In vitro transcribed mRNA and pharmaceutical composition containing the same
In vitro transcribed mRNA with specific structural components stabilizes protein expression in animal cells, addressing DNA stability issues and immune response variability, offering a robust platform for genetic vaccines.
Patent Information
- Application Number
- JP2022555835
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-03-17
- Filing Date
- 2021-03-17
- Publication Date
- 2025-10-15
- Estimated Expiration
- 2041-03-17
AI Technical Summary
Existing gene therapy and vaccine technologies face challenges with DNA stability, potential genetic damage, limited protein expression, and species-specific immune responses, making it difficult to induce effective immune responses with RNA vaccines.
In vitro transcribed mRNA with a 5'-UTR, 3'-UTR, 5'-cap, and a polyA tail of 20 to 400 adenines for stable expression in animal cells, using a template DNA for production and a pharmaceutical composition for vaccines.
The solution enables stable and high expression of target proteins in animal cells, providing a safe and efficient platform for genetic vaccines against diseases like autoimmune, infectious, and cancer-related conditions.
Smart Images

Figure 0007754829000007 
Figure 0007754829000008 
Figure 0007754829000009
Abstract
Description
[Technical Field]
[0001] The present invention relates to an in vitro transcribed mRNA for intracellular expression of a gene of interest, and more particularly to an in vitro transcribed mRNA for intracellular expression of a gene of interest and a pharmaceutical composition for a vaccine containing the same.
[0002] [Background technology]
[0003] Gene therapy and gene vaccines are proven and commonly applied technologies in the medical field, and can treat not only genetic diseases but also autoimmune diseases, infectious diseases, cancer or tumor-related diseases, inflammatory diseases, etc.
[0004] Development of gene vaccines began after it was reported that if DNA and RNA encoding a target gene are directly injected into an animal, the target gene will be expressed in the living animal, and this expression can confer immunity (Wolff JA et al. Science, 247:1465-8, 1990).
[0005] In gene therapy or genetic vaccination, DNA and RNA may be used as nucleic acid molecules for gene administration, and DNA is known to be relatively stable and easy to handle compared to RNA. However, DNA can pose potential risks if the administered DNA fragment is inserted into an undesired location in the patient's genome, damaging the gene. Furthermore, unwanted anti-DNA antibodies may appear. Another problem is that the expression level of peptides or proteins expressed by DNA administration and subsequent transcription / translation is limited. The presence or absence of specific transcription factors that regulate DNA transcription has a major impact on the expression level of administered DNA. In the absence of specific transcription factors, DNA transcription does not produce sufficient amounts of RNA, resulting in limited levels of translated peptides or proteins.
[0006] On the other hand, when using RNA as a tool for gene delivery, RNA does not require transcription or entry into the nucleus like DNA. It can immediately synthesize proteins in the cytoplasm, eliminating the risk of it being inserted into cell chromosomes and causing unwanted genetic damage. Furthermore, its shorter half-life than DNA prevents long-term genetic alterations (Sayour EJ, et al., J Immunother Cancer 2015;3:13, 2015). Conventional RNA vaccines are activated within a short period of time after delivery into cells, expressing target proteins. They are then destroyed by enzymatic reactions within a few days, while the specific immune response to the expressed target antigen (protein) remains.
[0007] Furthermore, when RNA is used as a tool for gene administration, it can act by passing only through the cell membrane without needing to pass through the nuclear membrane, so even if a smaller amount is used, it can express the same amount of target protein as DNA. Furthermore, RNA itself has immunogenicity, so it can achieve the same immune effect even when administered in a smaller amount than DNA.
[0008] Furthermore, because RNA can be mass-produced in vitro, it can be safely produced even in small-scale GMP production facilities. After synthesizing only the genes for epitopes associated with the induction of neutralizing antibodies from viruses or microorganisms, only those portions can be transcribed in vitro to produce RNA transcripts. Previously, producing large amounts of RNA using this method required high costs and highly complex techniques, but improvements in the reagents used in in vitro transcription reactions, particularly DNA-dependent RNA polymerase, have made it possible to produce large amounts of RNA in one to two weeks using a small amount of DNA template.
[0009] Genetic vaccines are essentially systems that express target antigens by injecting the gene (DNA or RNA) of the target protein into animals using various vectors. Interestingly, the amount of protein expressed from the gene is not directly proportional to its immunogenicity. That is, expressing a larger amount of antigen does not necessarily increase its immunogenicity. Generally, when a genetic vaccine is injected into an animal, the genetic vaccine (DNA or RNA) is delivered to and infected with the animal's muscle cells in various ways. Because these delivered muscle cells are lysed by antigen-specific T cells, the actual duration and amount of antigen expression do not match those predicted by in vitro cell culture experiments. Therefore, further research is needed to accurately understand how genetic vaccines induce immune responses with limited expression levels and duration. In fact, results from in vitro cell culture studies often do not match those from in vivo animal experiments. This is due to species-specific expression of innate immune receptors and differences in antigen recognition patterns associated with immune responses after genetic vaccine administration, as well as differences in innate immune receptor expression levels among different cell types. This suggests that self-replicon RNA vaccines based on alphaviruses may not be highly immunogenic simply because of their high antigen expression levels, but that other factors may also be at play (Park, JH et al., J. Bacteriol & Virol., 46:115, 2016).
