Natural killer (NK) cell engagers that bind NKp46 and BCMA mutants with FC engineering

Multifunctional binding proteins with enhanced Fc engineering for BCMA and NKp46 engagement address the safety issues of existing BCMA therapies, offering potent and safe treatment options for B-cell cancers.

JP7747911B2Active Publication Date: 2025-10-01SANOFI SA(FR) +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2024569737
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2023-03-23
Filing Date
2023-05-26
Publication Date
2025-10-01
Estimated Expiration
2043-05-26

AI Technical Summary

Technical Problem

Existing BCMA-targeted therapies, such as anti-CD3xBCMA T-cell engagers, induce excessive pro-inflammatory cytokine release and have unfavorable safety profiles.

Method used

Development of multifunctional binding proteins with specific antigen-binding domains for BCMA and NKp46, enhanced via Fc engineering for CD16 binding and extended serum half-life, providing dual NK engagement with minimal cytokine release.

Benefits of technology

The NKp46-BCMA engagers exhibit strong potency and a favorable safety profile with reduced cytokine release and prolonged serum persistence, making them effective for treating B-cell cancers like multiple myeloma and light chain amyloidosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007747911000039
    Figure 0007747911000039
  • Figure 0007747911000040
    Figure 0007747911000040
  • Figure 0007747911000041
    Figure 0007747911000041
Patent Text Reader

Abstract

The present disclosure relates to a multifunctional binding protein comprising a first and a second antigen-binding domain (ABD) and all or part of an immunoglobulin Fc region or a variant thereof, wherein the first ABD specifically binds to human BCMA, the second ABD specifically binds to human NKp46, and all or part of the immunoglobulin Fc region or a variant thereof binds to human Fc-gamma receptors. The present disclosure also relates to methods for making such binding proteins, compositions thereof, and their use, including the treatment or prevention of proliferative disorders including multiple myeloma (MM).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] B-cell maturation antigen (BCMA) is expressed on mature B cells and B-cell-derived tumor cells and is involved in the progression of several B-cell cancers (e.g., multiple myeloma) and B-cell diseases or disorders (e.g., light chain amyloidosis or LCA). Therefore, BCMA is an attractive target for anti-B-cell cancer therapy and the treatment of B-cell-related diseases or disorders. The few existing BCMA-targeted therapies, such as anti-CD3xBCMA T-cell engagers, induce potent toxicity issues, including excessive pro-inflammatory cytokine release. [Background technology]

[0002] Natural killer (NK) cells are a subpopulation of lymphocytes involved in innate immunity. NK cells provide an efficient immune surveillance mechanism capable of eliminating unwanted cells, such as tumor or virus-infected cells. The characteristics and biological properties of NK cells include the expression of surface antigens including CD16, CD56, and / or CD57, the absence of α / β or γ / δ TCR complexes on the cell surface, the ability to bind and kill cells in an MHC-independent manner, particularly by activating specific cytolytic enzymes, to kill "self" cells that do not express MHC / HLA antigens, tumor cells, or other disease cells that express ligands for NK-activating receptors, and the ability to release protein molecules called cytokines that stimulate the immune response. There has been growing interest in natural killer (NK) cells due to their potential antitumor properties.

[0003] There is a need in the art for potent anti-BCMA therapies with manageable safety profiles. The anti-BCMA x NKp46 binding proteins claimed herein provide this need. Summary of the Invention [Means for solving the problem]

[0004] The present disclosure relates to multifunctional binding proteins comprising first and second antigen-binding domains (ABDs) and all or a portion of an immunoglobulin Fc region or variant thereof, wherein the first ABD specifically binds human BCMA, the second ABD specifically binds human NKp46, and the immunoglobulin Fc region or variant thereof binds to a human Fc-γ receptor. In particular, the disclosed NKp46-BCMA engagers have extensive Fc engineering that enhances ADCC activity (via CD16 (FcγRIIIa) binding to the antibody constant region (Fc)) and / or serum half-life.

[0005] The disclosed NKp46-BCMA engager exhibits strong potency through dual NK engagement with NKp46 and CD16, has a favorable safety profile (minimal pro-inflammatory cytokine release compared to T cell engager (TCE) modalities) and a long serum half-life.

[0006] The present disclosure also relates to methods for making such binding proteins, compositions thereof, and their uses.

[0007] In one aspect, the disclosure provides a binding protein comprising a first antigen binding domain (ABD) that has binding specificity for BCMA and a second ABD that has binding specificity for NKp46, (a) a first ABD comprising: (a1) a first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and an HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); and (a2) CX 1 SSTGX 2 VTPX 3 X 4 An LCDR1 sequence comprising the amino acid sequence of YAN (SEQ ID NO: 4), 1 is R or A, and X 2 is T or A, and X 3 is S or G, and X 4 LCDR1 sequence, DNNX,5 X 6 PP (SEQ ID NO: 5), 5 is S, I or N, and X 6 is R or K, and ALX 7 X 8 GX 9 An LCDR3 sequence comprising the amino acid sequence of QWV (SEQ ID NO: 6), 7 is W or Y, and X 8 is F or Y, and X 9 and a first immunoglobulin light chain variable domain (VL1) comprising an LCDR3 sequence wherein (b) providing a binding protein in which the second ABD comprises binding specificity for NKp46;

[0008] In certain embodiments, (b) the second ABD is: (b1) a second immunoglobulin heavy chain variable domain (VH2), - an HCDR1 sequence comprising DYVIN, an HCDR2 sequence comprising EIYPGSGTNYYNEKFKA, and an HCDR3 sequence comprising RGRYGLYAMDY; - an HCDR1 sequence comprising GYTFSDYVIN (SEQ ID NO: 19), an HCDR2 sequence comprising EIYPGSGTN (SEQ ID NO: 20), and an HCDR3 sequence comprising RGRYGLYAMDY (SEQ ID NO: 21); - an HCDR1 sequence comprising SDYAWN (SEQ ID NO: 22), an HCDR2 sequence comprising YITYSGSTSYNPSLES (SEQ ID NO: 23), and an HCDR3 sequence comprising GGYYGSSWGVFAY (SEQ ID NO: 24); - an HCDR1 sequence comprising EYTMH (SEQ ID NO: 25) a second immunoglobulin heavy chain variable domain comprising an HCDR2 sequence comprising the sequence GISPNIGGTSYNQKFKG (SEQ ID NO: 26), and an HCDR3 sequence comprising RGGSFDY (SEQ ID NO: 27); an HCDR1 sequence comprising -SFTMH (SEQ ID NO: 28), an HCDR2 sequence comprising YINPSSGYTEYNQKFKD (SEQ ID NO: 29), and an HCDR3 sequence comprising GSSRGFDY (SEQ ID NO: 30); or an HCDR1 sequence comprising -SDYAWN (SEQ ID NO: 31), an HCDR2 sequence comprising YITYSGSTNYNPSLKS (SEQ ID NO: 32), and an HCDR3 sequence comprising CWDYALYAMDC (SEQ ID NO: 33), and (b2) a second immunoglobulin light chain variable domain (VL2), - an LCDR1 sequence comprising RASQDISNYLN (SEQ ID NO: 34), an LCDR2 sequence comprising YTSRLHS (SEQ ID NO: 35), and an LCDR3 sequence comprising QQGNTRPWT (SEQ ID NO: 36); - an LCDR1 sequence comprising RVSENIYSYLA (SEQ ID NO: 37), an LCDR2 sequence comprising NAKTLAE (SEQ ID NO: 38), and an LCDR3 sequence comprising QHHYGTPWT (SEQ ID NO: 39); - an LCDR1 sequence comprising RASQSISDYLH (SEQ ID NO: 40), an LCDR2 sequence comprising YASQSIS (SEQ ID NO: 41), and an LCDR3 sequence comprising QNGHSFPLT (SEQ ID NO: 42); an LCDR1 sequence comprising -RASENIYSNLA (SEQ ID NO: 43), an LCDR2 sequence comprising AATNLAD (SEQ ID NO: 44), and an LCDR3 sequence comprising QHFWGTPRT (SEQ ID NO: 45); or a LCDR1 sequence comprising -RTSENIYSYLA (SEQ ID NO: 46), an LCDR2 sequence comprising NAKTLAE (SEQ ID NO: 47), and an LCDR3 sequence comprising QHHYDTPLT (SEQ ID NO: 48).

[0009] In certain embodiments, VL1 comprises an LCDR1 sequence comprising the amino acid sequence of -CASSTGTVTPSNYAN (SEQ ID NO: 7), an LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 8), and an LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 9); an LCDR1 sequence comprising the amino acid sequence of -CRSSTGTVTPSNYAN (SEQ ID NO: 10), an LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 11), and an LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 12). 3 sequences; - an LCDR1 sequence having the amino acid sequence of CASSTGAVTPSNYAN (SEQ ID NO: 13), an LCDR2 sequence having the amino acid sequence of DNNIKPP (SEQ ID NO: 14), and an LCDR3 sequence having the amino acid sequence of ALWYGGQWV (SEQ ID NO: 15); or - an LCDR1 sequence having the amino acid sequence of CASSTGAVTPGYYAN (SEQ ID NO: 16), an LCDR2 sequence having the amino acid sequence of DNNNKPP (SEQ ID NO: 17), and an LCDR3 sequence having the amino acid sequence of ALYYGGQWV (SEQ ID NO: 18).

[0010] In certain embodiments, - VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 55; - ​​VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 50; - VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 51. - VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49 and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 52; - VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49 and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 53; or - VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49 and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 54.

[0011] In certain embodiments, VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 55; - ​​VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 50; - VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 51; - VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 52; - VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 53; or - VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 54.

[0012] In certain embodiments, - VH2 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, and VL2 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 64; - VH2 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 57, and VL2 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 65; - VH2 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 58, and VL2 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 66; - VH2 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 59, and VL2 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 67. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 60, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 68; - VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 61, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 69; - VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 62, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 70; or - VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 63, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 71.

[0013] In certain embodiments, -VH2 comprises the amino acid sequence of SEQ ID NO: 56 and VL2 comprises the amino acid sequence of SEQ ID NO: 64; -VH2 comprises the amino acid sequence of SEQ ID NO: 57 and VL2 comprises the amino acid sequence of SEQ ID NO: 65; -VH2 comprises the amino acid sequence of SEQ ID NO: 58 and VL2 comprises the amino acid sequence of SEQ ID NO: 66; -VH2 comprises the amino acid sequence of SEQ ID NO: 59 and VL2 comprises the amino acid sequence of SEQ ID NO: 67; -VH2 comprises the amino acid sequence of SEQ ID NO: 60 and VL2 comprises the amino acid sequence of SEQ ID NO: 68; -VH2 comprises the amino acid sequence of SEQ ID NO: 61 and VL2 comprises the amino acid sequence of SEQ ID NO: 69; -VH2 comprises the amino acid sequence of SEQ ID NO: 62 and VL2 comprises the amino acid sequence of SEQ ID NO: 70; or -VH2 comprises the amino acid sequence of SEQ ID NO: 63 and VL2 comprises the amino acid sequence of SEQ ID NO: 71.

[0014] In certain embodiments, the binding protein further comprises all or a portion of an immunoglobulin Fc domain or a variant thereof. In certain embodiments, the Fc domain is an IgG1 Fc domain. In certain embodiments, the IgG1 Fc domain is a human IgG1 Fc domain. In certain embodiments, all or a portion of the immunoglobulin Fc domain or a variant thereof binds to a human Fc-gamma receptor. In certain embodiments, all or a portion of the immunoglobulin Fc domain or a variant thereof binds to a human CD16A (FcγRIII) polypeptide.

[0015] In certain embodiments, the Fc domain comprises a native glycan at amino acid position 297 according to EU numbering.

[0016] In certain embodiments, the binding protein is N-glycosylated.

[0017] In certain embodiments, the Fc domain or variant thereof comprises a first Fc heavy chain and a second Fc heavy chain.

[0018] In certain embodiments, at least one Fc heavy chain comprises an engineered intrachain disulfide bond mediated by a pair of cysteines (C) substituting: (i) a leucine (L) at amino acid position 242 and a lysine (K) at amino acid position 334; or (ii) an arginine (R) at amino acid position 292 and a valine (V) at amino acid position 302 (amino acid positions according to EU numbering).

[0019] In certain embodiments, the first Fc heavy chain or the second Fc heavy chain comprises a pair of cysteines. In certain embodiments, the first and second Fc heavy chains each comprise a pair of cysteines. In certain embodiments, the first and second Fc heavy chains each comprise a L242C / K334C substitution. In certain embodiments, the first and second Fc heavy chains each comprise a R292C / V302C substitution.

[0020] In certain embodiments, at least one Fc heavy chain comprises a substitution at amino acid position 332 according to EU numbering. In certain embodiments, the substitution at amino acid position 332 is glutamic acid (E).

[0021] In certain embodiments, at least one Fc heavy chain further comprises one or more substitutions at amino acid position 236, 239, or 330 according to EU numbering. In certain embodiments, the substitution at amino acid position 236 is alanine (A). In certain embodiments, the substitution at amino acid position 239 is aspartic acid (D). In certain embodiments, the substitution at amino acid position 330 is leucine (L).

[0022] In certain embodiments, at least one Fc heavy chain further comprises an aspartic acid (D) at amino acid position 239 according to EU numbering and a glutamic acid (E) at amino acid position 332. In certain embodiments, at least one Fc heavy chain further comprises an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, and a glutamic acid (E) at amino acid position 332 according to EU numbering. In certain embodiments, at least one Fc heavy chain further comprises an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, a leucine (L) at amino acid position 330, and a glutamic acid (E) at amino acid position 332 according to EU numbering.

[0023] In certain embodiments, the binding protein comprises at least two polypeptide chains that form at least two antigen binding sites, and at least one polypeptide chain has the formula: VL1-L1-VL2-L2-CL[I] and a structure represented by At least one polypeptide chain has the formula: VH2-L3-VH1-L4-CH1[II] and a structure represented by During the ceremony, CL is an immunoglobulin light chain constant domain; CH1 is the immunoglobulin CH1 heavy chain constant domain; L1, L2, L3, and L4 are amino acid linkers, and any one or more of L1, L2, L3, and L4 are optionally absent; The polypeptide of formula I and the polypeptide of formula II form a cross-over light-heavy chain pair.

[0024] In certain embodiments, the binding protein comprises three polypeptide chains that form two antigen binding sites, one polypeptide chain having the following formula: VL1-L1-VL2-L2-CL[I] and a structure represented by One polypeptide chain has the formula: VH2-L3-VH1-L4-CH1-hinge-CH2-CH3[III] and a structure represented by One polypeptide chain has the formula: Hinge-CH2-CH3[IV] and a structure represented by During the ceremony, CL is an immunoglobulin light chain constant domain; CH1 is the immunoglobulin CH1 heavy chain constant domain; CH2 is the immunoglobulin CH2 heavy chain constant domain; CH3 is the immunoglobulin CH3 heavy chain constant domain; The hinge is an immunoglobulin hinge region that connects the CH1 and CH2 domains, L1, L2, L3, and L4 are amino acid linkers, and any one or more of L1, L2, L3, and L4 are optionally absent; The polypeptide of formula I and the polypeptide of formula II form a cross-over light-heavy chain pair.

[0025] In certain embodiments, (a) L1, L2, L3, and L4 are each independently 0 amino acids in length or comprise a sequence selected from the group consisting of GGGGSGGGGS, GGGGSGGGGGSGGGGS (SEQ ID NO: 82), S, RT, TKGPS (SEQ ID NO: 83), GQPKAAP (SEQ ID NO: 84), and GGSGSSGSGG (SEQ ID NO: 85), or (b) L1, L2, L3, and L4 are each independently a sequence selected from the group consisting of GGGGSGGGGS, GGGGSGGGGGSGGGGS, S, RT, TKGPS, GQPKAAP, and GGSGSSGSGG.

[0026] In certain embodiments, L1 and L2 each comprise the amino acid sequence GGGGSGGGGS, hi certain embodiments, L3 and L4 each are absent.

[0027] In certain embodiments, the binding protein comprises (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72, (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73, and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO: 74.

[0028] In another aspect, the disclosure provides a binding protein comprising a first antigen-binding domain (ABD) that has binding specificity for BCMA and a second ABD that has binding specificity for NKp46, wherein (a) the first ABD comprises a first immunoglobulin heavy chain variable domain (VH1) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and a first immunoglobulin light chain variable domain (VL1) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 55, and (b) the second ABD comprises a second immunoglobulin heavy chain variable domain (VH2) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, and a second immunoglobulin light chain variable domain (VL2) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64.

[0029] In a specific embodiment, VH1 comprises the amino acid sequence of SEQ ID NO:49, VL1 comprises the amino acid sequence of SEQ ID NO:55, VH2 comprises the amino acid sequence of SEQ ID NO:56, and VL2 comprises the amino acid sequence of SEQ ID NO:64.

[0030] In certain embodiments, the binding protein comprises (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72, (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73, and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO: 74.

[0031] In another aspect, the disclosure provides a binding protein comprising a first antigen binding domain (ABD) that has binding specificity for BCMA and a second ABD that has binding specificity for NKp46, wherein the binding protein comprises (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72, (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73, and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO: 74.

[0032] In certain embodiments, the binding proteins described above are for use as pharmaceuticals.

[0033] In certain embodiments, the binding proteins described above are for use in a method for treating a disease or disorder.

[0034] In certain embodiments, the binding proteins described above are for use in a method for the treatment or prevention of cancer.

[0035] In certain embodiments, the binding proteins described above are for use in a method for the treatment or prevention of multiple myeloma.

[0036] In certain embodiments, the binding proteins are for use in a method for the treatment or prevention of light chain amyloidosis (LCA).

[0037] In another aspect, the present disclosure provides a pharmaceutical composition comprising the binding protein described above and a pharmaceutically acceptable carrier.

[0038] In another aspect, the present disclosure provides a method for treating or preventing cancer, comprising administering the pharmaceutical composition described above to a subject in need of such treatment or prevention.

[0039] In another aspect, the disclosure provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding the above-described binding protein.

[0040] In another aspect, the disclosure provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a first polypeptide chain comprising the amino acid sequence of SEQ ID NO:72.

[0041] In another aspect, the disclosure provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a second polypeptide chain comprising the amino acid sequence of SEQ ID NO:73.

[0042] In another aspect, the disclosure provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a third polypeptide chain comprising the amino acid sequence of SEQ ID NO:74.

[0043] In another aspect, the disclosure provides an expression vector comprising the above-described nucleic acid molecule.

[0044] In another aspect, the present disclosure provides an isolated cell comprising the above-described nucleic acid molecule.

[0045] In another aspect, the disclosure provides an isolated cell comprising the above-described expression vector. In certain embodiments, the cell is a mammalian cell.

[0046] In another aspect, the disclosure provides a method of producing a binding protein, the method comprising culturing the isolated cells under suitable conditions and recovering the binding protein.

[0047] In another aspect, the disclosure provides a method for producing the above-described binding protein, the method comprising: (a) culturing a host cell under conditions suitable for expressing a plurality of recombinant polypeptides, the plurality comprising: (i) a polypeptide comprising the amino acid sequence of SEQ ID NO: 72; (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 73; and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 74; and (b) optionally recovering the expressed recombinant polypeptides.

[0048] In another aspect, the present disclosure provides a binding protein produced by the above-described method of making. In another aspect, the present disclosure provides a method of treating or preventing a disease or disorder, comprising administering to a subject in need thereof the above-described pharmaceutical composition.

[0049] In another aspect, the present disclosure provides a method for treating or preventing cancer, comprising administering to a subject in need thereof the pharmaceutical composition described above.

[0050] In another aspect, the present disclosure provides a method for treating or preventing multiple myeloma, comprising administering to a subject in need thereof the pharmaceutical composition described above. In certain embodiments, the multiple myeloma is relapsed multiple myeloma. In certain embodiments, the multiple myeloma is refractory multiple myeloma. In certain embodiments, the multiple myeloma is smoldering multiple myeloma.

[0051] In another aspect, the present disclosure provides a method for treating or preventing light chain amyloidosis (LCA), comprising administering the pharmaceutical composition described above to a subject in need thereof. In certain embodiments, the LCA is relapsed LCA. In certain embodiments, the LCA is refractory LCA.

[0052] In another aspect, the present disclosure provides a method for restoring or enhancing the activity of NKp46-expressing cells in a patient in need thereof, the method comprising administering to the patient the pharmaceutical composition described above.

[0053] In another aspect, the present disclosure provides a method of removing cancer cells in a patient in need thereof, the method comprising administering to the patient the pharmaceutical composition described above.

[0054] In another aspect, the present disclosure provides a method of inducing or increasing NK cell-mediated lysis of cancer cells in a patient in need thereof, comprising administering to the patient the pharmaceutical composition described above. In certain embodiments, the cancer cells express BCMA.

[0055] In another aspect, the present disclosure provides a method for inducing NK cell elimination of cancer cells in a patient in need thereof, the method comprising administering to the patient the pharmaceutical composition described above.

[0056] In another aspect, the disclosure provides a binding protein comprising a first antigen binding domain (ABD) that has binding specificity for BCMA and a second ABD that has binding specificity for NKp46.

[0057] In certain embodiments, the binding protein further comprises all or a portion of an immunoglobulin Fc domain or a variant thereof, where, optionally, the all or portion of the immunoglobulin Fc domain or variant thereof binds to a human Fc-gamma receptor; the all or portion of the immunoglobulin Fc domain or variant thereof binds to a human CD16a (FcγRIIIa) polypeptide; the Fc domain comprises a natural glycan at amino acid position 297 according to EU numbering; and / or the binding protein is N-glycosylated.

[0058] In certain embodiments, the Fc domain or variant thereof comprises a first Fc heavy chain and a second Fc heavy chain, wherein at least one Fc heavy chain comprises an engineered intrachain disulfide bond mediated by a pair of cysteines (C) substituting: (i) a leucine (L) at amino acid position 242 and a lysine (K) at amino acid position 334; or (ii) an arginine (R) at amino acid position 292 and a valine (V) at amino acid position 302 (amino acid positions according to EU numbering).

[0059] In certain embodiments, the first and second Fc heavy chains each comprise L242C / K334C substitutions. In certain embodiments, the first and second Fc heavy chains each comprise R292C / V302C substitutions.

[0060] In a specific embodiment, at least one Fc heavy chain comprises a substitution at amino acid position 332 according to EU numbering, optionally wherein the substitution at amino acid position 332 is glutamic acid (E), and optionally further comprises at least one Fc heavy chain further comprising one or more substitutions at amino acid positions 236, 239, or 330 according to EU numbering, optionally wherein the substitution at amino acid position 236 is alanine (A), the substitution at amino acid position 239 is aspartic acid (D), and the substitution at amino acid position 330 is leucine (L).

[0061] In certain embodiments, at least one Fc heavy chain further comprises an aspartic acid (D) at amino acid position 239 and a glutamic acid (E) at amino acid position 332 according to EU numbering; or at least one Fc heavy chain further comprises an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, and a glutamic acid (E) at amino acid position 332 according to EU numbering; or at least one Fc heavy chain further comprises an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, a leucine (L) at amino acid position 330, and a glutamic acid (E) at amino acid position 332 according to EU numbering.

[0062] The foregoing and other features and advantages of the present disclosure will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings. [Brief explanation of the drawings]

[0063] [Figure 1A-1B]Figures 1A-1B are schematic diagrams of NKp46 multispecific NK cell engagers (NKCEs). Figure 1A shows an NKp46 NKCE that binds with one arm to an antigen on the surface of tumor cells (e.g., BCMA) and the other arm to the NKp46 receptor on NK cells. The Fc domain of the NKCE also binds to CD16 on NK cells. Figure 1B shows a different NKp46-BCMA NKCE format that engages BCMA on the surface of tumor cells, recruiting NK cells through dual binding of both NKp46 and the Fcγ receptor CD16a and inducing ADCC activity in an enhanced Fc-competent format. The enhanced Fc-competent format (hereinafter referred to as "CODV-OL1-ADE-DSB") includes: (1) ADE mutations in CH2 (G236A / S239D / I332E) to enhance ADCC activity; (2) DSB in CH2 (R292C / V302C) for thermostability and productivity (e.g., cellular expressibility and overall yield); (3) knob-into-hole (KIH) mutations in CH3 to promote heterodimer formation in Fc-(3a) knob (heavy chain containing VH / VL domains): S354C / T366W and (3b) hole (heavy chain lacking VH / VL domains): Y349C / T366S / L368A / Y407V; and (4) RF mutations in one CH3 (H435R / Y436F) to promote heterodimer purification in Fc. All Fc domain amino acid numbering follows EU. This NKp46-BCMA NKCE_Fc CODV-OL1-ADE-DSB contains two linkers in the light chain: GGGGSGGGGS, one between VL anti-BCMA and VL anti-NKp46, and one between VL NKp46 and CL. NKp46 binding site: 3D9; BCMA binding site: CA10v7; CD16 binding via the ADCC-competent Fc domain. [Figure 2A-2B] Figure 2A is a bar graph depicting BCMA density on a panel of multiple myeloma cell lines based on cell surface FITC fluorescence, and Figure 2B is a corresponding table recording BCMA density on each cell line ranked in descending order. [Figure 3A-3B]Figure 3A is a representative titration of NKp46-BCMA_Fc-ADE-DSB on RPMI 8226 cells. Titration data shown are median fluorescence intensities across a range of antibody concentrations. EC50 values ​​for five independent titrations are shown. Figure 3B is a representative titration of NKp46-BCMA_Fc-ADE-DSB on human NK cells purified from PBMCs of healthy volunteers. Titration data shown are median fluorescence intensities across a range of antibody concentrations. EC50 values ​​for three NK donors are shown. [Figure 4] FIG. 4 is a table showing the binding affinity (measured as KD) of 12 different Fc formats of NKp46-BCMA-NKCE to two different variants of human CD16a (having either valine (V) or phenylalanine (F) at amino acid position 176), as quantified by using surface plasmon resonance (SPR). [Figure 5] FIG. 5 is a table showing the binding affinity (measured as KD) of 12 different Fc formats of NKp46-BCMA-NKCE to the human neonatal Fc receptor (FcRn) as quantified using SPR. [Figure 6] Figure 6 shows an in vitro cytotoxicity assay comparing the cytotoxicity of NKp46-BCMA-NKCE with enhanced ADCC (Fc-DE, Fc-DE-DSB, Fc-ADE, Fc-ADE-DSB) and non-enhanced ADCC (NKp46-BCMA_Fc) at increasing concentrations (nM) incubated in the presence of purified resting NK cells from RPMI8226 cells of six different donors (D410, D700, D114, D974, D245, and D409). RPMI8226 cells were used as targets and purified resting NK cells as effectors. [Figure 6-1] Same as above. [Figure 6-2] Same as above. [Figure 7]Figure 7 is an in vitro cell cytotoxicity assay comparing the cytotoxicity of NKp46-BCMA_Fc-ADE, NKp46-BCMA_Fc, Ref-1, BCMA_IgG1, IC_IgG1-DE, and NKp46-IC_Fc control at increasing concentrations (nM) incubated with either RPMI8226 or MM.1s cells in the presence of purified resting NK cells from two different donors (D611 and D222). RPMI 8226 and MM.1s cells were used as targets, and purified resting NK cells were used as effectors. [Figure 8] Figure 8 is an in vitro cell cytotoxicity assay comparing the cytotoxicity of NKp46-BCMA_Fc-ADE, Reference-1, BCMA_IgG1, and NKp46-IC_Fc-ADE control at increasing concentrations (nM) incubated with RPMI 8226 cells in the presence of purified resting NK cells from three different donors (D786, D371, or D695). RPMI 8226 cells were used as targets and purified resting NK cells were used as effectors. [Figure 9] Figure 9 is an in vitro cell cytotoxicity assay comparing the cytotoxicity of NKp46-BCMA_Fc-ADE and NKp46-IC_Fc-ADE using purified resting NK cells with RPMI 8226 cells. RPMI 8226 cells were used as targets, and purified resting NK cells (left panel) or RPMI 8226 cells (right panel) were loaded with 51Cr to determine both target cell killing and NK vs. NK fratricide toxicity in the same assay. (Two NK cell donors are shown.) [Figure 10] Figure 10 is an in vitro cell cytotoxicity assay comparing the cytotoxicity of NKp46-BCMA-NKCE in the presence of various soluble BCMA concentrations. Cytotoxic activity of NKp46-BCMA_Fc-ADE-DSB against RPMI 8226 cells in the presence of increasing concentrations of soluble BCMA recombinant protein (0, 2, 20, and 200 ng / mL). RPMI 8226 cells were used as targets, and purified resting NK cells were used as effectors (two NK cell donors, D504 and D930, are shown). [Figure 11] FIG. 11 shows that optimal NK cell activation involves dual targeting of NKp46 and CD16a by NKp46-BCMA_Fc-ADE-DSB. [Figure 12] Figure 12 demonstrates that the high potency of NKp46-BCMA_Fc-ADE-DSB allows for high efficiency in tumor cell killing, even in MM cell models expressing low BCMA. [Figure 13] Figure 13 demonstrates that NKp46-BCMA_Fc-ADE-DSB has enhanced potency over antibodies with enhanced ADCC characteristics. [Figure 14A] Figure 14A is a schematic diagram of an experimental mouse model for determining in vivo NKp46-BCMA_Fc anti-tumor activity. A 1:1 mixture of green (eGFP) and red (dsRed) fluorescent mouse lymphoma RMA cells, which do not express and express human BCMA, respectively, was intravenously (iv) injected into human NKp46 transgenic Rag1-deficient mice (Tg huNKp46 Rag1 - / -). Tumor-bearing mice (n=7 per group) were treated once with a total dose of 12.2 pmoles of NKp46-BCMA_Fc or vehicle as a control. Mouse livers were biopsied 48 hours after treatment, and the absolute number of infiltrated RMA cells was monitored by flow cytometry, as described in Figures 14B-E. [Figures 14B-14D] Figure 14B shows a mixed population of green (eGFP-huBCMA negative) and red (dsRed-huBCMA positive) fluorescent mouse lymphoma RMA cells analyzed by flow cytometry prior to engraftment. Figure 14C shows human BCMA expression by flow cytometry on green (eGFP) and red (dsRed) fluorescent mouse lymphoma RMA cells. Figure 14D shows human BCMA expression on dsRed RMA cells prior to engraftment (in vitro) and after engraftment in a liver biopsy (ex vivo) analyzed by flow cytometry. [Figure 14E]Figure 14E shows the absolute number of liver-infiltrating RMA cells (left) and the dsRed / eGFP cell ratio (right) analyzed by flow cytometry 48 hours after treatment. The statistical test used to analyze the data was the Mann-Whitney test. If p > 0.05, non-significant (ns); significant (**) p < 0.01. [Figure 15A] Figure 15A shows flow cytometric measurements of the percentage of multiple myeloma (MM) cells, defined as CD138+CD38+ cells, and the percentage of CD107a and CD69 expression by NK cells, defined as CD3-CD56+CD16+ cells, after overnight treatment of whole blood-derived PBMCs from one MM patient with 10 μg / mL of NKp46-BCMA_Fc-ADE-DSB, 20 μg / mL of reference-4 antibody (anti-CD38 IgG1 antibody), or control isotype (NKp46-IC_Fc-ADE-DSB). The left panel is a dot plot showing CD138 and CD38 staining of PBMCs from one MM patient and gating on CD138+CD38+ (MM) cells. The contour plot in the center panel shows CD107a and CD16 staining of CD3-CD56+ cells. The contour plot in the right panel shows CD69 and CD16 staining of CD3-CD56+ cells. [Figure 15B] In Figure 15B, the left bar graph represents the percentage of CD38+CD138+ (MM) cells in PBMCs, the middle bar graph represents the percentage of CD3-CD56+CD16+ NK cells expressing CD107a, and the right bar graph represents the percentage of CD3-CD56+CD16+ NK cells expressing CD69 after overnight treatment of whole blood-derived PBMCs from one MM patient with 10 μg / mL of NKp46-BCMA_Fc-ADE-DSB (black), or 20 μg / mL of reference-4 antibody (grey - anti-CD38 IgG1 antibody), or control isotype (white). [Figures 16A-16C]Figures 16A-16C show % MM cell death in patient samples treated ex vivo with NKp46-BCMA_Fc-ADE-DSB, patients who were treatment-naive or relapsed after standard of care. TC = therapeutic class; <4TC: Imid, Dex, PI, and anti-CD38 mAb; >4TC: previous agent and / or alkylating agent, BH3 mimetic, and / or BCMA or CD38TCE, and / or anti-CD47 mAb, and / or histone deacetylase inhibitor (HDACi). [Figure 17] Figure 17 shows the locations of the VYACEVTHQGLSSPVTK (SEQ ID NO: 86), GPSVFPLAPSSK (SEQ ID NO: 87), and TTPPVLDSDGSFFLYSK (SEQ ID NO: 88) peptides on the NKp46-BCMA NKCE_Fc CODV-OL1-ADE-DSB molecule. [Figure 18] FIG. 18 depicts the mean (N=3) plasma concentration versus time profile of NKp46-BCMA_Fc-ADE-DSB NKCE following a single intravenous (2.5 mg / kg) administration to female huFcRn tg32 transgenic mice. [Figure 19] FIG. 19 depicts individual plasma concentration versus time profiles of NKp46-BCMA_Fc-ADE-DSB NKCE following a single intravenous (2.5 mg / kg) administration to female huFcRn tg32 transgenic mice. [Figure 20] Figure 20 shows the activity of the NKp46-BCMA Fc WT CODV-OL1 bispecific antibody against disseminated EL4-huBCMA tumor cells in huNKp46-Tg x Rag mice. The graph depicts Kaplan-Meier curves for animals treated with 5, 0.5, and 0.05 mg / kg of the NKp46-BCMA Fc WT CODV-OL1 bispecific antibody versus the reference 2 compound; control NKCE was abolished for either CD16 (blue), NKp46 (green), or BCMA binding (black), or untreated. [Figure 21]Figure 21 shows the activity of surrogate muNKp46-huBCMA CODV-OL1 Fc WT and Fc-ADE bispecific antibodies against disseminated EL4-huBCMA tumor cells in huFcgR-Tg mice. The graph represents Kaplan-Meier curves for animals treated with 5, 0.5, and 0.05 mg / kg of Fc WT and Fc-ADE muNKp46-huBCMA surrogate bispecific antibodies. [Figure 22] Figure 22 shows the percent dose-response curves of reduction of the main peak of non-reduced samples by DTT as measured by capillary electrophoresis (cGE): mAb ctrl (yellow), CODV-OL1 wt (blue), CODV-OL1 ADE (red), and CODV-OL1 ADE-DSB (black). [Figures 23A-23B] Figure 23 shows dose-response curves of % NEM incorporation / DSB reduction for CODV-OL1 wt (Panel A), CODV-OL1 ADE (Panel B), and CODV-OL1 ADE-DSB (Panel C). The analyzed cysteine ​​residues are numbered according to the analyzed protein and are indicated in the figure legend. [Figure 23C] Same as above. [Figure 24A] Figures 24A-B show the cytotoxicity of NKp46-BCMA_Fc-ADE-DSB in NK cell co-cultures with RPMI8226 cells (Figure 24A) and pro-inflammatory cytokine release (IL-1-β, IL-6, TNF-α, and IFN-γ) in the same co-cultures with PMBCs (Figure 24B). [Figure 24B] Figures 24A-B show the cytotoxicity of NKp46-BCMA_Fc-ADE-DSB in NK cell co-cultures with RPMI8226 cells (Figure 24A) and pro-inflammatory cytokine release (IL-1-β, IL-6, TNF-α, and IFN-γ) in the same co-cultures with PMBCs (Figure 24B). [Figure 25A]Figures 25A-B show the proliferation of MM1R tumor cell line in the presence of NKp46-BCMA_Fc-ADE-DSB in NK cell co-culture (Figure 25A) and pro-inflammatory cytokine release (IL-1-β, IL-6, TNF-α and IFN-γ) in the same co-culture with PMBC (Figure 25B). [Figure 25B] Figures 25A-B show the proliferation of MM1R tumor cell line in the presence of NKp46-BCMA_Fc-ADE-DSB in NK cell co-culture (Figure 25A) and pro-inflammatory cytokine release (IL-1-β, IL-6, TNF-α and IFN-γ) in the same co-culture with PMBC (Figure 25B). [Figure 26A] Figures 26A-26D show the efficacy of NKp46-BCMA_Fc-ADE-DSB on NK cell activation as indicated by activation markers CD69 (Figures 26A and 26C) and CD107a / b (Figures 26B and 26D) in the presence or absence of RPMI 8226 MM cells. [Figure 26B] Same as above. [Figure 26C] Same as above. [Figure 26D] Same as above. [Figure 27A] Figures 27A-27F show the efficacy of NKp46-BCMA_Fc-ADE-DSB on the intracellular production of TFNα (Figures 27A and 27D), IFNγ (Figures 27B and 27E), and MIP1β (Figures 27C and 27F) by NK cells in the presence or absence of RPMI 8826 MM cells. [Figure 27B] Same as above. [Figure 27C] Same as above. [Figure 27D] Same as above. [Figure 27E] Same as above. [Figure 27F] Same as above. [Figure 28A]Figures 28A-B show IFN-γ (Figure 28A) and MIP-1α (Figure 28B) plasma levels following treatment with 1, 10, 100, and 300 μg / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or negative or positive controls in an in vitro assay using human whole blood co-cultured with RPMI 8226-FRP cells. [Figure 28B] Figures 28A-B show IFN-γ (Figure 28A) and MIP-1α (Figure 28B) plasma levels following treatment with 1, 10, 100, and 300 μg / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or negative or positive controls in an in vitro assay using human whole blood co-cultured with RPMI 8226-FRP cells. [Figure 29A] Figures 29A-B show TNF-α (Figure 29A) and IL-1β (Figure 29B) plasma levels following treatment with 1, 10, 100, and 300 μg / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or negative or positive controls in an in vitro assay using human whole blood co-cultured with RPMI 8226-RFP cells. [Figure 29B] Figures 29A-B show TNF-α (Figure 29A) and IL-1β (Figure 29B) plasma levels following treatment with 1, 10, 100, and 300 μg / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or negative or positive controls in an in vitro assay using human whole blood co-cultured with RPMI 8226-RFP cells. [Figure 30A] Figures 30A-B show IL-6 (Figure 30A) and IL-8 (Figure 30B) plasma levels following treatment with 1, 10, 100, and 300 μg / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or negative or positive controls in an in vitro assay using human whole blood co-cultured with RPMI 8226-RFP cells. [Figure 30B]Figures 30A-B show IL-6 (Figure 30A) and IL-8 (Figure 30B) plasma levels following treatment with 1, 10, 100, and 300 μg / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or negative or positive controls in an in vitro assay using human whole blood co-cultured with RPMI 8226-RFP cells. [Figure 31A] Figures 31A-B show IL-2 (Figure 31A) and GM-CSF (Figure 31B) plasma levels following treatment with 1, 10, 100, and 300 μg / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or negative or positive controls in an in vitro assay using human whole blood co-cultured with RPMI 8226-RFP cells. [Figure 31B] Figures 31A-B show IL-2 (Figure 31A) and GM-CSF (Figure 31B) plasma levels following treatment with 1, 10, 100, and 300 μg / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or negative or positive controls in an in vitro assay using human whole blood co-cultured with RPMI 8226-RFP cells. [Figure 32A] Figures 32A-B show IL-4 (Figure 32A) and IL-10 (Figure 32B) plasma levels following treatment with 1, 10, 100, and 300 μg / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or negative or positive controls in an in vitro assay using human whole blood co-cultured with RPMI 8226-RFP cells. [Figure 32B] Figures 32A-B show IL-4 (Figure 32A) and IL-10 (Figure 32B) plasma levels following treatment with 1, 10, 100, and 300 μg / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or negative or positive controls in an in vitro assay using human whole blood co-cultured with RPMI 8226-RFP cells. [Figures 33A-33C]Figures 33A-C show the induction of NK cell activation and tumor cell depletion by NKp46-BCMA_Fc-ADE-DSB in vitro and ex vivo using primary patient samples at diagnosis and relapse. Figure 33A shows % of MM cell death, Figure 33B shows % of CD107+ cells, and Figure 33C shows % of INFγ+ cells. [Figure 34A-34B] Figures 34A-B are graphs showing plasma NKp46-BCMA_Fc-ADE-DSB concentrations after repeated (once weekly for 3 weeks) subcutaneous injections of NKp46-BCMA_Fc-ADE-DSB in cynomolgus monkeys (2 monkeys / dose). Figure 34A shows plasma concentrations in two male monkeys receiving 25,000 μg / kg / dose. Figure 34B shows plasma concentrations in two female monkeys receiving 50,000 μg / kg / dose. [Figure 35] Figure 35 shows plasma IL-6 levels after repeated (once weekly for 3 weeks) subcutaneous injections of NKp46-BCMA_Fc-ADE-DSB at 25 mg / kg / dose or 50 mg / kg / dose in cynomolgus monkeys (2 per dose). DETAILED DESCRIPTION OF THE INVENTION

