Compositions, methods and uses for controlling heat production in organisms
By regulating the binding of EBI-3 and p28, or their receptor, or downstream signaling pathways, the control of thermogenesis in organisms is achieved, addressing the lack of understanding in adipose tissue immune factors and treating metabolic diseases.
Patent Information
- Application Number
- JP2024536345
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-08-26
- Filing Date
- 2022-08-25
- Publication Date
- 2026-01-15
- Estimated Expiration
- 2042-08-25
AI Technical Summary
The diversity and abundance of immune factors in adipose tissue, particularly in relation to thermogenesis, are not well understood, limiting the control of heat production in organisms.
Regulating the binding of EBI-3 and p28, or their receptor, or downstream signaling pathways using molecules such as biopolymers, antibodies, or IL-27 recombinant proteins to modulate thermogenesis.
This approach allows for the inhibition or promotion of heat production in organisms, providing a means to control body temperature and treat metabolic diseases like hypothermia.
Smart Images

Figure 0007799840000001 
Figure 0007799840000002 
Figure 0007799840000003
Abstract
Description
[Technical Field]
[0001] TECHNICAL FIELD This application relates to the field of biotechnology, specifically to compositions, methods and uses, especially compositions, methods and uses for controlling heat production in organisms. [Background technology]
[0002] Thermogenesis by brown and beige fat plays an important role in maintaining body temperature during development. Although the differentiation and activation of brown / beige fat are well known, the diversity and abundance of immune factors in adipose tissue remain unknown. Summary of the Invention [Problem to be solved by the invention]
[0003] The present application provides a composition for controlling thermogenesis in an organism, comprising a molecule for regulating the binding of EBI-3 and p28, or the binding of a dimer of both to its receptor, or downstream signaling pathways. [Means for solving the problem]
[0004] Optionally, said modulation refers to inhibiting or reducing binding between EBI-3 and p28, or inhibiting or reducing binding between the dimer of both and its receptor, or downregulating downstream signaling pathways, and said control refers to inhibiting heat production and further reducing the body temperature of the organism.
[0005] Optionally, the molecule comprises a biopolymer or small molecule compound, including an anti-EBI-3 antibody, an anti-p28 antibody, an anti-IL-27R antibody, an EBI-3 soluble fragment, a p28 soluble fragment, or an IL-27R soluble fragment.
[0006] Optionally, said modulation refers to promoting or strengthening the binding of EBI-3 and p28, or promoting or strengthening the binding of the dimer of both to its receptor, or upregulating downstream signaling pathways, and said control refers to promoting thermogenesis and further increasing the body temperature of the organism.
[0007] Optionally, the molecule comprises IL-27 recombinant protein and modifications thereof, polypeptides or small molecule compounds that have the activity of activating IL-27R.
[0008] The present application provides a method for controlling thermogenesis in an organism using a molecule that regulates the binding of EBI-3 and p28, or the binding of a dimer of the two to its receptor, or downstream signaling pathways in the organism.
[0009] Optionally, the organism comprises a human subject or tissues or cells thereof, a mammal or tissues or cells thereof, or a microorganism.
[0010] Optionally, the tissue or cell is an in vitro tissue or cell.
[0011] The present application also provides a method for screening candidate compounds capable of regulating thermogenesis in an organism, comprising the step of measuring the binding status between EBI-3 and p28, or the binding status between a dimer of both EBI-3 and its receptor, or the downstream signaling pathway resulting from said binding, before and after the use of a compound to be measured.
[0012] Optionally, after using the target compound, if the binding of EBI-3 and p28 is inhibited or reduced, or if the binding of the dimer of both EBI-3 and their receptor is inhibited or reduced, or if downstream signals due to the binding are downregulated, the target compound is identified as a candidate compound that inhibits heat production in an organism.
[0013] Optionally, after using the target compound, if the binding of EBI-3 and p28 is promoted or strengthened, or if the binding of the dimer of both EBI-3 and p28 to its receptor is promoted or strengthened, or if a downstream signal due to the binding is upregulated, the target compound is identified as a candidate compound that promotes heat production in an organism.
[0014] Optionally, the method further comprises: (1) measuring binding parameters between EBI-3 and p28, or binding parameters between a dimer of EBI-3 and p28 and its receptor, or activation parameters of downstream signaling pathways in an organism model to obtain a first measurement value; (2) after applying the compound to be measured to the organism model, measuring a binding parameter between EBI-3 and p28, or a binding parameter between a dimer of both EBI-3 and its receptor, or an activation status parameter of a downstream signaling pathway in the organism model to obtain a second measurement value; and (3) comparing the first measurement with the second measurement.
[0015] Optionally, the method further comprises: (1) measuring binding parameters between EBI-3 and p28, or binding parameters between a dimer of both EBI-3 and p28 and its receptor, or activation status parameters of downstream signaling pathways in a first organism model to obtain a first measurement value; The method includes a step (2) of measuring a binding parameter between EBI-3 and p28, or a binding parameter between a dimer of both EBI-3 and its receptor, or an activation status parameter of a downstream signaling pathway in a second organism model that belongs to the same model as the first organism model in which the target compound is not used and in which the target compound is used, to obtain a second measurement value, and a step (3) of comparing the first measurement value with the second measurement value.
[0016] Optionally, the method further comprises: (1) measuring the binding parameters of EBI-3 and p28, or the binding parameters of the dimer of EBI-3 and p28 and its receptor, or the activation status parameters of downstream signal transduction pathways in the biological model after using the compound to be measured, and obtaining measured values; and (2) comparing the measured value with a reference value, which is a binding parameter between EBI-3 and p28, or a binding parameter between a dimer of both EBI-3 and its receptor, obtained by measurement in the absence of the compound to be measured in the organism model, or a parameter of the activation status of the downstream signal transduction pathway.
[0017] Optionally, the organism model comprises an animal model or a cell model.
[0018] The present application also provides a composition according to any one of the above claims for use in treating a metabolic disease.
[0019] Optionally, said metabolic disease comprises hypothermia.
[0020] The present application also provides a method for treating a metabolic disease, comprising administering to said subject in need thereof a composition described in any one of the above.