[0010] Therefore, in order to induce an effective immune response from a target gene, it is important to consider the amount of protein expressed from animal cells by the administered RNA, the composition of the administered RNA transcript, the appropriate RNA dosage required for immunization, and optimal RNA modification using compounds such as protamine (Park, JH et al., J. Bacteriol & Virol., 46:115, 2016).
[0011] Therefore, the present inventors have made extensive efforts to develop a method for stably expressing a target gene in animal cells. As a result, they have confirmed that when a target gene is transferred to animal cells using in vitro transcript mRNA comprising the target gene, a 5'-UTR and a 3'-UTR linked to both ends of the target gene, a 5'-cap linked to the 5'-UTR, and a polyA tail consisting of 20 to 400 adenines linked to the 3'-UTR, the animal cells produce the target protein with excellent expression efficiency, thereby completing the present invention.
[0012]
[0013] Summary of the Invention
[0014] An object of the present invention is to provide an in vitro transcript mRNA for stably expressing a target gene in animal cells.
[0015] Another object of the present invention is to provide a DNA template for producing the in vitro transcribed mRNA.
[0016] It is yet another object of the present invention to provide a pharmaceutical composition for a vaccine, which comprises the in vitro transcript mRNA.
[0017]
[0018] To achieve the above-mentioned objectives, the present invention provides an in vitro transcript mRNA comprising: (a) an RNA sequence insert encoding a target peptide or protein; (b) a 5'-UTR and a 3'-UTR linked to both ends of the RNA sequence encoding the target peptide or protein; (c) a 5'-cap linked to the 5'-UTR; and (d) a polyA tail containing 20 to 400 adenines linked to the 3'-UTR.
[0019] The present invention also provides a template DNA for producing an in vitro transcript mRNA, comprising: (a) a portion having a DNA sequence corresponding to the RNA in vitro transcript mRNA; and (b) a promoter to which an RNA polymerase binds for transcription of the DNA sequence corresponding to the in vitro transcript mRNA.
[0020] The present invention also provides a pharmaceutical composition for a vaccine, which comprises the in vitro transcript mRNA.
[0021] The present invention also provides a method for preventing or treating a disease, which comprises administering the in vitro transcript mRNA.
[0022] The present invention also provides the use of the in vitro transcript mRNA for the prevention or treatment of a disease.
[0023] The present invention also provides the use of the in vitro transcript mRNA for the prevention or treatment of a disease.
[0024] [Brief explanation of the drawings]
[0025] [Figure 1] FIG. 1 shows the structure of in vitro transcribed mRNA and template DNA according to the present invention.
[0026] [Figure 2] FIG. 1 shows a process for synthesizing in vitro transcript mRNA from a template plasmid DNA using in vitro transcription according to the present invention.
[0027] [Figure 3] FIG. 1 shows the results of confirming the level of target protein expression depending on the length of the poly(A) tail of in vitro transcribed mRNA.
[0028] [Figure 4] FIG. 1 shows the results of confirming the degree of expression of a target protein depending on the shape of the poly(A) tail end of in vitro transcribed mRNA.
[0029] [Figure 5] FIG. 1 shows the results of confirming the level of expression of a target protein by mixing non-A residues in the poly A tail of in vitro transcribed mRNA.
[0030] [Figure 6] FIG. 1 shows the results of confirming the level of expression of a target protein depending on the type of cap of in vitro transcript mRNA.
[0031] [Figure 7] Figure 1A shows the results of substituting modified nucleotides for the nucleotides of in vitro transcribed mRNA to confirm the level of expression of a target protein. Figure 1B shows the results of substituting modified nucleotides for the non-A residues of a mixed non-A polyA tail to confirm the level of expression of a target protein.
[0032]
[0033] DETAILED DESCRIPTION OF THE INVENTION
[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art to which this invention belongs. Generally, the nomenclature used herein is one that is well known and commonly used in the art.
