Skin topical and internal medications

Extracts from Polygonatum nigra and related plants offer a multifunctional solution for collagen production, MMP inhibition, hyaluronic acid promotion, cell proliferation, and antioxidant effects, addressing the need for safe and stable materials in beauty and health products.

JP7759076B2Active Publication Date: 2025-10-23NIPPON MENARD COSMETIC CO
View PDF 14 Cites 0 Cited by

Patent Information

Application Number
JP2021007409
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-01-20
Publication Date
2025-10-23
Estimated Expiration
2041-01-20

AI Technical Summary

Technical Problem

There is a demand for safe, stable materials that have excellent collagen production-promoting, MMP-inhibiting, hyaluronic acid production-promoting, cell proliferation-promoting, and antioxidant properties, but no fully satisfactory materials have been provided.

Method used

The use of extracts from Polygonatum nigra, Polygala gracilis, Polygonatum sieboldii, and Polygala arvensis, which are found to have collagen production-promoting, MMP inhibitory, hyaluronic acid production-promoting, cell proliferation-promoting, and antioxidant effects, and are safe for external or internal preparations.

Benefits of technology

These extracts provide effective and safe solutions for promoting collagen production, inhibiting MMPs, increasing hyaluronic acid, enhancing cell proliferation, and acting as antioxidants, suitable for use in cosmetics, quasi-drugs, pharmaceuticals, and foods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007759076000001
    Figure 0007759076000001
  • Figure 0007759076000002
    Figure 0007759076000002
  • Figure 0007759076000003
    Figure 0007759076000003
Patent Text Reader

Abstract

To provide external and internal agents for skin that have high safety and stability and show great effects of promoting collagen production, inhibiting MMP, promoting hyaluronic acid production, promoting cell proliferation, and antioxidation.SOLUTION: The present invention relates to: a collagen production promoter containing extract from Alisma orientale; an MMP inhibitor, a hyaluronic acid production promoter, a cell proliferation promoter, and an antioxidant, containing extract from Alisma orientale; and a food composition for preventing / improving various diseases caused by an increase of MMP, containing extract from Alisma orientale.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a collagen production promoter, an MMP inhibitor, a hyaluronic acid production promoter, a cell proliferation promoter, an antioxidant, or a food composition. [Background technology]

[0002] Skin is exposed daily to various physical and chemical stressors, including ultraviolet rays, dryness, cold, heat, and drugs. As a result, skin function declines, resulting in various skin aging phenomena. One of these skin aging phenomena is wrinkles. Two types of wrinkles are known: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles, also known as fine lines, are temporary wrinkles that occur when the moisture content in the epidermal stratum corneum decreases due to dry skin. Dermal wrinkles, on the other hand, are formed by ultraviolet rays contained in sunlight and aging. Possible mechanisms for their formation include a decrease in collagen synthesis ability in dermal fibroblasts due to ultraviolet rays and aging, and accelerated collagen degradation due to an increase in matrix metalloproteinases (MMPs).

[0003] Epidermal wrinkles caused by dryness and dermal wrinkles differ in their histological morphology, onset mechanism, and treatment methods, and dermal wrinkles caused by ultraviolet rays and aging are difficult to improve by using cosmetics with moisturizing effects.

[0004] To date, agents that aim to improve dermal wrinkles caused by ultraviolet rays have been reported, including an agent for preventing and improving skin wrinkle formation, which contains hydrolyzed almonds as an active ingredient (Patent Document 1), and an agent for improving wrinkles caused by ultraviolet radiation, which contains extracts of Atractylodes macrocarpa, Atractylodes chinensis, and Atractylodes xanthan gum as active ingredients (Patent Document 2).

[0005] The dermis also contains fibroblasts and collagen, with type I collagen accounting for 80% of the total. In addition to type I collagen, types III, V, XII, and XIV collagen are known to exist. One of the causes of wrinkles and sagging skin is a decrease in type I collagen. Therefore, promoting the production of type I collagen is effective in preventing and improving wrinkles and sagging skin.