[0021] Optionally, said metabolic disease comprises hypothermia. [Brief explanation of the drawings]
[0022] [Figure 1] This is a diagram showing that IL-27 (interleukin-27) signaling promotes heat production and energy consumption. [Figure 2] IL-27 directly targets adipocytes to promote thermogenesis. [Figure 3] FIG. 1 shows that IL-27 promotes thermogenesis. [Figure 4] FIG. 1 shows reduced energy expenditure and thermogenesis in IL-27 signaling-deficient mice. [Figure 5] FIG. 1 shows that the thermogenic effect of IL-27Rα signaling does not act directly on CD2+ lymphocytes or Lyz2+ myeloid cells. [Figure 6] Phenotypes of IL-27Rα KO and WT chimeras during HFD-induced adaptive thermogenesis. [Figure 7]FIG. 1 shows that IL-27 upregulates UCP1 (uncoupling protein 1) to improve browning of subcutaneous white adipose tissue. [Figure 8] FIG. 1 shows that IL-27 promotes thermogenic activity. DETAILED DESCRIPTION OF THE INVENTION
[0023] Several exemplary embodiments of the present application have now been described, and the detailed description should not be considered a limitation on the present application, but rather should be understood as a more detailed description of certain aspects, features and embodiments of the present application.
[0024] It should be understood that the terms used in this application are for the purpose of describing particular embodiments only and are not intended to limit the application. It should also be understood that the numerical ranges in this application specifically disclose the upper and lower limits of the range, as well as each intermediate value therebetween. Each smaller range between any stated value or intermediate value within a stated range and any other stated value or intermediate value within said range is also included within this application. The upper and lower limits of these smaller ranges are independently included or excluded within the range.
[0025] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art described in this application. This application describes only preferred methods and materials; however, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of this application. All publications mentioned herein are incorporated by reference and are used to disclose and describe the methods and / or materials related to said publications, with the present specification controlling in the event of any conflict with any incorporated publication. Unless otherwise explained, "%" is percent by weight.
[0026] As used herein, the term "heat production" can be used interchangeably with the terms "heat production," "thermogenesis," and "thermogenesis." As used herein, thermogenesis refers to the process by which mammals, including humans, regulate heat production.
[0027] In this application, the binding of EBI-3 (Epstein-Barr virus-inducible gene 3) and p28 (i.e., a subunit of IL-27, a cellular factor secreted by dendritic cells) refers to the interaction of the EBI-3 subunit and the p28 subunit to form a heterodimeric structure with a specific spatial arrangement, which may be connected by a disulfide bond.
[0028] As used herein, the term "receptor" refers to a biological macromolecule that can bind to the dimer and cause a change in cellular function. The receptor contains at least an active site that recognizes and binds to the dimer and a functional active site responsible for generating a response reaction, thereby initiating a series of biochemical reactions and ultimately resulting in a biological effect in the target cell. The binding between the receptor and the dimer of the present application results in receptor activation, generating the basic step of transmitting a signal after receptor activation. Under physiological conditions, the receptor and the dimer are bound to each other not through a covalent bond but mainly through ionic bonds, hydrogen bonds, van der Waals forces, and hydrophobic effects.
[0029] As used herein, the term "signal transduction pathway" refers to a phenomenon in which, when a certain reaction is about to occur within a cell, a signal transmits information from outside the cell to inside the cell, and the cell responds in response to such information. In particular, the signal transduction pathway in this application refers to a series of enzymatic reaction pathways that transmit extracellular molecular signals into the cell through the cell membrane to exert an effect.
[0030] Some embodiments of the present application provide compositions for regulating heat production in an organism.
[0031] The present application provides a composition for controlling thermogenesis in an organism, comprising a molecule for regulating the binding of EBI-3 and p28, or the binding of a dimer of both to its receptor, or downstream signaling pathways.
[0032] In some embodiments, the modulation refers to inhibiting or reducing the binding of EBI-3 to p28, or inhibiting or reducing the binding of the dimer of both to its receptor, or downregulating downstream signaling pathways, and the control refers to inhibiting thermogenesis and further reducing the body temperature of the organism.
[0033] In some embodiments, the molecule comprises a biopolymer or small molecule compound, including an anti-EBI-3 antibody, an anti-p28 antibody, an anti-IL-27R antibody, an EBI-3 soluble fragment, a p28 soluble fragment, or an IL-27R soluble fragment.
[0034] In some embodiments, the modulation refers to promoting or enhancing the binding of EBI-3 and p28, or promoting or enhancing the binding of the dimer of both to its receptor, or upregulating downstream signaling pathways, and the control refers to promoting thermogenesis and thereby increasing the body temperature of the organism.
[0035] In some embodiments, the molecule comprises IL-27 recombinant protein and modifications thereof, polypeptides or small molecule compounds that have the activity of activating IL-27R.
[0036] Optionally, the composition of the present application includes a molecule for regulating IL27 signaling, the binding of IL27 to its receptor, or a downstream signaling pathway, where the downstream signaling pathway includes, but is not limited to, JAK / STAT3, p38 MAPK, etc. In the present application, heat production and energy consumption are mediated by adipocytes, and the adipocytes include, but are not limited to, brown / beige adipocytes and white adipocytes. In the present application, the adipocytes are IL27 target cells, not immune cells.
[0037] Some embodiments of the present application provide methods for controlling thermogenesis in an organism using molecules that regulate the binding of EBI-3 and p28, or the binding of a dimer of both to its receptor, or downstream signaling pathways in the organism.
[0038] In some embodiments, the organism comprises a human subject or tissues or cells thereof, a mammal or tissues or cells thereof, or a microorganism.
[0039] In some embodiments, the tissue or cells are in vitro tissue or cells.
[0040] Some embodiments of the present application provide methods for screening candidate compounds capable of regulating thermogenesis in an organism.
[0041] In the present application, the screening method includes at least a step of measuring the binding status of EBI-3 and p28, or the binding status of a dimer of the two and its receptor, or a downstream signaling pathway resulting from the binding, using a reagent before and after the use of the target compound. The binding status also includes a step of measuring a related parameter using a reagent, such as the amount of a dimer formed from the two, a metabolic phenotype, or the amount of a thermogenic protein. The thermogenic protein includes, but is not limited to, UCP1, PPARα (peroxisome proliferator-activated receptor), and PGC-1α (peroxisome proliferator-activated receptor-γ coactivator-1α). In the present application, activation (sometimes referred to as activity) of a downstream signaling pathway refers to the further expression of a downstream target gene. Optionally, the reagent includes a sequence set forth in SEQ ID NO.: 1-30.
[0042] In some embodiments, if, after using the target compound, the binding of EBI-3 to p28 is inhibited or reduced, or the binding of the dimer of both EBI-3 and their receptor is inhibited or reduced, or the downstream signal resulting from the binding is down-regulated, the target compound is identified as a candidate compound that inhibits heat production in an organism.