[0035]
[0036] Although conventional gene therapy techniques have already provided means for improving mRNA stabilization and translation activity, the low stability of RNA-based platforms remains a problem. Therefore, there is a need to develop a platform for improving mRNA stability and translation activity that provides better expression rates of encoded proteins in vivo. In the present invention, we have developed an in vitro transcript mRNA comprising: (a) an RNA sequence insert encoding a target peptide or protein; (b) a 5'-UTR and a 3'-UTR linked to both ends of the RNA sequence encoding the target peptide or protein; (c) a 5'-cap linked to the 5'-UTR; and (d) a polyA tail containing 20 to 400 adenines linked to the 3'-UTR (Figure 1). The polyA tail (A) containing 120 adenines, prepared by the method of the present invention, is a nucleotide sequence encoding a target peptide or protein. 120 In vitro transcript mRNA with A 33 C 18 , A0, A 30 Compared to mRNA with a tail, it showed stable and high expression of the target protein in the administered animal cells.
[0037] Therefore, in one aspect, the present invention provides a method for producing a nucleic acid sequence comprising: (a) an insert portion of an RNA sequence encoding a peptide or protein of interest; (b) a 5'-UTR and a 3'-UTR ligated to both ends of the RNA sequence encoding the peptide or protein of interest;
[0038] (c) a 5' cap linked to the 5'-UTR; and (d) a poly-A tail containing 20 to 400 adenines linked to the 3'-UTR.
[0039] In the present invention, the target gene may be characterized as being a gene encoding a therapeutically active protein or peptide, an adjuvant protein, an antigen, a tumor antigen, a pathogenic antigen, an animal antigen, a viral antigen, a protozoan antigen, a bacterial antigen, an allergic antigen, an autoimmune antigen, an allergen, an antibody, an immunostimulatory protein or peptide, or an antigen-specific T cell receptor.
[0040] In the present invention, the 5' cap is a component located at the 5' start site of mRNA. The cap structure plays a role in initiating protein synthesis and protecting mRNA from the action of nucleases. The 5' cap also affects translation. During the translation initiation process, the 5' cap binds to eukaryote translation initiation factor 4E (eIF4E) to allow the 40S ribosomal subunit to bind to the mRNA.
[0041] In the present invention, the 5' cap may be characterized as being Cap-1 or ARCA (anti-reverse cap analog).
[0042] In the present invention, when a transcript is produced using a co-transcriptional capping method in which capping and transcription are performed simultaneously, mMESSAGE mMACHINE TM ARCA-RNA was synthesized using the T7ULTRA transcription kit (Thermofisher Scientific).
[0043] If you use the post-transcriptional capping method, use MEGAscriptTM Uncapped RNA (uncapped RNA) was synthesized using a T7 transcription kit (Thermofisher Scientific).
[0044] In this study, we determined the optimal 5' cap for the in vitro transcribed mRNA platform for the delivery and expression of target genes in animal cells by synthesizing in vitro transcribed mRNA containing uncapped, Cap-0, Cap-1, and ARCA. We then compared the expression levels of target proteins in 293T cells and confirmed that ACRA and Cap-1 had the highest expression efficiencies (Figure 6). However, methods such as ARCA, which involve simultaneous capping with in vitro transcription by decreasing the GTP ratio and increasing the cap analog ratio, can sometimes produce uncapped RNA. This can induce innate immunity, so we determined that Cap-1, an enzymatic post-transcriptional capping system, is relatively suitable for the in vitro transcribed mRNA platform.
[0045] In the present invention, it is preferable that a Kozak sequence is added to the beginning of the start codon of the target gene, and it is preferable that the target gene has a sequence that is codon optimized for the host cell.
[0046] The poly(A) tail is a component located at the 3' end of the in vitro transcribed mRNA of the present invention. Together with the 5'-cap, it protects the mRNA from enzymatic degradation, and it is known that an insufficient length of the poly(A) tail reduces mRNA stability. The poly(A) tail also affects translation. PABP (Poly(A) binding protein), a protein that binds to the poly(A) tail, binds to eukaryote translation initiation factor 4G (eIF4G) during the translation initiation process, attaching the 40S ribosomal subunit to the mRNA.
[0047] In the present invention, the poly(A) tail is characterized by being composed of 20 to 400 adenines, and may be preferably composed of 30 to 200 adenines, more preferably composed of 60 to 150 adenines, and even more preferably composed of 100 to 130 adenines.
[0048] In one embodiment of the present invention, in order to compare the translation efficiency of mRNA with various lengths of poly(A) tail, existing A 33 C 18 A0, A1, and A2 contain 0, 30, and 120 adenines, respectively. 30 and A 120 After preparing the tailed template DNA, mRNA generated by in vitro transcription was transfected into 293T cells to compare the expression of the target protein. As a result, IgM-D4 expression was not confirmed with the A0 tail, and the A 120 Tail, A 30 Tail, A 33 C 18 It was confirmed that the expression was highest in the order of the tail (Figure 3).