[0006] Collagen is a major structural protein, accounting for approximately one-third of mammalian tissues, and is an essential component of many matrix tissues, such as cartilage, bone, tendon, and skin. When collagenase (MMP-1), a member of the MMP family, cleaves collagen at a single site, the collagen molecule, which is stable in normal tissues, is denatured into single-chain gelatin, which is then degraded by various other proteases. As a result, the structural integrity of the matrix tissue is lost.

[0007] Gelatinase (MMP-2), a member of the MMP family, is an enzyme produced by fibroblasts, endothelial cells, cancer cells, and other cells. It degrades substrates such as collagen, gelatin, and elastin (structural proteins that are specific components of elastic tissues such as arteries, tendons, and skin). Therefore, substances with inhibitory activity against gelatinase are expected to suppress angiogenesis and cancer metastasis in cancer tissues, making them useful for the prevention and treatment of cancer. Furthermore, MMP inhibition is useful not only for cancer, but also for the prevention, treatment, and amelioration of various diseases caused by increased MMP activity, such as ulcer formation, rheumatoid arthritis, osteoporosis, and periodontitis.

[0008] Materials that have been proposed as having collagenase inhibitory activity include, for example, cocoa husk extract (Patent Document 3), which is the skin of the cocoa bean, Rubus nigra extract (Patent Document 4), lactoferrin (Patent Document 5), etc. With increasing interest in skin aging and oral hygiene, there is a demand for materials that are safe, have no side effects, and have excellent collagenase inhibitory activity.

[0009] Fibroblasts also produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermal connective tissue, which maintains skin firmness. It is believed that wrinkles and sagging skin occur when this connective tissue loses its contractile force and elasticity.

[0010] In particular, hyaluronic acid is known as a high molecular weight polysaccharide widely distributed in connective tissue, and it takes on a gel-like form in the dermis, maintaining skin elasticity. Therefore, the alteration or decrease of hyaluronic acid is thought to be important in skin aging. Furthermore, because hyaluronic acid is a high molecular weight, cosmetics containing it have the problem of being poorly absorbed when applied directly to the skin. Therefore, to date, efforts have been made to develop topical skin preparations that can activate fibroblasts to promote the cells' own production of collagen and hyaluronic acid (Patent Document 6).

[0011] Hyaluronic acid is also present in joints, where it is known to cushion the impact of joint loads and smooth joint movement. While the concentration of hyaluronic acid in normal human synovial fluid is approximately 2.3 mg / mL, in patients with rheumatoid arthritis, the concentration drops to approximately 1.2 mg / mL, and the viscosity of the synovial fluid also drops significantly (Non-Patent Document 1). It is also known that hyaluronic acid content decreases in septic arthritis, gouty arthritis, and other conditions, similar to those associated with rheumatoid arthritis (Non-Patent Document 2). Increasing the amount of hyaluronic acid in synovial fluid is considered to improve lubrication, coat and protect articular cartilage, suppress pain, and improve pathological synovial fluid in these diseases. For example, intra-articular injection of sodium hyaluronate in patients with rheumatoid arthritis has been shown to improve the symptoms described above (Non-Patent Document 3). However, treatment for these diseases is long-term. Therefore, there is a demand for external skin preparations, foods, and pharmaceuticals containing hyaluronic acid production promoters so that prevention and treatment can be easily carried out in daily life.

[0012] Floaters are a condition characterized by the appearance of thin shadows resembling lint or mosquitoes in the field of vision. They occur when opacities in the vitreous, which fills the interior of the eye, cast a shadow on the retina. Floaters can be broadly divided into two types: physiological floaters, which develop due to factors such as aging, ultraviolet light, and active oxygen, and pathological floaters, which appear as a symptom of diseases such as retinal detachment, retinal tears, vitreous hemorrhage, and uveitis. Physiological floaters occur when the vitreous becomes opaque due to the loss of hyaluronic acid, a major component of the vitreous, causing liquefaction and the breakdown of collagen fibers. Treatment options include vitrectomy and laser therapy, but these procedures are not commonly performed in Japan due to safety concerns, and treatment overseas is expensive. Therefore, to prevent and improve physiological floaters, foods and medicines containing hyaluronic acid production promoters that can be used on a daily basis are needed.

