combination therapy does not require that individual agents be administered together in a single composition (or even necessarily simultaneously), although in some embodiments, two or more agents or active portions thereof may be administered together in a combination composition or even in a combined compound (e.g., as part of a single chemical complex or covalent conjugate).
[0034] Composition: Those skilled in the art will understand that the term "composition" can be used to refer to a discrete physical entity that includes one or more specific components. Generally, unless otherwise specified, a composition can be in any form—e.g., gas, gel, liquid, solid, etc.
[0035] Domain: As used herein, the term "domain" refers to a section or portion of an entity. In some embodiments, a "domain" is associated with a particular structural and / or functional property of an entity, such that when the domain is physically separated from the remainder of its parent entity, it retains the particular structural and / or functional property intact. Alternatively or additionally, a domain may be or comprise a part of an entity that, when separated from its (parent) entity and combined with a different (recipient) entity, substantially maintains and / or confers to the recipient entity one or more structural and / or functional properties that characterize it in the parent entity. In some embodiments, a domain is a section or portion of a molecule (e.g., a small molecule, carbohydrate, lipid, nucleic acid, or polypeptide). In some embodiments, a domain is a section of a polypeptide, and in some such embodiments, a domain is characterized by particular structural elements (e.g., particular amino acid sequences or sequence motifs, alpha-helical properties, beta-sheet properties, coiled-coil properties, random coil properties, etc.) and / or particular functional properties (e.g., binding activity, enzymatic activity, folding activity, signaling activity, etc.).
[0036] Dosage form or unit dosage form: Those of skill in the art will understand that the term "dosage form" can be used to refer to a physically discrete unit of an active agent (e.g., a therapeutic or diagnostic agent) for administration to a subject. Typically, each such unit contains a predetermined amount of active agent. In some embodiments, such amount is a unit dosage (or a whole fraction thereof) appropriate for administration according to a dosing regimen (i.e., a therapeutic dosing regimen) that has been determined to correlate with a desirable or beneficial outcome when administered to a relevant population. Those of skill in the art will understand that the total amount of a therapeutic composition or agent to be administered to a particular subject is determined by one or more attending physicians and may involve the administration of multiple dosage forms.
[0037] Dosing regimen or treatment regimen: Those skilled in the art will understand that the terms "dosing regimen" and "treatment regimen" can be used to refer to a series of unit doses (typically more than one) administered individually to a subject, typically separated by a period of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which can include one or more doses. In some embodiments, a dosing regimen includes multiple doses, each separated in time from the other doses. In some embodiments, the individual doses are separated from each other by periods of equal length, and in some embodiments, a dosing regimen includes multiple doses and at least two different periods separating the individual doses. In some embodiments, all doses within a dosing regimen are the same unit dose amount. In some embodiments, different doses within a dosing regimen are different amounts. In some embodiments, a dosing regimen includes a first dose in a first dose amount, followed by one or more additional doses in a second dose amount that is different from the amount of the first dose. In some embodiments, the dosing regimen includes a first dose in a first dose amount, followed by one or more additional doses in a second dose amount that is the same as the first dose amount. In some embodiments, the dosing regimen is correlated with a desired or beneficial outcome when administered across a relevant population (i.e., is a therapeutic dosing regimen).
[0038] Excipient: As used herein, refers to a non-therapeutic agent that may be included in a pharmaceutical composition, for example, to provide or contribute to a desired consistency or stabilizing effect. Suitable pharmaceutical excipients include, for example, starch, glucose, lactose, sucrose, gelatin, malt, rice, wheat flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like.
[0039] Heteroaryl: The terms "heteroaryl" and "heteroar-" are used alone or as part of a larger moiety, for example, "heteroaralkyl" or "heteroaralkoxy" refer to groups having 5 to 10 ring atoms, preferably 5, 6, 9, or 10 ring atoms, with 6, 10, or 14 pi electrons shared in the cyclic array, and having 1 to 5 heteroatoms in addition to carbon atoms. The term "heteroatom" refers to nitrogen, oxygen, or sulfur, and includes oxidized forms of nitrogen or sulfur and quaternized forms of a basic nitrogen. Heteroaryl groups include, but are not limited to, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. As used herein, the terms "heteroaryl" and "heteroar-" also include groups in which a heteroaromatic ring is fused to one or more aryl, alicyclic, or heterocyclyl rings. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. Heteroaryl groups can be monocyclic or bicyclic. The term "heteroaryl" may be used interchangeably with the terms "heteroaryl ring," "heteroaryl group," or "heteroaromatic," any of which terms include rings that are optionally substituted. The term "heteroaralkyl" refers to an alkyl group substituted by a heteroaryl, where the alkyl and heteroaryl portions independently are optionally substituted.
[0040] Heterocyclic ring: As used herein, the terms "heterocycle," "heterocyclyl ring," "heterocyclic radical," and "heterocyclic ring" are used interchangeably and refer to a stable 3- to 8-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated and that, in addition to carbon atoms, has one or more heteroatoms, such as 1 to 4, as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0 to 3 heteroatoms selected from oxygen, sulfur, and nitrogen, the nitrogen may be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or NR + (such as N-substituted pyrrolidinyl). A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure, and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, but are not limited to, tetrahydrofuranyl, tetrahydrothienyl, piperidinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and thiamorpholinyl. A heterocyclyl group can be monocyclic, bicyclic, tricyclic, or polycyclic, preferably monocyclic, bicyclic, or tricyclic, more preferably monocyclic or bicyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted by a heterocyclyl, wherein the alkyl and heterocyclyl portions are independently optionally substituted. Additionally, heterocyclic rings also include groups in which the heterocyclic ring is fused to one or more aryl rings (eg, 2,3-dihydrobenzofuran, 2,3-dihydrobenzo[b][1,4]dioxin, etc.).
[0041] Inhibitor: As used herein, the term "inhibitor" refers to an entity, condition, or event whose presence, level, or extent correlates with a decrease in the level or activity of a target. In some embodiments, an inhibitor can act directly (where it exerts its effect directly on the target, e.g., by binding to the target), while in some embodiments, an inhibitor can act indirectly (where it exerts its effect by interacting with and / or otherwise altering a modulator of the target, resulting in a decrease in the target level and / or activity). In some embodiments, an inhibitor is one whose presence or level correlates with a decrease in the target level or activity compared to a particular reference level or activity (e.g., observed under appropriate reference conditions, such as the presence of a known inhibitor or the absence of the inhibitor in question).
[0042] Neurodegeneration: As used herein, the term "neurodegeneration" refers to a decrease in one or more properties, structure, function, or characteristics of neurons or nervous tissue. In some embodiments, neurodegeneration is observed as a pathological decrease in an organism. One skilled in the art will understand that neurodegeneration is associated with certain diseases, disorders, and conditions, including those that affect humans. In some embodiments, neurodegeneration can be transient (e.g., occurring sometimes in association with certain infections and / or chemical or mechanical disruption), while in some embodiments, neurodegeneration can be chronic and / or progressive (e.g., often associated with certain diseases, disorders, or conditions, such as, but not limited to, Parkinson's disease, amyotrophic lateral sclerosis, multiple sclerosis, Huntington's disease, or Alzheimer's disease). In some embodiments, neurodegeneration can be assessed in a subject, for example, by detecting an increase in a biomarker associated with neurodegeneration. In some embodiments, neurodegeneration can be assessed in a subject, for example, by detecting a decrease in a biomarker associated with neurodegeneration. Alternatively or additionally, in some embodiments, neurodegeneration can be assessed by magnetic resonance imaging (MRI), cerebrospinal fluid-containing biomarkers, or other biomarkers observed in patients. In some embodiments, neurodegeneration is defined as a score of less than 24 on the Mini-Mental State Examination. In some embodiments, neurodegeneration refers to synaptic loss. In some embodiments, neurodegeneration refers to a loss of nervous tissue associated with traumatic injury (e.g., exposure to an external force that disrupts the integrity of nervous tissue). In some embodiments, neurodegeneration refers to a loss of peripheral nervous tissue. In some embodiments, neurodegeneration refers to a loss of central nervous tissue.
[0043] Oral: As used herein, the phrases "oral administration" and "administered orally" have their art-understood meaning to refer to administration of a compound or composition by mouth.
[0044] Parenteral: As used herein, the phrases "parenteral administration" and "administered parenterally" have their art-understood meaning to refer to modes of administration other than enteral and topical administration, usually by injection, and include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.
[0045] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a ring moiety that includes at least one double or triple bond between ring atoms. The term "partially unsaturated" is intended to encompass rings with multiple sites of unsaturation, but is not intended to include aromatic (e.g., aryl or heteroaryl) moieties as defined herein.
[0046] Patient: As used herein, the term "patient" refers to any organism to which provided compositions are or can be administered, e.g., for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is human. In some embodiments, the patient is suffering from or susceptible to one or more disorders or conditions. In some embodiments, the patient exhibits one or more symptoms of a disorder or condition. In some embodiments, the patient has been diagnosed with one or more disorders or conditions. In some embodiments, the patient is undergoing or has undergone a particular therapy to diagnose and / or treat a disease, disorder, or condition.
[0047] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose amount suitable for administration in a treatment or dosing regimen that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, the pharmaceutical compositions may be specifically formulated in solid or liquid form for administration, including oral administration, e.g., drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., buccal, sublingual, and those targeted for systemic absorption, boluses, powders, granules, pastes for application to the tongue, etc.; parenteral administration, e.g., by subcutaneous, intramuscular, intravenous, or epidural injection, e.g., sterile solutions or suspensions, or sustained release formulations; topical application, e.g., creams, ointments, or sustained release patches or sprays applied to the skin, lungs, or oral cavity; vaginally or rectally, e.g., pessaries, creams, or foams; sublingually, ophthalmically, transdermally, or adapted for the nose, lungs, and other mucosal surfaces.
[0048] Pharmaceutically acceptable: The term "pharmaceutically acceptable" refers to those compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit-risk ratio.
[0049] Pharmaceutically acceptable carrier: As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, that is involved in carrying or transporting a compound of interest from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the patient. Some examples of materials that can serve as pharmaceutically acceptable carriers include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethyl cellulose, cellulose acetate, and the like; excipients such as powdered tragacanth, malt, gelatin, talc, cocoa butter, and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar, buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethyl alcohol, pH buffered solutions, polyesters, polycarbonates, and / or polyanhydrides, and other non-toxic, compatible substances used in pharmaceutical formulations.
[0050] Pharmaceutically acceptable salts: As used herein, the term "pharmaceutically acceptable salts" refers to salts of compounds that are suitable for use in pharmaceutical contexts, i.e., salts that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, etc., and that are commensurate with a reasonable risk-to-benefit ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66:1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, non-toxic acid addition salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods used in the art, such as ion exchange. In some embodiments, pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lanthanide ... Representative alkali or alkaline earth metal salts include, but are not limited to, sodium, lithium, potassium, calcium, magnesium, etc. ...In some embodiments, pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyls having 1 to 6 carbon atoms, sulfonates, and aryl sulfonates, as appropriate.
[0051] Prevent or Prevention: As used herein, the terms "prevent" or "prevention," when used in reference to the occurrence of a disease, disorder, and / or condition, refer to reducing the risk of developing the disease, disorder, and / or condition and / or delaying the onset of one or more characteristics or symptoms of the disease, disorder, or condition. Prevention may be considered complete when the onset of the disease, disorder, or condition has been delayed for a predetermined period of time.
[0052] Specific: The term "specific," as used herein with respect to an active agent, is understood by those skilled in the art to mean that the agent discriminates between potential target entities or conditions. For example, in some embodiments, an agent is said to "specifically" bind to a target if it preferentially binds to that target in the presence of one or more competing surrogate targets. In many embodiments, the specific interaction depends on the presence of particular structural features of the target entity (e.g., epitopes, clefts, binding sites). It should be understood that specificity need not be absolute. In some embodiments, specificity can be assessed relative to that of a binding agent for one or more other potential target entities (e.g., competitors). In some embodiments, specificity is assessed relative to that of a reference specific binding agent. In some embodiments, specificity is assessed relative to that of a reference nonspecific binding agent. In some embodiments, an agent or entity does not detectably bind to a competing surrogate target under conditions that bind to the target entity. In some embodiments, a binding agent binds to the target entity with a higher on-rate, a lower off-rate, an increased affinity, a decreased dissociation, and / or an increased stability relative to the competing surrogate target.
[0053] Subject: As used herein, the term "subject" refers to an organism, typically a mammal (e.g., a human, including in some embodiments prenatal human forms). In some embodiments, the subject is afflicted with the relevant disease, disorder, or condition. In some embodiments, the subject is predisposed to the disease, disorder, or condition. In some embodiments, the subject exhibits one or more symptoms or characteristics of the disease, disorder, or condition. In some embodiments, the subject does not exhibit any symptoms or characteristics of the disease, disorder, or condition. In some embodiments, the subject possesses one or more characteristics characteristic of susceptibility to or risk for the disease, disorder, or condition. In some embodiments, the subject is a patient. In some embodiments, the subject is an individual for whom diagnosis and / or treatment is being and / or is being administered.
[0054] Substituted or Optionally Substituted: As described herein, compounds of the invention can contain "optionally substituted" moieties. In general, the term "substituted," whether preceded by the term "optionally," means that one or more hydrogens of the specified moiety are replaced with a suitable substituent. "Substituted" applies to one or more hydrogens that are explicitly or implicitly present from the structure (e.g., [ka] At least [ka] refers to, [ka] At least [ka] (refers to "optionally substituted"). Unless otherwise specified, an "optionally substituted" group may have a suitable substituent at each substitutable position of the group, and if more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituents may be either the same or different at all positions. Combinations of substituents envisioned by the present invention are preferably those that result in the formation of stable or chemically feasible compounds. As used herein, the term "stable" refers to compounds that are substantially unchanged when subjected to conditions that permit their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein.
[0055] Suitable monovalent substituents on a substitutable carbon atom of an "optionally substituted" group are independently halogen, -(CH) 0-4 R°, -(CH2) 0-4 OR°, -O(CH2) 0-4 R o , -O-(CH2) 0-4 C(O)OR°, -(CH2) 0-4 CH(OR°)2, -(CH2) 0-4 SR°, R° may be substituted -(CH2) 0-4 Ph, R° may be substituted -(CH2) 0-4 O(CH2) 0-1 Ph, may be substituted with R° -CH=CHPh, may be substituted with R° -(CH 0-4 O(CH2) 0-1 -Pyridyl, -NO2, -CN, -N3, -(CH2) 0-4 N(R°)2, -(CH2) 0-4 N(R°)C(O)R°, -N(R°)C(S)R°, -(CH2) 0-4 N(R°)C(O)NR°2, -N(R°)C(S)NR°2, -(CH2) 0-4 N(R°)C(O)OR°, -N(R°)N(R°)C(O), R°, -N(R°)N(R°)C(O)NR°2, -N(R°)N(R°)C(O)OR°, -(CH2) 0-4 C(O)R°, -C(S)R°, -(CH2) 0-4 C(O)OR°, -(CH2) 0-4C(O)SR°, -(CH2) 0-4 C(O)OSiR°3, -(CH2) 0-4 OC(O)R°, -OC(O)(CH2) 0-4 SR°, -(CH2) 0-4 SC(O)R°, -(CH2) 0-4 C(O)NR°2, -C(S)NR°2, -C(S)SR°, -SC(S)SR°, -(CH2) 0-4 OC(O)NR°2, -C(O)N(OR°)R°, -C(O)C(O)R°, -C(O)CH2C(O)R°, -C(NOR°)R°, -(CH2) 0-4 SSR°, -(CH2) 0-4 S(O)2R°, -(CH2) 0-4 S(O)(NH)R°, -(CH2) 0-4 S(O)2OR°, -(CH2) 0-4 OS(O)2R°, -S(O)2NR°2, -(CH2) 0-4 S(O)R°, -N(R°)S(O)2NR°2, -N(R°)S(O)2R°, -N(OR°)R°, -C(NH)NR°2, -P(O)2R°, -P(O)R°2, -OP(O)R°2, -OP(O)(OR°)2, SiR°3, -(C ~41-4 linear or branched alkylene)ON(R°)2, or -(C ~41-4 linear or branched alkylene)C(O)ON(R°), where each R° may be substituted as defined below and is independently hydrogen; C ~61-6 Aliphatic;-CH2Ph;-O(CH2) 0-1 Ph; -CH2- (a 5-6 membered heteroaryl ring); a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur; or an 8-10 membered bicyclic aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the above definitions, two independent occurrences of R° together with their intervening atoms form a 3-12 membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which may be substituted as defined below.