[0064] The present disclosure provides multifunctional binding proteins that can bind to one surface biomarker on immune NK cells, i.e., NKp46, and one antigen of interest, i.e., BCMA, on the cell membrane of normal and malignant plasma cells, and redirect NK cells to lyse target cells that express the BCMA surface biomarker. The multifunctional binding proteins of the present disclosure further comprise all or a portion of an Fc region or variant thereof that binds to an Fc-gamma receptor (FcγR), particularly an activating Fc-gamma receptor (FcγR), such as FcγRIIIa, also known as CD16a.

[0065] The present disclosure provides novel Fc domain variants (e.g., novel binding polypeptides comprising the Fc domain variants) with improved thermal stability. The present disclosure also provides novel Fc domain variants (e.g., novel binding polypeptides comprising the Fc domain variants) with improved binding to Fc receptors. The present disclosure further provides novel Fc domain variants (e.g., binding polypeptides comprising the Fc domain variants) comprising a glycosylated Fc domain that enhances interaction with antibody effector molecules compared to a wild-type (e.g., unmodified) Fc domain. The present disclosure also provides nucleic acids encoding the Fc domain variants (e.g., novel binding polypeptides comprising the Fc domain variants), recombinant expression vectors and host cells for producing the Fc domain variants (e.g., novel binding polypeptides comprising the Fc domain variants), and pharmaceutical compositions comprising the isolated Fc domain variants (e.g., novel binding polypeptides comprising the Fc domain variants). Methods of using the Fc domain variants (e.g., novel binding polypeptides comprising the Fc domain variants) of the present disclosure to treat one or more diseases or disorders are also provided.

[0066] It is to be understood that the methods described in this disclosure are not limited to the particular methods and experimental conditions disclosed herein, as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0067] Furthermore, unless otherwise indicated, the experiments described herein use conventional molecular and cellular biological and immunological techniques within the skill of those skilled in the art.Such techniques are well known to those skilled in the art and are fully described in the literature.See, for example, Ausubel, et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, NY (1987-2008) (including all supplements), M.R. Green and J. Sambrook, Molecular Cloning: A Laboratory Manual (4th Edition), and J. Sambrook and Harlow et al., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Harbor Laboratory, Cold Spring Harbor (2013, 2nd Edition).

[0068] Unless otherwise defined, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In the case of potential ambiguity, definitions provided herein take precedence over any dictionary or external definitions. Unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. The use of "or" means "and / or" unless specifically stated otherwise. The use of the term "including" and other forms such as "includes" and "included" is not limiting.

[0069] In general, the nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein is well known and commonly used in the art. The methods and techniques provided herein are generally performed according to conventional methods known in the art and as described in the various general and more specific references cited and discussed throughout the specification, unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. The nomenclature used in connection with analytical chemistry, synthetic organic chemistry, and pharmaceutical and medicinal chemistry described herein, as well as the laboratory procedures and techniques thereof, are well known and commonly used in the art. Standard techniques are used for chemical synthesis, chemical analysis, pharmaceutical preparation, formulation and delivery, and treatment of patients.

[0070] In order that the present disclosure may be more readily understood, selected terms are defined below.

[0071] The term "polypeptide" refers to any polymeric chain of amino acids and, unless contradicted by context, includes natural or artificial proteins, polypeptide analogs or variants of protein sequences, or fragments thereof. Polypeptides can be monomeric or polymeric. Polypeptide fragments contain, for example, at least about 5 contiguous amino acids, at least about 10 contiguous amino acids, at least about 15 contiguous amino acids, or at least about 20 contiguous amino acids.

[0072] The term "isolated protein" or "isolated polypeptide" refers to a protein or polypeptide that, by reason of its origin or source, is not associated with naturally associated components which accompany it in its natural state; is substantially free of other proteins from the same species; is expressed by cells from a different species; or does not occur in nature. Thus, a protein or polypeptide that is chemically synthesized or synthesized in a cellular system other than the cell from which it is naturally derived is "isolated" from its naturally associated components. A protein or polypeptide may also be rendered substantially free of naturally associated components by isolation using protein purification techniques well known in the art.

[0073] As used herein, the term "binding protein" or "binding polypeptide" refers to a protein or polypeptide (e.g., an antibody or immunoadhesin) that comprises at least one binding site that is involved in selective binding to a target antigen of interest (e.g., a human target antigen). Exemplary binding sites include an antibody variable domain, a ligand-binding site of a receptor, or a receptor-binding site of a ligand. In certain aspects, a binding protein or binding polypeptide comprises multiple (e.g., 2, 3, 4, or more) binding sites. In certain aspects, a binding protein or binding polypeptide is a therapeutic enzyme.

[0074] The term "ligand" refers to any substance that is capable of binding or being bound to another substance. Similarly, the term "antigen" refers to any substance to which an antibody can be generated. Although "antigen" is commonly used in reference to an antibody-binding substance and "ligand" is often used in reference to a receptor-binding substance, these terms do not distinguish one from the other and encompass a wide range of overlapping chemical entities. For the avoidance of doubt, antigen and ligand are used interchangeably throughout this specification. Antigens / ligands may be peptides, polypeptides, proteins, aptamers, polysaccharides, sugar molecules, carbohydrates, lipids, oligonucleotides, polynucleotides, synthetic molecules, inorganic molecules, organic molecules, and any combination thereof.

[0075] Dissociation constant (K D ) can be determined, for example, by surface plasmon resonance. Generally, surface plasmon resonance analysis measures real-time binding interactions between a ligand (target antigen on a biosensor matrix) and an analyte (binding protein in solution) by surface plasmon resonance (SPR) using a BIAcore system (Pharmacia Biosensor; Piscataway, NJ). Surface plasmon analysis can also be performed by immobilizing the analyte (binding protein on a biosensor matrix) and presenting the ligand (target antigen). As used herein, "K" refers to a surface plasmon resonance (SPR) analysis. D The term "dissociation constant" refers to the dissociation constant of the interaction between a particular binding protein and a target antigen.

[0076] As used herein, the term "specifically binds" means to bind to a molecule that specifically binds ... -6 M, about 1 x 10 -7 M, about 1 x 10 -8 M, about 1 x 10 -9 M, about 1 x 10 -10 M, about 1 x 10 -11 M, about 1 x 10 -12 The dissociation constant (K D ) and / or binds to an antigen with an affinity that is at least about two-fold greater than its affinity for a nonspecific antigen. Specific binding of an antibody can be binding to a target antigen via CDR sequences. An antibody can also specifically bind to an FcR, such as FcRn or FcγRIIIa, via its Fc region.

[0077] As used herein, the term "antibody" refers to such an assembly (e.g., an intact antibody molecule, an immunoadhesin, or a variant thereof) that has significant, known specific immunoreactive activity against an antigen of interest (e.g., a tumor-associated antigen). Antibodies and immunoglobulins comprise light and heavy chains, with or without covalent interchain bonds between them. Basic immunoglobulin structure in vertebrate systems is relatively well understood.

[0078] As discussed in more detail below, the general term "antibody" includes five different classes of antibodies that can be biochemically distinguished. While all five classes of antibodies are clearly within the scope of this disclosure, the following discussion generally relates to the IgG class of immunoglobulin molecules. With respect to IgG, immunoglobulins contain two identical light chains with a molecular weight of approximately 23,000 daltons and two identical heavy chains with a molecular weight of 53,000-70,000. The four chains are joined by disulfide bonds in a "Y" configuration, with the light chains supporting the heavy chains, starting at the mouth of the "Y" and continuing through the variable region.

[0079] Immunoglobulin light chains are classified as either kappa (κ) or lambda (λ). Each heavy chain class can associate with either a kappa or lambda light chain. Generally, when immunoglobulins are produced by either hybridomas, B cells, or genetically engineered host cells, the light and heavy chains are covalently linked to each other, and the "tail" portions of the two heavy chains are linked to each other by covalent disulfide bonds or non-covalent bonds. In heavy chains, the amino acid sequence extends from the N-terminus at the forked end of the Y configuration to the C-terminus at the bottom of each chain. Those skilled in the art will understand that heavy chains are classified as gamma (γ), mu (μ), alpha (α), delta (δ), or epsilon (ε), with several subclasses within them (e.g., γ1-γ4). It is the nature of this chain that determines the "class" of the antibody, as IgG, IgM, IgA, or IgE, respectively. Immunoglobulin isotype subclasses (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, etc.) are well characterized and are known to confer functional specialization. Modified versions of each of these classes and isotypes are readily discernible to those of skill in the art in light of the present disclosure and, accordingly, are within the scope of the present disclosure.

[0080] Both light and heavy chains are divided into regions of structural and functional homology. The term "region" refers to a portion or parts of an immunoglobulin or antibody chain, and includes the constant or variable region, as well as more distinct portions or parts of such regions. For example, a light chain variable region contains "complementarity-determining regions" or "CDRs" interspersed among "framework regions" or "FRs," as defined herein.

[0081] Regions of an immunoglobulin heavy or light chain can be defined as "constant" (C) regions or "variable" (V) regions, based on the relative lack of sequence variation within the region among various class members, in the case of the "constant region," or the significant variation within the region among various class members, in the case of the "variable region." The terms "constant region" and "variable region" can also be used functionally. In this regard, it will be understood that the variable region of an immunoglobulin or antibody determines antigen recognition and specificity. Conversely, the constant region of an immunoglobulin or antibody confers important effector functions, such as secretion, transplacental movement, Fc receptor binding, complement fixation, and the like. The subunit structures and three-dimensional configurations of the constant regions of various immunoglobulin classes are well known.

[0082] The constant and variable regions of immunoglobulin heavy and light chains are folded into domains. The term "domain" refers to a globular region of a heavy or light chain, including, for example, a beta-pleated sheet and / or peptide loops (e.g., containing 3-4 peptide loops) stabilized by intrachain disulfide bonds. The constant region domain on the light chain of an immunoglobulin is synonymously referred to as a "light chain constant region domain," "CL region," "CL domain," or "CK domain." The constant domain on the heavy chain (e.g., hinge, CH1, CH2, or CH3 domain) is synonymously referred to as a "heavy chain constant region domain," "CH" region domain, or "CH domain." The variable domain on the light chain is synonymously referred to as a "light chain variable region domain," "VL region domain," or "VL domain." The variable domain on the heavy chain is synonymously referred to as a "heavy chain variable region domain," "VH region domain," or "VH domain."

[0083] By convention, the numbering of the amino acids in the variable constant region domains increases as they become more distal from the antigen-binding site or amino-terminus of the immunoglobulin or antibody. The N-terminus of each heavy and light immunoglobulin chain is the variable region, and the C-terminus is the constant region. The CH3 and CL domains comprise the carboxy-termini of the heavy and light chains, respectively. Thus, the domains of the light chain immunoglobulin are arranged in a VL-CL orientation, while the domains of the heavy chain are arranged in a VH-CH1-hinge-CH2-CH3 orientation.

[0084] The amino acid assignments for each variable region domain follow the definitions in Kabat, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, MD, 1987 and 1991). Kabat also provides a widely used numbering scheme (Kabat numbering) in which the same numbers are assigned to corresponding residues between different heavy chain variable regions or different light chain variable regions. CDRs 1, 2, and 3 of the VL domain are also referred to herein as CDR-L1, CDR-L2, and CDR-L3, respectively. CDRs 1, 2, and 3 of the VH domain are also referred to herein as CDR-H1, CDR-H2, and CDR-H3, respectively. If so, CDR assignments can follow IMGT® (Lefranc et al., Developmental & Comparative Immunology 27:55-77; 2003) instead of Kabat. The numbering of the heavy chain constant region is according to the EU index as described in Kabat (Kabat, Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, MD, 1987 and 1991).The exact amino acid sequence boundaries of a given CDR or FR can be determined by Kabat et al. (1991), "Sequences of Proteins of Immunological Interest," 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. ("Kabat" numbering scheme); Al-Lazikani et al., (1997) JMB 273, 927-948 ("Chothia" numbering scheme); MacCallum et al., J. Mol. Biol. 262:732-745 (1996), "Antibody-antigen interactions: Contact analysis and binding site topography," J. Mol. Biol. 262, 732-745 ("Contact" numbering scheme); Lefranc MP et al., "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains," Dev Comp Immunol. 2003 January;27(1):55-77 (the "IMGT" numbering scheme), and Honegger A and Pluckthun A, "Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool," J Mol Biol, 2001 June.8;309(3):657-70 (the AHo numbering scheme).

[0085] The boundaries of a given CDR or FR may vary depending on the scheme used for identification. For example, the Kabat scheme is based on structural alignment, while the Chothia scheme is based on structural information. The numbering for both the Kabat and Chothia schemes is based on the most common antibody region sequence lengths, with insertions accommodated by an insertion letter, e.g., "30a," and deletions occurring in some antibodies. The two schemes place certain insertions and deletions ("indels") at different positions, resulting in different numbering. The contact scheme is based on the analysis of complex crystal structures and is similar in many respects to the Chothia numbering scheme.

[0086] As used herein, the CDRs of an antibody can be determined according to the numbering system called "IMGT" described in Lefranc (1999), The Immunologist, vol. 7:132-136 and Lefranc et al. (1999), Nucleic Acids Res., vol. 27:209-212.

[0087] As used herein, the CDRs of an antibody can be determined according to the Chothia numbering scheme, which refers to the position of the immunoglobulin structural loops. Chothia and Lesk (1987), J. Mol. Biol., vol. 196: 901-917; Al-Lazikani et al. (1997), J. Mol. Biol., vol. 273: 927-948; Chothia et al. (1992), J. Mol. Biol., vol. 227: 799-817; Tramontano A et al. (1990), J. Mol. Biol., vol. 215(1): 175-82.

[0088] As used herein, the CDRs of an antibody can be determined according to the Honegger-Pluckthun numbering scheme described in Honnegger and Pluckthun (2001), J. Mol. Biol., vol. 309(3):657-670.

[0089] As used herein, the term "VH domain" includes the amino-terminal variable domain of an immunoglobulin heavy chain, and the term "VL domain" includes the amino-terminal variable domain of an immunoglobulin light chain.

[0090] As used herein, the term "CH1 domain" includes the first (most amino-terminal) constant region domain of an immunoglobulin heavy chain, e.g., extending from about positions 114-223 of the Kabat numbering system (EU positions 118-215). The CH1 domain is adjacent to the VH domain and amino-terminal to the hinge region of the immunoglobulin heavy chain molecule, and does not form part of the Fc region of the immunoglobulin heavy chain.

[0091] As used herein, the term "hinge region" includes the portion of a heavy chain molecule that connects the CH1 domain to the CH2 domain. The hinge region contains approximately 25 residues and is flexible, allowing the two N-terminal antigen-binding regions to move independently. The hinge region can be subdivided into three distinct domains: the upper, middle, and lower hinge domains (Roux et al. J. Immunol. 1998, 161:4083).

[0092] As used herein, the term "CH2 domain" includes, for example, the portion of a heavy chain immunoglobulin molecule extending from about position 244-360 of the Kabat numbering system (EU positions 231-340). The CH2 domain is unique in that it is not closely paired with another domain. Rather, two N-linked branched carbohydrate chains are sandwiched between the two CH2 domains in an intact, native IgG molecule. In one embodiment, a binding polypeptide of the disclosure comprises a CH2 domain derived from an IgG1 molecule (e.g., a human IgG1 molecule).

[0093] As used herein, the term "CH3 domain" includes the portion of a heavy chain immunoglobulin molecule extending approximately 110 residues from the N-terminus of the CH2 domain, e.g., from about positions 361-476 of the Kabat numbering system (EU positions 341-445). The CH3 domain typically forms the C-terminal portion of the antibody. However, in some immunoglobulins, additional domains may extend from the CH3 domain and form the C-terminal portion of the molecule (e.g., the CH4 domain in the μ chain of IgM and the e chain of IgE). In one embodiment, a binding polypeptide of the disclosure comprises a CH3 domain derived from an IgG1 molecule (e.g., a human IgG1 molecule).

[0094] As used herein, the term "CL domain" includes, for example, the constant region domain of an immunoglobulin light chain extending from about Kabat position 107A to about Kabat position 216. The CL domain is adjacent to the VL domain. In one embodiment, a binding polypeptide of the disclosure includes a CL domain derived from a kappa light chain (e.g., a human kappa light chain).

[0095] The variable region of an antibody enables the antibody to selectively recognize and specifically bind to an epitope on an antigen. That is, the VL domain and VH domain of an antibody combine to form a variable region (Fv) that defines a three-dimensional antigen-binding site. More specifically, the antigen-binding site is defined by three complementarity-determining regions (CDRs) of each of the heavy and light chain variable regions. As used herein, the term "antigen-binding site" includes a site that specifically binds to an antigen (e.g., a cell-surface or soluble antigen). An antigen-binding site comprises immunoglobulin heavy and light chain variable regions, and the binding site formed by these variable regions determines the specificity of the antibody. The antigen-binding site is formed by variable regions that differ from antibody to antibody. The modified antibodies of the present disclosure comprise at least one antigen-binding site.

[0096] In certain embodiments, binding polypeptides of the present disclosure comprise at least two antigen-binding domains that provide for association of the binding polypeptide with a selected antigen. The antigen-binding domains need not be derived from the same immunoglobulin molecule. In this regard, the variable regions may be derived from any type of animal that can be induced to mount a humoral response and produce immunoglobulins against the desired antigen. Thus, the variable regions of the binding polypeptides may be of mammalian origin, such as human, mouse, rat, goat, sheep, non-human primate (e.g., cynomolgus monkey, macaque, etc.), lupine, or camelid (e.g., from camel, llama, and related species).

[0097] In naturally occurring antibodies, the six CDRs present on each monomeric antibody are short, noncontiguous sequences of amino acids that are specifically arranged to form the antigen-binding site when the antibody assumes its three-dimensional configuration in an aqueous environment. The remainder of the heavy and light variable domains, which show less inter-molecular variability in amino acid sequence, are called framework regions. The framework regions primarily adopt a beta-sheet conformation, and the CDRs form loops that connect, and in some cases form part of, the beta-sheet structure. Thus, these framework regions act as a scaffold that orients the six CDRs through interchain non-covalent interactions. The antigen-binding domain formed by the arranged CDRs defines a surface complementary to the epitope on the immunoreactive antigen. This complementary surface facilitates non-covalent binding of the antibody to the immunoreactive antigen epitope.

[0098] Exemplary binding polypeptides include antibody variants. As used herein, the term "antibody variant" includes antibodies that have been modified so as not to occur in nature, e.g., synthetic and engineered forms of antibodies that contain at least two heavy chain portions but not two complete heavy chains (e.g., domain-deleted antibodies or minibodies); multispecific forms of antibodies (e.g., bispecific, trispecific, etc.) that have been modified to bind to two or more different antigens or different epitopes on a single antigen; heavy chain molecules linked to scFv molecules, etc. Furthermore, the term "antibody variant" includes multivalent forms of antibodies (e.g., trivalent, tetravalent, etc., antibodies that bind to three, four, or more copies of the same antigen).

[0099] As used herein, the term "valency" refers to the number of potential target binding sites in a polypeptide. Each target binding site specifically binds to one target molecule or specific site on a target molecule. When a polypeptide contains two or more target binding sites, each target binding site may specifically bind to the same or different molecules (e.g., different ligands or different antigens, or different epitopes on the same antigen). A subject-binding polypeptide typically has at least one binding site specific for a human antigen molecule. For example, a typical IgG1 monoclonal antibody is specific for one target antigen. A bivalent antibody contains antigen-binding domains that target two different antigens, or two antigen-binding domains that target one antigen. Similarly, a trivalent antibody can be a monospecific antibody with three targeting domains for a single antigen. A trivalent antibody can be bispecific if it binds to a first antigen with two binding domains and a second antigen with a different binding domain. A trivalent antibody can be trispecific, binding to three different targets.

[0100] The term "specificity" refers to the ability to specifically bind (e.g., to) a given target antigen (e.g., a human target antigen). A binding polypeptide can be monospecific and contain one or more binding sites that specifically bind to a target, or the polypeptide can be multispecific and contain two or more binding sites that specifically bind to the same or different targets. In certain embodiments, a binding polypeptide is specific for two different (e.g., non-overlapping) portions of the same target. In certain embodiments, a binding polypeptide is specific for two or more targets. Exemplary binding polypeptides (e.g., antibodies) that contain an antigen-binding site that binds to an antigen expressed on tumor cells are known in the art, and one or more CDRs from such antibodies can be included in the antibodies described herein.

[0101] As used herein, the term "antigen" or "target antigen" refers to a molecule or portion of a molecule that can be bound by the binding site of a binding polypeptide. A target antigen can have one or more epitopes.

[0102] The term "about" or "approximately" means within about 20%, such as within about 10%, within about 5%, or within about 1% or less of a given value or range.

[0103] As used herein, "administering" or "administration" refers to the act of injecting or otherwise physically delivering a substance present outside the body (e.g., an isolated binding polypeptide provided herein) to a patient, such as, but not limited to, pulmonary (e.g., inhalation), mucosal (e.g., intranasal), intradermal, intravenous, intramuscular, subcutaneous delivery, and / or any other physical delivery method described herein or known in the art. Where a disease or a symptom thereof is being managed or treated, administration of the substance typically occurs after the onset of the disease or a symptom thereof. Where a disease or a symptom thereof is being prevented, administration of the substance typically occurs before the onset of the disease or a symptom thereof and may be continued chronically to postpone or reduce the appearance or magnitude of disease-related symptoms.

[0104] As used herein, the term "composition" is intended to encompass a product containing specified components (e.g., an isolated binding polypeptide provided herein), optionally in specified amounts, as well as any product resulting directly or indirectly from the combination of specified components, optionally in specified amounts.

[0105] "Effective amount" means an amount of active pharmaceutical agent (e.g., an isolated binding polypeptide of the present disclosure) sufficient to achieve a desired physiological outcome in an individual in need thereof. The effective amount may vary from individual to individual depending on the health and condition of the individual being treated, the taxonomic group of the individual being treated, the formulation of the composition, an assessment of the individual's medical condition, and other relevant factors.

[0106] As used herein, the terms "subject" and "patient" are used interchangeably. As used herein, a subject can be a mammal, such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans). In certain embodiments, the term "subject" as used herein refers to a vertebrate, such as a mammal. Mammals include, but are not limited to, humans, non-human primates, wild animals, feral animals, farm animals, sport animals, and pets.

[0107] As used herein, the term "treatment" refers to any protocol, method, and / or agent that can be used to prevent, manage, treat, and / or ameliorate a disease or its associated symptoms. In some embodiments, the term "treatment" refers to any protocol, method, and / or agent that can be used to modulate an immune response to an infection or its associated symptoms in a subject. In some embodiments, the terms "treatment / therapies" and "treatment / therapy" refer to biological therapies, supportive therapies, and / or other therapies known to those of skill in the art, such as healthcare professionals, that are useful for preventing, managing, treating, and / or ameliorating a disease or its associated symptoms. In other embodiments, the terms "treatment / therapies" and "treatment / therapy" refer to biological therapies, supportive therapies, and / or other therapies known to those of skill in the art, such as healthcare professionals, that are useful for modulating an immune response to an infection or its associated symptoms in a subject.

[0108] As used herein, the terms "treat," "treatment," and "treating" refer to the reduction or amelioration of the progression, severity, and / or duration of a disease or symptoms associated therewith resulting from the administration of one or more therapies (including, but not limited to, the administration of one or more prophylactic or therapeutic agents, e.g., an isolated binding polypeptide provided herein). As used herein, the term "treating" can also refer to altering the course of the disease in the subject being treated. The therapeutic effect of a treatment includes, but is not limited to, prevention of the onset or recurrence of the disease, alleviation of symptoms (), reduction of the direct or indirect pathological consequences of the disease, slowing the rate of disease progression, improvement or palliation of the disease state, and remission or improved prognosis.

[0109] BCMA As used herein, the term "BCMA" refers to a B-cell maturation antigen. BCMA (also known as TNFRSF17, BCM, or CD269) is a member of the tumor necrosis receptor (TNFR) family and is expressed primarily on terminally differentiated B cells, such as memory B cells and plasma cells. Its ligands are called B-cell-activating factor of the TNF family (BAFF) and proliferation-inducing ligand (APRIL). BCMA is involved in mediating plasma cell survival to maintain long-term humoral immunity. The BCMA gene is encoded on chromosome 16 and produces a primary 35 mRNA transcript 994 nucleotides long (NCBI accession NM_001192.2) that encodes a 184-amino acid protein (NP_001183.2). A second antisense transcript derived from the BCMA locus has been described, which may play a role in regulating BCMA expression. (Laabi Y. et al., Nucleic Acids Res., 1994, 22:1147-1154) Additional transcript variants have been described of unknown significance (Smirnova AS et al. Mol Immunol., 2008, 45(4):1179-1183). A second isoform, also known as TV4, has been identified (Uniprot identifier Q02223-2). "BCMA" includes proteins containing mutations of full-length wild-type BCMA, such as point mutations, fragments, insertions, deletions, and splice variants.

[0110] Natural killer cells As used herein, "natural killer cells" or "NK cells" refer to a subpopulation of lymphocytes involved in innate immunity. NK cells can be identified by certain characteristics and biological properties, such as the expression of specific surface antigens, including CD16, CD56 and / or CD57, NKp46 on human NK cells, the absence of alpha / beta or gamma / delta TCR complexes on the cell surface, the ability to bind to and kill cells that do not express "self" MHC / HLA antigens by activating specific cytolytic mechanisms, the ability to kill tumor cells or other diseased cells that express ligands for NK-activating receptors, and the ability to release protein molecules called cytokines that stimulate or inhibit immune responses. Any of these characteristics and activities can be used to identify NK cells using methods well known in the art. Any subpopulation of NK cells is also encompassed by the term NK cells. Within the context of this specification, "active" NK cells refer to biologically active NK cells, including NK cells that have the ability to lyse target cells or enhance the immune function of other cells. NK cells can be obtained by a variety of techniques known in the art, such as isolation from blood samples, cytapheresis, tissue or cell harvesting, etc. Protocols useful for assays involving NK cells can be found in Natural Killer Cells Protocols (ed. Campbell KS and Colonna M) Human Press, pp. 219-238 (2000).

[0111] NKp46 As used herein, the "NKp46" marker or "natural cytotoxicity-inducing receptor 1," also known as "CD335" or "NKP46" or "NK-p46" or "LY94," refers to the protein or polypeptide encoded by the Ncr1 gene. The reference sequence for the full-length human NKp46 protein is available from the NCBI database under accession number NP_004820. The human NKp46 mRNA sequence is set forth in NCBI accession number NM_004829.

[0112] NK cell engager As used herein, isolated effector-competent polypeptides include multispecific antibodies in NK cell engager format. "NK cell engager" refers to a binding protein comprising an activating NK cell receptor, an antigen-specific targeting region, and, optionally, a monoclonal antibody domain targeting the Fc region (Gauthier, et al. (2019) Cell, 177:1701-13). NK cells express CD16a, also known as FcγRIIIa, which binds with low affinity to the Fc portion of antibodies (Cerwenka and Lanier (2018) Science 359:6383). CD16a engagement is less demanding than CD3 engagement due to lower steric hindrance and is further facilitated by the lack of accessory molecules. Upon recognition of antibody-decorated target cells, NK cells mediate antibody-dependent cellular cytotoxicity (ADCC) and kill the target cells (Lo Nigro (2019) Ann Transl Med 7:105). This naturally occurring mechanism can be exploited to engage CD16 in combination with NKp46 (another activating NK cell receptor) to generate trifunctional natural killer cell engagers (i.e., NKCEs) that result in impressive therapeutic outcomes. For a review of NK cell engagers, see Demaria et al. (2021) Eur. J. Immunology 51(8):1934, incorporated herein by reference in its entirety.

[0113] Trifunctional NKCEs are more potent in vitro than clinical therapeutic antibodies targeting the same antigen, have in vivo pharmacokinetics similar to full IgG antibodies, and are free of off-target effects. See International Application No. PCT / IB21 / 62494, incorporated herein by reference in its entirety.