[0013] In general, the proliferation and division ability of epidermal cells declines with age, resulting in thinner epidermal layers (Non-Patent Document 4). Biological factors such as epidermal growth factor (EGF) and female hormones (estrogen) stimulate epidermal cell proliferation, but their secretion declines with age. This age-related decline in epidermal cell metabolic function slows skin turnover, leading to rough skin and skin aging. Furthermore, the retention of keratinocytes that shed from the stratum corneum inhibits the smooth excretion of melanin within the epidermis, causing pigmentation and dull skin. It is also known to slow epidermal wound healing. To prevent or ameliorate these phenomena, researchers have sought to identify ingredients that promote epidermal cell proliferation, and many topical skin preparations have been proposed.

[0014] Furthermore, skin, located at the outermost layer of the body, is an organ susceptible to the generation of reactive oxygen species due to the effects of ultraviolet rays and other factors, and is constantly exposed to oxygen stress. Meanwhile, reactive oxygen-scavenging enzymes exist within skin cells, protecting them from reactive oxygen damage unless the generation of reactive oxygen species exceeds their capacity. However, it is known that the activity of these enzymes decreases with age. When the damage caused by reactive oxygen species overcomes their defense response, the skin becomes oxidized, cellular function deteriorates, and aging progresses. Furthermore, exposure to reactive oxygen species in organs other than the skin can lead to functional decline, aging, and the development of various lifestyle-related diseases such as cancer and myocardial infarction. Therefore, reactive oxygen scavengers and antioxidants have been investigated to protect against reactive oxygen-induced damage, and foods, cosmetics, quasi-drugs, and pharmaceuticals containing reactive oxygen-scavenging enzymes such as SOD and catalase, and SOD-like active substances, as well as reactive oxygen scavengers and antioxidants, have been developed (Patent Documents 7 and 8).

[0015] Alisma orientale (scientific name: Alisma orientale) is a perennial herb belonging to the genus Alisma in the family Alismaceae, order Altissuales. The herb Takusha (Takusha) is the dried rhizome of Alisma orientale, containing alisol (a triterpene) and other compounds, and is used in traditional Chinese medicine for its diuretic and thirst-quenching effects. Alisma orientale extracts have been known to have anti-inflammatory effects, such as treating contact dermatitis caused by type IV allergies (Patent Document 9), inhibiting interleukin-4 production (Patent Document 10), inhibiting TNF-α production (Patent Document 11), and inhibiting prostaglandin E2 production (Patent Document 12), as well as promoting ceramide production (Patent Document 13). However, it was not known that Alisma orientale extracts have collagen production-promoting effects, MMP inhibitory effects, hyaluronic acid production-promoting effects, cell proliferation-promoting effects, and antioxidant effects. [Prior art documents] [Patent documents]

[0016] [Patent Document 1] Japanese Patent Application Laid-Open No. 2000-119125 [Patent Document 2] Japanese Patent Application Laid-Open No. 2006-199611 [Patent Document 3] Japanese Patent Application Publication No. 3-44331 [Patent Document 4] Japanese Patent Application Laid-Open No. 2003-137801 [Patent Document 5] Japanese Patent Application Publication No. 5-186368 [Patent Document 6] Japanese Patent Application Laid-Open No. 2007-1924 [Patent Document 7] Japanese Patent Application Publication No. 9-118630 [Patent Document 8] Japanese Patent Application Publication No. 9-208484 [Patent Document 9] Japanese Patent Application Publication No. 9-2961 [Patent Document 10] Japanese Patent Application Publication No. 10-45613 [Patent Document 11] Japanese Patent Application Laid-Open No. 2015-218145 [Patent Document 12] Japanese Patent Application Laid-Open No. 2012-144464 [Patent Document 13] Japanese Patent Application Laid-Open No. 2010-70499 [Non-patent literature]

