Therapeutic MUSK antibodies

High-affinity MuSK antibodies stimulate neuromuscular junction formation and improve muscle function in ALS models, addressing the limitations of existing treatments by enhancing synaptic integrity and extending lifespan.

JP7772715B2Active Publication Date: 2025-11-18NEW YORK UNIV +1

Patent Information

Application Number
JP2022563016
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-11-11
Filing Date
2021-04-16
Publication Date
2025-11-18
Estimated Expiration
2041-04-16

AI Technical Summary

Technical Problem

Existing treatments for neuromuscular disorders, such as ALS, have shown limited effectiveness in maintaining neuromuscular junction function and muscle function, necessitating further research into MuSK agonist antibodies for therapeutic potential.

Method used

Development of high-affinity MuSK antibodies that stimulate MuSK activation and phosphorylation, mimicking the effect of Dok7 in neuromuscular junction formation, using engineered antibody formats to enhance synaptic integrity and muscle function.

Benefits of technology

The MuSK antibodies improve neuromuscular junction innervation, delay muscle denervation, and extend lifespan in mouse models of ALS, demonstrating potential therapeutic benefits for neuromuscular disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007772715000020
    Figure 0007772715000020
  • Figure 0007772715000021
    Figure 0007772715000021
  • Figure 0007772715000022
    Figure 0007772715000022
Patent Text Reader

Abstract

The present invention relates to antibody-based molecules, including full-length antibodies, antigen-binding domains thereof, and antibody derivatives, that can bind to and activate human muscle-specific tyrosine protein kinase (MuSK). The invention further discloses methods of treating neuromuscular conditions using said MuSK antibodies.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application claims the benefit of U.S. Provisional Patent Application Nos. 63 / 011,986, filed April 17, 2020, 63 / 038,633, filed June 12, 2020, and 63 / 112,375, filed November 11, 2020, which are incorporated by reference in their entireties.

[0002] Field The present invention relates to antibody-based molecules, including full-length antibodies, antigen-binding domains thereof, and antibody derivatives, that can bind to and activate human muscle-specific tyrosine protein kinase (MuSK). The invention further discloses methods of treating neuromuscular conditions using said MuSK antibodies. [Background technology]

[0003] background Muscle-specific kinase (MuSK) is a receptor tyrosine kinase essential for the establishment and maintenance of neuromuscular junctions (NMJs). Activation of MuSK by the nerve-derived heparin sulfate proteoglycan agrin and its agrin receptor LRP4 leads to clustering of acetylcholine receptors (AChRs) at the postsynaptic side of the NMJ, enabling neuromuscular transmission and muscle contraction. The MuSK ectodomain contains three immunoglobulin-like domains (Ig-like domains 1-3) and a cysteine-rich domain (Fz-CRD) related to the domain in the Wnt receptor Frizzled protein.

[0004] Many neuromuscular disorders are characterized by impaired NMJ function. The importance of MuSK signaling for establishing and maintaining synapses leads us to speculate that stimulating MuSK may have therapeutic potential for these disorders. In line with this hypothesis, it was demonstrated that MuSK overexpression preserved innervation and motor function for more than one month in a mouse model of amyotrophic lateral sclerosis (ALS). Additionally, several monoclonal MuSK-binding scFvs were identified using phage display. One of these MuSK binders was produced in a (murine) IgG format and was also tested in ALS mice (see Cantor et al., "Preserving Neuromuscular Synapses in ALS by Stimulating MuSK with a Therapeutic Agonist Antibody," Elife 7:e34375 (2018), and Sengupta-Ghosh et al., "Muscle Specific Kinase (MuSK) Activation Preserves Neuromuscular Junctions in the Diaphragm but Is Not Sufficient to Provide a Functional Benefit in the SOD1G93A Mouse Model of ALS," Neurobiol. Dis. 124:340-352 (2019)). Both studies passively transferred antibody #13 into SOD1-G93A mice and demonstrated that treatment with antibody #13 improved NMJ innervation and delayed muscle denervation compared to mock-treated mice. Cantor et al., "Preserving Neuromuscular Synapses in ALS by Stimulating MuSK with a Therapeutic Agonist Antibody," Elife 7:e34375 (2018) further demonstrated improved motor neuron survival and muscle function, resulting in a small extension of lifespan.These studies demonstrate that MuSK agonists have the ability to at least maintain the structural integrity of neuromuscular synapses in ALS mice, but further studies are needed to confirm improvement in muscle function. Evaluating the therapeutic potential of MuSK agonist antibodies in other neuromuscular disorders appears to be an important new research direction (Vergoossen et al., "MuSK Antibodies, Lessons Learned from Poly- and Monoclonality," J. Autoimmun. 112: 102488 (2020)). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] U.S. Patent No. 5,225,539 [Patent Document 2] U.S. Patent No. 5,530,101 [Patent Document 3] U.S. Patent No. 5,585,089 [Patent Document 4] U.S. Patent No. 5,859,205 [Patent Document 5] U.S. Patent No. 6,407,213 [Patent Document 6] U.S. Patent No. 6,881,557 [Non-patent literature]

[0006] [Non-Patent Document 1] Cantor et al., “Preserving Neuromuscular Synapses in ALS by Stimulating MuSK with a Therapeutic Agonist Antibody,” Elife 7:e34375 (2018) [Non-patent document 2] Sengupta-Ghosh, "Muscle Specific Kinase (MuSK) Activation Preserves Neuromuscular Junctions in the Diaphragm but is not Sufficient to Provide a Functional Benefit in the SOD1G93A Mouse Model of ALS", Neurobiol. Dis. 124:340~352 pages (2019) [Non-licensed Document 3] Vergoossen, "MuSK Antibodies, Lessons Learned from Poly- and Monoclonality", J. Autoimmun. 112: 102488 pages (2020) [Non-licensed Document 4] Carillo, H. and Lipman, D., SIAM, J. Applied Math., 48:1073 (1988) [Non-licensed Document 5] Devereux, J., Nucleic Acids Research 12(1): 387 (1984) [Non-licensed Document 6] Altschul, SF, J. Mol. Biol. 215:403-410 (1990) [Non-licensed Document 7] Madeira, F., Nucleic Acids Research 47(W1): W636~W641 (2019) [Non-licensed Document 8] Needleman and Wunsch, J. Mol. Biol. 48(3): pages 443~453 (1970) [Non-licensed Document 9] Enikoff and Henikoff, Proc. Natl. Acad. Sci. USA. 89:10915~10919 (1992) [Non-licensed Document 10] Burden et al., “The Role of MuSK in Synapse Formation and Neuromuscular Disease,” Cold Spring Harb. Perspect. Biol. 5:a009167 (2013) [Non-Patent Document 11] Jennings et al., "Muscle-Specific trk-Related Receptor with a Kringle Domain Defines a Distinct Class of Receptor Tyrosine Kinases," Proc. Natl. Acad. Sci. USA 90:2895-2899 (1993) [Non-Patent Document 12] Valenzuela et al., “Receptor Tyrosine Kinase Specific for the Skeletal Muscle Lineage: Expression in Embryonicmuscle, at the Neuromuscular Junction, and After Injury,” Neuron 15: pp. 573-584 (1995) [Non-Patent Document 13] Kong et al., "Inhibition of Synapse Assembly in Mammalian Muscle in vivo by RNA Interference", EMBO Rep 5:183-188 (2004) [Non-Patent Document 14] Hesser et al., “Synapse Disassembly and Formation of New Synapses in Postnatal Muscle Upon Conditional Inactivation of MuSK,” Mol. Cell. Neurosci. 31:470–480 (2006) [Non-Patent Document 15] Beeson et al., "Dok-7 Mutations Underlie a Neuromuscular Junction Synaptopathy," Science 313: 1975-1978 (2006) [Non-Patent Document 16] Muller et al., “Phenotypical Spectrum of DOK7 Mutations in Congenital Myasthenic Syndromes,” Brain 130: pp. 1497–1506 (2007) [Non-Patent Document 17] Selcen et al., “A Compensatory Subpopulation of Motor Neurons in a Mouse Model of Amyotrophic Lateral Sclerosis,” J. Comp. Neurol. 490:209–219 (2008) [Non-Patent Document 18] Ward et al., "Binding Activities Of A Repertoier of Single Immunoglobulin Variable Domains Secreted From Escherichia coli." Nature 341:544-546 (1989) [Non-Patent Document 19] Holt et al., “Domain Antibodies: Proteins for Therapy,” Trends Biotechnol. 21(11): pp. 484–490 (2003) [Non-Patent Document 20] Revets et al., “Nanobodies As Novel Agents For Cancer Therapy,” Expert Opin. Biol. Ther. 5(1):111–124 (2005) [Non-Patent Document 21] Evans et al., "Rapid Expression Of An Anti-Human C5 Chimeric Fab Utilizing A Vector That Replicates In COS And 293 Cells," J. Immunol. Meth. 184:123-38 (1995) [Non-Patent Document 22] Bird et al., "Single-Chain Antigen-Binding Proteins", Science 242:423-426 (1988) [Non-Patent Document 23] Huston et al., "Protein Engineering Of Antibody Binding Sites: Recovery Of Specific Activity In An Anti-Digoxin Single-Chain Fv Analogue Produced In Escherichia coli," Proc. Natl. Acad. Sci. (USA) 85:5879-5883 (1988) [Non-Patent Document 24] Holliger et al., "'Diabodies': Small Bivalent And Bispecific Antibody Fragments," Proc. Natl. Acad. Sci. (USA) 90(14), pp. 6444-8 (1993) [Non-Patent Document 25] Zapata et al., Protein Eng. 8(10): 1057-1062 (1995) [Non-Patent Document 26] LoBuglio, AF et al., "Mouse / Human Chimeric Monoclonal Antibody In Man: Kinetics And Immune Response", Proc. Natl. Acad. Sci. USA 86:4220-4224 (1989) [Non-Patent Document 27] Sato, K. et al., Cancer Res 53:851-856 (1993) Riechmann, L. et al., "Reshaping Human Antibodies for Therapy," Nature 332:323-327 (1988) [Non-patent document 28] Verhoeyen, M. et al., "Reshaping Human Antibodies: Grafting An Antilysozyme Activity", Science 239:1534-1536 (1988) [Non-Patent Document 29] Kettleborough, CA et al., "Humanization Of A Mouse Monoclonal Antibody By CDR-Grafting: The Importance Of Framework Residues On Loop Conformation," Protein Engineering 4:773-3783 (1991) [Non-Patent Document 30] Maeda, H. et al., "Construction Of Reshaped Human Antibodies With HIV-Neutralizing Activity", Human Antibodies Hybridoma 2: pp. 124-134 (1991) [Non-Patent Document 31] Gorman, SD et al., "Reshaping A Therapeutic CD4 Antibody," Proc. Natl. Acad. Sci. USA 88:4181-4185 (1991) [Non-Patent Document 32] Tempest, PR et al., "Reshaping A Human Monoclonal Antibody To Inhibit Human Respiratory Syncytial Virus Infection In Vivo," Bio / Technology 9:266-271 (1991) [Non-Patent Document 33] Co, MS et al., "Humanized Antibodies For Antiviral Therapy", Proc. Natl. Acad. Sci. USA 88:2869-2873 (1991) [Non-Patent Document 34] Carter, P. et al., "Humanization Of An Anti-pl85her2 Antibody For Human Cancer Therapy," Proc. Natl. Acad. Sci. USA 89:4285-4289 (1992) [Non-Patent Document 35] Co, MS et al., "Chimeric And Humanized Antibodies With Specificity For The CD33 Antigen", J. Immunol. 148: pp. 1149-1154 (1992) [Non-Patent Document 36] Kabat et al., SEQUENCES OF PROTEINS OF IMMUNOLOGICAL INTEREST, National Institutes of Health Publication No. 91-3242 (1992) [Non-Patent Document 37] Chothia, C. et al., "Canonical Structures For The Hypervariable Regions Of Immunoglobulins", J. Mol. Biol. 196:901-917 (1987) [Non-Patent Document 38] Gonzales, NR et al., "SDR Grafting Of A Murine Antibody Using Multiple Human Germline Templates To Minimize Its Immunogenicity", Mol. Immunol. 41:863-872 (2004) [Non-Patent Document 39] Glaser et al., "Antibody Engineering By Codon-Based Mutagenesis In A Filamentous Phage Vector System," J. Immunology 149:3903-3913 (1992) [Non-Patent Document 40] Wu, H. et al., "Stepwise In Vitro Affinity Maturation of Vitaxin, An Alphav Beta 3-Specific Humanized mAb", Proc. Natl. Acad. Sci. USA 95:6037-6042 (1998) [Non-Patent Document 41] Yelton et al., “Affinity Maturation Of The BR96 Anti-Carcinoma Antibody By Codon-Based Mutagenesis,” J. Immunology 155:1994 (1995) [Non-Patent Document 42] Schier, R. et al., "Isolation Of Picomolar Affinity Anti-c-erbB-2 Single-Chain Fv By Molecular Evolution Of The Complementarity Determining Regions In The Center Of The Antibody Binding Site," J. Mol. Biol. 263:551-567 (1996) [Non-Patent Document 43] Krause, JC et al., “An Insertion Mutation That Distorts Antibody Binding Site Architecture Enhances Function of a Human Antibody”, MBio. 2(1): e00345–10 (2011) [Non-Patent Document 44] Kuan, CT et al., “Affinity-Matured Anti-Glycoprotein NMB Recombinant Immunotoxins Targeting Malignant Gliomas And Melanomas,” Int. J. Cancer 10.1002 / ijc.25645 (2010) [Non-Patent Document 45] Hackel, BJ et al., “Stability And CDR Composition Biases Enrich Binder Functionality Landscapes,” J. Mol. Biol. 401(l): pp. 84–96 (2010) [Non-Patent Document 46] Montgomery, DL et al., “Affinity Maturation And Characterization Of A Human Monoclonal Antibody Against HIV-1 gp41,” MAbs 1(5): pp. 462–474 (2009) [Non-Patent Document 47] Gustchina, E. et al., "Affinity Maturation By Targeted Diversification Of The CDR-H2 Loop Of A Monoclonal Fab Derived From A Synthetic Naive Human Antibody Library And Directed Against The Internal Trimeric Coiled-Coil Of Gp41 Yields A Set Of Fabs With Improved HIV-1 Neutralization Potency And Breadth," Virology 393(1): pp. 112-119 (2009) [Non-Patent Document 48] Finlay, WJ et al., "Affinity Maturation Of A Humanized Rat Antibody For Anti-RAGE Therapy: Comprehensive Mutagenesis Reveals A High Level Of Mutational Plasticity Both Inside And Outside The Complementarity-Determining Regions," J. Mol. Biol. 388(3): pp. 541-558 (2009) [Non-Patent Document 49] Bostrom, J. et al., "Improving Antibody Binding Affinity And Specificity For Therapeutic Development", Methods Mol. Biol. 525:353-376 (2009); Steidl, S. et al., "In Vitro Affinity Maturation Of Human GM-CSF Antibodies By Targeted CDR-Diversification", Mol. Immunol.46(1): pp. 135-144 (2008) [Non-Patent Document 50] Barderas, R. et al., "Affinity Maturation Of Antibodies Assisted By In Silico Modeling", Proc. Natl. Acad. Sci. USA 105(26):9029-9034 (2008) [Non-Patent Document 51] Deverman et al., “Gene Therapy for Neurological Disorders: Progress and Prospects,” Nature Rev. 17:641–659 (2018) [Non-Patent Document 52] Vitale et al., “Anti-tau Conformational scFv MCI Antibody Efficiently Reduces Pathological Tau Species in Adult JNPL3 Mice,” Acta Neuropalhol. Commun. 6:82 (2018) [Non-Patent Document 53] Haiyan et al., “Targeting Root Cause by Systemic scAAV9-hIDS Gene Delivery: Functional Correction and Reversal of Severe MPSII in Mice,” Mol. Ther. Methods Clin. Dev. 10:327–340 (2018) [Non-Patent Document 54] Liu et al., “Vectored Intracerebral Immunizations with the Anti-Tau Monoclonal Antibody PHF1 Markedly Reduces Tau Pathology in Mutant Transgenic Mice,” J. Neurosci. 36(49): pp. 12425–35 (2016) [Non-Patent Document 55] Broekman et al., “Adeno-associated Virus Vectors Serotyped with AAV8 Capsid are More Efficient than AAV-1 or-2 Serotypes for Widespread Gene Delivery to the Neonatal Mouse Brain,” Neuroscience 138:501–510 (2006) [Non-Patent Document 56] Ising et al., “AAV-mediated Expression of Anti-Tau ScFv Decreases Tau Accumulation in a Mouse Model of Tauopathy,” J. Exp. Med. 214(5): p. 1227 (2017) [Non-licensed Document 57] Simonら, "A Rapid Gene Delivery-Based Mouse Model for Early-Stage Alzheimer Disease-Type Tauopathy", J. Neuropath. Exp. Neurol. 72(11): 1062~1 pages (2013) [Non-licensed Document 58] Grimm, J. Viol. 82:5887~5911 pages (2008) [Non-licensed Document 59] Murlidharan, J. Virol. 89: pp. 3976~3987 (2015) [Non-licensed Document 60] Ojala, Mol. Ther. 26:304~319 pages (2018) [Non-licensed Document 61] Muller, Nat. Biotechnol. 21:1040-1046 [Non-licensed Document 62] Korbelin, EMBO Mol. Med. 8: Pages 609~625 (2016) [Non-licensed Document 63] Deverman, Nat. Biotechnol. 34: Pages 204~209 (2016) [Non-licensed Document 64] Chanら, Nat. Neurosci. 20: Pages 1172~1179 (2017) [Non-licensed Document 65] Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77: pages 4216~4220 (1980) [Non-licensed Document 66] Langer, Science 249: 1527 pages (1990) [Non-licensed Document 67] Hanes, Advanced Drug Delivery Reviews 28:97~119 pages (1997) [Non-licensed Document 68] Price et al., “Specific Disruption of Abca1 Targeting Largely Mimics the Effects of miR-33 Knockout on Macrophage Cholesterol Efflux and Atherosclerotic Plaque Development,” Circ. Res. 124:874–880 (2019) [Non-Patent Document 69] Smith et al., “Src, Fyn, and Yes are not Required for Neuromuscular Synapse Formation but are Necessary for Stabilization of Agrin-Induced Clusters of Acetylcholine Receptors,” J. Neurosci. 21:3151–3160 (2001) [Non-Patent Document 70] Takata, K. et al., “Characterization of Pathogenic Monoclonal Autoantibodies Derived from Muscle-Specific Kinase Myasthenia Gravis Patients”, JCI Insight 4(12):el27167 (2019) [Non-Patent Document 71] Fichtner et al., “Affinity Maturation is Required for Pathogenic Monovalent IgG4 Autoantibody Development in Myasthenia Gravis”, J. Exp. Med.217(12):e20200513 (2020) [Non-Patent Document 72] Herbst & Burden, “The Juxtamembrane Region of MuSK has a Critical Role in Agrin-Mediated Signaling,” EMBO J. 19:67–77 (2000) [Non-Patent Document 73] Bergamin et al., “The Cytoplasmic Adapter Protein Dok7 Activates the Receptor Tyrosine Kinase MuSK via Dimerization”, Mol. Cell 39: pp. 100-109 (2010) [Non-Patent Document 74] Hallock et al., “Dok-7 Regulates Neuromuscular Synapse Formation by Recruiting Crk and Crk-L,” Genes Dev. 24:2451–2461 (2010) [Non-Patent Document 75] Remedio et al., “Diverging Roles for Lrp4 and Wnt Signaling in Neuromuscular Synapse Development During Evolution,” Genes Dev. 30: pp. 1058–1069 (2016) [Non-Patent Document 76] Jaworski & Burden, "Neuromuscular Synapse Formation in Mice Lacking Motor Neuron- and Skeletal Muscle-Derived Neuregulin-1", J. Neurosci. 26:655-661 (2006) [Non-Patent Document 77] Kim & Burden, “MuSK Controls where Motor Axons Grow and Form Synapses,” Nat. Neurosci. 11:19–27 (2008) [Non-Patent Document 78] Mandillo et al., “Reliability, Robustness, and Reproducibility in Mouse Behavioral Phenotyping: A Cross-Laboratory Study,” Physiol. Genomics 34:243–255 (2008) [Non-Patent Document 79] Oury et al., “MACF1 Links Rapsyn to Microtubule- and Actin-Binding Proteins to Maintain Neuromuscular Synapses,” J. Cell Biol. 218:1686–1705 (2019) [Non-Patent Document 80] Miller et al., “T Cell Receptor-Like Recognition of Tumor in vivo by Synthetic Antibody Fragment”, PLoS One 7:e43746 (2012) [Non-Patent Document 81] Lo et al., “Effector-Attenuating Substitutions That Maintain Antibody Stability and Reduce Toxicity in Mice,” J. Biol. Chem. 292:3900–3908 (2017) [Non-Patent Document 82] Nishikori et al., “Broad Ranges of Affinity and Specificity of Anti-Histone Antibodies Revealed by a Quantitative Peptide Immunoprecipitation Assay,” J. Mol. Biol. 424:391–399 (2012) [Non-Patent Document 83] Nady et al., “ETO Family Protein Mtgrl Mediates Prdml4 Functions in Stem Cell Maintenance and Primordial Germ Cell Formation”, Elife 4:el0150 (2015) [Non-Patent Document 84] Hattori et al., “Multiplex Bead Binding Assays Using Off-the-Shelf Components and Common Flow Cytometers,” J. Immunol. Methods 490:112952 (2020) [Non-Patent Document 85] Muller et al., “Congenital Myasthenic Syndromes: Spotlight on Genetic Defects of Neuromuscular Transmission,” Expert Rev. Mol. Med. 9:1–20 (2007) [Non-Patent Document 86] Engel, AG, “Current Status of the Congenital Myasthenic Syndromes”, Neuromuscul. Disord. 22:99–111 (2012) [Non-Patent Document 87] Engel et al., “Congenital Myasthenic Syndromes: Pathogenesis, Diagnosis, and Treatment,” Lancet Neurol. 14:420–434 (2015) [Non-Patent Document 88] Okada et al., “The Muscle Protein Dok-7 is Essential for Neuromuscular Synaptogenesis,” Science 312:1802–1805 (2006) [Non-Patent Document 89] Hamuro et al., “Mutations Causing DOK7 Congenital Myasthenia Ablate Functional Motifs in Dok-7,” J. Biol. Chem. 283:5518–5524 (2008) [Non-Patent Document 90] Liewluck et al., “Beneficial Effects of Albuterol in Congenital Endplate Acetylcholinesterase Deficiency and Dok-7 Myasthenia,” Muscle Nerve 44:789–794 (2011) [Non-Patent Document 91] Burke et al., “Salbutamol Benefits Children with Congenital Myasthenic Syndrome due to DOK7 mutations,” Neuromuscul. Disord. 23:170–175 (2013) [Non-Patent Document 92] Burden, S. J, "The Formation of Neuromuscular Synapses", Genes Dev. 12: pp. 133-148 (1998) [Non-Patent Document 93] Sanes & Lichtman, "Induction, Assembly, Maturation and Maintenance of a Postsynaptic Apparatus", Nat. Rev. Neurosci. 2: pp. 791-805 (2001) [Non-Patent Document 94] Burden, SJ, "SnapShot: Neuromuscular Junction", Cell 144: pp. 826-826 (2011) [Non-Patent Document 95] Tintignac et al., “Mechanisms Regulating Neuromuscular Junction Development and Function and Causes of Muscle Wasting,” Physiol. Rev. 95: pp. 809–852 (2015) [Non-Patent Document 96] McMahan, UJ, "The Agrin Hypothesis", Cold Spring Harb. Symp. Quant. Biol. 55:407-418 (1990) [Non-Patent Document 97] DeChiara et al., “The Receptor Tyrosine Kinase MuSK is Required for Neuromuscular Junction Formation in vivo,” Cell 85:501–512 (1996) [Non-Patent Document 98] Glass et al., “Agrin Acts via a MuSK Receptor Complex,” Cell 85:513–523 (1996) [Non-Patent Document 99] Kim et al., “Lrp4 is a Receptor for Agrin and Forms a Complex with MuSK,” Cell 135:334–342 (2008) [Non-Patent Document 100] Zhang et al., "LRP4 Serves as a Coreceptor of Agrin," Neuron. 60:285-297 (2008) [Non-Patent Document 101] Yumoto et al., “Lrp4 is a Retrograde Signal for Presynaptic Differentiation at Neuromuscular Synapses”, Nature 489:438–442 (2012) [Non-Patent Document 102] McMacken et al., “The Increasing Genetic and Phenotypical Diversity of Congenital Myasthenic Syndromes,” Neuropediatrics 48:294–308 (2017) [Non-Patent Document 103] Zhou et al., “Distinct Domains of MuSK Mediate its Abilities to Induce and to Associate with Postsynaptic Specializations,” J. Cell Biol. 146:1133–1146 (1999) [Non-Patent Document 104] Cossins et al., “The Spectrum of Mutations that Underlie the Neuromuscular Junction Synaptopathy in DOK7 Congenital Myasthenic Syndrome,” Hum. Mol. Genet. 21:3765–3775 (2012) [Non-Patent Document 105] Watty et al., “The in vitro and in vivo Phosphotyrosine Map of Activated MuSK,” Proc. Natl. Acad. Sci. USA 97:4585–4590 (2000) [Non-Patent Document 106] Till et al., "Crystal Structure of the MuSK Tyrosine Kinase: Insights into Receptor Autoregulation", Structure 10: pp. 1187-1196 (2002) [Non-Patent Document 107] Arimura et al., “Neuromuscular Disease.DOK7 Gene Therapy Benefits Mouse Models of Diseases Characterized by Defects in the Neuromuscular Junction”, Science 345:1505–1508 (2014) [Non-Patent Document 108] de Haard et al., “A Large Non-Immunized Human Fab Fragment Phage Library that Permits Rapid Isolation and Kinetic Analysis of High Affinity Antibodies,” J. Biol. Chem. 274:18218–18230 (1999) [Non-Patent Document 109] Huijbers et al., “MuSK Myasthenia Gravis Monoclonal Antibodies: Valency Dictates Pathogenicity”, Neurol. Neuroimmunol. Neuroinflamm. 6(3):e547 (2019) [Non-Patent Document 110] Zhu et al., “Muscle-Specific Receptor Tyrosine Kinase Endocytosis in Acetylcholine Receptor Clustering in Response to Agrin,” J. Neurosci. 28(7): pp. 1688–1696 (2008) [Non-Patent Document 111] Stiegler et al., “Crystal Structure of the Agrin-Responsive Immunoglobulin-Like Domains 1 and 2 of the Receptor Tyrosine Kinase MuSK,” J. Mol. Biol. 364:424–433 (2006) [Non-Patent Document 112] Zhang et al., “Agrin Binds to the N-Terminal Region of Lrp4 Protein and Stimulates Association between Lrp4 and the First Immunoglobulin-Like Domain in Muscle-Specific Kinase (MuSK),” J. Biol. Chem. 286:40624–40630 (2011) [Non-Patent Document 113] Zong et al., “Structural Basis of Agrin-LRP4-MuSK Signaling,” Genes Dev. 26:247–258 (2012) Summary of the Invention

[0007] The present invention is directed to overcoming this and other deficiencies in the art. BRIEF DESCRIPTION OF THE DRAWINGS [Brief explanation of the drawings]