[0056] Suitable monovalent substituents on R° (or the ring formed by two independent occurrences of R° taken together with their intervening atoms) are independently halogen, —(CH) 0-2 R λ ,-(Halo R λ ), -(CH2) 0-2 OH, -(CH2) 0-2 OR λ , -(CH2) 0-2 CH(OR λ )2, -O(HaloR λ ), -CN, -N3, -(CH2) 0-2 C(O)R λ , -(CH2) 0-2 C(O)OH, -(CH2) 0-2 C(O)OR λ , -(CH2) 0-2 SR λ , -(CH2) 0-2 SH, -(CH2) 0-2 NH2, -(CH2) 0-2 NHR λ , -(CH2) 0-2 NR λ 2, -NO2, -SiR λ 3. -OSiR λ 3. -C(O)SR λ , -(C ~41-4 Linear or branched alkylene)C(O)OR λ , or -SSR λ and each R λ is unsubstituted or, if preceded by "halo", is substituted only with one or more halogens, and independently represents C ~41-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or a 3-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents on a saturated carbon atom of R° include =0 and =S.
[0057] Suitable divalent substituents on a saturated carbon atom of an "optionally substituted" group include the following: ═O ("oxo"), ═S, ═NNR * 2, =NNHC(O)R *, =NNHC(O)OR * , =NNHS(O)2R * , =NR * , =NOR * , -O(C(R * 2)) 2-3 O- or -S(C(R * 2)) 2-3 S- is mentioned, R * Each independent occurrence of may be substituted as defined below with hydrogen, C ~61-6 Aliphatic or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents attached to adjacent substitutable carbons of an "optionally substituted" group include -O(CR * 2) 2-3 O- and R * Each independent occurrence of may be substituted as defined below with hydrogen, C ~61-6 It is selected from aliphatic or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0058] R * Suitable substituents on the aliphatic group include halogen, -R λ ,-(Halo R λ ), -OH, -OR λ , -O(HaloR λ ), -CN, -C(O)OH, -C(O)OR λ , -NH2, -NHR λ , -NR λ 2 or -NO2, and each R λ is unsubstituted or, if preceded by "halo", is substituted only with one or more halogens, and independently, C ~41-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0059] Suitable substituents on a substitutable nitrogen of an "optionally substituted" group include -R † , -NR † 2. -C(O)R † , -C(O)OR † , -C(O)C(O)R † , -C(O)CHC(O)R † , -S(O)2R † , -S(O)NR † 2. -C(S)NR † 2. -C(NH)NR † 2, or -N(R † )S(O)2R † are listed, and each R † are independently hydrogen, C which may be substituted as defined below 1-6 an aliphatic, unsubstituted -OPh, or an unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur; or, notwithstanding the above definition, two independent R † together with their intervening atoms form an unsubstituted 3- to 12-membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0060] R † Suitable substituents on the aliphatic group are independently halogen, —R λ ,-(Halo R λ ), -OH, -OR λ , -O(HaloR λ ), -CN, -C(O)OH, -C(O)OR λ , -NH2, -NHR λ , -NR λ 2, or -NO2, and each R λ is unsubstituted or, if preceded by "halo", is substituted only with one or more halogens, and independently, C ~41-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0061] Therapeutic Agent: As used herein, the phrase "therapeutic agent" generally refers to any agent that induces a desired pharmacological effect when administered to an organism. In some embodiments, an agent is considered to be therapeutic if it exhibits a statistically significant effect across an appropriate population. In some embodiments, the appropriate population may be a population of model organisms. In some embodiments, the appropriate population may be defined by various criteria, such as a particular age group, sex, genetic background, pre-existing clinical conditions, etc. In some embodiments, a therapeutic agent is a substance that can be used to alleviate, ameliorate, reduce, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. In some embodiments, a "therapeutic agent" is a drug that has been, or needs to be, approved by a government agency before it can be sold for administration to humans. In some embodiments, a "therapeutic agent" is a drug that requires a prescription for administration to humans.
[0062] Treat: As used herein, the terms "treat," "treatment," or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. Treatment may be administered to a subject who does not show signs of a disease, disorder, and / or condition. In some embodiments, treatment may be administered to a subject who shows only early signs of a disease, disorder, and / or condition, for example, for the purpose of reducing the risk of developing a condition associated with the disease, disorder, and / or condition.
[0063] Additionally, unless otherwise stated, in some embodiments, structures depicted herein include compounds that differ only in the presence of one or more isotopically enriched or isotopically enriched atoms. Isotopically enriched compounds may have one or more atoms replaced by an atom having an atomic mass or mass number normally found in nature. Examples of isotopes present in compounds of Formula I include, but are not limited to, 2 H, 3 H, 13 C. 14 C. 15 N, 18 O. 17 O. 35 S, and 18 Included are isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, such as F. In addition to being useful as therapeutic agents, certain isotopically labeled compounds of Formula I are also useful as analytical tools in drug and / or substrate tissue distribution assays, or as probes in other biological assays. In one aspect of the invention, tritiated (e.g., 3 H) and carbon-14 (e.g., 14 C) isotopes are useful for their ease of detectability. In another embodiment of the invention, one or more hydrogen atoms are replaced with deuterium (e.g., 2 Substitution with heavier isotopes such as 3H can provide certain therapeutic advantages. DETAILED DESCRIPTION OF THE INVENTION
[0064] Programmed axon degeneration and SARM1 Axonal degeneration is a key pathological characteristic of neurological diseases, including, but not limited to, Alzheimer's disease, Parkinson's disease, ALS, multiple sclerosis, diabetic peripheral neuropathy, chemotherapy-induced peripheral neuropathy, hereditary neuropathies, traumatic brain injury, and / or glaucoma. Damaged or unhealthy axons are eliminated by an intrinsic self-destruction program known as Wallerian degeneration, which differs from conventional cell death pathways such as apoptosis. (Gerdts, J., et al., Neuron, 2016, 89, 449-460; Whitmore, A. V. et al., Cell Death Differ., 2003, 10, 260-261). During Wallerian degeneration, peripheral nerves undergo selective degradation of axon segments distal to the injury, while proximal axon segments and cell bodies remain intact. This degeneration is characterized by an initial depletion of nicotinamide mononucleotide adenyltransferase (NMNAT), followed by loss of nicotinamide adenine dinucleotide (NAD+), loss of adenosine triphosphate (ATP), neurofilament protein degradation, and axonal degradation approximately 8-24 hours after injury (Gerdts, J., et al., Neuron, 2016, 89, 449-460).
[0065] NAD+ is a ubiquitous metabolite that plays an important role in energy metabolism and cell signaling (Belenkey et al., Trends Biochem., 2007, 32, 12-19; Chiarugi et al., Nat. Rev. Cancer, 2012, 12, 741-752). Homeostatic regulation of NAD+ levels is also involved in maintaining axonal stability and integrity. Therefore, manipulations that increase the axonal localization of NMNAT1 confer axonal protection (Babetto et al., Cell Rep., 2010, 3, 1422-1429; Sasaki et al., J. Neurosci., 2009).
[0066] A genome-wide RNAi screen in primary mouse neurons identified sterile alpha and TIR motif-containing 1 (SARM1), and knockdown of SARM1 led to long-term protection of sensory neurons against injury-induced axonal degeneration (Gerdts et al., J Neurosci, 2013, 33, 13569-13580). SARM1 belongs to the family of cytosolic adaptor proteins, but is unique among them because it is the most ancient and evolved adaptor, paradoxically inhibiting TLR signaling and identified as a central player in injury-induced axonal death pathways (O'Neill, LA & Bowie, AG, Nat. Rev. Immunol., 2007, 7, 353-364; Osterloh, JM, et al., Science, 2012, 337, 481-484; Gerdts, J., et al., J. Neurosci. 33, 2013, 13569-13580). Activation of SARM1 via axonal injury or forced dimerization of the SARM1-TIR domain promotes rapid and catastrophic depletion of nicotinamide adenine dinucleotide (NAD), followed quickly by axonal degradation, highlighting the central role of NAD homeostasis in axonal integrity. (Gerdts, J., et al., Science, 2015, 348, 453-457). SARM1 is required for this injury-induced NAD+ depletion both in vitro and in vivo, and SARM1 activation locally causes axonal degeneration through NAD(+) destruction (Gerdts et al., et al., Science, 2015, 348, 452-457; Sasaki et al., J. Biol. Chem. 2015, 290, 17228-17238, both of which are incorporated herein by reference in their entirety).
[0067] Genetic loss-of-function studies have demonstrated that SARM1 functions as a central executor of the axon degeneration pathway after injury. Genetic knockout of SARM1 allows axon preservation for more than 14 days after nerve transection (Osterloh, JM, et al., Science, 2012, 337, 481-484; Gerdts, J., et al., J. Neurosci., 2013, 33, 13569-13580) and improves functional outcomes in mice after traumatic brain injury (Henninger, N. et al., Brain 139, 2016, 1094-1105). In addition to its role in direct axonal damage, SARM1 is also required for the axon degeneration observed in chemotherapy-induced peripheral neuropathy. Loss of SARM1 blocks chemotherapy-induced peripheral neuropathy and inhibits both axonal degeneration and increased pain sensitivity that develop after chemotherapy vincristine treatment (Geisler et al, Brain, 2016, 139, 3092-3108).
[0068] SARM1 contains several conserved motifs, including a SAM domain, an ARM / HEAT motif, and a TIR domain (Figure 1), which mediates oligomerization and protein-protein interactions (O'Neill, LA & Bowie, AG, Nat. Rev. Immunol., 2007, 7, 353-364; Tewari, R., et al., Trends Cell Biol., 2010, 20, 470-481; Qiao, F. & Bowie, JU, Sci. STKE 2005, re7, 2005). TIR domains are commonly found in signaling proteins that function in innate immune pathways, where they function as scaffolds for protein complexes (O'Neill, LA & Bowie, AG, Nat. Rev. Immunol., 2007, 7, 353-364). Interestingly, dimerization of the SARM1-TIR domain is sufficient to induce axonal degeneration and rapidly cause NAD degradation by acting as an NAD cleaving enzyme (Milbrandt et al., WO2018 / 057989; Gerdts, J., et al., Science, 2015, 348, 453-457). Given the central role of SARM1 in axonal degeneration pathways and its identified NADase activity, attempts have been made to identify agents that can modulate SARM1 and potentially function as useful therapeutic agents to protect against neurodegenerative diseases, including, for example, peripheral neuropathy, traumatic brain injury, and / or neurodegenerative diseases.
[0069] Among other things, the present disclosure provides certain compounds and / or compositions that act as SARM1 inhibitors (eg, as SARM1 inhibitors), and technology related thereto.
[0070] compound In some embodiments, the present disclosure provides a compound having a structure as set forth in Formula I: [ka] or a pharmaceutically acceptable salt thereof, wherein: Ring A, together with the carbon atom to which it is fused, is a 6-membered aryl ring or a 6-membered heteroaryl ring having 1 to 3 nitrogen atoms; L is optionally substituted C 1-4 an aliphatic chain in which one carbon atom is optionally replaced by a group selected from -O-, -N(R)-, -S-, -C(O)-, -C(O)N(R)-, -N(R)C(O)-, -C(O)O-, -OC(O)-, -S(O)N(R)-, -N(R)S(O)-, and an optionally substituted divalent 3- to 6-membered monocyclic ring having 0-2 heteroatoms independently selected from oxygen, nitrogen, and sulfur; R 1 is an optionally substituted group selected from a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur, and a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; R 2 is an optionally substituted group, C 1-6 an optionally substituted group selected from aliphatic; a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; phenyl; a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; an 8- to 10-membered bicyclic saturated, partially unsaturated, or aryl carbocyclic ring; an 8- to 10-membered bicyclic saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; and an 8- to 10-membered bicyclic heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; Each R y are independently selected from halogen, cyano, OR, SR, N(R)2, and optionally substituted C 1-4 selected from aliphatic each R is independently hydrogen or an optionally substituted group; C 1-6an optionally substituted group selected from aliphatic; a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; phenyl; and a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; or two R groups, together with the nitrogen atom to which they are attached, form an optionally substituted 3- to 7-membered monocyclic heterocyclic ring having 0-2 additional heteroatoms independently selected from oxygen, nitrogen, and sulfur; n is 0, 1, or 2, or a pharmaceutically acceptable salt thereof.
[0071] As generally defined above, ring A, together with the carbon atom to which it is fused, is a 6-membered aryl ring or a 6-membered heteroaryl ring having 1 to 3 nitrogen atoms. In some embodiments, ring A is a 6-membered aryl ring. In some embodiments, ring A is a 6-membered heteroaryl ring having 1 to 3 nitrogen atoms. In some embodiments, ring A is a 6-membered heteroaryl ring having 1 to 2 nitrogen atoms. In some embodiments, ring A is a 6-membered heteroaryl ring having 1 nitrogen atom. In some embodiments, ring A is a 6-membered heteroaryl ring having 2 nitrogen atoms. In some such embodiments, ring A is selected from pyrimidinyl and pyridazinyl.
[0072] In some embodiments, the present disclosure provides compounds of formula Ia, Ib, Ic, Id, Ie, If, Ig, Ih, Ii, Ij, Ik, Il, Im, and In: [ka] or a pharmaceutically acceptable salt thereof, wherein L, R 1 , R 2 , R y and n are each as defined above and described herein, or a pharmaceutically acceptable salt thereof.
[0073] L is an optionally substituted C 1-4 an aliphatic chain in which one carbon atom in the aliphatic chain is optionally replaced with a group selected from -O-, -N(R)-, -S-, -C(O)-, -C(O)N(R)-, -N(R)C(O)-, -C(O)O-, -OC(O)-, -S(O)N(R)-, -N(R)S(O)-, and an optionally substituted divalent 3- to 6-membered monocyclic ring having 0-2 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, L is an optionally substituted C(O) group in which one carbon atom in the aliphatic chain is optionally replaced with a group selected from -O- and -N(R)-. ~41-4 In some embodiments, L is an optionally substituted C ~41-4 In some embodiments, L is an optionally substituted C2 aliphatic chain in which one carbon atom in the aliphatic chain is optionally replaced by an optionally substituted divalent 3-6 membered monocyclic ring having 0-2 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, L is an optionally substituted C2 aliphatic chain in which one carbon atom in the aliphatic chain is optionally replaced by a group selected from -O- and -N(R)-. In some embodiments, L is an optionally substituted C2 aliphatic chain in which one carbon atom in the aliphatic chain is optionally replaced by an optionally substituted divalent 3-6 membered monocyclic ring having 0-2 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
[0074] In some embodiments, L is selected from: [ka]
[0075] In some embodiments, L is [ka] is.
[0076] As generally defined above, R 1 is an optionally substituted group selected from a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur, and a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
[0077] In some embodiments, R 1 is an optionally substituted 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R 1 is an optionally substituted 5-6 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R 1 is an optionally substituted group selected from pyrrolidinyl, piperidinyl, morpholinyl, and piperazinyl.
[0078] In some embodiments, R 1 is an optionally substituted 5-6 membered heteroaryl ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
[0079] In some embodiments, R 1 is an optionally substituted 5-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R 1 is an optionally substituted 5-membered heteroaryl ring having 1 to 2 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R 1 is an optionally substituted group selected from pyrazolyl, imidazolyl, isothiazolyl, thiazolyl, oxazolyl, and thiophenyl rings.
[0080] In some embodiments, R 1is an optionally substituted 6-membered heteroaryl ring having 1 to 3 nitrogen atoms. In some embodiments, R 1 is an optionally substituted 6-membered heteroaryl ring having 1-2 nitrogen atoms. In some embodiments, R 1 is an optionally substituted group selected from pyridinyl, pyrimidinyl, and pyridazinyl.
[0081] In some embodiments, R 1 is selected from the following: [ka]
[0082] In certain particularly preferred embodiments, R 1 teeth, [ka] is selected from.
[0083] As generally defined above, R 2 is an optionally substituted group, C 1-6 an optionally substituted group selected from aliphatic; a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; phenyl; a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; an 8- to 10-membered bicyclic saturated, partially unsaturated, or aryl carbocyclic ring; an 8- to 10-membered bicyclic saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; and an 8- to 10-membered bicyclic heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
[0084] In some embodiments, R 2 is an arbitrarily substituted C 1-6 In some embodiments, R 2is an optionally substituted group selected from cyclopentyl and cyclohexyl. In some embodiments, R 2 is C 1-6 In some embodiments, R 2 is methyl. In some embodiments, R 2 is ethyl. In some embodiments, R 2 is cyclohexyl.