[0017] [Non-Patent Document 1] “Arthritis Rheumatism”,vol.10,pp 357,1967 [Non-patent document 2] "Bonding Composition", Kanehara Publishing, 481 pages, 1984 [Non-patent document 3] "Inflammation," Japanese Society of Inflammation, Vol. 11, No. 16, 1991 [Non-patent document 4] Varani J et al., J Invest Dermatol, Vol.3,pp 57-60,1998 Summary of the Invention [Problem to be solved by the invention]

[0018] There is a demand for safe, stable materials that have excellent collagen production-promoting, MMP-inhibiting, hyaluronic acid production-promoting, cell proliferation-promoting, and antioxidant properties, but at present, no fully satisfactory materials have been provided. [Means for solving the problem]

[0019] Under these circumstances, the present inventors conducted extensive research and found that an extract of Polygonatum nigra has excellent collagen production-promoting effects, MMP inhibitory effects, hyaluronic acid production-promoting effects, cell proliferation-promoting effects, and antioxidant effects, and is also highly stable.Furthermore, the present inventors discovered that external or internal preparations containing the extract are safe and stable, and have excellent collagen production-promoting effects, MMP inhibitory effects, hyaluronic acid production-promoting effects, cell proliferation-promoting effects, and antioxidant effects, and can be used as multifunctional beauty and health materials and pharmaceuticals, thereby completing the present invention.

[0020] That is, the present invention includes the following inventions. (1) A collagen production promoter characterized by containing an extract of Polygonatum sieboldii. (2) An MMP inhibitor characterized by containing an extract of Polygala gracilis. (3) A hyaluronic acid production promoter characterized by containing an extract of hyaluronic acid. (4) A cell proliferation promoter characterized by containing an extract of Polygonatum nigra. (5) An antioxidant characterized by containing an extract of Polygala arvensis. (6) A food composition for preventing and improving various diseases caused by increased MMP, characterized by containing an extract of Acanthus nigra. [Effects of the Invention]

[0021] According to the present invention, a collagen production promoter, an MMP inhibitor, a hyaluronic acid production promoter, a cell proliferation promoter, and an antioxidant containing an extract of Polytrichum nigra as an active ingredient are provided. In addition, since the extract of Polytrichum nigra is a natural edible plant, it has no side effects and is highly safe. Therefore, an external or internal preparation containing the extract of Polytrichum nigra can be used safely. DETAILED DESCRIPTION OF THE INVENTION

[0022] The Alisma orientale (scientific name: Alisma orientale, Japanese name: Shimentaka, herbal medicine name: Takusha) used in the present invention is a perennial plant belonging to the genus Alisma in the family Alismaceae of the order Salticales, and is found primarily in northern Japan, East Asia, Central Asia, etc., but its place of origin is not particularly limited. In the present invention, the extract of Alisma orientale refers to an extract of parts of the plant, such as the rhizome (tuber), flowers, fruits, seeds, leaves, or stems, or the whole plant, or a mixture thereof. In the present invention, the part used as the extraction raw material is preferably the rhizome, which is used as a herbal medicine (alisma). Furthermore, for extraction, the plant may be used as is, or may be processed by drying, crushing, shredding, etc.

[0023] The extraction method is not particularly limited, but can be carried out using water, hot water, or a mixed solvent of water and an organic solvent, by stirring or column extraction. Examples of extraction solvents include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are preferred, with water, ethanol, 1,3-butylene glycol, and propylene glycol being particularly preferred. These solvents may be used alone or in combination. Particularly preferred extraction solvents include water or a water-ethanol mixed polar solvent. The amount of solvent used is not particularly limited, and may be, for example, 10 times or more, preferably 20 times or more, the dry weight of the rhizome of the sedge. However, for convenience of operations such as concentration and isolation after extraction, it is preferable that the amount be 100 times or less. The extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure during extraction, etc.

[0024] The extract may be used as the extracted solution as it is, or, if necessary, may be subjected to treatment such as concentration (vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon or the like, deodorization, ethanol precipitation, etc., within the scope of the effects of the present invention. Furthermore, the extracted solution may be subjected to treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

[0025] In the present invention, the extract may be used as is, or may contain ingredients such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, coating agents, sweeteners, and acidulants, which are used in cosmetics, quasi-drugs, pharmaceuticals, foods, etc., within a range that does not impair the effects of the extract.

[0026] The present invention can be used for any of cosmetics, quasi-drugs, pharmaceuticals, and foods, and examples of dosage forms thereof include lotions, creams, emulsions, gels, aerosols, essences, packs, cleansers, bath additives, foundations, dusting powders, lipsticks, ointments, poultices, candy tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and solutions for injection.

[0027] For external use, the content of the extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, calculated as solid matter. Furthermore, 0.01 to 5% by weight is most preferable. If it is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If it exceeds 10% by weight, it is difficult to see an enhancement of the effect, which is uneconomical.

[0028] For internal use, the dosage varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc. Generally, the daily dosage per adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0029] In the following, in order to explain the present invention in detail, production examples, experimental examples, and formulation examples of the extract used in the present invention are given as examples, but the present invention is not limited to these. In the production examples, % means % by weight, and in the formulation examples, parts of the content means parts by weight. [Example]

[0030] Example of manufacturing an extract of Scabious rhododendron An extract of Polygala gracilis was produced as follows: In Production Examples 1 to 4, the rhizome of Polygala gracilis was used as the extraction material.

[0031] (Production Example 1) Preparation of hot water extract of Polygala sieboldii 200 mL of water was added to 10 g of dried Phyllospermum officinalis, and the mixture was extracted for 2 hours at 95-100° C. The resulting extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 2.0 g of a hot water extract of Phyllospermum officinalis.

[0032] (Production Example 2) Preparation of 50% ethanol extract of Polygala sieboldii 10 g of dried Phyllospermum esculentum was soaked in 200 mL of 50% ethanol solution at room temperature for 7 days for extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 1.5 g of 50% ethanol extract of Phyllospermum esculentum.

[0033] (Production Example 3) Preparation of Ethanol Extract of Polygala gracilis 10 g of dried Phyllospermum esculentum was soaked in 200 mL of ethanol at room temperature for 7 days for extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 0.5 g of ethanol extract of Phyllospermum esculentum.

[0034] (Production Example 4) Preparation of 1,3-butylene glycol extract of Polygala sieboldii 10 g of dried Phyllospermum esculentum was soaked in 200 mL of 1,3-butylene glycol at room temperature for 7 days for extraction. The resulting extract was filtered to obtain 195 g of 1,3-butylene glycol extract of Phyllospermum esculentum. [Example]

[0035] (Formulation example 1) Lotion Prescription Content (parts) 1. Hot water extract of Scutellaria baicalensis (Production Example 1) 2.0 2.1,3-Butylene Glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1 10.Fragrance (appropriate amount) 11. Add purified water to make the total volume 100 [Manufacturing method] Components 1 to 6 and 11 are dissolved uniformly, and components 7 to 10 are dissolved uniformly. The mixture is then mixed and filtered to obtain the product.

[0036] (Comparative Formulation Example 1) Conventional lotion In Formulation Example 1, the hot water extract of Acanthus nigricans was replaced with purified water to prepare a conventional lotion.

[0037] (Formulation example 2) Cream Prescription Content (parts) 1. 50% ethanol extract of Eucalyptus sieboldii (Production Example 2) 1.0 2. Squalane 5.5 3. Olive Oil 3.0 4. Stearic Acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-butylene glycol 8.5 13. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 2-9, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 1 and 11-13, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool with stirring. Add ingredient 10 at 45°C, then cool further to 30°C to form the final product.

[0038] (Comparative Formulation Example 2) Conventional cream In Formulation Example 2, the 50% ethanol extract of Psathyrium sieboldii was replaced with purified water to produce a conventional cream.