[0043] In some embodiments, if, after using the target compound, the binding of EBI-3 and p28 is promoted or strengthened, or the binding of a dimer of both EBI-3 and p28 to its receptor is promoted or strengthened, or a downstream signal resulting from the binding is upregulated, the target compound is identified as a candidate compound that promotes thermogenesis in an organism.
[0044] In some embodiments, the method comprises: (1) measuring binding parameters between EBI-3 and p28, or binding parameters between a dimer of EBI-3 and p28 and its receptor, or activation parameters of downstream signaling pathways in an organism model to obtain a first measurement value; (2) after applying the compound to be measured to the organism model, measuring the binding parameters of EBI-3 and p28, or the binding parameters of the dimer of EBI-3 and p28 and its receptor, or the activation status parameters of downstream signaling pathways in the organism model to obtain a second measurement value; and (3) comparing the first measurement with the second measurement.
[0045] In some embodiments, the method comprises: (1) measuring binding parameters between EBI-3 and p28, or binding parameters between a dimer of both EBI-3 and p28 and its receptor, or activation status parameters of downstream signaling pathways in a first organism model to obtain a first measurement value; (2) measuring a binding parameter between EBI-3 and p28, or a binding parameter between a dimer of both EBI-3 and its receptor, or an activation status parameter of a downstream signaling pathway in a second organism model that belongs to the same model as the first organism model in which the compound to be measured is not used and in which the compound to be measured is used, to obtain a second measurement value; and (3) comparing the first measurement with the second measurement.
[0046] In some embodiments, the method comprises: (1) measuring the binding parameters of EBI-3 and p28, or the binding parameters of the dimer of EBI-3 and p28 and its receptor, or the activation status parameters of downstream signal transduction pathways in the biological model after using the compound to be measured, and obtaining measured values; and (2) comparing the measured value with a reference value, which is a binding parameter between EBI-3 and p28, or a binding parameter between a dimer of both EBI-3 and its receptor, obtained by measurement in the absence of the compound to be measured in the organism model, or a parameter of the activation status of the downstream signal transduction pathway.
[0047] In some embodiments, the organism model comprises an animal model or a cell model.
[0048] The present application also provides a composition according to any one of the above claims for use in treating a metabolic disease.
[0049] The present application also provides a method for treating a metabolic disease, comprising administering to said subject in need thereof a composition described in any one of the above.
[0050] In some embodiments, the metabolic disease comprises hypothermia.
[0051] This application discloses the role of IL-27 (EBI-3 / p28) signaling in improving endogenous heat production. We demonstrate that IL-27 acts directly on adipocytes, activating p38 MAPK-PGC1 signaling and stimulating UCP1 production. Therapeutic administration of IL-27 can ameliorate cold-induced hypothermia in EBI-3 KO mice.
[0052] The present application provides compositions, methods, and uses for controlling thermogenesis in living organisms. This application demonstrates that research has shown that (EBI-3 / p28) signaling plays an important role in improving thermogenesis in the body, and that IL-27 acts directly on adipocytes to activate p38 MAPK-PGC1 signaling and stimulate the production of UCP1.
[0053] Example 1. Experimental Materials 1.1 Material 1.1.1 Mouse Interleukin-27Rα KO (B6N.129P2-Il27ra tm1Mak / J, No.: 018078) and EBI-3 KO (B6.129X1-Ebi3 tm1Rsb / J (No. 008691) mice were purchased from the Jackson Laboratory. Adipoq-cre mice were provided by Professor Yong Liu. IL-27Rα f / f Mice [herein] were prepared in our laboratory. Animal experiments were conducted in accordance with ethical specifications and contracts approved by the Southern University Institutional Animal Care and Use Committee and the Yale University Institutional Animal Care and Use Committee. All experiments used sex- and age-matched mouse groups, with four to six animals in each cage. IL-27 treatment experiments and bone marrow chimera generation were performed by randomly dividing the mice into groups. Mice were housed in a specific pathogen-free animal facility with controlled temperature and humidity, maintained at 25°C, and maintained on a 12:12 h light:dark cycle. They had free access to food and water. 1.1.2 Reagents Bio-Plex-Pro TM Human Cytokine 17-Plex Analysis Kit (Cat. No. M5000031YV) and Bio-Plex Pro TMHuman serum samples were analyzed using the Bio-Plex system (BioRad) with Human Inflammation Panel 1 (Cat. No. 171-AL001M). Human IL-27 ELISA kit (434607) was purchased from Biolegend. Glucose (63005518) was purchased from China National Pharmaceutical Chemical Reagents Corporation. Blood glucose test strips (one-touch) were purchased from Johnson & Johnson. Anti-mouse pAKT monoclonal antibody (4060), anti-mouse AKT monoclonal antibody (4685), anti-mouse GAPDH monoclonal antibody (5174), anti-mouse HSP90 monoclonal antibody (4877), anti-mouse PPARγ monoclonal antibody (2435), anti-mouse pSTAT3 monoclonal antibody (9145), anti-mouse STAT3 monoclonal antibody (9139), anti-mouse p-p38 MAPK (9211), anti-mouse p38 MAPK (9212), anti-mouse pATF2 monoclonal antibody (9221), and anti-mouse ATF2 monoclonal antibody (35031) were purchased from Cell Signaling Technology. Anti-mouse UCP1 monoclonal antibody (ab10983), anti-mouse PGC-1α monoclonal antibody (ab54481), anti-mouse PPARα monoclonal antibody (ab8934), anti-mouse PRDM16 monoclonal antibody (ab202344), and anti-mouse IL-27Rα monoclonal antibody (ab5997) were purchased from Abcam. APC-CY7-anti-mouse CD45 (clone 30-F11) was purchased from BD. APC anti-mouse CD11b (clone M1 / 70) and PE anti-mouse F4 / 80 (clone BM8) were purchased from Sungene Biotech (Tianjin, China). Recombinant mouse IL-27 (rmIL-27) (577408) was purchased from Biolegend. The STAT3 inhibitor SH-4-54 and p38 MAPK inhibitor SB203580 were purchased from Selleck Chemicals.Brown / beige adipose differentiation agents dexamethasone (D4902), rosiglitazone (R2408), indomethacin (I7378), isoprenaline (I5627), forskolin (F6886), 3-isobutyl-1-methylxanthine (IBMX) (I5879), triglyceride detection kit (T2449), and insulin (I3536) were purchased from Sigma. Leptin detection kit (MOB00) and adiponectin detection kit (MRP300) were purchased from R&D. Insulin detection kit (90080) was purchased from Crystal Chem.