[0049] In the present invention, the poly(A) tail is characterized in that one or more nucleotides other than adenine selected from the group consisting of uracil (U), cytosine (C), and guanine (G) are inserted between multiple adenines, and the inserted nucleotides other than adenine may be inserted between 2 to 20, preferably 4 to 15, more preferably 6 to 12, and most preferably 8 to 10 adenines, but is not limited thereto.
[0050] In one embodiment of the present invention, to compare the translation efficiency of mixed tails containing mixed non-A residues, the original A 120 Tail, A 120 -G mixed tail, A 120 -C mixed tail, A 120 Template DNAs with mixed U tails were prepared. In vitro transcripts of mRNA were synthesized using each template, and the expression levels of target proteins in 293T cells were compared using the same method as in Example 3. The results confirmed that the mRNA with a mixed U tail had the highest expression efficiency.
[0051] In the present invention, the end of the poly(A) tail may be adenine.
[0052] During in vitro transcription, a linearized DNA template is used, so the poly(A) tail of the mRNA generated by the restriction enzyme used to linearize the template plasmid DNA may end with an A residue and may contain a restriction enzyme recognition site.
[0053] [ka]
[0054] To compare the translational efficiency depending on the terminal shape of the poly(A) tail, mRNA with non-complete and complete ends was synthesized based on a template linearized with NheI or SapI restriction enzyme, and the expression level of the target protein was compared. As a result, it was confirmed that mRNA with a normal A-terminated tail had a relatively superior expression ability (Figure 4).
[0055] In the present invention, the uracil (U) in the in vitro transcript mRNA sequence is entirely or partially substituted with modified U, and the modified UTP may be pseudo UTP or N1-methyl pseudo UTP.
[0056] In the present invention, the poly(A) tail may be characterized in that a modified U is inserted between multiple adenines.
[0057] In one aspect of the present invention, to determine modified nucleotides compatible with the in vitro transcribed mRNA platform for the transfer and expression of target genes in animal cells, in vitro transcribed mRNA containing modified CTP and UTP was synthesized and the expression level of target proteins in 293T cells was compared.
[0058] As a result, it was confirmed that the highest protein expression rate was achieved with mRNA in which 100% of the U in the mRNA was replaced with modified U using modified UTP alone (Figure 7). Furthermore, it was determined that a synergistic effect could be achieved when combined with a U-mixed tail, which had a superior protein expression rate. Further, a comparison was made between mixed tails using modified UTP, and the results confirmed that the U-mixed tail had the highest protein expression rate.
[0059] In another aspect, the present invention relates to a template DNA for producing an in vitro transcript mRNA, the template DNA comprising: (a) a portion having a DNA sequence corresponding to the RNA in vitro transcript mRNA; and (b) a promoter to which an RNA polymerase binds for transcription of the DNA sequence corresponding to the in vitro transcript mRNA.
[0060] In the present invention, the promoter may be selected from the group consisting of a T7 promoter, a T3 promoter, and an SP6 promoter.
[0061] In the present invention, the template DNA may be characterized by including a restriction enzyme recognition site linked to a poly(A) tail.
[0062] The restriction enzyme recognition site is preferably a sequence that terminates the end of the in vitro transcribed mRNA poly(A) tail with adenine (A) upon restriction enzyme treatment, and the restriction enzyme is preferably NheI or SapI.
[0063] To produce the in vitro transcribed mRNA of the present invention, mRNA is produced using a standard in vitro transcription reaction, and all production steps are carried out in vitro. That is, RNA is synthesized in vitro using T7, SP6, or T3 RNA polymerase, using enzymatically cleaved, linearized DNA as a template. This eliminates the need to handle live viruses or microorganisms, which are commonly used in the production of live or killed vaccines. Furthermore, it eliminates the need for the cultivation of yeast, E. coli, or insect cells, which are required for the production of recombinant vaccines (recombinant proteins).
[0064] In yet another aspect, the present invention relates to a pharmaceutical composition for a vaccine comprising the in vitro transcript mRNA.
[0065] The in vitro transcribed mRNA of the present invention may be inserted with a gene of interest, such as a gene encoding a therapeutically active protein or peptide, an adjuvant protein, an antigen, a tumor antigen, a pathogenic antigen, an animal antigen, a viral antigen, a protozoan antigen, a bacterial antigen, an allergic antigen, an autoimmune antigen, an allergen, an antibody, an immunostimulatory protein or peptide, or an antigen-specific T cell receptor. Depending on the type of inserted gene, the mRNA may be used as a genetic vaccine against autoimmune diseases, infectious diseases, cancer or tumor-related diseases, inflammatory diseases, etc.
[0066] In yet another aspect, the present invention relates to a method for preventing or treating a disease, which comprises administering the in vitro transcript mRNA.
[0067] In yet another aspect, the present invention also relates to the use of the in vitro transcript mRNA for the prevention or treatment of diseases.
[0068] In yet another aspect, the present invention also relates to the use of said in vitro transcript mRNA for the prevention or treatment of a disease.
[0069]
[0070] The in vitro transcript mRNA platform is an innovative vaccine production technology that completely transforms current vaccine production methods. Recently, new variants of viruses, such as the MERS virus and COVID-19, as well as viruses that have existed for a long time but suddenly cause problems, such as the Zika virus, have emerged frequently. However, it is practically impossible to always prepare vaccines for all such infectious agents. The only production platform that best meets the requirements for a vaccine in crisis response is in vitro transcript mRNA. mRNA production requires only a small amount of template DNA, allowing the nationally required amount of 300,000 doses to be produced in one to two weeks. In vitro mRNA production does not require a biological reactor or direct handling of the infectious agent, making it the only vaccine production platform that can synthetically process all relevant genes to produce a vaccine.
[0071]
[0072] The present invention will be described in more detail below with reference to examples. It will be apparent to those skilled in the art that these examples are merely intended to more specifically illustrate the present invention and are not intended to limit the scope of the present invention.
[0073]
[0074] Example 1: Preparation of template DNA
[0075] To prepare in vitro transcript mRNA, we prepared a template plasmid DNA (template pDNA) containing the tomato fluorescent protein gene as the target protein gene.
[0076] To insert the target protein gene into the template pDNA, the target protein gene was amplified by PCR using the pTdTomato-N1 vector containing the tomato fluorescent protein gene (SEQ ID NO: 1) as a template.
[0077] When designing the primers, 20 bp at both ends of the target protein gene were used as annealing sites, and PCR primers were used that were designed to add an EcoRI recognition sequence-Kozak sequence and a HindIII recognition sequence to both ends.
[0078] - Forward primer: 5' at gaattc gccacc atggtgagcaagggcgagga3' (SEQ ID NO: 3)
[0079] Reverse primer: 5' at aagctt ttacttgtacagctcgtcca 3' (SEQ ID NO: 4)
[0080] After PCR, the amplified tomato fluorescent protein gene was confirmed by electrophoresis and then analyzed using MEGAquick-spin TM The in vitro transcription template pDNA (SEQ ID NO: 2) and the tomato fluorescent protein DNA were then digested with restriction enzymes EcoRI and HindIII (Thermofisher) and purified using a MEGAquick-spin kit. TM After purification using the Plus Fragment DNA Purification Kit, ligation reaction was carried out using T4 ligase (Enzynomics).
[0081] After ligation, the plasmid was transformed into DH5α competent cells and cultured overnight at 37°C. pDNA was isolated from the cultured colonies, and the template pDNA sequence was confirmed by base sequence analysis (sequencing service, Cosmogene Tech).
[0082]
[0083] Example 2: In vitro synthesis of mRNA
[0084] In vitro transcript mRNA (transcript mRNA) was synthesized in vitro using the template plasmid DNA prepared in Example 1 as a template and T7 RNA polymerase.
[0085] First, the template plasmid DNA was linearized by cleaving just after the poly(A) tail using NheI or SapI restriction enzyme (Thermofisher Scientific), and then cleaved using MEGAquick-Spin. TM The template DNA was purified using a plus Fragment DNA purification kit (Intron) to obtain template DNA, which was then used for in vitro transcription (Figure 2).
[0086] First, when producing transcripts using the co-transcriptional capping method, which involves capping and transcription simultaneously, mMESSAGE mMACHINE TM ARCA-RNA was synthesized using the T7ULTRA transcription kit (Thermofisher Scientific).
[0087] If you use the post-transcriptional capping method, use MEGAscript TM Uncapped RNA was synthesized using a T7 transcription kit (Thermofisher Scientific). The experiment was performed according to the kit's protocol. The experimental method was as follows.
[0088] A mixed solution with a final volume of 20 μL was prepared by adding the solutions provided with the kit to 1 μg of linearized template DNA as shown in Table 1 or 2. When using modified nucleotides such as 5-methyl-CTP, pseudo-UTP, and N1-methyl pseudo-UTP (TriLink), the nucleotides were substituted 100% with the modified nucleotides, taking into account their concentrations.
[0089]
[0090] [Table 1]
[0091]
[0092] [Table 2]
[0093] The prepared mixture was reacted at 37°C overnight, and then 1 μL of DNase was added and reacted at 37°C for 15 minutes. Finally, the synthesized in vitro transcript RNA (SEQ ID NO: 5) was purified using lithium chloride.
[0094] When the synthesized uncapped RNA is capped with Cap-0 or Cap-1, ScriptCap is used. TM M7G Capping System Kit (CELLSCRIPT) and ScriptCap TM The Cap-1 Capping System Kit (CELLSCRIPT) was used, and the experiment was carried out according to the manufacturer's protocol. The experimental method is as follows.
[0095] 55 μg of uncapped RNA was diluted to a final volume of 68.5 μL or 67 μL and reacted at 65° C. for 10 minutes, and then cooled on ice to prepare premixes as shown in Tables 3 and 4.
[0096]
[0097] [Table 3]
[0098]
[0099] [Table 4]
[0100]
[0101] Uncapped RNA was added to the premix solution and reacted at 37° C. for 30 minutes, and then Cap-0 and Cap-1 RNAs were purified using lithium chloride (LiCl).
[0102] The LiCl purification method was as follows: RNA solution was mixed with 7.5M LiCl solution (Thermofisher) and nuclease-free purified water in a 1:1:1 ratio, and the mixture was incubated at -20°C for 30 minutes, followed by centrifugation at 13,000 rpm for 15 minutes. The supernatant was removed, 70% ethanol was added, and the mixture was centrifuged at 13,000 rpm for 5 minutes. The supernatant was then removed, and the RNA pellet was dissolved in nuclease-free purified water to obtain purified RNA.
[0103]
[0104] Example 3: mRNA introduction into mammalian cells and confirmation of target protein expression
[0105] 293T cells (ATCC CRL-3216) were seeded in 6-well plates at 70-80% confluence and then cultured in DMEM / high glucose (HyClone TM ) medium overnight. 2.5 μg of the in vitro transcribed mRNA obtained in Example 2 and 5 μL of Lipofectamine™ 2000 (Thermofisher Scientific, USA) were added to Opti-MEM medium. TM(Thermofisher Scientific, USA) 200 μL was mixed and reacted at room temperature for 10 minutes, and then the two solutions were mixed to form a mixed solution, which was then reacted at room temperature for 5 minutes.
[0106] The cell culture medium of the 293T cells cultured in the 6-well plate was replaced with serum- and antibiotic-free DMEM / high glucose (HyClone TM After 4 hours, the culture medium was replaced with 10% fetal bovine serum (HyClone TM ) and 1% antibiotics (HyClone TM The medium was replaced with medium containing 5% BSA and then cultured for 24 hours. After 24 hours of culture, the cells were washed with DPBS and lysed in RIPA buffer (Biosesang, Korea) containing protease inhibitors (Roche, Basel, Switzerland) for 30 minutes at 4°C. After cell lysis, the cells were centrifuged at 13,000 rpm for 30 minutes to separate the supernatant, and protein was quantified using the BCA assay. Each lysate sample was added to 5X SDS-PAGE sample buffer and boiled at 100°C for 10 minutes. Proteins were separated by size using SDS-PAGE, transferred to a PVDF membrane, and incubated overnight at 4°C with 10 mL of 5% BSA + 5% skim milk (in phosphate buffer containing 0.1% Tween-20). Next, 10 mL of a 1:5000 dilution of anti-PA-D4 antibody (ABION, Seoul, South Korea, 5% skim milk in phosphate buffer containing 0.1% Tween-20) was added and incubated at room temperature for 3 hours. After washing with 0.1% Tween-20 phosphate buffer, the membrane was incubated with HRP-conjugated goat anti-mouse IgG (H+L) (Thermofisher Scientific, MA, USA) for 1 hour at room temperature. Finally, after washing, the membrane was developed using EZ-Western LumiFemto (DOGEN, Seoul, South Korea) solution to confirm the target protein bands expressed from in vitro transcribed mRNA.
[0107]
[0108] Example 4: Expression confirmation method using real-time fluorescence analysis
[0109] 293T cells (ATCC CRL-3216) were seeded onto a 6-well plate to 70-80% confluence and then cultured overnight. 2.5 μg of the in vitro transcribed mRNA obtained in Example 2 and 5 μL of Lipofectamine™ 2000 (Thermofisher Scientific, USA) were added to Opti-MEM. TM (Thermofisher Scientific, USA) 200 μL, and reacted at room temperature for 10 minutes. After that, the two solutions were mixed to prepare a mixed solution, which was then reacted at room temperature for 5 minutes.
[0110] The cell culture medium of 293T cells cultured in the 6-well plate was diluted with serum- and antibiotic-free DMEM / high glucose (HyClone TM After replacing the medium with the new one, the mixed solution was added. TM (Sartorius, Germany), and red fluorescence was measured every hour. After 4 hours, the culture medium was rehydrated with 10% fetal bovine serum (HyClone TM ) and 1% antibiotic (HyClone TM After replacing the medium with one containing 1,000 mg of PEG-4000, the cells were cultured for 48 hours.