[0008] [Figure 1A] Figures 1A-1D demonstrate that the C-terminal region of Dok7 is essential for synaptic differentiation. Figure 1A is a schematic diagram showing the pleckstrin homology (PH) domain and phosphotyrosine binding (PTB) domain in Dok7, which mediate Dok7 dimerization and binding to tyrosine-phosphorylated MuSK. The C-terminal region contains two tyrosine residues, Y396 and Y406, that are phosphorylated after Dok7 recruitment to MuSK. Dok7 1124_1127 dup mice (also referred to herein as Dok7 CM mice and Dok7CM / CM mice) display the most common mutation in Dok7 found in humans with congenital myasthenia gravis, which leads to frameshifts, premature terminations, and truncations of the Dok7 protein, including deletions of Y396 and Y406. Dok7 Y396F;Y406F (Dok7 2YF) mice have a mutation in which Y396 and Y406 are replaced with phenylalanine. [Figure 1B] Figures 1A-1D demonstrate that the C-terminal region of Dok7 is essential for synaptic differentiation. Figure 1B shows a chi-square analysis of offspring derived from crossbred Dok7CM / + C57BL / 6 mice, demonstrating that Dok7CM / CM homozygous mice did not survive postnatal life. In contrast, Dok72YF / 2YF mice were present in the expected numbers when genotyped at P5-P10. [Figure 1C]Figures 1A-1D demonstrate that the C-terminal region of Dok7 is essential for synaptic differentiation. Figure 1C shows fluorescence microscopy images of diaphragm muscles from wild-type, Dok7CM / CM, and Dok72YF / 2YF mice at E18.5 stained with Alexa488-α-BGT to label AChRs (red) and with antibodies against neurofilament / synapsin to label motor axons / nerve terminals (green). Scale bar = 10 μm. [Figure 1D] Figures 1A-1D demonstrate that the C-terminal region of Dok7 is essential for synapse differentiation. Figure 1D shows a graph demonstrating that at E18.5, synapse number, synapse size, and synaptic AChR density were reduced 4.5-fold, 4-fold, and 5-fold, respectively. In Dok72YF / 2YF mice, synapse size was normal, but synaptic AChR density was mildly reduced (15%). The shape of synapses in Dok72YF / 2YF mice often appeared elongated. Graphs show values ​​for three mice of each genotype and the mean ± SEM values ​​for these mice (ns, not significant; p, ****<0.00005). [Figure 2A] Figures 2A-2D demonstrate that truncated Dok7 is abundantly expressed and MuSK tyrosine phosphorylation is significantly reduced in Dok7CM / CM mice. Figures 2A-2B show immunoblots of Dok7 immunoprecipitated from muscle of wild-type, Dok7CM / +, and Dok72YF / 2YF mice at E18.5. The blots were probed with an antibody against Dok7 (Figures 9A-9B). Figure 9A shows that truncated Dok7 (t-Dok7), encoded by Dok7CM, migrates at the predicted size but is expressed at a threefold lower level than wild-type Dok7. Quantification and comparison of wild-type and mutant proteins was simplified when the two proteins were co-immunoprecipitated from the same lysate; similar results were obtained by comparing expression in wild-type and Dok7CM / CM mice (Figures 10A-10C). Scatter plots show values ​​and mean ± SEM values ​​for 8 mice from each genotype (p, ****<0.00005). [Figure 2B]Figures 2A-2D demonstrate that truncated Dok7 is fully expressed and MuSK tyrosine phosphorylation is significantly reduced in Dok7CM / CM mice. Figures 2A-2B are immunoblots in which Dok7 was immunoprecipitated from muscle of wild-type, Dok7CM / +, and Dok72YF / 2YF mice at E18.5. Figure 2B shows that the mutant Dok7Y396F;Y406F protein migrates at the predicted size and is expressed similarly to wild-type Dok7. Scatter plots show values ​​and mean ± SEM values ​​for 11 mice of each genotype (ns, not significant). [Figure 2C] Figures 2A-2D demonstrate that truncated Dok7 is fully expressed and MuSK tyrosine phosphorylation is significantly reduced in Dok7CM / CM mice. Figures 2C-2D show that MuSK was immunoprecipitated from muscle of E18.5 wild-type, Dok7CM / CM, and Dok72YF / 2YF mice, and blots were probed with antibodies against MuSK or phosphotyrosine. MuSK phosphorylation was quantified and normalized to MuSK expression. Figure 2C shows that MuSK phosphorylation is 7-fold lower in Dok7CM / CM mice than in wild-type mice. Scatter plots show values ​​for seven mice of each genotype and mean ± SEM values ​​(p, ****<0.00005). [Figure 2D] Figures 2A-2D demonstrate that truncated Dok7 is fully expressed and MuSK tyrosine phosphorylation is significantly reduced in Dok7CM / CM mice. Figures 2C-2D show that MuSK was immunoprecipitated from muscle of wild-type, Dok7CM / CM, and Dok72YF / 2YF mice at E18.5, and blots were probed with antibodies against MuSK or phosphotyrosine. MuSK phosphorylation was quantified and normalized to MuSK expression. Figure 2D shows that MuSK tyrosine phosphorylation is similar in Dok72YF / 2YF and wild-type mice. Scatter plots show values ​​for five mice of each genotype and mean ± SEM values ​​(ns, not significant). [Figure 3A]Figures 3A-3D demonstrate that recruitment of CrK to synapses and to the MuSK / Dok7 complex is reduced in Dok7CM / CM mice. Figure 3A shows that Crk-L (green) colocalizes with AChRs at synapses in cross-sections of tibialis anterior muscles from wild-type mice at E18.5. Crk-L staining persists at synaptic sites in Dok7CM / CM and Dok72YF / 2YF mice, but recruitment appears to be reduced at synapses in Dok7CM / CM mice. Scale bar = 5 μm. [Figure 3B] Figures 3A-3D demonstrate that recruitment of Crk to synapses and to the MuSK / Dok7 complex is reduced in Dok7CM / CM mice. Figure 3B shows that MuSK was immunoprecipitated from muscles of wild-type, Dok7CM / CM, and Dok72YF / 2YF mice at E18.5, and blots were probed with antibodies against MuSK or Crk. The levels of Crk co-isolated with the MuSK complex were normalized to MuSK expression. Association of Crk with the MuSK complex was reduced 2.8-fold in Dok7CM / CM mice; scatter plots show values ​​and mean ± SEM values ​​for eight mice of each genotype (p, ****<0.00005). Association of Crk with the MuSK complex was reduced by 24% in Dok72YF / 2YF mice; mean ± SEM values ​​for 4 mice are shown (p, *<0.05, ****<0.00005). [Figure 3C] Figures 3A-3D demonstrate that recruitment of CrK to synapses and to the MuSK / Dok7 complex is impaired in Dok7CM / CM mice. Figure 3C shows that the MuSK juxtamembrane region (JM) contains a binding site for Dok7 (residues 547-554 of SEQ ID NO: 129) and a potential binding site for Crk (residues 554-557 of SEQ ID NO: 129). [Figure 3D]Figures 3A-3D demonstrate that recruitment of CrK to synapses and to the MuSK / Dok7 complex is impaired in Dok7CM / CM mice. Figure 3D shows the results of an experiment in which HA-tagged forms of Dok7 or Crk-I were expressed from transfected 293T cells. Biotin-tagged peptides derived from MuSK JM (SEQ ID NOs: 272-275) were incubated with lysates from transfected 293T cells. The biotin-tagged peptides were captured with streptavidin-agarose beads, and blots of the isolated proteins were probed with antibodies against HA and Crk. Both Dok7 and Crk showed greater binding to the phosphopeptide than to the non-phosphorylated peptide. Mutation of the critical asparagine at position -3 in the consensus (NPXY) PTB binding site of the MuSK JM phosphopeptide prevented Dok7 binding, but not Crk binding. In contrast, mutation of the consensus SH2 site in the MuSK JM phosphopeptide prevented binding of Crk to the MuSK JM phosphopeptide. [Figure 4A] Figures 4A-4F demonstrate that antibodies against MuSK bind with high affinity to human and mouse MuSK, stimulate MuSK phosphorylation in cultured myotubes, and bind to MuSK in vivo. Figure 4A is a table showing KD values ​​of antibody clones against different MuSK antigens tested in monovalent Fab form using a bead binding assay. KD values ​​are the mean and sd from n=3. Titrations are shown in Figures 12A-12C. [Figure 4B] Figures 4A-4F demonstrate that antibodies against MuSK bind with high affinity to human and mouse MuSK, stimulate MuSK phosphorylation in cultured myotubes, and bind to MuSK in vivo. Figure 4B shows the results of an experiment in which C2 myotubes were treated for 30 minutes with biotinylated Fabs, including a negative control Fab (isotype), each tetramerized by preincubation with streptavidin. MuSK was immunoprecipitated, and Western blots were probed with antibodies against MuSK or phosphotyrosine (pTyr). MuSK phosphorylation was normalized to total MuSK expression. Scatter plots show values ​​and means ± SEM for each Fab. [Figure 4C] Figures 4A-4F demonstrate that antibodies against MuSK bind with high affinity to human and mouse MuSK, stimulate MuSK phosphorylation in cultured myotubes, and bind to MuSK in vivo. Figure 4C is a table showing KD values ​​of IgG antibodies against immobilized hFz, hECD, mFz, and mECD tested using a bead-based binding assay. KD values ​​are the mean and SD from n=3. Titrations are shown in Figures 12A-12C. [Figure 4D] Figures 4A-4F demonstrate that antibodies against MuSK bind human and mouse MuSK with high affinity, stimulate MuSK phosphorylation in cultured myotubes, and bind MuSK in vivo. Figure 4D shows the results of an experiment in which C2 myotubes were treated with 10 nM of antibodies X2, X3, or X17 with 0.5 nM of agrin, the Fc region of mouse IgG2, or human IgG1, or an isotype control, and MuSK was analyzed as described in Figure 4B. Scatter plots show values ​​of MuSK phosphorylation normalized to MuSK expression and the mean ± SEM. [Figure 4E] Figures 4A-4F demonstrate that antibodies against MuSK bind with high affinity to human and mouse MuSK, stimulate MuSK phosphorylation in cultured myotubes, and bind to MuSK in vivo. Figure 4E is a plot showing the measured blood half-life of X17-mIgG2a-LALAPG. Nonlinear least-squares fitting of median fluorescence intensity values ​​to a single exponential curve for three mice is shown. The half-life was determined to be 4.9 ± 0.2 days. [Figure 4F]Figures 4A-4F demonstrate that antibodies against MuSK bind with high affinity to human and mouse MuSK, stimulate MuSK phosphorylation in cultured myotubes, and bind to MuSK in vivo. Figure 4F demonstrates that the MuSK antibody mIgG2a-X17 associates with MuSK at synapses and saturates MuSK at 10 mg / kg. P30 wild-type mice were intraperitoneally injected with the MuSK agonist antibody mIgG2a-X17 (0, 0.4, 2, or 10 mg / kg). Two days later, mice were sacrificed, and diaphragm muscles were stained with Alexa488-α-BGT to label AChRs and Alexa647 goat anti-human IgG, F(ab')2 fragment-specific, to label X17. The saturation level of mIgG2a-X17 at synapses was measured by the ratio of X17 to AChR signal intensity. The mean ± SEM values ​​from three mice at each concentration are shown. [Figure 5A] Figures 5A-5E demonstrate that the agonistic antibody mIgG2a-X17 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 5A shows that Dok7 1124_1127 dup mice on a C57BL / 6-CBA mixed background survive 1-2 weeks after birth. Dok7 1124_1127 dup mice on a mixed background were treated with the agonistic antibody mIgG2a-X17 or an isotype-equivalent negative control on P4. Dok7 1124_1127 dup mice (n = 11) injected with an isotype control died between 1 and 2 weeks of age, similar to untreated mice, whereas Dok7 1124_1127 dup mice (n = 12) injected with mIgG2a-X17 on days 4, 24, and 44 survived to adulthood. Of the 12 mutant mice injected with X17, six were sacrificed on day 60. Three mutant mice injected with X17 died at 3 weeks of age, just before the second scheduled injection. Three mutant mice were aged for disease recurrence experiments. Scatter plots show survival times and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 5B]Figures 5A-5E demonstrate that the agonist antibody mIgG2a-X17 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 5B shows that Dok7 1124_1127 dup mice injected with mIgG2a-X17, but not Dok7 1124_1127 dup mice treated with an isotype control antibody, gained weight. Dok7 1124_1127 dup mice were injected with mIgG2a-X17 (10 mg / kg) on ​​days 4, 24, and 44. [Figure 5C] Figures 5A-5E demonstrate that the agonist antibody mIgG2a-X17 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 5C demonstrates that mIgG2a-X17 restores synapse development in young Dok7 1124_1127 dup mice. Diaphragm muscles from P60 wild-type and Dok7 1124_1127 mice were stained with Alexa488-α-BGT to label AChRs and with an antibody against βIII tubulin / synapsin to label motor axons / nerve terminals. In Dok7 1124_1127 dup mice treated with mIgG2a-X17, synapses matured from simple plaque-like shapes to complex pretzel-like shapes characteristic of mature mouse neuromuscular synapses. Scale bar = 10 mm. In Dok7 1124_1127 dup mice treated with mIgG2a-X17, synapse number, synapse size, and synaptic AChR density were restored to 60%, 60%, and 68% of normal levels, respectively. Mean ± SEM values ​​from three mice (>50 synapses per mouse) are shown (ns, **<0.005, ****<0.00005). [Figure 5D]Figures 5A-5E demonstrate that the agonist antibody mIgG2a-X17 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 5D shows that in single muscle fibers isolated from the tibialis anterior muscle of X17-rescued Dok7 1124_1127 dup mice, Crk-L (center panel) is concentrated at synapses marked by AChRs (left panel) and nerve terminals (right panel). Mean ± SEM values ​​from three mice (10 synapses per mouse; ns, not significant). Scale bar = 5 µm. [Figure 5E] Figures 5A-5E demonstrate that mIgG2a-X17, an agonist antibody against MuSK, rescues lethality in young Dok7 1124_1127 dup mice. Figure 5E is a graph showing that mIgG2a-X17 rescues the motor performance of Dok7 1124_1127 dup mice. The motor performance of Dok 1124 1127 dup mice, as assessed by grip strength and latency to fall from a rotating rotarod, was completely restored by treatment with mIgG2a-X17. Scatter plots show values ​​and mean ± SEM values ​​for 18 wild-type mice and 9 Dok7 1124_1127 dup mice rescued with X17 (ns, not significant). [Figure 6A]Figures 6A-6C demonstrate that mIgG2a-X17 reverses disease relapse in adult Dok7 1124_1127 dup mice. Mice were injected with mIgG2a-X17 (10 mg / kg) on ​​either P4, P24, and P44, or P4 and P18, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight (Figures 6A-6B) and exhibit motor deficits, as assessed by grip strength and latency to fall from a rotating rotarod (Figure 6C). At this point, mice were reinjected with either no mIgG2a-X17 (Figure 6A) or mIgG2a-X17 (Figure 6B). While mice that were not reinjected died within a few days (Figure 6A), after resuming mIgG2a-X17 treatment, Dok7 1124_1127 dup mice began to gain weight (Figure 6B) and their motor deficits reversed by 1 week after treatment was resumed (Figure 6C). Dok7 1124_1127 dup mice showed a 5.5-fold improvement in motor performance on the rotarod and a 1.25-fold improvement in grip strength (p, *<0.05, ***<0.0005 (Figure 6C)). [Figure 6B]Figures 6A-6C demonstrate that mIgG2a-X17 reverses disease relapse in adult Dok7 1124_1127 dup mice. Mice were injected with mIgG2a-X17 (10 mg / kg) on ​​either P4, P24, and P44, or P4 and P18, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight (Figures 6A-6B) and exhibit motor deficits, as assessed by grip strength and latency to fall from a rotating rotarod (Figure 6C). At this point, mice were reinjected with either no mIgG2a-X17 (Figure 6A) or mIgG2a-X17 (Figure 6B). While mice that were not reinjected died within a few days (Figure 6A), after resuming mIgG2a-X17 treatment, Dok7 1124_1127 dup mice began to gain weight (Figure 6B) and their motor deficits reversed by 1 week after treatment was resumed (Figure 6C). Dok7 1124_1127 dup mice showed a 5.5-fold improvement in motor performance on the rotarod and a 1.25-fold improvement in grip strength (p, *<0.05, ***<0.0005 (Figure 6C)). [Figure 6C]Figures 6A-6C demonstrate that mIgG2a-X17 reverses disease relapse in adult Dok7 1124_1127 dup mice. Mice were injected with mIgG2a-X17 (10 mg / kg) on ​​either P4, P24, and P44, or P4 and P18, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight (Figures 6A-6B) and exhibit motor deficits, as assessed by grip strength and latency to fall from a rotating rotarod (Figure 6C). At this point, mice were reinjected with either no mIgG2a-X17 (Figure 6A) or mIgG2a-X17 (Figure 6B). While mice that were not reinjected died within a few days (Figure 6A), after resuming mIgG2a-X17 treatment, Dok7 1124_1127 dup mice began to gain weight (Figure 6B) and their motor deficits reversed by 1 week after treatment was resumed (Figure 6C). Dok7 1124_1127 dup mice showed a 5.5-fold improvement in motor performance on the rotarod and a 1.25-fold improvement in grip strength (p, *<0.05, ***<0.0005 (Figure 6C)). [Figure 7] Figure 7 shows synaptic endplate width, denervation, and colocalization in Dok7 CM (i.e., Dok7 1124_1127 dup) mice. The width of the endplate band (dashed line) was increased by 45% in Dok7CM / CM mice but was normal in Dok72YF / 2YF mice. In Dok7CM / CM mice, 17% of AChR clusters were not fully opposed by nerve terminals, suggesting denervated muscle fibers. Many synapses in Dok7CM / CM mice were partially innervated, as nearly half of the AChR-enriched region in the synapse was not apposed to nerve terminals. Mean ± SEM values ​​(100 synapses per mouse) from three mice of each genotype are shown (p, *<0.05; p, **<0.005; p, ***<0.0005; p, ****<0.00005; ns: not significant). Scale bar = 50 μm. [Figure 8]Figure 8 demonstrates that Y396 and Y406F in the carboxy-terminal region of Dok7 are not essential for the maturation of neuromuscular synapses. Diaphragm muscles from wild-type and Dok72YF / 2YF mice at P35 were stained with Alexa488-α-BGT to label AChRs and with antibodies against neurofilament / synapsin to label motor axons / nerve terminals. Scale bar = 10 μm. In Dok72YF / 2YF mice, synapses matured from plaque-like shapes to complex pretzel-like shapes characteristic of mature mouse neuromuscular synapses. The number of synapses was similar in wild-type and Dok72YF / 2YF mice. Synaptic AChR density and synapse size were 15% and 20%, respectively, greater in Dok72YF / 2YF mice than in wild-type mice. Mean ± SEM values ​​(100 synapses per mouse) from three mice are shown (ns, not significant; p, ***<0.0005, ****<0.00005). [Figure 9A] Figures 9A-9B demonstrate that wild-type and truncated Dok7 are detected with similar efficiency using antibodies against the PH / PTB domain of Dok7. Figure 9A shows the results of an experiment in which HEK293 cells were transiently transfected with plasmids expressing either HA-tagged Dok7 or HA-tagged truncated Dok7 encoded by the Dok7 1124_1127 TGCC dup. Proteins (in triplicate) in cell lysates were separated by SDS-PAGE, and Western blots were probed with either a rabbit antibody against the PTB domain of Dok7 or a monoclonal antibody against HA. The gray levels of the bands for wild-type and truncated Dok7 proteins were measured, and Western blot detection levels were normalized to those of the rabbit antibody against Dok7, and Western blot detection levels were normalized to those of the antibody against HA. The ratio of wild-type Dok7 was comparable to that of truncated Dok7, indicating that the rabbit antibody against Dok7 detected wild-type and truncated Dok7 proteins with similar efficiency by Western blotting. [Figure 9B]Figures 9A-9B demonstrate that wild-type and truncated Dok7 are detected with similar efficiency by antibodies against the PH / PTB domain of Dok7. Figure 9B shows the results of an experiment in which wild-type and truncated Dok7 were immunoprecipitated with similar efficiency by a goat antibody against the PTB domain of Dok7. HEK293 cells were transiently cotransfected with plasmids expressing HA-tagged Dok7 encoded by the Dok7 1124_1127 TGCC dup and HA-tagged truncated Dok7. Dok7 protein was immunoprecipitated from cell lysates (in triplicate) with either a monoclonal antibody against HA or a goat antibody against the PTB domain of Dok7, and Western blots were probed with a monoclonal antibody against HA. Gray levels were measured, the level of background bands in control, untransfected samples was subtracted, and the values ​​for each protein immunoprecipitated with the goat antibody against Dok7 were normalized to the value for the same protein immunoprecipitated with an antibody against HA. This ratio was comparable for wild-type and truncated Dok7 proteins, indicating that the goat antibody against Dok7 immunoprecipitated the wild-type and truncated proteins with similar efficiency. The scatter plots in Figures 9A-9B show values ​​and means ± SEM from three experiments (ns, not significant). [Figure 10A] Figures 10A-10C demonstrate that Dok7 RNA expression is normal in Dok7CM / CM mice. Figure 10A shows that RT-PCR amplification of Dok7 RNA demonstrated similar Dok7 mRNA levels in muscles from wild-type and Dok7CM / CM mice at E18.5. GAPDH was used as a loading control. [Figure 10B] Figures 10A-10C demonstrate that Dok7 RNA expression is normal in Dok7CM / CM mice. Figure 10B shows the results of an experiment in which Dok7 mRNA levels were quantified by qPCR. The results demonstrated that Dok7 mRNA levels were normal in Dok7CM / CM mice. Scatter plots show values ​​from three mice and mean ± SEM values ​​(ns, not significant). [Figure 10C] Figures 10A-10C demonstrate that Dok7 RNA expression is normal in Dok7CM / CM mice. Figure 10C shows the results of an experiment in which Dok7 was immunoprecipitated from muscle of E18.5 wild-type and Dok7CM / CM mice and blots were probed with an antibody to Dok7. The truncated Dok7 (t-Dok7) encoded by Dok7CM / CM migrates at the predicted size but is expressed at a level three-fold lower than wild-type Dok7. Scatter plots show values ​​and mean ± SEM values ​​for 10 mice from each genotype (p, ****<0.00005). [Figure 11] Figure 11 demonstrates that Y396 and Y406 are the major tyrosine residues in Dok7 phosphorylated by agrin stimulation, if not the only tyrosine residues. Muscle cell lines were generated from wild-type and Dok72YF / 2YF mice, and cultured myotubes were treated with agrin for 30 minutes. MuSK was immunoprecipitated, and Western blots were probed with antibodies against MuSK or phosphotyrosine (pTyr). Agrin stimulates Dok7 tyrosine phosphorylation in wild-type but not Dok72YF / 2YF myotubes. [Figure 12A] Figures 12A-12C show the binding characteristics of MuSK antibody clones. Figures 12A-12C show the binding titration of antibodies against MuSK in Fab form to immobilized hFz, hECD, mFz, and mECD when tested using a bead-based binding assay. The curves show the best fit of a 1:1 binding model. KD values ​​are listed in Figure 5A. The data sets in Figures 12A and 12B were measured on different instruments, resulting in different signal ranges. [Figure 12B] Figures 12A-12C show the binding characteristics of MuSK antibody clones. Figures 12A-12C show the binding titration of antibodies against MuSK in Fab form to immobilized hFz, hECD, mFz, and mECD when tested using a bead-based binding assay. The curves show the best fit of a 1:1 binding model. KD values ​​are listed in Figure 5A. The data sets in Figures 12A and 12B were measured on different instruments, resulting in different signal ranges. [Figure 12C] Figures 12A-12C show the binding characteristics of MuSK antibody clones. Figures 12A-12C show the binding titration of antibodies against MuSK in Fab form to immobilized hFz, hECD, mFz, and mECD when tested using a bead-based binding assay. The curves show the best fit of a 1:1 binding model. KD values ​​are listed in Figure 5A. Figure 12C shows the binding titration of antibodies against MuSK in IgG form, performed in a manner similar to Figure 12A. [Figure 13A] Figures 13A-13D demonstrate that chronic injection of the MuSK agonist antibody mIgG2a-X17 in wild-type mice does not affect survival, neuromuscular synaptic organization, weight gain, or motor behavior. Figure 13A is a scatter plot showing the results of an experiment in which wild-type mice (n=4) on a C57BL / 6-CBA mixed background injected with mIgG2a-X17 at P4, P24, and P44 survived until P60 when they were sacrificed. The scatter plot shows the survival times of nine uninjected wild-type mice and four wild-type mice injected with mIgG2a-X17, as well as the mean ± SEM values ​​(ns, not significant). [Figure 13B] Figures 13A-13D demonstrate that chronic injection of the MuSK agonist antibody mIgG2a-X17 in wild-type mice does not affect survival, neuromuscular synaptic organization, weight gain, or motor behavior. Figure 13B is a plot showing the results of an experiment in which wild-type mice injected with mIgG2a-X17 (n=4) gained weight similar to wild-type mice (n=9). [Figure 13C]Figures 13A-13D demonstrate that chronic injection of the MuSK agonist antibody mIgG2a-X17 in wild-type mice does not affect survival, neuromuscular synapse organization, weight gain, or motor behavior. Figure 13C shows that chronic injection of mIgG2a-X17 in wild-type mice does not affect neuromuscular synapse organization. Diaphragm muscles from P60 wild-type mice and wild-type mice injected with mIgG2a-X17 were stained with Alexa488-α-BGT to label acetylcholine receptors (AChRs) and with an antibody against βIII tubulin / synapsin to label motor axons / nerve terminals. In wild-type mice treated with mIgG2a-X17, synapses matured from simple plaque-like shapes to complex pretzel-like shapes characteristic of mature mouse neuromuscular synapses. Scale bar = 10 mm. Injection of mIgG2a-X17 in wild-type mice does not affect synapse number, synapse size, and AChR density. One hundred synapses from two mice in each category were analyzed. [Figure 13D] Figures 13A-13D demonstrate that chronic injection of the MuSK agonist antibody mIgG2a-X17 in wild-type mice does not affect survival, neuromuscular synaptic organization, weight gain, or motor behavior. Figure 13D is a scatter plot showing that chronic injection of mIgG2a-X17 in wild-type mice does not affect motor behavior. The motor performance of wild-type mice injected with mIgG2a-X17, as assessed by grip strength and latency to fall from a rotating rotarod, was similar to that of uninjected wild-type mice. The scatter plots show values ​​for 18 wild-type mice and 4 wild-type mice injected with mIgG2a-X17, as well as mean ± SEM values ​​(ns, not significant). [Figure 14A]Figures 14A and 14B are tables showing that Dok7CM / CM mice with mixed genetic backgrounds survive approximately two weeks after birth. The survival of Dok7CM / CM mice was analyzed using mixed genetic background mice. Dok7CM / + mice with a C57BL / 6 background were mated with wild-type CBA, 129svl, FVB, or BALB / c mice. Heterozygous F1 offspring were then intercrossed to generate mixed-background Dok7CM / CM mice. Genotypes were determined in the offspring at P5 to P10 or at postmortem. Figure 14A is a table showing a chi-square analysis of F2 mice. The table indicates that the occurrence of the genotypes is unlikely due to chance, and shows that homozygous Dok7CM / CM mice with each mixed genetic background survive postnatally. [Figure 14B] Figures 14A-14B are tables showing that Dok7CM / CM mice on mixed genetic backgrounds survive approximately two weeks after birth. Survival of Dok7CM / CM mice was analyzed using mixed genetic background mice. Dok7CM / + mice on a C57BL / 6 background were mated with wild-type CBA, 129svl, FVB, or BALB / c mice. Heterozygous F1 offspring were then intercrossed to generate mixed background Dok7CM / CM mice. Genotypes were determined at P5-P10 offspring or postmortem. Figure 14B is a table showing the mean and maximum survival times (in days) of homozygous Dok7CM / CM mice on a mixed genetic background. [Figure 15A]Figures 15A-15E demonstrate that the C-terminal region of Dok7 is essential for the complete differentiation and maturation of neuromuscular synapses in Dok7CM / CM mice with a mixed genetic background. In Figures 15A-15C, diaphragm muscles from wild-type mice and Dok7CM / CM mice with a C57BL / 6-CBA mixed genetic background at E18.5 and P10 were stained with Alexa488-α-BGT to label AChRs (red) and with antibodies against neurofilament / synapsin to label motor axons / nerve terminals (green). Figure 15A shows that at E18.5, the endplate band (white dashed line) is 30% wider in Dok7CM / CM mice than in wild-type mice. Furthermore, in Dok7CM / CM mice, 15% of AChR clusters lacked nerve terminals, and the colocalization index (synapsin / AChR) was 3.5-fold reduced. Scale bar = 50 μm. Mean ± SEM values ​​from three mice are shown (p, *<0.05; p, ****<0.00005). [Figure 15B] Figures 15A-15E show that the C-terminal region of Dok7 is essential for the complete differentiation and maturation of neuromuscular synapses in Dok7CM / CM mice with a mixed genetic background. In Figures 15A-15C, diaphragm muscles from wild-type mice and Dok7CM / CM mice with a C57BL / 6-CBA mixed genetic background at E18.5 and P10 were stained with Alexa488-α-BGT to label AChRs (red) and with antibodies against neurofilament / synapsin to label motor axons / nerve terminals (green). Figure 15B shows that the number of synapses, synapse size, and density of synaptic AChRs were reduced 3.2-fold, 4.5-fold, and 8-fold, respectively, in Dok7CM / CM mice at E18.5. Mean ± SEM values ​​from three mice (100 synapses per mouse) are shown (p, ****<0.00005). Scale bar = 10 μm. [Figure 15C]Figures 15A-15E show that the C-terminal region of Dok7 is essential for the complete differentiation and maturation of neuromuscular synapses in Dok7CM / CM mice with a mixed genetic background. In Figures 15A-15C, diaphragm muscles from wild-type mice and Dok7CM / CM mice with a mixed C57BL / 6-CBA genetic background at E18.5 and P10 were stained with Alexa488-α-BGT to label AChRs (red) and with antibodies against neurofilament / synapsin to label motor axons / nerve terminals (green). Figure 15C shows that at P10, the number of synapses, synapse size, and density of synaptic AChRs were reduced by more than 10-fold in Dok7CM / CM mice. In addition, nerve terminals were lost from 20% of AChR clusters in Dok7CM / CM mice. Mean ± SEM values ​​(100 synapses per mouse) from three mice are shown (p, ****<0.00005). [Figure 15D] Figures 15A-15E show that the C-terminal region of Dok7 is essential for the complete differentiation and maturation of neuromuscular synapses in Dok7CM / CM mice with a mixed genetic background. Figure 15D shows that Dok7 was immunoprecipitated from muscles of wild-type and Dok7CM / CM mice at E18.5, and blots were probed with an antibody against Dok7. The truncated Dok7 (t-Dok7) encoded by Dok7CM / CM migrates at the predicted size but is expressed at a level threefold lower than wild-type Dok7. Because Dok7 expression and MuSK phosphorylation were similarly reduced in C57BL / 6-CBA mixed-breed and C57BL / 6 inbred mice, it is presumed that other factors contribute to the increased survival rate in the mixed genetic background. Scatter plots show values ​​and mean ± SEM values ​​for eight mice from each genotype (p, ****<0.00005). [Figure 15E]Figures 15A-15E show that the C-terminal region of Dok7 is essential for the complete differentiation and maturation of neuromuscular synapses in Dok7CM / CM mice of mixed genetic backgrounds. Figure 15E shows that MuSK was immunoprecipitated from wild-type, Dok7CM / CM muscle at El8.5, and blots were probed with antibodies against MuSK, phosphotyrosine, and Crk. The levels of phosphotyrosine and Crk, which co-segregate with the MuSK complex, were normalized to MuSK expression. Association of Crk with the MuSK complex was 2.8-fold lower in Dok7CM / CM mice than in wild-type mice. MuSK tyrosine phosphorylation was 5-fold lower in Dok7CM / CM mice than in wild-type mice. Scatter plots show values ​​for three mice of each genotype and mean ± SEM values ​​(p, **<0.005, ****<0.00005). Scale bar = 10 μm. [Figure 16A] Figures 16A-16B are tables showing that sequence analysis of potential off-target sites failed to identify mutations in these genes. Figure 16A shows the top potential off-target gene sequences 1-5 (SEQ ID NOs: 280-284) in Dok 7CM mice. [Figure 16B] Figures 16A-16B are tables showing that sequence analysis of potential off-target sites failed to identify mutations in these genes. Figure 16B shows the top potential off-target gene sequences 1-5 (SEQ ID NOs: 285-289) in Dok72YF mice. [Figure 17A] Figures 17A-17C are graphs showing that antibodies X2 and X3, like X17, rescued Dok7CM / CM mice from early lethality. Figure 17A shows the results of an experiment in which Dok7CM / CM mice on a mixed C57BL / 6-CBA background were injected with 10 mg / kg mIgG2a-X3 on P4 (see also Figure 46B). At this dose, X3 failed to rescue the mice from lethality. [Figure 17B]Figures 17A-17C are graphs showing that antibodies X2 and X3, like X17, rescued Dok7CM / CM mice from early lethality. Figure 17B, in contrast, shows that treatment with 20 mg / kg mIgG2a-X3 at P4 rescued the mice from early lethality (see also Figure 17B). These mice were subsequently injected with 10 mg / kg mIgG2a-X3 at P18 and survived until P60, when the mice were sacrificed. [Figure 17C] Figures 17A-17C are graphs showing that antibodies X2 and X3, like X17, rescued Dok7CM / CM mice from early lethality. Figure 17C shows that administration of 20 mg / kg hIgG1-X2 to Dok7CM / CM mice on P4 similarly rescued Dok7CM / CM mice from early lethality. Subsequent injection of 10 mg / kg hIgG1-X2 on P18 resulted in Dok7CM / CM mice surviving until P60, when the mice were sacrificed. [Figure 18] FIG. 18 is a schematic outlining the strategy for phage display selection of a llama immune Fab library. [Figure 19] FIG. 19 shows the results of an ELISA experiment demonstrating poor binding of antibodies to human or mouse MuSK. [Figure 20] FIG. 20 is a plot demonstrating that 3B2 rescues early postnatal lethality of Dok7 1124 — 1127 dup mice. [Figure 21] FIG. 21 is a graph showing the percent phosphorylation induced by MuSK antibodies of the invention in a C2C12 phosphorylation assay. [Figure 22] FIG. 22 is a graph showing the binding affinity of the 3B2 antibody and 3B2 antibody variants to human, cynomolgus monkey, rat or mouse MuSK as measured via ELISA. [Figure 23]Figure 23 is a graph showing the binding of MuSK agonist Fabs (Fab X17, Fab X2, Fab X2m4, Fab X3, Fab 3B2, Fab 3B2g2m1, Fab X9) to mouse MuSK at pH 7.4 and pH 5.5 in a Biacore. [Figure 24] FIG. 24 is a scatter plot showing that MuSK phosphorylation can be costimulated by the natural ligand agrin and the agonist MuSK-mAb 3B2g2m1, which targets the Fz domain of MuSK. [Figure 25A] Figures 25A-B demonstrate that a combination of the agonistic antibody mIgG2a-X17 against MuSK and hIgG-X17 rescues lethality in young Dok7 1124_1127 dup mice. Figure 25A is a scatter plot showing that Dok7 1124_1127 dup mice on a C57BL / 6-CBA mixed background survive 1-2 weeks after birth. Dok7 1124_1127 dup mice on a mixed background were treated with the agonistic antibody X17 or the isotype-equivalent negative control, motavizumab, on P4. Dok7 1124_1127 dup mice injected with isotype control (n = 11) died within 1 to 2 weeks of age, similar to untreated mice, whereas Dok7 1124_1127 dup mice (n = 3) injected with mIgG2a-X17 on P4 and hIgG-X17 on P24 and P44 survived to adulthood. Mutant mice injected with mIgG2a-X17 followed by hIgG-X17 were sacrificed on P60. Scatter plots show survival times and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 25B]Figures 25A-25B demonstrate that a combination of the agonist antibody mIgG2a-X17 against MuSK and hIgG-X17 rescues lethality in young Dok7 1124_1127 dup mice. Figure 25B is a plot showing that Dok7 1124_1127 dup mice injected with mIgG2a-X17 followed by hIgG-X17 gained weight, unlike Dok7 1124_1127 dup mice treated with an isotype control antibody. Dok7 1124_1127 dup mice were injected with mIgG2a-X17 (10 mg / kg) on ​​P4 and hIgG-X17 (10 mg / kg) on ​​P24 and P44. [Figure 26] Figure 26 demonstrates that the combination of mIgG2a-X17 and hIgG-X17 rescues the motor performance of Dok7 1124_1127 dup mice. The motor performance of Dok7 1124_1127 dup mice, as assessed by grip strength (left panel) and latency to fall from a rotating rotarod (right panel), was fully restored by treatment with the combination of mIgG2a-X17 and hIgG-X17. The scatter plot shows values ​​and mean ± SEM values ​​for 27 wild-type mice and 3 Dok7 1124_1127 dup mice rescued with the combination of mIgG2a-X17 and hIgG-X17 (ns, not significant). [Figure 27] Figure 27 demonstrates that the MuSK agonist antibody hIgG-X17 associates with MuSK at synapses and saturates MuSK at 20 mg / kg. P40 wild-type mice were intraperitoneally injected with the MuSK agonist antibody hIgG-X17 (0, 2, 10, or 20 mg / kg). Two days later, the mice were sacrificed, and diaphragm muscles were stained with Alexa488-α-BGT to label AChR and Alexa647 goat anti-human IgG, F(ab')2 fragment-specific, to label X17. The saturation level of X17 at synapses was measured by the ratio of X17 to AChR signal intensity. Mean ± SEM values ​​from three mice at each concentration are shown. [Figure 28A]Figures 28A-B demonstrate that hIgG-X17, an agonistic antibody against MuSK, rescues lethality in young Dok7 1124_1127 dup mice. Figure 28A is a scatter plot showing that Dok7 1124_1127 dup mice on a C57BL / 6-CBA mixed background survive 1-2 weeks after birth. Dok7 1124_1127 dup mice on a mixed background were treated with the agonistic antibody gG-X17 or the isotype-equivalent negative control motavizumab at P4. Dok7 1124_1127 dup mice (n = 11) injected with an isotype control died within 1 to 2 weeks of age, similar to untreated mice, whereas Dok7 1124_1127 dup mice (n = 4) injected with hIgG-X17 at P4, P18, and P38 or P4 and P18 survived to adulthood. Of the four mutant mice injected with hIgG-X17, two were sacrificed at P60, and two mutant mice were aged for disease recurrence experiments. Scatter plots show survival times and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 28B] Figures 28A-28B demonstrate that hIgG-X17, an agonist antibody against MuSK, rescues lethality in young Dok7 1124_1127 dup mice. Figure 28B is a plot showing that Dok7 1124_1127 dup mice injected with hIgG-X17 gained weight, unlike Dok7 1124_1127 dup mice treated with an isotype control antibody. Dok7 1124_1127 dup mice were injected with hIgG-X17 at P4 (20 mg / kg), P18, and P38 (10 mg / kg), or P4 (20 mg / kg) and P18 (10 mg / kg). [Figure 29]Figure 29 demonstrates that hIgG-X17 restores synapse development in young Dok7 1124_1127 dup mice. Diaphragm muscles from P60 wild-type and Dok7 1124_1127 dup mice were stained with Alexa488-α-BGT to label AChRs and with an antibody against βIII tubulin / synapsin to label motor axons / nerve terminals. In Dok7 1124_1127 dup mice treated with hIgG-X17, synapses matured from simple plaque-like shapes to complex pretzel-like shapes characteristic of mature mouse neuromuscular synapses. Scale bar = 10 mm. In Dok7 1124_1127 dup mice treated with hIgG-X17, synapse number, synapse size, and synaptic AChR density were restored to 70%, 50%, and 40% of normal levels, respectively. Mean ± SEM values ​​from two mice (>50 synapses per mouse) are shown. [Figure 30] Figure 30 demonstrates that hIgG-X17 rescues the motor performance of Dok7 1124_1127 dup mice. The motor performance of Dok7 1124_1127 dup mice, as assessed by grip strength (left panel) and latency to fall from a rotating rotarod (right panel), was fully restored by treatment with hIgG-X17. Scatter plots show values ​​and mean ± SEM values ​​for 27 wild-type mice and 2 hIgG-X17-rescued Dok7 1124_1127 dup mice. [Figure 31A]Figures 31A-31C demonstrate that hIgG-X17 reverses disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with a MuSK agonist antibody at either P4, P24, and P44, or P4 and P18, after which antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight (Figures 31A and 31B) and exhibit motor deficits, as assessed by grip strength and latency to fall from a rotating rotarod (Figure 31C). At this time, mice were either not reinjected (Figure 31A) or reinjected (Figure 31B) with hIgG-X17. Mice that were not reinjected died within a few days (Figure 31A), whereas after resuming X17 treatment, Dok7 1124_1127 dup mice began to gain weight (Figure 31B) and their motor deficits reversed by 1 week after resumption of treatment (Figure 31C, left panel). Dok7 1124_1127 dup mice showed a 3.25-fold improvement in performance on the rotarod, compared with a 1.30-fold improvement in performance in wild-type mice (p, ***<0.0005). Dok7 1124_1127 dup mice showed a 1.30-fold improvement in grip strength, compared with a 1.30-fold improvement in performance in wild-type mice (p, ***<0.0005) (Figure 31C). [Figure 31B]Figures 31A-31C demonstrate that hIgG-X17 reverses disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with a MuSK agonist antibody at either P4, P24, and P44, or P4 and P18, after which antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight (Figures 31A and 31B) and exhibit motor deficits, as assessed by grip strength and latency to fall from a rotating rotarod (Figure 31C). At this time, mice were either not reinjected (Figure 31A) or reinjected (Figure 31B) with hIgG-X17. Mice that were not reinjected died within a few days (Figure 31A), whereas after resuming X17 treatment, Dok7 1124_1127 dup mice began to gain weight (Figure 31B) and their motor deficits reversed by 1 week after resumption of treatment (Figure 31C, left panel). Dok7 1124_1127 dup mice showed a 3.25-fold improvement in performance on the rotarod, compared with a 1.30-fold improvement in performance in wild-type mice (p, ***<0.0005). Dok7 1124_1127 dup mice showed a 1.30-fold improvement in grip strength, compared with a 1.30-fold improvement in performance in wild-type mice (p, ***<0.0005) (Figure 31C). [Figure 31C]Figures 31A-31C demonstrate that hIgG-X17 reverses disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with a MuSK agonist antibody at either P4, P24, and P44, or P4 and P18, after which antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight (Figures 31A and 31B) and exhibit motor deficits, as assessed by grip strength and latency to fall from a rotating rotarod (Figure 31C). At this time, mice were either not reinjected (Figure 31A) or reinjected (Figure 31B) with hIgG-X17. Mice that were not reinjected died within a few days (Figure 31A), whereas after resuming X17 treatment, Dok7 1124_1127 dup mice began to gain weight (Figure 31B) and their motor deficits reversed by 1 week after resumption of treatment (Figure 31C, left panel). Dok7 1124_1127 dup mice showed a 3.25-fold improvement in performance on the rotarod, compared with a 1.30-fold improvement in performance in wild-type mice (p, ***<0.0005). Dok7 1124_1127 dup mice showed a 1.30-fold improvement in grip strength, compared with a 1.30-fold improvement in performance in wild-type mice (p, ***<0.0005) (Figure 31C). [Figure 32A] Figures 32A-B demonstrate that chronic injection of 3B2 in wild-type mice does not affect survival or weight gain. Figure 32A is a scatter plot showing that wild-type mice on a C57BL / 6-CBA mixed background injected with 3B2 (n=3) on P4 and P18 survived until sacrifice on P38. The scatter plot shows the survival times of four uninjected wild-type mice and three 3B2-injected wild-type mice, as well as the mean ± SEM values ​​(ns, not significant). [Figure 32B] Figures 32A-B demonstrate that chronic injection of 3B2 in wild-type mice does not affect survival or weight gain. Figure 32B is a scatter plot showing that wild-type mice injected with 3B2 (n=3) gained weight similar to wild-type mice (n=4). [Figure 33A] Figures 33A-B demonstrate that the 3B2 agonist antibody against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 33A is a scatter plot showing that Dok7 1124_1127 dup mice on a C57BL / 6-CBA mixed background survive 1-2 weeks after birth. Dok7 1124_1127 dup mice on a mixed background were treated with the agonist antibody 3B2 or the isotype-equivalent negative control, motavizumab, on P4. Dok7 1124_1127 dup mice (n = 11) injected with an isotype control died within 1 to 2 weeks of age, similar to untreated mice, whereas Dok7 1124_1127 dup mice injected with 3B2 (n = 3) at P4, P18, and P38, or P4 and P18, survived to adulthood. Of the three mutant mice injected with 3B2, two were sacrificed at P60, and one mutant mouse was aged for disease recurrence experiments. Scatter plots show survival times and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 33B] Figures 33A-B demonstrate that the 3B2 agonist antibody against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 33B is a scatter plot showing that Dok7 1124_1127 dup mice injected with 3B2 gained weight, unlike Dok7 1124_1127 dup mice treated with an isotype control antibody. Dok7 1124_1127 dup mice were injected with 3B2 at P4 (20 mg / kg), P18, and P38 (10 mg / kg). [Figure 34]Figure 34 demonstrates that 3B2 restores synapse development in young Dok7 1124_1127 dup mice. Diaphragm muscles from P60 wild-type and Dok7 1124_1127 dup mice were stained with Alexa488-α-BGT to label AChRs and with an antibody against βIII tubulin / synapsin to label motor axons / nerve terminals. In 3B2-treated Dok7 1124_1127 dup mice, synapses matured from simple plaque-like shapes to complex pretzel-like shapes characteristic of mature mouse neuromuscular synapses. Scale bar = 10 mm. In 3B2-treated Dok7 1124_1127 dup mice, synapse number, synapse size, and synaptic AChR density were restored to 80%, 75%, and 40% of normal levels, respectively. Mean ± SEM values ​​from two mice (>50 synapses per mouse) are shown. [Figure 35] Figure 35 demonstrates that 3B2 rescues the motor performance of Dok7 1124_1127 dup mice. The motor performance of Dok7 1124_1127 dup mice, as assessed by grip strength (left panel) and latency to fall from a rotating rotarod (right panel), was fully restored by treatment with 3B2. Scatter plots show values ​​and mean ± SEM values ​​for 27 wild-type mice and two 3B2-rescued Dok7 1124_1127 dup mice. [Figure 36] Figure 36 demonstrates that 3B2 keeps Dok7 1124_1127 dup mice healthy for at least two months. Dok7 1124_1127 dup mice were injected with 3B2 on days P4, P18, and P38, after which antibody treatment was discontinued. The Dok7 1124_1127 dup mice gained weight and remained mobile for several months, but eventually began to lose weight and died within a few days. [Figure 37]Figure 37 demonstrates that 3B2 reverses disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with mIgG2a-X17 on P4, P24, and P44, after which antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and remained mobile for several months, but eventually began to lose weight. At this point, the mice were reinjected with 3B2. After resuming treatment with 3B2, the Dok7 1124_1127 dup mice began to gain weight. [Figure 38A] Figures 38A-B demonstrate that chronic injection of hIgG-X2 in wild-type mice does not affect survival or weight gain. Figure 38A is a scatter plot showing that wild-type mice (n=3) on a C57BL / 6-CBA mixed background injected with hIgG-X2 on P4 and P18 survived until sacrifice on P38. The scatter plot shows survival times and mean ± SEM values ​​for four uninjected wild-type mice and three wild-type mice injected with hIgG-X2 (ns, not significant). [Figure 38B] Figures 38A-B demonstrate that chronic injection of hIgG-X2 in wild-type mice does not affect survival or weight gain. Figure 38B is a scatter plot showing that wild-type mice injected with hIgG-X2 (n=3) gained weight similarly to wild-type mice (n=4). [Figure 39A]Figures 39A-B demonstrate that hIgG-X2, an agonistic antibody against MuSK, rescues lethality in young Dok7 1124_1127 dup mice. Figure 39A is a scatter plot showing that Dok7 1124_1127 dup mice on a C57BL / 6-CBA mixed background survive 1-2 weeks after birth. Dok7 1124_1127 dup mice on a mixed background were treated with the agonistic antibody gG-X2 or the isotype-equivalent negative control motavizumab on P4. Dok7 1124_1127 dup mice (n = 11) injected with an isotype control died within 1 to 2 weeks of age, similar to untreated mice, whereas Dok7 1124_1127 dup mice (n = 2) injected with hIgG-X2 at P4 and P18 survived to adulthood. Mutant mice injected with hIgG-X2 were aged for disease recurrence experiments. Scatter plots show survival times and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 39B] Figures 39A-39B demonstrate that hIgG-X2, an agonist antibody against MuSK, rescues lethality in young Dok7 1124_1127 dup mice. Figure 39B is a scatter plot showing that Dok7 1124_1127 dup mice injected with hIgG-X2, but not Dok7 1124_1127 dup mice treated with an isotype control antibody, gained weight. Dok7 1124_1127 dup mice were injected with hIgG-X2 at P4 (20 mg / kg) and P18 (10 mg / kg). [Figure 40A]Figures 40A-B demonstrate that hIgG-X2 reverses disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with hIgG-X2 on P4 and P18, after which antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained their mobility for several weeks, but eventually began to lose weight (Figure 40A) and exhibit motor deficits, as assessed by grip strength and latency to fall from a rotating rotarod (Figure 40B). At this point, the mice were reinjected with hIgG-X2. After resuming X2 treatment, Dok7 1124_1127 dup mice began to gain weight (Figure 40A), and by 3 weeks after resumption of treatment, their motor deficits were completely reversed (Figure 40B). [Figure 40B] Figures 40A-B demonstrate that hIgG-X2 reverses disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with hIgG-X2 on P4 and P18, after which antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained their mobility for several weeks, but eventually began to lose weight (Figure 40A) and exhibit motor deficits, as assessed by grip strength and latency to fall from a rotating rotarod (Figure 40B). At this point, the mice were reinjected with hIgG-X2. After resuming X2 treatment, Dok7 1124_1127 dup mice began to gain weight (Figure 40A), and by 3 weeks after resumption of treatment, their motor deficits were completely reversed (Figure 40B). [Figure 41A]Figures 41A-B demonstrate that the agonistic antibody hIgG-X2m4 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 41A is a scatter plot showing that Dok7 1124_1127 dup mice on a C57BL / 6-CBA mixed background survive 1-2 weeks after birth. Dok7 1124_1127 dup mice on a mixed background were treated with the agonistic antibody hIgG-X2m4 or the isotype-equivalent negative control motavizumab on P4. Dok7 1124_1127 dup mice (n = 11) injected with an isotype control died within 1 to 2 weeks of age, similar to untreated mice, whereas Dok7 1124_1127 dup mice (n = 3) injected with hIgG-X2m4 at P4 and P18 survived to adulthood. Mutant mice injected with hIgG-X2m4 were monitored for survival or aged for disease recurrence experiments with hIgG-X17. Scatter plots show survival times and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 41B] Figures 41A-B demonstrate that hIgG-X2m4, an agonist antibody against MuSK, rescues lethality in young Dok7 1124_1127 dup mice. Figure 41B is a scatter plot showing that Dok7 1124_1127 dup mice injected with hIgG-X2m4 gained weight, unlike Dok7 1124_1127 dup mice treated with an isotype control antibody. Dok7 1124_1127 dup mice were injected with hIgG-X2m4 at P4 (20 mg / kg) and P18 (10 mg / kg). One mouse was used for disease recurrence experiments with hIgG-X17, and the other mice were monitored for survival. [Figure 42]Figure 42 is a scatter plot showing that hIgG-X2m4 keeps Dok7 1124_1127 dup mice healthy for at least two months. Dok7 1124_1127 dup mice were injected with X2m4 on P4 and P18, after which antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and remained mobile for several months, but eventually began to lose weight and died within a few days. [Figure 43A] Figures 43A-B demonstrate that chronic injection of mIgG2a-X3 in wild-type mice does not affect survival or weight gain. Figure 43A is a scatter plot showing that wild-type mice (n=2) on a C57BL / 6-CBA mixed background injected with mIgG2a-X3 on P4, P24, and P44 survived until P60 when they were sacrificed. The scatter plot shows survival times and mean ± SEM values ​​for nine uninjected wild-type mice and two wild-type mice injected with mIgG2a-X3. [Figure 43B] Figures 43A-B demonstrate that chronic injection of mIgG2a-X3 in wild-type mice does not affect survival or weight gain. Figure 43B is a scatter plot showing that wild-type mice injected with mIgG2a-X3 (n=2) gained weight similarly to uninjected wild-type mice (n=9). [Figure 44] Figure 44 demonstrates that chronic injection of mIgG2a-X3 in wild-type mice does not affect the organization of neuromuscular synapses. Diaphragm muscles from P60 wild-type mice and wild-type mice injected with mIgG2a-X3 were stained with Alexa488-α-BGT to label acetylcholine receptors and with an antibody against βIII-tubulin / synapsin to label motor axons / nerve terminals. In wild-type mice treated with mIgG2a-X3, synapses matured from simple plaque-like shapes to complex pretzel-like shapes characteristic of mature mouse neuromuscular synapses. Scale bar = 10 mm. Injection of mIgG2a-X3 in wild-type mice does not affect synapse number, synapse size, or AChR density. 100 synapses from two mice in each category were analyzed. [Figure 45]Figure 45 demonstrates that chronic injection of mIgG2a-X3 in wild-type mice does not affect motor behavior. The motor performance of wild-type mice injected with mIgG2a-X3 was similar to that of uninjected wild-type mice, as assessed by grip strength (left panel) and latency to fall from a rotating rotarod (right panel). The scatter plot shows the values ​​and mean ± SEM values ​​for 27 wild-type mice and 2 wild-type mice injected with mIgG2a-X3. [Figure 46A] Figures 46A-B demonstrate that mIgG2a-X3, an agonist antibody against MuSK, at 10 mg / kg on P4 rescues lethality in young Dok7 1124_1127 dup mice for several days. Figure 46A is a scatter plot showing that Dok7 1124_1127 dup mice on a C57BL / 6-CBAno mixed background survive 1-2 weeks after birth. Dok7 1124_1127 dup mice on a mixed background were treated on P4 with the agonist antibody mIgG2a-X3 or the isotype-equivalent negative control, motavizumab. Dok7 1124_1127 mice injected with isotype control (n=11) and Dok7 1124_1127 mice injected with mIgG2a-X33 (n=4) died between 1 and 2 weeks of age, similar to untreated mice. Scatter plots show survival times and mean ± SEM values ​​for each mouse (p, **<0.05). [Figure 46B] Figures 46A-B demonstrate that mIgG2a-X3, an agonist antibody against MuSK, at 10 mg / kg at P4 rescues lethality in young Dok7 1124_1127 dup mice for several days. Figure 46B is a scatter plot showing that Dok7 1124_1127 dup mice injected with mIgG2a-X3 did not gain weight, similar to Dok7 1124_1127 dup mice treated with an isotype control antibody. Dok7 1124_1127 dup mice were injected with mIgG2a-X3 (10 mg / kg) at P4. [Figure 47A]Figures 47A-47B demonstrate that 20 mg / kg of the agonist antibody mIgG2a-X3 against MuSK at P4 rescues lethality in young Dok7 1124_1127 dup mice. Figure 47A is a scatter plot showing that Dok7 1124_1127 dup mice on a C57BL / 6-CBA mixed background survive 1-2 weeks after birth. Dok7 1124_1127 dup mice on a mixed background were treated with the agonist antibody mIgG2a-X3 (20 mg / kg) or the isotype-equivalent negative control, motavizumab, on P4. Dok7 1124_1127 dup mice (n=11) injected with the isotype control died 1-2 weeks after birth, similar to untreated mice. Dok7 1124_1127 dup mice (n=2) injected with mIgG2a-X3 at P4 (20 mg / kg) and P18 (10 mg / kg) survived to adulthood. Mutant mice injected with mIgG2a-X3 were aged for disease recurrence experiments. Scatter plots show survival times and mean ± SEM values ​​for each mouse. [Figure 47B] Figures 47A-47B demonstrate that 20 mg / kg of the agonist antibody mIgG2a-X3 against MuSK at P4 rescues lethality in young Dok7 1124_1127 dup mice. Figure 47B is a scatter plot showing that Dok7 1124_1127 dup mice injected with mIgG2a-X3 gained weight, unlike Dok7 1124_1127 dup mice treated with an isotype control antibody. Dok7 1124_1127 dup mice were injected with mIgG2a-X3 at P4 (20 mg / kg) and P18 (10 mg / kg). [Figure 48] Figure 48 demonstrates that mIgG2a-X3 keeps Dok7 1124_1127 dup mice healthy for at least two months. Dok7 1124_1127 dup mice were injected with mIgG2a-X3 on P4 and P18, after which antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and remained mobile for two months, but eventually began to lose weight and died within a few days. [Figure 49A] Figures 49A-49B demonstrate that the agonistic antibody mIgG2a-X9 against MuSK can rescue lethality in young Dok7 1124_1127 dup mice. Figure 49A is a scatter plot showing that Dok7 1124_1127 dup mice on a C57BL / 6-CBA mixed background survived 1-2 weeks after birth. Dok7 1124_1127 dup mice on a mixed background were treated with the agonistic antibody mIgG2a-X9 or the isotype-equivalent negative control, motavizumab, on P4. Dok7 1124_1127 dup mice injected with the isotype control (n=11) and Dok7 1124_1127 dup mice injected with mIgG2a-X9 (n=6) died between 1-2 weeks after birth, similar to untreated mice. Only one Dok7 1124_1127 dup mouse injected with mIgG2a-X9 (10 mg / kg) on ​​P4, P24, and P44 survived until P60. The scatter plot shows the survival time and mean ± SEM values ​​for each mouse (ns, not significant). [Figure 49B] Figures 49A-49B demonstrate that the agonist antibody mIgG2a-X9 against MuSK can rescue lethality in young Dok7 1124_1127 dup mice. Figure 49B is a scatter plot showing that Dok7 1124_1127 dup mice injected with mIgG2a-X9, similar to Dok7 1124_1127 dup mice treated with an isotype control antibody, did not gain weight. Only one Dok7 1124_1127 dup mouse injected with mIgG2a-X9 gained weight over time. Dok7 1124_1127 dup mice were injected with mIgG2a-X9 (10 mg / kg) on ​​P4, P24, and P44. [Figure 50]Figure 50 demonstrates that the MuSK agonist antibody 3B2g2m1 associates with MuSK at synapses and saturates MuSK at 20 mg / kg. P30 wild-type mice were intraperitoneally injected with the MuSK agonist antibody 3B2g2m1 (0, 2, 10, or 20 mg / kg). Two days later, the mice were sacrificed, and diaphragm muscles were stained with Alexa488-α-BGT to label AChRs and Alexa647 goat anti-human IgG, F(ab')2 fragment-specific, to label 3B2g2m1. The saturation level of 3B2g2m1 at synapses was measured by the ratio of 3B2g2m1 to AChR signal intensity. Mean ± SEM values ​​from three mice at each concentration are shown. [Figure 51A] Figures 51A-B demonstrate that chronic injection of 3B2g2m1 in wild-type mice does not affect survival or weight gain. Figure 51A is a scatter plot showing that wild-type mice (n=6) on a C57BL / 6-CBA mixed background injected with 10 mg / kg of 3B2g2m1 on P4, P24, and P44 survived and gained weight similarly to wild-type mice (n=6) injected with 10 mg / kg of the isotype-equivalent negative control, motavizumab, on P4, P24, and P44. [Figure 51B] Figures 51A-51B demonstrate that chronic injection of 3B2g2m1 in wild-type mice does not affect survival or weight gain. Figure 51B is a scatter plot showing that wild-type mice on a C57BL / 6-CBA mixed background injected with 3B2g2m1 twice weekly starting at 20 mg / kg on P4 survived and gained weight similarly to wild-type mice injected with the isotype-equivalent negative control, motavizumab, twice weekly starting at 20 mg / kg on P4. [Figure 52A]Figures 52A-B demonstrate that the agonist antibody 3B2g2m1 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 52A is a scatter plot showing that Dok7 1124_1127 dup mice on a C57BL / 6-CBA mixed background survive 1-2 weeks after birth. Dok7 1124_1127 dup mice on a mixed background were treated with the agonist antibody 3B2g2m1 or the isotype-equivalent negative control, motavizumab, on P4. Dok7 1124_1127 dup mice (n = 11) injected with an isotype control died between 1 and 2 weeks of age, similar to untreated mice, whereas Dok7 1124_1127 dup mice (n = 10) injected with 3B2g2m1 at P4 (20 mg / kg), P18 (10 mg / kg), and P38 (10 mg / kg) survived to adulthood. Of the 10 mutant mice injected with 3B2g2m1, three were sacrificed at P60, and seven were aged for disease recurrence experiments. Scatter plots show survival times and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 52B] Figures 52A-B demonstrate that the agonist antibody 3B2g2m1 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 52B is a scatter plot showing that Dok7 1124_1127 dup mice injected with 3B2g2m1 gained weight, unlike Dok7 1124_1127 dup mice treated with an isotype control antibody. Dok7 1124_1127 dup mice were injected with 3B2g2m1 at P4 (20 mg / kg), P18 (10 mg / kg), and P44 (10 mg / kg). [Figure 53]Figure 53 demonstrates that 3B2g2m1 restores synapse development in young Dok7 1124_1127 dup mice. Diaphragm muscles from P60 wild-type and Dok7 1124_1127 dup mice were stained with Alexa488-α-BGT to label AChRs and with an antibody against βIII tubulin / synapsin to label motor axons / nerve terminals. In Dok7 1124_1127 dup mice treated with 3B2g2m1, synapses matured from simple plaque-like shapes to complex pretzel-like shapes characteristic of mature mouse neuromuscular synapses. Scale bar = 10 mm. In Dok7 1124_1127 dup mice treated with 3B2g2m1, synapse number, synapse size, and synaptic AChR density were restored to 80%, 50%, and 60% of normal levels, respectively. Mean ± SEM values ​​from 3 mice (>50 synapses per mouse) are shown (p, *<0.05, ****<0.00005). [Figure 54] Figure 54 demonstrates that 3B2g2m1 rescues the motor performance of Dok7 1124_1127 dup mice. The motor performance of Dok7 1124_1127 dup mice, as assessed by grip strength (left panel) and latency to fall from a rotating rotarod (right panel), was fully restored by treatment with 3B2g2m1. Scatter plots show values ​​and mean ± SEM values ​​for 27 wild-type mice and 10 Dok7 1124_1127 dup mice rescued with 3B2g2m1 (ns, not significant). [Figure 55]Figure 55 demonstrates that 3B2g2m1 maintains the health of Dok7 1124_1127 dup mice for at least two months. Dok7 1124_1127 dup mice were injected with 3B2g2m1 on days P4, P18, and P38, after which antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and remained mobile for several months, but eventually began to lose weight. At this point, the mice were re-injected with either 5 mg / kg or 10 mg / kg of 3B2g2m1. After resuming 3B2g2m1 treatment, Dok7 1124_1127 dup mice began to gain weight. [Figure 56A] Figures 56A-C demonstrate that 3B2g2m1 reverses disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with 3B2g2m1 on days 4, 18, and 38, after which antibody treatment was discontinued. The Dok7 1124_1127 dup mice gained weight and maintained their mobility for several months, but eventually began to lose weight (Figure 56A) and exhibit motor impairments, as assessed by grip strength and latency to fall from a rotating rotarod (Figure 56B). At this point, the mice were re-injected with 3B2g2m1 (Figure 56A). After resuming treatment with 3B2g2m1, Dok7 1124_1127 dup mice began to gain weight (Figure 56A), and by 1 week after resumption of treatment, their motor deficits had improved (Figures 56B-C). Dok7 1124_1127 dup mice showed a 5.5-fold improvement in rotarod performance (Figure 56B) and a 1.1-fold improvement in grip strength (Figure 56C). [Figure 56B]Figures 56A-C demonstrate that 3B2g2m1 reverses disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with 3B2g2m1 on days 4, 18, and 38, after which antibody treatment was discontinued. The Dok7 1124_1127 dup mice gained weight and maintained their mobility for several months, but eventually began to lose weight (Figure 56A) and exhibit motor impairments, as assessed by grip strength and latency to fall from a rotating rotarod (Figure 56B). At this point, the mice were re-injected with 3B2g2m1 (Figure 56A). After resuming treatment with 3B2g2m1, Dok7 1124_1127 dup mice began to gain weight (Figure 56A), and by 1 week after resumption of treatment, their motor deficits had improved (Figures 56B-C). Dok7 1124_1127 dup mice showed a 5.5-fold improvement in rotarod performance (Figure 56B) and a 1.1-fold improvement in grip strength (Figure 56C). [Figure 56C] Figures 56A-C demonstrate that 3B2g2m1 reverses disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with 3B2g2m1 on days 4, 18, and 38, after which antibody treatment was discontinued. The Dok7 1124_1127 dup mice gained weight and maintained their mobility for several months, but eventually began to lose weight (Figure 56A) and exhibit motor impairments, as assessed by grip strength and latency to fall from a rotating rotarod (Figure 56B). At this point, the mice were re-injected with 3B2g2m1 (Figure 56A). After resuming treatment with 3B2g2m1, Dok7 1124_1127 dup mice began to gain weight (Figure 56A), and by 1 week after resumption of treatment, their motor deficits had improved (Figures 56B-C). Dok7 1124_1127 dup mice showed a 5.5-fold improvement in rotarod performance (Figure 56B) and a 1.1-fold improvement in grip strength (Figure 56C). [Figure 57]Figure 57 demonstrates that the agonist antibody 3B2g2m1 against MuSK rescues lethality in young Dok7 1124_1127 dup mice (chronic administration twice weekly). Figure 57 demonstrates that Dok7 1124_1127 dup mice on a C57BL / 6-CBA mixed background survive 1-2 weeks after birth. Dok7 1124_1127 dup mice on a mixed background were treated with the agonist antibody 3B2g2m1 (20 mg / kg) twice weekly starting on day 4. Dok7 1124_1127 dup mice (n=4) injected with 3B2g2m1 survived and gained weight as adults. [Figure 58A] Figures 58A-C show that MuSK antibody treatment prolongs survival of Dok7 1124_1127 dup mice. Figure 58A shows survival plots of Dok7 1124_1127 dup mice injected with the indicated MuSK agonist antibody or isotype control (motavizumab) at P4 (20 mg / kg), P18 (10 mg / kg), and P38 (10 mg / kg). [Figure 58B] Figures 58A-C show that MuSK antibody treatment prolongs survival of Dok7 1124_1127 dup mice. Figure 58B shows survival plots of Dok7 1124_1127 dup mice injected with MuSK agonist antibody or isotype control (motavizumab) at P4 (20 mg / kg), P18 (10 mg / kg). [Figure 58C] Figures 58A-C show that MuSK antibody treatment prolongs survival of Dok7 1124_1127 dup mice. Figure 58C shows survival plots of Dok7 1124_1127 dup mice that were reinjected (treatment resumed) with the indicated MuSK agonist antibodies (10 mg / kg) several days after weight loss (Figure 58C) occurred. These results demonstrate that injection of MuSK agonist antibodies prolongs survival of Dok7 1124_1127 dup mice. DETAILED DESCRIPTION OF THE INVENTION