[0054] 2. Experimental Method 2.1 Enzyme-linked immunosorbent assay Human serum was obtained as described above. Mouse serum was collected after 10 weeks of HFD (high-fat diet). Human IL-27 and mouse insulin were detected using ELISA kits according to the manufacturer's instructions. 2.2 Luminex immunoassay Human serum was collected as previously described. TM Human Cytokine 17-Plex Analysis Kit (Cat. No. M5000031YV) and Bio-Plex Pro TM Human serum inflammatory factors were detected using Human Inflammation Panel 1 (Cat. No. 171-AL001M) in a Bio-Plex 200 flow cytometry liquid phase chip analysis system (BioRad) according to the instructions in the user's manual. 2.3 Protein Western Blotting Whole cell or tissue lysates were extracted using RIPA lysis buffer (Beyotime, China) containing complete protease inhibitors (Roche) and phosphatase inhibitor Cocktail 2 (P5726, Sigma), and the supernatant was used for subsequent analysis. Proteins were diluted in loading dye (BL502A, Bio-sharp), heated at 95°C for 10 minutes, and electrophoresed on a 4-12% polyacrylamide gel. Proteins were transferred to polyvinylidene difluoride membranes, and protein Western blotting experiments were performed using the commercial antibodies and reagents indicated in the figures. 2.4 Histology Adipose or liver tissues were fixed overnight in 4% paraformaldehyde / 1x PBS at 4°C and embedded in paraffin before sectioning. Sections were stained with hematoxylin and eosin (H and E) or oil liver and photographed under a bright-field microscope. 2.5 Immunohistochemistry UCP1 and immunohistochemistry were performed using a rabbit-specific HRP / DAB (ABC) detection IHC kit (ab64261, Abcam) according to the manufacturer's instructions. 2.6 Core body temperature measurement and cold stimulation experiment Cold stimulation experiments were conducted in a temperature-controlled cold room. Mice were placed singly in individual cages (without floor coverings) at 4°C. Mice had free access to food and water. Rectal core body temperature was recorded every 2 hours using a digital thermometer and a rectal thermocouple probe (TH-212, HICHANCE, China). If the core body temperature fell below 20°C, the individual mice were euthanized and evaluated for survival analysis. 2.7 Metabolic cage Energy loss and expenditure were measured in mice using metabolic cages in a Yale University Environmental Control Rodent Incubator (CLAMS, Columbus Instruments, Columbus, OH). Before data collection, mice were housed singly and allowed to adapt to the metabolic chamber for 48 hours. Mice had free access to food and water. Continuous monitoring of physical activity and food intake was performed on each mouse. CO₂ / O₂ concentrations were collected from each mouse four times per hour during the experiment. 2.8 RNA extraction and gene expression analysis Total RNA was extracted from frozen tissues using TRNzol Common Reagent (Tiangen, Beijing) and quantified using a Nanodrop 2000 UV-Visible Spectrophotometer (Thermo). cDNA was purified using PrimeScript. TM The cDNA was prepared using the RT Reagent Kit (TAKARA, Dalian) and subjected to reverse transcription polymerase chain reaction (RT-PCR) with 1 μg of total RNA. Real-time quantitative PCR of the cDNA was performed using TB Green TM Premix-EX-Taq TM II kit (TAKARA) for CFX96 TM The PCR was performed in a real-time PCR detection system (Bio-Rad). Mouse HPRT was used as an internal control. t The immunohistochemical method was used to calculate the fold change in expression. The primer pair sequences were: Mouse HPRT: forward - TCATTATGCCGAGGATTTG (SEQ ID NO. 1), reverse - GCCTCCCATCTCCTTCAT (SEQ ID NO. 2), TNF-α: forward-CTACTGAACTTCGGGGTGAT (SEQ ID NO. 3), reverse-CAGGCTTGTCACTCGAATT (SEQ ID NO. 4), IL-6: forward-TCCAGTTGCCTTCTTGGGAC (SEQ ID NO. 5), reverse-GTGTAATTAAGCGCCGACTTG (SEQ ID NO. 6), IL-12p40: forward-GGCTGGTGCAAAGAAACATGGACTTGA (SEQ ID NO. 7), reverse-TGCAGACAGAGACGCCATTCCACAT (SEQ ID NO. 8), IL-1β: forward-CAACCAACAAGTGATATTCTCCATG (SEQ ID NO. 9), reverse-GATCCACACTCTCCAGCTGCA (SEQ ID NO. 10), IL-4: forward-GAAAACTCCATGCTTGAAGAA (SEQ ID NO. 11), reverse-TCTTTCAGTGATGTGGACTTG (SEQ ID NO. 12), IL-5: forward-TCACCGAGCTCTGTTGACAA (SEQ ID NO. 13), reverse-CCACACTTCTCTTTTTGGCG (SEQ ID NO. 14), IL-13: forward-TGAGCAACATCACACAAGACC (SEQ ID NO. 15), reverse-GGCCTTGCGGTTACAGAGG (SEQ ID NO. 16), Ucp1: forward-ACTGCCACACCTCCAGTCATT (SEQ ID NO. 17), reverse-CTTTGCCTCACTCAGGATTGG (SEQ ID NO. 18), Cox8b: forward -GAACCATGAAGCCAACGACT (SEQ ID NO. 19), reverse -GCGAAGTTCACAGTGGTTCC (SEQ ID NO. 20), Cidea: forward-TGCTCTTCTGTATCGCCCAGT (SEQ ID NO. 21), reverse-GCCGTGTTAAGGAATCTGCTG (SEQ ID NO. 22), Prdm16: forward-CAGCACGGTGAAGCCATTC (SEQ ID NO. 23), reverse-GCGTGCATCCGCTTGTG (SEQ ID NO. 24), Adiponectin: forward-GAATCATTATGACGGCAGCA (SEQ ID NO. 25), reverse-TCATGTACACCGTGATGTGGTA (SEQ ID NO. 26), Elovl3: forward -TCCGCGTTCTCATGTAGGTCT (SEQ ID NO. 27), reverse -GGACCTGATGCAACCCTATGA (SEQ ID NO. 28). 2.9 Bone marrow chimeras Ten-week-old IL-27Rα KO and WT mice served as bone marrow cell donors. Bone marrow was isolated from the hind femur, lysed with red blood cells, and filtered through a cell strainer (40 μm). The cell pellets were washed three times with sterile PBS, counted, and stored on ice for injection. Ten-week-old IL-27Rα KO and WT mice were lethally irradiated (900 rads), and 1 × 10 mice were injected via the ophthalmic vein. 7 After injection and transplantation of bone marrow cells, the mice were placed in a specific pathogen-free facility and supplemented with disinfected water and food for eight weeks to reconstitute their immune systems, after which metabolic studies were performed. 