[0111]
[0112] Example 5: Optimization of poly(A) tails of in vitro transcribed mRNA
[0113] The poly(A) tail is a component located at the 3' end of the in vitro transcribed mRNA of the present invention. Together with the 5'-cap, it protects the mRNA from enzymatic degradation, and it is known that an insufficient length of the poly(A) tail reduces mRNA stability. The poly(A) tail also affects translation. PABP (Poly(A) binding protein), a protein that binds to the poly(A) tail, binds to eukaryote translation initiation factor 4G (eIF4G) during the translation initiation process, attaching the 40S ribosomal subunit to the mRNA.
[0114] To determine the optimal poly(A) tail for the in vitro transcribed mRNA platform for the transfer and expression of target genes in animal cells, various mRNAs were produced using in vitro transcription, with different 1) poly(A) tail lengths, 2) tail shapes, and 3) the presence or absence of mixed non-A residues, and the expression levels of target proteins were compared.
[0115] 1) Poly(A) tail length
[0116] To compare the translation efficiency of mRNAs of various lengths, we used existing A 33 C 18 A0, A1, and A2 contain 0, 30, and 120 adenines, respectively. 30 and A 120 Tailed template DNAs were prepared. mRNAs were synthesized using each template DNA by in vitro transcription and Cap-1 capping in the same manner as in Example 2, and the expression levels of target proteins in 293T cells were compared in the same manner as in Example 3.
[0117] As a result, as shown in Figure 3, IgM-D4 expression was not confirmed in the A0 tail, and 120 Tail, A 30 Tail, A 33 C 18It was confirmed that expression increased in the order of the tail. This is thought to be because the longer the tail, the longer it takes for the A tail to disappear through deadenylation, making it relatively stable, and as the length increases, the PABP protein binds better, increasing translation efficiency.
[0118] 2) End shape
[0119] During in vitro transcription, a linearized DNA template is used, so the poly(A) tail of the mRNA created by the restriction enzyme used to linearize the template plasmid DNA may end with an A residue and may contain a restriction enzyme recognition site.
[0120] [ka]
[0121] To compare the degree of translation depending on the terminal shape of the poly(A) tail, non-complete and complete end mRNAs were synthesized based on templates linearized with NheI or SapI restriction enzyme, and the expression levels of the target proteins in 293T cells were compared using the same method as in Example 3.
[0122] As a result, as shown in Figure 4, it was confirmed that the expression ability of mRNA with a tail that normally ends with A is relatively superior. This is thought to be because, unlike a complete poly(A) tail, a non-complete tail that contains part of a restriction enzyme recognition site does not properly protect against 3'->5' exonuclease.
[0123] 3) Mixture of non-adenine NT (non-A residue)
[0124] Based on a paper that non-A residues generated in the A-tail by TENT4A and 4B interfere with deadenylation, we compared the translation efficiency of mixed tails containing mixed non-A residues with the original A-tail. 120 Tail, A 120 -G mixed tail, A 120 -C mixed tail, A 120 Template DNA with a -U mixed tail was prepared. In vitro transcript mRNA was synthesized based on each template, and the expression levels of the target proteins in 293T cells were compared using the same method as in Example 3.
[0125] The results confirmed that the expression efficiency of U-mixed tail mRNA was the highest. The G, C-mixed tail and the original tail consistently showed the lowest expression efficiency of the original tail in real-time fluorescence detection results, but the Western blot results were not consistent. However, in all experiments, A 120 The expression efficiency of the -U mixed tail was found to be the best, and the presence of non-A residues in the poly(A) tail inhibited the deadenylation activity, with U being the most inhibitory.
[0126]
[0127] Example 6: Optimization of the 5'-cap of in vitro transcribed mRNA
[0128] The 5' cap is a component located at the 5' start site of mRNA. Similar to the poly(A) tail, it is known to play a role in preventing mRNA degradation. The 5' cap also affects translation. During the translation initiation process, the 5' cap binds to eukaryote translation initiation factor 4 E (eIF4E) to guide the 40S ribosomal subunit to bind to the mRNA.
[0129] To determine the optimal 5' cap for the in vitro transcribed mRNA platform for the transfer and expression of target genes in animal cells, in vitro transcribed mRNAs with uncapped, Cap-0, Cap-1, and ARCA were synthesized and the expression levels of target proteins in 293T cells were compared using the same method as in Example 3.
[0130] As a result, as shown in Figure 6, ACRA and Cap-1 were confirmed to have the highest expression efficiency. However, methods such as ARCA, which involve capping simultaneously with in vitro transcription by decreasing the GTP ratio and increasing the cap analog ratio, can result in the synthesis of uncapped RNA. This can induce innate immunity, so we determined that Cap-1, an enzyme-based post-transcriptional capping system, is relatively suitable for the in vitro transcript mRNA platform.