[0085] In some embodiments, R 2 is optionally substituted phenyl.
[0086] In some embodiments, R 2 is an optionally substituted 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R 2 is an optionally substituted 3-membered saturated heterocyclic ring having one heteroatom selected from oxygen, nitrogen, and sulfur. In some embodiments, R 2 is an optionally substituted 4-membered saturated heterocyclic ring having one heteroatom selected from oxygen, nitrogen, and sulfur. In some embodiments, R 2 is an optionally substituted 5-membered saturated or partially unsaturated heterocyclic ring having 1 to 2 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R 2 is an optionally substituted 6-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R 2 is an optionally substituted group selected from pyrrolidinyl, piperidinyl, morpholinyl, and piperazinyl.
[0087] In some embodiments, R 2 is an optionally substituted 5-6 membered heteroaryl ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R2 is an optionally substituted 5-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R 2 is an optionally substituted 5-membered heteroaryl ring having 1 to 2 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some such embodiments, R 2 is an optionally substituted group selected from thiophenyl, pyrazolyl, and imidazolyl.
[0088] In some embodiments, R 2 is an optionally substituted 6-membered heteroaryl ring having 1 to 3 nitrogen atoms. In some embodiments, R 2 is an optionally substituted 6-membered heteroaryl ring having 1-2 nitrogen atoms. In some embodiments, R 2 is an optionally substituted group selected from pyridinyl or pyrimidinyl.
[0089] In some embodiments, R 2 is an optionally substituted 8-10 membered bicyclic saturated, partially unsaturated, or aryl carbocyclic ring. In some embodiments, R 2 is an optionally substituted 9-membered bicyclic saturated, partially unsaturated, or aryl carbocyclic ring. In some such embodiments, R 2 is optionally substituted 2,3-dihydro-1H-indenyl. In some embodiments, R 2 is an optionally substituted 10-membered bicyclic saturated, partially unsaturated, or aryl carbocyclic ring. In some such embodiments, R 2 is an optionally substituted group selected from 1,2,3,4-tetrahydronaphthalenyl and naphthalenyl.
[0090] In some embodiments, R 2is an optionally substituted 8-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R 2 is an optionally substituted 9-membered bicyclic saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R 2 is an optionally substituted 10-membered bicyclic saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some such embodiments, R 2 is an optionally substituted group selected from chromanyl, isochromanyl, 1,2,3,4-tetrahydroquinolinyl, 3,4-dihydro-2H-benzo[b][1,4]oxazinyl, and 2H-benzo[b][1,4]oxazin-3(4H)-onyl.
[0091] In some embodiments, R 2 is an optionally substituted 8-10 membered bicyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 2 is an optionally substituted 9-membered bicyclic heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some such embodiments, R 2 is an optionally substituted group selected from indolyl, benzopyrazolyl, benzimidazolyl, and imidazo[1,2-a]pyridinyl.
[0092] In some embodiments, R 2 is selected from the group consisting of: [ka]
[0093] In some embodiments, -LR 2 is selected from the group consisting of: [ka]
[0094] As generally defined above, each R y are independently selected from halogen, cyano, OR, SR, N(R)2, and optionally substituted C 1-4 is selected from aliphatic.
[0095] In some embodiments, R y is halogen. In some such embodiments, R y is chloro or bromo.
[0096] In some embodiments, R y is cyano.
[0097] In some embodiments, R y is OR. In some embodiments, R y is OR, hydrogen and optionally substituted C 1-6 In some embodiments, R y is OR, hydrogen and optionally substituted C 1-4 In some embodiments, R y is selected from OH, OCH3, and OCH2CH3.
[0098] In some embodiments, R y is SR. In some embodiments, R y is SR, where R is hydrogen and optionally substituted C 1-6 In some embodiments, R y is SR, where R is hydrogen and optionally substituted C 1-4 In some embodiments, R y is selected from SH, SCH3, and SCH2CH3.
[0099] In some embodiments, R yis N(R). In some embodiments, R y is N(R)2, where R is hydrogen and optionally substituted C 1-6 In some embodiments, R y is N(R)2, where R is hydrogen and optionally substituted C 1-4 In some embodiments, R y is selected from NH2, NHCH3, NHCH2CH3, N(CH3)2, and N(CH2CH3)2.
[0100] In some embodiments, R y is an arbitrarily substituted C ~41-4 In some embodiments, R y is methyl, ethyl, or isopropyl. y is an arbitrarily substituted C 3-4 In some such embodiments, R y is tert-butyl, [ka] is selected from.
[0101] In some embodiments, R y is a halogen, -(CH2) 0-4 R°, -(CH2) 0-4 OR°, -(CH2) 0-4 N(R°)2, -(CH2) 0-4 C(O)OR°, and -(CH2) 0-4 C optionally substituted with a group selected from C(O)NR°2 1-4 In some such embodiments, R° is hydrogen; 1-6 Aliphatic;-CH2Ph;-O(CH2) 0-1Ph; -CH2- (a 5-6 membered heteroaryl ring); a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; and an 8-10 membered bicyclic aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or two independent occurrences of R° together with their intervening atoms form a 3-12 membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
[0102] In some embodiments, R y is C optionally substituted with a group selected from halogen, -R°, -OR°, -N(R°)2, -C(O)OR°, and -C(O)NR°2; 1-4 In some embodiments, R y is an optionally halogen-substituted C ~41-4 In some such embodiments, R y is selected from —CH 3 , —CF 3 , —CHF 2 , and CH 2 F.
[0103] In some embodiments, R y is selected from —CHR°, —CHOR°, —CHN(R°), —CHC(O)OR°, and —CHC(O)N(R°). In some such embodiments, R y is selected from —CHOH, —CHOCH, —CHC(O)NH, —CHC(O)NHCH, and —CHC(O)N(CH).
[0104] As generally defined above, each R is independently hydrogen or an optionally substituted group, and C 1-6an optionally substituted group selected from aliphatic; a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; phenyl; and a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; or two R groups, taken together with the nitrogen atom to which they are attached, form an optionally substituted 3- to 7-membered monocyclic heterocyclic ring having 0-2 additional heteroatoms independently selected from oxygen, nitrogen, and sulfur. In some embodiments, R is hydrogen. In some embodiments, R is an optionally substituted group selected from C 1-6 an optionally substituted group selected from aliphatic; a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; phenyl; and a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur, or two R groups together with the nitrogen atom to which they are attached form an optionally substituted 3- to 7-membered monocyclic heterocyclic ring having 0-2 additional heteroatoms independently selected from oxygen, nitrogen, and sulfur.
[0105] In some embodiments, R is optionally substituted C 1-6 In some embodiments, R is a C optionally substituted with oxo and OR°. 1-6 Aliphatic, R° is C 1-6 In some such embodiments, R is —C(O)OtBu.
[0106] In some embodiments, R is C 1-6 In some such embodiments, R is methyl or ethyl.
[0107] In some such embodiments, R is selected from the group consisting of hydrogen and optionally substituted C 1-6 In some such embodiments, R is selected from hydrogen, methyl, and ethyl.
[0108] In some embodiments, the present disclosure provides compounds of formula Iai, Ibi, Ici, Iei, Ifi, Ihi, and Iji: [ka] or a pharmaceutically acceptable salt thereof, wherein L, R 1 , R 2 , R y and n are each as defined above and described herein, or a pharmaceutically acceptable salt thereof.
[0109] In some embodiments, the present disclosure provides a compound selected from: [Table 1] or a pharmaceutically acceptable salt thereof.
[0110] In some aspects, the present disclosure provides compounds according to the following embodiments:
[0111] Embodiment 1. A compound of Formula I: [ka] or a pharmaceutically acceptable salt thereof, wherein: Ring A, together with the carbon atom to which it is fused, is a 6-membered aryl ring or a 6-membered heteroaryl ring having 1 to 3 nitrogen atoms; L is optionally substituted C 1-4 an aliphatic chain in which one carbon atom is optionally replaced by a group selected from -O-, -N(R)-, -S-, -C(O)-, -C(O)N(R)-, -N(R)C(O)-, -C(O)O-, -OC(O)-, -S(O)N(R)-, -N(R)S(O)-, and an optionally substituted divalent 3- to 6-membered monocyclic ring having 0-2 heteroatoms independently selected from oxygen, nitrogen, and sulfur; R 1 is an optionally substituted group selected from a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur, and a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; R 2 is an optionally substituted group, C 1-6 an optionally substituted group selected from aliphatic; a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; phenyl; a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; an 8- to 10-membered bicyclic saturated, partially unsaturated, or aryl carbocyclic ring; an 8- to 10-membered bicyclic saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; and an 8- to 10-membered bicyclic heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; Each R y are independently selected from halogen, cyano, OR, SR, N(R)2, and optionally substituted C 1-4 selected from aliphatic each R is independently hydrogen or an optionally substituted group; C 1-6 an optionally substituted group selected from aliphatic; a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; phenyl; and a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; or two R groups, together with the nitrogen atom to which they are attached, form an optionally substituted 3- to 7-membered monocyclic heterocyclic ring having 0-2 additional heteroatoms independently selected from oxygen, nitrogen, and sulfur; n is 0, 1, or 2, or a pharmaceutically acceptable salt thereof.
[0112] Embodiment 2. The compound of embodiment 1, wherein ring A is a 6-membered aryl ring.
[0113] Embodiment 3. The compound of embodiment 1, wherein ring A is a 6-membered heteroaryl ring having 1 to 3 nitrogen atoms.
[0114] Embodiment 4. The compound of embodiment 1, wherein ring A is a 6-membered heteroaryl ring having one nitrogen atom.
[0115] Embodiment 5. The compound of embodiment 1, wherein ring A is a 6-membered heteroaryl ring having two nitrogen atoms.
[0116] Embodiment 6. The compound is a compound of formula Ia, Ib, Ic, Id, Ie, If, Ig, Ih, Ii, Ij, Ik, Il, Im, and In: [ka] or a pharmaceutically acceptable salt thereof.
[0117] Embodiment 7.R 1 is an optionally substituted 5-6 membered heteroaryl ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
[0118] Embodiment 8.R 1 is an optionally substituted 5-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
[0119] Embodiment 9.R 1 is an optionally substituted 5-membered heteroaryl ring having 1-2 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
[0120] Embodiment 10.R 1The compound of embodiment 7, wherein is an optionally substituted 6-membered heteroaryl ring having 1 to 3 nitrogen atoms.
[0121] Embodiment 11.R 1 The compound of embodiment 10, wherein is an optionally substituted 6-membered heteroaryl ring having 1-2 nitrogen atoms.
[0122] Embodiment 12.R 1 is selected from the following: [ka]
[0123] Embodiment 13.R 1 but, [ka] 13. The compound of embodiment 12, selected from:
[0124] Embodiment 14. L is optionally substituted C 1-4 The compound of any one of embodiments 1-13, which is an aliphatic chain wherein one carbon atom in the aliphatic chain is optionally replaced with a group selected from —O—, —N(R)—, —S—, —C(O)—, —C(O)N(R)—, —N(R)C(O)—, —C(O)O—, —OC(O)—, —S(O)N(R)—, —N(R)S(O)—, and an optionally substituted divalent 3- to 6-membered monocyclic ring having 0-2 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
[0125] Embodiment 15. L is optionally substituted C 1-2 The compound of embodiment 14, which is an aliphatic chain, wherein one carbon atom in the aliphatic chain is replaced with a group selected from -O- or -N(R)-.
[0126] Embodiment 16. L is optionally substituted C 1-2The compound of embodiment 14 or 15, which is an aliphatic chain, wherein one carbon atom in the aliphatic chain is replaced by a group selected from -O- or -N(H)-.
[0127] Embodiment 17. L is optionally substituted C 1-2 The compound of embodiment 14 or 15, which is an aliphatic chain, and one carbon atom in the aliphatic chain is replaced by -O-.
[0128] Embodiment 18. L is optionally substituted C 1-2 The compound of embodiment 16, wherein the aliphatic chain is one carbon atom in the aliphatic chain is replaced by -N(H)-.
[0129] Embodiment 19. The compound of any one of embodiments 1 to 13, wherein L is selected from: [ka]
[0130] Embodiment 20. A compound according to any one of embodiments 1 to 15 or 19, wherein R is hydrogen.
[0131] Embodiment 21. R is optionally substituted C 1-6 The compound of any one of embodiments 1 to 15 or 19, which is aliphatic.
[0132] Embodiment 22. A compound according to embodiment 21, wherein R is methyl or ethyl.
[0133] Embodiment 23.R 2 is an optionally substituted group, C 1-623. The compound of any one of embodiments 1-22, wherein the optionally substituted group is selected from: aliphatic; a 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; phenyl; a 5-6 membered heteroaryl ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; an 8-10 membered bicyclic saturated, partially unsaturated, or aryl carbocyclic ring; an 8-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; and an 8-10 membered bicyclic heteroaryl ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
[0134] Embodiment 24.R 2 is arbitrarily substituted C 1-6 The compound of embodiment 23, which is aliphatic.
[0135] Embodiment 25.R 2 is methyl or ethyl.
[0136] Embodiment 26.R 2 The compound of embodiment 24, wherein is optionally substituted cyclohexyl.
[0137] Embodiment 27.R 2 The compound of embodiment 23, wherein is optionally substituted phenyl.
[0138] Embodiment 28.R 2 is an optionally substituted 5-6 membered heteroaryl ring having 1-3 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
[0139] Embodiment 29.R 2 but, Compounds according to embodiment 28, which are optionally substituted 5-membered heteroaryl rings having 1 to 2 heteroatoms independently selected from oxygen, nitrogen, and sulfur.
[0140] Embodiment 30.R 2 30. The compound of embodiment 28 or 29, wherein is an optionally substituted group selected from thiophenyl, pyrazolyl, and imidazolyl.
[0141] Embodiment 31.R 2 The compound of embodiment 28, wherein is an optionally substituted 6-membered heteroaryl ring having 1 to 3 nitrogen atoms.
[0142] Embodiment 32.R 2 The compound of embodiment 31, wherein is an optionally substituted 6-membered heteroaryl ring having 1-2 nitrogen atoms.
[0143] Embodiment 33.R 2 is an optionally substituted group selected from pyridinyl or pyrimidinyl.
[0144] Embodiment 34.R 2 but, The compound of embodiment 23, selected from the group consisting of: [ka]
[0145] Embodiment 35.R y The compound of any one of embodiments 1-34, wherein is halogen.
[0146] Embodiment 36.R y The compound of any one of embodiments 1-34, wherein is cyano.
[0147] Embodiment 37.R y The compound of any one of embodiments 1-34, wherein is OR.
[0148] Embodiment 38.R y The compound of any one of embodiments 1-34, wherein is SR.
[0149] Embodiment 39.Ry The compound of any one of embodiments 1-34, wherein is N(R)2.
[0150] Embodiment 40. R is selected from hydrogen and optionally substituted C 1-6 The compound of any one of embodiments 37-39, wherein the compound is selected from aliphatic.
[0151] Embodiment 41. R is selected from hydrogen and optionally substituted C 1-4 The compound of embodiment 40, wherein the compound is selected from aliphatic.
[0152] Embodiment 42.R y The compound of any one of embodiments 37, 40, and 41, wherein is OH, OCH3, and OCH2CH3.
[0153] Embodiment 43.R y The compound of any one of embodiments 38, 40, and 41, wherein is SH, SCH3, and SCH2CH3.
[0154] Embodiment 44.R y The compound of any one of embodiments 39-41, wherein is selected from NH2, NHCH3, NHCH2CH3, N(CH3)2, and N(CH2CH3)2.
[0155] Embodiment 45.R y is arbitrarily substituted C 1-4 The compound of any one of embodiments 1-34, which is aliphatic.
[0156] Embodiment 46.R y is arbitrarily substituted C 3-4 The compound of embodiment 45, which is aliphatic.
[0157] Embodiment 47.R y But tert-butyl, [ka] 47. The compound of embodiment 46, selected from:
[0158] Embodiment 48.R y But halogen, -(CH2) 0-4 R°, -(CH2) 0-4 OR°, -(CH2) 0-4 N(R°)2, -(CH2) 0-4 C(O)OR°, and -(CH2) 0-4 C optionally substituted with a group selected from C(O)NR°2 1-4 The compound of embodiment 45, which is aliphatic.