[0009] Detailed Description general definition The following terms or definitions are provided solely to aid in the understanding of the present invention. Unless otherwise defined herein, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art of the present invention. Practitioners are directed to definitions and terms of the art, particularly to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainsview, New York (1989) and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999). The definitions provided herein should not be construed to have a scope narrower than that understood by a person skilled in the art.

[0010] Unless otherwise indicated, all methods, steps, techniques and operations not specifically detailed can and have been carried out in a manner known per se, as would be apparent to one skilled in the art, reference being again made, for example, to the standard handbooks, the general background art mentioned above and the further references cited therein.

[0011] As used herein, the singular forms "a," "an," and "the" include singular and plural referents unless the context clearly dictates otherwise.

[0012] As used herein, the terms "comprising," "comprises," and "comprised of" are synonymous with "including," "uncludes," or "containing," and "contains" and are inclusive or open-ended, not excluding additional, unrecited members, compounds, products, elements, or method steps. The phrase "essentially consists of" used in the context of a product or composition ("a product essentially consisting of" or "a composition essentially consisting of") means that additional molecules may be present, but such molecules do not modify / alter the characteristics / activity / functionality of the product or composition. For example, a composition may consist essentially of an antibody or antibody fragment if the composition itself exhibits similar characteristics / activity / functionality as one of an antibody or one of an antibody fragment.

[0013] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.

[0014] As used herein, the term "about," when referring to a measurable value such as a parameter, amount, duration, etc., is meant to encompass a variation of no more than + / - 10%, preferably no more than + / - 5%, more preferably no more than + / - 1%, and even more preferably no more than + / - 0.1% of the specified value, insofar as such variations are appropriate in the disclosed invention. It is to be understood that the value to which the modifier "about" refers is itself also specifically and preferably disclosed.

[0015] As used herein, amino acid residues are designated by their full name or according to the standard three-letter or one-letter amino acid code.

[0016] As used herein, the terms "polypeptide" or "protein" are used interchangeably and refer to polymeric forms of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides with modified peptide backbones. A "peptide" is also a polymer of amino acids, usually up to 50 amino acids in length. A polypeptide or peptide is represented by an amino acid sequence.

[0017] As used herein, the terms "nucleic acid molecule," "polynucleotide," "polynucleic acid," and "nucleic acid" are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Nucleic acid molecules are represented by nucleic acid sequences, which are characterized primarily by their base sequence. Polynucleotides may have any three-dimensional structure and may perform any function, known or unknown. Non-limiting examples of polynucleotides include genes, gene fragments, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, control regions, isolated RNA of any sequence, nucleic acid probes, and primers. Nucleic acid molecules can be linear or circular.

[0018] As used herein, the term "homology" refers to identity or similarity of at least secondary structure between two macromolecules, particularly two polypeptides or polynucleotides, from the same or different taxonomic groups, where the similarity is due to a common ancestor. Accordingly, the term "homolog" refers to such related macromolecules that share similarities in secondary structure and, optionally, tertiary structure. For comparing two or more nucleotide sequences, the "percentage of sequence identity" between a first nucleotide sequence and a second nucleotide sequence may be calculated using methods known to those skilled in the art, for example, by dividing the number of nucleotides in the first nucleotide sequence that are identical to nucleotides at corresponding positions in the second nucleotide sequence by the total number of nucleotides in the first nucleotide sequence and multiplying by 100%, or by using known computer algorithms for sequence alignment, such as NCBI Blast. When determining the degree of sequence similarity between two amino acid sequences, those skilled in the art may also take into account so-called "conservative" amino acid substitutions. "Conservative" amino acid substitutions can generally be described as amino acid substitutions in which an amino acid residue is replaced with another amino acid residue of similar chemical structure, and which have little or no effect on the function, activity, or other biological properties of the polypeptide. Possible conservative amino acid substitutions have been exemplified herein. Amino acid and nucleic acid sequences are said to be "completely identical" if they have 100% sequence identity over their entire length.

[0019] Throughout this application, in each instance where a particular amino acid sequence SEQ ID NO: (e.g., SEQ ID NO: Y) is referenced, that sequence may be replaced with a polypeptide comprising an amino acid sequence having at least 80% sequence identity or similarity to amino acid sequence SEQ ID NO: Y. Throughout this application, the phrase "a sequence is at least X% identical to another sequence" may be replaced with "a sequence has at least X% sequence identity to another sequence."

[0020] Each amino acid sequence described herein by its respective percentage identity (at least 80%) to a given amino acid sequence, in further preferred embodiments, has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to the given amino acid sequence, respectively. In preferred embodiments, sequence identity is determined by comparing the full length of the sequences identified herein. Each amino acid sequence described herein by a percentage similarity (at least 80%) to a given amino acid sequence has, in a further preferred embodiment, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more similarity to the given amino acid sequence, respectively. In a preferred embodiment, sequence similarity is determined by comparing the full length of the sequences identified herein. Unless otherwise indicated herein, identity or similarity to a given SEQ ID NO refers to identity or similarity based on the full length of the sequence (i.e., across its entire length or as a whole).

[0021] "Sequence identity" is defined herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. Identity between two amino acid sequences is preferably defined by assessing identity within all or a portion of a SEQ ID NO identified herein. A portion can mean at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90% of the length of the SEQ ID NO.

[0022] In the art, "identity" also means the degree of sequence relatedness between amino acid sequences, sometimes as determined by the match between strings of amino acid sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. "Identity" and "similarity" can be easily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G., Academic Press, 1987; Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H. and Lipman, D., SIAM, J. Applied Math., 48:1073 (1988).

[0023] Preferred methods for determining identity are designed to maximize the match between the tested sequences. Methods for determining identity and similarity are codified in publicly available computer programs. Preferred computer program methods for determining identity and similarity between two sequences include, for example, the GCG program package (Devereux, J. et al., Nucleic Acids Research 12(1): 387 (1984)), BestFit, FASTA, BLASTN, and BLASTP (Altschul, SF et al., J. Mol. Biol. 215: 403-410 (1990)), and EMBOSS Needle (Madeira, F. et al., Nucleic Acids Research 47(W1): W636-W641 (2019)). BLAST programs are publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, MD 20894; Altschul, S. et al., J. Mol. Biol. 215: 403-410 (1990)). EMBOSS programs are publicly available from EMBL-EBI. The well-known Smith Waterman algorithm may also be used to determine identity. The EMBOSS Needle program is a preferred program to use.

[0024] Preferred parameters for comparing polypeptide sequences include the following algorithm: Needleman and Wunsch, J. Mol. Biol. 48(3):443-453 (1970); comparison matrix: BLOSUM62 from Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA. 89:10915-10919 (1992); gap open penalty: 10; and gap extension penalty: 0.5. A program useful with these parameters is publicly available from EMBL-EBI as the EMBOSS Needle program. The aforementioned parameters are the default parameters for global pairwise sequence alignment of proteins (with no penalty for end gaps).

[0025] Preferred parameters for nucleic acid comparison include the following algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); comparison matrix: DNAfull; gap open penalty: 10; gap extension penalty: 0.5. A program useful with these parameters is publicly available from EMBL-EBI as the EMBOSS Needle program. The aforementioned parameters are the default parameters for global pairwise sequence alignment of nucleotide sequences (with no penalty for end gaps).

[0026] Any embodiment described herein is also provided herein as being capable of being combined with any one or more other embodiments, provided that the combinations are not mutually exclusive.