[0039] (Formulation Example 3) Emulsion Prescription Content (parts) 1. Ethanol extract of Eucalyptus sieboldii (Production Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetyl alcohol 1.5 6. Glyceryl Monostearate 2.0 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene Glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 1-8, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 10-13, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool with stirring. Add ingredient 9 at 45°C, then cool to 30°C to form the final product.

[0040] (Formulation Example 4) Gel Prescription Content (parts) 1. 1,3-butylene glycol extract of sedge (Production Example 4) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1 5.Fragrance (appropriate amount) 6. 1,3-Butylene Glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Add purified water to make the total volume 100 [Manufacturing method] Components 2 to 5, 1, and 6 to 11 are each dissolved uniformly, and then mixed to form the product.

[0041] (Prescription Example 5) Pack Prescription Content (parts) 1. Hot water extract of sedge (Production Example 1) 1.0 2. 1,3-butylene glycol extract of sedge (Production Example 4) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5. 1,3-Butylene Glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Add purified water to make the total volume 100 [Manufacturing method] Components 1 to 11 are dissolved uniformly to produce the product.

[0042] (Formulation Example 6) Foundation Prescription Content (parts) 1. 50% ethanol extract of Eucalyptus sieboldii (Production Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0 4. Polyoxyethylene cetyl ether (20E.O.) 2.0 5. Cetyl alcohol 1.0 6. Liquid Lanolin 2.0 7. Liquid Paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene Glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengala 1.0 17. Yellow Iron Oxide 2.0 18.Fragrance (appropriate amount) 19. Add purified water to make the total volume 100 [Manufacturing Method] Heat and dissolve ingredients 2-8 and maintain at 80°C to form the oil phase. Ingredient 9 is thoroughly swelled in ingredient 19, and then ingredients 1 and 10-13 are added and mixed uniformly. To this, ingredients 14-17, which have been pulverized and mixed in a grinder, are added, and the mixture is stirred in a homomixer and maintained at 75°C to form the water phase. The water phase is added to the oil phase while stirring, and emulsified. After that, cool, add ingredient 18 at 45°C, and cool to 30°C while stirring to form the final product.

[0043] (Formulation Example 7) Bath additive Prescription Content (parts) 1. Ethanol extract of Prunus arvensis (Production Example 3) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to make the total volume 100 [Manufacturing method] Mix ingredients 1 to 5 uniformly to make the product.

[0044] (Prescription Example 8) Ointment Prescription Content (parts) 1. Hot water extract of Scutellaria baicalensis (Production Example 1) 5.0 2. 1,3-butylene glycol extract of sedge (Production Example 4) 1.0 3. Polyoxyethylene cetyl ether (30E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid Paraffin 5.0 6. Cetyl alcohol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene Glycol 10.0 9. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 3-6, and maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 1, 2, and 7-9, and maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool to 30°C while stirring to form the final product.

[0045] (Prescription Example 9) Powder Prescription Content (parts) 1. Hot water extract of sedge (Production Example 1) 1.0 2.Dry cornstarch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix ingredients 1 to 3 to form a powder.

[0046] (Prescription Example 10) Tablets Prescription Content (parts) 1. Ethanol extract of Prunus arvensis (Production Example 3) 5.0 2.Dry cornstarch 25.0 3. Calcium carboxymethylcellulose 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Components 1 to 4 are mixed, and then an aqueous solution of component 5 is added as a binder to form granules. Component 6 is added to the formed granules and compressed into tablets. Each tablet weighs 0.52 g.

[0047] (Prescription Example 11) Tablets Prescription Content (parts) 1. Ethanol extract of Prunus arvensis (Production Example 3) 2.0 2. Dry cornstarch 49.8 3. Erythritol 40.0 4. Citric Acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7.Purified water 0.1 [Manufacturing method] Mix ingredients 1 to 4 and 7 and form into granules. Add ingredients 5 and 6 to the formed granules and compress into tablets. Each tablet weighs 1.0 g.

[0048] (Formulation Example 12) Beverage Prescription Content (parts) 1. Hot water extract of sedge (Production Example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Add purified water to make the total volume 100 [Manufacturing Method] Dissolve ingredients 1 to 3 in a small amount of water. Then add ingredients 4 and 5 and mix.