[0159] Embodiment 49. R° is hydrogen; C 1-6 Aliphatic;-CH2Ph;-O(CH2) 0-1 Compounds according to embodiment 48, wherein the ring is selected from Ph; —CH—(a 5-6 membered heteroaryl ring); a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; and an 8-10 membered bicyclic aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or two independent occurrences of R°, taken together with their intervening atoms, form a 3-12 membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
[0160] Embodiment 50.R y is optionally substituted with a group selected from halogen, —R°, —OR°, —N(R°)2, —C(O)OR°, and —C(O)NR°2; 1-4 The compound of embodiment 45, which is aliphatic.
[0161] Embodiment 51.R y C optionally substituted with halogen 1-4 The compound of embodiment 45, which is aliphatic.
[0162] Embodiment 52.R y is selected from —CH 3 , —CF 3 , —CHF 2 , and CH 2 F.
[0163] Embodiment 53.R y is selected from —CHR°, —CHOR°, —CHN(R°), —CHC(O)OR°, and —CHC(O)N(R°).
[0164] Embodiment 54.R y is selected from —CH 2 OH, —CH 2 OCH 3 , —CH 2 C(O)NH 2 , —CH 2 C(O)NHCH 3 , and —CH 2 C(O)N(CH 3 ) 2 .
[0165] Embodiment 55. The compound is represented by the formulae Iai, Ibi, Ici, Iei, Ifi, Ihi, and Iji: [ka] or a pharmaceutically acceptable salt thereof.
[0166] Embodiment 56. A pharmaceutical composition comprising a compound according to any one of embodiments 1 to 55 and a pharmaceutically acceptable carrier.
[0167] Embodiment 57. A method comprising the step of administering a compound of any one of embodiments 1-55 to a subject (i) having a condition characterized by axonal degeneration, or (ii) at risk of developing a condition characterized by axonal degeneration.
[0168] Embodiment 58. A method for treating or preventing axonal degeneration, comprising administering to a subject in need thereof a compound of any one of embodiments 1 to 55.
[0169] Embodiment 59. A method of inhibiting SARM1, comprising contacting a biological sample with a compound of any one of embodiments 1 to 55.
[0170] Embodiment 60. A compound according to any one of embodiments 1 to 55 for use in medicine.
[0171] Embodiment 61. A compound according to any one of embodiments 1 to 55 for use in treating one or more diseases, disorders, or conditions mediated by SARM1.
[0172] Embodiment 62. A compound according to any one of embodiments 1 to 55 for use in treating or preventing axonal degeneration.
[0173] composition In some embodiments, a compound of formula I can be provided in a composition, eg, in combination (eg, a mixture) with one or more other components.
[0174] In some embodiments, the present disclosure provides compositions that contain and / or deliver a compound of formula I or an active metabolite thereof, e.g., when contacted with or otherwise administered to a system or environment, e.g., the system or environment may contain SARM1 NADase activity, and in some embodiments, administration of such a composition to the system or environment achieves inhibition of SARM1 activity, as described herein.
[0175] In some embodiments, a provided composition described herein may be a pharmaceutical composition in that it comprises an active agent and one or more pharmaceutically acceptable excipients, and in some such embodiments, a provided pharmaceutical composition comprises and / or delivers to a relevant system or environment (e.g., a subject in need thereof) a compound of Formula I or an active metabolite thereof as described herein.
[0176] In some embodiments, one or more compounds of formula I are provided and / or utilized in the form of a pharmaceutically acceptable salt.
[0177] In particular, the present disclosure provides compositions comprising a compound of Formula I, or a pharmaceutically acceptable salt or derivative thereof, and a pharmaceutically acceptable carrier, adjuvant, or vehicle. The amount of the compound in the provided compositions is such that it is effective to measurably inhibit axonal degeneration in a biological sample or patient. In certain embodiments, the provided compounds or compositions are formulated for administration to a patient in need of such a composition. The compounds and compositions according to the methods of the present disclosure may be administered using any amount and any route of administration effective to treat or reduce the severity of any disease or disorder described herein. The provided compounds are preferably formulated in dosage unit form for ease of administration and uniformity of dosage. As used herein, the phrase "dosage unit form" refers to a physically discrete unit of drug appropriate for the patient to be treated. However, it will be understood that the total daily usage of the provided compounds and compositions will be determined by the attending physician within the scope of sound medical judgment. The specific effective dosage level in any particular patient or organism will depend on a variety of factors, including the disorder being treated and the severity of the disorder, the activity of the specific compound used, the specific composition used and its route of administration, the patient's species, age, weight, sex, and diet, the general condition of the subject, the timing of administration, the excretion rate of the specific compound used, the duration of treatment, drugs used in combination with or concomitantly with the specific compound used, etc.
[0178] Provided compositions may be administered orally, parenterally, by inhalation or nasal spray, topically (e.g., by powder, ointment, or infusion), rectally, bucally, intravaginally, intraperitoneally, intracisternally, or via an implanted reservoir, depending on the severity of the condition being treated. Preferably, the compositions are administered orally, intraperitoneally, or intravenously. In certain embodiments, provided compounds are administered orally or parenterally at a dosage level of about 0.01 mg / kg to about 50 mg / kg of subject body weight per day, one or more times daily to achieve the desired therapeutic effect.
[0179] The term "parenteral" as used herein includes subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injection or infusion techniques. Sterile injectable forms of the provided compositions may be aqueous or oily suspensions. These suspensions can be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that can be used are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally used as solvents or suspending media.
[0180] For this purpose, any bland fixed oil can be used, including synthetic monoglycerides or diglycerides. Fatty acids such as oleic acid and its glyceride derivatives are useful for preparing injections, as are natural pharmaceutically acceptable oils such as olive oil or castor oil, especially their polyoxyethylated versions. These oil solutions or suspensions can also contain long-chain alcohol diluents or dispersants, such as carboxymethylcellulose or similar dispersants, which are commonly used in the formulation of pharmaceutically acceptable dosage forms, including emulsions and suspensions. Other commonly used surfactants, such as Tween, spans, and other emulsifiers or bioavailability enhancers, which are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms, can also be used for formulation purposes.
[0181] Injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium before use.
[0182] In some cases, it is desirable to slow the absorption of the compound from subcutaneous or intramuscular injection to prolong the effect of the compound. This can be accomplished by using a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the compound then depends on its dissolution rate, which in turn may depend on crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered compound form can be achieved by dissolving or suspending the compound in an oil vehicle. Injectable depot formulations are made by forming microencapsule matrices of the compound in biodegradable polymers such as polylactide-polyglycolide. The compound release rate can be controlled depending on the ratio of compound to polymer and the nature of the particular polymer used. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Injectable depot formulations can also be prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues.
[0183] The pharmaceutically acceptable compositions described herein can be orally administered in any orally acceptable dosage form, including but not limited to capsules, tablets, aqueous suspensions or solutions.In such solid dosage forms, the active compound can be mixed with at least one inert diluent, such as sucrose, lactose, or starch.Such dosage forms can also contain, as is customary, additional substances other than inert diluents, such as lubricants and other tableting aids, such as magnesium stearate and microcrystalline cellulose.When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents.If desired, certain sweeteners, flavors, or coloring agents can be added.
[0184] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one inert pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate, and / or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia; c) hygroscopic agents such as glycerol; d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; e) solution retarding agents such as paraffin; f) absorption accelerators such as quaternary ammonium compounds; g) humectants such as, for example, cetyl alcohol and glycerol monostearate; h) absorbents such as kaolin and bentonite clay; and / or i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents. The active compounds can also be in micro-encapsulated form with one or more excipients as noted above.
[0185] Solid compositions of a similar type may also be employed as fillers for soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar, and high molecular weight polyethylene glycols, and the like. Solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings (i.e., buffers) and other coatings well known in the pharmaceutical formulating art. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes.
[0186] Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active ingredient, liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide oil (specifically cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol, and sorbitan fatty acid esters, and mixtures thereof. In addition to inert diluents, oral compositions may also contain adjuvants such as wetting agents, emulsifiers and suspending agents, sweeteners, flavorings, and fragrances.
[0187] Alternatively, the pharmaceutically acceptable compositions described herein can be administered in the form of suppositories for rectal or vaginal administration. These can be prepared by mixing the compounds of the present disclosure with a suitable non-irritating excipient or carrier that is solid at room temperature but liquid at body temperature (rectum or vagina), and therefore melts in the rectum or vaginal cavity to release the active compound. Such materials include cocoa butter, suppository wax (e.g., beeswax) and polyethylene glycol.
[0188] The pharmaceutically acceptable compositions described herein may also be administered topically, particularly when the target of treatment includes areas or organs readily accessible by topical application, including diseases of the eye, the skin, or the lower intestinal tract. Topical application to the lower intestinal tract can be effected in a rectal suppository formulation (see above) or in a suitable enema formulation.
[0189] Dosage forms for topical or transdermal administration of the provided compounds include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, or patches. The active ingredient is mixed under sterile conditions with a pharmaceutically acceptable carrier and, if necessary, necessary preservatives or buffers. Ophthalmic formulations, ear drops, and eye drops are also contemplated within the scope of this disclosure. Additionally, the present disclosure contemplates the use of transdermal patches, which have the added advantage of providing controlled delivery of the compound to the body. Such dosage forms can be made by dissolving or dispersing the compound in a suitable medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. This rate can be controlled by either providing a flow-controlling membrane or dispersing the compound in a polymer matrix or gel.
[0190] For topical application, the provided pharmaceutically acceptable composition can be formulated into a suitable ointment containing the active ingredient suspended or dissolved in one or more carriers.Carriers for topical administration of the compounds of the present disclosure include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene compounds, emulsifying wax, and water.Alternatively, the provided pharmaceutically acceptable composition can be formulated into a suitable lotion or cream containing the active ingredient suspended or dissolved in one or more pharmaceutically acceptable carriers.Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl ester wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol, and water.
[0191] For ophthalmic use, the pharmaceutically acceptable composition may be formulated as a micronized suspension in isotonic, pH-adjusted, sterile saline, or preferably as a solution in isotonic, pH-adjusted, sterile saline, with or without a preservative such as benzylalkonium chloride. Alternatively, for ophthalmic use, the pharmaceutically acceptable composition may be formulated into an ointment such as petrolatum.
[0192] The pharmaceutically acceptable compositions of this disclosure may also be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well known in the pharmaceutical art and may be prepared as solutions in saline using benzyl alcohol or other suitable preservatives, absorption enhancers to enhance bioavailability, fluorocarbons, and / or other conventional solubilizing or dispersing agents.
[0193] Most preferably, the pharmaceutically acceptable compositions of the present disclosure are formulated for oral administration.
[0194] Identification and / or characterization of compounds and / or compositions Among other things, the present disclosure provides various techniques for identifying and / or characterizing the compounds and / or compositions described herein. For example, the present disclosure provides various assays for assessing SARM1 inhibitory activity, particularly for assessing SARM1 inhibitory activity.
[0195] In some embodiments, the performance of one or more compounds or compositions of interest in an assay such as those described herein is compared to the performance of a suitable reference. For example, in some embodiments, the reference can be the absence of the relevant compound or composition. Alternatively, or additionally, in some embodiments, the reference can be the presence of an alternative compound or composition, e.g., the alternative compound or composition has known performance in the relevant assay (e.g., as a positive or negative control, as understood in the art). In some embodiments, the reference can be an alternative but equivalent set of conditions (e.g., temperature, pH, salt concentration, etc.). In some embodiments, the reference can be the performance of the compound or composition with respect to a SARM1 variant.
[0196] Further alternatively or additionally, in some embodiments, the performance of one or more compounds or compositions of interest in the assays described herein may be evaluated, for example, in the presence of a suitable reference compound or composition, such that the ability of the compound or composition to compete with the reference is determined.
[0197] In some embodiments, a plurality of compounds or compositions of interest may be subjected to analysis in a particular assay and / or compared to the same reference. In some embodiments, such a plurality of compounds or compositions may be or may include a set of compounds or compositions that are considered to be a "library" because multiple members share one or more characteristics (e.g., structural elements, source identity, synthetic similarity, etc.).
[0198] Certain exemplary assays that may be useful in practicing the present disclosure are illustrated in the Examples below. Those of skill in the art reading this disclosure will recognize that useful or relevant systems for identifying and / or characterizing compounds and / or compositions in accordance with the present disclosure are not limited to those included in the Examples or discussed below.
[0199] In some embodiments, compounds and / or compositions can be identified and / or characterized based on one or more activities or characteristics, such as, for example, promoting axonal integrity, cytoskeletal stability, and / or neuronal survival. In some embodiments, provided SARM1 inhibitors inhibit the catabolism of NAD+ by SARM1. In some embodiments, provided SARM1 inhibitors slow the rate of NAD+ catabolism.
[0200] In some embodiments, provided SARM1 inhibitors reduce or inhibit NAD binding by SARM1. In some embodiments, provided SARM1 inhibitors bind to SARM1 within a pocket that contains one or more catalytic residues (e.g., the catalytic cleft of SARM1). An example of such a catalytic residue includes glutamic acid at position 642 (E642).
[0201] In some embodiments, provided SARM1 inhibitors disrupt and / or prevent multimerization of the TIR1 domain of SARM1. In some embodiments, provided SARM1 inhibitors disrupt multimerization of the SAM domain. In some embodiments, provided SARM1 inhibitors disrupt axonal signaling cascades that lead to NAD+ depletion.
[0202] In some embodiments, the present disclosure provides assays useful for identifying and / or characterizing one or more activities and / or characteristics of compounds and / or compositions of interest. For example, in some embodiments, the present disclosure provides in vitro, cellular, and / or in vivo systems for assessing one or more such activities and / or characteristics.
[0203] SARM1 activity assay In some embodiments, a method for identifying a SARM1 inhibitor includes: a) providing a mixture containing i) a mutant or fragment of SARM1, ii) NAD+, and iii) a candidate inhibitor, wherein the mutant or fragment has constitutive activity; b) incubating the mixture; c) quantifying the NAD+ in the mixture after incubation; and d) identifying the candidate inhibitor compound as an inhibitor if the amount of NAD+ is greater than the amount in a control mixture not containing the candidate inhibitor.
[0204] In some embodiments, a method for identifying a SARM1 inhibitor is provided, comprising: a) providing a mixture comprising i) full-length SARM1, ii) NAD+, and iii) a candidate inhibitor, wherein the full-length SARM1 has constitutive activity; b) incubating the mixture; c) quantifying NAD+ and ADPR (or cADPR) in the mixture after incubation; d) determining the molar ratio of NAD+:ADPR (or cADPR); and e) identifying the candidate inhibitor compound as an inhibitor if the molar ratio is greater than the ratio in a control mixture not containing the candidate inhibitor.
[0205] In some embodiments, a method for identifying a SARM1 inhibitor is provided, comprising: a) providing a mixture comprising i) full-length SARM1 and at least one tag, ii) NAD+, and iii) a solid support bound to a candidate inhibitor; b) incubating the mixture; c) quantifying NAD+ after incubation; and d) identifying the candidate inhibitor compound as a SARM1 inhibitor if the concentration of NAD+ is higher than that of a control.
[0206] SARM1 binding assay In some embodiments, the efficacy of provided SARM1 inhibitors can be determined, for example, according to the assays described in WO2018 / 057989 published March 29, 2018, which is incorporated herein by reference in its entirety. In some embodiments, provided SARM1 inhibitors can be applied to a solution containing SARM1 or a fragment thereof. In some embodiments, provided SARM1 inhibitors can be applied to an in vitro system. In some embodiments, provided SARM1 inhibitors can be applied in vivo. In some embodiments, provided SARM1 inhibitors can be applied to a patient. In some embodiments, SARM1 inhibitors can be mixed with epitope-tagged SARM1 or a fragment thereof. In some embodiments, the amount of bound SARM1 inhibitor can be compared to the amount of unbound SARM1 inhibitor, resulting in affinity for the SARM1 inhibitor.