2.10 Preparation of primary beige adipocytes Subcutaneous adipose tissue from the groin was minced and digested in PBS containing collagenase II (1 mg / ml) at 37°C for 45 minutes. The tissue suspension was filtered through a 100 μm cell strainer and centrifuged at 600 g for 5 minutes to granulate the stromal vascular fraction (SVF). After granulation, the SVF was further filtered through a 40 μm cell strainer and placed on a collagen-coated plate. After overnight culture, the supernatant containing non-adherent cells was removed. Preadipocytes were grown and confluent in DMEM containing 10% FBS and insulin (5 μg / ml). Cells were treated with dexamethasone (1 μM), 3-isobutyl-1-methylxanthine (IBMX, 0.5 mM), insulin (5 μg / ml), indomethacin (125 nM), and rosiglitazone (1 μM) for 2 days to induce cell differentiation and fusion, followed by treatment with insulin (5 μg / ml) and triiodothyronine (T3, 1 nM) alone for another 5 days. On day 7, cells were pretreated overnight with or without IL-27 (100 ng / ml) and then treated with isoprenaline (10 μM) or forskolin (10 μM) for 4–6 h. On day 7, IL-27 (100 ng / ml) was added for 0–120 min and used for protein phosphorylation analysis, or for 12–24 h and used for protein expression level detection. For signal inhibition experiments, a STAT3 inhibitor (C188-9, 10 μM) or a p38 MAPK inhibitor (SB203580, 10 μM) was added to the culture medium 0.5 h before and during IL-27 treatment. 2.11 Flow cytometry (FACS). Epididymal adipose tissue was minced and digested as described above. SVF granules were used for surface staining with APC-CY7 anti-mouse CD45, APC anti-mouse CD11b, and PE anti-mouse F4 / 80. After 15 min of incubation, cells were washed with PBS and analyzed using a BD-FACSVerse flow cytometer (BD). 2.12 IL-27Rα knockout mice were generated. Development work was carried out using gene targeting technology to generate IL-27Rα knockout mice. Briefly, a 997-bps CKO region (GenBank NM_016671.3) containing exons 3 and 4 of the IL-27Rα gene, one 5.2-kb 5' homologous arm, and one 3-kb 3' homologous arm were amplified from a BAC clone using high-throughput Taq DNA technology, and a targeting vector was constructed with recombination sites and selectable markers. The final targeting vector was determined by multiple restriction endonuclease and full sequence analysis, and then transformed into 129s mouse embryonic stem cells by electroporation. Correct embryonic stem cell clones were identified and injected into C57BL / 6J mouse blastocysts. Chimeric mice were then clearly identified and backcrossed with C57BL / 6J mice. Genotypic PCR confirmed germline transmission. Next, we bred mice with the IL-27Rα f / w genotype and B6 adipoq-cre mice. Mice with the expected genotype were selected for the experiment. Genotyping primers with floxed or wt genotypes were used: forward: CTGGTTCTGGTATGGTTTGGGGTT (SEQ ID NO. 29) and reverse: TGAAAGAACTCAACAGTGGGCCGG (SEQ ID NO. 30). 2.13 IL-27 treatment Eight-week-old WT mice were fed an HFD for 32 weeks and randomly divided into two groups. Mice were intraperitoneally injected with rmIL-27 (100 μg / kg) or PBS for 15 consecutive days, followed by metabolic analysis. Twelve-month-old EBI-3 KO mice were randomly divided into two groups and intraperitoneally injected with rmIL-27 (100 μg / kg) or PBS for 7 consecutive days. Mice then underwent a cold stimulation experiment at 4°C. 2.14 Statistical analysis Plotting and statistical analysis were performed using Graphpad Prism software (version 7). All statistical tests were fully described in the figures and legends, and met the standard of normal distribution with similar variances. No statistical methods were used to predetermine sample size. Comparisons between two groups were performed using t-tests. For data evaluation of related samples, repeated measures analysis of variance (AVOVA) was performed. For evaluation of two or more groups, one-way analysis of variance and multiple comparisons were used. For evaluation between two independent variables, two-way analysis of variance with multiple comparisons was used. For survival analysis, the log-rank test was used. For association analysis, linear regression analysis was used. Otherwise, data are presented as mean ± sem unless otherwise stated. p<0.05 was considered statistically significant; *p<0.05, **p<0.01, **p<0.001, NS indicated non-significant.
[0055] 3. Experimental Results Figure 1 shows how IL-27 signaling promotes heat production and energy expenditure. a) IL-27Rα KO mice and WT control mice were fed an HFD for 4 weeks and then housed in metabolic cages. Food intake (shown in a), oxygen consumption (shown in b), and energy expenditure (shown in c) were monitored over a 24-hour period (n = 7–8). d and e: IL-27Rα KO mice and WT control mice, respectively, were fed an HFD for 6 weeks and then subjected to cold stimulation (4°C). Survival curves are shown in (d, n = 6–8), and rectal temperatures are shown in (e, n = 11–15). f and g: IL-27Rα KO and WT mice were fed an HFD for 6 weeks and then subjected to cold stimulation at 25°C (shown in f) or 4°C for 2 hours (shown in g). Subcutaneous fat (SCW) and brown adipose tissue (BAT) tissues were harvested and subjected to UCP1 immuno-Western blotting analysis. h-j: IL-27Rα KO and WT mice fed a normal diet were placed at 25°C or cold-stimulated at 4°C for 48 hours. SCW and BAT tissues were harvested and subjected to UCP1 immuno-Western blotting analysis (shown in h). i: UCP1 immunohistochemical staining results (scale = 100 μm), j: H and E staining of BAT and SCW tissues (scale = 50 μm). (f-h): Band density was quantified and normalized using ImageJ. Each lane represents one biologically independent sample, and experiments were repeated at least twice with similar results. Data are means ± sem of biologically independent samples, two-way ANOVA (a-c and e), and log-rank test (d). *p<0.05, **p<0.01, ***p<0.001.