[0049] Next, experimental examples will be given to explain the effects of the present invention in detail. [Example]

[0050] Experimental Example 1 Measurement of mRNA expression levels of type I collagen (COL1A1), MMP-1, MMP-2, and hyaluronic acid synthase 2 (HAS2) The mRNA expression levels of COL1A1, MMP-1, MMP-2, and HAS2 were measured. Human fibroblasts NB1RGB were cultured in a 60 mm dish at 1 × 10 5Cells were seeded and cultured in DMEM medium containing 10% FBS at 37°C under 5% CO2 conditions. When cells reached confluence, they were cultured in DMEM(-) medium supplemented with each sample at a final concentration of 1 or 10 μg / mL for 24 hours, after which total RNA was extracted. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and total RNA content was determined by absorbance at 260 nm using a Nanodrop spectrophotometer. mRNA expression levels were measured by real-time RT-PCR using the total RNA extracted from the cells. For real-time RT-PCR, a High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Life Technologies) were used. 500 ng of total RNA was reverse transcribed and then subjected to PCR (95°C for 15 seconds, 60°C for 60 seconds, 40 cycles). Other procedures were performed according to established procedures, and the expression levels of COL1A1, MMP-1, MMP-2, and HAS2 mRNA were calculated as a percentage of the expression level of β-actin mRNA, an internal standard. The COL1A1 expression rate was calculated as the ratio of the COL1A1 mRNA expression level in the sample-added group to the COL1A1 mRNA expression level in the control (no sample added) group. The MMP-1 expression rate, MMP-2 expression rate, and HAS2 expression rate were calculated in the same way. The primers used to measure the expression level of each gene are as follows.

[0051] Primer set for COL1A1 AGGACAAGAGGCATGTCTGGTT (SEQ ID NO: 1) TTGCAGTGGTAGGTGATGTTCTG (SEQ ID NO: 2) Primer set for MMP-1 GGGAGATCATCGGGACAACTC (SEQ ID NO: 3) TGAGCATCCCCTCCAATACC (SEQ ID NO: 4) Primer set for MMP-2 CCGTCGCCCATCATCAA (SEQ ID NO: 5) CTTCTGCATCTTCTTTAGTGTGTCCTT (SEQ ID NO: 6) Primer set for HAS2 TGGATGACCTACGAAGCGATTA (SEQ ID NO: 7) GCTGGATTACTGTGGCAATGAG (SEQ ID NO: 8) Primer set for β-Actin CACTCTTCCAGCCTTCCTTCC (SEQ ID NO: 9) GTGTTGGCGTACAGGTCTTTG (SEQ ID NO: 10)

[0052] The results of these experiments are shown in Tables 1 to 4. As a result, the extract of Polytrichum arvensis of the present invention was found to have excellent COL1A1 expression promoting effects (collagen production promoting effects), MMP expression suppressing effects (MMP inhibitory effects), and HAS2 expression promoting effects (hyaluronic acid production promoting effects). In particular, the ethanol extract of Polytrichum arvensis (Production Example 3) was remarkably effective in promoting COL1A1 expression and inhibiting MMP-1.

[0053] [Table 1]

[0054] [Table 2]

[0055] [Table 3]

[0056] [Table 4]

[0057] Experimental Example 2 Cell proliferation promotion test Human keratinocytes were cultured in DMEM culture medium containing 0.1% FBS at 1 × 10 per well in a 96-well plate. 3After seeding, each sample was added to a final concentration of 0.1 or 1 μg / mL and cultured at 37°C under 5% CO2 for 4 days. Cell counts were measured using a staining method. After culture, the culture medium was removed and the cells were fixed with methanol. Next, 0.1% methylene blue was added and the cells were stained for 1 hour. After drying, 100 μL of 0.1 N HCl was added to each well and mixed well. The absorbance at 650 nm was measured using a microplate reader. The cell proliferation rate was calculated as the ratio of the cell mass in the sample-added group to the cell mass in the control (no sample added) group.