[0027] MuSK antibody-based molecules The present invention relates to antibody-based molecules, such as the antibodies, epitope-binding domains thereof, and antibody derivatives described herein, that can bind to and activate muscle-specific tyrosine protein kinase (MuSK) signaling and / or phosphorylation. Such antibody-based molecules are useful for treating conditions, e.g., neuromuscular conditions, in which a subject requires increased MuSK signaling or MuSK phosphorylation.

[0028] A first aspect of the present invention relates to antibody-based molecules that bind to an epitope of MuSK, a receptor tyrosine kinase expressed in skeletal muscle that plays a crucial and dominant role in the formation and maintenance of neuromuscular synapses (Burden et al., "The Role of MuSK in Synapse Formation and Neuromuscular Disease," Cold Spring Harb. Perspect. Biol. 5:a009167 (2013) which is incorporated herein by reference in its entirety). MuSK is a single-pass, 120-kDa transmembrane protein containing an extracellular region containing three Ig-like domains and a Frizzled (Fz)-like domain, and an intracellular region containing a juxtamembrane region, a kinase domain, and a short cytoplasmic tail (Jennings et al., "Muscle-Specific trk-Related Receptor with a Kringle Domain Defines a Distinct Class of Receptor Tyrosine Kinases," Proc. Natl. Acad. Sci. USA 90:2895-2899 (1993) and Valenzuela et al., "Receptor Tyrosine Kinase Specific for the Skeletal Muscle Lineage: Expression in Embryonic Muscle, at the Neuromuscular Junction, and After Injury," Neuron 15:573-584 (1995), both of which are incorporated by reference in their entireties). MuSK phosphorylation is stimulated by agrin, a signal provided by motor neurons. When activated, MuSK stimulates pathways that (1) cluster and anchor AChRs and additional muscle proteins essential for synaptic transmission, (2) enhance transcription of genes encoding synaptic proteins within the muscle "synaptic nucleus," and (3) promote presynaptic differentiation and the production of retrograde signals that facilitate attachment of motor nerve terminals to muscle.In the absence of MuSK, neuromuscular synapses do not form (Burden et al., "The Role of MuSK in Synapse Formation and Neuromuscular Disease," Cold Spring Harb. Perspect. Biol. 5: a009167 (2013), which is incorporated by reference in its entirety). In addition to its role during synaptogenesis, MuSK is also required for maintaining adult synapses, since inhibition of MuSK expression in adult muscle results in severe defects in pre- and postsynaptic differentiation (Kong et al., "Inhibition of Synapse Assembly in Mammalian Muscle in vivo by RNA Interference," EMBO Rep 5:183-188 (2004) and Hesser et al., "Synapse Disassembly and Formation of New Synapses in Postnatal Muscle Upon Conditional Inactivation of MuSK," Mol. Cell. Neurosci. 31:470-480 (2006), both of which are incorporated by reference in their entireties).Consistent with these findings in mice, mutations that impair MuSK kinase activity or inhibit signaling steps downstream from MuSK cause myasthenia gravis (CM), a condition characterized by structurally and functionally defective synapses, resulting in muscle weakness and fatigue (Beeson et al., "Dok-7 Mutations Underlie a Neuromuscular Junction Synaptopathy," Science 313:1975-1978 (2006); Muller et al., "Phenotypical Spectrum of DOK7 Mutations in Congenital Myasthenic Syndromes," Brain 130:1497-1506 (2007); and Selcen et al., "A Compensatory Subpopulation of Motor Neurons in a Mouse Model of Amyotrophic Lateral Sclerosis," J. Comp. Neurol. 490:209-219 (2008), which are incorporated by reference in their entireties).

[0029] The amino acid sequence of human MuSK has the amino acid sequence of SEQ ID NO:129 below. [ka]

[0030] In accordance with the present invention, the MuSK antibody-based molecules described herein bind to an epitope within the Frizzled (Fz)-like domain of the MuSK protein. The Fz-like domain of MuSK has the amino acid sequence of SEQ ID NO: 130, as shown below. [ka]

[0031] As used herein, the term "epitope" refers to an antigenic determinant capable of binding to an antibody. Epitopes typically consist of molecular surface groups such as amino acids or sugar side chains and typically have distinct three-dimensional structural and charge characteristics. Conformational and nonconformational epitopes are distinguished in that binding to conformational epitopes, but not to nonconformational epitopes, is lost in the presence of denaturing solvents. Epitopes may include amino acid residues directly involved in binding (also called immunodominant components of the epitope) and may also include other amino acid residues not directly involved in binding, such as amino acid residues that are effectively blocked by the specific antigen-binding peptide (i.e., amino acid residues within the footprint of the specific antigen-binding peptide). An epitope typically includes at least 3, and more usually, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acids in a unique spatial conformation.

[0032] The MuSK antibody-based molecules of the invention immunospecifically bind to an epitope within the MuSK Fz-like domain sequence of SEQ ID NO: 130 more frequently, more rapidly, with longer duration and / or with higher affinity or avidity than alternative epitopes. In one embodiment, the MuSK antibody-based molecules described herein immunospecifically bind to any 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid residues of SEQ ID NO: 130. As used herein, the terms "affinity," "specific binding," "binding," "immunospecific binding," "binding activity," or "specific binding activity" refer to the degree to which an antibody or antibody fragment as defined herein binds to an epitope within the MuSK-Fz-like domain sequence of SEQ ID NO: 130.

[0033] In one embodiment, the MuSK antibody-based molecules disclosed herein are -7 M or less K DFor example, the MuSK antibody-based molecules disclosed herein bind to the MuSK Fz-like domain with an affinity corresponding to about 10 as determined by surface plasmon resonance (SPR) techniques, e.g., on a Biacore3000 instrument (preferably using the antibody as the ligand and MuSK as the analyte). -8 M, about 10 -9 M, about 10 -10 M, about 10 -11 M, about 10 -12 M or less K D The MuSK antibody-based molecules disclosed herein bind to the MuSK Fz-like domain with an affinity corresponding to a K that is at least 10-fold lower, such as at least 100-fold lower, such as at least 1,000-fold lower, such as at least 10,000-fold lower, such as at least 100,000-fold lower, such as at least 100,000-fold lower, than their affinity for binding to a non-specific antigen (e.g., bovine serum albumin, casein, etc.). D The antibody binds to the MuSK Fz-like domain with an affinity corresponding to the K D It depends on the antibody's K D If k is very low (i.e., the antibody is very specific), the amount at which the affinity for the antigen is lower than the affinity for a non-specific antigen can be at least 10,000 times lower. d ”(seconds -1 The term k (or 1 / s) refers to the dissociation rate constant of a particular antibody-antigen interaction. This value is k 0ff Also called the k value. a " (M -1 × seconds -1 The term "K" (or 1 / M) as used herein refers to the association rate constant of a particular antibody-antigen interaction. D The term "(M)" as used herein refers to the dissociation equilibrium constant of a particular antibody-antigen interaction, k d k a As used herein, "K A " (M -1 or 1 / M) refers to the association equilibrium constant of a particular antibody-antigen interaction, k a kd It is obtained by dividing by

[0034] In one embodiment, the MuSK antibody-based molecules described herein have pH-dependent binding affinity to MuSK, allowing for antibody recycling, which enhances antigen binding. For example, in one embodiment, the association or dissociation rate constant may differ under acidic pH conditions, neutral pH conditions, and basic pH conditions. In one embodiment, the MuSK antibody-based molecules described herein have a higher dissociation rate constant under acidic pH conditions, e.g., a pH of <7.0, compared to neutral pH conditions, e.g., a pH of about 7.0 to 7.9. In some embodiments, the MuSK antibody-based molecules described herein have a 2- to 3-fold higher dissociation rate constant (i.e., lower binding affinity) at acidic pH (e.g., a pH of about 5.5) compared to neutral pH (a pH of about 7.4). In one embodiment, the MuSK antibody-based molecules bind to the MuSK Fz-like domain with higher affinity under neutral pH conditions than under acidic pH conditions. In other words, in one embodiment, the MuSK antibody-based molecules bind to the MuSK Fz-like domain with a higher dissociation rate under acidic pH conditions than under neutral pH conditions. Neutral pH conditions may be defined as a pH between 7.0 and 7.9. Acidic pH conditions may be defined as a pH below 7.0. Higher may mean at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, or 300% higher. Antibodies with this pH-dependent dissociation property dissociate from antigen after binding and activation, but before lysosomal degradation. Upon dissociation, the antibody reenters the circulation via the neonatal Fc receptor, where it is released and binds more antigen.

[0035] MuSK signaling is activated by binding of the MuSK antibodies of the present invention to their respective epitopes within the Fz-like domain. In particular, when the MuSK antibodies of the present invention bind to their respective epitopes in the MuSK Fz-like domain, this binding induces MuSK phosphorylation and activation as described above. The MuSK antibodies of the present invention induce MuSK phosphorylation by about 50% to about 100% compared to MuSK phosphorylation induced by agrin activation (e.g., as measured in the C2C12 phosphorylation assay described herein). In one embodiment, the MuSK antibodies of the present invention induce MuSK phosphorylation by about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% (compared to MuSK phosphorylation induced by agrin activation). In one embodiment, the MuSK antibody-based molecules of the present invention induce about 90% to about 100% MuSK phosphorylation upon MuSK binding (compared to MuSK phosphorylation induced by agrin activation). MuSK phosphorylation may be assessed using techniques known to those skilled in the art, such as Western blotting. The phosphorylation assay described in the Examples herein (i.e., the C2C12 myotube phosphorylation assay) can also be used to assess phosphorylation.

[0036] In some embodiments, MuSK antibodies of the invention, i.e., MuSK antibodies that bind to the Fz domain of MuSK, do not interfere with (i.e., block, suppress, inhibit, or reduce) natural ligand binding and stimulation of MuSK. In some embodiments, MuSK antibodies costimulate MuSK activation with its natural ligand, i.e., agrin, resulting in an additional effect of activation, e.g., MuSK phosphorylation. Thus, in some embodiments, MuSK antibodies of the invention enhance natural MuSK activation, i.e., phosphorylation, induced by natural ligand binding. In some embodiments, antibodies of the invention activate MuSK (i.e., phosphorylate MuSK) in combination with the natural ligand to >100% of endogenous activation levels, e.g., at least 110%, 130%, 150%, 200% of endogenous activation levels. Phosphorylation of MuSK may be assessed as described above.

[0037] Thus, in one embodiment, the activity of a MuSK antibody-based molecule of the invention includes: (i) binding to an epitope of human muscle-specific tyrosine protein kinase (MuSK) present in the MuSK Frizzled (Fz)-like domain sequence of SEQ ID NO: 130, and upon binding to that epitope, the antibody-based molecule induces MuSK phosphorylation, and / or (ii) binding to the MuSK Fz-like domain does not block, suppress, or inhibit native or endogenous MuSK ligand-induced phosphorylation, but may enhance native or endogenous MuSK ligand-induced phosphorylation, and (iii) binding to the MuSK Fz-like domain occurs with higher affinity at neutral pH conditions than at acidic pH conditions. All of these characteristics are further defined herein.

[0038] Antibody-based molecules include, but are not limited to, complete antibodies, epitope-binding fragments of whole antibodies, and antibody derivatives. Epitope-binding fragments of antibodies can be obtained by actual fragmentation of a parent antibody (e.g., an Fab or (Fab)2 fragment). Alternatively, epitope-binding fragments are amino acid sequences that comprise a portion of the amino acid sequence of such a parent antibody. As used herein, a molecule is said to be a "derivative" of an antibody (or a relevant portion thereof) if it is obtained through actual chemical modification of the parent antibody or a portion thereof, or if it comprises an amino acid sequence that is substantially similar to the amino acid sequence of such a parent antibody or a relevant portion thereof (e.g., differs by less than 30%, less than 20%, less than 10%, or less than 5% from such parent molecule or a relevant portion thereof, or differs by less than 10 amino acid residues, or by less than 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acid residues from such parent molecule or a relevant portion thereof).

[0039] In one embodiment, the antibody-based molecules of the present invention are molecules comprising an intact immunoglobulin or an epitope-binding fragment thereof. As used herein, the terms "fragment," "region," "portion," and "domain" are generally intended to be synonymous unless the context of their use indicates otherwise. Naturally occurring antibodies typically comprise a tetramer, usually composed of at least two heavy (H) chains and at least two light (L) chains. Each heavy chain comprises a heavy chain variable (V H ) region and heavy chain constant (C H ) regions, which are typically divided into three domains (C H 1 domain, C H 2 domain, and C H The heavy chains can be of any isotype, including IgG (subtypes IgG1, IgG2, IgG3, and IgG4), IgA (subtypes IgA1 and IgA2), IgM, and IgE. Each light chain contains a light chain variable (V L ) region and light chain constant (C L ) regions. Light chains include kappa and lambda chains. The variable regions of the heavy and light chains are typically involved in antigen recognition, while the constant regions of the heavy and light chains may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system. V H Area and V L The regions can be further subdivided into regions of hypervariability called "complementarity-determining regions" or "CDRs" separated by regions of more conserved sequence called "framework regions" (FR). H Area and V L The regions consist of three CDR domains and four FR domains arranged from amino terminus to carboxy terminus in the following order: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. The heavy and light chain variable regions contain binding domains that interact with antigen. Of particular relevance are antibodies and epitope-binding fragments thereof that have been "isolated" so as to be in a physical environment different from that which may occur in nature, or that have been modified so as to differ in amino acid sequence from naturally occurring antibodies.

[0040] Fragments of antibodies (including Fab and (Fab)2 fragments) that retain epitope binding ability can be obtained, for example, by protease cleavage of intact antibodies. Single-domain antibody fragments contain one variable domain (e.g., V L or V H Examples of epitope-binding fragments encompassed by the present invention include: (i) V L , V H , C L and C H (ii) a Fab' or Fab fragment, which is a monovalent fragment containing one domain; (iii) a F(ab')2 fragment, which is a bivalent fragment containing two Fab fragments linked by a disulfide bridge at the hinge region; and (iv) a fragment consisting essentially of a VH domain and a C domain. H (iv) an Fd fragment consisting essentially of a V L and V H (v) an Fv fragment consisting essentially of a V domain; H or V Ldomains (Ward et al., "Binding Activities Of A Repertoire of Single Immunoglobulin Variable Domains Secreted From Escherichia coli." Nature 341:544-546 (1989), which is incorporated herein by reference in its entirety), also called domain antibodies (Holt et al., "Domain Antibodies: Proteins for Therapy," Trends Biotechnol. 21(11):484-490 (2003), which is incorporated herein by reference in its entirety), dAb fragments; (vi) nanobodies (Revets et al., "Nanobodies As Novel Agents For Cancer Therapy," Expert Opin. Biol. Ther. 5(1):111-124 (2005), and (vii) isolated complementarity-determining regions (CDRs). An epitope-binding fragment may contain one, two, three, four, five, or all six of the CDR domains of such an antibody. In one embodiment, an antibody fragment (or region or portion or domain) comprises, consists essentially of, or consists of 30 to 100 amino acids, or 50 to 150 amino acids, or 70 to 200 amino acids. In one embodiment, the length of an antibody fragment (or region or portion or domain) is at least one of the lengths of the antibody (full-length antibody). In one embodiment, the fragment is an epitope-binding or functional fragment of said antibody that is expected to induce the activity of the antibody to at least some extent. "At least some extent" can mean at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, 150%, 200% or more. In one embodiment, the antibody or antibody fragment should induce a detectable activity of the antibody. Antibody activity is defined herein above.

[0041] Such antibody fragments can be obtained using conventional techniques known to those skilled in the art. For example, F(ab')2 fragments can be generated by treating a full-length antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments. Fab fragments can be obtained by treating an IgG antibody with papain. Fab' fragments can be obtained by pepsin digestion of an IgG antibody. Fab' fragments can be obtained by treating an F(ab')2 fragment with a reducing agent, such as dithiothreitol. Antibody fragments can also be produced by expressing nucleic acids encoding such fragments in recombinant cells (see, for example, Evans et al., "Rapid Expression of an Anti-Human C5 Chimeric Fab Utilizing a Vector That Replicates in COS and 293 Cells," J. Immunol. Meth. 184:123-38 (1995), incorporated herein by reference in its entirety). For example, a chimeric gene encoding a portion of the F(ab')2 fragment can include DNA sequences encoding the CH1 domain and hinge region of the heavy chain, followed by a translation stop codon, to generate such a truncated antibody fragment molecule. Suitable fragments capable of binding to a desired epitope can be readily screened for utility in the same manner as intact antibodies.

[0042] Antibody derivatives include molecules that contain at least one epitope-binding domain of an antibody and are typically generated using recombinant techniques. One exemplary antibody derivative is the single-chain Fv (scFv). scFvs are molecules that combine two domains of an Fv fragment, V and V. L Area and V H The gene sequences are formed from regions, which may be encoded by separate genes. Such gene sequences or cDNA encoding gene sequences are joined using recombinant methods by flexible linkers (typically about 10, 12, 15 or more amino acid residues), thereby forming the gene sequences into V L and V HThe V domains can be produced as a single protein chain, with the V domains associating to form monovalent epitope-binding molecules (see Bird et al., "Single-Chain Antigen-Binding Proteins," Science 242:423-426 (1988); and Huston et al., "Protein Engineering of Antibody Binding Sites: Recovery of Specific Activity in An Anti-Digoxin Single-Chain Fv Analogue Produced in Escherichia coli," Proc. Natl. Acad. Sci. (USA) 85:5879-5883 (1988), which are incorporated herein by reference in their entireties). Alternatively, the V domains can be produced as a single polypeptide chain, with the V domains associating to form monovalent epitope-binding molecules (see Bird et al., "Single-Chain Antigen-Binding Proteins," Science 242:423-426 (1988); and Huston et al., "Protein Engineering of Antibody Binding Sites: Recovery of Specific Activity in An Anti-Digoxin Single-Chain Fv Analogue Produced in Escherichia coli," Proc. Natl. Acad. Sci. (USA) 85:5879-5883 (1988), which are incorporated herein by reference in their entireties). L and V H By using a flexible linker that is not too short (e.g., greater than about 9 residues) to allow the domains to associate together, bispecific antibodies can be formed that have binding specificities for two different epitopes.

[0043] In another embodiment, the antibody derivative is a divalent (or bivalent) single-chain variable fragment engineered by linking two scFvs in tandem (i.e., tandem scFvs) or by linking them so that they dimerize to form a diabody (Holliger et al., "'Diabodies': Small Bivalent And Bispecific Antibody Fragments," Proc. Natl. Acad. Sci. (USA) 90(14), pp. 6444-8 (1993), incorporated herein by reference in its entirety). In yet another embodiment, the antibody is a triabody, i.e., a trivalent single-chain variable fragment engineered by linking three scFvs in tandem or by linking them to form a trimer to form a triabody. In another embodiment, the antibody is a tetramer of four single-chain variable fragments ... H-C H 1-V H -C H 1) (see Zapata et al., Protein Eng. 8(10):1057-1062 (1995), which is incorporated herein by reference in its entirety). In another embodiment, the antibody derivative is a "linear antibody," which is an antibody comprising H A single-chain Fv region (i.e., scFv-C) linked to three domains H 3) It is a mini body consisting of

[0044] These and other useful antibody fragments and antibody derivatives in the context of the present invention are discussed further herein. It should also be understood that the term antibody-based molecule, unless otherwise specified, also includes antibody-like polypeptides, such as chimeric and humanized antibodies, as well as antibody fragments (epitope-binding or functional fragments) that retain the ability to specifically bind to an antigen, provided by any known technique, such as enzymatic cleavage, peptide synthesis, and recombinant techniques. In one embodiment, the term "antibody-based molecule" may be replaced by the term "antibody" or the phrase "antibody or functional fragment thereof."

[0045] The antibodies generated herein can be of any isotype. As used herein, "isotype" refers to the immunoglobulin class (e.g., IgG1, IgG2, IgG3, IgG4, IgD, IgA, IgE, or IgM) encoded by heavy chain constant region genes. The choice of isotype is typically guided by the desired effector function, such as antibody-dependent cellular cytotoxicity (ADCC) induction. Exemplary isotypes are IgG1, IgG2, IgG3, and IgG4. Particularly useful isotypes of the MuSK antibodies disclosed herein include IgG1 and IgG2.

[0046] Either kappa or lambda human light chain constant regions may be used. If desired, the class of the MuSK antibodies of the present invention may be switched by known methods. For example, an antibody of the present invention that is originally IgM may be class-switched to an IgG antibody of the present invention. Furthermore, class switching techniques may be used to convert one IgG subclass to another, e.g., from IgG1 to IgG2. Thus, the effector functions of the antibodies of the present invention may be altered for various therapeutic uses by isotype switching, e.g., to an IgG1, IgG2, IgG3, IgG4, IgD, IgA, IgE, or IgM antibody.

[0047] In one embodiment, the antibody-based molecules of the invention are "humanized," particularly when used for therapeutic purposes. The term "humanized" generally refers to chimeric molecules, prepared using recombinant techniques, having an antigen-binding site derived from an immunoglobulin from a non-human species and the remainder of the immunoglobulin structure based on the structure and / or sequence of a human immunoglobulin. The antigen-binding site may comprise either a complete non-human antibody variable domain fused to a human constant domain, or only the complementarity-determining regions (CDRs) of such a variable domain grafted into appropriate human framework regions of a human variable domain. The framework residues of such humanized molecules may be wild-type (e.g., fully human) or may be modified to contain one or more amino acid substitutions not found in the sequence of the human antibody serving as the basis for humanization. Humanization reduces or eliminates the potential for the constant regions of a molecule to function as immunogens in human individuals, but the potential for an immune response to the foreign variable regions remains (see LoBuglio, AF et al., "Mouse / Human Chimeric Monoclonal Antibody In Man: Kinetics And Immune Response," Proc. Natl. Acad. Sci. USA 86:4220-4224 (1989), incorporated herein by reference in its entirety). Another approach focuses not only on providing constant regions of human origin, but also on modifying the variable regions to reshape them as closely as possible to human form. Both the heavy and light chain variable regions contain three complementarity-determining regions (CDRs), which change in response to the antigen of interest and determine binding capacity. The CDRs are flanked by four framework regions (FRs). The FRs are relatively conserved in a given species and presumptively provide the framework for the CDRs. When a non-human antibody is prepared for a particular antigen, the variable region can be "reshaped" or "humanized" by grafting CDRs from the non-human antibody onto FRs present in the modified human antibody. Suitable methods for humanizing the non-human antibodies described herein are known in the art. See, for example, Sato, K., "Humanization of Non-Human Antibodies," which is incorporated herein by reference in its entirety.et al., Cancer Res 53:851 - 856 (1993); Riechmann, L. et al., "Reshaping Human Antibodies for Therapy", Nature 332:323 - 327 (1988); Verhoeyen, M. et al., "Reshaping Human Antibodies: Grafting An Antilysozyme Activity", Science 239:1534 - 1536 (1988); Kettleborough, C. A. et al., "Humanization Of A Mouse Monoclonal Antibody By CDR-Grafting: The Importance Of Framework Residues On Loop Conformation", Protein Engineering 4:773 - 3783 (1991); Maeda, H. et al., "Construction Of Reshaped Human Antibodies With HIV-Neutralizing Activity", Human Antibodies Hybridoma 2:124 - 134 (1991); Gorman, S. D. et al., "Reshaping A Therapeutic CD4 Antibody", Proc. Natl. Acad. Sci. USA 88:4181 - 4185 (1991); Tempest, P.R. et al., "Reshaping A Human Monoclonal Antibody To Inhibit Human Respiratory Syncytial Virus Infection In Vivo", Bio / Technology 9:266 - 271 (1991); Co, M. S. et al., "Humanized Antibodies For Antiviral Therapy", Proc. Natl. Acad. Sci. USA 88:2869 - 2873 (1991); Carter, P. et al., "Humanization Of An Anti-pl85her2 Antibody For Human Cancer Therapy", Proc. Natl. Acad. Sci.USA 89:4285-4289 (1992); and Co, MS et al., "Chimeric And Humanized Antibodies With Specificity For The CD33 Antigen," J. Immunol. 148:1149-1154 (1992). In some embodiments, the humanized MuSK antibodies of the invention retain all CDR sequences (e.g., a humanized antibody containing all six CDRs from a llama or mouse antibody). In other embodiments, the humanized MuSK antibodies of the invention have one or more CDRs (one, two, three, four, five, six) that are altered with respect to the original antibody. Methods for humanizing antibodies are well known in the art and are suitable for humanizing the antibodies disclosed herein (see, e.g., U.S. Pat. No. 5,225,539 by Winter; U.S. Pat. Nos. 5,530,101 and 5,585,089 by Queen and Selick; U.S. Pat. No. 5,859,205 by Robert et al.; U.S. Pat. No. 6,407,213 by Carter; and U.S. Pat. No. 6,881,557 by Foote, which are incorporated by reference in their entireties).

[0048] In some antibodies, only a portion of the CDRs, namely the subset of CDR residues necessary for binding, called the "specificity-determining residues" ("SDRs"), are necessary to retain antibody binding. CDR residues that do not contact antigen and are not present within the SDRs can be identified by molecular modeling and / or empirically based on previous studies from regions of Kabat CDRs that reside outside the Chothia hypervariable loops (see Kabat et al., SEQUENCES OF PROTEINS OF IMMUNOLOGICAL INTEREST, National Institutes of Health Publication No. 91-3242 (1992); Chothia, C. et al., "Canonical Structures For The Hypervariable Regions Of Immunoglobulins," J. Mol. Biol. 196:901-917 (1987), which are incorporated herein by reference in their entireties), or as described in Gonzales, N.R. et al., "SDR Grafting Of A Murine Antibody Using Multiple Human Germline Templates To Minimize Its Immunogenicity," Mol. Immunol. 41:863-872 (2004), which is incorporated herein by reference in its entirety. In such humanized antibodies, at positions where one or more donor CDR residues are absent or where the donor CDR has been eliminated entirely, the amino acid residue occupying the position may be the amino acid residue occupying the corresponding position (according to Kabat numbering) in the acceptor antibody sequence. The number of such acceptor to donor amino acid substitutions to be included in the CDRs reflects a balance of competing considerations. Such substitutions are potentially advantageous in reducing the number of non-human amino acids in the humanized antibody and consequently reducing potential immunogenicity. However, substitutions may also result in changes in affinity, and significant decreases in affinity are preferably avoided. Substitutions may also result in changes in activity.Such substitutions that result in a significant decrease in activity are also preferably avoided. In this situation, the antibody or antibody fragment should still exhibit detectable or at least some antibody activity as defined hereinabove. The positions for substitution within the CDRs and the amino acids to be substituted may be selected empirically.

[0049] Alternatively, phage display technology can be used to increase (or decrease) the CDR affinity of antibody-based molecules of the present invention. This technique, called affinity maturation, uses mutagenesis or "CDR walking" followed by reselection using the target antigen or its antigenic fragment to identify antibodies with CDRs that bind with higher (or lower) affinity to the antigen compared to the initial or parent antibody (see, e.g., Glaser et al., "Antibody Engineering By Codon-Based Mutagenesis In A Filamentous Phage Vector System," J. Immunology 149:3903-3913 (1992), incorporated herein by reference in its entirety). Mutagenesis of entire codons rather than single nucleotides results in a semi-randomized repertoire of amino acid mutations. Libraries consisting of a pool of variant clones can be constructed, each of which differs from other members of the library by a single amino acid modification in a single CDR, with the library containing variants potentially representing every possible amino acid substitution for each CDR residue. Mutants with increased (or decreased) binding affinity for the antigen can be screened for by contacting the immobilized mutants with labeled antigen. Any screening method known in the art can be used to identify variant antibody-based binding molecules with increased or decreased affinity for the antigen (e.g., ELISA) (see Wu, H. et al., "Stepwise In Vitro Affinity Maturation of Vitaxin, An Alphav Beta 3-Specific Humanized mAb," Proc. Natl. Acad. Sci. USA 95:6037-6042 (1998); Yelton et al., "Affinity Maturation of the BR96 Anti-Carcinoma Antibody By Codon-Based Mutagenesis," J. Immunology 155:1994 (1995), the entire contents of which are incorporated herein by reference).CDR walking may also be used to randomize the light chain (see Schier, R. et al., "Isolation of Picomolar Affinity Anti-c-erbB-2 Single-Chain Fv by Molecular Evolution of the Complementarity Determining Regions in the Center of the Antibody Binding Site," J. Mol. Biol. 263:551-567 (1996), which is incorporated herein by reference in its entirety).

[0050] Methods for affinity maturation of MuSK antibody molecules are described herein and are also described in, for example, Krause, JC et al., "An Insertion Mutation That Distorts Antibody Binding Site Architecture Enhances Function of a Human Antibody," MBio. 2(1): e00345-10 (2011); Kuan, CT et al., "Affinity-Matured Anti-Glycoprotein NMB Recombinant Immunotoxins Targeting Malignant Gliomas and Melanomas," Int. J. Cancer 10.1002 / ijc.25645 (2010); Hackel, BJ et al., "Stability And CDR Composition Biases Enrich Binder Functionality Landscapes," J. Mol. Biol. 401(1): 84-96 (2010); Montgomery, DL et al., "Affinity Maturation And Characterization Of A Human Monoclonal Antibody Against HIV-1," which are incorporated herein by reference in their entireties. gp41”, MAbs 1(5):462–474 (2009); Gustchina, E. et al., “Affinity Maturation By Targeted Diversification Of The CDR-H2 Loop Of A Monoclonal Fab Derived From A Synthetic Naive Human Antibody Library And Directed Against The Internal Trimeric Coiled-Coil Of Gp41 Yields A Set Of Fabs With Improved HIV-1 Neutralization "Potency And Breadth", Virology 393(1): pp. 112-119 (2009); Finlay, WJet al., "Affinity Maturation Of A Humanized Rat Antibody For Anti-RAGE Therapy: Comprehensive Mutagenesis Reveals A High Level Of Mutational Plasticity Both Inside And Outside The Complementarity-Determining Regions", J. Mol. Biol. 388(3):541-558 (2009); Bostrom, J. et al., "Improving Antibody Binding Affinity And Specificity For Therapeutic Development”, Methods Mol. Biol. 525:353-376 (2009); Steidl, S. et al., “In Vitro Affinity Maturation Of Human GM-CSF Antibodies By Targeted CDR-Diversification”, Mol. Immunol.46(1): pp.135-144 (2008); and Barderas, R. et al., “Affinity Maturation Of Antibodies Assisted By In Silico "Modeling," Proc. Natl. Acad. Sci. USA 105(26):9029-9034 (2008).

[0051] In certain aspects of the invention, the MuSK antibody-based molecules described herein comprise the amino acid sequences of any one, any two, any three, any four, any five, or any six of the CDRs shown in Tables 1 and 2 herein.

[0052] In one aspect, an antibody-based molecule that binds to human muscle-specific tyrosine-protein kinase (MuSK) comprises a heavy chain variable region, the heavy chain variable region comprising: (i) a complementarity determining region 1 (CDR-H1) comprising the amino acid sequence of any one of SEQ ID NOs: 1-16, 135, 136, or 147-149, or a modified amino acid sequence of any one of SEQ ID NOs: 1-16, 135, 136, or 147-149, wherein the modified amino acid sequence has at least 80% sequence identity to any one of SEQ ID NOs: 1-16, 135, 136, or 147-149; (ii) an amino acid sequence of any one of SEQ ID NOs: 17-32, 137, 138, or 150-155, or a modified amino acid sequence of any one of SEQ ID NOs: 17-32, 137, 138, or 150-155; and (iii) a complementarity determining region 3 (CDR-H3) comprising an amino acid sequence of any one of SEQ ID NOs: 33 to 48, 139, 140, 156 to 158, or 240 to 251, or a modified amino acid sequence of any one of SEQ ID NOs: 33 to 48, 139, 140, 156 to 158, or 240 to 251, which has at least 80% sequence identity to any one of SEQ ID NOs: 33 to 48, 139, 140, 156 to 158, or 240 to 251.

[0053] In one embodiment, the antibody-based molecule that binds to human muscle-specific tyrosine-protein kinase (MuSK) comprises: (i) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 1, CDR-H2 of SEQ ID NO: 17, and CDR-H3 of SEQ ID NO: 33; (ii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 34; (iii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 3, CDR-H2 of SEQ ID NO: 19, and CDR-H3 of SEQ ID NO: 35; (iv) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 4, CDR-H2 of SEQ ID NO: 20; and CDR-H3 of SEQ ID NO: 36; (v) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 5, CDR-H2 of SEQ ID NO: 21, and CDR-H3 of SEQ ID NO: 37; (vi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 6, CDR-H2 of SEQ ID NO: 22, and CDR-H3 of SEQ ID NO: 38; (vii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 7, CDR-H2 of SEQ ID NO: 23, and CDR-H3 of SEQ ID NO: 39; (viii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 8, CDR-H2 of SEQ ID NO: 24, and CDR-H3 of SEQ ID NO: 40. (ix) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 9, CDR-H2 of SEQ ID NO: 25, and CDR-H3 of SEQ ID NO: 41; (x) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 10, CDR-H2 of SEQ ID NO: 26, and CDR-H3 of SEQ ID NO: 42; (xi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 11, CDR-H2 of SEQ ID NO: 27, and CDR-H3 of SEQ ID NO: 43; (xii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 12, CDR-H2 of SEQ ID NO: 28, and CDR-H3 of SEQ ID NO: 44; (xiii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 13 (xiv) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 14, CDR-H2 of SEQ ID NO: 30, and CDR-H3 of SEQ ID NO: 46; (xv) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 15, CDR-H2 of SEQ ID NO: 31, and CDR-H3 of SEQ ID NO: 47; (xvi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 16, CDR-H2 of SEQ ID NO: 32, and CDR-H3 of SEQ ID NO: 48; (xvii) a CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137;and CDR-H3 of SEQ ID NO: 139, and (xviii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 136, CDR-H2 of SEQ ID NO: 138, and CDR-H3 of SEQ ID NO: 140. The sequences of the heavy chain CDR sequences are shown in Table 1 below.