[0056] Figure 2 shows that IL-27 directly targets adipocytes to promote thermogenesis. a. IL-27Rα KO or WT mice were used as donors or recipients and fed an HFD for 10 weeks to generate four groups of bone marrow chimeras. Body weights were recorded each week (n = 10-13). b. The effect of cold stimulation on rectal temperature in mated mice fed a normal diet (4°C, n = 6-7). c. Mated mice fed a normal diet were cold stimulated at 4°C for 12 hours, after which SCW was collected and subjected to immuno-Western blotting. d. 8-week-old Adipoq-CreIl27ra f / f Mouse and Il27ra f / f The control group was fed HFD for 10 weeks. Body weight was recorded each week (n=7-9). e. Effect of cold stimulation on rectal temperature in mice fed a normal diet (4°C, n=16-17). f. Adipoq-CreIl27ra mice fed a normal diet. f / f and Il27ra f / f Mice were cold stimulated at 4°C for 12 hours, and then SCW and BAT were collected and subjected to immuno-Western blotting. g. 8-week-old Ucp1-CreIl27ra mice f / f Mouse and Il27ra f / f The control group was fed HFD for 10 weeks. Body weight was recorded each week (n=5-6). h. Effect of cold stimulation on rectal temperature in mice fed a normal diet (4°C, n=5-8). i. Ucp1-CreIl27ra mice fed normal food. f / f and Il27ra f / f Mice were cold-stimulated at 4°C for 12 hours, after which SCW and BAT were collected and subjected to immuno-Western blotting (c, f, and i). Band densities were quantified and normalized using ImageJ. Each lane represents one independent biological sample, and experiments were repeated at least twice with similar results. Data are mean ± sem of independent biological samples. Two-way ANOVA (a, b, d, e, g, and h). *p<0.05, **p<0.01, **p<0.001.
[0057] Figure 3 shows the role of IL-27 in promoting thermogenesis. a) Primary beige adipocytes were generated from the SVF of WT SCW in vitro and then treated with rmIL-27 (100 ng / ml) or PBS for 24 hours. Cells were lysed, and protein extracts were used for immuno-Western blotting analysis. b) rmIL-27 (100 ng / ml) was used to treat WT primary beige adipocyte extracts for the indicated time points. c) Primary beige adipocytes from WT SCW were generated in vitro. A STAT3 inhibitor (C188-9, 10 μM) or a p38 MAPK inhibitor (SB203580, 10 μM) was added to the culture medium for 0.5 hours before culture and during rmIL-27 treatment (100 ng / ml, lasting 12 hours). Representative immuno-Western blotting results of cell lysates and protein extracts are shown in the figure. d-j: WT mice were fed an HFD for 32 weeks and then intraperitoneally injected with rmIL-27 (100 μg / kg) or PBS every other day for 15 days. d. Body weight was recorded at the indicated time points (n = 8). e. After 15 days of treatment with rmIL-27, adipose tissue was collected and weighed (n = 6-8), and a glucose tolerance test (f, n = 8) and an insulin tolerance test (g, n = 8) were performed. h. Mice were fasted overnight and then intraperitoneally injected with 0.75 U / kg insulin (15 min). Immuno-Western blotting analysis of pAKT (pSer473) in epididymal fat was performed. i. After 15 days of treatment with rmIL-27, liver tissue was stained with Oil Red O. j–m: UCP1-KO mice were fed a HFD for 20 weeks and then intraperitoneally injected with rmIL-27 (100 μg / kg) or PBS every other day for 15 consecutive days. j. Body weights were recorded at the indicated time points (n = 6). k. After 15 days of treatment with rmIL-27 (n = 6), adipose tissue and liver were collected and weighed. After 15 days of treatment with rmIL-27, GTT (l, n = 6) and ITT (m, n = 4) tests were performed. Band densities were quantified and normalized using ImageJ (a and c). Experiments were repeated at least twice, and results were similar. Data are means ± sem for biologically independent samples. Unpaired Student's t-test (e and k), two-way ANOVA (d, f, g, j, l, and m).*p<0.05.
[0058] Figure 4 shows reduced energy expenditure and heat production in IL-27 signaling-deficient mice. a-c: Eight-week-old IL-27Rα KO and WT mice were placed in metabolic cages. Food intake (a), oxygen consumption (b), and energy expenditure (c) (n = 7-8) are shown in the figure. d. BAT and SCW tissues were isolated from 6- to 8-week-old WT-ND and IL-27Rα KO mice and cut into small pieces (BAT approximately 0.003 g, SCW approximately 0.004 g). Basal oxygen consumption rates (n = 5 mice / group, 4-5 pieces / group / mouse) were measured using a Seahorse XF analyzer. e. Survival curves of IL-27Rα KO and WT mice fed ND diet in response to cold stimulation (4°C, n = 9-11). f. Effect of cold stimulation on rectal temperature in ND-fed mice (4°C, n = 9-11). g. Expression of the IL-27Rα gene in SCW of IL-27Rα KO and WT mice fed a normal diet was detected by real-time PCR (n = 9–11). h–j: EBI-3 KO mice and WT control mice fed a normal diet were cold-stimulated at 4°C and recorded. The survival curve (h) and rectal temperature (i) (n = 5–6) are shown in the figure. After 12 hours of cold stimulation, BAT and SCW were collected, lysed, and used for immuno-Western blotting analysis of UCP1 (j). Band density was quantified using ImageJ, and the UCP1 / HSP90 ratio was normalized. Experiments were performed twice, and the results shown are similar. Data are means ± SEM of biologically independent samples. Unpaired t-test (d and g), two-way ANOVA (a–c, f and i), and log-rank test (e and h). *p < 0.05, **p < 0.01, **p < 0.001.
[0059] Figure 5 shows that the thermogenic effect of IL-27Rα signaling does not directly affect CD2+ lymphocytes or Lyz2+ myeloid cells. flox / floxAn exemplary model generated from a mouse. The Il27ra locus (top) was targeted by a targeting vector (second), which contained homologous sequences of Il27ra and contained two LoxP sites flanking exons 3 and 4 and a Neo selection box. The linearized vector was then electroporated into embryonic stem cells (C57BL / 6), followed by drug selection, PCR screening, and Southern blotting confirmation. A floxed allele (third) was generated by homologous recombination. After determining the correct targeted ES clone by Southern blotting, the selected clone was used for blastocyst microinjection to generate the F0 generation. Following identification, the F0 was crossed with an Flp-deleter, and the Neo box (fourth) was deleted, confirming the F1 germline passage. After Cre recombination, a mismatch in the floxed Il27ra allele resulted in the deletion of exons 3 and 4 (bottom). b. Il27ra f / f Mouse genotype. c. Il27ra was identified using real-time fluorescent quantitative PCR. f / f Il27ra gene expression was detected in the spleens of WT and WT mice (n = 3). d. Il27ra gene expression was detected using real-time fluorescent quantitative PCR (n = 3, left). f / f and Cd2-Cre Il27ra f / f We detected the expression of Il27ra gene in mouse pancreatic CD3 T cells. Thioglycolate was used to detect the expression of Il27ra. f / f and Lyz2-Cre Il27ra f / f Mice were intraperitoneally injected with Il27ra for 4 days, and then peritoneal macrophages were collected and Il27ra gene expression was detected by real-time PCR (n = 5-6, right panel). e-h: Il27ra in 8-week-old mice. f / f , Cd2-Cre-Il27ra f / f and Lyz2-Cre-Il27ra f / fMice were fed an HFD for 10 weeks. e. Body weights were recorded each week (n = 11–21). After 10 weeks of HFD treatment, GTT (f) and ITT (g) tests (n = 11–19) were performed. h. After 10 weeks of HFD treatment, adipose tissue was collected and weighed (n = 11–21). Data are mean ± sem for biologically independent samples. Unpaired t-test (c, d), two-way ANOVA (e–g), one-way ANOVA (h). *p < 0.05, ***p < 0.001.