[0058] The results of these experiments are shown in Table 5. As a result, the extract of Polygonatum arvensis of the present invention exhibited excellent cell proliferation-promoting activity. In particular, the hot water extract of Polygonatum arvensis (Production Example 1) had a significantly high cell proliferation-promoting effect.

[0059] [Table 5]

[0060] Experimental Example 3: Active oxygen scavenging effect The free radical scavenging and scavenging activity was evaluated. As a free radical model, the stable free radical α,α-diphenyl-β-picrylhydrazyl (hereinafter referred to as DPPH) was used, and reacted with the sample at a fixed ratio for a fixed period of time, and the amount of radicals that decreased was measured from the decrease in absorbance at 517 nm.

[0061] Method for measuring free radical scavenging and scavenging activity Each sample was added to 2 mL of 1.0 M acetate buffer (pH 5.5) to a final concentration of 250-750 μg / mL, and 2 mL of ethanol and 1 mL of 0.5 mM DPPPH ethanol solution were added to prepare a reaction solution. For oil-soluble samples, the sample was added to 2 mL of ethanol to prepare a reaction solution. The reaction was then allowed to proceed at 37°C for 30 minutes, and the absorbance (A) at 517 nm was measured using water as a control. Furthermore, the absorbance (B) was measured using purified water instead of the sample as a blank. The free radical capture and removal rate was calculated using the following formula. Free radical scavenging and removal rate (%) = (1-A / B) x 100

[0062] From the test results for each sample, the concentration required to capture and remove 50% of free radicals (hereinafter referred to as IC 50 The lower IC 50 The IC value corresponds to a more powerful active oxygen scavenger. The test results are shown in Table 6. Depending on the material, even if the concentration is increased to the solubility limit, the IC 50 The hot water extract of the present invention (Production Example 1) and the 50% ethanol extract (Production Example 2) of Polygala sieboldii were found to be IC 50 was calculated, and it was found to have stable and excellent free radical scavenging and scavenging activity (antioxidant activity).

[0063] [Table 6]

[0064] Experimental Example 4: Usage test A one-month usage test was conducted on five people (aged 26 to 66) with wrinkles and sagging skin using the lotion of Formulation Example 1 and the conventional lotion of Comparative Formulation Example 1. After use, the extent of wrinkles and sagging skin was assessed by questionnaire.

[0065] As a result, the lotion containing the extract of the present invention reduced wrinkles and sagging. Furthermore, during the test period, not a single subject experienced any skin troubles, and there were no safety issues. There were also no problems with the deterioration of the prescription ingredients. [Industrial Applicability]

[0066] From the above, the extract of the present invention has excellent collagen production promoting activity, MMP inhibitory activity, hyaluronic acid production promoting activity, cell proliferation promoting activity, and antioxidant activity, and is also excellent in stability. Therefore, the extract of the present invention can be used not only in the cosmetic field such as skin aging, but also in the medical field such as suppressing functional decline due to aging, preventing and treating cancer, and is expected to be applied to cosmetics, foods, quasi-drugs, and pharmaceuticals.

Claims

1. A fibroblast collagen production promoter (excluding internal use agents) characterized by containing an extract of Polytrichum nigra obtained by extraction with ethanol in an amount of 0.0001% by weight or more in terms of solid content, said fibroblast collagen production promoter being used to improve dermal wrinkles.

2. A keratinocyte proliferation promoter (excluding oral preparations) characterized by containing an extract of Polytrichum nigra obtained by extraction with water, ethanol, or aqueous ethanol, in an amount of 0.00001% by weight or more, calculated as solid content, and characterized by being used to improve skin pigmentation.

Citation Information

Patent Citations

  • Collagenase inhibitor

    JP1991044331A

  • Antirheumatic agent

    JP1993186368A

  • Dermatitis treating agent

    JP1997002961A

  • Active oxygen scavenger

    JP1997118630A

  • Active oxygen-eliminator and composition containing the same

    JP1997208484A