[0131]
[0132] Example 7: Modified nucleotide substitutions for in vitro transcript mRNA optimization
[0133] The use of modified nucleotides is known to evade innate immune sensors in the host and improve translational activity.
[0134] To determine modified nucleotides suitable for the in vitro transcribed mRNA platform for the transfer and expression of a target gene in animal cells, in vitro transcribed mRNAs containing modified CTP (5-methylcytidine-5'-triphosphate (TriLink Biotechnologies)), modified UTP (pseudouridine-5'-triphosphate (TriLink Biotechnologies), and N1-methylpseudouridine-5'-triphosphate (TriLink Biotechnologies)) were synthesized, and the expression levels of the target protein in 293T cells were compared using the same method as in Example 3.
[0135] As a result, as shown in Figure 7, it was confirmed that the highest protein expression rate was achieved with mRNA in which modified UTP was used alone and 100% of the U in the mRNA was replaced with modified U. Furthermore, since it was determined that a synergistic effect could be achieved when the mixed tail of Example 4 was combined with the U-mixed tail, which had excellent protein expression rates, modified UTP was further used for comparison. As expected, it was confirmed that the U-mixed tail using modified U had the highest protein expression rate. It is presumed that modified UTP plays an excellent role in stabilizing the mRNA structure.
[0136] [Industrial Applicability]
[0137] When in vitro transcript mRNA containing the target gene according to the present invention is injected into animal cells, a large amount of the target protein can be expressed in the animal cells, and the gene can be used as a genetic vaccine against autoimmune diseases, infectious diseases, cancer or tumor-related diseases, inflammatory diseases, etc.
[0138]
[0139] While certain parts of the present invention have been described in detail above, it will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the true scope of the present invention is defined by the appended claims and their equivalents. Simple modifications or variations of the present invention are readily accessible to those skilled in the art, and all such modifications or variations are considered to be within the scope of the present invention.
[0140] Sequence Catalog Free Text
[0141] Attached as an electronic file.
Claims
1. In vitro transcribed mRNA including: (a) an RNA sequence insert encoding a peptide or protein of interest; (b) 5'-UTR and 3'-UTR linked to both ends of the RNA sequence encoding the target peptide or protein; (c) a 5′ cap linked to the 5′-UTR; and (d) a poly(A) tail containing 20 to 400 adenines linked to the 3′-UTR; And, The poly(A) tail has uracil (U) inserted between 9 to 19 adenines, and the end of the poly(A) tail is an adenine.
2. 2. The in vitro transcribed mRNA of claim 1, wherein the poly(A) tail contains 30 to 200 adenines.
3. The in vitro transcribed mRNA according to claim 1, wherein the 5' cap is Cap-1 or ARCA (anti-reverse cap analog).
4. 2. The in vitro transcribed mRNA of claim 1, wherein all or part of the uracil (U) in the in vitro transcribed mRNA sequence is replaced with modified U.
5. The in vitro transcribed mRNA according to claim 4, wherein the modified UTP is pseudo-UTP or N1-methyl pseudo-UTP.
6. The in vitro transcribed mRNA of claim 1, wherein the poly(A) tail has a modified U inserted between 9 to 19 adenines.
7. The in vitro transcribed mRNA according to claim 6, characterized in that the modified UTP is pseudo-UTP or N1-methyl pseudo-UTP.
8. The in vitro transcribed mRNA of claim 1, wherein the target peptide or protein is a therapeutically active protein or peptide, an adjuvant protein, an antigen, a tumor antigen, a pathogenic antigen, an animal antigen, a viral antigen, a protozoan antigen, a bacterial antigen, an allergic antigen, an autoimmune antigen, an allergen, an antibody, an immunostimulatory protein or peptide, or an antigen-specific T cell receptor.
9. Template DNA for the production of in vitro transcribed mRNA, including: (a) a portion having a DNA sequence corresponding to the RNA in vitro transcript mRNA of any one of claims 1 to 8; and (b) a promoter to which RNA polymerase binds for transcription of a DNA sequence corresponding to said in vitro transcribed mRNA.
10. 10. The template DNA according to claim 9, wherein the promoter is selected from the group consisting of a T7 promoter, a T3 promoter, and an SP6 promoter.
11. The template DNA according to claim 9, comprising a restriction enzyme recognition site ligated to a poly(A) tail contained in the portion having a DNA sequence corresponding to the in vitro transcribed mRNA.
12. A pharmaceutical composition for a vaccine, comprising the in vitro transcribed mRNA according to any one of claims 1 to 8.
Citation Information
Patent Citations
Terminal modified RNA
JP2015535430A
3’UTR sequences for RNA stabilization
JP2018530332A
trans-replicative RNA
JP2019509048A
Click-modified mRNA
WO2019121803A1