[0060] Figure 6. Phenotype of IL-27Rα KO and WT chimeras in HFD-induced adaptive thermogenesis. Bone marrow cells from the CD45.1 WT line were cultured in irradiated CD45.2 IL-27Rα KO or CD45.2 WT hosts (1x10 7 Chimeras were generated by transferring donor (CD45.1+) and host (CD45.2+) cells (cells / mouse). Mice were then maintained for 8 weeks to allow immune system reconstitution. Immune cells were isolated from different tissues as indicated, and analyzed by flow cytometry for the percentages (n = 3) of donor (CD45.1+) and host (CD45.2+) cells in CD4+ T cells (top), CD19+ B cells (middle), or F4 / 80+ macrophages (bottom). b–d: Bone marrow chimeras were obtained as indicated in a and fed an HFD. After 10 weeks of HFD treatment, GTT (b, n = 10–13) and ITT (c, n = 5–7) tests were performed. d. After 10 weeks of HFD treatment, adipose tissue and liver were collected and weighed (n = 4–6). e–g. Mated mice fed a normal diet were cold-stimulated at 4°C for 12 hours, and SCW and BAT were collected for histological analysis (e, H, and E, scale = 100 μm) or UCP1 immunohistochemical staining (f, scale = 100 μm). Real-time PCR analysis of SCW gene expression (g, n = 12) was performed. Data are means ± SEM of biologically independent samples. Unpaired t-test (a, f, and g), one-way ANOVA (d), and two-way ANOVA (b and c). *p < 0.05, **p < 0.01, and **p < 0.001.
[0061] Figure 7 shows that IL-27 upregulates UCP1 and ameliorates browning of subcutaneous white adipose tissue. a-c: 8-week-old Il27raf / f and Ucp1-CreIl27ra f / f Mice were fed HFD for 10 weeks. After 10 weeks of HFD treatment, GTT (a) and ITT (b) tests (n = 5-6) were performed, and adipose tissue and liver were collected and weighed (c, n = 5-6). d. Il27ra mice fed normal diet. f / f and Ucp1-Cre Il27ra f / fMice were cold-stimulated at 4°C for 12 hours, after which SCW and BAT were collected for histological analysis (H and E). Scale bar = 100 μm. e. Primary beige adipocytes were generated in vitro from the SVF of WT SCW mice and then treated with rmIL-27 (100 ng / ml) or PBS for 24 hours. Cells were lysed, and protein extracts were used for immuno-Western blotting analysis. BAT tissue from WT mice served as a positive control. f. Immuno-Western blotting analysis of STAT1 phosphorylation in extracts of WT primary beige adipocytes treated with rmIL-27 (100 ng / ml) for the indicated times was performed. g. WT mouse subcutaneous adipocytes were cultured in vitro. Two different p38 MAPK inhibitors (SB203580, 10 μM and SB202190, 5 μM) or three STAT3 inhibitors (C188-9, 10 μM, Stattic, 10 μM, or HO3867, 20 μM) were added to the culture medium 0.5 h before and during rmIL-27 treatment (100 ng / ml, 12 h). UCP1 expression was detected by immuno-Western blotting. h-i: Primary SCW beige adipocytes from WT (h) or IL-27Rα KO (i) mice were obtained by in vitro culture. The p38 MAPK inhibitor (SB203580, 10 μM) or STAT3 inhibitor (C188-9, 10 μM) was added to the culture medium 0.5 h before and during rmIL-27 treatment (100 ng / ml, 12 h). The expression of UCP1 or PPARα was analyzed by immuno-Western blotting. j-m: EBI-3 KO mice were intraperitoneally injected with rmIL-27 (100 μg / kg) or PBS for 7 consecutive days, followed by cold stimulation at 4°C. j. Rectal temperature of mice in response to cold stimulation (n=6). 24 h after cold stimulation, SCW and BAT protein extracts were used for immuno-Western blotting analysis. UCP1 staining (l) and histological analysis (m) (scale = 100 μm) are shown in the figure. Representative sections are shown in the figure. Band density was quantified and normalized using ImageJ. Experiments were repeated twice, and results were similar. Data are means ± sem of biologically independent samples. Unpaired t-test (c), two-way ANOVA (a, b, and j): *p<0.05, **p<0.01, **p<0.001.
[0062] Figure 8 shows the role of IL-27 in promoting thermogenesis. f / f and Adipoq-CreIl27ra f / f Mice were fed a HFD for 32 weeks and then intraperitoneally injected with rmIL-27 (100 μg / kg) or PBS every other day for 15 days. (a) Inflammatory factors in serum were detected using a Bio-Rad Bio-Plex 200 multifunction analyzer. (b) Representative tissue slices (H and E) are shown. (c) The percentage of infiltrated CD4 or CD8 T cells and the production of cellular factors in liver CD4 T cells were analyzed using a flow cytometer. Il27ra f / f The body weight (d), GTT (e) and ITT (f) of the mice (n=5-8) were detected and recorded. f / f The body weight (g), GTT (h), and ITT (i) of the mice (n = 4-5) were detected and recorded. f / f Mice were fed an HFD for 16 weeks and then intraperitoneally injected with rmIL-27 (100 μg / kg) or PBS every other day for 15 days. Body weight (j), tissue weight (k), glucose tolerance test (l), and insulin tolerance test (m) were measured and recorded (n = 5-6). Data are means ± sem for biologically independent samples. One-way ANOVA (a and c), two-way ANOVA (d-j, l and m), and unpaired t-test (k). *p < 0.05, **p < 0.01, **p < 0.001.