[0054] In one embodiment, the antibody-based molecule that binds to human muscle-specific tyrosine-protein kinase (MuSK) comprises: (ii.a) a heavy chain variable region (X2m1) comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 240; (ii.b) a heavy chain variable region (X2m2) comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 241; (ii.c) a heavy chain variable region (X2m3) comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 242; (ii.d) a heavy chain variable region (X2m4) comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 24 (ii.e) a heavy chain variable region (X2m5) comprising a CDR-H1 of SEQ ID NO: 2, a CDR-H2 of SEQ ID NO: 18, and a CDR-H3 of SEQ ID NO: 244; (ii.f) a heavy chain variable region (X2m6) comprising a CDR-H1 of SEQ ID NO: 2, a CDR-H2 of SEQ ID NO: 18, and a CDR-H3 of SEQ ID NO: 245; (ii.g) a heavy chain variable region (X2m7) comprising a CDR-H1 of SEQ ID NO: 2, a CDR-H2 of SEQ ID NO: 18, and a CDR-H3 of SEQ ID NO: 246; and (ii.h) a heavy chain variable region (X2m8) comprising a CDR-H1 of SEQ ID NO: 2, a CDR-H2 of SEQ ID NO: 18, and a CDR-H3 of SEQ ID NO: 247.

[0055] In one embodiment, the antibody-based molecule that binds to human muscle-specific tyrosine-protein kinase (MuSK) comprises: (xvii.a) a heavy chain variable region (X17m1) comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 248; (xvii.b) a heavy chain variable region (X17m2) comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 249; (xvii.c) a heavy chain variable region (X17m3) comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 250; and (xvii.d) a heavy chain variable region (X17m6) comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 251.

[0056] In one embodiment, the antibody-based molecule that binds to human muscle-specific tyrosine-protein kinase (MuSK) comprises a heavy chain variable region, the heavy chain variable region comprising: (xix) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156; (xx) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157; (xxi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158.

[0057] In one embodiment, the antibody-based molecule that binds to human muscle-specific tyrosine protein kinase (MuSK) comprises a heavy chain variable region, the heavy chain variable region comprising: (xxii) a heavy chain variable region (3B2g1m1 / 3B2g2m1) comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156; (xxiii) a heavy chain variable region (3B2g1m2 / 3B2g2m2) comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156; or (xxiv) a heavy chain variable region (3B2g1m4 / 3B2g2m4) comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 155, and CDR-H3 of SEQ ID NO: 156. The sequences of the heavy chain CDR sequences are shown in Table 1 below.

[0058] In one embodiment, an antibody-based molecule that binds to human muscle-specific tyrosine protein kinase (MuSK) comprises a heavy chain variable region, wherein the heavy chain variable region comprises a CDR-H1 of SEQ ID NO: 147, a CDR-H2 of SEQ ID NO: 153 or a CDR-H2 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 153, and a CDR-H3 of SEQ ID NO: 156 (3B2g2m1). According to this embodiment, the CDR-H2 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 153 comprises one or more amino acid substitutions with respect to the amino acid sequence of SEQ ID NO: 153, wherein said substitutions are at residues 1, 2, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or any combination thereof. In another embodiment, the CDR-H2 amino acid sequence has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 153. In one embodiment, the CDR-H2 of the antibody comprises a proline (P) at position 3, a tryptophan (W) at position 4, and a serine (S) or asparagine (N) at position 5.

[0059] In one embodiment, an antibody-based molecule that binds to human muscle-specific tyrosine-protein kinase (MuSK) comprises a heavy chain variable region, wherein the heavy chain variable region comprises CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156.

[0060] The sequences of the heavy chain CDR sequences are shown in Table 1 below.

[0061] [Table 1A] [Table 1B]

[0062] In some embodiments, the MuSK antibody-based molecules disclosed herein further comprise a light chain variable region comprising: (i) a complementarity determining region 1 (CDR-L1) having the amino acid sequence of any one of SEQ ID NOs: 49-64, 141, 142, or 159-169, or a modified amino acid sequence of any one of SEQ ID NOs: 49-64, 141, 142, or 159-169, wherein the modified amino acid sequence has at least 80% sequence identity to any one of SEQ ID NOs: 49-64, 141, 142, or 159-169; and (ii) an amino acid sequence of any one of SEQ ID NOs: 65-80, 143, 144, or 170-179, or a modified amino acid sequence of any one of SEQ ID NOs: 65-80, 143, 144, or 170-179. and (iii) a complementarity determining region 2 (CDR-L2) having a modified amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 65 to 80, 143, 144, or 170 to 179, and (iv) a complementarity determining region 3 (CDR-L3) having an amino acid sequence of any one of SEQ ID NOs: 81 to 96, 145, 146, or 180 to 195, or a modified amino acid sequence of any one of SEQ ID NOs: 81 to 96, 145, 146, or 180 to 195, which has at least 80% sequence identity to any one of SEQ ID NOs: 81 to 96, 145, 146, or 180 to 195.

[0063] In one embodiment, the light chain variable region of the MuSK antibody-based molecules disclosed herein comprises: (i) a light chain variable region comprising CDR-L1 of SEQ ID NO: 49, CDR-L2 of SEQ ID NO: 65, and CDR-L3 of SEQ ID NO: 81; (ii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (iii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 51, CDR-L2 of SEQ ID NO: 67, and CDR-L3 of SEQ ID NO: 83; (iv) a light chain variable region comprising CDR-L1 of SEQ ID NO: 52, CDR-L2 of SEQ ID NO: 68, and CDR-L3 of SEQ ID NO: (v) a light chain variable region comprising a CDR-L1 of SEQ ID NO: 53, a CDR-L2 of SEQ ID NO: 69, and a CDR-L3 of SEQ ID NO: 85; (vi) a light chain variable region comprising a CDR-L1 of SEQ ID NO: 54, a CDR-L2 of SEQ ID NO: 70, and a CDR-L3 of SEQ ID NO: 86; (vii) a light chain variable region comprising a CDR-L1 of SEQ ID NO: 55, a CDR-L2 of SEQ ID NO: 71, and a CDR-L3 of SEQ ID NO: 87; (viii) a light chain variable region comprising a CDR-L1 of SEQ ID NO: 56, a CDR-L2 of SEQ ID NO: 72, and a CDR-L3 of SEQ ID NO: 88. (ix) a light chain variable region comprising CDR-L1 of SEQ ID NO: 57, CDR-L2 of SEQ ID NO: 73, and CDR-L3 of SEQ ID NO: 89; (x) a light chain variable region comprising CDR-L1 of SEQ ID NO: 58, CDR-L2 of SEQ ID NO: 74, and CDR-L3 of SEQ ID NO: 90; (xi) a light chain variable region comprising CDR-L1 of SEQ ID NO: 59, CDR-L2 of SEQ ID NO: 75, and CDR-L3 of SEQ ID NO: 91; (xii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 60, CDR-L2 of SEQ ID NO: 76, and CDR-L3 of SEQ ID NO: 92; (xiii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 61 (xiv) a light chain variable region comprising CDR-L1 of SEQ ID NO: 62, CDR-L2 of SEQ ID NO: 78, and CDR-L3 of SEQ ID NO: 94; (xv) a light chain variable region comprising CDR-L1 of SEQ ID NO: 63, CDR-L2 of SEQ ID NO: 79, and CDR-L3 of SEQ ID NO: 95; (xvi) a light chain variable region comprising CDR-L1 of SEQ ID NO: 64, CDR-L2 of SEQ ID NO: 80, and CDR-L3 of SEQ ID NO: 96; (xvii) a CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143;and a light chain variable region comprising CDR-L1 of SEQ ID NO: 142, CDR-L2 of SEQ ID NO: 144, and CDR-L3 of SEQ ID NO: 146. The sequences of the light chain CDR sequences are shown in Table 2 below.

[0064] In one embodiment, the light chain variable region of the MuSK antibody-based molecules disclosed herein comprises: (xix) a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 170, and CDR-L3 of SEQ ID NO: 180; (xx) a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 181; (xxi) a light chain variable region comprising CDR-L1 of SEQ ID NO: 160, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 182; (xxii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 183; (xxiii) a light chain variable region comprising a CDR-L1 of SEQ ID NO: 159, a CDR-L2 of SEQ ID NO: 171, and a CDR-L3 of SEQ ID NO: 184; (xxiv) a light chain variable region comprising a CDR-L1 of SEQ ID NO: 159, a CDR-L2 of SEQ ID NO: 173, and a CDR-L3 of SEQ ID NO: 185; (xxv) a light chain variable region comprising a CDR-L1 of SEQ ID NO: 159, a CDR-L2 of SEQ ID NO: 173, and a CDR-L3 of SEQ ID NO: 186; (xxvi) a light chain variable region comprising a CDR-L1 of SEQ ID NO: 161, a CDR-L2 of SEQ ID NO: 1 (xxvii) a light chain variable region comprising a CDR-L1 of SEQ ID NO: 162, a CDR-L2 of SEQ ID NO: 174, and a CDR-L3 of SEQ ID NO: 188; (xxviii) a light chain variable region comprising a CDR-L1 of SEQ ID NO: 163, a CDR-L2 of SEQ ID NO: 174, and a CDR-L3 of SEQ ID NO: 188; (xxix) a light chain variable region comprising a CDR-L1 of SEQ ID NO: 164, a CDR-L2 of SEQ ID NO: 174, and a CDR-L3 of SEQ ID NO: 189; (xxx) a light chain variable region comprising a CDR-L1 of SEQ ID NO: 165, a CDR-L2 of SEQ ID NO: 174, and a CDR-L3 of SEQ ID NO: (xxxi) a light chain variable region comprising CDR-L1 of SEQ ID NO: 166, CDR-L2 of SEQ ID NO: 176, and CDR-L3 of SEQ ID NO: 191; (xxxii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 167, CDR-L2 of SEQ ID NO: 177, and CDR-L3 of SEQ ID NO: 192; (xxxii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 168, CDR-L2 of SEQ ID NO: 178, and CDR-L3 of SEQ ID NO: 193; (xxxiii) a CDR-L1 of SEQ ID NO: 169;It comprises a light chain variable region comprising CDR-L2 of SEQ ID NO: 179 and CDR-L3 of SEQ ID NO: 194.

[0065] In one embodiment, the light chain variable region of a MuSK antibody-based molecule disclosed herein comprises a light chain variable region comprising a CDR-L1 of SEQ ID NO: 159, a CDR-L2 of SEQ ID NO: 172, and a CDR-L3 of SEQ ID NO: 195, or a CDR-L3 with at least 80% sequence identity to SEQ ID NO: 195. According to this embodiment, the CDR-L3 amino acid sequence with at least 80% sequence identity to SEQ ID NO: 195 comprises one or more amino acid substitutions with respect to the amino acid sequence of SEQ ID NO: 195, wherein said substitutions are at residues 1, 2, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or any combination thereof. In another embodiment, the CDR-L3 amino acid sequence has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 195.

[0066] The sequences of the light chain CDR sequences are shown in Table 2 below.

[0067] [Table 2A] [Table 2B]

[0068] Suitable amino acid modifications to the heavy and / or light chain CDR sequences of the MuSK antibody-based molecules disclosed herein include, for example, conservative substitutions or substitutions of functionally equivalent amino acid residues that result in variant CDR sequences with similar or enhanced binding characteristics to those of the CDR sequences disclosed herein, as described above. The CDRs of Tables 1 and 2 containing one, two, three, four, five, or more amino acid substitutions (depending on the length of the CDR) that maintain or enhance MuSK binding of the antibody are encompassed by the present invention. The resulting modified CDRs are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% similar in sequence to the CDRs of Tables 1 and 2. Suitable amino acid modifications to the heavy chain CDR sequences in Table 1 and / or the light chain CDR sequences in Tables 1 and 2 include, for example, conservative substitutions or substitutions of functionally equivalent amino acid residues that result in variant CDR sequences with similar or enhanced binding characteristics to those of the CDR sequences in Tables 1 and 2. Conservative substitutions are those made within a family of amino acids that are related in their side chains. Genetically encoded amino acids can be divided into four families: (1) acidic (aspartate, glutamate), (2) basic (lysine, arginine, histidine), (3) nonpolar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and (4) uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine). Phenylanine, tryptophan, and tyrosine are sometimes classified collectively as aromatic amino acids.Alternatively, the amino acid repertoire may be grouped as follows: (1) acidic (aspartate, glutamate), (2) basic (lysine, arginine, histidine), (3) aliphatic (glycine, alanine, valine, leucine, isoleucine, serine, threonine), where serine and threonine are sometimes grouped separately as aliphatic-hydroxyl; (4) aromatic (phenylalanine, tyrosine, tryptophan); (5) amide (asparagine, glutamine); and (6) sulfur-containing (cysteine ​​and methionine) (Stryer (ed.), Biochemistry, 2nd ed., W.H. Freeman and Co., 1981, incorporated herein by reference in its entirety). Non-conservative substitutions may be made to the heavy chain CDR sequences in Table 1 and the light chain CDR sequences in Table 2. Non-conservative substitutions involve replacing one or more amino acid residues in a CDR with one or more amino acid residues from a different class of amino acids to improve or enhance the binding properties of the CDR. The amino acid sequences of the heavy chain variable region CDRs in Table 1 and / or the light chain variable region CDRs in Table 2 may further include one or more internal neutral amino acid insertions or deletions that maintain or enhance MuSK binding.

[0069] In one embodiment, the MuSK antibody-based molecule comprises: (i) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 1, CDR-H2 of SEQ ID NO: 17, and CDR-H3 of SEQ ID NO: 33, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 49, CDR-L2 of SEQ ID NO: 65, and CDR-L3 of SEQ ID NO: 81; (ii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 34, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (iii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 3, CDR-H2 of SEQ ID NO: 19, and CDR-H3 of SEQ ID NO: 35, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 51, CDR-L2 of SEQ ID NO: 67, and CDR-L3 of SEQ ID NO: 83; (iv) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 4, CDR-H2 of SEQ ID NO: 20, and CDR-H3 of SEQ ID NO: 36, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 52, CDR-L2 of SEQ ID NO: 68, and CDR-L3 of SEQ ID NO: 84; (v) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 5, CDR-H2 of SEQ ID NO: 21, and CDR-H3 of SEQ ID NO: 37, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 53, CDR-L2 of SEQ ID NO: 69, and CDR-L3 of SEQ ID NO: 85; (vi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 6, CDR-H2 of SEQ ID NO: 22, and CDR-H3 of SEQ ID NO: 38, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 54, CDR-L2 of SEQ ID NO: 70, and CDR-L3 of SEQ ID NO: 86; (vii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 7, CDR-H2 of SEQ ID NO: 23, and CDR-H3 of SEQ ID NO: 39, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 55, CDR-L2 of SEQ ID NO: 71, and CDR-L3 of SEQ ID NO: 87; (viii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 8, CDR-H2 of SEQ ID NO: 24, and CDR-H3 of SEQ ID NO: 40, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 56, CDR-L2 of SEQ ID NO: 72, and CDR-L3 of SEQ ID NO: 88; (ix) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 9, CDR-H2 of SEQ ID NO: 25, and CDR-H3 of SEQ ID NO: 41, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 57, CDR-L2 of SEQ ID NO: 73, and CDR-L3 of SEQ ID NO: 89; (x) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 10, CDR-H2 of SEQ ID NO: 26, and CDR-H3 of SEQ ID NO: 42, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 58, CDR-L2 of SEQ ID NO: 74, and CDR-L3 of SEQ ID NO: 90; (xi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 11, CDR-H2 of SEQ ID NO: 27, and CDR-H3 of SEQ ID NO: 43, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 59, CDR-L2 of SEQ ID NO: 75, and CDR-L3 of SEQ ID NO: 91; (xii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 12, CDR-H2 of SEQ ID NO: 28, and CDR-H3 of SEQ ID NO: 44, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 60, CDR-L2 of SEQ ID NO: 76, and CDR-L3 of SEQ ID NO: 92; (xiii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 13, CDR-H2 of SEQ ID NO: 29, and CDR-H3 of SEQ ID NO: 45, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 61, CDR-L2 of SEQ ID NO: 77, and CDR-L3 of SEQ ID NO: 93; (xiv) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 14, CDR-H2 of SEQ ID NO: 30, and CDR-H3 of SEQ ID NO: 46, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 62, CDR-L2 of SEQ ID NO: 78, and CDR-L3 of SEQ ID NO: 94; (xv) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 15, CDR-H2 of SEQ ID NO: 31, and CDR-H3 of SEQ ID NO: 47, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 63, CDR-L2 of SEQ ID NO: 79, and CDR-L3 of SEQ ID NO: 95; (xvi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 16, CDR-H2 of SEQ ID NO: 32, and CDR-H3 of SEQ ID NO: 48, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 64, CDR-L2 of SEQ ID NO: 80, and CDR-L3 of SEQ ID NO: 96; (xvii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 139, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145; and (xviii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 136, CDR-H2 of SEQ ID NO: 138, and CDR-H3 of SEQ ID NO: 140, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 142, CDR-L2 of SEQ ID NO: 144, and CDR-L3 of SEQ ID NO: 146. Includes:

[0070] In one embodiment, the MuSK antibody-based molecule comprises: (ii.a) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 240, and a light chain variable region (X2m1) comprising CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.b) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 241, and a light chain variable region (X2m2) comprising CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.c) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 242, and a light chain variable region (X2m3) comprising CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.d) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 243, and a light chain variable region (X2m4) comprising CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.e) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 244, and a light chain variable region (X2m5) comprising CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.f) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 245, and a light chain variable region (X2m6) comprising CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.g) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 246, and a light chain variable region (X2m7) comprising CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.f) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 247, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82 (X2m8) Includes:

[0071] In one embodiment, the MuSK antibody-based molecule comprises: (xvii.a) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 248, and a light chain variable region (X17m1) comprising CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145; (xvii.b) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 249, and a light chain variable region (X17m2) comprising CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145; (xvii.c) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 250, and a light chain variable region (X17m3) comprising CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145; (xvii.d) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 251, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145 (X17m6) Includes:

[0072] In one embodiment, the MuSK antibody-based molecule comprises: (i) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 170, and CDR-L3 of SEQ ID NO: 180 (14D10); (ii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 181 (7G4); (iii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 160, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 182 (3C4); (iv) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183 (3B2); (v) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 184 (3G3); (vi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 185 (31G2); (vii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 186 (31B7); (viii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 161, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 187 (17H10); (ix) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 162, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 188 (23B6); (x) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 163, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 188 (30E1); (xi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 164, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 189 (30A11); (xii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 165, CDR-L2 of SEQ ID NO: 175, and CDR-L3 of SEQ ID NO: 190 (16F11); (xiii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 166, CDR-L2 of SEQ ID NO: 176, and CDR-L3 of SEQ ID NO: 191 (4C11); (xiv) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 167, CDR-L2 of SEQ ID NO: 177, and CDR-L3 of SEQ ID NO: 192 (7A12); (xv) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 168, CDR-L2 of SEQ ID NO: 178, and CDR-L3 of SEQ ID NO: 193 (7G12); (xvi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 169, CDR-L2 of SEQ ID NO: 179, and CDR-L3 of SEQ ID NO: 194 (7B8); (xvii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183 (3B2g1m1); (xviii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183 (3B2g1m2); (xvix) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 155, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183 (3B2g1m4); (xx) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195 (3B2g2m1); (xxi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195 (3B2g2m2); and (xxii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 155, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195 (3B2g2m4) Includes:

[0073] In a preferred embodiment, the MuSK antibody-based molecule comprises a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region (3B2g2m1) comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195.

[0074] The MuSK antibody-based molecules described herein can comprise a variable light (VL) chain, a variable heavy (VH) chain, or a combination of a VL chain and a VH chain. In some embodiments, the VH chain of the MuSK antibody-based molecule comprises any one of the VH amino acid sequences shown in Table 3 below, or an amino acid sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to any one of the VH amino acid sequences listed in Table 3. In some embodiments, the VL chain of the MuSK antibody-based molecule comprises any one of the VL amino acid sequences shown in Table 3 below, or an amino acid sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to any one of the VL amino acid sequences listed in Table 3.

[0075] [Table 3A] [Table 3B] [Table 3C] [Table 3D] [Table 3E]

Table 3F

[0076] In one embodiment, the MuSK antibody-based molecule disclosed herein comprises: (i) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 97, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 98; (ii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to any one of SEQ ID NOs: 99 and 252-259, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 100; (iii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 101; (iv) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 103 and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 104; (v) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 105 and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 106; (vi) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 107. (vii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 109 and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 110; (viii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 111 and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 112; (ix) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 113. (x) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 115 and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 116; (xi) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 117 and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 118; (xii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 119;and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 120; (xiii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 121, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 122; (xiv) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 123, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 124; (xv) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 125, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 126. (xvi) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 127, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 128, (xvii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to any one of SEQ ID NOs: 131 and 260 to 263, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 132, and (xviii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 133, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 134.

[0077] In some embodiments, the MuSK antibody-based molecules disclosed herein comprise: (i) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 196, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 197; (ii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 198, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 199; (iii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 200, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 201; (iv) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 202 and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 203; (v) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 204 and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 205; (vi) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 206 and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 207. (vii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 208, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 209; (viii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 210, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 211; (vix) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 212, and an amino acid sequence at least 80% identical to SEQ ID NO: 213. (x) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 214, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 215; (xi) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 216, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 217; (xii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 218, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 219;(xiii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 220, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 221; (xiv) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 222, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 223; (xv) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 224, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 225; (xvi) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 226, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 227; (xvii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 228, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 229; (x (viii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 230, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 231; (xix) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 232, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 233; (xx) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 234, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 235; (xxi) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 236, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 237; (xxii) a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 238, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 229.

[0078] Another aspect of the invention relates to isolated polynucleotides encoding the MuSK antibody-based molecules described herein. In one embodiment, the polynucleotides encoding the MuSK antibodies of the invention comprise sequences encoding any one, any two, any three, any four, any five, or any six of the above-described CDRs, e.g., the heavy chain CDRs of SEQ ID NOs: 1-48, 135-140, 147-158, and 240-251, and the light chain CDRs of SEQ ID NOs: 49-96, 141-146, and 159-195.

[0079] In one embodiment, the polynucleotide is H a nucleotide sequence encoding a V HThe domains are: (i) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 1, CDR-H2 of SEQ ID NO: 17, and CDR-H3 of SEQ ID NO: 33; (ii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 34; (iii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 3, CDR-H2 of SEQ ID NO: 19, and CDR-H3 of SEQ ID NO: 35; (iv) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 4, CDR-H2 of SEQ ID NO: 20, and CDR-H3 of SEQ ID NO: 36; (v) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 5, CDR-H2 of SEQ ID NO: 6, and CDR-H3 of SEQ ID NO: 7; (i) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 6, CDR-H2 of SEQ ID NO: 22, and CDR-H3 of SEQ ID NO: 38; (vii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 7, CDR-H2 of SEQ ID NO: 23, and CDR-H3 of SEQ ID NO: 39; (viii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 8, CDR-H2 of SEQ ID NO: 24, and CDR-H3 of SEQ ID NO: 40; (ix) a CDR-H1 of SEQ ID NO: 9, CDR-H2 of SEQ ID NO: 25, and and CDR-H3 of SEQ ID NO: 41; (x) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 10, CDR-H2 of SEQ ID NO: 26, and CDR-H3 of SEQ ID NO: 42; (xi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 11, CDR-H2 of SEQ ID NO: 27, and CDR-H3 of SEQ ID NO: 43; (xii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 12, CDR-H2 of SEQ ID NO: 28, and CDR-H3 of SEQ ID NO: 44; (xiii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 13, CDR-H2 of SEQ ID NO: 29, and CDR-H3 of SEQ ID NO: 45. (xiv) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 14, CDR-H2 of SEQ ID NO: 30, and CDR-H3 of SEQ ID NO: 46; (xv) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 15, CDR-H2 of SEQ ID NO: 31, and CDR-H3 of SEQ ID NO: 47; (xvi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 16, CDR-H2 of SEQ ID NO: 32, and CDR-H3 of SEQ ID NO: 48; (xvii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 139;and (xviii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 136, CDR-H2 of SEQ ID NO: 138, and CDR-H3 of SEQ ID NO: 140.

[0080] In some embodiments, the polynucleotide is H a nucleotide sequence encoding a V H The domains are: (ii.a) a heavy chain variable region (X2m1) comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 240; (ii.b) a heavy chain variable region (X2m2) comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 241; (ii.c) a heavy chain variable region (X2m3) comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 242; (ii.d) a heavy chain variable region (X2m3) comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 243; 4), (ii.e) a heavy chain variable region (X2m5) comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 244, (ii.f) a heavy chain variable region (X2m6) comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 245, (ii.g) a heavy chain variable region (X2m7) comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 246, and (ii.h) a heavy chain variable region (X2m8) comprising CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 247.

[0081] In some embodiments, the polynucleotide is H a nucleotide sequence encoding a V HThe domains include: (xvii.a) a heavy chain variable region (X17m1) comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 248; (xvii.b) a heavy chain variable region (X17m2) comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 249; (xvii.c) a heavy chain variable region (X17m3) comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 250; and (xvii.d) a heavy chain variable region (X17m6) comprising CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 251.

[0082] In one embodiment, the polynucleotide is H a nucleotide sequence encoding a V H The domains include: (xix) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156; (xx) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157; and (xxi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158.

[0083] In one embodiment, the polynucleotide is H a nucleotide sequence encoding a V H The domains include: (xxii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156; (xxiii) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156; and (xxiv) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 155, and CDR-H3 of SEQ ID NO: 156.

[0084] In one embodiment, the polynucleotide is L a nucleotide sequence encoding a V LThe domains are: (i) a light chain variable region comprising CDR-L1 of SEQ ID NO: 49, CDR-L2 of SEQ ID NO: 65, and CDR-L3 of SEQ ID NO: 81; (ii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (iii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 51, CDR-L2 of SEQ ID NO: 67, and CDR-L3 of SEQ ID NO: 83; (iv) a light chain variable region comprising CDR-L1 of SEQ ID NO: 52, CDR-L2 of SEQ ID NO: 68, and CDR-L3 of SEQ ID NO: 84; (v) a light chain variable region comprising CDR-L1 of SEQ ID NO: 53; (vi) a light chain variable region comprising CDR-L1 of SEQ ID NO: 54, CDR-L2 of SEQ ID NO: 70, and CDR-L3 of SEQ ID NO: 86; (vii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 55, CDR-L2 of SEQ ID NO: 71, and CDR-L3 of SEQ ID NO: 87; (viii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 56, CDR-L2 of SEQ ID NO: 72, and CDR-L3 of SEQ ID NO: 88; (ix) a light chain variable region comprising CDR-L1 of SEQ ID NO: 57, CDR-L2 of SEQ ID NO: 73 (x) a light chain variable region comprising CDR-L1 of SEQ ID NO: 58, CDR-L2 of SEQ ID NO: 74, and CDR-L3 of SEQ ID NO: 90; (xi) a light chain variable region comprising CDR-L1 of SEQ ID NO: 59, CDR-L2 of SEQ ID NO: 75, and CDR-L3 of SEQ ID NO: 91; (xii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 60, CDR-L2 of SEQ ID NO: 76, and CDR-L3 of SEQ ID NO: 92; (xiii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 61, CDR-L2 of SEQ ID NO: 77, and CDR-L3 of SEQ ID NO: 93. (xiv) a light chain variable region comprising CDR-L1 of SEQ ID NO: 62, CDR-L2 of SEQ ID NO: 78, and CDR-L3 of SEQ ID NO: 94; (xv) a light chain variable region comprising CDR-L1 of SEQ ID NO: 63, CDR-L2 of SEQ ID NO: 79, and CDR-L3 of SEQ ID NO: 95; (xvi) a light chain variable region comprising CDR-L1 of SEQ ID NO: 64, CDR-L2 of SEQ ID NO: 80, and CDR-L3 of SEQ ID NO: 96; (xvii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145;and (xviii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 142, CDR-L2 of SEQ ID NO: 144, and CDR-L3 of SEQ ID NO: 146.

[0085] In one embodiment, the polynucleotide is L a nucleotide sequence encoding a V LThe domains are: (xix) a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 170, and CDR-L3 of SEQ ID NO: 180; (xx) a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 181; (xxi) a light chain variable region comprising CDR-L1 of SEQ ID NO: 160, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 182; and (xxii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183. (xxiii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 184; (xxiv) a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 185; (xxv) a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 186; (xxvi) a light chain variable region comprising CDR-L1 of SEQ ID NO: 161, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 187; xxvii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 162, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 188; (xxviii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 163, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 188; (xxix) a light chain variable region comprising CDR-L1 of SEQ ID NO: 164, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 189; (xxx) a light chain variable region comprising CDR-L1 of SEQ ID NO: 165, CDR-L2 of SEQ ID NO: 175, and CDR-L3 of SEQ ID NO: 190; (xxxi) a light chain variable region comprising CDR-L1 of SEQ ID NO: 166, CDR-L2 of SEQ ID NO: 176, and CDR-L3 of SEQ ID NO: 191; (xxxi) a light chain variable region comprising CDR-L1 of SEQ ID NO: 167, CDR-L2 of SEQ ID NO: 177, and CDR-L3 of SEQ ID NO: 192; (xxxii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 168, CDR-L2 of SEQ ID NO: 178, and CDR-L3 of SEQ ID NO: 193; (xxxiii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 169, CDR-L2 of SEQ ID NO: 179, and CDR-L3 of SEQ ID NO: 194;Including.

[0086] In one embodiment, the polynucleotide is L a nucleotide sequence encoding a V L The domains include: (xxxiv) a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183; and (xxxv) a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195.

[0087] In one embodiment, the isolated polynucleotide encoding the MuSK antibody-based molecule is selected from the group consisting of V and VL2 as shown in Table 3 below. H and / or V L The nucleic acid molecules described herein include isolated polynucleotides, portions of expression vectors, or portions of linear DNA sequences, such as linear DNA sequences used for in vitro transcription / translation and vectors adapted for prokaryotic, eukaryotic, or filamentous phage expression, secretion, and / or display of the antibodies or binding fragments thereof described herein.

[0088] Polynucleotides of the invention may be produced by chemical synthesis, for example, by solid-phase polynucleotide synthesis on an automated polynucleotide synthesizer, and assembled into complete single- or double-stranded molecules. Alternatively, polynucleotides of the invention may be produced by other techniques, such as PCR followed by routine cloning. Techniques for producing or obtaining polynucleotides of a given sequence are well known in the art.

[0089] The polynucleotides of the invention may contain at least one non-coding sequence, such as a promoter or enhancer sequence, an intron, a polyadenylation signal, a cis-sequence that promotes RepA binding, etc. The polynucleotide sequence may also contain additional sequences that encode, for example, a linker sequence, a marker or tag sequence, such as a histidine tag or HA tag to facilitate protein purification or detection, a signal sequence, a fusion protein partner such as RepA, an Fc portion, or a bacteriophage coat protein, such as pIX or pill.

[0090] Another embodiment of the present invention relates to a vector comprising at least one polynucleotide encoding a MuSK antibody-based molecule described herein. Such vectors include, but are not limited to, plasmid vectors, viral vectors, including, but not limited to, vaccinia vectors, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors, vectors for baculovirus expression, transposon-based vectors, or any other vector suitable for introducing the polynucleotides described herein into a given organism or genetic background by any means to promote expression of the encoded antibody polypeptide. In one embodiment, a polynucleotide sequence encoding a heavy chain variable domain described herein, alone or together with a polynucleotide sequence encoding a light chain variable domain described herein, is combined with a promoter, a translation initiation segment (e.g., a ribosome binding sequence and start codon), a 3' untranslated region, a polyadenylation signal, a stop codon, and sequences for transcription termination to form one or more expression vector constructs.

[0091] In one embodiment, the vector is an adenovirus-associated virus (AAV) vector. Several therapeutic AAV vectors suitable for delivering polynucleotides encoding the antibodies described herein to the central nervous system are known in the art. See, for example, Deverman et al., "Gene Therapy for Neurological Disorders: Progress and Prospects," Nature Rev. 17:641-659 (2018), incorporated herein by reference in its entirety. Suitable AAV vectors include serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or AAV11, either in their native form or engineered for enhanced tropism. AAV vectors known to have tropism for the CNS that are particularly suitable for therapeutic expression of the MuSK antibodies described herein include AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9, either in their native form or engineered for enhanced tropism. In one embodiment, the AAV vector is an AAV2 vector. In another embodiment, the AAV vector is an AAV5 vector (Vitale et al., "Anti-tau Conformational scFv MCI Antibody Efficiently Reduces Pathological Tau Species in Adult JNPL3 Mice," Acta Neuropalhol. Commun. 6:82 (2018), which is incorporated herein by reference in its entirety). In another embodiment, the AAV vector is an AAV9 vector (Haiyan et al., "Targeting Root Cause by Systemic scAAV9-hIDS Gene Delivery: Functional Correction and Reversal of Severe MPSII in Mice," Mol. Ther. Methods Clin. Dev. 10:327-340 (2018), which is incorporated herein by reference in its entirety).In another embodiment, the AAV vector is an AAVrhlO vector (Liu et al., "Vectored Intracerebral Immunizations with the Anti-Tau Monoclonal Antibody PHF1 Markedly Reduces Tau Pathology in Mutant Transgenic Mice," J. Neurosci. 36(49): 12425-35 (2016), which is incorporated by reference in its entirety).

[0092] In another embodiment, the AAV vector is a hybrid vector containing the genome of one serotype, e.g., AAV2, and the capsid protein of another serotype, e.g., AAV1 or AAV3-9, to control tropism. See, e.g., Broekman et al., "Adeno-associated Virus Vectors Serotyped with AAV8 Capsid Are More Efficient than AAV-1 or -2 Serotypes for Widespread Gene Delivery to the Neonatal Mouse Brain," Neuroscience 138:501-510 (2006), incorporated herein by reference in its entirety. In one embodiment, the AAV vector is an AAV2 / 8 hybrid vector (Ising et al., "AAV-Mediated Expression of Anti-Tau ScFv Decreases Tau Accumulation in a Mouse Model of Tauopathy," J. Exp. Med. 214(5):1227 (2017), incorporated herein by reference in its entirety). In another embodiment, the AAV vector is an AAV2 / 9 hybrid vector (Simon et al., "A Rapid Gene Delivery-Based Mouse Model for Early-Stage Alzheimer Disease-Type Tauopathy," J. Neuropath. Exp. Neurol. 72(11): 1062-1 (2013), which is incorporated by reference in its entirety).