[0114] Fc domain Certain embodiments of the present disclosure provide Fc domains, e.g., Fc domain variants. As used herein, the term "Fc region" or "Fc domain" refers to the portion of the heavy chain constant region beginning with the hinge region immediately upstream of the papain cleavage site (i.e., residue 216 in IgG, with the first residue of the heavy chain constant region being 114) and ending at the C-terminus of the antibody. Thus, a complete Fc region includes at least the hinge, CH2, and CH3 domains.

[0115] The Fc region of an antibody is not involved in antigen binding but can mediate effector functions by binding to Fc receptors. There are several different types of Fc receptors, which are classified based on the type of antibody they recognize. For example, Fc-gamma receptors (FcγR) bind to IgG class antibodies, Fc-alpha receptors (FcαR) bind to IgA class antibodies, and Fc-epsilon receptors (FcεR) bind to IgE class antibodies. The neonatal Fc receptor (FcRn) interacts with the Fc region of antibodies to promote antibody recycling by rescuing them from normal lysosomal degradation. The FcγR family includes several members, including FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa, and FcγRIIIb.

[0116] As used herein, the term "native Fc" or "wild-type Fc" refers to a molecule corresponding to the sequence of a non-antigen-binding fragment resulting from antibody digestion or produced by other means, whether in monomeric or multimeric form, and may include the hinge region. The original immunoglobulin source of a native Fc is typically human and can be any immunoglobulin, e.g., IgG1 and IgG2. A native Fc molecule is composed of monomeric polypeptides that can be linked into dimeric or multimeric forms by covalent (i.e., disulfide) and non-covalent bonds. The number of intermolecular disulfide bonds between the monomeric subunits of a native Fc molecule ranges from one to four, depending on the class (e.g., IgG, IgA, and IgE) or subclass (e.g., IgG1, IgG2, IgG3, IgA1, and IgGA2). One example of a native Fc is a disulfide-bonded dimer resulting from papain digestion of IgG. As used herein, the term "native Fc" refers to any of the monomeric, dimeric and multimeric forms.

[0117] As used herein, the terms "Fc domain variant," "Fc variant," or "modified Fc" refer to a molecule or sequence that has been modified from a native / wild-type Fc but still comprises an FcR binding site. Thus, the term "Fc variant" can include a molecule or sequence that has been humanized from a non-human native Fc. Furthermore, a native Fc contains regions that can be removed because they provide structural features or biological activity not required for the antibody-like binding polypeptides described herein. Thus, the term "Fc variant" includes molecules or sequences that lack one or more native Fc sites or residues, or in which one or more Fc sites or residues have been modified to affect or be involved in: (1) disulfide bond formation, (2) incompatibility with a selected host cell, (3) N-terminal heterogeneity upon expression in a selected host cell, (4) glycosylation, (5) interaction with complement, (6) binding to Fc receptors other than the salvage receptor, or (7) antibody-dependent cellular cytotoxicity (ADCC).

[0118] As used herein, "effector-competent Fc variant" or "effector-competent polypeptide" refers to an Fc domain that possesses one or more Fc effector functions as further described herein.

[0119] In certain exemplary embodiments, the Fc variants featured herein have one or more of increased serum half-life, enhanced FcRn binding affinity, enhanced FcRn binding affinity at acidic pH, enhanced FcγRIIIa binding affinity, and / or similar thermal stability compared to the wild-type Fc.

[0120] FcγRIIIa V176, or FcγRIIIa V158, or human CD16a-V receptor, or CD16a V refers to a polypeptide construct that binds to the Fc region of a native antibody, mediates antibody-dependent cellular cytotoxicity, and comprises a fragment of the CD16 human receptor with a valine (V) at position 176 or position 158, also reported in the literature as allotype CD16a V176 or allotype CD16a V158.

[0121] FcγRIIIa F176, or FcγRIIIa F158, or human CD16a-F receptor, or CD16a F refers to a polypeptide construct containing a fragment of the CD16 human receptor that binds to the Fc region of a native antibody, mediates antibody-dependent cellular cytotoxicity, and has a phenylalanine (F) at position 176 or position 158, also reported in the literature as allotype CD16a F176 or allotype CD16a F158.

[0122] As used herein, the term "Fc domain" encompasses native / wild-type Fc and Fc variants and sequences as defined herein. As with Fc variants and native Fc molecules, the term "Fc domain" includes the monomeric or multimeric form of the molecule, whether digested from a whole antibody or produced by other means.

[0123] In certain exemplary embodiments, the Fc domains described herein are thermally stabilized.

[0124] In certain exemplary embodiments, the Fc domain described herein is glycosylated (e.g., via N-linked glycosylation). In certain exemplary embodiments, the Fc domain comprises N-linked glycosylation, e.g., at an N-linked glycosylation motif comprising the amino acid sequence NXT or NXS (where X is any amino acid residue except proline). In certain exemplary embodiments, the Fc domain is glycosylated at amino acid position 297 according to EU numbering.

[0125] In certain exemplary embodiments, the Fc domains described herein are effector-competent.

[0126] In certain exemplary embodiments, the Fc domains described herein are any combination of thermostable, glycosylated, and effector competent.

[0127] Thermostabilized Fc domain variants The structure of constant antibody domains is similar to that of variable domains, consisting of β-strands connected by loops and short helices. The CH2 domain of the heavy constant region exhibits weak carbohydrate-mediated interchain protein-protein interactions, in contrast to the extensive interchain interactions exhibited by other domains. Although isolated mouse CH2 domains are relatively unstable at physiological temperatures (Feige et al., 2004, J. Mol. Biol. 344:107-118), previous studies have demonstrated that the thermal stability of CH2 domains can be enhanced by the addition of intrachain disulfide bonds, which can be used as binder scaffolds (Gong et al., 2009, J. Biol. Chem. 284:14203-210).

[0128] Effector-enhancing Fc domain mutants are known that exhibit increased thermolability (i.e., decreased thermal stability) compared to wild-type Fc domains. For example, the S239D / I332E and S239D / I332E / A330L mutants result in decreased stability of the CH2 domain, as indicated by a decreased melting temperature (Tm) in differential scanning calorimetry (DSC) analysis. The G236A / S239D / A330L / I332E mutant exhibits a decreased measured thermal shift of the protein compared to the wild-type, and a significantly decreased half-life in hFcγR transgenic mice. (See Liu et al. (2014) J. Biol. Chem. 289(6):3571, and for a review, Liu et al. (2020) Antibodies 9(4):64.)

[0129] Effector-enhancing Fc domain mutants with improved FcγR binding and no significant reduction in stability compared to the wild-type are known (see, e.g., Igawa et al., European Patent No. 2 940 135).

[0130] It has further been discovered that thermostabilized Fc domain variants can be produced by introducing one or more disulfide bonds into the Fc domain. Accordingly, in one aspect, the present disclosure provides Fc domain variants comprising one or more engineered (e.g., non-native) disulfide bonds, e.g., intrachain disulfide bonds mediated, for example, by one or more cysteine ​​pairs.

[0131] In certain exemplary embodiments, the disulfide bond is an intrachain disulfide bond between the two CH2 regions of the Fc domain. In certain exemplary embodiments, the disulfide bond is an intrachain disulfide bond between the two CH3 regions of the Fc domain. In certain exemplary embodiments, two or more intrachain disulfide bonds exist between the two CH2 regions of the Fc domain and / or between the two CH3 regions of the Fc domain.

[0132] Thermal stability, or the tendency of an Fc domain (e.g., an Fc domain with or without a binding polypeptide) to unfold, can be determined using various methods known in the art. For example, the unfolding or denaturation temperature can be measured by nanoformat differential scanning calorimetry (nanoDSC) or nanoformat differential scanning fluorometry (nanoDSF) (Wen et al., 2020 Anal. Biochem. 593:113581). The detectable temperature at which a protein begins to unfold is T.

[0133] In certain exemplary embodiments, the Tonset of a thermostabilized Fc domain variant (e.g., having one or more engineered disulfide bonds) is increased compared to a non-thermostabilized Fc domain variant. In certain exemplary embodiments, the Tonset of a thermostabilized Fc domain variant is increased by about 1.0°C, about 1.5°C, about 2.0°C, about 2.5°C, about 3.0°C, about 3.5°C, about 4.0°C, about 4.5°C, about 5.0°C, about 5.5°C, about 6.0°C, about 6.5°C, about 7.0°C, about 7.5°C, about 8.0°C, about 8.5°C, about 9.0°C, about 9.5°C, about 10.0°C, about 10.5°C, about 11.0°C, or about 11.5°C relative to a non-thermostabilized Fc domain variant. , about 12.0°C, about 12.5°C, about 13.0°C, about 13.5°C, about 14.0°C, about 14.5°C, about 15.0°C, about 15.5°C, about 16.0°C, about 16.5°C, about 17.0°C, about 17.5°C, about 18.0°C, about 18.5°C, about 19.0°C, about 19.5°C, about 20.0°C, about 20.5°C, about 21.0°C, about 21.5°C, about 22.0°C, about 22.5°C, about 23.0°C, about 23.5°C, about 24.0°C, about 24.5°C, or about 25.0°C.

[0134] In certain exemplary embodiments, the thermostabilizing Fc domain variants have one or more pairs of amino acid substitutions selected from the group consisting of cysteine ​​substitutions at the following positions: amino acid positions 242 and 334; amino acid positions 240 and 334; amino acid positions 287 and 306; amino acid positions 292 and 302; amino acid positions 323 and 332; amino acid positions 259 and 306; amino acid positions 350 and 441; amino acid positions 343 and 431; amino acid positions 375 and 404; amino acid positions 375 and 396; and amino acid positions 348 and 439 (according to EU numbering). (Wozniak-Knopp et al., 2012, PLoS One 7:e30083; Jacobsen et al., 2017 J. Biol. Chem. 202:1865-75; for review see WO2014153063).

[0135] In certain exemplary embodiments, the thermostabilizing Fc domain variant comprises an engineered (e.g., non-natural) intrachain disulfide bond mediated by a pair of cysteines substituting, according to EU numbering, (i) a leucine (L) at amino acid position 242 and a lysine (K) at amino acid position 334; (ii) an alanine (A) at amino acid position 287 and a leucine (L) at amino acid position 306; or (iii) an arginine (R) at amino acid position 292 and a valine (V) at amino acid position 302.

[0136] In certain exemplary embodiments, the thermostabilizing Fc domain variant comprises an engineered (e.g., non-natural) intrachain disulfide bond mediated by a pair of cysteines substituting (i) leucine (L) at amino acid position 242 and lysine (K) at amino acid position 334; (ii) arginine (R) at amino acid position 292 and valine (V) at amino acid position 302, according to EU numbering.

[0137] In certain exemplary embodiments, the thermostabilizing Fc domain variant comprises an engineered (e.g., non-natural) intrachain disulfide bond mediated by a pair of cysteines substituting leucine (L) at amino acid position 242 and lysine (K) at amino acid position 334. In certain exemplary embodiments, the thermostabilizing Fc domain variant comprises an engineered (e.g., non-natural) intrachain disulfide bond mediated by a pair of cysteines substituting alanine (A) at amino acid position 287 and leucine (L) at amino acid position 306. In certain exemplary embodiments, the thermostabilizing Fc domain variant comprises an engineered (e.g., non-natural) intrachain disulfide bond mediated by a pair of cysteines substituting arginine (R) at amino acid position 292 and valine (V) at amino acid position 302. In certain exemplary embodiments, the thermostabilizing Fc domain variant may comprise at least one engineered intrachain disulfide bond. In certain exemplary embodiments, the thermostabilizing Fc domain variant may comprise two or more engineered intrachain disulfide bonds.

[0138] Effector-enhancing Fc domain mutants In one aspect, the present disclosure provides Fc domain variants comprising effector-enhancing amino acid substitutions.

[0139] In one embodiment, the Fc domain variant with altered FcγRIIIa binding comprises one or more amino acid substitutions as disclosed herein. In one embodiment, the Fc domain variant with enhanced FcγRIIIa binding affinity comprises one or more amino acid substitutions as disclosed herein. In one embodiment, the Fc domain variant with enhanced FcγRIIIa binding affinity comprises two or more amino acid substitutions as disclosed herein. In one embodiment, the Fc domain variant with enhanced FcγRIIIa binding affinity comprises three or more amino acid substitutions as disclosed herein. In one embodiment, the Fc domain variant with enhanced FcγRIIIa binding affinity comprises four or more amino acid substitutions as disclosed herein.

[0140] In one embodiment, the Fc domain variant with altered FcRn binding comprises an Fc domain with one or more amino acid substitutions disclosed herein. In one embodiment, the Fc domain variant with enhanced FcRn binding affinity comprises an Fc domain with one or more amino acid substitutions disclosed herein. In one embodiment, the Fc domain variant with enhanced FcRn binding affinity comprises an Fc domain with two or more amino acid substitutions disclosed herein. In one embodiment, the Fc domain variant with enhanced FcRn binding affinity comprises an Fc domain with three or more amino acid substitutions disclosed herein.

[0141] In some embodiments, the Fc domain variants may exhibit species-specific FcRn binding affinity. In one embodiment, the Fc domain variants may exhibit FcRn binding affinity. In one embodiment, the Fc domain variants may exhibit cynomolgus monkey FcRn binding affinity. In some embodiments, the Fc domain variants may exhibit cross-species FcRn binding affinity. Such Fc domain variants are said to be cross-reactive across one or more different species. In one embodiment, the Fc domain variants may exhibit both human and cynomolgus monkey FcRn binding affinity.

[0142] The neonatal Fc receptor (FcRn) interacts with the Fc region of antibodies to promote their recycling via rescue from normal lysosomal degradation. This process is pH-dependent, occurring in endosomes at acidic pH (e.g., pH less than 6.5) but not under physiological pH conditions of the bloodstream (e.g., non-acidic pH). In some embodiments, the Fc domain variants have enhanced FcRn-binding affinity at acidic pH compared to the wild-type Fc domain. In some embodiments, the Fc domain variants have enhanced FcRn-binding affinity at pH less than 7.0, e.g., about pH 6.5, about pH 6.0, about pH 5.5, or about pH 5.0, compared to the wild-type Fc domain. In some embodiments, the Fc domain variants have enhanced FcRn-binding affinity at pH less than 7.0, e.g., about pH 6.5, about pH 6.0, about pH 5.5, or about pH 5.0, compared to the FcRn-binding affinity of the wild-type Fc domain at elevated, non-acidic pH. The elevated non-acidic pH can be, for example, a pH above 7.0, about pH 7.0, about pH 7.4, about pH 7.6, about pH 7.8, about pH 8.0, about pH 8.5, about pH 9.0.

[0143] In certain embodiments, it may be desirable for the Fc domain variant to exhibit approximately the same FcRn-binding affinity as the wild-type Fc domain at non-acidic pH. In some embodiments, it may be desirable for the Fc domain variant to exhibit lower FcRn-binding affinity at non-acidic pH than a binding polypeptide comprising a modified Fc domain with the double amino acid substitution M428L / N434S, according to EU numbering (see U.S. Pat. No. 8,088,376). Thus, it may be desirable for the Fc domain variant to exhibit minimal perturbation to pH-dependent FcRn binding.

[0144] In some embodiments, Fc domain variants with enhanced FcRn binding affinity at acidic pH have a reduced (i.e., slower) FcRn off-rate compared to the wild-type Fc domain. In some embodiments, Fc domain variants with enhanced FcRn binding affinity at acidic pH compared to the FcRn binding affinity of the binding polypeptide at elevated non-acidic pH have a slower FcRn off-rate at acidic pH compared to the FcRn off-rate of the wild-type Fc domain at elevated non-acidic pH.

[0145] Certain embodiments include Fc domain variants in which at least one amino acid in one or more of the constant region domains has been deleted or otherwise modified to provide a desired biochemical characteristic, e.g., reduced or enhanced effector function, ability to non-covalently dimerize, increased ability to localize to tumor sites, decreased serum half-life, or increased serum half-life, when compared to a intact antibody of approximately the same immunogenicity.

[0146] In certain other embodiments, the Fc domain variant comprises a constant region derived from a different antibody isotype (e.g., constant regions derived from two or more of human IgG1, IgG2, IgG3, or IgG4). In other embodiments, the Fc domain variant comprises a chimeric hinge (i.e., a hinge comprising hinge domains from different antibody isotypes, e.g., an upper hinge domain derived from an IgG4 molecule and a hinge portion derived from an IgG1 middle hinge domain). In certain embodiments, the Fc domain can be mutated to increase or decrease effector function using techniques known in the art.

[0147] In some embodiments, the Fc domain variants have altered binding affinity to an Fc receptor. There are several different types of Fc receptors, which are classified based on the type of antibody they recognize. For example, Fc-gamma receptors (FcγR) bind to IgG class antibodies, Fc-alpha receptors (FcαR) bind to IgA class antibodies, and Fc-epsilon receptors (FcεR) bind to IgE class antibodies. FcγR belongs to a family that includes several members, such as FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa, and FcγRIIIb. In some embodiments, the Fc domain variants have altered FcγRIIIa binding affinity compared to the wild-type Fc domain. In some embodiments, the Fc domain variants have reduced FcγRIIIa binding affinity compared to the wild-type Fc domain. In some embodiments, the Fc domain variants have enhanced FcγRIIIa binding affinity compared to the wild-type Fc domain. In some embodiments, the Fc domain variant modified Fc domain has about the same FcγRIIIa binding affinity as compared to the wild-type Fc domain.

[0148] In certain embodiments, the Fc domain variant comprises an antibody constant region (e.g., an IgG constant region, e.g., a human IgG constant region, e.g., a human IgG1 constant region) that mediates one or more effector functions. For example, binding of the C1 complex to an antibody constant region can activate the complement system. Activation of the complement system is important in the opsonization and lysis of cellular pathogens. Activation of the complement system also stimulates inflammatory responses and may be involved in autoimmune hypersensitivity. Furthermore, antibodies bind to receptors on various cells via the Fc domain (Fc receptor binding sites on antibody Fc regions bind to Fc receptors (FcRs) on cells). There are several Fc receptors specific for different classes of antibodies, including IgG (gamma receptors), IgE (epsilon receptors), IgA (alpha receptors), and IgM (mu receptors). Binding of antibodies to Fc receptors on cell surfaces triggers several important and diverse biological responses, including phagocytosis and destruction of antibody-coated particles, clearance of immune complexes, lysis of antibody-coated target cells by killer cells (called antibody-dependent cell-mediated cytotoxicity, or ADCC), release of inflammatory mediators, placental transfer, and regulation of immunoglobulin production. In some embodiments, Fc domain variants, e.g., binding polypeptides (e.g., antibodies, immunoadhesins, or antibody variants), bind to Fc-gamma receptors. In alternative embodiments, the Fc domain variants comprise a constant region lacking one or more effector functions (e.g., ADCC activity) and / or unable to bind to Fcγ receptors.

[0149] In certain exemplary embodiments, the effector-enhancing Fc domain variants have one or more amino acid substitutions selected from the group consisting of: aspartic acid (D) at amino acid position 221; cysteine ​​(C) at amino acid position 222; tyrosine (Y) at amino acid position 234; alanine (A) at amino acid position 236; tryptophan (W) at amino acid position 236; aspartic acid (D) at amino acid position 239; leucine (L) at amino acid position 243; glutamic acid (E) at amino acid position 267; phenylalanine (F) at amino acid position 268; proline (P) at amino acid position 292; Alanine (A) at amino acid position 98; leucine (L) at amino acid position 300; isoleucine (I) at amino acid position 305; threonine (T) at amino acid position 324; tryptophan (W) at amino acid position 326; alanine (A) at amino acid position 326; leucine (L) at amino acid position 330; glutamic acid (E) at amino acid position 332; alanine (A) at amino acid position 333; serine (S) at amino acid position 333; alanine (A) at amino acid position 334; alanine (A) at amino acid position 336; arginine (R) at amino acid position 345; and leucine (L) at amino acid position 396 (according to EU numbering). (For a review, see Saunders, 2009, Front.Immunol. doi:10.3389 / fimmu.2019.01296)

[0150] In some embodiments, the Fc domain variants may comprise amino acid substitutions at positions selected from amino acid positions 236, 239, 330, and 332 according to EU numbering. In some embodiments, the substitutions may comprise an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, a leucine (L) at amino acid position 330, and a glutamic acid (E) at amino acid position 332 according to EU numbering. In some embodiments, the Fc domain variants may comprise double amino acid substitutions at any two amino acid positions selected from an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, a leucine (L) at amino acid position 330, and a glutamic acid (E) at amino acid position 332. In some embodiments, Fc domain variants may comprise triple amino acid substitutions at any three amino acid positions selected from alanine (A) at amino acid position 236, aspartic acid (D) at amino acid position 239, leucine (L) at amino acid position 330, and glutamic acid (E) at amino acid position 332. In some embodiments, Fc domain variants may comprise quadruple amino acid substitutions at any four amino acid positions selected from alanine (A) at amino acid position 236, aspartic acid (D) at amino acid position 239, leucine (L) at amino acid position 330, and glutamic acid (E) at amino acid position 332. In some embodiments, Fc domain variants may comprise a combination of amino acid substitutions comprising aspartic acid (D) at amino acid position 239 and glutamic acid (E) at amino acid position 332. In some embodiments, Fc domain variants may comprise a combination of amino acid substitutions comprising alanine (A) at amino acid position 236, aspartic acid (D) and glutamic acid at amino acid position 332.

[0151] In some embodiments, the Fc domain variant may further comprise an amino acid substitution at amino acid position 256 and / or 307 according to EU numbering. In some embodiments, the Fc domain variant may comprise a combination of amino acid substitutions comprising an aspartic acid (D) at amino acid position 256 and a glutamine (Q) at amino acid position 307 (see Mackness et al., 2019 MAbs 11:1276-88; WO2019147973A1, which are incorporated by reference in their entireties).

[0152] Glycosylated Fc domain variants In certain exemplary embodiments, the binding protein is glycosylated. Glycosylation of antibodies at conserved positions within their constant regions is known to have a significant impact on antibody function, particularly effector functions as described above (see, e.g., Boyd et al. (Mol. Immunol, 32:1311-1318, 1996)). Glycosylation of binding proteins of the present disclosure in which one or more carbohydrate moieties are added, substituted, deleted, or modified is contemplated. In some embodiments, glycosylation of the Fc domain of the binding protein is N-linked glycosylation. Introduction of an asparagine-X-serine or asparagine-X-threonine motif creates potential sites for enzymatic attachment of carbohydrate moieties and can therefore be used to engineer the glycosylation of Fc domain variants. Raju et al. (Biochemistry 40:8868-8876, 2001), the terminal sialylation of a TNFR-IgG immunoadhesin was increased through the process of regalactosylation and / or resialylation using β-1,4-galactosyltransferase and / or alpha,2,3 sialyltransferase. Increasing terminal sialylation is thought to increase the half-life of the immunoglobulin.

[0153] In common with most glycoproteins, antibodies are typically produced as a mixture of glycoforms. This mixture is particularly evident when antibodies are produced in eukaryotic, especially mammalian, cells. Various methods have been developed to produce defined glycoforms (see Zhang et al. 2004, Science 303:371; Sears et al. 2001, Science 291:2344; Wacker et al. 2002, Science 298:1790; Davis et al. 2002, Chem. Rev. 102:579; Hang et al. 2001, Acc. Chem. Res. 34:727). In some embodiments, the glycosylated Fc domain contains a native glycan at amino acid position 297 according to EU numbering. Glycosylation of asparagine at amino acid position 297 in the CH2 domain of IgG1 is known to promote interaction between the Fc domain and FcγR. Elimination of this glycosylation site eliminates effector function (Leabman, et al., 2013, MAbs 5:896-903). In a particularly exemplary embodiment, the Fc domain contains wild-type or near-wild-type levels of glycosylation at amino acid position 297 according to EU numbering.

[0154] In some embodiments, the glycosylated Fc domain variant comprises an engineered or non-naturally occurring glycan, which in some embodiments is a modified glycan that can be conjugated to a therapeutic molecule (e.g., an antibody-drug conjugate).

[0155] Fc-containing binding polypeptide In one aspect, the present disclosure provides isolated Fc domain variants comprising or complexed (e.g., fused) to at least one binding domain (e.g., at least one binding polypeptide). In certain embodiments, the binding domain comprises one or more antigen-binding domains. The antigen-binding domain need not be derived from the same molecule as the parent Fc domain. In certain embodiments, the Fc domain variant is present in an antibody.

[0156] In one embodiment, the Fc domain variant is present in or complexed with an antibody. Any antibody from any source or species can be used with the Fc domain variants disclosed herein. Suitable antibodies include, but are not limited to, chimeric antibodies, humanized antibodies, or human antibodies. Suitable antibodies include, but are not limited to, full-length antibodies, monoclonal antibodies, polyclonal antibodies, or single-domain antibodies, such as VHH antibodies.

[0157] In certain exemplary embodiments, the Fc domain variants may be conjugated to or complexed with an antigen-binding fragment of an antibody. The term "antigen-binding fragment" refers to a polypeptide fragment of an immunoglobulin or antibody that binds to an antigen or competes with the intact antibody (i.e., with the intact antibody from which it was derived) for antigen binding (i.e., specific binding). Antigen-binding fragments can be produced by recombinant or biochemical methods well known in the art. Exemplary antigen-binding fragments include Fv, Fab, Fab', and (Fab')2. In certain exemplary embodiments, a binding polypeptide of the present disclosure comprises at least one antigen-binding fragment and an Fc domain variant.

[0158] In some embodiments, the binding polypeptide comprises a single-chain variable region sequence (ScFv). A single-chain variable region sequence comprises one or more antigen-binding sites, e.g., a single polypeptide having a VL domain linked to a VH domain by a flexible linker. ScFv molecules can be constructed in a VH-linker-VL orientation or a VL-linker-VH orientation. The flexible hinge linking the VL and VH domains that make up the antigen-binding site comprises about 10 to about 50 amino acid residues. Connecting peptides are known in the art. A binding polypeptide can comprise at least one scFv and / or at least one constant region. In one embodiment, a binding polypeptide of the present disclosure can comprise at least one scFv linked or fused to an Fc domain variant.

[0159] In some embodiments, binding polypeptides of the disclosure are multivalent (e.g., tetravalent) antibodies produced by fusing DNA sequences encoding the antibodies to ScFv molecules (e.g., modified ScFv molecules). For example, in one embodiment, these sequences are combined such that the ScFv molecule (e.g., modified ScFv molecule) is linked at its N- or C-terminus to an Fc domain variant via a flexible linker (e.g., a gly / ser linker). In another embodiment, a tetravalent antibody of the disclosure can be made by fusing the ScFv molecule to a linking peptide that is fused to the Fc domain variant to construct an ScFv-Fab tetravalent molecule.

[0160] In another embodiment, the binding polypeptide of the present disclosure is a modified minibody. The modified minibody of the present disclosure is a dimeric molecule composed of two polypeptide chains, each containing an ScFv molecule fused to an Fc domain variant via a connecting peptide. Minibodies can be produced by constructing the ScFv components and linking the peptide components using methods described in the art (see, e.g., U.S. Pat. No. 5,837,821 or WO 94 / 09817 A1). In another embodiment, tetravalent minibodies can be constructed in the same manner as minibodies, except that the two ScFv molecules are linked using a flexible linker. The linked scFv-scFv construct is then tethered to the Fc domain variant.

[0161] In another embodiment, binding polypeptides of the present disclosure include diabodies. Diabodies are dimeric tetravalent molecules, each having a polypeptide similar to an scFv molecule, but typically with a short (less than 10, e.g., about 1 to about 5) amino acid residue linker connecting both variable domains, such that the VL and VH domains on the same polypeptide chain cannot interact. Instead, the VL and VH domains of one polypeptide chain interact with the VH and VL domains on a second polypeptide chain (see, e.g., WO 02 / 02781). Diabodies of the present disclosure comprise scFv-like molecules fused to Fc domain variants.

[0162] In another embodiment, the binding polypeptides of the present disclosure comprise single-domain antibodies (sdAbs), also known as VHHs or nanobodies. Nanobody® is a registered trademark of Ablynx. VHHs contain a variable heavy domain lacking a light chain. Like conventional VH domains, VHHs contain four FRs and three CDRs. VHHs have advantages over conventional antibodies. Because they are approximately 10 times smaller than IgG molecules, properly folded, functional VHHs can be produced by in vitro expression with high yields. Furthermore, VHHs are highly stable and resistant to the action of proteases. The properties and production of VHHs are reviewed by Harmsen and De Haard HJ (Appl. Microbiol. Biotechnol. 2007 November;77(1):13-22).

[0163] In certain exemplary embodiments, the Fc domain is fused to one or more VHHs.

[0164] In other embodiments, the binding polypeptide comprises a multispecific or multivalent antibody comprising one or more variable domains in tandem on the same polypeptide chain, e.g., a tandem variable domain (TVD) polypeptide. Exemplary TVD polypeptides include the "dual-headed" or "dual Fv" configuration described in U.S. Patent No. 5,989,830. In the dual Fv configuration, the variable domains of two different antibodies are expressed in tandem orientation on two separate chains (one heavy and one light chain), where one polypeptide chain has two VH domains in tandem, optionally separated by a peptide linker (VH1-linker-VH2), and the other polypeptide chain consists of complementary VL domains connected in tandem, optionally by a peptide linker (VL1-linker-VL2). In the crossover double-head configuration, the variable domains of two different antibodies are expressed in tandem orientation on two separate polypeptide chains (one heavy and one light chain), with one polypeptide chain having two VH domains in tandem, optionally separated by a peptide linker (VH1-linker-VH2), and the other polypeptide chain consisting of complementary VL domains connected in tandem by a peptide linker (VL2-linker-VL1), optionally in the opposite orientation. Additional antibody variants based on the "dual Fv" format include dual variable domain IgG (DVD-IgG) bispecific antibodies (see U.S. Pat. No. 7,612,181 and the TBTI format (see U.S. Patent Application Publication No. 2010 / 0226923 A1). In some embodiments, the binding polypeptide comprises a multispecific or multivalent antibody comprising one or more variable domains in tandem on the same polypeptide chain fused to an Fc domain variant.

[0165] In another embodiment, the binding polypeptide comprises a crossover dual variable domain IgG (CODV-IgG) bispecific antibody based on a "double-headed" configuration (see U.S. Patent Application Publication No. 20120251541 A1, which is incorporated herein by reference in its entirety).

[0166] In other embodiments, the binding polypeptide comprises a CrossMab or CrossMab-Fab multispecific format (see WO 2009080253 and Schaefer, et al., PNAS (2011), 108:11187-1191). Antibody variants based on the CrossMab format have an antibody domain crossover within one arm of the bispecific IgG antibody that allows for correct chain association.

[0167] In other embodiments, the glycosylated effector-competent polypeptide comprises a multispecific antibody in a T cell engager format. "T cell engager" refers to a protein directed against the host's immune system, more specifically, the cytotoxic activity of T cells, as well as a binding protein directed against a tumor target protein. In some embodiments, the isolated effector-competent polypeptide comprises a multispecific antibody in an NK cell engager format. "NK cell engager" refers to a binding protein comprising an activating NK cell receptor, an antigen-specific targeting region, and a monoclonal antibody fragment targeting the Fc region (Gauthier, et al. Cell (2019), 177:1701-13).

[0168] Binding polypeptides of the disclosure comprising the Fc domain variants described herein can comprise the CDR or variable domain sequences of a known "parent" antibody. In some embodiments, the parent antibody and an antibody of the disclosure can share similar or identical sequences, except for the modifications to the Fc domain disclosed herein.

[0169] Double variable crossover In certain embodiments, "crossover dual variable" or "CODV" refers to an antigen-binding domain comprising at least two polypeptide chains that specifically bind to at least one target antigen or at least one target epitope and form at least two antigen-binding sites, wherein at least one polypeptide chain has the formula: VL1-L1-VL2-L2-CL[I] and a structure represented by At least one polypeptide chain has the formula: VH2-L3-VH1-L4-CH1[II] During the ceremony, VL1 is the first immunoglobulin light chain variable domain, VL2 is the second immunoglobulin light chain variable domain, VH1 is the first immunoglobulin heavy chain variable domain, VH2 is the second immunoglobulin heavy chain variable domain, CL is an immunoglobulin light chain constant domain; CH1 is the immunoglobulin CH1 heavy chain constant domain; L1, L2, L3, and L4 are amino acid linkers, and any one or more of L1, L2, L3, and L4 are optionally absent; The polypeptide of formula I and the polypeptide of formula II form a cross-over light-heavy chain pair.

[0170] In certain exemplary embodiments, the binding proteins of the disclosure comprise the "CODV-OL1" format, which comprises three polypeptide chains that form two antigen binding sites, one polypeptide chain having the formula: VL1-L1-VL2-L2-CL[I] and a structure represented by One polypeptide chain has the formula: VH2-L3-VH1-L4-CH1-hinge-CH2-CH3[III] and a structure represented by One polypeptide chain has the formula: Hinge-CH2-CH3[IV] and a structure represented by During the ceremony, CL is an immunoglobulin light chain constant domain; CH1 is the immunoglobulin CH1 heavy chain constant domain; CH2 is the immunoglobulin CH2 heavy chain constant domain; CH3 is the immunoglobulin CH3 heavy chain constant domain; The hinge is an immunoglobulin hinge region that connects the CH1 and CH2 domains, L1, L2, L3, and L4 are amino acid linkers, and any one or more of L1, L2, L3, and L4 are optionally absent; The polypeptide of formula I and the polypeptide of formula II form a cross-over light-heavy chain pair.

[0171] In certain embodiments, the CODV antigen-binding domain comprises four polypeptide chains that specifically bind to at least one target antigen or at least one target epitope and form four antigen-binding sites, wherein two polypeptide chains each have the formula: VL1-L1-VL2-L2-CL[I] and a structure represented by The two polypeptide chains each have the formula: VH2-L3-VH1-L4-CH1-Fc[II] and a structure represented by During the ceremony, VL1 is the first immunoglobulin light chain variable domain, VL2 is the second immunoglobulin light chain variable domain, VH1 is the first immunoglobulin heavy chain variable domain, VH2 is the second immunoglobulin heavy chain variable domain, CL is an immunoglobulin light chain constant domain; CH1 is the immunoglobulin CH1 heavy chain constant domain; Fc is the immunoglobulin hinge region and CH2 and CH3 immunoglobulin heavy chain constant domains; L1, L2, L3, and L4 are amino acid linkers, and any one or more of L1, L2, L3, and L4 are optionally absent; a polypeptide of formula I and a polypeptide of formula II form a cross-linked light chain-heavy chain pair; The VH1 / VL1 pair comprises a first antigen-binding specificity, and the VH2 / VL2 pair comprises a second antigen-binding specificity.