[0207] In some embodiments, the SARM1 mutant or fragment is a constitutively active SAM-TIR fragment. Examples of constitutively active SARM1 fragments include, but are not limited to, SARM1 with a deleted autoinhibitory domain, at least one point mutation in SARM1 that renders the autoinhibitory domain inactive, a TIR domain-containing SARM1 fragment, or a SARM1 fragment consisting of the SAM and TIR domains. In some embodiments, the SARM1 polypeptide can contain one or more additional amino acid sequences that can act as a tag, such as a His tag, a streptavidin tag, or a combination thereof. In some embodiments, the SARM1 polypeptide can contain a tag at the amino terminus, the carboxy terminus, or a combination thereof. In some embodiments, epitope-tagged SARM1 or a fragment thereof can be used to measure the binding efficiency of a provided SARM1 inhibitor.
[0208] Purification of the SARM1-TIR domain In some embodiments, the SARM1-TIR domain can be engineered with various protein or epitope tags that may be useful, for example, in purification. In some embodiments, the present disclosure also provides an NRK1-HEK293T cell line, comprising HEK293T cells transformed with nicotinamide riboside kinase 1 (NRK1). In some embodiments, the HEK293T cells are transformed or transfected with a DNA sequence encoding nicotinamide riboside kinase 1 (NRK1). In some embodiments, the DNA encoding NRK1 can be genomic or cDNA. In some embodiments, the HEK293T cells are stably or transiently transfected with DNA encoding NRK1 from a source exogenous to the host cell. In some embodiments, the HEK293T cells are stably or transiently transfected with DNA encoding NRK1 such that the cells express NRK1 at a higher level compared to control cells. In some embodiments, the DNA encoding NRK1 is under the control of one or more exogenous regulatory DNA sequences, such as a promoter, an enhancer, or a combination thereof. In some embodiments, the combination of the DNA sequence encoding NRK1 and the regulatory sequence is a combination that does not occur in nature. In some embodiments, the DNA encoding NRK1 is either genomic or cDNA and comprises an expression vector, such as an FCIV expression vector. In some embodiments, the DNA encoding NRK1 is derived from genomic or cDNA from a vertebrate or invertebrate species, such as, but not limited to, human, mouse, zebrafish, or Drosophila. In some configurations, the NRK1 DNA is human NRK1 DNA.
[0209] Use and application The present disclosure provides various uses and applications of the compounds and / or compositions described herein, for example, in view of their activities and / or characteristics described herein. In some embodiments, such uses may include therapeutic and / or diagnostic uses. Alternatively, in some embodiments, such uses may include research, production, and / or other technical uses.
[0210] In one aspect, the disclosure provides methods that include administering to a subject one or more compounds of Formula I, e.g., to treat, prevent, or reduce the risk of developing one or more conditions characterized by axonal degeneration. In some such embodiments, the compound of Formula I is a SARM1 inhibitor.
[0211] Another embodiment of the present disclosure relates to a method of inhibiting SARM1 activity in a patient, comprising administering to the patient a provided compound, or a composition comprising said compound.
[0212] Inhibition of enzymes in biological samples is useful for a variety of purposes known to those of skill in the art, including, but not limited to, biological assays, gene expression studies, and biological target identification.
[0213] In certain embodiments, the present disclosure relates to a method of treating axonal degeneration in a biological sample, comprising contacting the biological sample with a compound or composition of Formula I. In some embodiments, one or more compounds and / or compositions described herein are useful, for example, as a method for inhibiting degradation of neurons derived from a subject. In some embodiments, one or more compounds and / or compositions described herein are useful for inhibiting degeneration of in vitro cultured neurons or portions thereof. In some embodiments, one or more compounds and / or compositions described herein are useful as stabilizers for promoting survival of in vitro neurons.
[0214] In some embodiments, provided compounds and / or compositions inhibit the NADase activity of SARM1. Alternatively or additionally, in some embodiments, provided compounds alleviate one or more attributes of neurodegeneration. In some embodiments, the present disclosure provides methods of treating a neurodegenerative disease or disorder associated with axonal degeneration.
[0215] In some embodiments, one or more compounds and / or compositions described herein are useful, for example, in the practice of medicine. In some embodiments, one or more compounds and / or compositions described herein are useful, for example, for treating, preventing, or ameliorating axonal degeneration (e.g., one or more properties or characteristics thereof). In some embodiments, one or more compounds and / or compositions described herein are useful, for example, for inhibiting axonal degeneration, including axonal degeneration resulting from NAD+ reduction or depletion. In some embodiments, one or more compounds and / or compositions described herein are useful, for example, for preventing axons distal to axonal injury from degenerating.
[0216] In some embodiments, one or more compounds and / or compositions described herein are useful, for example, as methods for inhibiting the degradation of peripheral nervous system neurons or portions thereof. In some embodiments, one or more compounds and / or compositions described herein are useful, for example, as methods for inhibiting or preventing the degeneration of central nervous system (neurons) or portions thereof. In some embodiments, one or more compounds or compositions described herein are characterized in that, when administered to a population of subjects, they reduce one or more symptoms or characteristics of neurodegeneration. For example, in some embodiments, the relevant symptom or characteristic may be selected from the group consisting of the extent, rate, and / or timing of neuronal destruction.
[0217] In certain embodiments, the present disclosure provides compounds that are useful, for example, as analytical tools, probes in biological assays, or as therapeutic agents according to the present disclosure. The compounds provided by the present disclosure are also useful for testing SARM1 activity in biological and pathological phenomena, and for comparative evaluation of novel SARM1 activity inhibitors in vitro or in vivo. In certain embodiments, the present disclosure provides assays for identifying and / or characterizing the compounds and / or compositions provided herein. In some embodiments, the provided assays utilize specific reagents and / or systems (e.g., specific vector constructs and / or polypeptides) useful for assaying SARM1 activity. For example, in some embodiments, the provided assays may utilize, for example, SAM-TIR with the SARM1 N-terminal autoinhibitory domain deleted, and / or one or more tagged versions of the TIR domain.
[0218] In some embodiments, one or more compounds and / or compositions described herein are useful, for example, as methods for inhibiting the degradation of neurons derived from a subject. In some embodiments, one or more compounds and / or compositions described herein are useful for inhibiting the degeneration of in vitro cultured neurons or portions thereof. In some embodiments, one or more compounds and / or compositions described herein are useful as stabilizers for promoting the survival of in vitro neurons.
[0219] In some embodiments, one or more compounds and / or compositions described herein are useful, for example, for affecting biomarkers associated with neurodegeneration. In some embodiments, changes in biomarkers can be detected systemically or using cerebrospinal fluid (CSF), plasma, serum, and / or tissue samples from a subject. In some embodiments, one or more compounds and / or compositions can be used to affect changes in the concentration of neurofilament protein light chain (NF-L) and / or neurofilament protein heavy chain (NF-H) contained in the cerebrospinal fluid of a subject. In some embodiments, one or more compounds and / or compositions described herein can affect constitutive NAD and / or cADPR levels in neurons and / or axons.
[0220] In some embodiments, the one or more biomarkers of neurodegeneration include a concentration of neurofilament light chain protein (NF-L) in one or more of a cerebrospinal fluid (CSF), blood, and plasma sample from the subject; a concentration of neurofilament heavy chain protein (NF-H) in one or more of a cerebrospinal fluid (CSF), blood, and plasma sample from the subject; a concentration of ubiquitin C-terminal hydrolase L1 (UCH-L1) in one or more of a cerebrospinal fluid (CSF), blood, and plasma sample from the subject; a concentration of alpha synuclein in one or more of a cerebrospinal fluid (CSF), blood, and plasma sample from the subject; constitutive NAD+ levels in neurons and / or axons of the subject; constitutive cADPR levels in the subject; levels of albumin, amyloid-beta (Aβ) 38, Aβ 40, Aβ 42, glial fibrillary acidic protein (GFAP), heart-type fatty acid binding protein (hFABP), monocyte chemoattractant protein (MCP)-1, neurogranin, neuron-specific enolase (NSE), soluble amyloid precursor protein (sAPP) α, sAPP β, soluble triggering receptor expressed on myeloid cells (sTREM) 2, phospho-tau, or total tau in one or more of a cerebrospinal fluid (CSF) sample, a blood sample, a plasma sample, a skin biopsy sample, a nerve biopsy sample, and a brain biopsy sample from the subject; and CC in one or more of a cerebrospinal fluid (CSF) sample, a blood sample, a plasma sample, a skin biopsy sample, a nerve biopsy sample, and a brain biopsy sample from the subject. These include levels of Motif Chemokine Ligand (CCL)2, CCL7, CCL12, colony-stimulating factor (CSF) 1, or interleukin (IL) 6.
[0221] In some embodiments, one or more compounds and / or compositions described herein can affect detectable changes in the levels of one or more neurodegeneration-associated proteins in a subject. Such proteins include, but are not limited to, albumin, amyloid-β (Aβ)38, Aβ40, Aβ42, glial fibrillary acid protein (GFAP), heart-type fatty acid-binding protein (hFABP), monocyte chemoattractant protein (MCP)-1, neurogranin, neuron-specific enolase (NSE), soluble amyloid precursor protein (sAPP)α, sAPPβ, soluble triggering receptor expressed on myeloid cells (sTREM)2, phospho-tau, and / or total tau. In some embodiments, one or more compounds and / or compositions described herein can affect changes in cytokines and / or chemokines, including, but not limited to, Ccl2, Ccl7, Ccl12, Csf1, and / or Il6.
[0222] Diseases, Disorders, and Conditions In some embodiments, the compounds and / or compositions described herein can be administered to a subject suffering from one or more diseases, disorders, or conditions. In some embodiments, the one or more diseases, disorders, or conditions are mediated by SARM1. In some embodiments, the present disclosure provides a compound of Formula I, or a pharmaceutically acceptable salt thereof, for use in medicine. In some embodiments, the present disclosure provides a compound of Formula I, or a pharmaceutically acceptable salt thereof, for use in treating and / or preventing one or more diseases, disorders, or conditions mediated by SARM1. In some embodiments, the present disclosure provides a compound of Formula I, or a pharmaceutically acceptable salt thereof, for use in treating and / or preventing neurodegeneration. In some embodiments, the present disclosure provides a compound of Formula I, or a pharmaceutically acceptable salt thereof, for use in treating and / or preventing neurodegenerative diseases or disorders.
[0223] In some embodiments, the neurodegenerative disease or disorder comprises an acute or chronic disease or disorder of the peripheral nervous system (PNS), an acute or chronic disease or disorder of the central nervous system (CNS), or a disease associated with neurodegeneration.
[0224] In some embodiments, the neurodegenerative disease or disorder comprises an acute disease or disorder of the PNS. In some embodiments, the acute disease or disorder of the PNS is the result of mechanical injury, thermal injury, or chemical or chemotherapeutic injury. In some embodiments, the mechanical injury comprises a compressive or constriction injury or a pressure injury. In some embodiments, the compressive or constriction injury comprises carpal tunnel syndrome, direct trauma, penetrating injury, contusion, fracture, or bone dislocation. In some embodiments, the pressure injury comprises pressure involving the superficial peroneal nerve, pressure due to a tumor, or elevated intraocular pressure. In some embodiments, the chemical or chemotherapeutic agent comprises a cytotoxic anticancer agent, thalidomide, an epothilone, a taxane, a vinca alkaloid, a proteasome inhibitor, a platinum-based drug, or an auristatin. In some embodiments, the epothilone is ixabepilone. In some embodiments, the taxane is paclitaxel or docetaxel. In some embodiments, the vinca alkaloid is vinblastine, vinorelbine, vincristine, or vindesine. In some embodiments, the proteasome inhibitor is bortezomib. In some embodiments, the platinum-based drug is cisplatin, oxaliplatin, or carboplatin. In some embodiments, the auristatin is conjugated monomethyl auristatin E.
[0225] In some embodiments, the neurodegenerative disease or disorder comprises a chronic disease or disorder of the PNS. In some embodiments, the chronic disease or disorder of the PNS comprises a systemic disorder, a pain disorder, or a metabolic disease or disorder.
[0226] In some embodiments, the chronic disease or disorder of the PNS comprises hereditary neuropathies, Charcot-Marie-Tooth disease, hereditary sensory and autonomic neuropathies (HSAN), chronic inflammatory demyelinating polyneuropathy (CIDP), idiopathic neuropathies, or other peripheral neuropathies.
[0227] In some embodiments, the systemic disorder comprises diabetes, uremia, AIDS, leprosy, nutritional deficiencies, atherosclerosis, enteric neuropathy, axonopathy, Guillain-Barre syndrome, severe acute motor axonal neuropathy (AMAN), systemic lupus erythematosus, scleroderma, sarcoidosis, rheumatoid arthritis, or polyarteritis nodosa.
[0228] In some embodiments, the pain disorder comprises chronic pain, fibromyalgia, spinal pain, carpal tunnel syndrome, cancer pain, arthritis, sciatica, headache, surgical pain, muscle spasm, back pain, visceral pain, injury pain, dental pain, neurogenic pain, neuropathic pain, nerve inflammation, nerve injury, shingles, herniated disc, torn ligament, or diabetes.
[0229] In some embodiments, the metabolic disease or disorder comprises diabetes mellitus, hypoglycemia, uremia, hypothyroidism, liver failure, polycythemia, amyloidosis, acromegaly, porphyria, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), lipid / glycolipid metabolism disorders, nutritional deficiencies, vitamin deficiencies, or mitochondrial disorders.
[0230] In some embodiments, the neurodegenerative disease or disorder comprises an acute disease or disorder of the CNS, hi some embodiments, the acute disease or disorder of the CNS comprises ischemia, traumatic CNS injury, chemical injury, thermal injury, or viral encephalitis.
[0231] In some embodiments, ischemia comprises cerebral ischemia, hypoxic demyelination, ischemic demyelination, ischemic optic neuropathy, or non-arteritic anterior ischemic optic neuropathy.
[0232] In some embodiments, traumatic CNS injury includes spinal cord injury, traumatic brain injury (TBI), mechanical injury to the head and / or spine, traumatic injury to the head and / or spine, blunt trauma, closed head injury, open head injury, exposure to percussive and / or explosive forces, penetrating injury to the CNS, increased intraocular pressure, or injury due to forces that deform, stretch, crush, or thin axons.
[0233] In some embodiments, viral encephalitis comprises enteroviral encephalitis, arboviral encephalitis, herpes simplex virus (HSV) encephalitis, West Nile virus encephalitis, La Crosse encephalitis, Bunyaviral encephalitis, pediatric viral encephalitis, or HIV encephalopathy (HIV-associated dementia).
[0234] In some embodiments, the neurodegenerative disease or disorder comprises a chronic disease or disorder of the CNS.
[0235] In some embodiments, the chronic disease or disorder of the CNS is Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS, Lou Gehrig's disease), multiple sclerosis (MS), Huntington's disease (HD), senile dementia, Pick's disease, Gaucher's disease, Hurler's syndrome, progressive multifocal leukoencephalopathy, Alexander's disease, congenital cerebral hypomyelination, encephalomyelitis, acute disseminated encephalomyelitis, central pontine myelinolysis, osmotic hyponatremia, Tay-Sachs disease, motor neuron disease, ataxia, spinal muscular atrophy (SMA), Niemann-Pick disease, acute hemorrhagic leukoencephalitis, trigeminal neuralgia, Bell's palsy, cerebral ischemia, multiple system atrophy, Pelizaeus-Merzbach disease, periventricular leukoencephalopathy, neuropathy, including neuromalacia, hereditary ataxia, noise-induced hearing loss, congenital hearing loss, age-related hearing loss, Creutzfeldt-Jakob disease, transmissible spongiform encephalopathy, dementia with Lewy bodies, frontotemporal dementia, amyloidosis, diabetic neuropathy, globoid cell leukodystrophy (Krabbe disease), Bassen-Kornzweig syndrome, transverse myelitis, motor neuron disease, spinocerebellar ataxia, pre-eclampsia, hereditary spastic paraplegia, spastic paraplegia, familial spastic paraplegia, French colonial disease, Strampel-Lorraine disease, non-alcoholic steatohepatitis (NASH), adrenomyeloneuropathy, progressive supranuclear palsy (PSP), Friedrich's ataxia, or spinal cord injury.
[0236] In some embodiments, the chronic disease or disorder of the CNS comprises an optic neuropathy, a traumatic CNS injury, or a metabolic disease or disorder.
[0237] In some embodiments, optic neuropathy comprises acute optic neuropathy (AON), hereditary or idiopathic retinal conditions, Leber's congenital amaurosis (LCA), Leber's hereditary optic neuropathy (LHON), primary open-angle glaucoma (POAG), acute angle-closure glaucoma (AACG), autosomal dominant optic atrophy, retinal ganglion degeneration, retinitis pigmentosa, outer retinal neuropathy, optic neuritis, optic nerve degeneration associated with multiple sclerosis, Kedzier's optic neuropathy, ischemic optic neuropathy, vitamin B12 deficiency, folate (vitamin B9) deficiency, isolated vitamin E deficiency syndrome, non-arteritic anterior ischemic optic neuropathy, exposure to ethambutol, or exposure to cyanide.
[0238] In some embodiments, the traumatic CNS injury comprises traumatic brain injury (TBI), spinal cord injury, traumatic axonal injury, or chronic traumatic encephalopathy (CTE).
[0239] In some embodiments, metabolic diseases or disorders include diabetes mellitus, hypoglycemia, Bassen-Kornzweig syndrome, uremia, hypothyroidism, liver failure, polycythemia, amyloidosis, acromegaly, porphyria, lipid / glycolipid metabolism disorders, nutritional / vitamin deficiencies, and mitochondrial disorders.
[0240] In some embodiments, the neurodegenerative disease or disorder comprises a disease associated with neurodegeneration, hi some embodiments, the neurodegenerative disease or disorder results from blood clotting problems, inflammation, obesity, aging, stress, cancer, or diabetes.
[0241] In some embodiments, the condition is acute peripheral neuropathy. Chemotherapy-induced peripheral neuropathy (CIPN) is an example of acute peripheral neuropathy. CIPN can be associated with a variety of drugs, including, but not limited to, thalidomide, epothilones (e.g., ixabepilone), taxanes (e.g., paclitaxel and docetaxel), vinca alkaloids (e.g., vinblastine, vinorelbine, vincristine, and vindesine), proteasome inhibitors (e.g., bortezomib), platinum-based drugs (e.g., cisplatin, oxaliplatin, and carboplatin), and the like.
[0242] In some embodiments, one or more compounds and / or compositions described herein are useful for treating one or more neurodegenerative diseases, disorders, or conditions, e.g., selected from the group consisting of neuropathy and axonopathy. In some embodiments, one or more compounds and / or compositions described herein are useful for treating, e.g., neuropathy or axonopathy associated with axon degeneration. In some embodiments, the neuropathy associated with axon degeneration is a genetic or congenital neuropathy or axonopathy. In some embodiments, the neuropathy associated with axon degeneration results from a de novo or somatic mutation. In some embodiments, the neuropathy associated with axon degeneration is selected from the list contained herein. In some embodiments, the neuropathy or axonopathy is associated with axon degeneration, including, but not limited to, Parkinson's disease, non-Parkinson's disease, Alzheimer's disease, herpes infection, diabetes, amyotrophic lateral sclerosis, demyelinating disease, ischemia or stroke, chemical injury, thermal injury, and AIDS.
[0243] In some embodiments, one or more compounds or compositions described herein are characterized by reducing one or more symptoms or characteristics of neurodegeneration when administered to a population of subjects. For example, in some embodiments, the relevant symptom or characteristic may be selected from the group consisting of the extent, rate, and / or timing of neuronal destruction. In some embodiments, neuronal destruction may be or may include axonal degradation, loss of synapses, loss of dendrites, loss of synaptic density, loss of dendritic branching, loss of axonal branching, loss of neuronal density, loss of myelination, loss of neuronal cell body, loss of synaptic potentiation, loss of action potential potentiation, loss of cytoskeletal stability, loss of axonal transport, loss of ion channel synthesis and turnover, loss of neurotransmitter synthesis, loss of neurotransmitter release and reuptake capacity, loss of axonal potential propagation, neuronal hyperexcitability, and / or neuronal hypoexcitability. In some embodiments, neuronal destruction is characterized by an inability to maintain an appropriate resting neuronal membrane potential. In some embodiments, neuronal destruction is characterized by the appearance of inclusions, plaques, and / or neurofibrillary tangles. In some embodiments, neuronal destruction is characterized by the appearance of stress granules. In some embodiments, neuronal destruction is characterized by the intracellular activation of one or more members of the cysteine-aspartic acid protease (caspase) family. In some embodiments, neuronal destruction is characterized by neurons undergoing programmed cell death (e.g., apoptosis, pyroptosis, ferroapoptosis, and / or necrosis) and / or inflammation.
[0244] In some embodiments, the neurodegenerative or neurological disease or disorder is associated with axonal damage resulting from axonal degeneration, axonal injury, axonopathy, demyelinating disease, central pontine myelinosis, neuronal injury disease or disorder, metabolic disease, mitochondrial disease, metabolic axonal degeneration, leukoencephalopathy, or leukodystrophy.In some embodiments, the neurodegenerative or neurological disease or disorder is spinal cord injury, stroke, multiple sclerosis, progressive multifocal leukoencephalopathy, congenital dysmyelination, encephalomyelitis, acute disseminated encephalomyelitis, central pontine myelinolysis, osmotic hyponatremia, hypoxic demyelination, ischemic demyelination, adrenoleukodystrophy, Alexander disease, Niemann-Pick disease, Pelizaeus-Merzbach disease, periventricular leukomalacia, spherical cell leukodystrophy (Krabbe disease), Wallerian degeneration, optic neuritis, transverse myelitis, amyotrophic lateral sclerosis (ALS, Lou Gehrig's disease), Huntington's disease, Alzheimer's disease, Parkinson's disease, Tay-Sachs disease, Gaucher disease, Hurler syndrome, traumatic brain injury, post-radiation injury, neurological complications of chemotherapy (chemotherapy-induced neuropathy, CIPN), neuropathy, acute ischemic optic neuropathy, vitamin B12 deficiency, isolated vitamin E deficiency syndrome, Bassen-Kornzweig syndrome, glaucoma, Leber's hereditary optic neuropathy (neuropathy), Leber's congenital amaurosis, neuromyelitis optica, metachromatic leukodystrophy, acute Hemorrhagic leukoencephalitis, trigeminal neuralgia, Bell's palsy, cerebral ischemia, multiple system atrophy, traumatic glaucoma, tropical spastic paraplegia, human T-lymphotropic virus 1 (HTLV-1)-associated myelopathy, West Nile virus encephalitis, La Crosse virus encephalitis, Bunyaviral encephalitis, pediatric viral encephalitis, essential tremor, Charcot-Marie-Tooth disease, motor neuron disease, spinal muscular atrophy (SMA), hereditary sensory and autonomic neuropathy (HSAN), adrenomyeloneuropathy, progressive supranuclear palsy (PSP), Friedrich's ataxia, hereditary The disease is selected from the group consisting of ataxia, noise-induced hearing loss, congenital hearing loss, dementia with Lewy bodies, frontotemporal dementia, amyloidosis, diabetic neuropathy, HIV neuropathy, enteric neuropathy and axonopathy, Guillain-Barré syndrome, severe acute motor axonal neuropathy (AMAN), Creutzfeldt-Jakob disease, transmissible spongiform encephalopathy, spinocerebellar ataxia, pre-eclampsia, hereditary spastic paraplegia, spastic paraplegia, familial spastic paraplegia, French Settlement syndrome, Strampel-Lorraine disease, and non-alcoholic steatohepatitis (NASH).
[0245] In some embodiments, the present disclosure provides inhibitors of SARM1 activity for the treatment of neurodegenerative or neurological diseases or disorders involving axonal degeneration or axonopathy. The present disclosure also provides methods of using inhibitors of SARM1 activity to treat, prevent, or ameliorate neurodegenerative or neurological diseases or disorders involving axonal degeneration, axonopathy, and axonal degeneration.
[0246] In some embodiments, the present disclosure provides methods of treating neurodegenerative or neurological diseases or disorders associated with axonal damage due to axonal degeneration, axonal injury, axonopathy, demyelinating diseases, central pontine myelinolysis, neuronal injury diseases or disorders, metabolic diseases, mitochondrial diseases, metabolic axonal degeneration, leukoencephalopathy, or leukodystrophy.
[0247] In some embodiments, neuropathy and axonopathy include any disease or condition involving neurons and / or supporting cells, such as glia, myocytes, or fibroblasts, particularly those diseases or conditions involving axonal injury. Axonal injury can be caused by traumatic injury or by non-mechanical injury resulting from disease, condition, or exposure to toxic molecules or drugs. The result of such injury can be axonal degeneration or dysfunction and loss of functional neural activity. Diseases and conditions that result in or are associated with such axonal injury are present in the majority of neuropathic diseases and conditions. Such neuropathy can include peripheral neuropathy, central neuropathy, and combinations thereof. Furthermore, peripheral neuropathy symptoms can be caused by diseases primarily focused in the central nervous system, while central nervous system symptoms can be caused by diseases that are peripheral or systemic in nature.
[0248] In some embodiments, peripheral neuropathy can involve damage to peripheral nerves and / or can be caused by a nerve disease or as a result of a systemic disease. Some such diseases include diabetes, uremia, infectious diseases such as AIDS or leprosy, nutritional deficiencies, vascular or collagen disorders such as atherosclerosis, and autoimmune diseases such as systemic lupus erythematosus, scleroderma, sarcoidosis, rheumatoid arthritis, and polyarteritis nodosa. In some embodiments, peripheral nerve degeneration results from traumatic (mechanical) damage to nerves, as well as chemical or thermal damage to nerves. Conditions that damage peripheral nerves include glaucoma, carpal tunnel syndrome, direct trauma, penetrating injuries, crush injuries, compression or constriction injuries such as fractures or bone dislocations, compression involving the superficial peroneal nerve (ulnar, radial, or peroneal) that may result from prolonged use of crutches or staying in one position for a long time, or tumors, intraneural hemorrhage, ischemia, exposure to cold or radiation, or certain pharmaceuticals, or toxic substances such as herbicides or pesticides. In particular, nerve damage can be caused by chemical injury resulting from cytotoxic anticancer drugs, such as taxol, cisplatin, proteasome inhibitors, or vinca alkaloids, such as vincristine. Typical symptoms of such peripheral neuropathy include weakness, numbness, paresthesia (abnormal sensations such as burning, tingling, tingling, or tingling), and pain in the arms, hands, legs, and / or feet. In some embodiments, the neuropathy is associated with mitochondrial dysfunction. Such neurological disorders may manifest as decreased energy levels, ie, decreased levels of NAD and ATP.
[0249] In some embodiments, the peripheral neuropathy is a metabolic or endocrine neuropathy, including a wide range of peripheral neuropathies associated with systemic diseases of metabolic origin. These diseases include, for example, diabetes mellitus, hypoglycemia, uremia, hypothyroidism, liver failure, polycythemia, amyloidosis, acromegaly, porphyria, lipid / glycolipid metabolism disorders, nutritional / vitamin deficiencies, and mitochondrial disorders, among others. A common feature of these diseases is the involvement of peripheral nerves due to alterations in the structure or function of myelin and axons resulting from dysregulation of metabolic pathways.
[0250] In some embodiments, neuropathy includes optic neuropathy such as glaucoma, retinal ganglion degeneration such as that associated with retinitis pigmentosa and outer retinal neuropathy, optic nerve neuritis and / or degeneration including that associated with multiple sclerosis, trauma to the optic nerve, which may include, for example, damage during tumor removal, hereditary optic neuropathy such as Kell's disease and Leber's hereditary optic neuropathy, ischemic optic neuropathy such as that secondary to giant cell arteritis, metabolic optic neuropathy such as neurodegenerative diseases including the previously mentioned Leber's neuropathy, neuropathies caused by nutritional deficiencies such as vitamin B12 or folate deficiency, toxicity, adverse drug reactions such as those caused by ethambutol or cyanide, and neuropathies caused by vitamin deficiencies. Ischemic optic neuropathy also includes non-arteritic anterior ischemic optic neuropathy.
[0251] In some embodiments, neurodegenerative diseases associated with neuropathy or axonopathy in the central nervous system include various diseases. Such diseases include progressive dementias such as Alzheimer's disease, senile dementia, Pick's disease, and Huntington's disease, central nervous system diseases affecting muscle function such as Parkinson's disease, motor neuron disease, and progressive ataxias such as amyotrophic lateral sclerosis, demyelinating diseases such as multiple sclerosis, viral encephalitis such as those caused by enteric viruses, arboviruses, and herpes simplex viruses, and prion diseases. Mechanical injury or trauma to the head or spine, such as glaucoma, can also cause nerve damage or degeneration in the brain and spinal cord. In addition, conditions such as ischemia and stroke, as well as nutritional deficiencies and chemical toxicity such as chemotherapy, can cause central nervous system neurological disorders.
[0252] In some embodiments, the present disclosure provides methods for treating neuropathy or axonopathy associated with axon degeneration. In some such embodiments, the neuropathy or axonopathy associated with axon degeneration can be, for example, genetic or congenital, or any of several neuropathy or axonopathy, such as Parkinson's disease, Alzheimer's disease, herpes infection, diabetes, amyotrophic lateral sclerosis, demyelinating disease, ischemia or stroke, chemical injury, thermal injury, and AIDS-related. In addition, neurodegenerative diseases not listed above, as well as subsets of the above-mentioned diseases, can also be treated with the methods of the present disclosure. Such subsets of diseases can include Parkinson's disease or non-Parkinson's disease, or Alzheimer's disease.
[0253] subject In some embodiments, the compounds and / or compositions described herein are administered to a subject suffering from or susceptible to a disease, disorder, or condition described herein, in some embodiments, such disease, disorder, or condition is characterized by axonal degeneration, such as one of the conditions mentioned herein.
[0254] In some embodiments, the subject to whom a compound or composition as described herein is administered exhibits one or more signs or symptoms associated with axonal degeneration, hi some embodiments, the subject does not exhibit signs or symptoms of neurodegeneration.
[0255] In some embodiments, provided methods include administering a compound of Formula I to a patient in need thereof. In some such embodiments, the patient is at risk of developing a condition characterized by axonal degeneration. In some embodiments, the patient has a condition characterized by axonal degeneration. In some embodiments, the patient has been diagnosed with a condition characterized by axonal degeneration.
[0256] In some embodiments, provided methods include administering a composition described herein to a patient population in need thereof. In some embodiments, the population is taken from individuals who engage in activities with a high probability of traumatic nerve injury. In some embodiments, the population is taken from athletes who engage in contact sports or other high-risk activities.
[0257] In some embodiments, the subject is at risk for developing a condition characterized by axonal degeneration. In some embodiments, the subject is identified as being at risk for axonal degeneration based on, for example, the subject's genotype, a diagnosis of a condition associated with axonal degeneration, and / or exposure to agents and / or conditions that induce axonal degeneration.
[0258] In some embodiments, the patient is at risk of developing a neurodegenerative disorder. In some embodiments, the patient is elderly. In some embodiments, the patient is known to have a genetic risk factor for neurodegeneration. In some embodiments, the patient has a family history of neurodegenerative disease. In some embodiments, the patient expresses one or more copies of a known genetic risk factor for neurodegeneration. In some embodiments, the patient is taken from a population with a high incidence of neurodegeneration. In some embodiments, the patient has a hexanucleotide repeat expansion in open reading frame 72 of chromosome 9. In some embodiments, the patient has one or more copies of the ApoE4 allele.
[0259] In some embodiments, the subject to which a compound or composition described herein is administered may be or include a subject suffering from or susceptible to a neurodegenerative disease, disorder, or condition. In some embodiments, the neurodegenerative disease, disorder, or condition may be or include traumatic nerve injury. In some embodiments, the traumatic nerve injury is blunt force trauma, closed head injury, open head injury, exposure to impact and / or explosive force, penetrating injury in or to the brain cavity or innervated area of the body. In some embodiments, the traumatic nerve injury is a force that deforms, stretches, crushes, or rotates axons.
[0260] In some embodiments, the subject engages in an activity identified as a risk factor for neurodegeneration, for example, a subject who engages in a contact sport or occupation that carries a high chance of traumatic neurological injury.
[0261] For example, the subject may be a patient undergoing or being prescribed chemotherapy for peripheral neuropathy. Examples of chemotherapeutic agents include, but are not limited to, thalidomide, epothilones (e.g., ixabepilone), taxanes (e.g., paclitaxel and docetaxel), vinca alkaloids (e.g., vinblastine, vinorelbine, vincristine, and vindesine), proteasome inhibitors (e.g., bortezomib), platinum-based drugs (e.g., cisplatin, oxaliplatin, and carboplatin), and the like.
[0262] In some embodiments, provided methods include administering a composition as described herein to a patient or patient population based on the presence or absence of one or more biomarkers. In some embodiments, provided methods further include monitoring the levels of the biomarkers in the patient or patient population and adjusting the dosing regimen accordingly.
[0263] Administration Those skilled in the art will understand that in some embodiments, the exact amount of a particular compound included in and / or delivered by administration of a pharmaceutical composition or regimen as described herein can be selected by a physician and may vary for different subjects, taking into account, for example, one or more of the subject's species, age, and general condition, and / or the identity of the particular compound or composition, its method of administration, etc. Alternatively, in some embodiments, the amount of a particular compound included in and / or delivered by administration of a pharmaceutical composition or regimen as described herein can be standardized across a relevant patient population (e.g., all patients, all patients of a particular age or stage of disease, or all patients expressing a particular biomarker, etc.).
[0264] The compounds or compositions provided herein are preferably formulated in dosage unit form for ease of administration and uniformity of dosage. As used herein, the term "dosage unit form" refers to a physically discrete unit of drug appropriate for the patient being treated. However, it will be understood that the total daily usage of the compounds and compositions provided herein will be determined by the attending physician within the scope of sound medical judgment. The specific effective dosage level in any particular patient or organism will depend on various factors, including the disorder being treated and the severity of the disorder, the clinical condition of the individual patient, the cause of the disorder, the activity of the specific compound used, the specific composition used, the patient's age, weight, general health, sex, and diet, the timing of administration of the specific compound used, the drug delivery site, administration route, and excretion rate, the duration of treatment, drugs used in combination with or simultaneously with the specific compound used, and similar factors well known in the medical arts. The effective amount of the compound to be administered will be governed by such considerations and is, for example, the minimum amount required to inhibit SARM1 activity necessary to prevent or treat an undesirable disease or disorder, such as neurodegeneration or traumatic nerve injury.
[0265] The pharmaceutically acceptable compositions of the present disclosure can be administered to humans and other animals orally, rectally, intravenously, parenterally, intracisternally, intravaginally, intraperitoneally, topically (by powder, ointment, or infusion), bucally, or as an oral or nasal spray, etc., depending on the severity of the disease, disorder, or infection being treated. The daily dose, in certain embodiments, is given as a single dose per day, or as divided doses two to six times per day, or in sustained-release form. This dosing regimen can be adjusted to provide the optimal therapeutic response. The compounds can be administered on a regimen of one to four times per day, preferably once or twice per day.
[0266] In some embodiments, compositions of the present disclosure can be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, or via an implanted reservoir. As used herein, the term "parenteral" includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intradermal, intraocular, intralesional, and intracranial injection or infusion techniques. Preferably, the compositions are administered orally, intraperitoneally, or intravenously.
[0267] In some embodiments, the pharmaceutically acceptable compositions of the present disclosure may also be administered topically, particularly when the target of treatment includes areas or organs readily accessible by topical application, including diseases of the eye, the skin, or the lower intestinal tract, for each of which suitable topical formulations are readily prepared.
[0268] Most preferably, the pharmaceutically acceptable compositions of the present disclosure are formulated for oral administration. Such formulations can be administered with or without food. In some embodiments, the pharmaceutically acceptable compositions of the present disclosure are administered without food. In other embodiments, the pharmaceutically acceptable compositions of the present disclosure are administered with food.
[0269] These additional agents may be administered separately from the provided compound or compositions thereof as part of a multiple dose regimen. Alternatively, the agents may be part of a single dosage form and mixed together with the provided compound in a single composition. When administered as part of a multiple dose regimen, the two active agents may be administered simultaneously, sequentially, or within a period of each other, typically within 5 hours of each other.
[0270] It should also be understood that the specific administration and treatment regimen for a particular patient will depend on a variety of factors, including the activity of the specific compound used, the age, body weight, general health, sex, diet, time of administration, rate of excretion, drug combination, and the judgment of the treating physician, and the severity of the particular disease being treated. In some embodiments, the amount of a compound of the present disclosure in the composition will also depend on the particular compound in the composition.
[0271] In some embodiments, the SARM1 inhibitors described herein may be used in combination with one or more other therapies to treat associated diseases, disorders, or conditions. In some embodiments, the administration of the SARM1 inhibitor is altered when used in combination therapy compared to when administered as monotherapy. Alternatively, or additionally, in some embodiments, the therapy administered in combination with the SARM1 inhibitor described herein is administered according to a different regimen or protocol than the regimen or protocol when administered alone or in combination with one or more therapies other than the SARM1 inhibitor. In some embodiments, the additional therapeutic agent, the composition comprising the additional therapeutic agent and a provided compound may act synergistically. In some embodiments, one or both therapies utilized in a combination regimen are administered at a lower level or less frequently than when administered as monotherapy.
[0272] In some embodiments, the compounds and / or compositions described herein are administered with chemotherapeutic agents, including but not limited to alkylating agents, anthracyclines, taxanes, epothilones, histone deacetylase inhibitors, topoisomerase inhibitors, kinase inhibitors, nucleotide analogs, peptide antibiotics, platinum-based agents, retinoids, vinca alkaloids and derivatives. In some embodiments, the compounds and / or compositions described herein are administered in combination with a PARP inhibitor. [Example]
[0273] The present teachings, including the description, are provided by way of examples that are not intended to limit the scope of the claims. Unless specifically stated in the past tense, inclusion in an example does not imply that an experiment was actually performed. The following non-limiting examples are provided to further illustrate the present teachings. Those skilled in the art will, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments disclosed and still obtain like or similar results without departing from the spirit and scope of the present teachings.
[0274] method Some of the methods and compositions described herein utilize laboratory techniques well known to those skilled in the art and can be found in laboratory manuals, such as Sambrook, J., et al., Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001; Methods In Molecular Biology, ed. Richard, Humana Press, NJ, 1995; Spector, DL et al., Cells: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1998; and Harlow, E., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1999. Methods of administration and dosing regimens for pharmaceuticals can be determined in accordance with standard principles of pharmacology using methods provided by standard reference texts such as Remington: the Science and Practice of Pharmacy (Alfonso R. Gennaro ed. 19th ed. 1995), Hardman, JG, et al., Goodman & Gilman's The Pharmacological Basis of Therapeutics, Ninth Edition, McGraw-Hill, 1996, and Rowe, RC, et al., Handbook of Pharmaceutical Excipients, Fourth Edition, Pharmaceutical Press, 2003.
[0275] Example 1: Synthesis of compounds General synthesis method The compounds according to the present invention and their intermediates can be obtained using synthetic methods known to those skilled in the art and described in the literature of organic synthesis. Preferably, the compounds are obtained by methods similar to the preparation methods described more fully below, especially as described in the experimental section. In some cases, the order in which the reaction steps are carried out can be changed. Variants of the reaction methods known to those skilled in the art but not described in detail here can also be used.
[0276] General processes for preparing compounds according to the invention will be apparent to those skilled in the art upon studying the following schemes. Starting materials can be prepared by methods described in the literature or herein, or by analogous or similar methods. Any functional groups in the starting materials or intermediates can be protected using conventional protecting groups. These protecting groups can be cleaved again at a suitable stage in the reaction sequence using methods well known to those skilled in the art.
[0277] Optimum reaction conditions and reaction times may vary depending on the particular reactants used. Unless otherwise specified, solvents, temperatures, pressures, and other reaction conditions can be readily selected by one of ordinary skill in the art. Specific procedures are provided in the Synthetic Examples section. Intermediates and products can be purified by chromatography on silica gel, recrystallization, and / or reverse-phase HPLC (RHPLC). Discrete enantiomers can be obtained by separation of racemic products using chiral HPLC. RHPLC purification methods used 0-100% acetonitrile in water containing 0.1% formic acid, 0.1-0.01% TFA, 10 mM aqueous ammonium bicarbonate, or 0.2% aqueous ammonium hydroxide, and one of the following columns: a) Waters Xbridge C18 10μm 30×100mm column b) Waters Sunfire C18 10 μm 30 × 100 mm column c) Waters Xbridge C18 3.5 μm 50 × 4.6 mm column d) HALO C18 2.7μm 30×4.6mm column e) Waters Sunfire C18 3.5μm 50×4.6mm column
[0278] Synthesis of exemplary compounds Method A: Synthesis of I-1 [ka]
[0279] A flask was charged with R-2 (2.0 g, 9.22 mmol, 1.00 eq) and R-1 (1.29 g, 9.22 mmol, 1.00 eq), which was then refilled with N three times. With the mixture cooled in an ice bath at 0 °C, solvent EtOH (30 mL) was added to the flask. An aqueous solution of NaOH (554 mg, 13.83 mmol, 1.50 eq) in HO (8 mL) was added dropwise. After the addition was complete, the reaction mixture was stirred at 0 °C for 20 min and then warmed to room temperature for 1 h. The progress of the reaction was monitored by LCMS. After the reaction was complete, the reaction mixture was filtered to collect the solid, which was washed with brine and dried to give Int-1 (2.75 g, 88%).
[0280] To a solution of Int-1 (1 g, 2.90 mmol), pyridin-4-ylboronic acid (541.2 mg, 4.4 mmol), dioxane (10 mL), and HO (1.5 mL) were added PdCl(dppf) (212 mg, 0.29 mmol) and KCO (1.2 g, 8.7 mmol, 3 eq), and the mixture was stirred at 110 °C under N for 2 h. The reaction progress was monitored by LCMS. After completion of the reaction, the mixture was treated with HO (20 mL), extracted with EtOAc (20 mL × 3), washed with aqueous NaCl solution, and dried over NaSO. The organic layer was concentrated and purified by flash chromatography (SiO, petroleum ether / ethyl acetate, v / v, 4 / 5) to give Int-2 (700 mg, 70%).
[0281] To a solution of Int-2 (500 mg, 1.48 mmol) in THF (10 mL) was added 10% Pd / C (50 mg), and the reaction mixture was then stirred under H at 25 °C for 1 h. The progress of the reaction was monitored by LCMS and TLC. The reaction solution was filtered to remove solids, and the filtrate was collected and concentrated under reduced pressure to give a residue that was purified by flash chromatography (SiO, petroleum ether / ethyl acetate, v / v, 1 / 1) to give Int-3 (250 mg, 50%).
[0282] To a solution of Int-3 (150 mg, 0.44 mmol) in DMSO (3 mL), hydrazine hydrate (119.46 mg, 2.21 mmol) was added, and the mixture was then stirred at 120° C. for 16 h. The progress of the reaction was monitored by LCMS. The reaction solution was purified by preparative HPLC to give the title compound I-1 (82.5 mg, 56%).
[0283] Method B: Synthesis of I-2 [ka]
[0284] A flask was charged with R-2 (2.0 g, 9.22 mmol, 1.00 eq), R-1 (1.31 g, 9.22 mmol, 1.00 eq), and MeOH (30 mL). The flask was cooled to 0 °C, and a solution of NaOH (554 mg, 13.83 mmol, 1.50 eq) dissolved in HO (8 mL) was added dropwise to the mixture. After the addition was complete, the reaction mixture was stirred at 0 °C for 20 min, then warmed to room temperature and stirred for 2 h. The progress of the reaction was monitored by LCMS. The reaction mixture was filtered, washed with brine, and the filter cake was collected and dried to give Int-4 (1.1 g, 36%).
[0285] To a mixture of Int-4 (1.1 g, 3.30 mmol) in dioxane (15 mL) and HO (3 mL) was added Pd(dppf)Cl (235 mg, 0.33 mmol), KCO (1.37 g, 9.91 mmol), and pyridin-4-ylboronic acid (487 mg, 3.96 mmol). The mixture was degassed with N three times and stirred at 110 °C for 16 h. The progress of the reaction was monitored by LCMS. The reaction mixture was diluted with water and EtOAc. The mixture was separated, and the aqueous phase was extracted twice with EtOAc. The combined organic layers were dried, filtered, and concentrated in vacuo to give the crude product, which was purified by flash chromatography (SiO, petroleum ether / ethyl acetate, v / v=2:1) to give Int-5 (700 mg, crude).
[0286] To a solution of Int-5 (650 mg, 1.92 mmol) in THF (20 mL) and MeOH (2 mL) was added 10% Pd / C (300 mg), and the resulting mixture was then stirred at room temperature under the protection of H for 2 h. The progress of the reaction was monitored by LCMS. The reaction mixture was filtered to remove palladium, and the filtrate was concentrated and then purified by flash chromatography (SiO, petroleum ether / ethyl acetate, v / v, 1 / 1) to give Int-6 (340 mg, 42%).
[0287] To a mixture of Int-6 (150 mg, 0.35 mmol) in MeOH (3 mL) and AcOH (0.5 mL) was added tert-butyl hydrazinecarboxylate (174 mg, 1.32 mmol). The resulting mixture was then stirred at 100° C. for 2 h. The progress of the reaction was monitored by LCMS. The reaction mixture was concentrated, diluted with water (5 mL), and extracted twice with EtOAc (10 mL). The combined organic layers were dried over MgSO, filtered, and concentrated in vacuo to give the crude product, which was purified by flash chromatography (SiO, petroleum ether / ethyl acetate, v / v, 1 / 1) to give the Boc-hydrazine compound (200 mg, 65% purity, 81%).
[0288] A solution of Boc-hydrazine compound (150 mg, 65% purity, 0.21 mmol) in DBU (2 mL) in a sealed vial was heated at 150 °C for 30 min under microwave conditions. The reaction progress was monitored by LCMS and TLC. The reaction mixture was diluted with water (10 mL) and extracted three times with EtOAc (15 mL). The combined organic layers were dried over MgSO, filtered, and concentrated, and the residue was purified by flash chromatography (SiO, 99 / 1 to 5 / 1 dichloromethane / methanol) to give the crude product, which was further purified by preparative HPLC to give the title compound I-2 (14.5 mg, 21%).
[0289] Example 2. Compound characterization. LCMS method:
[0290] Analytical LC / MS analysis method A: ESI+ / -ion mode 100-1000Da Column: XBridge SB-C18, 3.5 μm, 4.6 × 50 mm Temperature: 40℃ [Table 2]
[0291] Analytical LC / MS analysis method B: ESI+ / -ion mode 100-1000Da Column: XBridge SB-C18, 3.5 μm, 4.6 × 50 mm Temperature: 40℃ [Table 3]
[0292] The results are presented in Table 1. [Table 4]
[0293] Example 3: ARM-SAM-TIR SARM1 IC50 Assay This example describes an assay for ARM-SAM-TIR NADase activity and its use to measure the efficacy of compounds of Formula I for blocking SARM1-mediated NAD+ cleavage. This assay is optimized to characterize the efficacy of compounds of Formula I for inhibiting SARM1 activity and calculate IC50 values for each compound. This assay uses full-length SARM1, including the ARM, SAM, and TIR domains. As shown herein, expression of this fragment without the autoinhibitory N-terminal domain produces a constitutively active enzyme that cleaves NAD+.
[0294] Preparation of ARM-SAM-TIR lysate (STL) NRK1-HEK293T cells were cultured at 150 cm 2 The cells were seeded onto plates at 20×10 6 cells / plate. The next day, the cells were transfected with 15 μg of ARM-SAM-TIR expression plasmid, SEQ ID NO:1. GCGATCGCGGCTCCCGACATCTTGGACCATTAGCTCCACAGGTATCTTCTTCCCTCTAGTGGTCATAACAGCAGCTTCAG CTACCTCTCAATTCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTATCAATCGTTGCGTTACACAC ACAAAAAACCAACACACATCCATCTTCGATGGATAGCGATTTTATTATCTAACTGCTGATCGAGTGTAGCCAGATCTAGT AATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGC TGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTG ACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTA TTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTAC ATCTACGTATTAGTCATCGCTATTACCATGCTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTC ACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAAT GTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTA GTGAACCGTCAGATCAGATCTTTGTCGATCCTACCATCCACTCGACACACCCGCCAGCGGCCGCTGCCAAGCTTCCGAGC TCTCGAATTCAAAGGAGGTACCCACcatgGCCATGCATCACCACCACCATCATAGCTCCGGCGTCGACCTCGGCACCGAG AATTTATATTTCCAAAGCGGCCTCAATGATATCTTCGAGGCCCAGAAGATCGAGTGGCACGAGGGCAGCTCCGACCTCGC CGTGCCCGGTCCCGATGGAGGCGGAGGCACTGGTCCTTGGTGGGCTGCTGGCGGCAGAGGCCCTAGAGAAGTGAGCCCCG GTGCTGGCACCGAGGTGCAAGACGCTCTGGAGAGGGCTCTGCCCGAACTGCAGCAAGCTCTGTCCGCTTTAAAGCAAGCT GGAGGAGCTAGAGCCGTCGGCGCCGGACTGGCCGAAGTGTTCCAGCTCGTGGAGGAAGCTTGGTTATTACCCGCTGTGGG AAGAGAGGTCGCCCAAGGTCTGTGTGACGCCATTCGTCTGGACGGAGGTTTAGACTTATTACTGAGGCTGCTGCAAGCTC CCGAACTGGAGACAAGGGTCCAAGCTGCTCGTCTGCTGGAGCAGATCCTCGTGGCCGAGAATCGTGACAGAGTGGCTAGA ATCGGTTTAGGCGTCATCCTCAATTTAGCCAAAGAGAGGGAGCCCGTTGAGCTGGCCAGAAGCGTCGCTGGCATCCTCGA GCACATGTTCAAGCATTCCGAGGAGACTTGTCAGAGACTGGTCGCCGCCGGAGGACTCGATGCTGTTTTATACTGGTGCA GAAGGACAGACCCCGCTTTACTGAGGCATTGTGCTCTGGCCCTCGGCAATTGCGCTTTACATGGAGGCCAAGCCGTCCAG AGAAGGATGGTGGAGAAAAGAGCCGCCGAGTGGCTGTTCCCTTTAGCCTTCTCCAAAGAAGACGAACTGTTACGTCTGCA TGCTTGTCTCGCTGTCGCTGTTTTAGCCACCAACAAGGAGGTGGAAAGGGAAGTGGAAAGAAGCGGAACACTGGCTTTAG TCGAACCTCTGGTGGCTTCTTTAGATCCCGGAAGGTTTGCCAGATGTCTGGTCGACGCCAGCGATACCTCCCAAGGAAGA GGCCCCGACGATCTCCAGAGACTGGTGCCTCTGCTGGACAGCAATCGTCTGGAGGCCCAATGTATTGGCGCCTTCTATCT CTGCGCCGAAGCCGCCATCAAGTCTTTACAAGGTAAGACCAAGGTGTTCTCCGACATTGGAGCCATCCAATCTTTAAAGA GGCTGGTGAGCTATTCCACCAACGGCACAAAAAGCGCTTTAGCCAAAAGAGCTTTAAGACTGCTGGGCGAAGAGGTGCCT AGGCCCATTTTACCTTCCGTGCCTAGCTGGAAGGAGGCCGAGGTGCAGACTTGGCTGCAGCAGATCGGCTTTAGCAAATA TTGCGAATCCTTTAGGGAGCAGCAAGTTGACGGCGATTTATTATTAAGGCTGACCGAGGAAGAGCTCCAGACAGATTTAG GCATGAAAAGCGGCATCACTCGTAAGAGGTTCTTTCGTGAGCTCACCGAACTGAAGACCTTCGCCAACTACTCCACTTGT GATCGTAGCAATTTAGCTGATTGGCTCGGATCCCTCGATCCCAGATTTCGTCAGTACACCTATGGACTCGTCTCTTGTGG ACTGGACAGATCTTTACTGCATCGTGTGAGCGAGCAACAGCTGCTGGAAGATTGCGGCATCCATTTAGGAGTGCACAGAG CCAGAATTCTGACCGCCGCTAGAGAGATGCTGCATTCCCCTCTCCCTTGTACCGGAGGCAAGCCTAGCGGAGACACCCCC GACGTGTTCATCAGCTATCGTAGAAACAGCGGAAGCCAGCTGGCCTCTTTACTGAAGGTCCATTTACAGCTGCACGGATT TAGCGTCTTCATCGACGTGGAGAAACTGGAGGCTGGCAAGTTCGAGGACAAGCTGATCCAGTCCGTGATGGGCGCTAGGA ATTTCGTTTTAGTGCTCAGCCCCGGCGCTCTGGATAAATGCATGCAAGATCATGACTGTAAGGACTGGGTCCACAAGGAA ATCGTGACCGCTCTGTCTTGTGGCAAGAACATCGTCCCCATCATCGACGGCTTCGAATGGCCCGAGCCTCAAGTTCTCCC CGAAGATATGCAAGCTGTTTTAACCTTCAATGGAATCAAGTGGAGCCACGAGTACCAAGAAGCCACAATCGAGAAGATCA TTCGTTTTCTGCAAGGTAGATCCTCCAGAGATTCCTCCGCTGGCAGCGACACATCTTTAGAGGGCGCCGCCCCTATGGGT CCTACCTAATAATctagAAGTTGTCTCCTCCTGCACTGACTGACTGATACAATCGATTTCTGGATCCGCAGGCCTCTGCT AGCTTGACTGACTGAGATACAGCGTACCTTCAGCTCACAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAAC TAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATA AACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAA AACCTCTACAAATGTGGTATTGGCCCATCTCTATCGGTATCGTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGG GGTTTTTTGTGCCCCTCGGGCCGGATTGCTATCTACCGGCATTGGCGCAGAAAAAAATGCCTGATGCGACGCTGCGCGTC TTATACTCCCACATATGCCAGATTCAGCAACGGATACGGCTTCCCCAACTTGCCCACTTCCATACGTGTCCTCCTTACCA GAAATTTATCCTTAAGGTCGTCAGCTATCCTGCAGGCGATCTCTCGATTTCGATCAAGACATTCCTTTAATGGTCTTTTC TGGACACCACTAGGGGTCAGAAGTAGTTCATCAAACTTTCTTCCCTCCCTAATCTCATTGGTTACCTTGGGCTATCGAAA CTTAATTAACCAGTCAAGTCAGCTACTTGGCGAGATCGACTTGTCTGGGTTTCGACTACGCTCAGAATTGCGTCAGTCAA GTTCGATCTGGTCCTTGCTATTGCACCCGTTCTCCGATTACGAGTTTCATTTAAATCATGTGAGCAAAAGGCCAGCAAAA GGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGAC GCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCT CCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACG CTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCT GCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAAC AGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAAC AGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCA CCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATC TTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTT CACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACC AATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCATTTAAATTTCCGAACTCT CCAAGGCCCTCGTCGGAAAATCTTCAAACCTTTCGTCCGATCCATCTTGCAGGCTACCTCTCGAACGAACTATCGCAAGT CTCTTGGCCGGCCTTGCGCCTTGGCTATTGCTTGGCAGCGCCTATCGCCAGGTATTACTCCAATCCCGAATATCCGAGAT CGGGATCACCCGAGAGAAGTTCAACCTACATCCTCAATCCCGATCTATCCGAGATCCGAGGAATATCGAAATCGGGGCGC GCCTGGTGTACCGAGAACGATCCTCTCAGTGCGAGTCTCGACGATCCATATCGTTGCTTGGCAGTCAGCCAGTCGGAATC CAGCTTGGGACCCAGGAAGTCCAATCGTCAGATATTGTACTCAAGCCTGGTCACGGCAGCGTACCGATCTGTTTAAACCT AGATATTGATAGTCTGATCGGTCAACGTATAATCGAGTCCTAGCTTTTGCAAACATCTATCAAGAGACAGGATCAGCAGG AGGCTTTCGCATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTC ACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCGCGAGTGGGTTACATCGAACTGGATCTCAAC AGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGCTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGC GGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTATT CACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAAC ACTGCGGCCAACTTACTTCTGACAACGATTGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGT AACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAA TGGCAACAACCTTGCGTAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAGTTGATAGACTGGATGGAG GCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGA GCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGA GTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACCGATTCTA GGTGCATTGGCGCAGAAAAAAATGCCTGATGCGACGCTGCGCGTCTTATACTCCCACATATGCCAGATTCAGCAACGGAT ACGGCTTCCCCAACTTGCCCACTTCCATACGTGTCCTCCTTACCAGAAATTTATCCTTAAGATCCCGAATCGTTTAAACT CGACTCTGGCTCTATCGAATCTCCGTCGTTTCGAGCTTACGCGAACAGCCGTGGCGCTCATTTGCTCGTCGGGCATCGAA TCTCGTCAGCTATCGTCAGCTTACCTTTTTGGCA(SEQ ID NO: 1).
[0295] To minimize toxicity due to overexpression of ARM-SAM-TIR, cultures were supplemented with 1 mM NR at the time of transfection. 48 hours after transfection, cells were harvested, pelleted by centrifugation at 1,000 rpm (Sorvall ST 16R centrifuge, Thermo Fisher Scientific), and washed once with cold PBS (0.01 M phosphate-buffered saline, 0.138 M NaCl, 0.0027 M KCl, pH 7.4). Cells were resuspended in PBS containing protease inhibitors (cOmplete™ protease inhibitor cocktail, Roche product number 11873580001), and cell lysates were prepared by sonication (Branson Sonifer 450, power = 3, 20 stroke episodes). The lysates were centrifuged (12,000 × g, 10 min at 4°C) to remove cellular debris, and the supernatants (containing ARM-SAM-TIR proteins) were stored at -80°C for later use in the in vitro ARM-SAM-TIR NADase assay (see below). Protein concentrations were determined by the bicinchoninic acid (BCA) method and used to normalize lysate concentrations.
[0296] ARM-SAM-TIR IC50 Assay for Formula I Compounds Enzyme assays were performed in 384-well polypropylene plates in Dulbecco's PBS buffer, with a final assay volume of 20 μL. ARM-SAM-TIR lysates at a final concentration of 5 μg / mL were preincubated with each compound at a final assay concentration of 1% DMSO for 2 hours at room temperature. The reaction was initiated by adding NAD+ as substrate at a final assay concentration of 5 μM. After 2 hours of incubation at room temperature, the reaction was stopped with 40 μL of a stop solution of 7.5% trichloroacetic acid in acetonitrile. NAD+ and ADPR concentrations were analyzed by a RapidFire high-throughput mass spectrometry system (Agilent Technologies, Santa Clara, CA) using an API4000 triple quadrupole mass spectrometer (AB Sciex, Framingham, MA).
[0297] The results are presented in Table 2. Compounds with activities designated as "A" have an IC 50 Compounds with activities designated as "B" provided IC<50 nM. 50 Compounds with activity designated as "C" provided IC 50 Compounds with activities designated as "D" provided IC 50 Compounds with an activity designated "E" provided IC 50 >1000nM provided. nd: Undetermined. [Table 5]
[0298] Example 4: Axonal Degeneration Index This example illustrates an in vitro axon degeneration assay used to characterize compounds of Formula I. This assay was used to test the efficacy of compounds of Formula I for preventing axon degeneration in mouse dorsal root ganglion (DRG) explant cultures.
[0299] Mouse DRG drop culture: Mouse dorsal root ganglion neurons (DRGs) were dissected from E12.5 CD1 mice (50 ganglia per embryo) and incubated with 0.5% trypsin solution containing 0.02% EDTA (Gibco) at 37°C for 15 minutes. Cells were then triturated by gentle pipetting and washed three times with DRG growth medium (Neurobasal medium (Gibco) containing 2% B27 (Invitrogen), 100 ng / ml 2.5S NGF (Harland Bioproducts), 1 mM 5-fluoro-2'-deoxyuridine (Sigma), penicillin, and streptomycin). Cells were suspended in DRG growth medium. DRG drop cultures were created by spotting 5000 cells / well into the center of each well of a 96-well tissue culture plate coated with poly-D-lysine (0.1 mg / ml, Sigma) and laminin (3 mg / ml, Invitrogen). After cells were allowed to attach to the plates for 15 min in a humidified tissue culture incubator (5% CO ), DRG growth medium was gently added (100 ml per well).
[0300] Axon degeneration assay: Axon degeneration is stimulated by either manual axonal transection using a scalpel blade or chemotoxic stimulation. After the appropriate experimental period, DRG cultures are fixed in 1% PFA + sucrose and stored in a refrigerator before imaging. Bright-field images of DRG axons and somata are collected using a 20x water-immersion lens on a Phenix automated confocal microscope (PerkinElmer), and axon quantification is performed using an in-house developed script (Acapella, PerkinElmer). The inventions described in the original claims of this application are set forth below. [1] A compound of formula I or a pharmaceutically acceptable salt thereof: [ka] [In the formula, Ring A, together with the carbon atom to which it is fused, is a 6-membered aryl ring or a 6-membered heteroaryl ring having 1 to 3 nitrogen atoms; L is an optionally substituted C 1-4 an aliphatic chain, wherein one carbon atom in the aliphatic chain is selected from the group consisting of -O-, -N(R)-, -S-, -C(O)-, -C(O)N(R)-, -N(R)C(O)-, -C(O)O-, -OC(O)-, and -S(O) 2 N(R)-, -N(R)S(O) 2 -, and an optionally substituted divalent 3- to 6-membered monocyclic ring having 0-2 heteroatoms independently selected from oxygen, nitrogen, and sulfur; R 1 is an optionally substituted group selected from a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur, and a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; R 2 is an optionally substituted group, C 1-6 an optionally substituted group selected from aliphatic; a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; phenyl; a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; an 8- to 10-membered bicyclic saturated, partially unsaturated, or aryl carbocyclic ring; an 8- to 10-membered bicyclic saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; and an 8- to 10-membered bicyclic heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; Each R y are independently halogen, cyano, OR, SR, N(R) 2 , and optionally substituted C 1-4 selected from aliphatic Each R is independently hydrogen or an optionally substituted group; C 1-6 an optionally substituted group selected from aliphatic; a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; phenyl; and a 5- to 6-membered heteroaryl ring having 1 to 3 heteroatoms independently selected from oxygen, nitrogen, and sulfur; or two R groups, together with the nitrogen atom to which they are attached, form an optionally substituted 3- to 7-membered monocyclic heterocyclic ring having 0-2 additional heteroatoms independently selected from oxygen, nitrogen, and sulfur; n is 0, 1, or 2]. [2] The compound according to [1], or a pharmaceutically acceptable salt thereof, wherein the compound is selected from the group consisting of formulas Ia, Ib, Ic, Id, Ie, If, Ig, Ih, Ii, Ij, Ik, Il, Im, and In.
change
change
change
change
change
change
change
[10] The compound according to [9], which is:
change
[11] The compound according to any one of [1] to [8], or a pharmaceutically acceptable salt thereof, wherein:
change
[12] The compound according to
[11] , wherein the compound is:
change
[13] A pharmaceutical composition comprising the compound according to any one of [1] to
[12] and a pharmaceutically acceptable carrier.
[14] A method comprising the step of administering a compound according to any one of [1] to
[12] to a subject (i) having a condition characterized by axonal degeneration or (ii) at risk of developing a condition characterized by axonal degeneration.
[15] A method for treating or preventing axonal degeneration, comprising administering to a subject in need thereof a compound according to any one of [1] to
[12] .
[16] A method for inhibiting SARM1, comprising contacting a biological sample with a compound according to any one of [1] to
[12] .
Claims
1. A compound of formula I-ai or a pharmaceutically acceptable salt thereof: 【Chemical 1】 [In the formula, L is, 【Chemistry 2】 and R 1 is an unsubstituted pyridine ring, R 2 is a pyridine ring or a benzene ring optionally substituted with a halogen atom, n is 0].
2. 2. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein: 【Chemistry 3】
3. 3. The compound of claim 2, wherein: 【Chemistry 4】
4. 2. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein: 【Chemistry 5】
5. 5. The compound of claim 4, wherein: 【Chemistry 6】
6. A pharmaceutical composition comprising a compound according to any one of claims 1 to 5 and a pharmaceutically acceptable carrier.
7. 10. A pharmaceutical composition comprising a compound according to any one of claims 1 to 5 for treating a subject (i) having a condition characterized by axonal degeneration, or (ii) at risk of developing a condition characterized by axonal degeneration.
8. A pharmaceutical composition comprising a compound according to any one of claims 1 to 5 for treating or preventing axonal degeneration.
9. A method of inhibiting SARM1, comprising contacting a previously collected biological sample with a compound of any one of claims 1 to 5.
Citation Information
Patent Citations
Indazole derivatives as well as preparation method and application thereof
CN110452176A
Indazole and its use for protein kinase inhibition
JP2003503481A
Indazole derivatives as JNK inhibitors
JP2006523721A
Indoles, 1,2-benzisoxazoles and 1,2-benzisothiazoles, and their manufacture and use
JP2007515424A
1h-indazole, benzothiazole, 1,2-benzisoxazole, 1,2-benzisothiazole and chromones and their preparation and use
JP2007538011A