[0093] In another embodiment, the AAV vector is engineered or selected for its enhanced CNS transduction following intraparenchymal administration, such as AAV-DJ (Grimm et al., J. Viol. 82:5887-5911 (2008) which is incorporated herein by reference in its entirety); engineered or selected for enhanced transduction of neural stem and progenitor cells, such as SCH9 and AAV4.18 (Murlidharan et al., J. Virol. 89:3976-3987 (2015) and Ojala et al., Mol. Ther. 26:304-319 (2018) which are incorporated herein by reference in their entireties); or engineered or selected for enhanced retrograde transduction, such as rAAV2-retro (Muller et al., Nat. Biotechnol. 2014, 2014, 2015, 2016, 2017, 2018, 2019, 2020, 2021, 2022, 2023, 2024, 2025, 2026, 2027, 2028, 2029, 2030, 2031, 2032, 2033, 2034, 2035, 2036, 2037, 2038, 2039, 2040, 2041, 2042, 2043, 2044, 2045, 2046, 2047, 2048, 2049, 2050, 2051, 2052, 2053, 2054, 2055, 2056, 2057, 2058, 2059, 2060 21:1040-1046 (2003)); those engineered or selected for selective transduction of brain endothelial cells, such as AAV-BRI (Korbelin et al., EMBO Mol. Med. 8:609-625 (2016) which is incorporated by reference in its entirety); or those engineered or selected for enhanced transduction of the adult CNS following IV administration, such as AAV-PHP.B and AAVPHP.eB (Deverman et al., Nat. Biotechnol. 34:204-209 (2016) and Chan et al., Nat. Neurosci. 20:1172-1179 (2017)).

[0094] According to this embodiment, the expression vector construct encoding the MuSK antibody-based molecule comprises a polynucleotide sequence encoding a heavy chain polypeptide, a functional fragment thereof, a variant thereof, or a combination thereof. Alternatively, the expression construct may comprise a nucleic acid sequence encoding a light chain polypeptide, a functional fragment thereof, a variant thereof, or a combination thereof. In one embodiment, the expression vector construct comprises nucleic acid sequences encoding a heavy chain polypeptide, a functional fragment thereof, or a variant thereof, and a light chain polypeptide, a functional fragment thereof, or a variant thereof.

[0095] In one embodiment, the expression construct further comprises a promoter sequence suitable for driving expression of the MuSK antibody-based molecule. Suitable promoter sequences include, but are not limited to, the elongation factor-1 alpha promoter (EF1a), the phosphoglycerate kinase-1 (PGK), the cytomegalovirus immediate early gene promoter (CMV), the chimeric liver-specific promoter (LSP), the cytomegalovirus enhancer / chicken β-actin promoter (CAG), the tetracycline-responsive promoter (TRE), the transthyretin promoter (TTR), the simian virus 40 promoter (SV40), and the CK6 promoter. Other promoters suitable for driving gene expression in mammalian cells known in the art are also suitable for incorporation into the expression constructs disclosed herein.

[0096] In one embodiment, the expression construct further encodes a linker sequence, which can encode an amino acid sequence that spatially separates and / or links one or more components of the expression construct (such as the heavy and light chain components of the encoded antibody).

[0097] Another aspect of the invention is a host cell that contains one or more vectors encoding a MuSK antibody and produces said MuSK antibody described herein. The MuSK antibody-based molecules described herein can optionally be produced by cell lines, mixed cell lines, immortalized cells, or clonal populations of immortalized cells, as is well known in the art (see, e.g., Ausubel et al., eds., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, NY (1987-2001); Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, NY (1989); Harlow and Lane, Antibodies, a Laboratory Manual, Cold Spring Harbor, NY (1989); Colligan et al., eds., Current Protocols in Immunology, John Wiley & Sons, Inc., NY (1994-2001); Colligan et al., Current Protocols in Protein Science, John Wiley & Sons, NY, NY (1997-2001), which are incorporated herein by reference in their entireties).

[0098] In some embodiments, the host cells selected for expression may be of mammalian origin. Suitable mammalian host cells include, but are not limited to, COS-1 cells, COS-7 cells, HEK293 cells, BHK21 cells, CHO cells, BSC-1 cells, HeG2 cells, SP2 / 0 cells, HeLa cells, mammalian myeloma cells, mammalian lymphoma cells, or any derivative, immortalized, or transformed cell thereof. Other suitable host cells include, but are not limited to, yeast cells, insect cells, and plant cells. Alternatively, the host cell may be selected from a species or organism that is unable to glycosylate polypeptides, for example, a prokaryotic cell or organism, such as BL21, BL21(DE3), BL21-GOLD(DE3), XL1-Blue, JM109, HMS174, HMS174(DE3), and any naturally occurring or engineered strain of E. coli spp., Klebsiella spp., or Pseudomonas spp.

[0099] The MuSK antibody-based molecules described herein can be prepared by any of a variety of techniques using the isolated polynucleotides, vectors, and host cells described above. Generally, antibodies can be produced by cell culture techniques, such as conventional techniques, to allow for antibody production, or by the generation of monoclonal antibodies via transfection of antibody genes, heavy chains, and / or light chains into suitable bacterial or mammalian cell hosts; the antibodies can be recombinant. In one embodiment, the MuSK antibody-based molecules described herein are monoclonal antibodies or functional binding fragments thereof. Standard molecular biology techniques are used to prepare recombinant expression vectors, transfect host cells, select for transformants, culture the host cells, and recover the antibody from the culture medium. Transfection of host cells can be carried out using a variety of techniques commonly used for the introduction of foreign DNA into prokaryotic or eukaryotic host cells, such as electroporation, calcium phosphate precipitation, DEAE-dextran transfection, etc. Although the antibodies described herein can be expressed in either prokaryotic or eukaryotic host cells, it may be preferable to express the antibodies in eukaryotic cells, particularly mammalian cells, because such cells are more likely than prokaryotic cells to assemble and secrete a properly folded and immunologically active antibody.

[0100] As mentioned above, exemplary mammalian host cells for expressing recombinant antibodies of the invention include Chinese hamster ovary (CHO) cells (e.g., dhfr-CHO cells described in Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77:4216-4220 (1980), incorporated herein by reference in its entirety). Other suitable mammalian host cells include, but are not limited to, NS0 myeloma cells, COS cells, and SP2 cells. When a recombinant expression vector encoding an antibody gene is introduced into a mammalian host cell, the antibody is produced by culturing the host cell for a period of time sufficient to allow expression of the antibody in the host cell, or more preferably, secretion of the antibody into the medium in which the host cell grows.

[0101] Host cells can also be used to produce functional antibody fragments, such as Fab fragments or scFv molecules. It is understood that variations on the above procedures are within the scope of the present invention. For example, it may be desirable to transfect host cells with DNA encoding functional fragments of either the light and / or heavy chains of the antibodies described herein. Recombinant DNA technology may be used to remove some or all of the DNA encoding either or both of the light and heavy chains that is not necessary for binding to the antigen of interest. Molecules expressed from such truncated DNA molecules are also encompassed by the antibodies described herein.

[0102] Antibodies and antibody-binding fragments are recovered and purified from recombinant cell culture by known methods, including, but not limited to, protein A purification, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography. High performance liquid chromatography ("HPLC") may also be used for purification.

[0103] Pharmaceutical compositions comprising MuSK antibody-based molecules The MuSK antibody-based molecules of the present invention or polynucleotides encoding MuSK antibody-based molecules are advantageously administered as a composition. In one embodiment, such a composition is a pharmaceutical composition comprising an active therapeutic agent (i.e., a MuSK antibody) and one or more of a variety of other pharmaceutically acceptable ingredients. See REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY (21st ed.) (2005) (Troy, DB et al. (eds.), Lippincott Williams & Wilkins (Publication), Baltimore, MD), which is incorporated herein by reference in its entirety. The preferred form will depend on the intended mode of administration and therapeutic application. Depending on the desired formulation, the composition may also include pharmaceutically acceptable non-toxic carriers, excipients, diluents, fillers, salts, buffers, detergents (e.g., non-ionic detergents such as Tween-20 or Tween-80), stabilizers (e.g., sugar- or protein-free amino acids), preservatives, tissue fixatives, solubilizers, and / or other materials suitable for inclusion in pharmaceutical compositions; these are vehicles commonly used to formulate pharmaceutical compositions for animal or human administration. The diluent is selected so as not to affect the biological activity of the combination. Such diluents include distilled water, physiological phosphate-buffered saline, Ringer's solution, dextrose solution, and Hank's solution. In addition, the pharmaceutical composition or formulation may include other carriers or non-toxic, non-therapeutic, non-immunogenic stabilizers, etc. Suitable aqueous and non-aqueous carriers that can be used in pharmaceutical compositions of the present invention include water, saline, phosphate buffered saline, ethanol, dextrose, polyols (e.g., glycerol, propylene glycol, polyethylene glycol, and the like) and suitable mixtures thereof, vegetable oils such as olive oil, corn oil, peanut oil, cottonseed oil, and sesame oil, carboxymethylcellulose colloidal solution, tragacanth gum, and injectable organic esters such as ethyl oleate, and / or various buffers. Other carriers are well known in the pharmaceutical art.

[0104] Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.The use of such media and agents for pharmaceutical active substances is well known in the art.Except insofar as any conventional media or agent is incompatible with the active compound, its use in the pharmaceutical compositions of the present invention is contemplated.

[0105] The compositions may also include large, slowly metabolized macromolecules, such as proteins, polysaccharides such as chitosan, polylactic acid, polyglycolic acid and copolymers (e.g., latex-functionalized Sepharose, agarose, cellulose, etc.), polymeric amino acids, amino acid copolymers, and lipid aggregates (e.g., oil droplets or liposomes), etc. Compatibility of the carrier with other components of the pharmaceutical composition is determined based on the lack of significantly adverse effect on the desired biological properties of the active antibody-based molecule of the invention (e.g., no substantial effect on antigen binding (e.g., 10% or less relative inhibition, 5% or less relative inhibition, etc.)).

[0106] The pharmaceutical compositions of the present invention may also contain pharmaceutically acceptable antioxidants, for example, (1) water-soluble antioxidants such as ascorbic acid, cysteine ​​hydrochloride, sodium bisulfate, sodium disulfite, and sodium sulfite; (2) oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, and α-tocopherol; and (3) metal chelators such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, and phosphoric acid.

[0107] The pharmaceutical compositions of the present invention may contain isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or glycerol, or sodium chloride in the composition.

[0108] Pharmaceutical compositions of the present invention may also contain one or more adjuvants appropriate for the selected route of administration, such as preservatives, wetting agents, emulsifying agents, dispersing agents, antiseptics, or buffers, which may enhance the shelf life or effectiveness of the pharmaceutical composition. The antibodies of the present invention may be prepared with carriers that will protect the antibody against rapid release, including, for example, controlled-release formulations, such as implants, transdermal patches, and microencapsulated delivery systems. Such carriers may include gelatin, glyceryl monostearate, glyceryl distearate, or biodegradable or biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid, alone or in combination with waxes, or other materials well known in the art. Methods for preparing such formulations are generally known to those skilled in the art. See, for example, SUSTAINED AND CONTROLLED RELEASE DRUG DELIVERY SYSTEMS, edited by JR Robinson, Marcel Dekker, Inc., New York, 1978.

[0109] In one embodiment, the antibodies of the present invention may be formulated to ensure proper distribution in vivo. Pharmaceutically acceptable carriers for parenteral administration include sterile aqueous solutions or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The use of such media and agents for pharmaceutically active substances is well known in the art.

[0110] Injectable pharmaceutical compositions typically must be sterile and stable under the conditions of manufacture and storage. The compositions may be formulated as solutions, microemulsions, liposomes, or other ordered structures suitable for achieving high drug concentrations. The carrier can be, for example, an aqueous or non-aqueous solvent or dispersion medium containing water, ethanol, polyols (e.g., glycerol, propylene glycol, polyethylene glycol, etc.) and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as glycerol, mannitol, or sorbitol, or sodium chloride in the composition. Prolonged absorption of injectable compositions can be achieved by including agents that delay absorption, for example, monostearate salts and gelatin in the composition. Sterile injectable solution can be prepared by incorporating active compound in the appropriate amount into suitable solvent, for example, with one or combination of the above-listed ingredients as needed, and then sterilizing microfiltration.Generally, dispersion is prepared by incorporating active compound into a sterile vehicle that contains basic dispersion medium and other necessary ingredients.For the preparation of sterile powder for sterile injectable solution, preparation methods include vacuum drying and freeze-drying (lyophilization), which can obtain powder of active ingredient and any additional desired ingredients from the solution that has been previously sterilized and filtered.

[0111] For parenteral administration, the agents of the present invention are typically formulated as an injectable solution or suspension of the agent in a physiologically acceptable diluent and a pharmaceutical carrier, which may be a sterile liquid, such as water, oil, saline, glycerol, or ethanol. Additionally, auxiliary substances, such as wetting or emulsifying agents, surfactants, pH buffering substances, and the like, may be present in the composition. Other components of pharmaceutical compositions may be of petroleum, animal, vegetable, or synthetic origin. Peanut oil, soybean oil, and mineral oil are all examples of useful materials. Generally, glycols, such as propylene glycol or polyethylene glycol, are preferred for liquid carriers, particularly for injectable solutions. The agents of the present invention may also be administered in the form of depot injectable or implant preparations, which can be formulated in a manner that allows sustained release of the active ingredient. An exemplary composition contains approximately 5 mg / mL of scFv formulated in an aqueous buffer containing 50 mM L-histidine and 150 mM NaCl, adjusted to pH 6.0 with HCl.

[0112] Typically, the composition is prepared as an injectable agent, either as a liquid solution or suspension.Solid forms suitable for dissolving or suspending in liquid vehicles before injection may also be prepared.The preparation may also be emulsified or encapsulated in liposomes or microparticles, such as polylactide, polyglycolide, or copolymers, to enhance adjuvant effect (Langer et al., Science 249:1527 (1990); Hanes et al., Advanced Drug Delivery Reviews 28:97-119 (1997)), the entire contents of which are incorporated herein by reference).Additional formulations suitable for other modes of administration include oral, intranasal, pulmonary, suppositories, and transdermal applications.

[0113] Administration of Pharmaceutical Compositions Comprising MuSK Antibody-Based Molecules The MuSK antibody-based molecules of the invention can be administered by parenteral, topical, oral, or intranasal means for therapeutic treatment. Intramuscular injection (e.g., injection into a muscle in the arm or leg) and intravenous injection are preferred methods of administering the molecules of the invention. In some methods, such molecules are administered as a sustained-release composition or device, e.g., a Medipad™ device (Elan Pharm. Technologies, Dublin, Ireland). In some methods, the antibodies disclosed herein are injected directly into a specific tissue, e.g., intracranial injection.

[0114] In one embodiment, the pharmaceutical compositions of the present invention are administered parenterally. As used herein, the phrases "parenteral administration" and "administered parenterally" refer to modes of administration other than enteral and topical administration, usually by injection, and include epidermal, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intracranial, intraorbital, intracardiac, intradermal, intraperitoneal, intrathecal, transtracheal, subcutaneous, subcuticular, intraarticular, intracapsular, intrathecal, intraspinal, intracranial, intrathoracic, epidural, and intrasternal injection, subcutaneous, and infusion. In one embodiment, the pharmaceutical composition is administered by intravenous or subcutaneous injection or infusion.

[0115] In therapeutic applications (i.e., applications relating to patients diagnosed with a neuromuscular disorder, e.g., amyotrophic lateral sclerosis (ALS), myasthenia gravis, or congenital myasthenia), the MuSK antibody-based molecules of the invention are administered to such patients in an amount sufficient to cure, treat, or at least partially arrest the symptoms of the disease (as evidenced by biochemical, histological, and / or behavioral assessments), including its complications in disease development and intermediate pathological phenotypes. In some embodiments, administration of a therapeutic molecule of the invention reduces or eliminates the neuromuscular disorder.

[0116] Effective doses of the therapeutic molecules provided herein for treating the above-mentioned conditions can vary depending on many different factors, such as the means of administration, the target site, the patient's physiological condition, and other drugs administered. Treatment dosages are typically titrated to optimize their safety and efficacy. On any given day, the dosage of the MuSK antibody-based molecules described herein can range from about 0.0001 to about 100 mg / kg of patient body weight, more usually from about 0.01 to about 20 mg / kg. For example, dosages can be 1 mg / kg body weight or 10 mg / kg body weight, or can be within the range of 1 to 10 mg / kg body weight. Thus, exemplary dosages include about 0.1 to about 10 mg / kg body weight, about 0.1 to about 5 mg / kg body weight, about 0.1 to about 2 mg / kg body weight, about 0.1 to about 1 mg / kg body weight, e.g., about 0.15 mg / kg body weight, about 0.2 mg / kg body weight, about 0.5 mg / kg body weight, about 1 mg / kg body weight, about 1.5 mg / kg body weight, about 2 mg / kg body weight, about 5 mg / kg body weight, or about 10 mg / kg body weight.

[0117] A physician or veterinarian skilled in the art can easily determine and prescribe the effective amount of pharmaceutical composition required. For example, the physician or veterinarian can start the dosage of the antibody-based molecule in the pharmaceutical composition at a lower level than necessary to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. Generally, a suitable daily dose of the composition of the present invention is the amount of the compound that is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend on the factors described above. Administration may be, for example, intravenous, intramuscular, intraperitoneal, or subcutaneous, and may be administered, for example, proximal to the target site. If desired, the effective daily dose of the pharmaceutical composition may be administered as two, three, four, five, six, or more subdoses administered separately at appropriate intervals throughout the day, optionally in unit dosage form. While the antibody-based molecules of the present invention can be administered alone, as described above, it is preferable to administer the antibody-based molecules as a pharmaceutical composition.

[0118] For therapeutic purposes, the MuSK antibody-based molecules of the present invention are typically administered multiple times. The interval between single administrations (e.g., bolus or injection) can be weekly, monthly, or yearly. In some methods, dosage is adjusted to achieve a plasma concentration of 1-1000 μg / mL, and in some methods, 25-300 μg / mL. Alternatively, the therapeutic molecules of the present invention can be administered as sustained-release formulations, in which case less frequent administration is required. Dosage and frequency vary depending on the half-life of the antibody in the patient. Generally, human antibodies exhibit the longest half-life, followed by humanized antibodies, chimeric antibodies, and non-human antibodies. scFv molecules generally have a short serum half-life.

[0119] In another embodiment, a pharmaceutical composition comprising a recombinant nucleic acid sequence encoding a MuSK antibody-based molecule described herein is administered to a subject to promote the in vivo expression and formation of the antibody-based molecule for the treatment of a condition mediated by decreased MuSK signaling and / or phosphorylation. Suitable expression vector constructs for use in this embodiment of the invention are described above.

[0120] The polynucleotide composition can result in the production of MuSK antibody-based molecules in the subject within at least about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 20 hours, 25 hours, 30 hours, 35 hours, 40 hours, 45 hours, 50 hours, or 60 hours of administration of the composition to the subject. The composition can result in the production of antibody-based molecules in the subject within at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days of administration of the composition to the subject. The composition can result in production of the antibody-based molecule in the subject within about 1 hour to about 6 days, about 1 hour to about 5 days, about 1 hour to about 4 days, about 1 hour to about 3 days, about 1 hour to about 2 days, about 1 hour to about 1 day, about 1 hour to about 72 hours, about 1 hour to about 60 hours, about 1 hour to about 48 hours, about 1 hour to about 36 hours, about 1 hour to about 24 hours, about 1 hour to about 12 hours, or about 1 hour to about 6 hours of administration of the composition to the subject.

[0121] The composition, when administered to a subject in need thereof, can result in sustained production of antibody-based molecules in the subject. The composition can provide sustained production of antibody-based molecules in the subject for at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 33 days, 34 days, 35 days, 36 days, 37 days, 38 days, 39 days, 40 days, 41 days, 42 days, 43 days, 44 days, 45 days, 46 days, 47 days, 48 ​​days, 49 days, 50 days, 51 days, 52 days, 53 days, 54 days, 55 days, 56 days, 57 days, 58 days, 59 days, 60 days, 61 days, 62 days, 63 days, 64 days, 65 days, 66 days, 67 days, 68 days, 69 days, 70 days, 71 days, 72 days, 73 days, 74 days, 75 days, 76 days, 77 days, 78 days, 79 days, 80 days, 81 days, 82 days, 83 days, 84 days, 85 days, 86 days, 87 days, 88 days, 89 days, 90 days, 91 days, 92 days, 93 days, 94 days, 95 days The production of the antibody-based molecule in the subject can be effected for 3 days, 34 days, 35 days, 36 days, 37 days, 38 days, 39 days, 40 days, 41 days, 42 days, 43 days, 44 days, 45 days, 46 days, 47 days, 48 ​​days, 49 days, 50 days, 51 days, 52 days, 53 days, 54 days, 55 days, 56 days, 57 days, 58 days, 59 days, or 60 days.

[0122] Therapeutic utility of MuSK-binding antibody-based molecules One aspect of the present invention relates to a method of increasing muscle-specific tyrosine-protein kinase (MuSK) signaling in a subject in need thereof. The method comprises administering to the subject a MuSK antibody-based molecule described herein, or a pharmaceutical composition comprising a MuSK antibody-based molecule described herein or a polynucleotide encoding a MuSK antibody-based molecule described herein. According to the method, the composition is administered in an amount effective to increase MuSK signaling in the subject compared to MuSK signaling in the subject prior to administration. Such administration may be provided to a subject with a neuromuscular disorder, such as amyotrophic lateral sclerosis (ALS), myasthenia gravis (MG), congenital myasthenia, MuSK-MG, spinal muscular atrophy (SMA), spinal-bulbar muscular atrophy (SBMA), Charcot-Marie-Tooth disease (CMT), distal hereditary motor neuropathy (dHMN), Duchenne muscular dystrophy (DMD), limb-girdle muscular dystrophy (LGMD), congenital muscular dystrophy (CMD), sarcopenia (SP), or Emery-Dreifuss muscular dystrophy. In one embodiment, the subject being treated is a subject with congenital myasthenia. In one embodiment, the subject being treated is a subject with Dok7-mediated congenital myasthenia. According to this aspect of the invention, such administration treats a neuromuscular condition.

[0123] In one embodiment, the MuSK antibody-based molecule administered to a subject in need thereof is a MuSK antibody-based molecule (3B2g2m1) comprising a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-H1 of SEQ ID NO: 159, CDR-H2 of SEQ ID NO: 172, and CDR-H3 of SEQ ID NO: 195.

[0124] In one embodiment, the MuSK antibody-based molecule administered to a subject in need thereof is a MuSK antibody-based molecule (3B2g1m1) comprising a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-H1 of SEQ ID NO: 159, CDR-H2 of SEQ ID NO: 172, and CDR-H3 of SEQ ID NO: 183.

[0125] In one embodiment, the MuSK antibody-based molecule administered to a subject in need thereof is a MuSK antibody-based molecule (3B2g1m2) comprising a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-H1 of SEQ ID NO: 159, CDR-H2 of SEQ ID NO: 172, and CDR-H3 of SEQ ID NO: 183.

[0126] In one embodiment, the MuSK antibody-based molecule administered to a subject in need thereof is a MuSK antibody-based molecule (3B2g2m2) comprising a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-H1 of SEQ ID NO: 159, CDR-H2 of SEQ ID NO: 172, and CDR-H3 of SEQ ID NO: 195.

[0127] In one embodiment, the MuSK antibody-based molecule administered to a subject in need thereof is a MuSK antibody-based molecule (3B2) comprising a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-H1 of SEQ ID NO: 159, CDR-H2 of SEQ ID NO: 172, and CDR-H3 of SEQ ID NO: 183.

[0128] As used herein, the term "treatment" or "treating" means ameliorating, slowing, or reversing the progression or severity of a disease or disorder, or ameliorating, slowing, or reversing one or more symptoms or side effects of such a disease or disorder. For purposes of the present invention, "treatment" or "treating" also means an approach for obtaining beneficial or desired clinical results. "Beneficial or desired clinical results" include, but are not limited to, partial or general alleviation of symptoms, detectable or undetectable, reduction in the extent of the disorder or disease, stabilization (i.e., not worsening) of the disease or disorder state, delaying or slowing the progression of the disease or disorder state, improvement or alleviation of the disease or disorder state, and remission of the disease or disorder.

[0129] An "effective amount" of an antibody-based molecule refers to an amount sufficient, at dosages and for periods of time necessary, to achieve an intended biological effect or desired therapeutic outcome, including but not limited to a clinical result. When applied to an antibody-based molecule of the invention, the phrase "therapeutically effective amount" is intended to refer to an amount of antibody sufficient to ameliorate, alleviate, stabilize, reverse, slow or delay the progression of a disorder or disease state, or the symptoms of a disorder or disease. In one embodiment, the method of the invention provides for the administration of an antibody-based molecule in combination with another compound. In such cases, an "effective amount" is the amount of the combination sufficient to cause the intended biological effect.

[0130] Another aspect of the present invention relates to a method of treating congenital myasthenia in a subject, comprising administering to a subject having congenital myasthenia a muscle-specific tyrosine-protein kinase (MuSK) agonist in an amount effective to increase MuSK phosphorylation, thereby treating congenital myasthenia in the subject.

[0131] In some embodiments, the MuSK agonist is a MuSK agonist antibody described herein. A MuSK agonist antibody binds to MuSK and enhances MuSK signaling or phosphorylation. In one embodiment, the MuSK agonist antibody binds to the Frizzled-like domain of human MuSK. In one embodiment, the MuSK agonist antibody binds to an epitope having the amino acid sequence of SEQ ID NO: 130 (Fz-like domain). Suitable MuSK agonist antibodies include those disclosed herein. In some embodiments, the congenital myasthenia is DOK7-mediated congenital myasthenia. [Example]

[0132] The detailed description of the present invention is further illustrated by the following examples, which should not be construed as limiting in any way.

[0133] Materials and Methods for Example 1 and Examples 5-12 mouse To generate Dok7 CM mice (also referred to herein as Dok7 1124 1127 dup mice), in vitro transcribed sgRNA (5'-CTGCTCAGTCTGCCCCC-3' (SEQ ID NO: 264)) (5 ​​ng / μl) and in vitro transcribed Cas9 RNA (10 ng / μl) were microinjected into the pronuclei of C57BL / 6 zygotes along with a DNA repair template containing a TGCC duplication (5'-ATGCCGGCAATCTG GACGTCTGGCGGGCCGGTGAGGAATTCGGTTCTCTGCTCAGTCTGCCTGCCCCCTGG AGCCAGCGCACCTGAGCCCAGACTGTGTGCCTGCCCACCTGGGGCGGCCGAGTA-3' (SEQ ID NO: 265) (10 ng / μl) (Price et al., "Specific Disruption of Abca1 Targeting Largely Mimics the Effects of miR-33 Knockout on Macrophage Cholesterol," which is incorporated herein by reference in its entirety). "Efflux and Atherosclerotic Plaque Development," Circ. Res. 124:874-880 (2019)). Fourteen mice born from the injected zygotes were analyzed by sequencing tail DNA (primer: 5'-GCAGTTACAG GAGGTTGG-3' (SEQ ID NO: 266)). One mouse carried the Dok7 allele with the desired TGCC duplication. Founder mice were crossed with wild-type C57BL / 6 mice to generate the Dok7 CM strain. DNA sequencing confirmed the sequence of the Dok7 mutation. Mice were subsequently genotyped using primers (forward: 5'-GCGGCCTCGGCAGTTACAG-3' (SEQ ID NO: 267); reverse: 5'-GCTTTACCTTG AGTCCGCCACAGA-3' (SEQ ID NO: 268). Five genomic loci with the highest probability of off-target recognition were analyzed. No evidence for mutations in these genes was found (Figures 16A-16B).

[0134] To generate Dok7 2YF mice, the cytoplasm of C57BL / 6 zygotes was injected with sgRNA (5'-TTCGAGGTGTGTCATAG-3' (SEQ ID NO: 269)) (15 ng / μl), and Cas9 RNA (30 ng / μl) was in vitro transcribed along with a DNA repair template (5'-ATGCCGGCAGCAACCTGGACGTGTGGCGGGCCGG TGAGGAATTCGGTTCTCTGCTCAGTCTGCCTGCCCCCTGGAGCCAGCGCACCTGAGC CCAGACTGTGTGCCTGCCCACCTGGGGCGGCCGAGTA-3' (SEQ ID NO: 270) (30 ng / μl) to convert tyrosine 396 and tyrosine 406 to phenylalanine. Thirty-three mice born from the injected zygotes were bred using tail DNA (primer: 5'-TGGCATTGCC The Dok7 allele was analyzed by sequencing the nucleotide sequence (SEQ ID NO: 271) of the Dok7 gene. One mouse carried the desired tyrosine-to-phenylalanine substitution. The founder mice were crossed with wild-type C57BL / 6 mice to generate the Dok7 2YF strain. DNA sequencing from these strains confirmed the sequence of the Dok7 mutation. Mice were housed and maintained in accordance with Institutional Animal Care and Use Committee (IACUC) guidelines.

[0135] Expansion of cultured skeletal muscle cells C2C12 mouse muscle cells (ATCC catalog number CRL-1772) were expanded in growth medium (GM), i.e., Dulbecco's modified Eagle's medium (DMEM) containing 4.5 g / L glucose, L-glutamine, and sodium pyruvate (Cellgro) supplemented with 10% fetal bovine serum (FBS; GemCell™), at 37° C. When myoblasts reached 70% confluence, they were switched to differentiation medium (DM), i.e., DMEM containing 4.5 g / L glucose and 1 mM L-glutamine supplemented with 2% heat-inactivated horse serum, to induce myoblast fusion and myotube differentiation. Immortalized myoblasts were isolated from wild-type and Dok7 2YF embryos and expanded as previously described (Smith et al., "Src, Fyn, and Yes are not required for neuromuscular synapse formation but are necessary for stabilization of agrin-induced clusters of acetylcholine receptors," J. Neurosci. 21:3151-3160 (2001), which is incorporated herein by reference in its entirety).

[0136] Agrin and antibody treatment of C2 myotubes Three days after C2C12 myotube formation, cultures were treated with 10 nM biotinylated Fab in combination with 2.5 nM streptavidin, 10 nM IgG, or 0.5 nM recombinant neural agrin-B8 (R&D Systems) for 30 minutes. Myotubes were homogenized at 4°C in lysis buffer (50 mM sodium chloride, 30 mM triethanolamine, pH 7.5, 50 mM sodium fluoride, 5 mM EDTA, 5 mM EGTA, 2 mM sodium orthovanadate, 1 mM N-ethylmaleimide, 1 mM sodium tetrathionate, 10 μM pepstatin, and complete protease inhibitor mix) (Roche). NP-40 was added to a final concentration of 1%, and the extract was incubated with rocking at 4°C for 30 minutes. Insoluble proteins were removed by centrifugation at 12,000 rpm for 20 minutes at 4°C. The supernatant was pre-cleared with protein G-agarose beads (Sigma-Aldrich) for 1 hour at 4°C and then incubated with an antibody against MuSK (MuSK 1A) overnight at 4°C (Takata, K. et al., "Characterization of Pathogenic Monoclonal Autoantibodies Derived from Muscle-Specific Kinase Myasthenia Gravis Patients," JCI Insight 4(12):el27167 (2019) and Fichtner et al., "Affinity Maturation is Required for Pathogenic Monovalent IgG4 Autoantibody Development in Myasthenia Gravis," J. Exp. Med. 217(12):e20200513 (2020), both of which are incorporated by reference in their entireties). The complex was incubated with protein G-agarose beads for 4 hours. The beads were then washed in lysis buffer containing 1% NP-40 (3 times for 9 minutes). Proteins were eluted from the beads with 1% SDS in lysis buffer.

[0137] Isolation of MuSK and Dok7 from muscle tissue Whole leg muscles or cultured muscle cells were homogenized at 4°C in lysis buffer (50 mM sodium chloride, 30 mM triethanolamine pH 7.5, 50 mM sodium fluoride, 5 mM EDTA, 5 mM EGTA, 2 mM sodium orthovanadate, 1 mM N-ethylmaleimide, 1 mM sodium tetrathionate, 10 μM pepstatin, and complete protease inhibitor mix (Roche). NP-40 was added to a final concentration of 1%, and the extract was incubated at 4°C for 30 minutes with rocking. Insoluble proteins were removed by centrifugation at 12,000 rpm for 20 minutes at 4°C. The supernatant was pre-cleared with protein G-agarose beads (Sigma-Aldrich) for 1 hour at 4°C, followed by incubation with an antibody against MuSK (MuSK 1A) (Takata, K. et al., "Characterization of Pathogenic Monoclonal Autoantibodies Derived from "Muscle-Specific Kinase in Myasthenia Gravis Patients," JCI Insight 4(12):el27167 (2019) and Fichtner et al., "Affinity Maturation is Required for Pathogenic Monovalent IgG4 Autoantibody Development in Myasthenia Gravis," J. Exp. Med. 217(12):e20200513 (2020) or goat anti-Dok7 (R&D Systems, AF 6398) was incubated overnight at 4°C, followed by incubation with protein G-agarose beads for 4 hours. The beads were then washed (3 times for 9 minutes) in lysis buffer containing 1% NP-40. Protein was eluted from the beads with 1% SDS in lysis buffer.

[0138] Western blotting Proteins were fractionated by SDS-PAGE and transferred to a PVDF membrane. Blots were probed with antibodies against MuSK (R&D Systems, AF 562), phosphotyrosine (Millipore, 05-321), or Dok7 (#1916) as previously described (Herbst & Burden, "The Juxtamembrane Region of MuSK has a Critical Role in Agrin-Mediated Signaling," EMBO J. 19:67-77 (2000); Bergamin et al., "The Cytoplasmic Adaptor Protein Dok7 Activates the Receptor Tyrosine Kinase MuSK via Dimerization," Mol. Cell 39:100-109 (2010); Hallock et al., "Dok-7 Regulates Neuromuscular Synapse Formation by Recruiting Crk and Crk-L," Genes Dev. 24:2451-2461 (2010), all of which are incorporated by reference in their entireties). Remedio et al., “Diverging Roles for Lrp4 and Wnt Signaling in Neuromuscular Synapse Development During Evolution”, Genes Dev. 30: 1058-1069 (2016); and Jaworski & Burden, “Neuromuscular Synapse Formation in Mice Lacking Motor Neuron- and Skeletal Muscle-Derived Neuregulin-1”, J. Neurosci. 26:655-661 (2006)).Antibodies against Crk (BD Bioscience, 610035) and Crk-L (Santa Cruz Biotechnology, sc-365092) were previously described (Hallock et al., "Dok-7 Regulates Neuromuscular Synapse Formation by Recruiting Crk and Crk-L," Genes Dev. 24:2451-2461 (2010), incorporated herein by reference in its entirety). Band intensity was quantified using a ChemiDoc imaging system (BioRad) as previously described (Remedio et al., "Diverging Roles for Lrp4 and Wnt Signaling in Neuromuscular Synapse Development During Evolution," Genes Dev. 30:1058-1069 (2016), incorporated herein by reference in its entirety). Graphs show average values ​​from at least three separate experiments. The Wilcoxon-Mann-Whitney test was used to determine statistical significance and was performed using GraphPad Prism 6.0 software.

[0139] Whole-mount muscle immunohistochemistry Diaphragm muscles were dissociated from E18.5 embryos and postnatal mice in oxygenated L-15 medium. Muscles were pinned onto Sylgard-coated dissection dishes, fixed in 1% PFA for 1.5 hours, and blocked with 3% BSA in PBS (Sigma, IgG-free) and 0.5% Triton X-100 (PBT) for 1 hour. Diaphragm muscles were stained with Alexa488-conjugated α-BGT (Invitrogen) to label AChRs and with antibodies against neurofilament-L (Synaptic Systems, 171002), b-TUBIII (Synaptic Systems, 302302), or synapsin 1 / 2 (Synaptic Systems, 106002) to label motor axons and nerve terminals (Kim & Burden, "MuSK Controls where Motor Axons Grow and Form Synapses," Nat. Neurosci. 11:19-27 (2008), incorporated herein by reference in its entirety). The antibodies were forcibly transferred to the muscles with a pipette, and the muscles were incubated overnight at 4°C on an orbital shaker in a humidified chamber. The diaphragm muscles were washed 10 times over 5 hours at room temperature with PT and rinsed with PBS. Afterwards, the muscles were whole-mounted in 50% glycerol. Muscles from at least three mice of each genotype were analyzed for each experiment. Images were acquired with a Zeiss LSM 800 confocal microscope. Detector gain and laser intensity were adjusted to avoid saturation. Synapse number and size, synaptic AChR density, endplate zone width, degree of denervation, and colocalization index (synapsin / AChR) were quantified using FIJI / ImageJ software as previously described (Jaworski & Burden, "Neuromuscular Synapse Formation in Mice Lacking Motor Neuron- and Skeletal Muscle-Derived Neuregulin-1," J. Neurosci. 26:655-661 (2006)), which is incorporated herein by reference in its entirety.The Wilcoxon-Mann-Whitney test was used to determine statistical significance and was performed using GraphPad Prism 9.0 software.

[0140] Isolation and staining of single muscle fibers Tibialis anterior muscles were dissected in oxygenated L-15 medium, pinned onto Sylgard-coated dishes, and fixed in 2% PFA (PBS) for 2 hours. After rinsing several times in PBS, one to three muscle fibers were manually separated using sharp forceps (Ralston et al., "The Organization of the Golgi Complex and Microtubules in Skeletal Muscle is Fiber Type-Dependent," J. Neurosci. 19:10694-10705 (1999)), which is incorporated herein by reference in its entirety). Fixed muscle fibers were blocked for 2 hours at room temperature in PBS containing 5% BSA, 1% normal goat serum, and 0.04% saponin. The fibers were then incubated with primary antibody overnight at 4°C, washed three times for 5 minutes in PBS containing 0.04% saponin, incubated with secondary antibody for 2 hours at room temperature, washed again, and mounted in VectaShield (Vector Laboratories). An antibody against Crk-L (Santa Cruz Biotechnology, sc-365092) was used, and the postsynaptic membrane was visualized by staining with AlexaFluor488-α-BGT (Invitrogen).

[0141] cryoablation immunohistochemistry Limb muscles were embedded in OCT medium and frozen on a dry ice platform. 10 μm sections collected on poly-L-lysine-coated glass slides were fixed in 1–4% PFA for 10 min, washed three times for 5 min in PBS containing 3% BSA (PB), permeabilized for 10 min in PB + 0.5% X-Triton (PBT), washed in PB, and incubated overnight at 4°C in a humidified chamber with a primary antibody against Crk-L (Santa Cruz Biotechnology, sc-365092) in PBT. After washing three times for 5 min in PB, sections were incubated overnight at 4°C in a humidified chamber with secondary antibodies diluted in PBS and AlexaFluor488-α-BGT (Invitrogen). After washing three times for 5 min in PB and then in PBS, sections were mounted in VECTASHIELD antifade mounting medium.

[0142] behavior Grip strength was measured using a grip strength apparatus (Bioseb) that measures both forelimb and whole-limb grip strength. To measure forelimb grip strength, mice were positioned in the center of a metal grid and gently held by the base of the tail, allowing only the forepaws to grip the grid. The mouse was gradually pulled backward until the forelimbs released their grip from the grid. The grip strength meter displayed a digital display of the maximum force (in grams) applied when the grip was released. For whole-limb measurements, the mouse was asked to grasp the grid with both forelimbs and hindlimbs, and the mouse was gradually pulled backward until it no longer gripped the grid. For both forelimb and whole-limb measurements, the average of six consecutive trials was used as an index of forelimb or whole-limb grip strength. Mice were allowed 10–15 s between each trial, with a 1–3 h interval between forelimb and whole-limb tests. Body weight was determined after all grip strength measurements to analyze potential covariates. To increase the robustness and reliability of grip strength assessments, all measurements were performed by the same experimenter (Mandillo et al., "Reliability, Robustness, and Reproducibility in Mouse Behavioral Phenotyping: A Cross-Laboratory Study," Physiol. Genomics 34:243-255 (2008) and Oury et al., "MACF1 Links Rapsyn to Microtubule- and Actin-Binding Proteins to Maintain Neuromuscular Synapses," J. Cell Biol. 218:1686-1705 (2019), both of which are incorporated by reference in their entireties).

[0143] The motor function of P60 male and female mice was assessed using a rotarod (AccuRotor four-channel, Omnitech Electronics, Inc.). Mice were placed on the rotarod (3.0 cm rotating cylinder) rotating at 2.5 rpm, and the rotation speed was linearly increased to 40 rpm over 5 min. The latency to fall from the rod was measured. Each mouse was given three trials with a 5-min interval, and the longest latency to fall from the three trials was recorded. The Wilcoxon-Mann-Whitney test was used to determine statistical significance and was performed using GraphPad Prism 9.0 software.

[0144] Development of human synthetic antibodies The full-length extracellular domains (E22-T494 of mouse MuSK and E22-T495 of human MuSK), including the Fz domain and C-terminal flanking sequences (D307-T494 of mouse MuSK and K314-T495 of human MuSK), were expressed as C-terminal fusions with the mouse IgkVIII secretion signal sequence in EXPI293 cells, carrying Avi and His6 tags. Expression was performed using the ExpiFectamine 293 Transfection kit (Thermo Fisher Scientific) according to the standard procedures provided by the vendor. Proteins were purified from filtered culture supernatants using a HiTrap nickel column (GE Healthcare) and biotinylated in vitro using BirA enzyme in the presence of 0.5 mM biotin and 10 mM ATP. The biotinylated proteins were further purified using a Superdex S75 10 / 300 column (GE Healthcare).

[0145] Selection of the antibody phage display library was performed as previously described (Miller et al., "T Cell Receptor-Like Recognition of Tumor in Vivo by Synthetic Antibody Fragment," PLoS One 7:e43746 (2012), incorporated herein by reference in its entirety). Briefly, the phage display library was initially selected with all four antigens at 100 nM in the first round, followed by selection with a single antigen at 100, 50, and 20 nM in the second, third, and fourth rounds, respectively. To enrich for clones that bind to both the human and mouse Fz domains, a multiple selection strategy was used, using alternate antigens sequentially (e.g., human Fz-mouse ECD-human ECD). Individual clones were screened using phage ELISA with the four antigens, and the DNA sequences of clones showing binding to all antigens were determined.

[0146] Fab proteins bearing an Avi tag at the C-terminus of the heavy chain of selected clones were produced in E. coli and biotinylated as previously described (Miller et al., "T Cell Receptor-Like Recognition of Tumor in Vivo by Synthetic Antibody Fragment," PLoS One 7:e43746 (2012), incorporated herein by reference in its entirety). Mouse IgG2a-LALAPG samples of clone X17 were generated using a modified version of the pFUSE-mIgG2a-Fc vector (InvivoGen), which contains the LALAPG mutation in the Fc region (Lo et al., "Effector-Attenuating Substitutions That Maintain Antibody Stability and Reduce Toxicity in Mice," J. Biol. Chem. 292:3900-3908 (2017)), and the human CH1 domain, as well as the pFUSE-CLIg vector (InvivoGen). This chimeric antibody consisted of a human Fab sequence and a mouse Fc sequence. Additionally, the mouse Fc sequence was replaced with that from human IgG1 containing the LALA mutation to generate hIgG1-X17, hIgG1-X2, and hIgG1-X3 antibodies.

[0147] Affinity measurement The affinity of antibody clones in the form of Fab and IgG was measured using a bead binding assay (Nishikori et al., "Broad Ranges of Affinity and Specificity of Anti-Histone Antibodies Revealed by a Quantitative Peptide Immunoprecipitation Assay," J. Mol. Biol. 424:391-399 (2012); Nady et al., "ETO Family Protein Mtgrl Mediates Prdml4 Functions in Stem Cell Maintenance and Primordial Germ Cell Formation," Elife 4:el0150 (2015); and Hattori et al., "Multiplex Bead Binding Assays Using Off-the-Shelf Components and Common Flow Cytometers," J. Immunol. Methods 490:112952 (2020), which are incorporated by reference in their entireties). Biotinylated human antigen proteins were immobilized on Dynabeads M280 streptavidin beads (Thermo Fisher Scientific) by rapidly mixing 100 μl of 10-fold diluted beads in 100 μl of PBSB (PBS containing 0.5% bovine serum albumin (BSA) (GeminiBio)) with 100 μl of 50 nM Fz protein. The beads were then blocked with 2 μM biotin, washed twice with PBSB, and resuspended in 1 ml of PBSB. The reaction was scaled appropriately for the number of measurements, if necessary. Five microliters of diluted beads and 20 μl of antibody sample were mixed in wells of a 96-well polypropylene plate (Greiner Bio-One, catalog no. 650261) and incubated for 30 minutes at room temperature with gentle shaking. The samples were transferred to wells of a 96-well filter plate (Millipore MultiScreen HTS HV, 0.45 mm, Thermo Fisher).The liquid was removed using a vacuum manifold, and the wells were washed three times with 200 μl of ice-cold PBSB using a vacuum manifold. The beads were stained with an anti-human Fab antibody labeled with AlexaFluor 647 (Jackson Immuno Research, AlexaFluor® 647 AffmiPure Goat Anti-Human IgG, F(ab')2 fragment specific, 109-605-097). After washing, the beads were suspended in 70 μl of PBSB and analyzed using an iQue screener (Sartorius) or an Intellicyt HTFC system. The resulting titration curves were analyzed by nonlinear least-squares fitting of a 1:1 binding model using GraphPad Prizm software.

[0148] Blood half-life measurement Mouse blood samples were centrifuged and the supernatant was diluted 2000-fold in PBSB. Antibody levels were quantified using the bead assay described above, except that the binding reaction was performed at 4°C. Half-lives were determined by nonlinear least-squares fitting of the median fluorescence intensity to a single exponential curve.

[0149] Phosphopeptide pull-down assay 293T cells were transfected with plasmids encoding HA-tagged Dok-7 and HA-tagged Crkl for 48 hours at 37°C (Lipofectamine 3000, Thermofisher Scientific). After 48 hours, transfected cells were homogenized in lysis buffer at 4°C, NP-40 was added to a final concentration of 1%, and the extract was incubated with rocking for 30 minutes at 4°C. Insoluble proteins were removed by centrifugation at 12,000 rpm for 20 minutes at 4°C. The supernatant was precleared with streptavidin-agarose beads (Sigma-Aldrich) for 1 hour at 4°C.

[0150] Four biotinylated phosphopeptides, (1) ELLLDRLHPNPMYQRMPLLLN (SEQ ID NO: 272), (2) ELLLDRLHPNPMp(Y)QRMPLLLN (SEQ ID NO: 273), (3) ELLLDRLHPAPMp(Y)QRMPLLLN (SEQ ID NO: 274), and (4) ELLLDRLHPNPMp(Y)AAAPLLLN (SEQ ID NO: 275) (Thermofisher Scientific), were immobilized on streptavidin agarose beads and incubated overnight at 4°C in lysis buffer (50 mM sodium chloride, 30 mM triethanolamine, pH 7.5, 50 mM sodium fluoride, 5 mM EDTA, 5 mM EGTA, 2 mM sodium orthovanadate, 1 mM N-methylimide, 1 mM sodium tetrathionate, and 10 μM pepstatin and complete protease inhibitor mix) (Roche) containing 1% NP-40. Cell extracts precleared with streptavidin-agarose beads were incubated overnight at 4°C with biotinylated phosphopeptides immobilized on streptavidin-agarose beads. The beads were then washed (3 times for 9 min) in lysis buffer containing 1% NP-40. Proteins were eluted from the beads with 1% SDS in lysis buffer. Western blotting was performed using an antibody against the HA tag (Abcam, ab49969).

[0151] RT-qPCR Total RNA was isolated from the muscles of wild-type and Dok-7CM embryos at E18.5 using TRIZOL Reagent (Invitrogen) and reverse transcribed using the Superscript-II First-Strand Kit (Invitrogen). Real-time quantitative PCR was performed on a LightCycler 480 (Roche) using the SYBR Green Master Kit (Roche). PCR was performed using the primer pair 5'-CTGGTGAA AAGGACCTCTCGAAG-3' (SEQ ID NO: 276) and 5'-CCAGTTTCACTAATGACACAAACG-3' (SEQ ID NO: 277) for Hprt and the primer pair 5'-TCAGCCTCAGAAGAGCGTGTTG-3' (SEQ ID NO: 278) and 5'-GCCTCAGAAGAGGAACTGGATAG-3' (SEQ ID NO: 279) for Dok7. Samples were run in triplicate, and Dok7 expression levels were normalized to Hprt expression.

[0152] Example 1 Disease mechanisms and therapeutic rescue of Dok7 congenital myasthenia Congenital myasthenic syndromes (CMs) are a group of disorders caused by mutations in genes that play important roles in the formation, function, and maintenance of neuromuscular synapses (e.g., Muller et al., "Congenital Myasthenic Syndromes: Spotlight on Genetic Defects of Neuromuscular Transmission," Expert Rev. Mol. Med. 9:1-20 (2007); Engel, AG, "Current Status of the Congenital Myasthenic Syndromes," Neuromuscul. Disord. 22:99-111 (2012); and Engel et al., "Congenital Myasthenic Syndromes: Pathogenesis, Diagnosis, and Treatment," Lancet Neurol. 14:420-434 (2015) which are incorporated by reference in their entireties). In most cases, mutations in these genes are recessive and reduce gene activity, causing synaptic defects that lead to early-onset structural and functional deficits of neuromuscular synapses, which cause fluctuating, fatigable, or persistent muscle weakness throughout life.

[0153] Mutations in Dok7, a gene encoding an adaptor protein important for the formation and maintenance of neuromuscular synapses (Okada et al., "The Muscle Protein Dok-7 is Essential for Neuromuscular Synaptogenesis," Science 312:1802-1805 (2006), which is incorporated herein by reference in its entirety), account for a significant proportion (10-20%) of all CM cases (Beeson et al., "Dok-7 Mutations Underlie a Neuromuscular Junction Synaptopathy," Science 313:1975-1978 (2006); Muller et al., "Phenotypical Spectrum of DOK7 Mutations in Congenital Myasthenic Syndromes," Brain 130:1497-1506 (2007); and Hamuro et al., "Mutations Causing DOK7 Congenital Myasthenia Ablate Functional Motifs in Dok-7," J. Neurol. 1999, 14:1497-1506 (2007), which are incorporated herein by reference in their entirety). Biol. Chem. 283:5518-5524 (2008)). The disease weakens muscles in the limbs, neck, and face, causing weakness, and one-quarter of Dok7 CM patients require non-invasive mechanical ventilation at some point in their lives.Albuterol / salbutamol, which activates adrenergic receptors, may benefit some patients with Dok7 CM through mechanisms that are not fully understood, but few treatments are available to alleviate clinical symptoms (Liewluck et al., "Beneficial Effects of Albuterol in Congenital Endplate Acetylcholinesterase Deficiency and Dok-7 Myasthenia," Muscle Nerve 44:789-794 (2011) and Burke et al., "Salbutamol Benefits Children with Congenital Myasthenic Syndrome due to DOK7 mutations," Neuromuscul. Disord. 23:170-175 (2013), which are incorporated by reference in their entireties).

[0154] The formation and maintenance of neuromuscular synapses requires the assembly of highly specialized pre- and postsynaptic membranes and involves the coordinated action of several key molecules (Burden, S. J, "The Formation of Neuromuscular Synapses," Genes Dev. 12: 133-148 (1998); Sanes & Lichtman, "Induction, Assembly, Maturation and Maintenance of a Postsynaptic Apparatus," Nat. Rev. Neurosci. 2: 791-805 (2001); Burden, SJ, "SnapShot: Neuromuscular Junction," Cell 144: 826-826 (2011); Burden et al., "The Role of MuSK in Synapse Formation and Neuromuscular Disease," Cold Spring Harb. Perspect. Biol. 5: 133-148 (2011); which are incorporated by reference in their entireties). a009167 (2013), and Tintignac et al., "Mechanisms Regulating Neuromuscular Junction Development and Function and Causes of Muscle Wasting," Physiol. Rev. 95: 809-852 (2015)). Agrin released from motor nerve terminals binds to lipoprotein receptor-related protein 4 (Lrp4) in muscle and stimulates the formation of a complex between Lrp4 and muscle-specific kinase (MuSK), a receptor tyrosine kinase that acts as a master regulator of synapse differentiation (Burden et al., "The Role of MuSK in Synapse Formation and Neuromuscular Disease," Cold Spring Harb. Perspect. Biol. 2015, 10:101-102, which is incorporated herein by reference in its entirety).5: pages 9167 (2013); Tintignac et al., "Mechanisms Regulating Neuromuscular Junction Development and Function and Causes of Muscle Wasting", Physiol. Rev. 95: 809-852 (2015); McMahan, U. J., "The Agrin Hypothesis", Cold Spring Harb. Symp. Quant. Biol. 55: 407-418 (1990); Jennings et al., "Muscle-Specific trk-Related Receptor with a Kringle Domain Defines a Distinct Class of Receptor Tyrosine Kinases", Proc. Natl. Acad. Sci. USA 90: 2895-2899 (1993); DeChiara et al., "The Receptor Tyrosine Kinase MuSK is Required for Neuromuscular Junction Formation in vivo", Cell 85: 501-512 (1996); Glass et al., "Agrin Acts via a MuSK Receptor Complex", Cell 85: 513-523 (1996); Kim et al., "Lrp4 is a Receptor for Agrin and Forms a Complex with MuSK", Cell 135: 334-342 (2008); and Zhang et al., "LRP4 Serves as a Coreceptor of Agrin", Neuron.60:285-297 (2008)). As a result of MuSK activation, Lrp4 clustered at the postsynaptic membrane retrogradely signals to motor axons, stimulating presynaptic differentiation (Yumoto et al., "Lrp4 is a Retrograde Signal for Presynaptic Differentiation at Neuromuscular Synapses," Nature 489:438-442 (2012), which is incorporated herein by reference in its entirety). Mutations in agrin, Lrp4, and MuSK, as well as mutations in acetylcholine receptor (AChR) subunit genes, also cause CM (Engel et al., "Congenital Myasthenic Syndromes: Pathogenesis, Diagnosis, and Treatment," Lancet Neurol. 14:420-434 (2015) and McMacken et al., "The Increasing Genetic and Phenotypical Diversity of Congenital Myasthenic Syndromes," Neuropediatrics 48:294-308 (2017), which are incorporated by reference in their entireties).

[0155] MuSK activation also depends on Dok7. The amino-terminal region of Dok7 contains pleckstrin homology (PH) and phosphotyrosine-binding (PTB) domains (FIG. 1A), which function to dimerize Dok7 and bind to phosphotyrosine motifs within the MuSK juxtamembrane (JM) region (Yamanashi et al., "Activation of Receptor Protein-Tyrosine Kinases from the Cytoplasmic Compartment," J. Biochem. 151:353-359 (2012), incorporated herein by reference in its entirety). Failure of Dok7 to bind to MuSK, either due to the absence of Dok7 or mutations in the MuSK JM region that prevent Dok7 binding, leads to a failure of agrin to stimulate MuSK phosphorylation (Okada et al., "The Muscle Protein Dok-7 is Essential for Neuromuscular Synaptogenesis," Science 312:1802-1805 (2006); Herbst & Burden, "The Juxtamembrane Region of MuSK has a Critical Role in Agrin-Mediated Signaling," EMBO J. 19:67-77 (2000); and Zhou et al., "Distinct Domains of MuSK Mediate Its Abilities to Induce and to Associate with Postsynaptic Specializations," J. Cell Biol. 146:1133-1146 (1999)), which are incorporated by reference in their entireties. This indicates that binding of Dok7 to MuSK is required to stabilize MuSK phosphorylation, likely by promoting MuSK dimerization (Bergamin et al., "The Cytoplasmic Adaptor Protein Dok7 Activates the Receptor Tyrosine Kinase MuSK via Dimerization," Mol. Cell 39: 100-109 (2010), which is incorporated herein by reference in its entirety).Furthermore, agrin-stimulated MuSK phosphorylation leads to phosphorylation of two tyrosine residues in the carboxy-terminal region of Dok7, resulting in the recruitment of Crk and Crk-L proteins, which are involved in acetylcholine receptor (AChR) clustering (Hallock et al., "Dok-7 Regulates Neuromuscular Synapse Formation by Recruiting Crk and Crk-L," Genes Dev. 24:2451-2461 (2010) and Hamuro et al., "Mutations Causing DOK7 Congenital Myasthenia Ablate Functional Motifs in Dok-7," J. Biol. Chem. 283:5518-5524 (2008), both of which are incorporated by reference in their entireties).

[0156] The most common cause of Dok7 CM is a four-base pair duplication (1124 1127 dup TGCC), which is almost always present as one or two mutant alleles in Dok7 CM, resulting in a frameshift and premature termination of Dok7 (Beeson et al., "Dok-7 Mutations Underlie a Neuromuscular Junction Synaptopathy," Science 313:1975-1978 (2006) and Cossins et al., "The Spectrum of Mutations that Underlie the Neuromuscular Junction Synaptopathy in DOK7 Congenital Myasthenic Syndrome," Hum. Mol. Genet. 21:3765-3775 (2012), which are incorporated by reference in their entireties). A truncated form of Dok7 retains the PH and PTB domains and binds to the tyrosine-phosphorylated JM region of MuSK (Beeson et al., "Dok-7 Mutations Underlie a Neuromuscular Junction Synaptopathy," Science 313:1975-1978 (2006), incorporated herein by reference in its entirety), but lacks the two tyrosine residues that become phosphorylated and recruit Crk proteins.These and other findings suggested that the absence of these two tyrosine residues in truncated Dok7 is responsible for the common form of synaptic defects in this Dok7 CM (Engel et al., "Congenital Myasthenic Syndromes: Pathogenesis, Diagnosis, and Treatment," Lancet Neurol. 14:420-434 (2015); Hallock et al., "Dok-7 Regulates Neuromuscular Synapse Formation by Recruiting Crk and Crk-L," Genes Dev. 24:2451-2461 (2010); and Hamuro et al., "Mutations Causing DOK7 Congenital Myasthenia Ablate Functional Motifs in Dok-7," J. Biol. Chem. 283:5518-5524 (2008) which are incorporated by reference in their entireties). However, the mechanism of Dok7 1124_1127 dup TGCC CM remains unclear.

[0157] The C-terminal region of Dok7 is essential for synapse formation To investigate how loss of the carboxy-terminal region of Dok7 leads to structural and functional defects in neuromuscular synapses, we generated a mouse model of the most common form of Dok7 CM (Dok7 1124_1127 dup) (Fig. 1A). We also generated a second mouse mutant (Dok7 Y396F; Y406F) in which two tyrosine residues in the carboxy-terminal region were mutated to phenylalanines (Fig. 1A).

[0158] Homozygous Dok7 1124_1127 dup mice, designated Dok7 CM mice, were present at the expected frequency at E18.5, but few were viable 1 day after birth, when neuromuscular synapses are essential for respiration and survival (Figure 1B). Diaphragm muscle from E18.5 embryos was stained with a probe that allows visualization of presynaptic and postsynaptic differentiation. Dok7 CM mice had 5-fold fewer synapses than wild-type mice (Figure 1C). Furthermore, the synapses that were formed were immature, as synapse size and synaptic AChR density were each 5-fold reduced (Figure 1C; Figure 7). In contrast, homozygous Dok7 Y396F; Y406F mice, designated Dok7 2YF mice, were born at the expected frequency (Figure 1B), and their neuromuscular synapses appeared nearly normal (Figure 1C; Figure 8). Furthermore, Dok7 2YF mice were raised to fertile adulthood. These findings, taken together, suggest that the loss of two tyrosine residues in the carboxy-terminal region of Dok7 is surprisingly not responsible for the lethality or severe defects in synaptogenesis in Dok7 CM mice.

[0159] Dok7 protein levels and MuSK tyrosine phosphorylation are reduced in Dok7 CM mice To determine how loss of the carboxy-terminal region causes synaptic defects, we measured the expression of Dok7 mRNA and truncated Dok7 protein in Dok7 CM mice using an antibody against the Dok7 PTB domain, which detected both the truncated and wild-type proteins equally (Figures 9A-9B). Although Dok7 mRNA levels were normal in muscles from Dok7 CM mice (Figures 10A-10C), the truncated Dok7 protein was expressed at levels three-fold lower than the wild-type Dok7 protein (Figure 2A; Figures 10A-10C).

[0160] Because Dok7 functions as a dimerizer for MuSK dimerization and stabilizes MuSK tyrosine phosphorylation (Bergamin et al., "The Cytoplasmic Adaptor Protein Dok7 Activates the Receptor Tyrosine Kinase MuSK via Dimerization," Mol. Cell 39:100-109 (2010), incorporated herein by reference in its entirety), we investigated whether reduced Dok7 protein levels in Dok7 CM mice would lead to reduced MuSK tyrosine phosphorylation. We immunoprecipitated MuSK and measured MuSK phosphorylation. MuSK phosphorylation was reduced 7-fold in Dok7 CM mice but remained normal in Dok7 2YF mice (Figures 2C-D).

[0161] Crk proteins, like Dok7, are directly recruited to MuSK We expected that Crk recruitment to synapses would be absent or severely reduced in both Dok7 CM and Dok7 2YF mutant mice. Indeed, Crk recruitment to synapses and MuSK complexes was substantially reduced (2.8-fold) in Dok7 CM mice (Fig. 3A-B), but surprisingly, it was only mildly reduced (28%) in Dok7 2YF mice (Fig. 3A-B). These findings suggest that Crk is recruited to tyrosine-phosphorylated synaptic proteins in addition to Dok7.

[0162] Three activation loop tyrosines and Y553 are phosphorylated in MuSK after agrin stimulation (Okada et al., "The Muscle Protein Dok-7 is Essential for Neuromuscular Synaptogenesis," Science 312:1802-1805 (2006); Herbst & Burden, "The Juxtamembrane Region of MuSK has a Critical Role in Agrin-Mediated Signaling," EMBO J 19:67-77 (2000); Watty et al., "The in vitro and in vivo Phosphotyrosine Map of Activated MuSK," Proc. Natl. Acad. Sci. USA 97:4585-4590 (2000); and Till et al., "Crystal Structure of the MuSK Tyrosine Kinase: Insights into Receptor Autoregulation," Structure 10: (2002, pp. 1187–1196). We found that Y553 in the MuSK JM region is not only located within the PTB-binding site that recruits Dok7, but also within a potential SH2-binding motif of the Crk protein (Figure 3C). Figure 3D shows that CrkI and Dok7 bound to the MuSK JM region in a phosphorylation-dependent manner. Mutation of amino acids that constitute the SH2-binding motif but not the PTB-binding site impaired CrkI binding (Figure 3D). Thus, Crk can directly bind not only to the phosphorylated carboxy-terminal region of Dok7 but also to the tyrosine-phosphorylated JM region of MuSK. This redundancy in recruiting Crk to synapses and the MuSK complex may explain the nearly normal association of Crk with the MuSK complex in Dok7 2YF mice and may underlie the distinct phenotypes of Dok7 CM and Dok7 2YF mice.

[0163] Thus, the MuSK JM region has overlapping binding sites for PTB and SH2 domain-containing proteins, an arrangement that provides flexibility and regulation in signaling patterns downstream of receptor tyrosine kinases and may be more general than currently understood.

[0164] Development of agonistic antibodies against human and mouse MuSK We reasoned that if reduced MuSK phosphorylation was critical for disease in Dok7 CM, stimulating MuSK might rescue synaptic defects and overcome lethality. We explored the notion that reduced MuSK phosphorylation is central to disease by generating Dok7 CM mice and treating them with an agonistic antibody targeting MuSK.

[0165] A phage display library expressing synthetic human antibodies in Fab format was screened for antibodies that bind to the Fz-like domain in the extracellular region of both mouse and human MuSK. The Fz-like domain was targeted because this domain is not essential for MuSK function and previous studies have shown that antibodies against the Fz-like domain cause no apparent adverse effects in mice (Remedio et al., "Diverging Roles for Lrp4 and Wnt Signaling in Neuromuscular Synapse Development During Evolution," Genes Dev. 30:1058-1069 (2016) and Cantor et al., "Preserving Neuromuscular Synapses in ALS by Stimulating MuSK with a Therapeutic Agonist Antibody," Elife 7:e34375 (2018), both of which are incorporated by reference in their entireties).

[0166] High-affinity antibodies that bound to the Fz-like domain in human and mouse MuSK were identified (Fig. 4A; Fig. 12A-C). Tetramerized versions of each Fab, except for X1, stimulated MuSK phosphorylation in mouse C2 myotubes (Fig. 4B). Antibodies X3 and X17, both in mouse IgG2a and human IgG1 forms, and antibody X2 in its human IgG1 form, bound to human and mouse MuSK with subnanomolar affinity and similarly stimulated MuSK tyrosine phosphorylation independently of agrin (Fig. 4C-D). Because these antibodies had similar activities, X17 was selected for further analysis in vivo.

[0167] The antibody X17, in its murine IgG2a form with the so-called LALAPG mutation, which reduces Fc domain effector function (Lo et al., "Effector-Attenuating Substitutions That Maintain Antibody Stability and Reduce Toxicity in Mice," J. Biol. Chem. 292:3900-3908 (2017)), which is incorporated herein by reference in its entirety, was injected intraperitoneally into wild-type mice. X17 was found to have a half-life of 5 days in the blood (Figure 4E). By staining for X17 and quantifying target association at neuromuscular synapses, we found that 10 mg / kg of X17 was sufficient to saturate synaptic MuSK (Figure 4F). Chronic injection of mIgG2a-X17 (10 mg / kg at P4, P24, and P44) in wild-type mice over a 2-month period did not affect neuromuscular synaptic organization, weight gain, or motor behavior (Figures 13A-D).

[0168] Agonistic antibody X17 rescues synaptogenesis and lethality in Dok7 CM mice While Dok7 CM mice on a C57BL / 6 background died at birth, Dok7 CM mice on a mixed genetic background were found to survive for 1–2 weeks after birth (Figures 14A–14B), facilitating experiments to investigate therapeutic efficacy. Dok7 CM mice on a C57BL / 6-CBA mixed background showed signs of disease soon after birth, as they were stunted and had defects in synaptogenesis (Figures 15A–15E). Despite surviving for several weeks after birth, Dok7 expression, MuSK phosphorylation, and organization of nerve terminals and AChRs were similar in El8.5 inbred C57BL / 6 and mixed-breed C57BL / 6-CBA mice carrying the same Dok7 mutation.

[0169] Dok7 CM mice were injected with 10 mg / kg of antibody X17 or an isotype-matched negative control antibody on P4. Untreated Dok7 CM mice or those injected with the isotype control antibody continued to lose weight and died within 1 week at P10–12 (Figures 5A–5B). Injection of antibody X17 reversed the weight loss and rescued Dok7 CM mice from this early lethality (Figures 5A–5B). Over the next 3 weeks, weight gain continued in 9 of 12 Dok7 CM mice injected with antibody X17; weight gain slowed in 3 of the X17-injected mice and they died at P23–P24. Another antibody, X3, rescued Dok7 CM mice from early postnatal lethality when administered at 20 mg / kg, but not at 10 mg / kg (Figures 17A-C), suggesting that higher initial doses of MuSK agonist antibodies may be more effective in early postnatal development, when synapses are undergoing the critical process of maturation.

[0170] Injections of antibody X17 were repeated in the nine surviving Dok7 CM mice at P24 and P44 to determine whether chronic administration could lead to long-term survival. Long-term administration of antibody X17 in the nine surviving Dok7 CM mice rescued these mice for at least 2 months when their motor performance was assessed and they were sacrificed for synaptic examination (Figures 5A-B).

[0171] Antibody X17 rescued synaptogenesis and maturation, such that neuromuscular synapses developed the complex pretzel-like shape characteristic of fully mature mouse neuromuscular synapses (Fig. 5C).Furthermore, XI7 rescued the recruitment of Crk protein to neuromuscular synapses (Fig. 5D).

[0172] Antibody X17 rescued motor function in Dok7 CM mice as assessed by forelimb grip strength and rotarod assays (Figure 5E). Furthermore, Dok7 CM mice injected with antibody XI7 were fertile and produced offspring at the expected frequency. Together, these findings support the idea that reduced MuSK tyrosine phosphorylation is central to the disease in Dok7 CM mice. Even if the carboxy-terminal region of Dok7 has an additional role in synaptogenesis, such function could be abrogated by stimulating MuSK.

[0173] Therapeutic success in adult Dok7 CM mice We next investigated whether X17 could reverse adult-onset neuromuscular defects. This question is particularly relevant for the development of therapeutics in humans, as Dok7 CM is likely treated in adulthood. Dok7 CM mice were treated with X17 either on P4, P24, and P44, or on P4 and P18, after which antibody treatment was discontinued. These Dok7 CM mice continued to maintain their weight and mobility for 2–3 months (Figure 6A), indicating that the rescue was more durable than the lifespan of the antibody in the blood. However, these Dok7 CM mice eventually began to lose weight and exhibit motor deficits (Figure 6A–6B). When mice showed weight loss at a rate of approximately 0.4 g / day, X17 was injected again, and the weight and mobility of Dok7 CM mice were monitored. Two days after resuming XI7 treatment, Dok7 CM mice began to regain weight, increasing at approximately 0.4 g / day over the next week (Figure 6A). Within one week of resuming antibody treatment, Dok7 CM mice regained their exercise performance (Figure 6B). Rescued mice continued to gain weight and improve their exercise performance for at least another week after antibody treatment, until they were sacrificed (Figures 6A-B).

[0174] Consideration of Example 1 Stimulating MuSK with an agonist antibody rescued synaptogenesis and motor function, prevented lethality, and enabled Dok7 CM mice to reproduce as fertile adults after birth. Furthermore, after cessation of antibody treatment, Dok7 CM adult mice eventually exhibited motor deficits, which rapidly reversed after resumption of antibody treatment. This suggests that this therapeutic strategy may be beneficial for Dok7 CM and other neuromuscular diseases in humans.

[0175] Most previous studies of Dok7 have relied on the analysis of transfected muscle and non-muscle cells overexpressing Dok7 (Okada et al., "The Muscle Protein Dok-7 is Essential for Neuromuscular Synaptogenesis," Science 312:1802-1805 (2006); Hamuro et al., "Mutations Causing DOK7 Congenital Myasthenia Ablate Functional Motifs in Dok-7," J. Biol. Chem. 283:5518-5524 (2008); and Hallock et al., "Dok-7 Regulates Neuromuscular Synapse Formation by Recruiting Crk and Crk-L," Genes Dev. 24:2451-2461 (2010), all of which are incorporated by reference in their entireties). In this context, where the normal requirement for agrin and Lrp4 to stimulate MuSK is bypassed, the in vivo consequences of Dok7 mutations may be masked due to Dok7 overexpression.

[0176] Previous work has described a similar mouse model of this common form of Dok7 CM, generated using classical ES cell gene targeting (Arimura et al., "Neuromuscular Disease. DOK7 Gene Therapy Benefits Mouse Models of Diseases Characterized by Defects in the Neuromuscular Junction," Science 345:1505-1508 (2014), which is incorporated herein by reference in its entirety). The lethality of these mutant mice was rescued by an adenovirus-associated vector expressing wild-type Dok7, establishing a therapeutic approach for treating Dok7 CM (Arimura et al., "Neuromuscular Disease. DOK7 Gene Therapy Benefits Mouse Models of Diseases Characterized by Defects in the Neuromuscular Junction," Science 345:1505-1508 (2014), incorporated herein by reference in its entirety), but this study did not examine the cause of disease in the Dok7 1124_1127 dup mouse model.

[0177] Inbred C57BL / 6 mice carrying the Dok7 1124_1127 dup mutation exhibited more severe functional defects than humans with the same mutation. While outbred mice survived for several weeks after birth, inbred mutant mice died at birth, suggesting that the severity of the mutant phenotype was less severe in mice with a mixed genetic background. It is possible that modifiers in the hybrid strain reduce the severity of the disease, or that C57BL / 6 mice harbor genes that exacerbate the phenotype. In either case, the moderately extended lifespan of Dok7 CM mice on a mixed background provides a mouse model that offers a longer time window for better evaluation of therapeutic approaches.

[0178] These experiments demonstrate complete rescue from congenital lethality by targeted therapy. These findings represent an unexpected therapeutic approach for treating disease because this strategy does not directly target the mutant protein but rather targets the reduced activity of the wild-type protein caused by mutations in an upstream gene, in this case Dok7. Such rescue of epistasis may provide a treatment for CM caused by mutations in agrin, Lrp4, or MuSK, in addition to Dok7, as well as additional neuromuscular diseases. Furthermore, this strategy has the potential for broad application for treating recessively inherited diseases in humans where the disease mechanisms are understood and appropriate targets have been identified.

[0179] Example 2 MuSK antibody Selection of simple antibodies targeting the Frizzle domain of MuSK Two llamas were immunized with recombinant human MuSK (R&D Systems, catalog number 9810-MK). PBLs isolated from the immunized llamas were used for RNA extraction, RT-PCR, and PCR cloning of Fabs into phagemids using the strategy described by de Haard et al. (see de Haard et al., "A Large Non-Immunized Human Fab Fragment Phage Library that Permits Rapid Isolation and Kinetic Analysis of High Affinity Antibodies," J. Biol. Chem. 274:18218-18230 (1999)), which is incorporated herein by reference in its entirety. Up to three rounds of panning phage display selection were performed using either full-length human MuSK, full-length mouse MuSK, or human MuSK lacking the Ig1-like and / or Ig2-like and / or Ig3-like domains (FIG. 18).

[0180] For each selection with enrichment, individual clones were expanded in 96-deep-well plates, and periplasmic fractions were prepared. These periplasmic extracts (containing Fabs) were tested for binding to full-length human MuSK, full-length mouse MuSK, or human MuSK lacking the Ig1-like and / or Ig2-like and / or Ig3-like domains in ELISA. Fabs showing clear binding in ELISA were then tested for off-rates on a Biacore™ chip coated with full-length human MuSK, full-length mouse MuSK, or human MuSK lacking the Ig1-like and / or Ig2-like and / or Ig3-like domains. Binders with good affinity for human and mouse MuSK and binders specific for the Frizzle domain of MuSK were sequenced. Six distinct binder families were obtained: 1E11, 6F8, 10F1, 17H10, 14D10, and 16F11. These were cloned into a vector containing the sequence of human IgG1 with LALA mutations (L234A, L235A) to knock out effector function. Antibodies were produced in HEK293 cells and purified on a Protein A column.

[0181] Antibody binding to human and mouse MuSK in ELISA ELISA plates were coated with human MuSK (R&D Systems, catalog no. 10189-MK) or mouse MuSK (produced in-house in HEK 293 cells) at 0.2 μg / ml. After washing and blocking, serial dilutions of anti-MuSK antibodies were applied and allowed to bind for 2 hours at room temperature. Binding was detected with goat anti-human Fc-HRP (Jackson Immunoresearch, catalog no. 109-035-008) and TMB (Merck Millipore, #CL07). OD at 620 nm was measured using a 96-well ELISA plate reader.

[0182] All six antibodies (1E11, 6F8, 10F1, 17H10, 14D10, and 16F11) showed binding to human MuSK. However, binding to mouse MuSK was poor, except for 16F11, whose binding to mouse MuSK increased at higher 16F11 concentrations than to human MuSK (Figure 19). In conclusion, this assay revealed poor human-mouse cross-reactive binding of five of the six antibodies tested.

[0183] Light chain shuffling to improve cross-reactivity in mice Upon repeated exposure to the same antigen, for example, during llama immunization, the immune response is optimized by increasing the affinity of the antibody for the target. Secondary responses can induce antibodies with several log-fold higher affinity than the primary response. As a result, B cells produce a variety of antibodies, and therefore variants with different affinities for the antigen. Five of the six antibodies selected above showed low cross-reactivity with mice. Therefore, chain shuffling was applied to the mAbs. In this method, the VH of the Fab molecules was cloned into the entire VL repertoire of each individual llama. The resulting library contained Fab phages with a VH chain specific to the Fab and a random VL chain. Using phage display and different variants of MuSK (as described above), naturally occurring higher affinity variants in the immunized animals were selected. For each selection with enrichment, individual clones were expanded in 96-deep-well plates, and periplasmic fractions were prepared. These periplasmic extracts (containing Fab) were tested for binding on Biacore on CM5 chips coated with full-length human MuSK and full-length mouse MuSK. Binders with good affinity for human and mouse MuSK were sequenced. This campaign was successful with 14D10, 16F11, 6F8, and 17H10. No improvement in mouse cross-reactivity was obtained with 10F1 and 1E11.

[0184] For 14D10, cross-reactive binders of six different sequences were obtained: 31G2, 31B7, 3C4, 7G4, 3G3, and 3B2. For 17H10, cross-reactive binders of three different sequences were obtained: 23B6, 30E1, and 30A11. For 16F11, cross-reactive binders of four different sequences were obtained: 4C11, 7G12, 7B8, and 7A12.

[0185] All of these antibodies were cloned into a vector containing the sequence of human IgG1 with the LALA mutation (L234A, L235A) to knock out effector function. The antibodies were produced in HEK293 cells and purified on a protein A column.

[0186] Antibody binding to human and mouse MuSK in ELISA ELISA plates were coated with 0.2 μg / ml human MuSK (R&D Systems, Cat. No. 10189-MK), rhesus MuSK (produced in-house in HEK293 cells), or mouse MuSK (produced in-house in HEK293 cells). After washing and blocking, a dilution series of anti-MuSK antibody was applied and allowed to bind for 2 hours at room temperature. Binding was detected with goat anti-human Fc-HRP (Jackson Immunoresearch, Cat. No. 109-035-008) and TMB (Merck Millipore, #CL07). After stopping the reaction with 0.5N H2SO4 (ChemLab, #CL052615), the OD at 450 nm was measured using a 96-well ELISA plate reader. EC 50 The values ​​are summarized in Table 4. All clones tested showed improved affinity for mouse MuSK.

[0187] [Table 4]

[0188] The best clones were selected using the following criteria: (i) highest affinity to human, rhesus, and mouse MuSK; (ii) smallest difference in affinity between human, rhesus, and mouse MuSK; (iii) maximum 10-fold difference in affinity between human, rhesus, and mouse MuSK; (iv) low risk of manufacturability issues based on sequence analysis of the CDRs; and (v) highest identity / homology with human.

[0189] Clones 3B2, 30A11 and 30E1 were selected for large-scale antibody production in HEK293 cells and detailed characterization.

[0190] Binding affinity for human versus mouse MuSK in Biacore Monovalent binding to MuSK can inhibit agrin-induced MuSK phosphorylation and AChR clustering, as described by Huijbers et al., "MuSK Myasthenia Gravis Monoclonal Antibodies: Valency Dictates Pathogenicity," Neurol. Neuroimmunol. Neuroinflamm. 6(3):e547 (2019), incorporated herein by reference in its entirety. Therefore, it is important to evaluate the affinity of the 3B2, 30E1, and 30A11 Fabs for MuSK. Indeed, low-affinity Fabs can reduce monovalent binding of mAbs and thus potentially have safety benefits. Therefore, Fab affinities for human and mouse MuSK were compared with mAb affinities in Biacore.

[0191] For affinity determination, CM5 chips were coated with either human or mouse MuSK (200 RU) and a dilution series of the antibodies (mAb and Fab) was applied so that affinities could be calculated.

[0192] Using this assay, the affinity of the 3B2 mAb was 0.1 nM for both human and mouse MuSK. Fab 3B2 exhibited affinities of 3 nM for human MuSK and 1.5 nM for mouse MuSK, which are 15-30 times lower than the affinities of the mAb.

[0193] 30E1 showed a 10-fold difference in binding affinity for human MuSK (0.01 nM) compared to mouse MuSK (0.1 nM). 30A11 showed a 100-fold difference in their binding affinity for human MuSK (0.001 nM) versus mouse MuSK (0.1 nM). Thus, both antibodies are not fully mouse cross-reactive. Furthermore, 30E1 Fab and 30A11 Fab showed high affinities for human MuSK (0.07 nM and 0.8 nM), respectively. The lack of mouse cross-reactivity of both antibodies was also observed for the Fabs. These results suggest a 10- to 100-fold difference in the affinities of the 30E1 and 30A11 mAbs and at least a 1000-fold difference in the affinities for human versus mouse MuSK for the 30E1 and 30A11 Fabs (Table 5). This difference in antibody target affinity makes it difficult to evaluate in vivo mouse experiments and translate the data to humans, and therefore discourages further antibody development. In conclusion, the 3B2 mAb and Fab exhibit desirable affinity characteristics and cross-species reactivity for further development.

[0194] [Table 5]

[0195] Antibody potency in the C2C12 phosphorylation assay To evaluate the enhancement of MuSK phosphorylation induced by 3B2, 30E1, and 30A11, an in vitro MuSK phosphorylation assay was performed using mouse C2C12 myotubes (91031101, Sigma Cell Line Services, ECACC). Differentiated myotubes were stimulated with 10 nM of antibody. A positive control for MuSK phosphorylation was the application of 0.1 nM rat neural agrin (550-AG-100, R&D Systems). Immunoprecipitation of MuSK was initiated immediately after exposure during overnight incubation at 4°C. Bound antigen-antibody complexes were detected by precipitation with streptavidin-coated magnetic beads (V7820, The beads were precipitated using a Promega antibody (Promega) at 4°C for at least 1 hour, followed by extensive washing. Concurrently, streptavidin-coated MSD plates (L15SA-1, MSD) were blocked and coated with biotinylated hIgG4 anti-MuSK (clone 13-3B5 - Evitria 801457.1 PID 9860 - biotinylation was performed by Argenx). MuSK protein was eluted from the beads using acid conditions, followed by a neutralization step, and incubated on the hIgG4 anti-MuSK-coated MSD plates for at least 2.5 hours at room temperature. Sample incubation was performed in the presence of a truncated form of MuSK (MuSK Δ1-2-3Ig in HEK, Argenx) in solution to limit drug interference from the co-eluting anti-MuSK hIgG1 antibody. Samples were loaded onto the plate in quadruplicate, allowing dual detection of total MuSK (a mix of PA1-1741, Thermoscientific, and MBS9205728, MyBioSource) and phosphorylated MuSK (a mix of 05-321, Millipore Corp. (clone 4G10) and ab10321, Abcam (clone PY20)). Final detection was performed using SULFO-TAG conjugated antibodies: anti-rabbit IgG (32AB-1, MSD) for total MuSK detection and anti-mouse IgG (R32AC-1, MSD) for phosphorylated MuSK detection, respectively. Bound antibodies were detected using a Quickplex SQ 120 (MSD).

[0196] Addition of agrin (1 nM) to C2C12 myotubes induced MuSK phosphorylation, which was set at 100%. Three independent experiments were performed. Using this experimental setup, 3B2, 30E1, and 30A11 were able to induce MuSK phosphorylation between 50 and 94% in this assay (Table 6).

[0197] [Table 6]

[0198] 3B2 rescues early postnatal lethality in Dok7 1124_1127 dup mice In the first experiment, intraperitoneal (IP) administration of 10 mg / kg of 3B2 at both P4 and P18 in wild-type mice (C57BL / 6 / / CBA) showed no clear differences in body weight and overall health from isotype-injected wild-type mice for at least 5 weeks, suggesting no safety concerns or toxicity issues, and demonstrating that the 3B2 antibody is safe for further in vivo experimental work.

[0199] Next, we administered 3B2 to Dok7 1124_1127 dup mice, a mouse model of CMS. In Dok7 1124_1127 dup mice (hereafter referred to as Dok7 mice), truncated Dok7 is not fully expressed, resulting in significantly reduced MuSK tyrosine phosphorylation. Reduced levels of MuSK phosphorylation in Dok7 mice play an important role in the disease. Stimulating MuSK phosphorylation with an agonist antibody against MuSK rescued the lethality of Dok7 mice, allowing the mutant mice to survive as adults. Indeed, administration of 3B2 (20 mg / kg IP on P4 and 10 mg / kg IP on P18) rescued the early postnatal lethality of Dok7 mutant mice (Figure 20).

[0200] Elimination of 3B2 Liabilities and CDR Porting The 3B2 antibody was diluted to 1 mg / mL in PBS-Tween and incubated at 37°C for up to 6 weeks. Samples were then analyzed by mass spectrometry and screened for deamidation, glycosylation, isomerization, and oxidation sites in VH and VL. As expected, two problem areas were identified: one deamidation site in VH-CDR2 and one oxidation site in VL-CDR3. Mutants were generated to eliminate both problems. Furthermore, 3B2 already had high human identity / homology (94.2% and 97.7%, respectively), which was further improved to 100% by CDR-grafting to the closest human germline sequences.

[0201] By combining these two strategies, a total of eight variants were generated, as summarized in Table 7. Antibodies were produced in HEK293 cells with a human IgG1-LALA backbone and purified on a Protein A column.

[0202] [Table 7]

[0203] Affinity of sequence-optimized variants of 3B2 in Biacore For affinity determination, CM5 chips were coated with cynomolgus monkey, rat, and mouse MuSK (200 RU), 66.7 nM antibody was applied, and kinetic parameters were calculated (Table 8). The following conclusions were obtained: (1) 3B2g1m3 and 3B2g2m3 (m3 variants) show significantly reduced affinity for MuSK for all species tested; (2) 3B2g1m2 and 3B2g2m2 (m2 variants) show some reduced affinity for MuSK; (3) 3B2g1m1, 3B2g2m1, 3B2g1m4, 3B2g2m4 (m1 and m4 variants) show no reduced affinity for MuSK for all species tested; and (4) there is no difference between the g1 and g2 variants for all clones (VL methionine vs. serine in CDR3).

[0204] [Table 8]

[0205] Conventional antibodies are internalized by nonspecific endocytosis or pinocytosis or via receptor-mediated internalization. In contrast to conventional antibodies, which can only bind to an antigen once, recycling antibodies are engineered so that a single antibody molecule can bind to the antigen multiple times. Indeed, when conventional antibodies bind to membrane-anchored antigens such as receptors, the antibody-antigen complex is internalized and degraded in lysosomes. This shortens the half-life of therapeutic antibodies and necessitates the frequent administration or higher doses of antibody drugs to maintain effective plasma antibody concentrations. Antibodies can be engineered to dissociate from antigens at the acidic pH of endosomes. Once dissociated, recycling antibodies are free to bind to FcRn (fetal Fc receptor) in the endosome, allowing them to return to the circulation and bind more antigens.

[0206] MuSK is expressed on the membrane of muscle cells. MuSK internalization has been reported by Zhu et al., "Muscle-Specific Receptor Tyrosine Kinase Endocytosis in Muscle Cells," which is incorporated herein by reference in its entirety. Acetylcholine Receptor Clustering in Response to Agrin," J. Neurosci. 28(7): 1688-1696 (2008). Therefore, recycling antibodies against this target may be of interest.

[0207] Although most pH-dependent antibodies reported to date have been obtained after extensive CDR engineering, this property may be pre-existing. We investigated by Biacore whether 3B2 and the optimized sequence variants possess an innate, pre-existing pH dependency for binding to MuSK.

[0208] To study the pH-dependent binding of our antibodies to MuSK, we used the same Biacore as above, but this time dissociation was performed at pH 5.5 instead of pH 7.4. The results demonstrate that 3B2 binds to MuSK (cynomolgus, rat, or mouse) in a pH-dependent manner, with affinity decreasing at pH 5.5 (Table 9). The following conclusions can be drawn about the various variants: (1) 3B2g1m3 and 3B2g2m3 (m3 variants) show significantly reduced affinity for MuSK for all species tested; (2) 3B2g1m2 and 3B2g2m2 (m2 variants) show some reduced affinity for MuSK; (3) 3B2g1m1, 3B2g2m1, 3B2g1m4, 3B2g2m4 (m1 and m4 variants) do not show reduced affinity for MuSK for all species tested; and (4) there is no difference between g1 and g2 variants for all clones (VL methionine vs. serine in CDR3).

[0209] [Table 9]

[0210] In vitro MuSK phosphorylation assay to evaluate 3B2 variants To evaluate the enhancement of MuSK phosphorylation induced by our agonistic 3B2 variant antibodies, we used an in vitro MuSK phosphorylation assay using mouse C2C12 myotubes. Controls included agrin, parental 3B2, and motavizumab (a non-MuSK-binding Ab). Addition of agrin to C2C12 myotubes induced MuSK phosphorylation, which was set to 100%. This included subtracting background MuSK phosphorylation, which was analyzed by inducing MuSK phosphorylation with motavizumab, a non-MuSK binder. The parental 3B2 Ab induced MuSK phosphorylation to the same extent as 1 nM agrin. Furthermore, the 3B2 variants 3B2g1m1 and 3B2g2m1 performed as well as the parental 3B2 Ab. 3B2g1m2 and 3B2g2m2 also potently induced MuSK phosphorylation (+ / - 80%). 3B2g1m3 and 3B2g2m3 lost their ability to induce MuSK, resulting in approximately 13% MuSK phosphorylation. Interestingly, 3B2g1m4 and 3B2g2m4 lost almost half their ability to induce MuSK, resulting in approximately 58% MuSK phosphorylation (Figure 21).

[0211] Binding affinity of 3B2 variants to coated MuSK from different species in ELISA ELISA was performed to evaluate the binding affinity of 3B2 variants to MuSK proteins from different species. Plates were coated with human, cynomolgus monkey, rat, or mouse MuSK forms, and the binding of different 3B2 variants relative to 3B2 was evaluated as described above. In this assay, 3B2g1m1, 3B2g2m1, 3B2g1m4, and 3B2g2m4 did not lose affinity relative to 3B2. On the other hand, 3B2g1m2, 3B2g2m2, 3B2g1m3, and 3B2g2m3 lost binding affinity to MuSK from different species (Figure 22).

[0212] Example 3 Differences in pH dependence of agonist MuSK antibodies Conventional antibodies are internalized by nonspecific endocytosis or pinocytosis or via receptor-mediated internalization. As mentioned above, in contrast to conventional antibodies, which can only bind to an antigen once, recycling antibodies are engineered so that a single antibody molecule can bind to the antigen multiple times. Indeed, when conventional antibodies bind to membrane-anchored antigens such as receptors, the antibody-antigen complex is internalized and degraded in lysosomes. This shortens the half-life of therapeutic antibodies and necessitates the frequent administration or higher doses of antibody drugs to maintain effective plasma antibody concentrations. Antibodies can be engineered to dissociate from antigens at the acidic pH of endosomes. Once dissociated, recycling antibodies are free to bind to FcRn (fetal Fc receptor) in endosomes, allowing them to return to the circulation and bind more antigens.

[0213] MuSK is expressed on the membrane of muscle cells. MuSK internalization has been described in Zhu et al., "Muscle-Specific Receptor Tyrosine Kinase Endocytosis in Acetylcholine Receptor Clustering in Response to Agrin," J. Neurosci. 28(7): 1688-1696 (2008), the entire contents of which are incorporated herein by reference. Therefore, recycling antibodies against this target may be of interest.

[0214] Although most pH-dependent antibodies reported to date have been obtained after extensive CDR engineering, this property may be pre-existing. We investigated by Biacore whether X2, X2m4, X3, X9, X17, 3B2, and 3B2g2m1 possess an innate, pre-existing pH dependency for binding to MuSK.

[0215] A Biacore T200 was used to study the pH-dependent binding of the antibodies described herein to MuSK. Briefly, CM5 chips were coated with human and mouse MuSK (200 RU), 22.2 nM Fab was applied, and kinetic parameters were calculated. Association was performed at pH 7.4, and dissociation was performed at pH 7.4 and pH 5.5. The following Fabs were tested: X2, X2m4, X3, X9, X17, 3B2, and 3B2g2m1 (Table 10 and Figure 23). Interestingly, these results suggest that 3B2g2m1 has a pH-dependent binding affinity to both human and mouse MuSK. The binding affinity at pH 5.5 is very low, resulting in rapid dissociation at endosomal pH, allowing 3B2g2m1 to recycle.

[0216] [Table 10]

[0217] Example 4 Agonistic MuSK antibodies targeting the Fz domain do not prevent MuSK activation by its natural ligand, agrin MuSK activation requires motor neuron-secreted agrin, muscle membrane-localized LRP4, and cytoplasmic DOK-7. LRP4 and MuSK are preassembled in the absence of agrin, but MuSK activation is induced only in the presence of agrin. Indeed, agrin-bound LRP4 with MuSK initiates MuSK transphosphorylation and activation (Stiegler et al., "Crystal Structure of the Agrin-Responsive Immunoglobulin-Like Domains 1 and 2 of the Receptor Tyrosine Kinase MuSK," J. Mol. Biol. 364:424-433 (2006); Kim et al., "Lrp4 is a Receptor for Agrin and Forms a Complex with MuSK," Cell 135:334-342 (2008); Zhang et al., "Agrin Binds to the N-Terminal Region of Lrp4 Protein and Stimulates Association between Lrp4 and the First Immunoglobulin-Like Domain in Muscle-Specific Kinase (MuSK)," J. Biol. Chem. 2008, the entire contents of which are incorporated herein by reference). 286:40624-40630 (2011); and Zong et al., "Structural Basis of Agrin-LRP4-MuSK Signaling," Genes Dev. 26:247-258 (2012)).

[0218] MuSK agonist antibodies targeting the Fz domain of MuSK can prevent agrin-mediated activation of MuSK. To test whether Fz-binding MuSK agonist antibodies can activate MuSK together with agrin, we performed in vitro costimulation experiments.

[0219] Using an in vitro MuSK phosphorylation assay in mouse C2C12 myotubes, enhancement of MuSK phosphorylation induced by the agonist MuSK antibody 3B2g2m1 was assessed in the presence or absence of non-saturating agrin (0.1 nM agrin). Controls included agrin (1 nM and 0.1 nM) and motavizumab (isotype control, non-MuSK-binding mAb, 333 nM). All stimulations were performed for 30 min. Addition of 1 nM agrin to C2C12 myotubes induced MuSK phosphorylation, which was set to 100%. This included subtracting background MuSK phosphorylation, which was analyzed by inducing MuSK phosphorylation with the non-MuSK binder motavizumab. Stimulation of MuSK with 0.1 nM agrin resulted in a 53% induction of MuSK phosphorylation, suggesting a suboptimal concentration of agrin in this assay. Titration of 3B2g2m1 (without agrin) from 0.01 to 333 nM resulted in a dose-dependent increase in MuSK phosphorylation. Importantly, costimulation of 3B2g2m1 with a suboptimal concentration of 0.1 nM agrin resulted in increased MuSK phosphorylation compared to stimulation with 3B2g2m1 or 0.1 nM agrin alone. Notably, combining 0.3 nM 3B2g2m1 with 0.1 nM agrin resulted in 100% MuSK phosphorylation, similar to stimulation with 1 nM agrin alone (Figure 24). These data suggest that 3B2g2m1, which binds to the Fz domain of MuSK, can stimulate MuSK in parallel with agrin. Furthermore, it may be suggested that 3B2g2m1 can activate MuSK via its natural ligand agrin, leading to increased MuSK phosphorylation. Indeed, agrin binds to LRP4, which then binds to the Ig-1-like domain of MuSK. Therefore, activating MuSK by targeting the Fz domain with an agonistic MuSK antibody does not prevent MuSK activation by its natural ligand agrin.

[0220] Example 5 MuSK agonist antibodies mIgG2a-X17 and hIgG-X17 The therapeutic utility of the combination of mIgG2a-X17 and hIgG-X17 antibodies was tested in the Dok7 model. Dok7 1124_27 dup mice on a mixed C57BL / 6-CBA background treated with the isotype-equivalent negative control motavizumab on P4 died within 1–2 weeks of age (as did untreated Dok7 1124_27 dup mice on a mixed genetic background), whereas Dok7 1124_1127 dup mice injected with 10 mg / kg mIgG2a-X17 on P4 (n=3) and 10 mg / kg hIgG-X17 on P24 and P44 survived into adulthood (Figures 25A–B).

[0221] Dok7 1124_1127 dup mice injected with 10 mg / kg mIgG2a-X17 (n=3) on P4 and 10 mg / kg hIgG-X17 on P24 and P44 gained weight, unlike Dok7 1124_1127 dup mice treated with an isotype control antibody (Figure 25B). Furthermore, the combination of mIgG2a-X1 and hIgG-X17 rescued motor function in Dok7 1124_27 dup mice, as assessed by grip strength and latency to fall from a rotating rotarod (Figure 26).

[0222] Together, these findings demonstrate that the agonistic antibody mIgG2a-X17 against MuSK, in combination with hIgG-X17, rescues young Dok7 1124_1127 dup mice.

[0223] Example 6 MuSK agonist antibody hIgG-X17 To determine whether the MuSK agonist antibody hIgG-X17 associates with MuSK at synapses, wild-type mice at P40 were intraperitoneally injected with the MuSK agonist antibody hIgG-X17 (0, 2, 10, or 20 mg / kg). Two days later, the mice were sacrificed, and diaphragm muscles were stained with Alexa488-α-BGT to label AChRs and with Alexa647 goat anti-human IgG, F(ab')2 fragment-specific, to label XI7. The saturation level of X17 at synapses was measured by the ratio of X17 to AChR signal intensity. The graph in Figure 27 shows that the MuSK agonist antibody hIgG-X17 associates with MuSK at synapses and saturates MuSK at 20 mg / kg.

[0224] Next, to examine whether hIgG-X17 rescues lethality in young Dok7 1124_1127 dup mice, mixed-background Dok7 1124_1127 dup mice were treated with the agonist antibody hIgG-X17 or the isotype-equivalent negative control, motavizumab, at P4. Similar to untreated mice, Dok7 1124_1127 dup mice (n = 11) injected with the isotype control died within 1–2 weeks of age, whereas Dok7 1124_1127 dup mice (n = 4) injected with hIgG-X17 at P4, P18, and P38 survived to adulthood (Figure 28A). Furthermore, Dok7 1124_1127 ...

Claims

1. 1. An antibody-based molecule that binds to an epitope of human muscle-specific tyrosine-protein kinase (MuSK), said antibody-based molecule comprising: a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195; and antibody-based molecules, including

2. The antibody-based molecule described in claim 1, wherein the epitope is present in the MuSK Frizzled (Fz)-like domain sequence of sequence number 130, and the antibody-based molecule induces MuSK phosphorylation when binding to the epitope.

3. 2. The antibody-based molecule of claim 1, wherein the antibody-based molecule binds to the MuSK Fz-like domain with higher affinity under neutral pH conditions of pH 7.4 than under acidic pH conditions of pH 5.

5.

4. The antibody-based molecule of claim 1 , wherein the antibody-based molecule does not enhance or inhibit agrin-induced MuSK phosphorylation upon binding to the MuSK Fz-like domain.

5. the antibody-based molecule a heavy chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO: 234, and a light chain variable region comprising an amino acid sequence at least 80% identical to SEQ ID NO:

235.

2. The antibody-based molecule of claim 1, comprising:

6. The antibody-based molecule of claim 1 , wherein the antibody-based molecule is a chimeric antibody or an epitope-binding fragment thereof.

7. The antibody-based molecule of claim 1, wherein the antibody-based molecule is a humanized antibody or an epitope-binding fragment thereof.

8. The antibody-based molecule of claim 1, wherein the antibody-based molecule is a monoclonal antibody or an epitope-binding fragment thereof.

9. The antibody-based molecule of claim 1, wherein the antibody-based molecule is a full-length antibody, an epitope-binding fragment of an antibody, or an antibody derivative.

10. the antibody-based molecule is an epitope-binding fragment selected from a F(ab) fragment, a F(ab') fragment, and a F(ab')2 fragment; or the antibody-based molecule is an antibody derivative selected from the group consisting of scFv, minibody, diabody, triabody, and tetrabody; 10. The antibody-based molecule of claim 9.

11. The antibody-based molecule of claim 1 A heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 234, and a light chain variable region comprising the amino acid sequence of SEQ ID NO:

235.

2. The antibody-based molecule of claim 1, comprising:

12. The antibody-based molecule of claim 11, wherein the antibody-based molecule is a human IgG1 antibody having L234A and L235A mutations.

13. 2. An isolated polynucleotide encoding the MuSK antibody-based molecule of claim 1.

14. A vector comprising the isolated polynucleotide of claim 13.

15. A host cell comprising the vector of claim 14.

16. 10. A pharmaceutical composition comprising the antibody-based molecule of claim 1 and a pharmaceutically acceptable carrier.

17. 10. A pharmaceutical composition for use in increasing muscle-specific tyrosine-protein kinase (MuSK) signaling in a subject in need thereof, comprising the antibody-based molecule of claim 1.

18. 18. The pharmaceutical composition of claim 17, wherein the subject has a neuromuscular disorder.

19. 19. The pharmaceutical composition of claim 18, wherein the neuromuscular disorder is selected from amyotrophic lateral sclerosis (ALS), myasthenia gravis (MG), and congenital myasthenia, MuSK-MG, spinal muscular atrophy (SMA), spinal-bulbar muscular atrophy (SBMA), Charcot-Marie-Tooth disease (CMT), distal hereditary motor neuron disease (dHMN), Duchenne muscular dystrophy (DMD), limb-girdle muscular dystrophy (LGMD), congenital muscular dystrophies (CMD), sarcopenia (SP), and Emery-Dreifuss muscular dystrophy.

20. 20. The pharmaceutical composition of claim 19, wherein the neuromuscular disorder is congenital myasthenia.

21. 21. The pharmaceutical composition of claim 20, wherein the congenital myasthenia is DOK7-mediated congenital myasthenia.

Citation Information

Patent Citations

  • Antibodies with pH-dependent antigen binding

    JP2013521772A

  • Muscle specific receptor kinase and modulation thereof

    US20150050289A1

  • Recombinant altered antibodies and methods of making altered antibodies

    US5225539A

  • Humanized immunoglobulins

    US5530101A

  • Humanized immunoglobulins

    US5585089A

Cited By

  • Therapeutic MUSK antibodies

    JP2026056615A