[0172] In certain embodiments, the antigen binding proteins described herein are trispecific and / or trivalent antigen binding proteins comprising four polypeptide chains that form three antigen binding sites that specifically bind to one or more different antigen targets, wherein a first polypeptide chain has the formula: VL2-L1-VL1-L2-CL[I] and a structure represented by The second polypeptide chain has the formula: VH1-L3-VH2-L4-CH1-hinge-CH2-CH3[II] and a structure represented by The third polypeptide chain has the formula: VH3-CH1-hinge-CH2-CH3[III] and a structure represented by The fourth polypeptide chain has the formula: VL3-CL[IV] and a structure represented by During the ceremony, VL1 is the first immunoglobulin light chain variable domain, VL2 is the second immunoglobulin light chain variable domain, VL3 is the third immunoglobulin light chain variable domain, VH1 is the first immunoglobulin heavy chain variable domain, VH2 is the second immunoglobulin heavy chain variable domain, VH3 is the third immunoglobulin heavy chain variable domain, CL is an immunoglobulin light chain constant domain; CH1 is the immunoglobulin CH1 heavy chain constant domain; CH2 is the immunoglobulin CH2 heavy chain constant domain; CH3 is the immunoglobulin CH3 heavy chain constant domain; The hinge is an immunoglobulin hinge region that connects the CH1 and CH2 domains, L1, L2, L3, and L4 are amino acid linkers, and any one or more of L1, L2, L3, and L4 are optionally absent; The polypeptide of formula I and the polypeptide of formula II form a cross-over light-heavy chain pair.

[0173] In certain embodiments, the first polypeptide chain and the second polypeptide chain have a cross-over orientation to form two distinct antigen-binding sites. In some embodiments, VH1 and VL1 form a binding pair to form a first antigen-binding site. In some embodiments, VH2 and VL2 form a binding pair to form a second antigen-binding site. In some embodiments, the third polypeptide and the fourth polypeptide form a third antigen-binding site. In some embodiments, VH3 and VL3 form a binding pair to form a third antigen-binding site.

[0174] Such an antigen-binding protein comprises at least three antigen-binding sites. It is at least a trivalent antigen-binding molecule. In certain embodiments, it specifically binds to one antigen target, i.e., it is a monospecific antigen-binding molecule. In other embodiments, it specifically binds to two different antigen targets, i.e., it is a bispecific antigen-binding molecule. In other embodiments, it specifically binds to three different antigen targets, i.e., it is a trispecific antigen-binding molecule.

[0175] The examples listed above are not intended to limit the scope of the present disclosure in any way, and demonstrate that linkers comprising randomly selected amino acids selected from the group consisting of valine, leucine, isoleucine, serine, threonine, lysine, arginine, histidine, aspartic acid, glutamic acid, asparagine, glutamine, glycine, and proline are suitable for the antibody-like binding proteins described herein.

[0176] In certain embodiments of the binding protein, (a) L1, L2, L3, and L4 are each independently 0 amino acids in length or comprise a sequence selected from the group consisting of GGGGSGGGGS, GGGGSGGGGGSGGGGS, S, RT, TKGPS, GQPKAAP, and GGSGSSGSGG, or (b) L1, L2, L3, and L4 are each independently a sequence selected from the group consisting of GGGGSGGGGS, GGGGGSGGGGSGGGGS, S, RT, TKGPS, GQPKAAP, and GGSGSSGSGG.

[0177] In certain embodiments, L1 and L2 each comprise the amino acid sequence GGGGSGGGGS.

[0178] In certain embodiments, L3 and L4 are each absent.

[0179] Further details regarding CODV antibody formats, various substitutions in CODV antibody formats, and linkers are further described in WO 2012 / 135345 A1 and WO 2017 / 180913 A2, which are incorporated by reference in their entireties.

[0180] Nucleic acids and vectors In one aspect, polynucleotides encoding the binding proteins disclosed herein are provided. Methods for producing the binding proteins comprising expressing these polynucleotides are also provided.

[0181] Polynucleotides encoding the binding proteins disclosed herein are typically inserted into expression vectors for introduction into host cells that can be used to produce desired quantities of the claimed binding proteins. Thus, in certain aspects, the present disclosure provides expression vectors comprising the polynucleotides disclosed herein, as well as host cells comprising these vectors and polynucleotides.

[0182] The term "vector" or "expression vector" is used herein to mean, for purposes of the specification and claims, a vector used to introduce and express a desired gene in a cell. As known to those skilled in the art, such vectors can be easily selected from the group consisting of plasmids, phages, viruses, and retroviruses. Generally, a vector contains a selectable marker, appropriate restriction sites to facilitate cloning of the desired gene, and the ability to enter and / or replicate in eukaryotic or prokaryotic cells.

[0183] Numerous expression vector systems can be used. For example, one class of vectors utilizes DNA elements derived from animal viruses such as bovine papillomavirus, polyomavirus, adenovirus, vaccinia virus, baculovirus, retrovirus (RSV, MMTV, or MOMLV), or SV40 virus. Others involve the use of polycistronic systems with internal ribosome binding sites. Furthermore, cells that have integrated the DNA into their chromosomes can be selected by introducing one or more markers that allow for selection of transfected host cells. Markers can provide prototrophy to auxotrophic hosts, biocide resistance (e.g., antibiotics), or resistance to heavy metals such as copper. The selectable marker gene can be directly linked to the DNA sequence to be expressed or can be introduced into the same cell by cotransformation. Additional elements may also be required for optimal synthesis of mRNA. These elements can include signal sequences, splice signals, as well as transcriptional promoters, enhancers, and termination signals. In some embodiments, the cloned variable region genes are inserted into an expression vector along with heavy and light chain constant region genes (such as human genes) synthesized as described above.

[0184] In other embodiments, the glycosylated effector-competent polypeptides described herein can be expressed using polycistronic constructs. In such expression systems, multiple gene products of interest, such as antibody heavy and light chains, can be produced from a single polycistronic construct. These systems advantageously use internal ribosome entry sites (IRES) to produce relatively high levels of polypeptides in eukaryotic host cells. Compatible IRES sequences are disclosed in U.S. Pat. No. 6,193,980, incorporated herein by reference. Those skilled in the art will appreciate that such expression systems can be used to effectively produce the full range of polypeptides disclosed in the present application.

[0185] More generally, once a vector or DNA sequence encoding a binding protein of the present disclosure has been prepared, the expression vector may be introduced into a suitable host cell. That is, the host cell may be transformed. Plasmid introduction into a host cell can be accomplished by a variety of techniques well known to those skilled in the art. These techniques include, but are not limited to, transfection (including electrophoresis and electroporation), protoplast fusion, calcium phosphate precipitation, cell fusion with enveloped DNA, microinjection, and infection with intact virus. See, for example, Ridgway, AAG "Mammalian Expression Vectors," Chapter 24.2, pp. 470-472, in Vectors, Rodriguez and Denhardt, Eds. (Butterworths, Boston, MA 1988). Transformed cells are grown under conditions appropriate for the production of light and heavy chains, and assayed for the synthesis of heavy and / or light chain proteins. Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), fluorescence-activated cell sorter analysis (FACS), immunohistochemistry, and the like.

[0186] As used herein, the term "transformation" is intended to be used broadly to refer to the introduction of DNA into a recipient host cell, resulting in a change in the genotype and consequent alteration of the recipient cell.

[0187] Similarly, a "host cell" refers to a cell that has been transformed with a vector constructed using recombinant DNA technology and encoding at least one heterologous gene. In describing the process of isolating a polypeptide from a recombinant host, the terms "cells" and "cell culture" are used interchangeably to indicate the source of the antibody, unless clearly specified otherwise. In other words, recovery of polypeptide from the "cells" can refer to recovery from either spun-down whole cells or from the cell culture medium containing both the medium and suspended cells.

[0188] In one embodiment, the host cell line used to express the binding protein is of eukaryotic or prokaryotic origin. In one embodiment, the host cell line used to express the binding protein is of bacterial origin. In one embodiment, the host cell line used to express the binding protein is of mammalian origin. One of skill in the art can determine the particular host cell line that is most suitable for the desired gene product to be expressed therein. Exemplary host cell lines include, but are not limited to, DG44 and DUXB11 (Chinese hamster ovary lines, DHFR minus), HELA (human cervical carcinoma), CVI (monkey kidney line), COS (a derivative of CVI that carries the SV40 T antigen), R1610 (Chinese hamster fibroblast), BALBC / 3T3 (mouse fibroblast), HAK (hamster kidney line), SP2 / O (mouse myeloma), BFA-1c1BPT (bovine endothelial cells), RAJI (human lymphocytes), and 293 (human kidney). In one embodiment, the cell line provides altered glycosylation, e.g., afucosylation, of the antibody expressed therefrom (e.g., PER.C6® (Crucell) or a FUT8 knockout CHO cell line (POTELLIGENT™ cells) (Biowa, Princeton, NJ)). In one embodiment, NSO cells may be used. Host cell lines are typically available from commercial services, the American Tissue Culture Collection, or from the public literature.

[0189] In vitro production allows for scale-up to obtain large quantities of the desired binding protein. Techniques for culturing mammalian cells under tissue culture conditions are known in the art and include, for example, homogenous suspension culture in airlift reactors or continuous stirred reactors, or culturing cells immobilized or entrapped, for example, in hollow fibers, in microcapsules, on agarose microbeads, or on ceramic cartridges. If necessary and / or desired, solutions of the polypeptide can be purified by conventional chromatographic methods, such as gel filtration, ion exchange chromatography, chromatography on DEAE-cellulose, and / or (immuno)affinity chromatography.

[0190] The gene(s) encoding the glycosylated binding protein can also be expressed in non-mammalian cells, such as bacteria, yeast, or plant cells. In this regard, it will be appreciated that various non-mammalian unicellular microorganisms (e.g., bacteria) can also be transformed, i.e., grown in culture or fermentation. Bacteria susceptible to transformation include members of the Enterobacteriaceae family, such as strains of Escherichia coli or Salmonella, the Bacillaceae family, such as Bacillus subtilis, Pneumococcus, Streptococcus, and Haemophilus influenzae. It will further be appreciated that when expressed in bacteria, the Fc domain variants and / or binding polypeptides can become part of inclusion bodies. The binding proteins must be isolated, purified, and then assembled into functional molecules.

[0191] In addition to prokaryotes, eukaryotic microorganisms can also be used. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used eukaryotic microorganism, although many other strains are commonly available. For expression in Saccharomyces, plasmids such as YRp7 (Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et al., Gene, 10:157 (1980)) are commonly used. This plasmid already contains the TRP1 gene, which provides a selection marker for yeast mutants lacking the ability to grow in tryptophan, such as ATCC No. 44076 or PEP4-1 (Jones, Genetics, 85:12 (1977)). The presence of the trpl lesion as a characteristic of the yeast host cell genome provides an effective environment for detecting transformation by growth in the absence of tryptophan.

[0192] How to use / treat In one aspect, the present disclosure provides a method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject an effective amount of a binding protein disclosed herein. In certain embodiments, the present disclosure provides kits and methods for treating diseases and disorders, e.g., cancer, in a mammalian subject in need of such treatment. In certain embodiments, the present disclosure provides kits and methods for treating diseases and disorders, e.g., amyloidosis or multiple myeloma, in a mammalian subject in need of such treatment.

[0193] In certain embodiments, the disease is cancer. In certain embodiments, the cancer is a hematological cancer. In certain embodiments, the hematological cancer is a plasma cell malignancy. In certain embodiments, the plasma cell malignancy is multiple myeloma. In certain embodiments, the multiple myeloma is relapsed / refractory multiple myeloma, newly diagnosed multiple myeloma, or smoldering multiple myeloma. In certain other embodiments, the disease is light chain amyloidosis (LCA). In certain embodiments, the LCA is relapsed / refractory LCA, newly diagnosed LCA, or smoldering LCA. The binding proteins of the present disclosure are useful in several different applications. For example, in one embodiment, the subject binding proteins are useful for reducing or eliminating cells bearing the epitope recognized by the binding protein. In another embodiment, the subject binding proteins are effective in reducing or eliminating the concentration of circulating soluble antigens. In another embodiment, the subject binding proteins are effective as NK cell engagers. In one embodiment, the Fc domain variants may reduce tumor size, inhibit tumor growth, and / or prolong survival of tumor-bearing animals. Accordingly, the present disclosure also relates to methods of treating tumors in humans or other animals by administering to the human or other animal an effective, non-toxic amount of a binding protein of the present disclosure.

[0194] In another embodiment, the subject binding proteins are useful for treating other disorders, including, but not limited to, infectious diseases, autoimmune disorders, inflammatory disorders, or cancer. The disease may optionally be identified as being characterized by cells (e.g., disease-causing cells, disease-causing B lymphocytes or other immune cells) that express BCMA. For example, cancer cells, particularly hematological cancers or plasma cell malignancies, may be characterized as expressing BCMA on the surface of the cancer cells. Accordingly, the present disclosure relates to methods of treating a variety of conditions that would benefit from, for example, the use of the subject effector-competent polypeptides with extended half-lives.

[0195] One of ordinary skill in the art would be able, by routine experimentation, to determine what would be an effective, non-toxic amount of a binding protein for the purpose of treating a malignancy. For example, a therapeutically active amount of a binding protein of the present disclosure may vary according to factors such as the stage of the disease (e.g., stage I vs. stage IV), the age, sex, medical complications (e.g., immunosuppressive conditions or diseases) and weight of the subject, and the ability of the modified antibody to elicit a desired response in the subject.

[0196] In general, the compositions provided in this disclosure can be used to prophylactically or therapeutically treat any neoplasm that contains an antigenic marker that allows for targeting of the cancerous cells by the binding protein.

[0197] Multiple Myeloma Treatment Methods / Uses In one aspect, the present disclosure relates to the treatment and prevention of multiple myeloma.

[0198] The term "multiple myeloma (MM)" (also known as plasma cell myeloma, myelomatosis, or Kahler's disease) refers to an aggressive blood cancer of plasma cells, a type of white blood cell normally responsible for antibody production. The condition is characterized by an excessive number of plasma cells in the bone marrow and the overproduction of intact monoclonal immunoglobulins or free monoclonal light chains. Clinically, the disease is diagnosed, staged, and treated based on various parameters, including myeloma tumor cell mass based on the amount of monoclonal (or myeloma) protein (M protein) in the serum and / or urine, along with hemoglobin and serum calcium concentrations, the number of lytic bone lesions based on skeletal surveys, and the presence or absence of renal failure. Additional approaches to characterizing the condition include the detection of more than ten percent (10%) plasma cells on bone marrow examination, the presence of soft tissue plasmacytomas, and the detection of free kappa and lambda serum immunoglobulin light chains. Bone marrow examination is performed using standard histology and immunohistochemistry techniques. Further cytogenetics of bone marrow samples may be performed to determine prognosis. Follow-up consists of chemistry and bone marrow evaluations if clinically indicated due to their invasive nature.

[0199] In certain embodiments, the methods of the invention include treating patients with relapsed and / or refractory MM, or patients with MM who have received one or more prior therapies for MM. In certain embodiments, the multiple myeloma is relapsed / refractory multiple myeloma (RR / MM). In some embodiments, the patient has received at least one or two prior therapies for multiple myeloma (e.g., a thalidomide analog such as lenalidomide, a proteasome inhibitor, or an autologous stem cell transplant (ASCT)) and has documented disease progression on or after completion of the last treatment.

[0200] "Relapsed MM" refers to multiple myeloma that has been previously treated, progressed, and requires the initiation of further treatment, but does not meet the criteria for either primary "refractory" or relapsed and refractory MM. Clinical criteria for determining relapse are well known to those skilled in the art. For example, the clinical criteria developed by the International Myeloma Working Group (IMWG) include an increase in serum M component of more than 1 gm / dL, the development of new soft tissue plasmacytomas or bone lesions, and an increase in the size of existing plasmacytomas or bone lesions.

[0201] "Refractory MM" refers to multiple myeloma that is unresponsive (e.g., fails to achieve a minimal response during treatment or develops progressive disease). In certain embodiments, the multiple myeloma is unresponsive during primary or salvage therapy or progresses within 60 days of the last therapy.

[0202] In certain embodiments, the MM is "relapsed and refractory MM." "Relapsed and refractory MM" is disease that progresses within 60 days of the last therapy in patients who are non-responsive while receiving salvage therapy (e.g., therapy administered after failure of first-line therapy) or who achieve a minimal response or better response at some point before progressing in the current disease course.

[0203] In certain embodiments, the MM is primary refractory MM. Primary refractory MM is non-responsive MM disease in patients who have not achieved a minimal response or better with any treatment.

[0204] In certain embodiments, the MM is precancerous or "smoldering" MM. Smoldering multiple myeloma is a precancerous condition that alters certain proteins in the blood and / or increases plasma cells in the bone marrow, but does not cause disease symptoms. However, approximately half of people diagnosed with this condition will develop multiple myeloma within five years. Patients are closely monitored for evidence of progression to active multiple myeloma. Patients are diagnosed with smoldering multiple myeloma if they meet certain criteria: a blood test showing M protein in the blood greater than 3 g / dL, or a 24-hour urine test showing 500 mg or more of protein, or a bone marrow biopsy showing that plasma cells make up 10% to 59% of the blood cells in the bone marrow; and no signs of abnormal bone lesions or kidney damage that can be caused by active myeloma. Currently, there is no approved treatment for smoldering multiple myeloma.

[0205] "Disease response" can be determined according to standard criteria for hematological malignancies and staging. Methods for assessing disease response for hematological malignancies are known to those skilled in the art. For example, methods for assessing disease response include the Eastern Cooperative Oncology Group (ECOG) performance status and the International Myeloma Working Group Response Criteria (see Oken, et al., Am. J. Clin. Oncol. 1982;5(6):649-655 and Kumar, et al., Lancet Oncol. 2016;17(8):328-346, respectively). Methods for assessing disease response may also include quantification of disease markers, bone marrow biopsy and / or aspirate, radiological imaging of plasmacytomas, bone skeletal survey, M protein quantification (serum and / or 24-hour urine) and serum-free or urinary light chain levels, serum b2-microglobulin, lymph node biopsy, radiological oncology evaluation (by X-ray, computed tomography (CT) scan, PET scan, or magnetic resonance imaging (MRI)), and blood counts including blast counts. This list of assessment methods should be understood to be non-limiting.

[0206] Based on the results obtained from the assessment of disease response, the disease response can then be stratified according to standard criteria for the underlying disease and classified as complete response or remission (CR), partial response (PR), stable disease (SD), or progressive disease (PD).

[0207] In another aspect, the disclosure provides a method of treating or preventing multiple myeloma in a subject in need thereof, the method comprising administering to the subject a binding protein disclosed herein, wherein the binding protein comprises a first antigen-binding domain that has binding specificity for BCMA and a second antigen-binding domain that has binding specificity for a natural killer (NK) cell marker.

[0208] In one aspect, the disclosure provides a method of treating or preventing multiple myeloma in a subject in need thereof, comprising administering to the subject a binding protein comprising a first antigen-binding domain that has binding specificity for BCMA and a second antigen-binding domain that has binding specificity for a natural killer (NK) cell marker, wherein the first antigen-binding domain: a. a first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and an HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); b. A first immunoglobulin light chain variable domain (VL1) comprising: an LCDR1 sequence having the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO: 4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; an LCDR2 sequence having the amino acid sequence of DNNX5X6PP (SEQ ID NO: 5), wherein X5 is S, I, or N, and X6 is R or K; and an LCDR3 sequence having the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO: 6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G.

[0209] In certain embodiments, the first antigen-binding domain with binding specificity for BCMA comprises: a. a first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and an HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); b. A first immunoglobulin light chain variable domain (VL1) comprising: an LCDR1 sequence having the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO: 4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; an LCDR2 sequence having the amino acid sequence of DNNX5X6PP (SEQ ID NO: 5), wherein X5 is S, I, or N, and X6 is R or K; and an LCDR3 sequence having the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO: 6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G.

[0210] In certain embodiments, VL1 is a. An LCDR1 sequence comprising the amino acid sequence of CASSTGTVTPSNYAN (SEQ ID NO: 7), an LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 8), and an LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 9); b. An LCDR1 sequence comprising the amino acid sequence of CRSSTGTVTPSNYAN (SEQ ID NO: 10), an LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 11), and an LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 12); c. an LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPSNYAN (SEQ ID NO: 13), an LCDR2 sequence comprising the amino acid sequence of DNNIKPP (SEQ ID NO: 14), and an LCDR3 sequence comprising the amino acid sequence of ALWYGGQWV (SEQ ID NO: 15); or d. Comprises an LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPGYYAN (SEQ ID NO: 16), an LCDR2 sequence comprising the amino acid sequence of DNNNKPP (SEQ ID NO: 17), and an LCDR3 sequence comprising the amino acid sequence of ALYYGGQWV (SEQ ID NO: 18).

[0211] In certain embodiments, a. VH1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 55; b. VH1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 50; c. VH1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 51; d. VH1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 52; e. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 53; or f. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:54.

[0212] In certain embodiments, a. VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 55; or b. VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 50; or c. VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 51; or d. VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 52; or e. VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 53; or f. VH1 comprises the amino acid sequence of SEQ ID NO:49, and VL1 comprises the amino acid sequence of SEQ ID NO:54.

[0213] In certain embodiments, the second antigen-binding domain with binding specificity for an NK cell marker comprises: a. a second immunoglobulin heavy chain variable domain (VH2), i. an HCDR1 sequence consisting of the amino acid sequence of DYVIN (SEQ ID NO: 80), an HCDR2 sequence consisting of the amino acid sequence of EIYPGSGTNYYNEKFKA (SEQ ID NO: 81), and an HCDR3 sequence consisting of the amino acid sequence of RGRYGLYAMDY (SEQ ID NO: 21); ii. an HCDR1 sequence comprising SDYAWN (SEQ ID NO: 22), an HCDR2 sequence comprising YITYSGSTSYNPSLES (SEQ ID NO: 23), and an HCDR3 sequence comprising GGYYGSSWGVFAY (SEQ ID NO: 24); iii. an HCDR1 sequence comprising EYTMH (SEQ ID NO: 25), an HCDR2 sequence comprising GISPNIGGTSYNQKFKG (SEQ ID NO: 26), and an HCDR3 sequence comprising RGGSFDY (SEQ ID NO: 27); iv. an HCDR1 sequence comprising SFTMH (SEQ ID NO: 28), an HCDR2 sequence comprising YINPSSGYTEYNQKFKD (SEQ ID NO: 29), and an HCDR3 sequence comprising GSSRGFDY (SEQ ID NO: 30); or v. a second immunoglobulin heavy chain variable domain comprising an HCDR1 sequence comprising SDYAWN (SEQ ID NO: 31), an HCDR2 sequence comprising YITYSGSTNYNPSLKS (SEQ ID NO: 32), and an HCDR3 sequence comprising CWDYALYAMDC (SEQ ID NO: 33); b. A second immunoglobulin light chain variable domain (VL2), i. an LCDR1 sequence comprising the amino acid sequence of RASQDISNYLN (SEQ ID NO: 34), an LCDR2 sequence comprising the amino acid sequence of YTSRLHS (SEQ ID NO: 35), and an LCDR3 sequence comprising the amino acid sequence of QQGNTRPWT (SEQ ID NO: 36); ii. an LCDR1 sequence comprising RVSENIYSYLA (SEQ ID NO: 37), an LCDR2 sequence comprising NAKTLAE (SEQ ID NO: 38), and an LCDR3 sequence comprising QHHYGTPWT (SEQ ID NO: 39); iii. An LCDR1 sequence comprising RASQSISDYLH (SEQ ID NO: 40), an LCDR2 sequence comprising YASQSIS (SEQ ID NO: 41), and an LCDR3 sequence comprising QNGHSFPLT (SEQ ID NO: 42); iv. an LCDR1 sequence comprising RASENIYSNLA (SEQ ID NO: 43), an LCDR2 sequence comprising AATNLAD (SEQ ID NO: 44), and an LCDR3 sequence comprising QHFWGTPRT (SEQ ID NO: 45); or v. A second immunoglobulin light chain variable domain comprising an LCDR1 sequence comprising RTSENIYSYLA (SEQ ID NO: 46), an LCDR2 sequence comprising NAKTLAE (SEQ ID NO: 47), and an LCDR3 sequence comprising QHHYDTPLT (SEQ ID NO: 48).

[0214] In certain embodiments, a. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64; or b. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 57 and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 65; or c. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 58, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 66; or d. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 59, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 67; or e. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 60, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 68; or f. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 61, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 69; or g. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 62, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 70; or h. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:63, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:71.

[0215] In certain embodiments, a. VH2 comprises the amino acid sequence of SEQ ID NO: 56 and VL2 comprises the amino acid sequence of SEQ ID NO: 64; or b. VH2 comprises the amino acid sequence of SEQ ID NO: 57 and VL2 comprises the amino acid sequence of SEQ ID NO: 65; or c. VH2 comprises the amino acid sequence of SEQ ID NO: 58 and VL2 comprises the amino acid sequence of SEQ ID NO: 66; or d. VH2 comprises the amino acid sequence of SEQ ID NO: 59 and VL2 comprises the amino acid sequence of SEQ ID NO: 67; or e. VH2 comprises the amino acid sequence of SEQ ID NO: 60 and VL2 comprises the amino acid sequence of SEQ ID NO: 68; or f. VH2 comprises the amino acid sequence of SEQ ID NO: 61 and VL2 comprises the amino acid sequence of SEQ ID NO: 69; or g. VH2 comprises the amino acid sequence of SEQ ID NO: 62 and VL2 comprises the amino acid sequence of SEQ ID NO: 70, or h. VH2 comprises the amino acid sequence of SEQ ID NO: 63 or VL2 comprises the amino acid sequence of SEQ ID NO: 71.

[0216] In certain embodiments, the method further comprises administering all or a portion of an immunoglobulin Fc domain or a variant thereof.

[0217] In certain embodiments, the Fc domain is an IgG1 Fc domain. In certain embodiments, the Fc domain or variant thereof comprises a first Fc heavy chain and a second Fc heavy chain. In certain embodiments, the first Fc heavy chain or the second Fc heavy chain comprises a pair of cysteines.

[0218] In certain embodiments, the subject has undergone treatment or therapy prior to treatment with NKCE as disclosed herein, hi certain embodiments, the multiple myeloma is relapsed / refractory multiple myeloma.

[0219] Light Chain Amyloidosis Treatment Methods / Uses In one aspect, the present disclosure relates to the treatment and prevention of light chain amyloidosis (LCA).

[0220] In certain embodiments, the present disclosure provides kits and methods for treating diseases and disorders, such as amyloidosis, in mammalian subjects in need of such treatment. The current standard of care for LCA is limited by the tolerability of this population, with frequent organ dysfunction. Thus, there remains an unmet need for additional effective and safe therapeutic agents for LCA.

[0221] In another aspect, the present disclosure provides a method of treating or preventing light chain amyloidosis in a subject in need thereof, the method comprising administering to the subject a binding protein disclosed herein, wherein the binding protein comprises a first antigen-binding domain having binding specificity for BCMA and a second antigen-binding domain having binding specificity for a natural killer (NK) cell marker.

[0222] In one aspect, the disclosure provides a method of treating or preventing LCA in a subject in need thereof, comprising administering to the subject a binding protein comprising a first antigen-binding domain that has binding specificity for BCMA and a second antigen-binding domain that has binding specificity for a natural killer (NK) cell marker, wherein the first antigen-binding domain: a. a first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and an HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); b. A first immunoglobulin light chain variable domain (VL1) comprising: an LCDR1 sequence having the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO: 4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; an LCDR2 sequence having the amino acid sequence of DNNX5X6PP (SEQ ID NO: 5), wherein X5 is S, I, or N, and X6 is R or K; and an LCDR3 sequence having the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO: 6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G.

[0223] In certain embodiments, the first antigen-binding domain with binding specificity for BCMA comprises: a. a first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and an HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); b. A first immunoglobulin light chain variable domain (VL1) comprising: an LCDR1 sequence having the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO: 4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; an LCDR2 sequence having the amino acid sequence of DNNX5X6PP (SEQ ID NO: 5), wherein X5 is S, I, or N, and X6 is R or K; and an LCDR3 sequence having the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO: 6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G.

[0224] In certain embodiments, VL1 is a. An LCDR1 sequence comprising the amino acid sequence of CASSTGTVTPSNYAN (SEQ ID NO: 7), an LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 8), and an LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 9); b. An LCDR1 sequence comprising the amino acid sequence of CRSSTGTVTPSNYAN (SEQ ID NO: 10), an LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 11), and an LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 12); c. an LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPSNYAN (SEQ ID NO: 13), an LCDR2 sequence comprising the amino acid sequence of DNNIKPP (SEQ ID NO: 14), and an LCDR3 sequence comprising the amino acid sequence of ALWYGGQWV (SEQ ID NO: 15); or d. Comprises an LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPGYYAN (SEQ ID NO: 16), an LCDR2 sequence comprising the amino acid sequence of DNNNKPP (SEQ ID NO: 17), and an LCDR3 sequence comprising the amino acid sequence of ALYYGGQWV (SEQ ID NO: 18).

[0225] In certain embodiments, a. VH1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 55; b. VH1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 50; c. VH1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 51; d. VH1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 52; e. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 53; or f. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:54.

[0226] In certain embodiments, a. VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 55; or b. VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 50; or c. VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 51; or d. VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 52; or e. VH1 comprises the amino acid sequence of SEQ ID NO: 49 and VL1 comprises the amino acid sequence of SEQ ID NO: 53; or f. VH1 comprises the amino acid sequence of SEQ ID NO:49, and VL1 comprises the amino acid sequence of SEQ ID NO:54.

[0227] In certain embodiments, the second antigen-binding domain with binding specificity for an NK cell marker comprises: a. a second immunoglobulin heavy chain variable domain (VH2), i. an HCDR1 sequence consisting of the amino acid sequence of DYVIN (SEQ ID NO: 80), an HCDR2 sequence consisting of the amino acid sequence of EIYPGSGTNYYNEKFKA (SEQ ID NO: 81), and an HCDR3 sequence consisting of the amino acid sequence of RGRYGLYAMDY (SEQ ID NO: 21); ii. an HCDR1 sequence comprising SDYAWN (SEQ ID NO: 22), an HCDR2 sequence comprising YITYSGSTSYNPSLES (SEQ ID NO: 23), and an HCDR3 sequence comprising GGYYGSSWGVFAY (SEQ ID NO: 24); iii. an HCDR1 sequence comprising EYTMH (SEQ ID NO: 25), an HCDR2 sequence comprising GISPNIGGTSYNQKFKG (SEQ ID NO: 26), and an HCDR3 sequence comprising RGGSFDY (SEQ ID NO: 27); iv. an HCDR1 sequence comprising SFTMH (SEQ ID NO: 28), an HCDR2 sequence comprising YINPSSGYTEYNQKFKD (SEQ ID NO: 29), and an HCDR3 sequence comprising GSSRGFDY (SEQ ID NO: 30); or v. a second immunoglobulin heavy chain variable domain comprising an HCDR1 sequence comprising SDYAWN (SEQ ID NO: 31), an HCDR2 sequence comprising YITYSGSTNYNPSLKS (SEQ ID NO: 32), and an HCDR3 sequence comprising CWDYALYAMDC (SEQ ID NO: 33); b. A second immunoglobulin light chain variable domain (VL2), i. an LCDR1 sequence comprising the amino acid sequence of RASQDISNYLN (SEQ ID NO: 34), an LCDR2 sequence comprising the amino acid sequence of YTSRLHS (SEQ ID NO: 35), and an LCDR3 sequence comprising the amino acid sequence of QQGNTRPWT (SEQ ID NO: 36); ii. an LCDR1 sequence comprising RVSENIYSYLA (SEQ ID NO: 37), an LCDR2 sequence comprising NAKTLAE (SEQ ID NO: 38), and an LCDR3 sequence comprising QHHYGTPWT (SEQ ID NO: 39); iii. An LCDR1 sequence comprising RASQSISDYLH (SEQ ID NO: 40), an LCDR2 sequence comprising YASQSIS (SEQ ID NO: 41), and an LCDR3 sequence comprising QNGHSFPLT (SEQ ID NO: 42); iv. an LCDR1 sequence comprising RASENIYSNLA (SEQ ID NO: 43), an LCDR2 sequence comprising AATNLAD (SEQ ID NO: 44), and an LCDR3 sequence comprising QHFWGTPRT (SEQ ID NO: 45); or v. A second immunoglobulin light chain variable domain comprising an LCDR1 sequence comprising RTSENIYSYLA (SEQ ID NO: 46), an LCDR2 sequence comprising NAKTLAE (SEQ ID NO: 47), and an LCDR3 sequence comprising QHHYDTPLT (SEQ ID NO: 48).

[0228] In certain embodiments, a. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64; or b. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 57 and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 65; or c. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 58, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 66; or d. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 59, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 67; or e. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 60, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 68; or f. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 61, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 69; or g. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 62, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 70; or h. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:63, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:71.

[0229] In certain embodiments, a. VH2 comprises the amino acid sequence of SEQ ID NO: 56 and VL2 comprises the amino acid sequence of SEQ ID NO: 64; or b. VH2 comprises the amino acid sequence of SEQ ID NO: 57 and VL2 comprises the amino acid sequence of SEQ ID NO: 65; or c. VH2 comprises the amino acid sequence of SEQ ID NO: 58 and VL2 comprises the amino acid sequence of SEQ ID NO: 66; or d. VH2 comprises the amino acid sequence of SEQ ID NO: 59 and VL2 comprises the amino acid sequence of SEQ ID NO: 67; or e. VH2 comprises the amino acid sequence of SEQ ID NO: 60 and VL2 comprises the amino acid sequence of SEQ ID NO: 68; or f. VH2 comprises the amino acid sequence of SEQ ID NO: 61 and VL2 comprises the amino acid sequence of SEQ ID NO: 69; or g. VH2 comprises the amino acid sequence of SEQ ID NO: 62 and VL2 comprises the amino acid sequence of SEQ ID NO: 70, or h. VH2 comprises the amino acid sequence of SEQ ID NO: 63 or VL2 comprises the amino acid sequence of SEQ ID NO: 71.

[0230] In certain embodiments, the method further comprises administering all or a portion of an immunoglobulin Fc domain or a variant thereof.

[0231] In certain embodiments, the Fc domain is an IgG1 Fc domain. In certain embodiments, the Fc domain or variant thereof comprises a first Fc heavy chain and a second Fc heavy chain. In certain embodiments, the first Fc heavy chain or the second Fc heavy chain comprises a pair of cysteines.

[0232] In certain embodiments, the NK cell marker is selected from NKp46, NKp30, NKp44, CD16, CD56, CD57, KIR receptors (e.g., KIR2DL1, KIR2DL2, KIR2DL3, KIR2DL5A, KIR2DL5B, KIR3DL1, KIR3DL2, and KIR3DL3), CD94, and NKG2. In certain embodiments, the NK cell marker is NKp46.

[0233] In certain embodiments, the method further comprises selecting a subject with light chain amyloidosis, wherein the selection comprises: a. Diagnosing a subject with light chain amyloidosis, b. determining the stage of the disease based on the prognostic system disclosed herein, and / or c. Determining that the subject does not have a prior diagnosis of multiple myeloma.

[0234] In certain embodiments, the subject is treatment naive.

[0235] In certain embodiments, the subject has received or is receiving one or more treatments for light chain amyloidosis (e.g., chemotherapy, autologous stem cell transplant, immunomodulatory agents, immunotherapy, proteasome inhibitors, and any combination thereof). In certain embodiments, the subject has received at least one proteasome inhibitor.

[0236] In certain embodiments, the LCA is relapsed / refractory LCA.

[0237] In one aspect, the disclosure provides a method of treating or preventing LCA in a subject in need thereof, comprising administering to the subject a binding protein comprising a first antigen-binding domain that has binding specificity for BCMA and a second antigen-binding domain that has binding specificity for NKp46; a. The first antigen-binding domain comprises: i. a first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and an HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); ii. a first immunoglobulin light chain variable domain (VL1) comprising: an LCDR1 sequence comprising the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO: 4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; an LCDR2 sequence comprising the amino acid sequence of DNNX5X6PP (SEQ ID NO: 5), wherein X5 is S, I, or N, and X6 is R or K; and an LCDR3 sequence comprising the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO: 6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G; b. The second antigen-binding domain comprises: i. an HCDR1 sequence comprising DYVIN (SEQ ID NO: 19), an HCDR2 sequence comprising EIYPGSGTNYYNEKFKA (SEQ ID NO: 20), and an HCDR3 sequence comprising RGRYGLYAMDY (SEQ ID NO: 21), and ii. Comprises an LCDR1 sequence comprising RASQDISNYLN (SEQ ID NO: 34), an LCDR2 sequence comprising YTSRLHS (SEQ ID NO: 35), and an LCDR3 sequence comprising QQGNTRPWT (SEQ ID NO: 36).

[0238] In one aspect, the disclosure provides a method of treating or preventing LCA in a subject in need thereof, comprising administering to the subject a binding protein comprising a first antigen-binding domain that has binding specificity for BCMA and a second antigen-binding domain that has binding specificity for NKp46; a. The first antigen-binding domain comprises: i. a VH1 comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49; ii. a VL1 comprising an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 55; b. The second antigen-binding domain comprises: i. a VH2 comprising an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 56; ii. VL1 comprising an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO: 64; Includes.

[0239] In certain embodiments, the binding protein is administered by intra-arterial, intraperitoneal, intramuscular, subcutaneous, rectal, or intravaginal administration. In certain embodiments, the binding protein is administered by subcutaneous administration.

[0240] In a specific embodiment, the Fc domain variant comprises ADE mutations in CH2 (G236 / S239D / I332E) to enhance ADCC activity.

[0241] In certain embodiments, the F domain mutant comprises a disulfide bond substitution in CH2 (R292C / V302C) for stabilization.

[0242] In certain embodiments, the Fc domain variants comprise knob-into-hole (KIH) mutations in CH3 to promote heterodimer formation in the Fc domain. In certain embodiments, the "knob" mutations are at positions C482 / W494 and the "hole" mutations are at positions C129 / S146 / A148 / V187. In some embodiments, the Fc domain variants comprise RF mutations (H435R / Y436F) in one CH3 to promote heterodimer formation in the Fc domain.

[0243] In certain embodiments, the disease is amyloidosis or an amyloid disease. As used herein, the terms "amyloidosis" or "amyloid disease" refer to diseases or disorders that fall under the category of plasma cell dyscrasias. Amyloidosis or an amyloid disease occurs when amyloid accumulates in organs and interferes with normal physiological function. As used herein, the term "amyloid" refers to abnormal fibrillar, extracellular proteinaceous deposits found in organs and tissues. Amyloid is not normally found in the body but can be formed from several different types of proteins. Amyloid is typically insoluble and structurally dominated by a beta-sheet structure. Organs that may be affected include the heart, kidneys, liver, spleen, nervous system, skin, and gastrointestinal tract. The term "amyloidosis" is used to refer to a cluster of diseases that share a common feature: extracellular deposition of pathological insoluble fibrillar proteins in organs and tissues.

[0244] A hallmark of amyloid diseases is the production of amyloid, characterized by fibrillar morphology approximately 5–15 nm in diameter that exhibits fluorescence birefringence when bound to the dye Congo Red and the dye Thioflavin T. Fibrils can form secondary structures called protofilaments, which consist of pleated beta sheets, making them resistant to degradation. (Toyama and Weissman (2011), Annu Rev Biochem, 80:557–585; Picken (2020), Acta Haematol, vol. 143:322–334)

[0245] In certain embodiments, the amyloidosis or amyloid disease is light chain amyloidosis or amyloid light chain amyloidosis. The current classification of amyloids is based on the type of amyloid protein. For example, amyloid is referred to as "A" (for amyloid), followed by the abbreviation for the protein type: AL (immunoglobulin light chain-derived amyloid). The term "amyloid light chain amyloidosis" or "light chain amyloidosis" or "LCA," also known as AL amyloidosis, AL, ALA, or primary AL amyloidosis, is the most common form of systemic amyloidosis in the United States and developed countries. Picken (2020), Acta Haematol, vol. 143:322-334. Patients may present with a first case of LCA (newly diagnosed LCA), or the LCA may be relapsed and / or refractory (relapsed / refractory LCA). LCA is the most common form of systemic amyloidosis and is associated with an underlying plasma cell disorder. Abnormal plasma cells originate from a single plasma cell source and secrete toxic fibril-forming free light chains. These plasma cells have been shown to be BCMA-positive (Godara et al. 2019. Blood 134(Supplement_1):4409). In certain embodiments, patients with LCA are treatment-naive. In some embodiments, patients with LCA have received or are currently receiving one or more treatments for light chain amyloidosis (e.g., chemotherapy, autologous stem cell transplant, immunomodulatory agents, immunotherapy, proteasome inhibitors, and any combination thereof).

[0246] In certain embodiments, binding proteins, including those comprising Fc domain variants, are useful in several different applications. For example, in one embodiment, a subject binding protein is useful for reducing or eliminating cells bearing the epitope recognized by the binding domain of the Fc domain variant. In another embodiment, a subject Fc domain variant is effective in reducing or eliminating the concentration of circulating soluble antigens. In another embodiment, a subject Fc domain variant is effective as a T cell engager.

[0247] In another embodiment, the subject binding proteins, including those comprising Fc domain variants, are useful for treating diseases or disorders associated with abnormal monoclonal B cells or plasma cells. In one embodiment, the abnormal monoclonal B cells or plasma cells express BCMA.

[0248] The binding proteins may be particularly useful for treating diseases or disorders within the category of plasma cell disorders. In one embodiment, the plasma cell disorder is not multiple myeloma. In one embodiment, the plasma cell disorder is an amyloidosis, such as LCA (also known as light chain amyloidosis, AL (primary) amyloidosis, systemic amyloidosis, AL, or ALA).

[0249] LCA is a hematological disorder primarily caused by clonal plasma cells producing misfolded immunoglobulin light chains. These abnormal light chains form toxic aggregates within plasma cells and deposit fibrils (amyloid) in organs and tissues, resulting in severe and sometimes permanent organ dysfunction. LCA can affect any organ except the brain. (Li et al. (2019), J Int Med Res., 47(4):1778-1786) The mechanism by which amyloidogenic immunoglobulin light chains lead to organ dysfunction is not fully characterized, but both amyloid deposits and prefibrillar aggregates likely have a cytotoxic effect on the underlying organ. Primary LCA is LCA that is not associated with or considered a complication of multiple myeloma.

[0250] Symptoms depend on the underlying organ affected and are generally recognized late in the disease progression. Early signs and symptoms of LCA include, but are not limited to, swelling of the ankles and legs; severe fatigue and weakness (e.g., shortness of breath; numbness, tingling, or pain in the hands or feet); diarrhea or constipation; significant unintentional weight loss; an enlarged tongue; skin changes (such as thickening or easy bruising around the eyes or purple spots); irregular heartbeat; or difficulty swallowing. Clinical features of more severe LCA include cardiac, renal, hepatic, and gastrointestinal involvement and / or dysfunction, as well as neuropathy and macroglossia. Cardiac involvement (e.g., heart failure and arrhythmias) is the most common LCA symptom and represents the single worst prognostic feature. (Bianchi et al. (2021), Cardiology, vol. 3:4.)

[0251] Diagnostic criteria for LCA include (1) the presence of a systemic syndrome, (2) histologic documentation of amyloid, (3) evidence of a monoclonal plasma cell dyscrasia (e.g., based on bone marrow or lipoaspirate and / or targeted biopsy and serological parameters), and (4) amyloidosis classification for identification of Ig light chains (e.g., via LC-MS or immunoelectron microscopy). Koh (2020) Blood Res., 55(Suppl):S54-S57.

[0252] The disease outcome of patients with LCA can be predicted based on a multistage prognostic system. Currently, there are four different prognostic models: (1) Mayo Model 2004 (Dispenzieri et al. (2004), J Clin Oncol., vol. 22:3751-7); (2) Mayo Model 2012 (Kumar et al. (2012), J Clin Oncol., vol. 30:989-95); (3) European Model 2015 (Muchtar et al. (2019), Leukemia, vol. 33:811-4); and (4) Boston University Score 2019 (Lilleness et al. (2019), Blood, vol. 133:215-23). ​​The Mayo Model 2012 and European Model 2015 showed the best predictive performance in recent validation studies. Vaxman et al. (2020)Blood Rev,40:100636.

[0253] Autologous stem cell transplantation (ASCT) is the most effective treatment for patients with LCA. (Sanchorawala (2020), Acta Haematol, vol. 143:381-387). Because troponin T levels >0.06 ng / mL or NT-proBNP levels >5000 ng / L are associated with high transplant-related mortality, cardiac biomarkers are often tested to assess ASCT eligibility. (Gavriatopoulou et al. (2018), Leukemia, vol. 32:1183-1898). The majority of LCA patients are ineligible for stem cell transplantation and may receive single-agent or combination chemotherapy and / or immunotherapy regimens to eradicate underlying plasma cells. The standard treatment for intermediate-risk patients has been oral melphalan / dexamethasone (MDEX), bortezomib-based regimens (BMDEX, or VCD). However, treatment-related mortality is substantial (24%). Patients who fail to achieve a rapid response rate are considered for second-line treatment, namely immunomodulatory drugs (IMIDs). IIMIDs include thalidomide, lenalidomide, and pomalidomide, as well as their combinations with alkylating agents. However, immunotherapy is poorly tolerated by patients, especially those with cardiac LCA. Sidiqi & Gertz (2021), Blood Cancer Journal, vol. 11:90. Overall, currently used LCA treatment regimens are often difficult for patients to tolerate, with patients often succumbing to persistent side effects of the therapy that often exacerbate disease symptoms. Hassan and Sanchorawala (2022), Hemato, vol. 3: 38-46. More recently, daratumumab (anti-CD38)-VCD was approved as standard treatment in newly diagnosed LCA patients based on the Phase 3 ANDROMEDA study (NCT03201965) (Kastritis et al. 2021. NEJM, 385: 46-58).

[0254] A therapeutically effective amount of an NK cell engager disclosed herein can be a dose or amount sufficient to induce a "therapeutic response" in a subject, such as an improvement in at least one measure of amyloid disease, such as a reduction in the size of existing amyloid deposits or plaques, a reduction in the rate of amyloid deposition, or improved organ function as measured by standard techniques. Examples of common presenting symptoms specific to common target organs and examples of improved organ function are summarized below.

[0255] heart Common symptoms of amyloid deposits include exertional dyspnea, orthopnea, paroxysmal nocturnal dyspnea, leg edema, pleural effusion, jugular venous distention, arrhythmias, syncope, and angina. A decrease in a patient's N-terminal pro-b-type natriuretic peptide (NT-proBNP) level or a decrease in a patient's New York Heart Association (NYHA) functional class level can be an indicator of cardiac improvement. Palladini et al. (2003), Circulation, vol. 107:2440-2445. Improved cardiac function can also be assessed by measuring cardiac troponin levels, analyzing cardiac MRI, and echocardiograms.

[0256] kidney Common signs of amyloid deposition in the kidney are leg edema, anasarca, and uremia. Proteinuria, or a decrease in urinary protein excretion rate and estimated glomerular filtration rate (eGFR), can be indicators of improved renal function. Kidney Int. Suppl(2011), vol.3(1):19-62.

[0257] liver Common signs of amyloid deposits in the liver include right upper quadrant tenderness, hepatomegaly, ascites, and / or oliguria. Improvements in alkaline phosphatase (ALP) and serum γ-glutamyltransferase (GGT) levels can be indicators of improved liver function. Improvements in other metrics, such as hyperlipidemia, coagulation abnormalities, thrombocytopenia, prothrombin time (PT), erythrocyte sedimentation rate (ESR), alanine aminotransferase (ALT) and / or aspartate aminotransferase (AST), serum albumin, and complement fragment levels, can also indicate improved liver function if assessed prior to any treatment, as these parameters lack specificity for hepatic amyloidosis. (Park et al. (2003), Medicine, vol. 82(5):291-298).

[0258] GI tract Common symptoms of amyloid deposits in the gastrointestinal (GI) tract include loss of motility, gastrointestinal bleeding, malabsorption, weight loss, anorexia, vomiting, nausea, hematomas, erosions and ulcers, or nodular gastritis. Improved GI tract function can be assessed using conventional imaging (e.g., echography, computed tomography scanner, X-ray, endoscopy).

[0259] Nervous system A common symptom of amyloid deposits near or within nerves is sensorimotor polyneuropathy, characterized by neuropathic pain, numbness, and, in advanced cases, weakness. Improvement in nervous system function can be assessed by electrophysiological tests such as nerve conduction studies (NCS), electromyography (EMG), autonomic function tests (AFT), and quantitative accessory axon reflex testing (QSART).

[0260] One of ordinary skill in the art will be able to determine by routine experimentation what an effective, non-toxic amount of binding protein or Fc domain variant is for the purpose of treating LCA. For example, a therapeutically active amount of a binding protein, including one comprising an Fc domain variant of the present disclosure, may vary according to factors such as the prognostic staging system, the subject's age, sex, medical complications (e.g., immunosuppressive conditions or diseases), and weight, as well as the ability of the modified antibody to elicit a desired response in the subject. Dosage regimens may be adjusted to provide the optimal therapeutic response. For example, several divided doses may be administered daily, or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.

[0261] In general, the compositions provided in this disclosure can be used to prophylactically or therapeutically treat any neoplasm that contains an antigenic marker that allows for targeting of cancerous cells by the binding protein, including those that contain Fc domain variants.

[0262] The binding proteins of the present disclosure can be administered on multiple occasions. The interval between single administrations can be weekly, monthly, or yearly. The intervals can also be irregular, as indicated by measuring the blood levels of the binding protein or binding antigen in the patient. In some methods, the dosage is adjusted to achieve a plasma concentration of the modified binding polypeptide of about 1-1000 μg / ml, and in some methods about 25-300 μg / ml. Alternatively, the binding protein can be administered as a sustained-release formulation, in which case less frequent administration is required. For antibodies, dosage and frequency vary depending on the half-life of the antibody in the patient. Generally, humanized antibodies exhibit the longest half-life, followed by chimeric and non-human antibodies.

[0263] The dosage and frequency of administration can vary depending on whether the treatment is prophylactic or therapeutic. In prophylactic applications, compositions containing the polypeptides of the present invention or a cocktail thereof are administered to patients not yet in a disease state to enhance the patient's resistance. Such an amount is defined as a "prophylactically effective dose." For this use, the exact amount again depends on the patient's health and general immunity, but generally ranges from about 0.1 to about 25 mg per dose, particularly about 0.5 to about 2.5 mg per dose. Relatively low dosages are administered at relatively infrequent intervals over an extended period of time. Some patients continue treatment for the remainder of their lives. For therapeutic applications, relatively high dosages (e.g., about 1 to 400 mg / kg antibody / dose, with dosages of about 5 to 25 mg being more commonly used for radioimmunoconjugates and higher doses for cytotoxin-drug-modified antibodies) may be required at relatively short intervals until disease progression is alleviated or terminated, or until the patient shows partial or complete improvement in disease symptoms. The patient can then be administered a prophylactic regimen.

[0264] Binding proteins of the present disclosure (including those comprising Fc variants) can optionally be administered in combination with other agents effective to treat the disorder or condition requiring treatment (e.g., prophylactic or therapeutic). Effective single treatment dosages (i.e., therapeutically effective amounts) of 90Y-labeled modified antibodies of the present disclosure range from about 5 to about 75 mCi, for example, from about 10 to about 40 mCi. Effective single treatment non-marrow ablative dosages of 131I-modified antibodies range from about 5 to about 70 mCi, or from about 5 to about 40 mCi. Effective single treatment ablative dosages (i.e., that may require autologous bone marrow transplantation) of 131I-labeled antibodies range from about 30 mCi to about 600 mCi, for example, from about 50 mCi to less than about 500 mCi. Due to the longer circulating half-life of murine antibodies, in conjunction with chimeric antibodies, the effective non-myeloablative single-treatment dosage of iodine-131 labeled chimeric antibodies ranges from about 5 mCi to about 40 mCi, e.g., less than about 30 mCi. For example, the imaging standard for the In-111 label is typically less than about 5 mCi.

[0265] It should be emphasized that while the binding protein can be administered as described above, in other embodiments, the polypeptide can be administered to otherwise healthy patients as a first-line therapy. In such embodiments, the binding protein can be administered to patients with normal or average red bone marrow reserve and / or to treatment-naïve and untreated patients. As used herein, administering a polypeptide in combination with or in conjunction with adjunctive therapy refers to sequential, simultaneous, coextensive, simultaneous, concurrent, or coextensive administration or application of the therapy and the disclosed antibodies. One skilled in the art will understand that the timing of administration or application of the various components of a combined therapeutic regimen can be adjusted to enhance the overall effectiveness of the treatment.

[0266] As noted above, the binding proteins (including those comprising Fc variants), antibodies thereof, therapeutic polypeptides, or Fc variant fusion polypeptides of the present disclosure may be administered in a pharmaceutically effective amount for the in vivo treatment of mammalian disorders. In this regard, it will be understood that the disclosed binding proteins will be formulated to facilitate administration and promote stability of the active agent.

[0267] Pharmaceutical Compositions and Their Administration Methods for preparing and administering binding proteins of the present disclosure to a subject are well known to, or readily determined by, those of skill in the art. Routes of administration of binding polypeptides of the present disclosure can be oral, parenteral, inhalation, or topical. As used herein, the term parenteral includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal, or vaginal administration. While all of these administration modes are expressly contemplated as being within the scope of the present disclosure, the administration mode is a solution for injection, particularly for intravenous or intraarterial injection or infusion, or for subcutaneous administration. Typically, pharmaceutical compositions suitable for injection may include buffers (e.g., acetate, phosphate, or citrate buffers), surfactants (e.g., polysorbates), optional stabilizers (e.g., human albumin), and the like. In some embodiments, Fc domain variants can be delivered directly to the site of harmful cell populations, thereby increasing exposure of diseased tissues to the therapeutic agent.

[0268] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions (e.g., saline and buffered media). In the compositions and methods of the present disclosure, pharmaceutically acceptable carriers include, but are not limited to, 0.01-0.1 M, e.g., 0.05 M phosphate buffer or 0.8% saline. Other common parenteral vehicles include sodium phosphate solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (e.g., those based on Ringer's dextrose), and the like. Preservatives and other additives (e.g., antimicrobials, antioxidants, chelating agents, and inert gases and the like) may also be present. More specifically, pharmaceutical compositions suitable for injection include sterile aqueous solutions (water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In such cases, the composition must be sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and typically be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0269] In many cases, isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride are included in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.

[0270] In either case, sterile injectable solutions can be prepared by incorporating the active compound (e.g., a binding protein of the present disclosure) in the required amount in an appropriate solvent containing one or a combination of ingredients enumerated herein, as needed, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, exemplary methods of preparation include vacuum drying and freeze-drying, which yield a powder of the active ingredient and any additional desired ingredients from a previously sterile-filtered solution. Preparations for injection are processed and filled into containers such as ampoules, bags, bottles, syringes, or vials, and sealed under aseptic conditions according to methods known in the art. They may also be packaged and sold in kit form. Such articles of manufacture typically have a label or package insert indicating that the associated composition is useful for treating a subject suffering from or predisposed to an autoimmune or neoplastic disorder.

[0271] The effective dose of the compositions of the present disclosure for treating the above-mentioned conditions will vary depending on many different factors, including the means of administration, the target site, the physiological condition of the patient, whether the patient is human or animal, other pharmaceutical agents administered, and whether the treatment is prophylactic or therapeutic. Typically, the patient is a human, but non-human mammals, including transgenic mammals, can also be treated. Treatment dosages may be adjusted to optimize safety and efficacy using routine methods known to those skilled in the art.

[0272] Pharmaceutical compositions according to the present disclosure can include pharmaceutically acceptable, non-toxic, sterile carriers, such as physiological saline, non-toxic buffers, preservatives, etc. For purposes of this application, a pharmaceutically effective amount of a binding protein shall be held to mean an amount sufficient to achieve effective binding to an antigen and achieve a benefit, e.g., ameliorating the symptoms of a disease or disorder, or detecting a substance or cell. In the case of tumor cells, the polypeptide can interact with a selected antigen on neoplastic or immunoreactive cells and increase the death of those cells. Of course, the pharmaceutical compositions of the present disclosure can be administered in single or multiple doses to provide a pharmaceutically effective amount of the modified binding polypeptide.

[0273] In accordance with the scope of the present disclosure, the binding proteins of the present disclosure can be administered to humans or other animals in accordance with the treatment methods described above in an amount sufficient to produce a therapeutic or prophylactic effect. The binding proteins of the present disclosure can be administered to such humans or other animals in conventional dosage forms prepared by combining the antibodies of the present disclosure with conventional pharmaceutically acceptable carriers or diluents in accordance with known techniques. Those skilled in the art will recognize that the form and characteristics of the pharmaceutically acceptable carrier or diluent will be determined by the amount of active ingredient to be combined therewith, the route of administration, and other well-known variables. Those skilled in the art will further appreciate that cocktails comprising one or more species of the binding polypeptides described in the present disclosure may prove particularly effective.

[0274] The contents of articles, patents, and patent applications, and all other documents and electronically available information mentioned or cited herein are incorporated by reference herein in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicant reserves the right to physically incorporate into this application any and all materials and information from such articles, patents, patent applications, or other physical and electronic documents.

[0275] While the present disclosure has been described with reference to specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents substituted without departing from the true spirit and scope of the present disclosure. It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein, using appropriate equivalents, may be made without departing from the scope of the embodiments disclosed herein. Furthermore, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps to the objective, spirit and scope of the present disclosure. All such modifications are intended to be within the scope of the appended claims. Having now described specific embodiments in detail, this will be more clearly understood by reference to the following examples, which are included for purposes of illustration only and are not intended to be limiting. [Example]

[0276] The present disclosure is further illustrated by the following examples, which should not be construed as further limiting.

[0277] Example 1: Design of NKp46-BCMA NKCE-binding proteins Introduction To date, antitumor therapy has focused on the manipulation of effector T cells. While T cell engager formats are in clinical development, their use is limited to hematological diseases due to potential toxicity. In contrast, the manipulation of NK cells in cancer via NKCE is a therapeutic alternative due to the antitumor effector potential of NK cells, but a favorable toxicity profile, when compared with effector T cells. Figure 1A illustrates an NKp46 NKCE, which binds one arm to an antigen on the surface of tumor cells and the other arm to the NKp46 receptor on NK cells.

[0278] NKp46 NKCE engineered with a unique Fc format (i.e., NKp46-BCMA_CODV-OL1_Fc-ADE-DSB) as shown in Figure 1B engages BCMA on the surface of tumor cells and simultaneously engages both NKp46 and the Fcγ receptor, CD16a. ADCC activity is induced in this novel, enhanced Fc-competent format. The novel enhanced Fc-competent format (hereinafter referred to as "CODV-OL1-ADE-DSB") contains: (1) ADE mutations in CH2 (G236A / S239D / I332E) to enhance ADCC activity; (2) DSB in CH2 (R292C / V302C) for thermostabilization; (3) knob-into-hole (KIH) mutations in CH3 to promote heterodimer formation in Fc—(3a) knob (heavy chain containing VH / VL domains): S354C / T366W and (3b) hole (heavy chain lacking VH / VL domains): Y349C / T366S / L368A / Y407V; and (4) RF mutations in one CH3 (H435R / Y436F) to promote heterodimer purification in Fc. This NKp46-BCMA NKCE_Fc CODV-OL1-ADE-DSB contains two linkers GGGGSGGGGS in the light chain, one between VL anti-BCMA and VL anti-NKp46, and one between VL NKp46 and CL.

[0279] Materials and Methods—Human Recombinant Proteins, Cloning, Production, and Purification Recombinant human NKp46 - cloning, production, and purification The sequence encoding the extracellular domain (ECD) of human NKp46 (Gln22-Asn255, NCBI reference: NM_004829.5) was inserted into an expression vector and tagged with a C-terminal 6xHis tag for purification. The following primers were used for PCR on human PBMCs: 5'TACGACTCACAAGCTTGCCGCCACCATGTCTTCCACACTCCCTGC3' (SEQ ID NO: 107) and 5'CCGCCCCGACTCTAGATCAATGGTGATGGTGGTGATGATTCTGGGCAGTGTGATCCC3' (SEQ ID NO: 108). The sequence of the amplicon was confirmed. The vector was then used to transfect a CHO cell line, and protein-producing clones were selected. The protein was purified from the culture supernatant using Ni-NTA beads (Qiagen, #1018244) and subjected to S200 size exclusion chromatography to ensure removal of aggregates, followed by downstream characterization of binding kinetics using surface plasmon resonance (SPR).

[0280] The sequence encoding the ECD of cynomolgus monkey NKp46 (Pro22-Asn254, NP_001271509.1) was cloned into an expression vector and tagged with a C-terminal Flag-M2 tag for purification. The primers used to amplify the predicted sequence from cynomolgus monkey PBMCs were as follows: 5'TACGACTCACAAGCTTGCCGCCACCATGTCTTCCACACTCCGTGC3' (SEQ ID NO: 109) and 5'CCGCCCCGACTCTAGATCACTTGTCATCGTCATCTTTGTAATCATTCTGGGCAGTGTGGTCC3' (SEQ ID NO: 110). After sequence verification, the vector was used to transfect the CHO-K1SV cell line and select producer cell clones. The first three batches were purified by M2 affinity chromatography. The beads were incubated overnight with the supernatant containing the recombinant protein. The beads were then washed with PBS1X and eluted with 150 ng / μl of eluted peptide in PBS1X. The protein was then dialyzed against 1x PBS. The next batch was purified by affinity chromatography by coupling anti-NKp46 antibody to AminoLink coupling resin according to the manufacturer's instructions (GE Healthcare, #20381, batch QB213815). The beads were then incubated overnight with the supernatant containing the recombinant protein. The beads were then washed with 1x PBS and eluted with glycine 0.1M pH 2.5. The protein was then dialyzed against TBS buffer pH 7.5, concentrated, and subjected to preparative size exclusion chromatography on a Superdex 200 Increase 10 / 300 GL column.

[0281] Recombinant human BCMA - cloning, production, and purification To generate recombinant human BCMA (TNFRSF17), a synthetic HEK293 codon-optimized DNA fragment encoding the extracellular domain of human BCMA fused to diphtheria toxin fragment A (DTA) and a His6 purification tag was ordered from Atum (Newark, CA, USA). The synthetic DNA fragment was then cloned into the pTT5 mammalian expression vector using Gateway® Cloning technology (Life Technologies-ThermoFisher Scientific) to generate a recombinant plasmid for heterologous expression in mammalian cells.

[0282] Expi293F cells (ThermoFisher) were transfected with plasmid DNA using a commercially available protocol. Cells were harvested after 6 days of growth, and conditioned medium (CM) was collected by centrifugation. Protein was purified using Ni-NTA agarose (Qiagen). The resin was equilibrated in PBS pH 7.2 three times by spinning at 1000 × g for 5 minutes and decanting / adding fresh PBS each time. The equilibrated resin was added to a roller bottle with CM and rotated at room temperature for 1 hour. 1 ml of resin was used for every 200 ml of conditioned medium. After incubation, the CM / resin slurry was poured into a gravity-flow column and washed with 10 CV of PBS (pH 7.2). Protein was eluted with 10 CV of 600 mM imidazole in PBS. The eluate was buffer-exchanged into PBS pH 7.2 and concentrated using an Amicon Ultra-15 centrifugal filter (Millipore). Preparative SEC was performed using a Superdex 200 (16 / 60) column (Cytiva Life Sciences) run in PBS. Final samples were pooled and concentrated to a final concentration of >5 mg / ml in PBS.

[0283] CODV-OL1 molecule - production and purification Expression plasmids encoding the different strands of the corresponding constructs were propagated in E. coli DH5a, and the plasmids used for transfection were prepared from E. coli using the EndoFree Plasmid Mega kit (Qiagen).

[0284] HEK 293-FS cells growing in F17 serum-free suspension culture (Invitrogen) were transfected with the indicated plasmids using polyethyleneimine transfection reagent. After 6 days of incubation at 37°C with 8% CO2, cells were removed by centrifugation, and the supernatant was passed through a 0.22 μm filter to remove particles.

[0285] The protein was captured with MabSelect SuRe (Cytiva), eluted with 0.1 M citrate buffer pH 3.0, and neutralized with 1 M Tris pH 9. After polishing the protein by size exclusion chromatography (SEC) using Superdex200 26 / 60 (Cytiva) and 0.22 μm filtration and UV280 concentration determination, the protein was used for further characterization.

[0286] Recombinant control sample The following human and cynomolgus monkey recombinant proteins were produced and purified at Innate Pharma as previously described (LG Cell 2019): human NKp46 (Gln22-Asn255, NCBI reference: NM_004829.5), human neonatal Fc receptor (FcRn, NCBI reference: P55899), human CD16a (human FcγRIIIA), human NKp46 (Gln22-Asn255, NCBI reference: NM_004829.5), human neonatal Fc receptor (FcRn, NCBI reference: P55899), human CD16a (human FcγRIIIA), human CD16b (human FcγRIIIA), human CD16c (human FcγRIIIA), human CD16d (human FcγRIIIA), human CD16e (human FcγRIIIA), human CD16f (human FcγRIIIA), human CD16g ... V and F isoforms, NCBI Reference: AAH36723), human CD32a (human FcγRIIA, NCBI Reference: AAH20823), human CD32b (human FcγRIIB, NCBI Reference: NP_003992), human CD16b (human FcγRIIIB, NCBI Reference: AAI28563), human CD64 (human FcγRI, NCBI Reference: P12314), cynomolgus monkey NKp46 (Gln17-Asn 254, NP_001271509.1), cynomolgus monkey FcRn (NCBI Reference: Q8SPV9), cynomolgus monkey CD16 (NCBI Reference: NP_001270121.1), cynomolgus monkey CD32a (NCBI Reference: NP_001270598.1), cynomolgus monkey CD32b (NCBI Reference: NP_001271060.1) and cynomolgus monkey CD64 (NCBI Reference: AAL92095.1). Recombinant human BCMA was purchased from ACRO Biosystems.

[0287] [Table 1]

[0288] Example 2: Determination of BCMA receptor density on a panel of myeloid myeloma cell lines Introduction B-cell maturation antigen (BCMA) expression has been proposed as a marker for identifying malignant plasma cells in patients with multiple myeloma (MM). Nearly all MM tumor cells express BCMA, but normal tissue expression is restricted to a subset of plasma cells and mature B cells. Friedman et al. (2018) Hum Gene Ther. 29(5):585-601. To determine the number of BCMA molecules per cell, a flow cytometry-based BCMA receptor assay was used to quantify BCMA surface expression, followed by the selection of MM cell lines suitable for downstream analysis of BCMA antibodies.

[0289] A list of MM cell lines used in this study is shown in Table 2 below.

[0290] [Table 2]

[0291] Materials and Methods—Analytical procedure for determining antigen binding capacity for BCMA expression on the surface of MM cell lines by flow cytometry. Experimental setup For BCMA density measurements, a CELLQUANT Calibrator (Biocytex, ref: 7208) was used. First, 200,000 MM cells (see list below for all tested cell lines) were seeded into a 96-well round-bottom plate (TPP, Trasadingen, ref. 92097) in 100 mL of Reagent 1, 1x (diluted 1 / 10 in distilled water) + 10 mL of FcR Blocking Reagent, Human (Miltenyi Biotec, Bergisch Gladbach, ref. 130-059-901) for 15 min at 4 °C.

[0292] The MM cells were then spun down at 300g for 5 minutes before removing the supernatant. 50ml of 10mg / ml mouse anti-human BCMA antibody was added and then incubated at 4°C for 30 minutes (BD BioLegend, clone 19F2 ref 357502, 0.5mg / ml stock concentration, 1 / 50 dilution by mixing 5ml of anti-BCMA with 245ml of Reagent 1 at 1x).

[0293] For the control isotype, 50 mL of purified mouse IgG2a kappa isotype control at 10 mg / mL was added instead, followed by incubation at 4°C for 30 minutes (BD BioLegend, ref. 400201, stock concentration 0.5 mg / mL, 1 / 50 dilution by mixing 5 mL of IgG2a 1x with 245 mL of Reagent 1).

[0294] Two consecutive washing steps were performed by adding 200 mL of 1x Reagent 1 to the wells, followed by centrifugation at 2000 rpm for 1 min at 4 °C. After removing the supernatant, the cells were resuspended in 50 mL of anti-mouse IgG FITC secondary antibody (reagent 3 from the Biocytex kit, reference number 7208, 1.5 mL Reagent 3 + 13.5 mL Reagent 1) previously diluted 1 / 10 in 1x Reagent 1. The 50 mL containing the calibration beads was added to the calibration well (reagent 2 from the Biocytex kit), and finally, 5 mL of Reagent 3 was added to the calibration well (undiluted) to achieve the same staining conditions as the cells. The 96-well plate was then incubated for 20 min at 4 °C, protected from light.

[0295] Three successive washing steps were performed by adding 200 mL of Reagent 1 at 1× to the wells, followed by centrifugation at 2000 rpm for 1 min at 4° C. After removing the supernatant, the cells were resuspended in 100 mL of cold PBS before being read on a MACSQuant Analyzer 10 or MACSQuant VYB (Miltenyi Biotec, Bergisch Gladbach).

[0296] Acquisition is performed in the B1 channel for FITC staining and the V1 channel for DAPI staining (cell viability marker).

[0297] BCMA density calculation To determine BCMA density on MM cell lines based on FITC fluorescence, the calibration bead information was used to generate a linear calibration curve as shown in Table 3 below.

[0298] [Table 3]

[0299] For analysis, BCMA density per cell was calculated using the following formula: BCMA density=10 (log(FITC BCMA)×a+b) -10 (log(FITCアイソタイプ)×a+b)

[0300] result Calculation of BCMA density per cell in the panel of MM cell lines revealed that the EJM cell line had the highest level of BCMA density, while the MM1S cell line had the lowest level of BCMA density on the cell surface compared to the other MM cell lines used in the panel. Figure 2 shows the ranking of MM cell lines by BCMA density per cell. Based on these results, cell lines were selected for use in downstream studies examining NKp46-BCMA_Fc binding affinity and cytolytic activity against BCMA on MM cells. In particular, RPMI 8226 has a BCMA density of approximately 2,000 sites per cell, which is close to the average for multiple myeloma cells. MM1S has a BCMA density of approximately 800 sites per cell, which roughly corresponds to the level of BCMA expression in healthy plasma cells. MM1R has a BCMA density of approximately 5,500 sites per cell, making it useful for determining the efficacy of the binding proteins of the present disclosure at high expression levels.

[0301] Example 3: Binding characteristics of NKp46-BCMA Fc format variants Introduction NKp46-BCMA_Fc-ADE-DSB NKCE was titrated on RPMI cells to determine the K for binding to MM tumor cells as well as donor NK cells. D The different Fc format variants of NKp46-BCMA-NKCE were then tested by SPR to confirm their affinity to the two variants of the FcRn as well as the CD16a receptor.

[0302] Materials and Methods cell RPMI 8226 multiple myeloma cell line was purchased from ATCC. Cells were cultured in complete RPMI medium (RPMI-1640 containing 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1× non-essential amino acids).

[0303] Titration assay Resting NK cells and RPMI 8226 cells (1.10 5 Cells (1000 cells / well) were stained for 1 hour in U-bottom 96-well plates with a 1 / 10 serial dilution range of unconjugated molecules starting at 225 μg / mL and 500 μg / mL, respectively. Secondary antibody staining was performed using goat anti-human IgG, Fcγ fragment-specific PE (Jackson Immunoresearch 109-116-170). After staining, cells were resuspended in BD Cellfix and analyzed by flow cytometry. Parameters were recorded and analyzed with FlowJo software. Staining EC50 values ​​were calculated using GraphPad Prism using a four-parameter logistic nonlinear regression model.

[0304] SPR binding experiment - CD16a For binding affinity measurements with CD16a, HBS-EP+ buffer (Cytiva, Uppsala, Cat. No. BR1006-69) was prepared by mixing 100 mL of 10× HBS-EP+ buffer with 900 mL of purified water.

[0305] Affinity capture of human CD16a protein was achieved using a His capture kit (Cytiva, Uppsala, catalog number 28995056). The anti-His capture antibody was diluted 1:20 in running buffer and coupled to a CM5 chip (Cytiva, Uppsala, catalog number 29149603) using standard amine coupling, yielding approximately 8000 response units (RU) using an amine coupling kit (Cytiva, Uppsala, catalog number BR-100-50).

[0306] Ten 1:1 dilutions of the bispecific antibodies in HBS-EP+ assay buffer were prepared to concentrations of 5.8 nmol / L, 11.7 nmol / L, 23.4 nmol / L, 46.8 nmol / L, 93.75 nmol / L, 187.5 nmol / L, 375 nmol / L, 750 nmol / L, 1500 nmol / L, and 3000 nmol / L. CD16a(V / F) protein was diluted to a concentration of 0.1 ng / mL in HBS-EP+ buffer and used at this concentration for the experiments. CD16a(V176) and CD16a(V176F) were captured on flow cells 2 and 4, respectively, at a flow rate of 10 μL / min for 30 seconds, yielding a maximum response (Rmax) of approximately 30 RU.

[0307] Measurements were performed in multi-cycle kinetic experiments. In each multi-cycle experiment, CD16a was captured via an anti-His antibody immobilized on a Series S CM5 sensor chip (Human Antibody Capture Kit, Cytiva, Uppsala, catalog no. BR1008-39). A 1:1 dilution series of bispecific antibodies diluted in HBS-EP+ buffer was injected from 5.8 nmol / L to 3000 nmol / L for 120 seconds at a flow rate of 30 μL / min, followed by a 120-second dissociation phase. For double referencing, all analyte concentrations were run in duplicate with multiple buffer blanks. Regeneration of the capture surface was performed using two consecutive injections of regeneration solution (10 mmol / L glycine, pH 1.5) at 30 μL / min for 30 seconds. The binding affinity (KD value) of the bispecific antibody to human CD16a was evaluated using steady-state fits of the SPR response to the measured antibody concentration using Biacore T200 Evaluation Software version 3.0 (Cytiva, Uppsala).

[0308] SPR binding experiments - huNKp 46 and BCMA For binding affinity measurements with huNKp46 and BCMA, serial two-fold dilutions of human NKp46 (concentration range 50 nM to 0.1 nM), cynomolgus NKp46 (concentration range 50 nM to 0.1 nM), human BCMA (concentration range 50 nM to 0.1 nM), and cynomolgus BCMA (PPB-17990; concentration range 50 nM to 0.1 nM) were prepared in HBS-EP+ assay buffer.

[0309] Affinity capture of mAb samples (FF-20-1319-1, FF-20-1320-1, FF-20-1634-1, FF-20-1635-1, EFF-20-106-1, and EFF-20-107-1) was achieved using a human antibody capture kit (Cytiva, Uppsala, catalog no. BR1008-39) according to the manufacturer's instructions. The anti-Fc capture antibody was diluted 1:20 in running buffer and coupled to a CM5 chip (Cytiva, Uppsala, catalog no. 29149603) using standard amine coupling, yielding approximately 8000 response units (RU) using an amine coupling kit (Cytiva, Uppsala, catalog no. BR-100-50).

[0310] The antibodies were diluted with HBS-EP+ buffer to concentrations of 0.1–0.4 μg / mL and used at these concentrations. The antibodies were captured for 120 seconds at a flow rate of 10 μL / min, yielding a maximum response (Rmax) of approximately 30 RU.

[0311] Measurements were performed in multi-cycle kinetic experiments for each antibody using a Biacore 8K instrument. In each multi-cycle experiment, the antibody was captured via an anti-hum Fc antibody immobilized on a Series S CM5 sensor chip (Human Antibody Capture Kit, Cytiva, Uppsala, Cat. No. BR1008-39).

[0312] Antigen diluted as described above (concentration range: 0.1 nM to 50 nM) was injected for 240 seconds at a flow rate of 60 μL / min, followed by a 400-second dissociation phase. For double referencing, all analyte concentrations were run in duplicate with multiple buffer blanks. Regeneration of the capture surface was performed with regeneration solution (3 mol / L MgCl) at 30 μL / min for 60 seconds. Binding kinetic data were evaluated using Biacore 8K Evaluation Software version 1.1.1.7442, using a 1:1 binding model with mass transport limitation.

[0313] result Titration of NKp46-BCMA_Fc-ADE-DSB on RPMI cells and donor NK cells demonstrated that the ADCC-enhanced Fc format of NKp46-BCMA still retained affinity for NKp46 and BCMA targets, as shown in Figures 3A and 3B.

[0314] SPR binding analysis of NKp46-BCMA-NKCE with a larger panel of 12 different Fc formats confirmed its affinity for CD16a and FcRn, as shown in Figures 4 and 5, respectively. Notably, all ADCC enhancing molecules demonstrated increased binding to the CD16(V176) and (F176) mutants, as shown in Figure 4.

[0315] The binding kinetics for NKp46-BCMA_Fc-ADE-DSB NKCE to NKp46 (human and cynomolgus), BCMA (human and cynomolgus), and FcγR were also calculated and the results are shown in Tables 4, 5, and 6 below.

[0316] [Table 4]

[0317] [Table 5]

[0318] [Table 6]

[0319] Example 4: Fc-engineered NKp46-BCMA NKCE demonstrates enhanced in vitro cell cytotoxic activity Introduction NKp46-BCMA NKCEs engineered with different Fc formats, with either enhanced ADCC (Fc-DE, Fc-DE-DSB, Fc-ADE, Fc-ADE-DSB) or non-enhanced ADCC (NKp46-BCMA_Fc), were evaluated for their ability to promote lysis of MM tumor cells in the presence of NK donor cells, as well as for assessment of potential off-target NK cytotoxicity. Furthermore, NKp46-BCMA NKCEs were compared to an anti-BCMA antibody control to assess their ability to kill MM tumors.

[0320] Materials and Methods cell Human NK cells. Healthy human buffy coats were provided by the Etablissement Français du Sang (EFS, French Blood Service, Marseille; AC-2019-3428). Peripheral mononuclear cells (PBMCs) were isolated from the buffy coats by Ficoll density gradient centrifugation. Human NK cells were purified from PBMCs using a bead-based negative selection kit from STEMCELL Technologies or Miltenyi Biotec. MM cell lines. RPMI 8226 and MM1.S multiple myeloma cell lines were purchased from ATCC. Cells were cultured in complete RPMI medium (RPMI-1640 containing 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1x non-essential amino acids).

[0321] NK cell-based cytotoxicity assay For cytotoxicity assays performed against MM cell lines, target cells were alternately loaded with Cr-51. Starting at 5, 10, or 15 μg / mL, a 1 / 10 serial dilution range was performed for the test and control items, depending on the experiment. The tested molecules, labeled target cells (approximately 3,000 cells), and human NK cells (approximately 30,000 cells) from healthy donors (fresh or overnight) were added sequentially to each well of a round-bottom 96-well plate to obtain a 10:1 (E:T) ratio. After 4 hours of co-incubation, the supernatant was transferred to a Lumaplate (for Cr-51). For Cr-51-based cytotoxicity assays, Cr-51 released from dead target cells was measured using a TopCount NXT (Microplate Scintillation and Luminescence Counter; Perkin Elmer). Radioactivity was measured by counting γ-emission for 60 seconds for each well. Results are expressed as cpm (counts per minute). Percent specific lysis was calculated using the following formula: Specific lysis (%)=(ER(cpm)-SR(cpm)) / (MR(cpm)-SR(cpm))×100 where ER = experimental release, SR = spontaneous release and MR = maximum release.

[0322] EC values ​​were calculated for each molecule by drawing an appropriate nonlinear regression curve (selection of the "log(agonist) vs. response - variable slope (four parameters)" model) using Graphpad Prism Software. 50 It was decided that:

[0323] result As shown in Figure 6, NKp46-BCMA NKCE engineered in ADCC-enhanced Fc formats (Fc-DE, Fc-DE-DSB, Fc-ADE, Fc-ADE-DSB) promoted NK cell-mediated MM tumor cytotoxicity more effectively than NKp46-BCMA_Fc in the non-enhanced ADCC format. Cytotoxic activity was not impaired by the introduction of a stabilizing DSB. As shown in Figures 7 and 8, both NKp46-IC_Fc-ADE and NKp46-BCMA_Fc in the presence of NK cell effectors mediated MM tumor cell death to levels similar to or superior to those of an anti-BCMA antibody in an IgG1 format (BCMA_IgG1) or a defucosylated IgG1 format (Reference 1).

[0324] Both NKp46-IC_Fc-ADE and NKp46-BCMA_Fc had excellent cytotoxic activity against MM tumor cells in the presence of NK cells, but no fratricidal NK cell killing was observed, indicating that NKp46-BCMA NKCE does not induce potential toxic off-target effects (Figure 9). The presence of soluble BCMA in the serum of MM patients has been described. Hipp et al. (2017) Leukemia 31:1743-1751. Soluble BCMA titrated at increasing concentrations in a cytotoxicity assay using MM cell and NK cell co-cultures demonstrates that soluble BCMA slightly affected the potency of NKp46-BCMA NKCE but did not affect the maximal level of MM cell lysis, as shown in Figure 10.

[0325] Example 5: In vitro cytotoxicity assay using calcein release as an indicator Materials and Methods Whole blood samples: Fresh human peripheral blood mononuclear cells (PBMCs) were isolated from whole blood samples of healthy donors supplied by EFS Ile de France, in accordance with the "terms & conditions" described in agreement N 12 / EFS / 131 established between EFS Ile de France and Sanofi-Aventis Recherche et Développement.

[0326] Isolation of human PBMCs from whole blood: Human PBMCs were isolated from whole blood of healthy donors (HD) by density gradient centrifugation.

[0327] Whole blood was collected from a blood bag and diluted with 40 mL of sterile phosphate buffered saline (PBS). 15 mL of Ficoll-Paque Plus Cytiva (Sigma-Aldrich, ref. 17-1440-02) was dispensed into the center of four sepMate-50 tubes (Stemcell ref. 85450). 80 mL of diluted blood was then gently added to the rim of each sepMate-50 tube containing Ficoll solution (20 mL / tube). The tubes were centrifuged at 1200 g for 20 minutes at room temperature (RT) without the brake. The four buffy coat layers were collected and transferred to two 50 mL tubes. The leukocyte solution was completed with sterile PBS to a final volume of 50 mL. The two tubes were centrifuged twice at 400 g for 10 minutes at room temperature with the brake on (the supernatant was discarded and 50 mL of PBS was added between each centrifugation). After the final centrifugation, the pellet was mixed and the volume was completed to 10 mL with RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine (complete culture medium). The total number of viable PBMCs was determined by Vicell XR counting (Beckman Coulter cell counter).

[0328] NK cell harvest: Human NK cells were purified from PBMCs using the MACSxpress® Whole Blood NK Cell Isolation Kit (Miltenyi) according to the supplier's recommendations. NK cells were then cultured overnight in complete medium at 5 × 10 cells / mL at +37°C and 5% CO2 (so-called "resting" NK cells) before use in activation assays. 6 The cells were left to stand and their expression of NKp46 and CD16 was assessed by flow cytometry.

[0329] Cell lines: RPMI8226 (ATCC CCL-155), MM.1R (ATCC CRL-2975), and MM.1S (ATCC CRL-2974) cells are multiple myeloma cell lines (plasmacytoma). They grow primarily in suspension, although some cells can grow adherently (up to 50% in some cases). For maintenance, cells were cultured in fresh complete medium at 0.3 × 10 6 The cells / mL were resuspended for 3 or 4 days.

[0330] Stock solutions: Stock solutions of each antibody were stored in PBS at 4°C. On the day of the assay, the products were vortexed to remove potential aggregates and then cascade diluted. A dilution range from 200 nM (2x concentrated) to 0.02 pM (1 / 10 serial dilutions) was performed in complete culture medium.

[0331] Of these serial dilutions, 100 μL was added to each well containing the cell suspension (50 μL BCMA+RPMI8226 target cells and 50 μL NK) to give final concentrations of 100, 10, 1, 0.1, 0.01, 0.001, 0.0001, and 0.00001 nM. For the combination antibody (not binding to NKp46 or CD16) conditions, the first concentration was concentrated 4-fold to reach the same concentration of the other antibodies tested: 50 μL NKp46-BCMA-Fc ADE-DSB.

[0332] Cytotoxicity assay: BCMA+RPMI8226 (or MM.1R or MM.1S) target cells were counted on the day of the assay to assess the amount of cells required for the experiment (5000 cells / well). 6 Target cells at a concentration of 1 / ml were resuspended in 4 ml of complete medium containing 10 μl of calcein-AM (50 μg) pre-reconstituted in 25 μl of DMSO. The labeled cells were incubated for 30 minutes at 37°C in the presence of 5% CO (carbon dioxide).

[0333] Serial antibody dilutions were prepared and added to U-bottom 96-well plates (100 μl / well) (Corning® Costar® Ultra-Low Attachment Multi-Pack 96-Well Plates; Thermo Scientific).

[0334] Target cells were washed three times with 5 ml of complete medium (after each wash, they were centrifuged at 300 g for 5 minutes and the supernatant discarded). A final wash was performed with complete medium (ThermoFisher Scientific) containing probenecid (4x concentrated). Target cells were counted and seeded at 5,000 cells / 50 μl / well. Finally, NK cells at a 10:1 E / T ratio were added to the target cell and antibody suspension. As controls, target cells alone and target cells with NK cells but no antibody were added. Additionally, 2% Triton X was added to achieve maximum target cell death. Each condition was performed in duplicate. The culture plates were incubated at 37°C in the presence of 5% CO2 for 4 hours, at the end of which 100 μl of supernatant was collected and transferred to a black 96-well flat-bottom medium-binding microplate. Calcein release from dead target cells was assessed using a TECAN 1000Pro machine.

[0335] Data Analysis: To convert antibody concentrations from mg / ml to M, the following formula was used: Concentration (mg / ml) / Molecular weight (Da) = Molar concentration (M) For killing assays, percent specific lysis was calculated using the following formula: Cytotoxicity %=[(ER-SR)×100 / (MR-SR)] ER = experimental release (target cells + NK + [antibody]) SR = spontaneous release (target cells only) MR=maximum release (target cells+2%Triton X)

[0336] Statistical analysis: Analysis was performed using GraphPad Prism 9.1.2. The upper limit of lysis values ​​corresponded to the maximum lysis observed (mean of duplicate values). According to Ratkowsky and Reedy, half-maximal effective concentrations (EC 50 ) values ​​are expressed in pM and calculated using a four-parameter logistic nonlinear regression model.

[0337] result NK cell activation was determined by measuring the % specific lysis of RPMI 8226 cells by NK cells and either: NKp46-BCMA_Fc-ADE-DSB, which engages both NKp46 and CD16a; NKp46-BCMA-Fc incompetent-DSB (a molecule that binds only to NKp46); X-BCMA-ADE-DSB (a molecule that binds only to CD16a); or a combination of an NKp46-only binder with a CD16a-only binder or an isotype control antibody (X-BCMA-Fc incompetent-DSB, which binds only to BCMA on tumor cells but not on NK cells, and NKp46-X-ADE-DSB, which binds to NKp46 and CD16a on NK cells but not on tumor cells). Compared to the other four antibody and single targeting agent combinations, optimal NK cell activation occurred with NKp46-BCMA_Fc-ADE-DSB, demonstrating that (1) dual targeting of NKp46 and CD16a results in higher potency and efficacy in tumor cell killing than single engagement, and (2) the importance of having the NKp46 and CD16a arms on the same molecule for optimized potency (Figure 11).

[0338] Furthermore, the high potency of NKp46-BCMA_Fc-ADE-DSB was found to enable strong efficiency in tumor cell killing even in MM cell models expressing low levels of BCMA (e.g., MM1S cells) (Figure 12).

[0339] NKp46-BCMA_Fc-ADE-DSB was also compared to an anti-BCMA monoclonal antibody with enhanced ADCC characteristics (e.g., a defucosylated anti-BCMA antibody). NKp46-BCMA_Fc-ADE-DSB demonstrated comparable maximal lysis and better potency when compared to the defucosylated anti-BCMA antibody in both RPMI 8226 and MM1S cells (Figure 13).

[0340] Example 6: Fc-engineered NKp46-BCMA NKCE demonstrates potent and specific in vivo anti-tumor activity Introduction To evaluate the in vivo efficacy of NKp46-BCMA NKCE against tumor cells, a xenograft mouse model that does not express CD16 was established. Figure 14A shows a schematic diagram of the experimental set up for determining the in vivo antitumor activity of NKp46-BCMA_Fc in the xenograft mouse model. Briefly, a 1:1 mixture of green (eGFP) and red (dsRed) fluorescent mouse lymphoma RMA cells, which do not express and express human BCMA, respectively, was intravenously injected into human NKp46 transgenic Rag1-deficient mice (Tg huNKp46 Rag1 − / − ). Tumor-bearing mice (n = 7 per group) were treated once with a total dose of 12.2 pmoles of NKp46-BCMA_Fc or vehicle as a control. Forty-eight hours after treatment, mouse livers were biopsied, and the absolute number of infiltrated RMA cells was monitored by flow cytometry. Livers of mice were biopsied 48 hours after treatment and the absolute number of infiltrated RMA cells was monitored by flow cytometry as described below and shown in the corresponding Figures 14B-14E.

[0341] Materials and Methods In vivo antitumor activity in short-term models The activity of BCMA-NKCE molecules was evaluated in a disseminated tumor model using murine RMA leukemia cells transduced for expression of human BCMA, RMA-dsRed-huBCMA Cl.E6 (BCMA positive) or RMA-eGFP Cl.5A6 (BCMA negative), and mixed at a 1:1 ratio for injection in the tail vein of immunodeficient mice expressing human NKp46 on NK cells (HuNKp46 Tg Rag1- / -) (N=14) on day 0. Mice were divided into two groups and treated on day 0 with vehicle (N=7) or NKp46-BCMA_Fc molecules (N=7) at a flat dose of 12.3 pmoles per mouse. On day 2 (48 hours after treatment), mice were sacrificed and disseminated RMA cells were extracted from the liver by disruption with OctoMacs® and Percoll gradient isolation. Liver-infiltrating RMA cells were analyzed and counted by flow cytometry.

[0342] Quantitative and statistical analysis Stepwise statistical analysis of the obtained data was performed using GraphPad Prism V7. The obtained ratio data were logarithmically transformed for statistical analysis. A normality test (d'Agostino-Pearson) was performed to confirm the use of nonparametric tests (Kruskal-Wallis, followed by post-comparison tests). Each treatment group was systematically compared with the control vehicle group. When data were not normally distributed, the statistical significance of differences between paired sample populations was determined using the Wilcoxon matched-pairs signed-rank test. N is the number of samples used in the experiment. Mean or median values ​​are shown with or without error bars indicating SD. Significance is indicated as follows: *p≦0.05; **p≦0.01; ***p≦0.001, ****p≦0.0001. Four-parameter nonlinear regression analysis was used to determine the correlation between NKp46-BCMA_Fc NKCE and EC. 50 was calculated.

[0343] result Prior to engraftment, there were 1.5-fold more dsRed-huBCMA RMA cells than eGFP-huBCMA-negative cells when analyzed by flow cytometry, and only RMA dsRed cells expressed BCMA (Figures 14B-14C). Expression of human BCMA on dsRed RMA cells analyzed by flow cytometry was also detectable prior to engraftment (in vitro) and after engraftment in liver biopsies (ex vivo) (Figure 14D). Forty-eight hours after treatment with NKp46-BCMA-FC or vehicle control, the absolute number of liver-infiltrating RMA cells analyzed by flow cytometry (left) and the dsRed / eGFP cell ratio (right) demonstrated that NKp46-BCMA_Fc tumor killing was specific to BCMA-expressing tumor cells (Figure 14E).

[0344] Example 7: NKp46-BCMA_Fc-ADE-DSB promotes autologous NK cell activation and multiple myeloma (MM) cell killing ex vivo Introduction Bone marrow and peripheral blood samples containing multiple myeloma cells and autoimmune effector cells were obtained from untreated or standard of care diagnosed patients with either de novo or relapsed multiple myeloma to assess the cumulative effect of ex vivo NKp46-BCMA_Fc-ADE-DSB NKCE.

[0345] Materials and Methods Cells and staining Bone marrow and peripheral blood samples were obtained from the MYRACLE cohort (Benaniba et al., BMC Cancer, 2019). Peripheral blood mononuclear cells (PBMCs) and bone marrow mononuclear cells (BMMCs) were isolated by density gradient centrifugation using Ficoll-Hypaque. Samples were from standard-of-care treated patients who had previously been treated with daratumumab, carfilzomib, dexamethasone, and Revlimid.

[0346] cells (4×10 5CTL-NKCE2 (10 μg / ml cells / well) were incubated in RPMI containing 5% FCS and 3 ng / ml IL-6 in the presence of CTL-NKCE2, NKCE2 (10 μg / ml), reference-4 (20 μg / ml), or obinutuzumab (10 μg / ml) for 24 hours. At the end of the incubation, cells were transferred to V-bottom plates, the plates were centrifuged at 3000 rpm for 1 minute, and washed once with PBS. A panel of antibodies in BD Pharmingen Stain Buffer BSA / Brilliant Stain buffer was added for each condition listed in the table below.

[0347] Cells were resuspended in FACS buffer and analyzed by flow cytometry using a FACS Symphony. NK cell activation, described further below, was assessed by CD107a and CD69 expression on CD3- / CD56+ NK cells, and myeloma cell death was assessed by the loss of CD138+ / CD38+ cells.

[0348] [Table 7]

[0349] NK cell activation assay The molecules were added to a U-bottom 96-well plate. Then, 50,000 resting NK cells and 50,000 RPMI 8226 cells were added sequentially to each well to obtain a 1:1 effector-to-target (E:T) ratio. A control condition was performed by adding 50,000 resting NK cells alone to each well. BD GolgiSTOP™ solution (BD Biosciences, 554724) was added to each well at a final dilution of 1 / 6000e (control and experimental). A positive control for NK cell activation was performed by adding 125 ng / mL final Phorbol 12 myristate 13 acetate (PMA, SIGMA, P8139) and 1 μg / mL final ionomycin (IONO, SIGMA, I0634) to 50,000 resting NK cells. Each condition was performed in duplicate. After 4 hours of co-incubation at 37 ± 1°C and 5 ± 1% CO2, extracellular staining was performed for CD3, CD56, CD69, CD107a, and CD107b markers. After fixation and permeabilization of the cells, intracellular staining was performed to measure intracellular IFNg, TNFα, and MIP1β production. The antibody mixture was centrifuged at 16,000g for 10 minutes at +4°C to remove potential aggregates. After the final staining, cells were resuspended in staining buffer (PBS, 0.2% BSA, 2 mM EDTA, 0.02% azide) and analyzed by flow cytometry (FC).

[0350] Flow cytometry data were analyzed using FlowJo software. Analysis of percent NK cell activation was performed using GraphPad Prism. The top activation value corresponded to the maximal activation observed. Half-maximal effective concentration (EC50) values ​​were calculated using a four-parameter logistic nonlinear regression model corresponding to the following equation:

number

[0351] The same model as for EC50 was used to calculate the lowest calculated activation, the highest calculated activation, slope and 95% confidence interval (CI) values.

[0352] result Flow cytometry analysis of MM patient PBMCs treated with NKp46-BCMA_Fc-ADE-DSB NKCE showed a decrease in the frequency of myeloma cells, characterized by the loss of CD138+ / CD38+ cells (Figure 15A, left panel), and an increase in activated NK cells, as assessed by CD107a and CD69 expression on CD3- / CD56+ NK cells (Figure 15A, center right panel), compared to anti-BCMA IgG1 DE antibody or no antibody control. These differences in marker expression levels were quantified in the corresponding bar graphs shown in Figure 15B. Figure 16 shows ex vivo characterization of NKp46-BCMA_Fc-ADE-NKCE tumor-killing activity in an autologous setting using bone marrow aspirates from MM patients who failed a variety of treatments (TCs; therapeutic classes) at diagnosis or after standard of care (SoC) treatment (daratumumab, isatuximab, proteasome inhibitors, IMIDs, dexamethasone, alkylating agents, BH3 mimetics, histone deacetylase inhibitors), anti-CD47, CD3-CD38, or CD3-BCMA T-cell engagers. Samples showing ≤10% lysis were associated with very low E:T ratios.

[0353] NKp46-BCMA_Fc-ADE-DSB NKCE shows similar ex vivo anti-myeloma activity (autologous setting) in patient samples at diagnosis or relapse. No decrease in anti-myeloma activity is observed at relapse.

[0354] These data demonstrate that NKp46-BCMA_Fc-ADE-DSB NKCE activates ex vivo NK cells in primary samples from MM patients, e.g., in an autologous assay using multiple myeloma cells and NK cells from the same patient.

[0355] Example 8: Fc-engineered NKp46-BCMA NKCE demonstrates potent and specific in vivo antitumor activity and favorable elimination half-life Introduction This example evaluates the pharmacokinetic (PK) profile and parameters of NKp46-BCMA_Fc-ADE-DSB NKCE following a single intravenous (2.5 mg / kg) administration to female huFcRn Tg32 transgenic mice.

[0356] Materials and Methods PK study in hFcRn transgenic mice Mouse experiments were performed with transgenic Tg32 (B6.Cg-Fcgrttm, 1Dcr Tg(FCGRT)32Dcr / DcrJ) mice, derived from C57BL / 6 mice and purchased from The Jackson Laboratory (Bar Harbor, Maine). FcRn- / -hFcRn (line 32) Tg mice carry a null mutation for the transgene, expressing the hFcRn α-chain transgene under the control of the mouse gene and its native human promoter. Three Tg32 homozygous naive adult female mice (average weight 21.4 g) were used at the start of the study.

[0357] For the dosing regimen, NKp46-BCMA_Fc-ADE-DSB NKCE (stock solution: 1.5 mg / ml) was extemporaneously prepared in 10 mM His, 150 mM NaCl, pH 6 buffer diluted in the same buffer and administered as a single intravenous dose of 2.5 mg / kg at a volume of 10 mL / kg into the tail vein. Animals were evaluated using a serial sampling approach at 0.083, 4, 24, 72, 168, 336, 504, and 672 hours post-dose over the 28-day study period. At each time point, blood samples (approximately 20 μL—serial sampling) were collected from the saphenous vein into K3-EDTA collection devices. Immediately after collection, blood samples were placed on wet ice and then centrifuged. 4 μL of plasma was then diluted in 60 μL of DPBS (phosphate-buffered saline).

[0358] The analytical methods were as follows: Concentrations at each time point were determined by bottom-up LC-MS / MS assay using the following general method: after precipitation of plasma aliquots, the plasma pellet was subjected to protein denaturation, reduction, alkylation, trypsin digestion, and solid-phase extraction before analysis of the surrogate peptides. The surrogate peptide VYACEVTHQGLSSPVTK, belonging to the Fab region (light chain), was selected for quantification for each antibody depending on its selectivity and response factor. Calibration standards were prepared by spiking plasma with antibody at 1, 2.8, 7, 14, 40, 80, and 100 μg / mL. Peptide separation was performed on a Shimadzu UHPLC system equipped with a reversed-phase Xbridge BEH C18 column (2.1 × 150 mm, 3.5 μM, 300 Å, water) using a stepwise gradient of 0.1% formic acid in water and 0.1% formic acid in acetonitrile at a flow rate of 600 μL / min. For detection, a Sciex API6600 TripleTOF mass spectrometer was used in positive product ion mode with a source temperature of 500 °C, ion spray voltage of 5500 V, curtain gas of 35, and nebulizer gas of 50. The dwell time was 15 ms for each experiment. The declustering potential was 90 V, and the collision energy was 26 V. The 807.4098 m / z fragment of the 626.0 m / z parent ion of the antibody's unique surrogate peptide was used for concentration determination compared to standards and controls using peak areas from the MQ4 integration algorithm in MultiQuant software.

[0359] Assay Method NKp46-BCMA_Fc-ADE-DSB NKCE concentrations were determined in plasma using an exploratory LBA method. NKp46-BCMA_Fc-ADE-DSB NKCE was captured by biotin-BCMA antigen bound to streptavidin beads on a Gyrolab microstructure disc and detected using a goat anti-human IgGFcg Alexa tag tracer. The lower limit of quantitation (LLOQ) was 1.00 μg / mL.

[0360] statistical analysis Individual plasma concentration values ​​of NKp46-BCMA_Fc-ADE-DSB NKCE (expressed in μg / mL) were summarized by descriptive statistics (mean, standard deviation (SD), and coefficient of variation (CV%)) and tabulated by sampling time. All results are reported to three significant figures, except for CV%, which is reported without a decimal point.

[0361] Individual PK parameters were summarized by descriptive statistics as described above, with individual and mean values ​​expressed to three significant figures (except for tmax and tlast, which were rounded appropriately for time values ​​and for which only median and range [min-max] values ​​were reported).

[0362] result No clinical signs or symptoms were observed during the study.

[0363] The mean and individual (N=3) NKp46-BCMA_Fc-ADE-DSB NKCE plasma concentrations (ug / ml) obtained after a single IV (2.5 mg / kg) administration of NKp46-BCMA_Fc-ADE-DSB NKCE to female huFcRn tg32 mice are reported in Table 8 below, and the corresponding mean and individual plasma concentration versus time profiles are shown in Figures 18 and 19, respectively.

[0364] [Table 8]

[0365] The mean and individual values ​​(N=3) of the pharmacokinetic parameters of NKp46-BCMA_Fc-ADE-DSB NKCE in plasma following a single intravenous dose (2.5 mg / kg) of NKp46-BCMA_Fc-ADE-DSB NKCE are shown in Table 9 below.

[0366] [Table 9]

[0367] Following a 2.5 mg / kg intravenous dose, NKp46-BCMA_Fc-ADE-DSB NKCE concentrations were quantifiable in plasma for up to 28 days (last sampling time), with an estimated plasma clearance of 6.4 ± 0.546 mL / day / kg and a steady-state volume of distribution of 121 ± 9.82 mL / kg, resulting in a terminal elimination half-life (t1 / 2) of approximately 14 days.

[0368] Example 9: NKp46-BCMA Fc WT CODV-OL1 exhibits potent anti-tumor activity in a dose-responsive manner, demonstrating better activity by co-engaging both CD16 and NKp46 on NK cells. Introduction The efficacy of NKp46-BCMA Fc WT CODV-OL1 was evaluated in huNKp46-Tg x Rag mice transplanted with disseminated murine EL4 cells expressing human BCMA. The IgG1-competent Fc domain can bind to all activating murine FcγRs, recruit murine effector cells, and induce ADCC with murine NK cells.

[0369] Materials and Methods On day 0, mice were treated with 0.5 × 10 6 Tumor cells were inoculated intravenously. Treatment was administered IP on day 1 after tumor implantation. The following control antibodies were administered at 5 mg / kg: NKp46-CD16-X Fc WT, which binds to huNKp46 and mouse FcγR but not huBCMA; NKp46-X-BCMA with the LALA Fc mutation, which binds to huNKp46 and BCMA but inhibits binding to mouse FcγR and recruitment of mouse effector cells via CD16; and X-CD16-BCMA, which binds to huBCMA and mouse FcγR but not huNKp46. NKp46-BCMA Fc WT CODV-OL1 was administered at 5, 0.5, and 0.05 mg / kg. The control group was left untreated.

[0370] Mice were checked daily for any adverse clinical reactions. Individual mice were weighed daily until the end of the experiment (day 60). Mice were euthanized when moribund according to predefined criteria to avoid animal suffering. Clinical signs associated with pathology considered serious included limb paralysis, ascites, palpable internal tumor masses, and morbidity or weight loss of 20% or more. The primary efficacy endpoints were median survival time (MST) in days, percent increased life expectancy (%ILS), and long-term survival. The individual date of death (if any) for each mouse was reported. MST was determined for each group and the proportion ILS was calculated and expressed as a percentage: %ILS = 100 × (TC) / C where T = MST of the treatment group and C = MST of the control group.

[0371] A dose is considered therapeutically active if the %ILS is better than 25% and highly active if the %ILS is better than 50% (Johnson JI et al. (2001) Br J Cancer 84(10):1424-1431). NCI Relationship between drug activity in preclinical in vitro and in vivo models and early clinical trials. Id.

[0372] Long-term survival is defined as the number of mice with a survival time greater than or equal to twice the MST of the control group relative to the total number of mice in the group expressed as a percentage.

[0373] result The results are shown in Figure 20 and Table 10.

[0374] NKp46-BCMA Fc WT NKCE induced statistically significant activity in the EL4-huBCMA disseminated model at doses of 5, 0.5, and 0.05 mg / kg, with ILS compared to controls of 215% and 57% of long-term survivors at the 5 dose, 215% and 62.5% of long-term survivors at the 0.5 dose, and 132% and 12.5% ​​of long-term survivors at the 0.25 mg / kg dose.

[0375] Control X-CD16-BCMA NKCE induced statistically significant activity at a dose of 5 mg / kg in the EL4-huBCMA disseminated model with ILS of 147% and 28.6% of long-term survivors, whereas control NKp46-X-BCMA NKCE did not induce significant activity at a dose of 5 mg / kg with an ILS of 84% and no long-term survivors.

[0376] In conclusion, NKp46-BCMA CODV-OL1 NKCE demonstrated dose-dependent activity with robust activity from 0.05 mg / kg, and activity compared with NKp46-X-BCMA and X-CD16-BCMA NKCE controls, demonstrating the benefit of co-engaging NK cells with both NKp46 and FcγR to improve in vivo efficacy.

[0377] [Table 10]

[0378] Example 10: ADCC-enhanced NKCE shows clear advantages in vivo compared to Fc WT NKCE. Introduction The efficacy of the surrogate muNKp46-huBCMA Fc WT and Fc-ADE CODV-OL1 was evaluated in huFcgR-Tg mice transplanted with disseminated murine EL4 cells expressing human BCMA. huFcgR-Tg mice were generated by the Rockefeller Institute (Smith P et al. (2012) PNAS, 109(16):6181-6186), and these mice express all five human Fc gamma receptors. The ADE mutation enhances the affinity of the Fc receptor for the human FcgRIIIA receptor expressed by NK cells, but not for the mouse ortholog, FcgRIV. huFcgR-Tg mice were used to evaluate the potential enhanced activity of ADE against WT NKCs. The control surrogate contains an IgG1-competent Fc domain.

[0379] Materials and Methods On day 0, mice were injected with 5 × 106 Tumor cells were inoculated intravenously. Treatments were administered IP on day 1 after tumor implantation. A control antibody that binds muNKp46, but not huBCMA (muNKp46-X), was administered at 5 mg / kg. muNKp46-BCMA Fc WT and Fc-ADE CODV-OL1 were administered at 5, 0.5, and 0.05 mg / kg.

[0380] Mice were checked daily for any adverse clinical reactions. Individual mice were weighed daily until the end of the experiment (day 60). Mice were euthanized when moribund according to predefined criteria to avoid animal suffering. Clinical signs associated with pathology considered serious included limb paralysis, ascites, palpable internal tumor masses, and morbidity or weight loss of 20% or more.

[0381] The primary efficacy endpoints were median survival time (MST) in days, percent increased life expectancy (%ILS), and long-term survival.

[0382] The individual date of death (if any) for each mouse was reported. MST was determined for each group and the proportion ILS was calculated and expressed as a percentage: %ILS = 100 × (TC) / C where T = MST of the treatment group and C = MST of the control group.

[0383] A dose is considered therapeutically active if the %ILS is greater than 25% and highly active if the %ILS is greater than 50% (Johnson JI et al. (2001), Br. J. Cancer, 84(10):1424-31).

[0384] Long-term survival is defined as the number of mice with a survival time greater than or equal to twice the MST of the control group relative to the total number of mice in the group expressed as a percentage.

[0385] result The results are shown in FIG. 21 and Table 11.

[0386] Surrogate muNKp46-huBCMA Fc WT NKCE did not induce statistically significant activity in the EL4-huBCMA disseminated model at doses of 5, 0.5, and 0.05 mg / kg (compared to the control NKCE group). In contrast, surrogate muNKp46-huBCMA Fc ADE NKCE induced statistically significant activity at doses of 5 mg / kg and 0.5 mg / kg, with ILS of 100% and over 90% of long-term survivors. The lower dose of 0.05 mg / kg did not induce statistically significant activity.

[0387] In conclusion, the muNKp46-huBCMA Fc ADE surrogate NKCE demonstrated better activity than the WT Fc surrogate in a dose-dependent manner.

[0388] [Table 11]

[0389] Example 11: Chemical stability / integrity of the disulfide bond R292C_V302C in the NKp46-BCMA CODV-OL1 molecule under reducing conditions Introduction Engineering a disulfide bond (DSB) on the Fc CH2 domain enhances stability. See U.S. Provisional Patent Application No. 63 / 193,665, incorporated herein by reference in its entirety. To ensure that the engineered DSBs, R292C_V302C and ADE mutations (G236A / S239D / I332E) in the NKp46-BCMA CODV-OL1 molecule do not aberrantly affect DSB reduction behavior, reduction rates were measured by DTT followed by tryptic peptide mapping.

[0390] Materials and Methods Reduction sensitivity assay Serial dilutions of DTT in PBS-E were performed (final DTT concentrations in the assay: 20, 10, 5, 2, 1, 0.5, 0.2, and 0.1 mM). Protein batches FF-20-819-1, FF-20-821-1, and FF-21-170-5 were dialyzed into PBS-E buffer using spin desalting columns to ensure a pH of 7.2 during reduction. Protein samples were normalized to 1.5 mg / mL in PBS-E. Two portions of the normalized sample were added to each portion of the DTT dilution solution in the PCR plate, followed by mixing. This process was performed within 1 minute, from the lowest to the highest DTT concentration. Reduction was performed by incubation at 25°C for 10 minutes on a Thermostat C thermoblock. The reaction was quenched by adding three portions of NEM stock solution to all wells. To ensure assay consistency, NEM additions were performed within 1 minute, from the lowest to the highest DTT concentration, followed by mixing. The prepared plates were stored at room temperature until measurement by capillary gel electrophoresis (cGE) and mass spectrometry (peptide mapping). Tables 12 and 13 below contain lists of reagents and materials for the reduction-sensitive assay and capillary gel electrophoresis, respectively.

[0391] [Table 12]

[0392] [Table 13]

[0393] After performing the reduction-sensitive assay, samples were measured using the non-reducing protocol of the Protein Clear HR assay according to the manufacturer's instructions.

[0394] To prepare the chip, all assay components were equilibrated to room temperature. Protein Clear HR Gel matrix was mixed with Protein Clear HR Dye solution, filtered, and then added to the rinsed chip wells according to the manufacturer's instructions.

[0395] The provided assay control VeriMAb standard was diluted in non-reducing sample buffer, denatured at 70°C for 10 minutes, mixed with water according to the manufacturer's instructions, and placed in the LabChip GXII Touch instrument for assay calibration. After diluting the Protein Clear HR Ladder 1:10 in water, the indicated volumes of ladder solution and Protein Clear HR Wash buffer were transferred to the corresponding tubes and placed in the LabChip GXII Touch instrument. The calibration process was successfully completed before running the samples.

[0396] To prepare samples, 5 μL of each sample from the reduction-sensitive assay was added to 18 μL of non-reducing sample buffer in a PCR plate, which was then sealed. The samples were denatured at 70°C for 10 minutes on a Thermostat C Thermoblock. After denaturation, the samples were diluted with 35 μL of water. The prepared assay plates were stored at room temperature until run on the LabChip GXII Touch instrument.

[0397] After the measurements, the data were analyzed using LabChip Reviewer Software. All peaks with a relative peak area of ​​0.85% or greater were integrated. The relative peak area [%] of the remaining intact molecules was plotted against the DTT concentration, and the curve was fitted by a four-parameter logistic / sigmoidal dose-response model (Xlfit, one part of the dose-response, model 205). The area of ​​the sample without added DTT was used for normalization and set to 100%. The DTT concentration of each sample at which 50% of the intact molecules remained was used as the EC50 value to assess the sensitivity of the molecules to reduction.

[0398] Antibody sample preparation after reduction assay for tryptic peptide mapping experiments After performing the reduction sensitivity assay, the samples were subjected to the digestion procedure. 100 μg of antibody per sample was denatured by buffer exchange with a 0.5 mL Zeba Spin Desalting Column (Thermo Fisher Scientific, Catalog No. 89883) using 0.2 mol / L histidine chloride, 5.6 mmol / L guanidinium hydrochloride, pH 6. The buffer exchange was repeated once to ensure complete removal of NEM. The samples were then reduced by adding 10 mmol / L TCEP (tris(2-carboxyethyl)phosphine, Thermo Fisher Scientific, Catalog No. T2556) for 1 hour at 37°C. The buffer was then exchanged into 20 mmol / L histidine chloride, 0.5 mmol / L TCEP, pH 6, using 0.5 mL Zeba Spin Desalting Columns (Thermo Fisher Scientific, Catalog No. 89883). The antibodies were digested with trypsin at an enzyme to substrate ratio of 1:20 overnight at 37° C. The digestion was stopped by adding 7 μL of 10% formic acid solution, and the samples were frozen at −80° C. until further analysis.

[0399] Detection of modified peptides by liquid chromatography tandem mass spectrometry Peptides were analyzed using a Vanquish™ Flex UHPLC system coupled to an orbitrap Fusion™ Lumos™ Tribrid™ mass spectrometer equipped with an EASY-ETD ion source (Thermo Fisher Scientific, San Jose, CA, USA). For peptide separation, a binary solvent system was used: (A) 0.1% formic acid and (B) 90% acetonitrile, 0.1% formic acid. Two micrograms of trypsin-digested sample was separated in a 50-minute gradient using a linearly increasing concentration of solvent B, followed by a 5-minute wash at 95% B and a 5-minute re-equilibration to 5% solvent B on a Hypersil GOLD™ C18 LC column (150 mm x 2.1 mm, 1.9 μm particle size, Thermo Fisher Scientific, catalog number 25003-152130-V). Peptides separated on the column were detected using the following key settings: a mass range of 375–2000, an automatic gain control (AGC) target of 4.0e5, a maximum injection time of 50 ms, and a 1 μm scan to acquire full MS spectra at a resolution of 120,000 (defined at 200 m / z). After accumulating 5.0e4 AGC targets within a 200 ms injection time, data-dependent (MS / MS) spectra were acquired in the top 5 data-dependent mode using a resolving power of 15,000 (defined at 200 m / z). Ions were isolated with a 1.6 Th isolation window and fragmented using HCD, EthcD, or EtciD at 30% normalized collision energy. Dynamic exclusion was set to 10 s.

[0400] Data Processing The acquired MS data were processed using Expressionist software (GeneData version 13.5) and manually inspected to ensure accurate assignment and relative quantification accuracy. Mass spectra were searched against the amino acid sequence of the sample molecules. Important settings were the mass tolerances for MS and MS / MS spectra, which were set to 10 ppm, respectively. Post-translational modifications considered within the search parameters were NEM modifications on cysteines and general N-terminal glycosylation using the IgG N-glycan library from Expressionist.

[0401] result EC50 values ​​were calculated from the dose-response curves shown in Figure 22. The reduction of the main peak of the non-reduced sample by DTT, as measured by capillary electrophoresis (cGE), was identical for CODV-OL1 wt, CODV-OL1 ADE, and CODV-OL1 ADE-DSB, indicating that neither the ADE mutation nor the engineered disulfide bond in the CH2 domain affected the reduction sensitivity of the protein.

[0402] Proteins from the reduction-sensitivity assay, CODV-OL1 wt, CODV-OL1 ADE, and CODV-OL1 ADE-DSB, analyzed by peptide mapping, exhibit similar reduction behavior of reduction-sensitive intermolecular disulfide bonds (DSBs), as shown in Figure 23A (CODV-OL1 wt), Figure 23B (CODV-OL1 ADE), and Figure 23C (CODV-OL1 ADE-DSB). Based on dose-response curves, EC50 values ​​were estimated to be in the range of 1.2–1.5 mM DTT for the three proteins, indicating that the engineered DSBs are reduction-stable, similar to typical intermolecular DSBs.

[0403] CODV-OL1 wt, CODV-OL1 ADE, and CODV-OL1 ADE-DSB-expression yields The antibodies were generated as follows: Expression plasmids encoding the different strands of the corresponding constructs were propagated in Escherichia coli DH5a. Plasmids used for transfection were prepared from E. coli using the EndoFree Plasmid Mega kit (Qiagen). HEK 293-FS cells growing in F17 serum-free suspension culture (Invitrogen) were transfected with the indicated plasmids using polyethylenimine transfection reagent. After 6 days of incubation at 37°C with 8% CO2, cells were removed by centrifugation, and the supernatant was passed through a 0.22 μm filter to remove particles. Proteins were captured with MabSelect SuRe (Cytiva), eluted with 0.1 M citrate buffer pH 3.0, and neutralized with 1 M Tris pH 9. After protein polishing by size exclusion chromatography (SEC) using Superdex200 26 / 60 (Cytiva) and 0.22 μm filtration and UV280 concentration determination, the proteins were used for further characterization. Yields are reported in Table 14 below.

[0404] [Table 14]

[0405] The antibody with a normal IgG1 Fc backbone demonstrated a sample yield of 25.2 mg / L, while the antibodies with ADE or DE mutations in the Fc backbone showed a strong decrease in sample yield of less than 5 mg / L. The antibodies with IgG1 Fc and disulfide bonds with ADE or DE mutations demonstrated sample yields similar to WT.

[0406] Example 12: In vitro cytokine release in PBMCs upon co-culture of BCMA-positive RPMI 8226 MM tumor cells with NKp46-BCMA_Fc-ADE-DSB Materials and Methods IncuCyte S3 in vitro safety procedure (PBMC + MM 1R-RFP, effector:target ratio = 3:1) One day after PBMC purification, both PBMCs and MM1R-RFP were counted in a Vi-Cell XR (Beckman Coulter, Brea).

[0407] Target cells: The MM1R cell line was purchased from ATCC / Northwestern University BDW and transfected with Incucyte Nuclight Red lentivirus (EssenBiosciences, ref. 4476) to express mKate2 Red Fluorescent Protein (RFP), which could be tracked over several days using an Incucyte incubator. Selection of MM1R-RFP cells was achieved by the addition of puromycin dichloride hydrate (Thermo Scientific, Denmark, Reference No. 10781691) at a final concentration of 1 μg / ml in the culture medium [RPMI medium 1640 (1x) (GIBCO, Denmark, Reference No. 31870-025) containing 20% ​​heat-inactivated fetal bovine serum (FBS) (Biowest, Reference No. S140H-100) and 1% L-glutamine 200 mM (100x) (GIBCO, Denmark, Reference No. 25030-024)].

[0408] Since MM1R-RFP cells are semi-adherent cells, remove the culture medium and culture them in a 75cm Nunc EasyY flask. 2 (Thermo Scientific, Denmark) was placed in a 50 ml Falcon tube with 5 ml of PBS 1x, which was used to wash the cells. 1 ml / 75 cm 2 The remaining adherent cells were detached by adding Accutase Cell Detachment Solution (Corning, ref. 25-058-CI) to the flask. The action of Accutase was stopped after 5 min at 37°C with 9 ml of culture medium (RPMI + 20% FBS, final volume 10 ml), and MM1R-RFP cells were counted in a Vi-Cell XR. The appropriate number of cells was prepared and seeded at a density of 30,000 cells / well (50 μl / well) with an E:T ratio of 3:1.

[0409] Antibodies: All Abs were prepared at 2x concentrations in RPMI culture medium (50 μl target cells + 100 μl Ab 2X + 50 μl PBMCs were added to each well). Antibodies used in the experiments were diluted 1 / 100 with medium in deepwell plates (Axigen, ref. P-DW-11-CS). The starting concentration of all Abs was 1000 nM (calculated to be approximately 2000 nM) and triplicate dilutions were performed, except for the CD3-BCMA T cell engager, which had an initial concentration of 100 nM (approximately 200 nM).

[0410] Effector cells: Total PBMCs were prepared at a density of 300,000 cells / well (50 μl / well) (E:T ratio 3:1). After counting, the required number of PBMCs was centrifuged at 300 g for 5 min (acceleration = 9, brake = 9) and resuspended in an appropriate volume of RPMI culture medium containing human IgG (Sigma-Aldrich, ref. I4506) at a concentration of 4 mg / ml to a final concentration of 1 mg / ml in a final volume of 200 μl / well: [50 μl MM1 R-RFP + 100 μl antibody (2x) + 50 μl PBMCs].

[0411] Cells were seeded in 96-well plates with polyD (Greiner bio-one, ref. 655946) and the outer wells were filled with 200 μl of PBS 1x.

[0412] After seeding tumor cells (50 μl / well) + Ab (100 μl / well) + PBMC (50 μl / well), the plates were centrifuged at 100 g for 1 min at room temperature and placed in an IncuCyte S3 (Essen BioScience) incubator, but plates were read only after at least 30 min to avoid temperature differences.

[0413] Plates were read on an Incucyte S3 using the following parameters: analysis type (Basic Analyzer), RED, objective 10x, 4 images / well, time point 48 hours (images every 4 hours), acquisition time 400ms.

[0414] After 48 hours, the Incucyte scanner was stopped and the plates were centrifuged at 300 g for 5 minutes, then 100 μl of supernatant per well was taken for analysis of cytokine release using the Human Proinflammatory I (4-Plex) Kit V-Plex.

[0415] Procedure for Analysis of Cytokine Release with the Human Proinflammatory I(4-Plex) Kit V-Plex For the analysis of cytokine release, the Human Proinflammatory I (4-Plex) Kit V-Plex was used (MSD, reference number K15052D-1).

[0416] First, a control range was prepared: a lyophilized tube was reconstituted with 1000 μl of Diluent 2 (calibrator, reference number C0049-2) and left to stand for 30 minutes. Seven serial dilutions of 1 / 4 were made in Diluent 2 (i.e., 75 μl of Cx + 225 μl of Diluent 2). The last tube n8 was considered as a negative control (Diluent 2 alone = 0), while tube n. 1 was left undiluted as the starting solution.

[0417] Samples were then prepared at a dilution of 1 / 100 for DART (i.e., 50 μl / well, prepare 5 μl DART / concentration + 495 μl Diluent 2) and 1 / 5 for other antibodies (i.e., prepare 50 μl / well, 100 μl Ab / concentration + 400 μl Diluent 2).

[0418] Secondary antibodies were prepared in diluent 3: 100 μl IFNγ + 100 μl IL1β + 100 μl IL6 + 100 μl TNFα + 4600 μl diluent 3 (final volume 5 ml), then 25 μl of the secondary Ab mix was distributed to all wells.

[0419] Before adding the samples to the plate, the plate was washed three times with 150 μl of PBS 1X tween 0.05% (wash buffer prepared with 500 μl of Tween 20 in 1 L of PBS 1X). Then, 50 μl / well of the diluted sample to be tested and 50 μl / well of the standard range were added. The plate was covered with film and left at room temperature with agitation for 2 hours.

[0420] The plate was washed three times with 150 μl of wash buffer, 25 μl of secondary Ab was added to the sample (the plate was tapped for better distribution of the secondary Ab), the plate was again covered with film and left for 2 hours at room temperature with agitation. Three wash steps with 150 μl of wash buffer were performed, and 150 μl of read buffer was added to all wells (read buffer prepared by 1 / 2 dilution in HO (4x)). The plate was read on an MSD 1250 instrument.

[0421] result As shown in Figures 24A and 24B, NKp46-BCMA_Fc-ADE-DSB mediated potent cytotoxicity of BCMA-expressing cells, but minimal cytokine release from PBMCs in coculture. As shown in Figures 25A and 25B, NKp46-BCMA_Fc-ADE-DSB also mediated reduced MM1R tumor cell proliferation while inducing minimal cytokine release. Reduced cytokine release in vitro indicates a favorable safety profile.

[0422] Example 13. In vitro characterization of NKCE on NK cell activation and cytokine / chemokine production by resting NK cells in the presence of MM cells. This example is directed to characterizing the in vitro efficacy of NKp46-BCMA_Fc-ADE-DSB on NK cell activation and cytokine / chemokine production in the presence of a BCMA-positive cell line (RPMI 8226 multiple myeloma cells).

[0423] Materials and Methods Peripheral blood mononuclear cells: To isolate peripheral blood mononuclear cells (PBMCs), the buffy coat was diluted approximately 1 / 5 with RPMI and transferred to a room temperature Pancoll tube. The tube was centrifuged at 800 g for 20 minutes without the brake. A first cell wash was performed in RPMI using centrifugation at 400 g for 10 minutes with the brake at room temperature. A second cell wash was performed in RPMI using centrifugation at 130 g for 10 minutes with the brake at room temperature.

[0424] NK cell harvest: Human NK cells were purified from PBMC samples using an NK cell isolation kit (Miltenyi) by negative selection with manual magnetic labeling followed by manual separation on an LS column according to the protocol recommended by the supplier. NK cells were then cultured at 37±1°C, 5±1% CO2 for approximately 24 hours at 1×10 for 1 hour before use in activation assays. 6 cells / mL in complete RPMI (so-called "resting" NK cells).

[0425] The survival criterion for effector cells was set at 90% or higher. Cell surface expression of both CD16a and NKp46 on resting NK cells was monitored by flow cytometry on the day of the experiment.

[0426] NK cell activation assay NKCE molecules were added to wells of a U-bottom 96-well plate. 50,000 resting (e.g., unactivated) NK cells and 50,000 RPMI 8226 MM cells were added sequentially to each well to obtain a 1:1 effector:target (E:T) ratio. Control conditions were performed by adding 50,000 resting NK cells alone to each well. GolgiStop™ (BD Biosciences) solution was added to each well (control and experimental) at a final dilution of 1 / 1500 to block extracellular protein transport and allow cytokine accumulation in the Golgi complex. Positive controls for NK cell activation were performed using phorbol 12-myristate 13-acetate (PMA) at a final concentration of 125 ng / mL and ionomycin at a final concentration of 1 μg / mL added to 50,000 resting NK cells. Each condition was performed in duplicate.

[0427] After 4 hours of co-incubation at 37±1°C, cells were stained for extracellular markers (CD3, CD56, CD69, CD107a, and CD107b) for flow cytometry analysis. After fixation and permeabilization, intracellular staining for IFNγ, TNFα, and MIP1β was performed. Cells were fixed 15 minutes after the final staining using Cytofix (BD Biosciences) and analyzed by flow cytometry using an LSR Fortessa™ X-20. FSC-A, FSC-H, FSC-W, SSC-A, SSC-H, SSC-W, FL-1, FL-3, FL-6, FL-7, FL-9, FL-13, and FL-16 parameters were recorded using BD FACSDiva software, and analysis was performed using FlowJo software.

[0428] Analysis of the percentage of NK cell activation and the median fluorescence intensity (MedFI) of activation markers was performed using GraphPad Prism. The highest activation value corresponded to the maximum activation observed. The half-maximal effective concentration (EC 50 ) values ​​were calculated using a four-parameter logistic nonlinear regression model corresponding to the following equation:

number

[0429] EC 50 The same model was used to calculate the bottom calculation of activation, the top calculation of activation, the slope and 95% confidence interval (CI) values.

[0430] Flow cytometric analysis of resting NK cell and target cell purity and phenotype Resting NK cells used in NK cell activation experiments were analyzed for purity, expression of CD16a, and NKp46. RPMI 8226 MM cells were analyzed for expression of CD32 and BCMA.

[0431] On the day of the experiment, resting NK cells and target cells were stained. 5 Cells / well were stained in U-bottom 96-well plates with dye-conjugated antibodies (allophycocyanin, Pacific Blue, or phycoerythrin).

[0432] result; NK cell activation was assessed by: 1) expression of activation markers (CD69 and CD107a / b) on the cell surface, and 2) intracellular production of cytokines (IFNγ, TNFα) and chemokines (MIP1β). Seven NK cell donors were evaluated in the study.

[0433] As shown in Figures 26A-26D, in the absence of RPMI 8226 MM cells, the positive control PMA-ionomycin activated NK cells by inducing the expression of CD69 and CD107a / b. In contrast, NKp46-BCMA_Fc-ADE-DSB and control NKCE induced a non-sigmoidal dose-response activation from 4.88 ng / mL, reaching a maximum concentration (4.88 μg / mL) of approximately 40% of CD69-positive cells (CD69 MedFI around 150) and 14% of CD107-positive cells (CD107 MedFI around 90).

[0434] In the presence of RPMI 8226 MM cells, NK cells were not activated in the absence of the molecule. Addition of control NKCE induced a low level of NK cell activation, similar to that obtained in the absence of target cells. Addition of NKp46-BCMA_Fc-ADE-DSB induced a sigmoidal dose response for NK cell activation, which was higher than that obtained with control NKCE. More precisely, a saturation phase was observed for approximately 48.8 ng / mL of NKp46-BCMA_Fc-ADE-DSB for CD69 expression (approximately 60% of positive cells and a MedFI of 351 on NK cells) and CD107a / b expression (approximately 22% of positive cells and a MedFI of 132 on NK cells) (Table 15).

[0435] [Table 15]

[0436] A saturation phase and sigmoidal dose response was obtained for NKp46-BCMA_Fc-ADE-DSB for CD69 expression, and EC 50 were extracted from seven selected donors (Table 16). Considering the level of CD107a / b production (approximately 20% or less of positive cells for three of the seven donors), EC 50 was not estimated.

[0437] [Table 16]

[0438] Secretion of IFNγ, TNFα, and MIP1β by NK cells In the same experiments, production of intracellular cytokines (IFNγ and TNFα) and the chemokine MIP1β by NK cells was measured. The release of TNFα, IFNγ, and MIP1β was proportional to NK cell activation: higher NK cell activation resulted in higher cytokine / chemokine production (Figures 27A-F).

[0439] In the absence of RPMI 8226 MM cells and NKp46-BCMA_Fc-ADE-DSB, no detectable TNFα or IFNγ was produced by NK cells, whereas MIP1β was produced by approximately 80% of NK cells. Addition of a positive control (PMA-ionomycin) induced NK cell production of TNFα (approximately 84% for D584), IFNγ (approximately 83% for D584), and increased MIP1β (approximately 100% for D584). In contrast, addition of NKp46-BCMA_Fc-ADE-DSB induced very low target-dependent expression of IFNγ and TNFα in a dose-dependent manner, with the highest observed activation of less than 20% of cells (8 ± 5% for IFNγ and 12 ± 7% for TNFα). MIP1β was produced by NK cells at 4.88 ng / mL, reaching approximately 95% positive cells (approximately 5400 MIP1β MedFI on NK cells) in a dose response of the two molecules.

[0440] The results showed that the presence of RPMI 8226 MM cells alone was not sufficient to induce cytokine secretion by NK cells in the absence of NKCE molecules. Addition of high concentrations of control NKCE molecules induced low or very low cytokine production by NK cells and high production of MIP1β with a sigmoidal dose response. Addition of NKp46-BCMA_Fc-ADE-DSB induced cytokine and chemokine production. For the three cytokines / chemokines, maximum levels of production were achieved at concentrations ranging from 4.88 to 48.8 ng / mL of NKp46-BCMA_Fc-ADE-DSB, depending on the donor. For the seven donors tested, the percentage of NK cells producing TNFα or IFNγ was approximately 12±7 (TNFα MedFI on NK cells: 39±7) and 8±5 (IFNγ MedFI on NK cells: 137±30), respectively, and the percentage of NK cells producing MIP1β was approximately 94±2 (MIPβ MedFI on NK cells: 10145±4416) at the highest NKp46-BCMA_Fc-ADE-DSB concentration (Table 17).

[0441] Since a saturation phase and sigmoidal dose response was obtained for NKp46-BCMA_Fc-ADE-DSB for TNFα, IFNγ, and MIP1β production, the top values ​​of activation (TNFα, IFNγ, and MIP1β) and EC values ​​observed for MIP1β from the seven test donors were 50 Considering the level of TNFα and IFNγ production (less than 20% of positive cells), the EC 50 was not estimated (Table 18).

[0442] [Table 17]

[0443] [Table 18]

[0444] Example 14: In vitro cytokine release analysis of NKp46-BCMA_Fc-ADE-DSB using co-cultured human donor whole blood cells and RPMI (multiple myeloma) cell line Introduction To assess the variability / range of responses observed in this assay, whole blood cells from 11 human donors were co-cultured with RPMI-8226-RFP cells treated with either NKp46-BCMA_Fc-ADE-DSB or a negative or positive control. Co-cultures were incubated overnight at 37°C with 1, 10, 100, and 300 μg / mL NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or the negative or positive controls detailed in the Materials and Methods section below. Treatment control groups included two negative controls (untreated co-culture and co-culture treated with isotype control 300 μg / mL) and three positive controls: human anti-CD3 / CD28 T cell activator (25 μg / mL; ImmunoCult™), anti-CD52 recombinant antibody (alemtuzumab 100 μg / mL; Campath-1H®), and internal BCMA T cell engager tool compound (TCE-BCMA 100 μg / mL).

[0445] Materials and Methods RPMI 8226 cell line was obtained from ATCC (American Type Culture Collection, USA) and transfected with red fluorescent protein (RFP). The modified RPMI 8226-RFP cells were cultured in RPMI 1640 medium (Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin (10,000 U / mL) at 37°C in a humidified atmosphere of 5% CO.

[0446] On the day of the cytokine release assay, cells were counted and assessed for viability using a Cellometer (Nexelcom, Lawrence, MA, USA). RPMI-8226-RFP cells were adjusted to a concentration of 800,000 cells / mL, and 25 μL of cells were seeded per well into a 96-well tissue culture plate (Thermo Fisher Scientific, Inc.) at a final density of 20,000 cells / well.

[0447] NKp46-BCMA_Fc-ADE-DSB and controls were dissolved in RPMI 1640 medium, GlutaMax (Thermo Fisher Scientific, Inc.), supplemented with 10% w / v fetal bovine serum and 1% penicillin-streptomycin (10,000 U / mL). 25 μL of NKp46-BCMA_Fc-ADE-DSB and controls were added in triplicate per well. Negative controls were medium alone and an isotype control at a final concentration of 300 μg / mL. Positive controls with the respective concentrations are listed above and also labeled in Figures 28-32.

[0448] Whole blood from 11 consenting donors was venipunctured into 10 mL vacutainer tubes containing sodium-heparin anticoagulant. Samples were gently mixed and maintained under ambient conditions until the start of the study. After RPMI-8226-RFP cells were added to either the NKp46-BCMA_Fc-ADE-DSB or treatment control groups, fresh whole blood samples (200 μL) from the donors were added to the wells, and the plates were incubated at +37°C in a humidified atmosphere of 5% CO2 for 24 hours.

[0449] At the end of the incubation period, the plates were centrifuged at 500 × g for 10 minutes. Plasma was collected from these plates and then transferred directly to a new 96-well cell culture plate, which was then centrifuged at 2000 × g for 10 minutes to remove any remaining cellular debris. The final plasma sample was transferred to a new 96-well culture plate for immediate assessment of cytokine levels.

[0450] The MSD U-PLEX assay (catalog no. K15067L-2; lot no. 404471) was used according to the manufacturer's instructions (Mesoscale Discovery, Rockville, Maryland, USA) to measure the following antibodies: granulocyte-macrophage colony-stimulating factor (GM-CSF; quantitative range 0.33–10,200 pg / mL), interferon gamma (IFN-γ; quantitative range 9.45–27,000 pg / mL), interleukin-1 beta (IL-1β; quantitative range 0.35–4430 pg / mL), interleukin-2 (IL-2; quantitative range 1.24–1990 pg / mL), and interleukin-4 (IL-4; quantitative range 0.35–4430 pg / mL). Plasma samples were evaluated for levels of IL-16 (IL-16; quantification range 0.89-2,050 pg / mL), interleukin-6 (IL-6; quantification range 0.89-2,050 pg / mL), interleukin-8 (IL-8; quantification range 0.35-2,180 pg / mL), interleukin-10 (IL-10; quantification range 0.35-3,770 pg / mL), macrophage inflammatory protein 1 alpha (MIP-1α; quantification range 14.5-5,580 pg / mL), and tumor necrosis factor alpha (TNF-α; quantification range 0.66-2,940 pg / mL).

[0451] Cytokine levels were calculated by multiplying the signal from the calibration standard by 1 / Y 2 Calibration curves for each cytokine were defined by fitting a four-parameter logistic or sigmoidal dose-response model with weighting of . Calculations to determine cytokine concentrations were performed using MSD DISCOVERY WORKBENCH analysis version 4.0 (Mesoscale Discovery, Rockville, Maryland, USA), and concentrations were expressed in pg / mL.

[0452] Cytokine data (triplicates) were analyzed, and the coefficient of variation (%CV) among triplicates was calculated using GraphPad Prism software, version 9.1.2 (GraphPad Software, San Diego, CA, USA). A sigmoidal dose-response, four-parameter, variable slope calculation with the bottom constraint set to 0 was used for the analysis. Samples where technical error occurred and nothing was detected were reported as not detected (UD). Samples with concentrations below the lower limit of quantification (LLOQ) were reported as the LLOQ, and this value was used for all calculations. Samples with concentrations above the upper limit of quantification (ULOQ) were reported as the resulting extrapolated value, and this value was used for all calculations. Fold changes in cytokine levels were calculated for each treated sample compared to the negative control (untreated coculture) [overall mean (with SD) and median (Q1 and Q3: first and third quartiles)].

[0453] result As shown in Figures 28-32, the positive controls, anti-CD3 / CD28 and TCE-BCMA, demonstrate a strong increase in cytokine release for IFN-γ (Figure 28A), MIP-1α (Figure 28B), TNF-α (Figure 29A), IL-1β (Figure 29B), IL-6 (Figure 30A), IL-8 (Figure 30B), IL-2 (Figure 31A), GM-CSF (Figure 31B), IL-4 (Figure 32A), and IL-10 (Figure 32B) when compared to the negative controls (untreated and isotype control). The positive control, anti-CD52, induced cytokine release of IFN-γ (Figure 28A), IL-6 (Figure 30A), MIP-1α (Figure 28B), IL-1β (Figure 29B), and IL-8 (Figure 30B), but not cytokines typically associated with T cell responses, such as IL-2 (Figure 28A), IL-10 (Figure 31A), GM-CSF (Figure 31B), or IL-4 (Figure 32A). In contrast, NKp46-BCMA_Fc-ADE-DSB induced secretion of only IFN-γ (Figure 28A) and MIP-1α (Figure 28B), with no reported changes in all other cytokines evaluated.

[0454] When compared to untreated whole blood and RPMI 8226-RFP cocultures (negative controls), there was a clear NKp46-BCMA_Fc-ADE-DSB-associated increase in IFN-γ and MIP-1α across donors at all concentrations tested (1, 10, 100, and 300 μg / mL). IFN-γ levels in samples incubated with NKp46-BCMA_Fc-ADE-DSB (at all tested concentrations) (Figure 28A) were higher (3- to 6-fold) than the negative control but much lower than the positive control. There was no NKp46-BCMA_Fc-ADE-DSB-associated concentration dependence for IFN-γ increases; levels were comparable to the isotype control, suggesting that IFN-γ secretion is related to NK cell engagement by NKp46-BCMA_Fc-ADE-DSB rather than related to BCMA binding activity. NKp46-BCMA_Fc-ADE-DSB-induced MIP-1α (Figure 28B) levels were slightly higher (1-3 fold) than the negative control, but significantly lower than the positive control. There was no difference in cytokine release profile between both NKp46-BCMA_Fc-ADE-DSB batches tested (CER and GMP).

[0455] Taken together, the results indicate that NKp46-BCMA_Fc-ADE-DSB results in humans and appears to be associated with a low risk of CRS. These results also support the results from the in vitro cytokine release assay (PBMC) shown in Example 12, supporting the conclusion that NKp46-BCMA_Fc-ADE-DSB has a favorable safety profile.

[0456] Example 15: Analysis of NK cell activation and MM cell lysis in response to NKp46 bispecific antibodies Introduction This example evaluated the ability of NKp46-BCMA_Fc-ADE-DSB to activate NK cells from MM peripheral blood and induce MM cell death. Karpas 620 MM as target cells were co-incubated with PBMCs from MM patients (n=13, Table 18) as effector cells in the presence of increasing concentrations of NKp46-BCMA_Fc-ADE-DSB, isotype control antibody (10 mg / ml), or daratumumab (10 mg / ml) at an E:T ratio of 10:1.

[0457] To this end, NKp46-BCMA_Fc-ADE-DSB was used to treat Karpas 620 MM cells co-incubated with PBMCs from MM patients at the time of MM diagnosis (N=2) or relapsed MM cases (N=11). Samples were analyzed by flow cytometry for MM cell death due to loss of CD138 expression. In parallel, NK cells (CD3) were analyzed by CD107a and IFNg expression. - CD56 dim ) activation was evaluated.

[0458] Materials and Methods (1) Cell purification and co-culture conditions. On the day before the MM cytolytic assay, PBMCs from MM patients isolated after density gradient centrifugation were immediately stained with CD3-PE and CD56-APC, and the results were analyzed using flow cytometry to determine the ratio of CD3- / CD56+ cells before NK activation. If NK cells represented more than 5% of lymphocytes, PBMCs were maintained overnight at 37°C and 5% CO2 in culture medium containing 10% FCS (Ferro-Chemicals for preserving NK cells). Resting PBMCs and MM target cell lines at a 10:1 ratio were co-cultured for 4 hours in the presence of the tested molecules. Then, (i) the expression of activation markers (CD107a) on NK cells and intracellular production of cytokines (IFNγ), and (ii) MM cell death (CD138) were analyzed by flow cytometry.

[0459] (2) Cell Preparation and Treatment and Control Conditions. 300,000 PBMCs and 30,000 MM target cells (Karpas 620) were harvested and counted into each well of a U-bottom 96-well plate to obtain an effector:target (E:T) cell ratio of 10:1. 400,000 PBMCs were kept in an incubator for minimal phenotyping of the patient's NK cells (CD56, CD3, CD16, NKp46). Cells were centrifuged at 300 g for 5 minutes, resuspended in medium containing BD GolgiSTOP™ solution (1 / 6000), and dispensed at 300,000 PBMCs and 30,000 MM cells per well. Control conditions were as follows: negative controls were untreated Karpas 620, PBMCs, and Karpas 620 + PBMCs. Positive controls for NK activation were PBMCs treated with 125 ng / ml Phorbol 12 myristate 13 acetate (PMA, Sigma, reference P8139) and 1 mg / ml ionomycin (Sigma, reference I0634). Treatment groups included isotype control (10 mg / ml) and NKp46-BCMA_Fc-ADE-DSB (10 mg / ml) added to the co-culture samples for 4 hours at 37 ± 1 °C and 5 ± 1% CO2. Prior to treatment, the antibodies were centrifuged at 16,000 × g for 10 minutes at +4 °C to remove potential aggregates.

[0460] (3) Staining and Flow Cytometry Analysis. After 4 hours of co-incubation at 37±1°C and 5±1% CO2, the cells were stained extracellularly or intracellularly for flow cytometry analysis. (3a) Extracellular Staining. The cells were transferred to a V-bottom plate, centrifuged at 1900×g for 1 minute, and the supernatant was discarded. The cells were washed with 200 μl of PBS and centrifuged again at 1900×g for 1 minute, and the supernatant was discarded. 50 μl of BD Pharmingen Stain Buffer BSA / Brilliant Stain buffer plus antibody master mix was added to each sample. The antibodies used for NK activation and MM cell death analysis are listed in Table 19 below. The cells were then incubated in the dark at 4°C for 20 minutes. Finally, the cells were washed with 200 μl of staining buffer, centrifuged at 1900×g for 1 minute, and the supernatant was discarded (twice). (3b) Intracellular Staining. Cells were resuspended in 100 ml of BD Cytofix / Cytoperm and incubated in the dark at 4°C for 20 minutes. Cells were washed twice with 200 μl of 1x BD Perm / Wash buffer (10x BD Perm / Wash buffer in distilled H2O), centrifuged at 1900 g for 1 minute, and the supernatant was discarded. Cells were resuspended in 50 μl of antibody master mix + BD Perm / Wash buffer and incubated in the dark at 4°C for 30 minutes. Cells were then washed twice with 200 μl of BD Perm / Wash buffer, centrifuged at 1900 g for 1 minute, and the supernatant was discarded. Finally, cells were resuspended in 200 μl of staining buffer and subjected to flow cytometry analysis. Prior to acquisition, UltraComp eBeads (Invitrogen) were stained with each antibody fluorophore to establish appropriate fluorescence compensation controls. Results were analyzed using a BD FACSymphony A5 and BD FACSDiva software. Analysis was performed using FlowJo software.

[0461] [Table 19]

[0462] result Karpas 620 MM cell death induced by NKp46-BCMA_Fc-ADE-DSB was first analyzed by measuring the loss of CD138 expression by flow cytometry. NKp46-BCMA_Fc-ADE-DSB demonstrated induction of Karpas 620 MM cell death when cocultured with PBMCs from 10 of 13 MM patients, regardless of disease stage. As expected, the isotype control did not induce MM cell death. Interestingly, MM cell death induced by 10 mg / ml NKp46-BCMA_Fc-ADE-DSB was significant (p=0.0105, Figure 33A).

[0463] In parallel, NK dim The ability of NKp46-BCMA_Fc-ADE-DSB to induce NK cell activation was assessed by measuring IFNg and CD107a expression on the cells (Figures 33B and 33C). IFNg and CD107a expression are more specifically induced in response to NKp46-BCMA_Fc-ADE-DSB than to the isotype control.

[0464] Taken together, these results indicate that NKp46-BCMA_Fc-ADE-DSB has therapeutic potential for treating patients with primary or refractory MM.

[0465] Example 16. Ex vivo functional activity of NKp46-BCMA_Fc-ADE-DSB on MM patient samples This example uses primary samples from MM patients to evaluate the ability of NKp46-BCMA_Fc-ADE-DSB to induce MM cell death. Cell death was measured by CD138 + This was determined by the reduction of MM cells.

[0466] Materials and Methods (1) Cell purification and co-culture conditions. On the day of the MM cell death assay, bone marrow mononuclear cells (BMMCs) from MM patients were isolated by density gradient centrifugation using Ficoll-Hypaque and immediately stained with anti-CD138-PE monoclonal antibody to identify MM cells (CD138 +BMMCs or PBMCs were incubated for 18 hours in the presence of negative control, SAR445514, or daratumumab.

[0467] (2) Cell Preparation and Treatment and Control Conditions. 400,000 BMMCs were seeded into each well of a U-bottom 96-well plate in RPMI containing 5% FCS and 3 ng / ml recombinant human IL-6. 600,000 PBMCs were kept in an incubator for minimal phenotyping of patient NK cells (CD56, CD3, CD16, NKp46) and for determining BCMA expression in MM cells. Control conditions were as follows: negative controls were BMMCs or PBMCs without treatment. For treatment groups, isotype control (10 μg / ml) and NKp46-BCMA_Fc-ADE-DSB (10 μg / ml) were added to the samples for 18 hours at 37 ± 1°C and 5 ± 1% CO2. Before treatment, the antibodies were centrifuged at 16,000 × g for 10 minutes at +4°C to remove potential aggregates.

[0468] (3) Staining and Flow Cytometry Analysis. After 18 hours of co-incubation at 37±1°C and 5±1% CO2, the cells were extracellularly stained for flow cytometry analysis. (3a) The cells were transferred to a V-bottom plate and centrifuged at 1900 × g for 1 minute. The supernatant was discarded, and the cells were washed with 200 μl of PBS and centrifuged again at 1900 × g for 1 minute. The supernatant was discarded. 50 μl of BD Pharmingen Stain Buffer BSA / Brilliant Stain buffer plus antibody master mix was added to each sample and incubated in the dark at 4°C for 30 minutes. The cells were washed with 200 μl of BD Pharmingen Stain Buffer BSA, centrifuged at 1900 × g for 1 minute, and the supernatant was discarded. This was repeated a second time. The cells were resuspended in 50 μl of 1% paraformaldehyde in PBS and incubated in the dark at 4°C for 15 minutes. Cells were then washed once in 200 μL of BD Pharmingen Stain Buffer BSA and resuspended in 200 μL of BD Pharmingen Stain Buffer BSA for flow cytometry analysis.

[0469] Prior to sample acquisition, UltraComp eBeads (Invitrogen) were stained with each antibody fluorophore to establish appropriate fluorescence compensation controls. Samples and eBeads were acquired using a BD FACSymphony A5 equipped with BD FACSDiva software. Analysis was performed using FlowJo software.

[0470] NK cell activation was confirmed by CD3- / CD56 dim Myeloma cell death was assessed by CD16, CD107a, and CD69 expression on NK cells. + Cell loss was assessed.

[0471] [Table 20]

[0472] [Table 21]

[0473] [Table 22]

[0474] result The ex vivo activity of NKp46-BCMA was tested on MM patient samples (N=16). To this end, BMMCs or PBMCs from multiple myeloma patients were untreated, treated with 10 mg / ml NKp46-BCMA_Fc-ADE-DSB, or treated with 10 μg / mL isotype control for 18 hours. MM cell death was measured by loss of CD138 expression using flow cytometry. Figures 16A-16C show the results of ex vivo NKp46-BCMA_Fc-ADE-DSB NKCE treatment in samples from treatment-naive patients compared with those who had received prior standard of care or were included in clinical trials. Patient samples were more responsive to NKp46-BCMA_Fc-ADE-DSB treatment if they were treatment-naive to daratumumab (Figure 16A), and were slightly less likely to respond if the patient had multiple relapses (Figure 16B). Figure 16C shows that samples after relapse >4 TC responded poorly to NKp46-BCMA_Fc-ADE-DSB.

[0475] These data demonstrate that NKp46-BCMA_Fc-ADE-DSB NKCE induces MM cell death in samples from MM patients at different stages of the disease (diagnosis or relapse).

[0476] Example 17. Combination Pharmacokinetic (PK) and Safety Study After Repeated Subcutaneous Administration in Cynomolgus Monkeys Methods and Materials A stock solution of NKp46-BCMA_Fc-ADE-DSB was provided at a concentration of 50 mg / mL in 10 mM histidine, pH 5.5, 8% sucrose, 0.05% PS80 and 10 μM EDTA.

[0477] Dose levels and administration: Non-human primates (NHP) cynomolgus monkeys (Macaca fascicularis) of both sexes (male and female) were administered NKp46-BCMA_Fc-ADE-DSB by subcutaneous route (SC, dorsal region) at 1 mL / kg once a week (days 1, 8, and 15) for 3 weeks.

[0478] [Table 23]

[0479] Samples collected: Plasma was collected for pharmacokinetic (PK) and cytokine assessment. PK Samples: Plasma samples for PK data were collected at the following time points: Day 1, 1, 5, and 24 hours; Day 8, 0 and 24 hours; Day 15, 0, 1, 5, 24, and 144 hours.

[0480] Cytokine (IFN-γ, IL-6, IL-8, and TNF-α) assessment: Sampling time points were pretreatment, 5 hours, and 24 hours after each dose (days 1, 8, and 15). Sampling sites were the femoral, saphenous, and / or cephalic veins. Blood samples (0.5 mL) were collected in K2-EDTA sampling tubes. Measurement of IFN-γ, IL-6, IL-8, and TNF-α in monkey plasma samples was performed using the exploratory ECLIA (electrochemiluminescence immunoassay) method from Mesoscale Discovery (U-PLEX Proinflam Combo 1 (NHP) SECTOR Assay Kit, catalog number K15070K-2). All variations are expressed relative to baseline values ​​(before the first dose on day 1). Due to analytical variability, cytokine increases were considered biologically significant if values ​​were more than two-fold higher than the corresponding baseline values. Grading was applied as follows: <2-fold change: no biologically relevant change; 3-10-fold change: very minimal increase; 11-100-fold change: minimal increase; 101-1000-fold change: moderate increase; and ≥1001-fold change: significant increase.

[0481] result Plasma NKp46-BCMA_Fc-ADE-DSB concentrations were determined using a discovery immunoassay performed on a Gyrolab platform. Descriptive statistics (mean and %CV) of NKp46-BCMA_Fc-ADE-DSB PK parameters in plasma following weekly SC dosing of NKp46-BCMA_Fc-ADE-DSB in cynomolgus monkeys are shown in Table 24. Individual NKp46-BCMA_Fc-ADE-DSB PK parameters are shown in Table 25. Individual (and mean) NKp46-BCMA_Fc-ADE-DSB plasma concentration values ​​are shown in Table 26.

[0482] [Table 24]

[0483] After SC administration three times per week, minimal NKp46-BCMA_Fc-ADE-DSB accumulation was observed in plasma on days 8 and 15, with accumulation ratios ranging from 1.6 to 2.6 at 25,000 and 50,000 μg / kg / adm (i.e., 25 and 50 mg / kg / adm), respectively (Figures 34A and 34B). Overall, bioavailability approached 90% after SC dosing of NKp46-BCMA_Fc-ADE-DSB in monkeys.

[0484] [Table 25]

[0485] [Table 26]

[0486] Cytokine (IFN-γ, IL-6, IL-8, and TNF-α) Assessment: Cytokines (IFN-γ, IL-6, IL-8, and TNF-α) were measured in plasma samples collected at the time points specified in the Methods and Materials section. No changes in IFN-γ and TNF-α levels were observed in any animal after weekly SC dosing. For IL-6 (Figure 35), only a transient, very minimal (maximum 10-fold change in female #25) to minimal (maximum 21-fold change in female #24) increase was observed after 50 mg / kg / adm, the highest dose tested. For IL-8, a very minimal increase (maximum 6-fold change) was observed in both animals dosed at 25 mg / kg / adm.

[0487] Example 18. Study of NKp46-BCMA NKCE-binding proteins in multiple myeloma patients This is a first-in-human Phase 1 / Phase 2 study to evaluate the NKp46-BCMA NKCE disclosed herein in participants with relapsed / refractory multiple myeloma (r / r MM).

[0488] The study includes three parts: a dose-escalation phase in r / r MM participants that will evaluate several doses to be administered to determine the two doses to be tested in the dose optimization portion; a dose optimization phase that will evaluate the two doses determined from the dose-escalation phase to determine the pre-recommended Phase 2 dose (pRP2D) and schedule NKp46-BCMA NKCE; and a dose-expansion phase that will evaluate the preliminary efficacy of the confirmed recommended Phase 2 dose (cRP2D) and schedule NKp46-BCMA NKCE in r / r MM patients.

[0489] Participants will be enrolled and treated with the study intervention and subsequently separated: approximately 18-30 participants in Part 1 / dose escalation phase; approximately 30 participants in Part 2 / dose optimization phase; and approximately 15 participants in Part 3 / dose expansion.

[0490] Participants' study period includes a screening period of up to 28 days prior to Cycle 1 Day 1 (C1D1), and a treatment period during which enrolled participants receive 4-week cycles of subcutaneous NKp46-BCMA NKCE. The end of treatment visit occurs 30 days (+ / - 7 days) after the last dose of investigational drug product or before the start of further treatment, whichever occurs first.

[0491] Primary endpoint measures: Dose escalation: Presence of dose-limiting toxicity (DLT). DLT is defined using NCI CTCAE version 5.0 or ASTCT criteria for CRS or ICANS. Dose Optimization: Overall Response Rate (ORR). ORR is defined as the proportion of participants with stringent complete response (sCR), complete response (CR), very good partial response (VGPR), and partial response (PR) according to the 2016 International Myeloma Working Group (IMWG) criteria after the last participant has been treated for at least four cycles or has discontinued earlier. Dose expansion: Overall response rate (ORR). ORR is defined as the proportion of participants with stringent complete response (sCR), complete response (CR), very good partial response (VGPR), and partial response (PR) according to the 2016 International Myeloma Working Group (IMWG) criteria.

[0492] Secondary endpoint measurements: Dose-escalation overall response rate (ORR): ORR is defined as the proportion of participants with sCR, CR, VGPR, and PR according to the 2016 IMWG criteria. Dose optimization: Presence of DLTs and proportion of participants experiencing treatment-emergent adverse events (TEAEs). TEAEs are defined as adverse events that develop, worsen, or become severe during the treatment period. Treatment period is defined as the time from the first dose of study treatment to 30 days after the last dose of study treatment. Dose optimization and expansion: Very good partial response or better rate Duration of response (DOR). DOR is defined as the time from the date of first response to the date of first occurrence of progressive disease (PD as determined by the investigator or death from any cause, whichever occurs first). DOR is determined only for participants who achieve a response (PR or better). Time to First Response (TT1R): TT1R is defined as the time from the date of first response to the date of first occurrence of progressive disease (PD as determined by the investigator or death from any cause, whichever occurs first). DOR is determined only for participants who achieve a response (PR or better). o Time to Best Response (TTBR): TTBR is defined as the time from the first administration of IMP to the date of the first subsequent occurrence of a confirmed best overall response (PR or better). o Progression-Free Survival (PFS): PFS is defined as the time from the first dose of IMP to the first documentation of progressive disease or death from any cause, whichever occurs first. Response is determined according to IMWG criteria. Paraprotein-based progression is confirmed based on two consecutive assessments. o Overall survival (OS): OS is defined as the time from the date of first administration of IMP to death from any cause. Clinical Response Rate (CBR): CBR is the proportion of participants with confirmed CR or PR or stable disease (SD) at any time point for at least 6 months after the first IMP dose, as determined by the investigator according to IMWG 2016 criteria. o Proportion of participants experiencing treatment-emergent adverse events (TEAEs): Treatment-emergent adverse events (TEAEs) are defined as AES that develop, worsen, or become severe during the treatment period. Treatment period is defined as the time from the first dose of study treatment to 30 days after the last dose of study treatment. Incidence of infusion-related reactions (IARs) Incidence of injection site reactions (ISR) o Incidence of abnormal tests Assessment of pharmacokinetic (PK) parameters of NKp46-BCMA NKCE in monotherapy AUClast: Area under the plasma concentration versus time curve calculated using the trape...

Claims

1. 1. A binding protein comprising a first antigen binding domain (ABD) that has binding specificity for BCMA and a second ABD that has binding specificity for NKp46, (a) the first ABD is (a1) a first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and an HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); and (a2) a first immunoglobulin light chain variable domain (VL1) comprising an LCDR1 sequence comprising the amino acid sequence of CASSTGTVTPSNYAN (SEQ ID NO: 7), an LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 8), and an LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 9); Including, (b) the second ABD is (b1) a second immunoglobulin heavy chain variable domain (VH2) comprising an HCDR1 sequence comprising the amino acid sequence of DYVIN (SEQ ID NO: 80), an HCDR2 sequence comprising the amino acid sequence of EIYPGSGTNYYNEKFKA (SEQ ID NO: 81), and an HCDR3 sequence comprising the amino acid sequence of RGRYGLYAMDY (SEQ ID NO: 21); and (b2) a second immunoglobulin light chain variable domain (VL2) comprising an LCDR1 sequence comprising RASQDISNYLN (SEQ ID NO: 34), an LCDR2 sequence comprising YTSRLHS (SEQ ID NO: 35), and an LCDR3 sequence comprising QQGNTRPWT (SEQ ID NO: 36); or (b3) a second immunoglobulin VH2 comprising an HCDR1 sequence comprising GYTFSDYVIN (SEQ ID NO: 19), an HCDR2 sequence comprising EIYPGSGTN (SEQ ID NO: 20), and an HCDR3 sequence comprising RGRYGLYAMDY (SEQ ID NO: 21); and (b4) an LCDR1 sequence comprising RASQDISNYLN (SEQ ID NO: 34), an LCDR2 sequence comprising YTSRLHS (SEQ ID NO: 35), and QQGNTRPWT (SEQ ID NO: 36) a second immunoglobulin VL2 comprising an LCDR3 sequence comprising: or (b5) a second immunoglobulin VH2 comprising an HCDR1 sequence comprising SDYAWN (SEQ ID NO: 22), an HCDR2 sequence comprising YITYSGSTSYNPSLES (SEQ ID NO: 23), and an HCDR3 sequence comprising GGYYGSSWGVFAY (SEQ ID NO: 24); and (b6) a second immunoglobulin VL2 comprising an LCDR1 sequence comprising RVSENIYSYLA (SEQ ID NO: 37), an LCDR2 sequence comprising NAKTLAE (SEQ ID NO: 38), and an LCDR3 sequence comprising QHHYGTPWT (SEQ ID NO: 39); or (b7) a second immunoglobulin VH2 comprising an HCDR1 sequence comprising EYTMH (SEQ ID NO: 25), an HCDR2 sequence comprising GISPNIGGTSYNQKFKG (SEQ ID NO: 26), and an HCDR3 sequence comprising RGGSFDY (SEQ ID NO: 27); and (b8) a second immunoglobulin VL2 comprising an LCDR1 sequence comprising RASQSISDYLH (SEQ ID NO: 40), an LCDR2 sequence comprising YASQSIS (SEQ ID NO: 41), and an LCDR3 sequence comprising QNGHSFPLT (SEQ ID NO: 42); or (b9) a second immunoglobulin VH2 comprising an HCDR1 sequence comprising SFTMH (SEQ ID NO: 28), an HCDR2 sequence comprising YINPSSGYTEYNQKFKD (SEQ ID NO: 29), and an HCDR3 sequence comprising GSSRGFDY (SEQ ID NO: 30); and (b10) a second immunoglobulin VL2 comprising an LCDR1 sequence comprising RASENIYSNLA (SEQ ID NO: 43), an LCDR2 sequence comprising AATNLAD (SEQ ID NO: 44), and an LCDR3 sequence comprising QHFWGTPRT (SEQ ID NO: 45); or (b11) a second immunoglobulin VH2 comprising an HCDR1 sequence comprising SDYAWN (SEQ ID NO: 31), an HCDR2 sequence comprising YITYSGSTNYNPSLKS (SEQ ID NO: 32), and an HCDR3 sequence comprising CWDYALYAMDC (SEQ ID NO: 33); and (b12) a second immunoglobulin VL2 comprising an LCDR1 sequence comprising RTSENIYSYLA (SEQ ID NO: 46), an LCDR2 sequence comprising NAKTLAE (SEQ ID NO: 47), and an LCDR3 sequence comprising QHHYDTPLT (SEQ ID NO: 48). A binding protein comprising:

2. 2. The binding protein of claim 1, wherein the VH1 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 49, and the VL1 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO:

55.

3. - said VH2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 56 and said VL2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 64; or - said VH2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 57 and said VL2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 65; or - said VH2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 58 and said VL2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 66; or - said VH2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 59 and said VL2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 67; or - said VH2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 60 and said VL2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 68; or - said VH2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 61 and said VL2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 69; or - said VH2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 62 and said VL2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 70, or - said VH2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 63, and said VL2 comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 71; The binding protein of claim 1.

4. 10. The binding protein of claim 1, further comprising all or a portion of an immunoglobulin Fc domain or a variant thereof.

5. 5. The binding protein of claim 4, wherein the Fc domain or variant thereof comprises a first Fc heavy chain and a second Fc heavy chain.

6. At least one Fc heavy chain comprises (i) a leucine (L) at amino acid position 242 and a lysine (K) at amino acid position 334, or (iii) an arginine (R) at amino acid position 292 and a valine (V) at amino acid position 302 6. The binding protein of claim 5, comprising an engineered intrachain disulfide bond mediated by a pair of cysteines (C) replacing , wherein the amino acid positions are according to EU numbering.

7. 7. The binding protein of claim 6, wherein the first and second Fc heavy chains each comprise a L242C / K334C substitution.

8. 7. The binding protein of claim 6, wherein the first and second Fc heavy chains each comprise a R292C / V302C substitution.

9. 7. The binding protein of claim 6, wherein at least one Fc heavy chain comprises a substitution at amino acid position 332 according to EU numbering.

10. 7. The binding protein of claim 6, wherein at least one Fc heavy chain further comprises an aspartic acid (D) at amino acid position 239 and a glutamic acid (E) at amino acid position 332 according to EU numbering.

11. at least two polypeptide chains forming at least two antigen-binding domains, wherein at least one polypeptide chain has the formula: VL1-L1-VL2-L2-CL[I] and a structure represented by At least one polypeptide chain has the formula: VH2-L3-VH1-L4-CH1[II] and a structure represented by During the ceremony, CL is an immunoglobulin light chain constant domain; CH1 is the immunoglobulin CH1 heavy chain constant domain; L1, L2, L3, and L4 are amino acid linkers, and any one or more of L1, L2, L3, and L4 are optionally absent; 2. The binding protein of claim 1, wherein said polypeptide of Formula I and said polypeptide of Formula II form a cross-linked light chain-heavy chain pair.

12. 12. The binding protein of claim 11, wherein L1, L2, L3, and L4 are each independently 0 amino acids in length or comprise a sequence selected from the group consisting of GGGGSGGGGS (SEQ ID NO:78), GGGGSGGGGSGGGGGS (SEQ ID NO:82), S,RT,TKGPS (SEQ ID NO:83), GQPKAAP (SEQ ID NO:84), and GGSGSSGSGG (SEQ ID NO:85).

13. (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73; and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO:

74. The binding protein of claim 1 , comprising:

14. 1. A binding protein comprising a first antigen binding domain (ABD) that has binding specificity for BCMA and a second ABD that has binding specificity for NKp46, (a) the first ABD comprises a first immunoglobulin heavy chain variable domain (VH1) comprising the HCDR1 sequence, the HCDR2 sequence, and the HCDR3 sequence of SEQ ID NO: 49 according to Kabat numbering, and a first immunoglobulin light chain variable domain (VL1) comprising the LCDR1 sequence, the LCDR2 sequence, and the LCDR3 sequence of SEQ ID NO: 55 according to Kabat numbering; (b) the second ABD comprises a second immunoglobulin heavy chain variable domain (VH2) comprising the HCDR1, HCDR2, and HCDR3 sequences of SEQ ID NO: 56 according to Kabat numbering, and a second immunoglobulin light chain variable domain (VL2) comprising the LCDR1, LCDR2, and LCDR3 sequences of the amino acid sequence of SEQ ID NO: 64 according to Kabat numbering.

15. (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73; and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO:

74.

15. The binding protein of claim 14, comprising:

16. 1. A binding protein comprising a first antigen binding domain (ABD) that has binding specificity for BCMA and a second ABD that has binding specificity for NKp46, said binding protein comprising: (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73; and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO:

74. A binding protein comprising:

17. A pharmaceutical composition comprising the binding protein of claim 1.

18. The binding protein of claim 4, wherein all or part of the immunoglobulin Fc domain or a variant thereof binds to a human Fc-γ receptor.

19. The binding protein of claim 4 , wherein all or part of the immunoglobulin Fc domain or a variant thereof binds to a human CD16A (FcγRIII) polypeptide.

20. 5. The binding protein of claim 4, wherein the Fc domain comprises a native glycan at amino acid position 297 according to EU numbering.

21. The binding protein of claim 4, wherein the binding protein is N-glycosylated.

22. 10. The binding protein of claim 9, wherein the substitution at amino acid position 332 is glutamic acid (E).

23. 10. The binding protein of claim 9, further comprising at least one Fc heavy chain further comprising one or more substitutions at amino acid positions 236, 239 or 330 according to EU numbering.

24. 23. The binding protein of claim 22, wherein the substitution at amino acid position 236 is alanine (A), the substitution at amino acid position 239 is aspartic acid (D), and the substitution at amino acid position 330 is leucine (L).

25. 7. The binding protein of claim 6, wherein at least one Fc heavy chain further comprises an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, and a glutamic acid (E) at amino acid position 332 according to EU numbering.

26. 7. The binding protein of claim 6, wherein at least one Fc heavy chain further comprises an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, a leucine (L) at amino acid position 330, and a glutamic acid (E) at amino acid position 332 according to EU numbering.

27. (b) the second ABD is (b1) a second immunoglobulin heavy chain variable domain (VH2) comprising an HCDR1 sequence comprising the amino acid sequence of DYVIN (SEQ ID NO: 80), an HCDR2 sequence comprising the amino acid sequence of EIYPGSGTNYYNEKFKA (SEQ ID NO: 81), and an HCDR3 sequence comprising the amino acid sequence of RGRYGLYAMDY (SEQ ID NO: 21); and (b2) a second immunoglobulin light chain variable domain (VL2) comprising an LCDR1 sequence comprising RASQDISNYLN (SEQ ID NO: 34), an LCDR2 sequence comprising YTSRLHS (SEQ ID NO: 35), and an LCDR3 sequence comprising QQGNTRPWT (SEQ ID NO: 36). The binding protein of claim 1 , comprising:

28. The binding protein comprises three polypeptide chains that form two antigen-binding domains, one polypeptide chain having the formula: VL1-L1-VL2-L2-CL[I] and a structure represented by One polypeptide chain has the formula: VH2-L3-VH1-L4-CH1-hinge-CH2-CH3[III] and a structure represented by One polypeptide chain has the formula: Hinge-CH2-CH3[IV] and a structure represented by During the ceremony, CL is an immunoglobulin light chain constant domain; CH1 is the immunoglobulin CH1 heavy chain constant domain; CH2 is the immunoglobulin CH2 heavy chain constant domain; CH3 is an immunoglobulin CH3 heavy chain constant domain; the hinge is an immunoglobulin hinge region connecting the CH1 domain and the CH2 domain; L1, L2, L3, and L4 are amino acid linkers, and any one or more of L1, L2, L3, and L4 are optionally absent; said polypeptide of formula I and said polypeptide of formula II form a cross-linked light chain-heavy chain pair; 12. The binding protein of claim 11.

29. 29. The binding protein of claim 28, wherein L1, L2, L3, and L4 are each independently 0 amino acids in length or comprise a sequence selected from the group consisting of GGGGSGGGGS (SEQ ID NO: 78), GGGGSGGGGSGGGGGS (SEQ ID NO: 82), S,RT,TKGPS (SEQ ID NO: 83), GQPKAAP (SEQ ID NO: 84), and GGSGSSGSGG (SEQ ID NO: 85).

30. 2. The binding protein of claim 1, wherein the VH1 comprises SEQ ID NO: 49 and the VL1 comprises SEQ ID NO:

55.

31. 2. The binding protein of claim 1, wherein the VH2 comprises SEQ ID NO: 56 and the VL2 comprises SEQ ID NO:

64.

32. (a) the first ABD comprises a VH1 of SEQ ID NO: 49 and a VL1 of SEQ ID NO: 55; (b) the second ABD comprises a VH2 of SEQ ID NO: 56 and a VL2 of SEQ ID NO: 64; The binding protein of claim 1.

33. 1. A binding protein comprising a first antigen binding domain (ABD) that has binding specificity for BCMA and a second ABD that has binding specificity for NKp46, (a) the first ABD comprises a first immunoglobulin heavy chain variable domain (VH1) comprising the HCDR1 sequence, the HCDR2 sequence, and the HCDR3 sequence of SEQ ID NO: 49 according to IMGT numbering, and a first immunoglobulin light chain variable domain (VL1) comprising the LCDR1 sequence, the LCDR2 sequence, and the LCDR3 sequence of SEQ ID NO: 55 according to IMGT numbering; (b) a binding protein, wherein the second ABD comprises a second immunoglobulin heavy chain variable domain (VH2) comprising the HCDR1, HCDR2, and HCDR3 sequences of SEQ ID NO: 56 according to IMGT numbering, and a second immunoglobulin light chain variable domain (VL2) comprising the LCDR1, LCDR2, and LCDR3 sequences of the amino acid sequence of SEQ ID NO: 64 according to IMGT numbering.

Citation Information

Patent Citations

  • Multispecific nkp46 binding protein

    JP2017521400A

  • Multispecific nk engager protein

    JP2018524326A

  • Variable region of NKp46-binding protein

    JP2019503713A