[0063] 4. Conclusion Browning of white adipose tissue allows mice to easily increase energy expenditure. To confirm the whole-body metabolic status, we examined the energy and nutrient expenditures of IL-27Rα KO mice and WT controls under normal chow or HFD treatment. Energy expenditure of IL-27Rα KO mice on a normal chow diet was significantly reduced without altering food intake (Figure 7a-c). The phenotype became more pronounced when fed an HFD (Figure 1a-c). These data indicate that IL-27 signaling plays a role in maintaining whole-body metabolic steady state. To determine whether the effect of IL-27Rα deficiency on energy expenditure is due to reduced thermogenesis, we next examined the effect of IL-27 signaling deficiency on adaptive thermogenesis.
[0064] IL-27Rα KO mice were sensitive to cold-induced hypothermia under normal dietary conditions (Fig. 4, f and g), and this intolerance became even more severe after HFD treatment (Fig. 1, d and e). Expression of uncoupling protein 1 (UCP1), a key protein for regulating thermogenesis, was also significantly reduced in IL-27Rα KO mice (Fig. 1, f–h). Tissue slices also showed less browning (Fig. 1, i) and fewer multilocular lipid droplet-containing cells (Fig. 1, j) in the brown adipose tissue (BAT) and subcutaneous white adipose tissue (SCW) of IL-27Rα KO mice. These data clearly demonstrated that the thermogenic activity of IL-27Rα KO mice was severely impaired. Note that UCP1 was already reduced in IL-27Rα KO mice before cold stimulation (shown in Figure 1f and h), consistent with other thermogenic genes (shown in Figure 4f), which was consistent with a reduction in system energy expenditure (shown in Figure 1b and c and Figure 4b and c). Furthermore, cold stimulation of EBI-3 KO mice recapitulated the findings in IL-27Rα KO mice (shown in Figure 4g-i), further demonstrating the thermogenic effect of IL-27 signaling.
[0065] Next, we dissected the cell types that transduce IL-27-mediated signals. First, we generated four groups of chimeric mice (WT > WT, WT > KO, KO > WT, and KO > KO) using bone marrow from IL-27Rα KO or WT mice and subjected these mice to an HFD. Surprisingly, only the IL-27Rα KO chimeras, regardless of the donor cells, were highly susceptible to HFD-induced fat accumulation and cold stimulation (Figure 2a-c). Compared to wild-type chimeras, thermogenesis in the IL-27Rα KO chimeras was consistently impaired, manifested as lower body temperature, fewer multilocular lipid droplets, and reduced UCP1 production (Figure 2a-c). These studies demonstrated that the primary target of IL-27 is adipocytes, not immune cells. Indeed, IL-27Rα is expressed in mature adipocytes and primary beige adipocytes. IL-27Rα also contributes to the development of IL-27Rα. △adipo Thermogenesis in mice was also suppressed due to cold intolerance, reduced browning, and decreased UCP1 (Figure 2c, e, f, h). In summary, these data demonstrate that IL-27 promotes thermogenesis by directly targeting adipocytes.
[0066] To investigate the molecular mechanism of IL-27's role in adipocytes, we directly treated primary beige adipocytes with IL-27 in vitro. After IL-27 treatment, UCP1 expression significantly increased, while simultaneously upregulating the expression of peroxisome proliferator-activated receptor α (PPARα), peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α), and other important transcriptional coactivators mediating energy metabolism (Figure 3A). In immune cells, typical downstream signaling pathways of IL-27Rα are JAK / STAT3 and p38 MAPK. We next examined whether IL-27 promotes adipocyte thermogenesis through these mechanisms. The phosphorylation of p38 MAPK was significantly increased under IL-27 stimulation, and pSTAT3 was briefly induced and rapidly reversed (Figure 3B). p38 MAPK is known to activate ATF2-mediated PGC-1α transcription, and PGC-1α is a key regulator of UCP1 and thermogenesis. As expected, IL-27 treatment also promoted ATF2 activation in primary beige adipocytes, resulting in the upregulation of PGC-1α, which could be reversed by pharmacological inhibition of p38 MAPK activity (Figure 3a-c). Furthermore, cells with p38 MAPK inhibition exhibited resistance to IL-27-induced UCP1 (Figure 3c). However, upregulation of UCP1 by IL-27 did not substantially affect the response to STAT3 inhibition, despite reducing PGC-1α expression (Figure 3c). These results indicate that IL-27 enhances thermogenic activity primarily through the p38 MAPK-PGC-1α signaling pathway. Interestingly, neither p38 nor STAT3 inhibition was able to reverse PPARα upregulation, indicating that the role of IL-27 may involve additional pathways.
[0067] Furthermore, supplementation of EBI-3 KO mice with IL-27 improved UCP1-mediated thermogenesis and prevented hypothermia during cold stimulation (Fig. 4).
[0068] In summary, our results demonstrate that IL-27 signaling is required for full adaptive thermogenesis. IL-27 directly targets adipocytes and induces p38 MAPK activation, thereby promoting ATF2 activation and subsequent PGC-1α and UCP1 expression. In summary, these findings provide new insights and broaden our understanding of the mechanisms of thermogenesis in the body.
[0069] Although the present application has been described with reference to exemplary embodiments, it should be understood that the present application is not limited to the disclosed exemplary embodiments. Numerous adjustments or modifications may be made to the exemplary embodiments of the specification of the present application without departing from the scope or spirit of the present application. The claims should be based on the broadest description to cover all modifications and equivalent structures and functions.
[0070] Industrial Practicality This application provides compositions, methods, and uses for controlling heat production in living organisms. This application discloses the role of IL-27 signaling in regulating heat production. Studies of the molecular mechanism demonstrate that IL-27 acts directly on adipocytes, activating p38 MAPK-PGC1 signaling and stimulating UCP1 production. Therapeutic administration of IL-27 ameliorates cold-induced hypothermia in EBI-3 KO mice. This application therefore reveals the important role of IL-27 signaling in the process of energy metabolism and provides a viable means for controlling body temperature, with significant industrial applicability and high market value.
[0071] This application claims priority to a Chinese patent application with application number CN202110986914.X, entitled "Composition, method and use for controlling heat production in organisms," filed with the China Patent Office on August 26, 2021, the entire contents of which are incorporated herein by reference.
Claims
[Claim 1] A composition for controlling heat production in an organism, comprising a molecule for regulating the binding of EBI-3 to p28 or the binding of IL27 to its receptor; The modulation refers to promoting or enhancing the binding of EBI-3 and p28, or promoting or enhancing the binding of IL27 and its receptor, and the control refers to promoting thermogenesis and further increasing the body temperature of the organism; The molecule is an IL-27 recombinant protein. A composition characterized by: