Improved Fc-silenced anti-oxMIF antibodies with reduced aggregation potential and reduced hydrophobicity

Abstract

The present invention relates to Fc-silenced anti-oxMIF antibodies with improved properties, e.g., reduced aggregation potential and reduced hydrophobicity, due to selected amino acid substitutions in the light and heavy chain variable domains, and their use in the treatment of oxMIF-associated conditions.

Description

[Technical Field]

[0001] The present invention relates to Fc-silenced anti-oxMIF antibodies with improved properties, such as reduced aggregation potential and reduced hydrophobicity, due to selected amino acid substitutions in the light and heavy chain variable domains, and their use in the treatment of oxMIF-associated conditions. [Background technology]

[0002] The cytokine macrophage migration inhibitory factor (MIF) was described as early as 1966 (David, JR, 1966; Bloom, BR, and Bennet, B., 1966). After cloning and recombinant expression, its biochemical properties and physiological role were elucidated (Bernhagen et al., 1993; Bernhagen et al., 1994). It is now well recognized that MIF is a crucial regulator of innate immunity and plays a central role in inflammatory responses and cancer. MIF promotes the production of other pro-inflammatory mediators, such as tumor necrosis factor (TNF) (Calandra et al., 1994), nitric oxide (Bernhagen et al., 1994), and prostaglandin E2 (Mitchell et al., 1999; Sampey et al., 2001). One of the most notable properties of MIF is its ability to counteract the immunosuppressive effects of glucocorticoids (GCs). In vitro, MIF counteracts GC-induced inhibition of cytokine secretion in monocytes (TNF, IL-1, IL-6, and IL-8) (Calandra et al., 1995) and T cells (Bacher et al., 1996) and reverses dexamethasone-induced suppression of TNF-induced arachidonic acid release in fibroblasts (Mitchell et al., 1999). In vivo studies have shown that MIF increases mortality in endotoxemic mice treated with dexamethasone (Calandra et al., 1995). Upregulation of MIF serum levels and its association with disease have been most extensively described in patients with severe sepsis (Emonts et al., 2007; Bozza et al., 2004; Sprong et al., 2007). Plasma levels of MIF correlate with disease severity and shock state, being significantly higher in deceased patients than in survivors. MIF concentrations were significantly correlated with elevated plasma concentrations of IL-1, IL-6, IL-10, IL-12, and cortisol.Elevated MIF levels in patients have also been measured in many inflammatory diseases, such as rheumatoid arthritis (Onodera et al., 1999; Morand et al., 2002), Crohn's disease (de Jong et al., 2001), psoriasis (Shimizu et al., 2001), and multiple sclerosis (Niino et al., 2000; Rinta et al., 2008).

[0003] MIF further contributes to the maintenance of the inflammatory process by preventing p53-dependent cell death and stimulating the survival of monocytes and macrophages (Mitchell et al., 2002).

[0004] Increasing evidence suggests a close connection between inflammation and many types of cancer. Inflammatory pathways, designed to protect against infection and injury, can also promote an environment conducive to tumor growth and metastasis (Conroy et al., 2010). Thus, inflammation has been suggested to be a key driver of tumorigenesis, with many cancers arising as a result of infection or chronic inflammation (Bucala and Donnelly, 2007; Conroy et al., 2010; Karin, 2009). Furthermore, it is well documented that the inflammatory nature of the tumor microenvironment promotes angiogenesis and extracellular matrix (ECM) breakdown, thereby contributing to tumor cell survival, proliferation, and migration (Coussens and Werb, 2002; Hagemann and Balkwill, 2005; Hagemann et al., 2007; Kessenbrock et al., 2010). MIF has been shown to be upregulated in a wide variety of human neoplasms, such as tumors of pancreatic, breast, prostate, colon, brain, skin, and lung origin (Bando et al., 2002; Chen et al., 2010; Kamimura et al., 2000; Meyer-Siegler and Hudson, 1996; Shimizu et al., 1999; Takahashi et al., 1998; Winner et al., 2007). Several studies have reported that MIF expression is closely correlated with tumor aggressiveness and metastatic potential, suggesting that MIF may play an important role in disease severity and cell survival (Rendon et al., 2009). Recent data suggest that extracellular MIF may contribute to a more aggressive tumor phenotype compared with intracellular MIF (Verjans et al., 2009). MIF contributes to a microenvironment favorable for tumor growth, angiogenesis, invasiveness, and metastasis.In addition to its pro-inflammatory function, MIF exerts anti-apoptotic and pro-proliferative effects, including inhibition of p53 (Hudson et al., 1999; Mitchell and Bucala, 2000) and activation of the pivotal kinases ERK1 / 2 (Mitchell et al., 1999) and AKT (Lue et al., 2007). MIF has also been described as a pro-angiogenic factor, promoting angiogenesis (Coleman et al., 2008) and tumor vascularization through stabilization of HIF-1α (Winner et al., 2007) and upregulation of pro-angiogenic factors such as VEGF and IL-8 (Ren et al., 2004). MIF also functions as a chemokine, predicted to contribute to the recruitment of inflammatory cells within the tumor environment via the chemokine receptors CXCR2 and CXCR4 (Bernhagen et al., 2007; Rendon et al., 2007).

[0005] However, MIF differs significantly from other cytokines and chemokines because it is constitutively expressed and present in the circulation of healthy subjects: it is preformed and stored in cytoplasmic pools in macrophages, T cells, and many other cells in the body, including the hypothalamic-pituitary-adrenal axis, allowing for rapid release upon stimulation without de novo synthesis (Bernhagen et al., 1993; Bacher et al., 1997; Fingerle-Rowson et al., 2003).

[0006] Due to the ubiquitous nature of this protein, MIF may be considered an inappropriate target for therapeutic intervention. However, MIF exists in two immunologically distinct conformational isoforms, termed reduced MIF (redMIF) and oxidized MIF (oxMIF) (Thiele M. et al., 2015). RedMIF has been found to be a highly expressed MIF isoform that can be found in the cytoplasm and circulation of any subject. RedMIF appears to represent a latent, inactive storage form (Schinagl A. et al., 2018).

[0007] In contrast, oxMIF appears to be a physiologically relevant disease-associated isoform that can be detected in tumor tissues, specifically tumor tissues from patients with colorectal, pancreatic, ovarian, and lung cancer, demonstrating the high tumor specificity of oxMIF (Schinagl et al., 2016), as well as in the circulation and inflamed tissues of patients with inflammatory diseases (Thiele et al., 2015).

[0008] The number of successful drug targets for treating cancers, such as the oxMIF-positive indications mentioned above, has been limited. For example, although over 300 potential immuno-oncology targets have been described, most clinical studies have focused on anti-PD-1 and anti-PD-L1 antibodies (Tang J., et al. 2018). Therefore, the scientific and medical communities desperately need promising agents that target tumor-specific antigens to increase treatment options for cancer patients with poor prognosis.

[0009] Furthermore, there is a high demand for drugs that target inflammatory diseases. Glucocorticoids (GCs) represent the most important and frequently used class of anti-inflammatory drugs in routine clinical practice (Schacke et al., 2002). The usefulness of GCs is primarily related to their ability to effectively block the inflammatory cascade at multiple levels by reducing the recruitment of inflammatory cells and suppressing the synthesis of pro-inflammatory cytokines and mediators (Barnes et al., 2003). Oral GC use is estimated to be 0.5% of the general population and 1.4% of those over 55 years of age (Ramsey-Goldman, 2002; Walsh et al., 1996). Although GCs are considered to be clearly beneficial, their use is limited by significant, dose-dependent, and often irreversible side effects (Pisu et al., 2005). The most concerning side effects include hypertension, obesity, osteoporosis, myopathy, edema, and immunosuppression. Premature atherosclerosis-related deaths are also becoming increasingly common in inflammatory diseases, including RA and systemic lupus erythematosus (SLE) (Wallberg-Jonsson et al., 2005; del Rincon et al., 2001; Solomon et al., 2003; El-Magadmi et al., 2004; Manzi et al., 1999). The substantial toxicity of GCs poses a significant burden, necessitating the development of therapeutic strategies that enhance the therapeutic effects of GCs on inflammatory diseases and allow for dose reduction. However, this requires elucidating the factors that regulate GC sensitivity. In the early 2000s, a unique relationship between the cytokine macrophage migration inhibitory factor (MIF) and GCs was discovered, identifying MIF as a potential regulator of GC sensitivity (Aeberli et al., 2006).

[0010] Antibodies targeting oxMIF have shown efficacy in in vitro and in vivo models of inflammation and cancer (Hussain F. et al., 2013; Schinagl. A. et al., 2016; Thiele et al., 2015).

[0011] WO 2019 / 234241 A1 discloses an anti-oxMIF / anti-CD3 bispecific antibody.

[0012] In WO 2009 / 086920 A1 the anti-oxMIF antibody Bax69 (imalumab) is described.

[0013] Protein aggregation, specifically antibody aggregation, is frequently observed during several stages of bioprocessing, including protein expression, purification, and storage. Antibody aggregation can affect the overall yield of therapeutic protein manufacturing processes and contribute to the stability and immunogenicity of therapeutic antibodies.

[0014] Therefore, protein aggregation of antibodies remains a significant problem due to their occurrence and remains a major concern in antibody production. Antibody aggregation can be induced by partial unfolding of its domains after monomer-monomer association, leading to nucleation and aggregate growth. Although the aggregation tendency of antibodies and antibody-based proteins can be influenced by external experimental conditions, it is strongly dependent on the underlying antibody properties determined by their sequence and structure.

[0015] For example, resistance to aggregation can be achieved by stabilizing the native state (i.e., resistant to unfolding) or by reducing the tendency of the unfolded or partially folded state of the protein to aggregate. The disadvantage of stabilizing the native state is that the protein is more likely to be exposed to an environment that will unfold it. Generally, when a protein denatures or unfolds, amino acid residues that normally mediate intramolecular contacts within the protein are exposed. Such exposure often makes the protein more susceptible to forming intermolecular contacts and thus more susceptible to aggregation. In contrast to proteins that are resistant to unfolding, proteins that have a reduced tendency to aggregate when unfolded readily refold into a biologically active, non-aggregated state after exposure to such an environment.

[0016] The aggregation resistance or aggregation propensity of proteins, including antibodies and their antigen-binding domains, is usually limited by the number of aggregation-prone domain(s) contained therein and by the strength of their interactions with surrounding domains, if any.

[0017] This is because once a domain unfolds, if it cannot refold, it can interact with other domains within the same protein or other proteins and form aggregates. The constant domains of antibodies generally do not aggregate and do not change significantly. Therefore, the weakest domains of antibodies in terms of aggregation potential and stability are generally considered to be the variable domains (e.g., heavy chain variable domains (V H ) and / or a light chain variable domain (V L ), Ewert S. et al., 2003). In this regard, the aggregation tendency V H or V LIncorporation of variable domains into otherwise stable recombinant antibody products often confers these generally undesirable properties to new recombinant designs. Therefore, engineering a variable domain to be aggregation-resistant is most likely to render the entire protein, including that variable domain, aggregation-resistant. Various strategies for reducing variable domain aggregation have been proposed, such as rational design of aggregation-resistant proteins, complementarity-determining region (CDR) grafting, or the introduction of disulfide bonds into variable domains. Rational design of aggregation-resistant proteins typically involves using in silico analysis to predict the effect of point mutations on the aggregation propensity of a protein. However, this approach faces several obstacles. For example, simply identifying mutations that may reduce the aggregation of an unfolded protein is not sufficient. More specifically, mutations must neither increase the aggregation of the folded protein nor affect the function of the folded protein, particularly in the case of antibodies, its binding properties, e.g., affinity or specificity. Furthermore, rational design requires detailed structural analysis of the specific protein to be improved, making it difficult to use with proteins that are not well characterized and not readily applicable to a variety of different proteins. CDR-grafting involves transplanting CDRs from one variable domain onto the framework regions (FRs) of another variable domain. This strategy has been shown to be useful for stabilizing anti-EGP-2 scFv (Willuda J. et al., 1999). A disadvantage of this approach is the potential loss of affinity after CDR-grafting. While this loss of affinity can be overcome by introducing mutations into the FRs, such mutations may result in the creation of immunogenic epitopes in the protein, making the protein undesirable from a therapeutic perspective. Furthermore, CDR-grafting generally requires crystallographic analysis or homology modeling of the donor and acceptor variable domains to assess the suitability of the graft. Such an approach is laborious and requires specialized knowledge. Furthermore, this method cannot be easily applied to various molecules because each variable domain has a different structure.Regarding methods involving the introduction of disulfide bonds into variable domains, disulfide bonds can aid in the correct refolding of proteins, but they also introduce inflexibility into the variable domains. Such inflexibility can reduce the affinity of antibodies for their antigens. Furthermore, the cysteine ​​residues required for disulfide bond formation cannot be introduced into all variable domains without loss of affinity or the introduction of immunogenic epitopes. Furthermore, disulfide bond formation at high protein concentrations can lead to protein aggregation, negating any potential beneficial effects of disulfide bonds.

[0018] However, reduced aggregation tendency has been shown to be accompanied by increased expression titers, indicating that reducing protein aggregation can be beneficial throughout the development process and potentially lead to more efficient clinical trials. For therapeutic proteins, aggregates are a significant risk factor for adverse immune responses in patients and can form through a variety of mechanisms. Controlling aggregation can improve protein stability, manufacturability, attenuation rate, safety, formulation, potency, immunogenicity, and solubility (Wei Li et al., 2016; Van der Kant R. et al., 2017).

[0019] Further intrinsic properties of proteins, such as hydrophobicity, also play an important role in antibody solubility. The low solubility of these therapeutic proteins due to surface hydrophobicity has been shown to make formulation development more difficult and can result in poor biodistribution in vivo, undesirable pharmacokinetic behavior, and immunogenicity. Therefore, reducing the overall surface hydrophobicity of candidate monoclonal antibodies can provide benefits and cost savings in terms of purification and administration regimens.

[0020] There has also been growing interest in controlling antibody effector functions for specific therapeutic purposes. Specifically, Fc-null or Fc-silenced antibodies offer a strategy to eliminate Fc effector functions and complement interactions (which may be unfavorable for antibody mechanisms) as potent immune effector functions mediated by FcγR. Similarly, controlling neonatal Fc receptor (FcRn) binding of IgG antibodies to control pharmacokinetics has also become widely known.

[0021] Strohl WR et al. (2012) describes antibody Fc engineering to increase or decrease FcγR-mediated activity of IgG isotypes.

[0022] WO2017 / 178493A1 describes an antibody targeting TIM-3 (T-cell immunoglobulin and mucin domain containing molecule 3) that contains modified CH1-CH3 domains for Fc silencing. The combination of reduced aggregation potential, reduced hydrophobicity, and Fc silencing is believed to result in highly advantageous antibody properties. There is an unmet need in the art for Fc-silenced anti-oxMIF aggregation-resistant antibodies with reduced hydrophobicity. Summary of the Invention

[0023] It is an object of the present invention to provide improved antibodies or antigen-binding fragments thereof that target Fc-silenced oxMIF and have reduced aggregation tendency and hydrophobicity.

[0024] This object is solved by the subject matter of the present invention.

[0025] The present invention provides an Fc-silenced anti-oxMIF antibody, or antigen-binding fragment thereof, comprising a mutant Fc region of wild-type human IgG comprising SEQ ID NO: 1 (CH2-CH3), or alternatively SEQ ID NO: 44 (CH1-CH3), with one or more amino acid substitutions or glycosylation modifications, and the following variable domains: (a1) a light chain variable domain comprising SEQ ID NO: 2 with at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F; or (a2) comprises SEQ ID NO: 2 with one, two, three, four, or five amino acid substitutions; - a conserved tyrosine at position 36, and - a light chain variable domain further comprising at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F; and (b1) a heavy chain variable domain comprising SEQ ID NO: 3; or (b2) a heavy chain variable domain comprising SEQ ID NO: 3 and the amino acid substitutions L5Q and / or W97Y; or (b3) a heavy chain variable domain comprising SEQ ID NO: 3 with at least one amino acid substitution L5Q or W97Y and one, two, three, four, or five additional amino acid substitutions. Including, where the amino acid positions are numbered according to Kabat: the mutant Fc region exhibits reduced FcγR binding compared to the wild-type IgG1 Fc region; Disclosed is an Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof has reduced aggregation ability and reduced hydrophobicity compared to an antibody or antigen-binding fragment thereof comprising SEQ ID NO: 2 and SEQ ID NO: 3 lacking the amino acid substitutions.

[0026] Specifically, the recombinant anti-oxMIF antibody refers to SEQ ID NO: 2 and contains the amino acid substitution W93F.

[0027] Specifically, the recombinant anti-oxMIF antibody refers to SEQ ID NO: 3 and contains the amino acid substitution W97Y.

[0028] According to a further particular embodiment, the recombinant anti-oxMIF antibody comprises the amino acid substitutions W93F and W97Y.

[0029] According to certain embodiments described herein, the amino acid substitutions in the Fc region are at any one of positions E233, L234, L235, G236, G237, P238, D265, S267, H268, N297, S298, T299, E318, L328, P329, A330, P331 of SEQ ID NO: 1 according to the EU numbering index.

[0030] According to an alternative embodiment, the Fc region is aglycosylated.

[0031] More specifically, the amino acid substitutions in the Fc region are at positions L234 and L235 of SEQ ID NO: 1, specifically L234A and L235A, according to the EU numbering index.

[0032] Specifically provided herein are Fc-silenced anti-oxMIF antibodies comprising an Fc region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 5, 6, 7, 8, 9, 43, and 85.

[0033] More specifically, the Fc-silenced anti-oxMIF antibodies described herein comprise variable heavy and light chains. i.) SEQ ID NOs: 3 and 6; ii.) SEQ ID NOs: 9 and 6; iii.) SEQ ID NOs: 4 and 6; iv.) SEQ ID NOs: 4 and 8; v.) SEQ ID NOs: 4 and 5, or vi.) SEQ ID NO: 43 and any one of SEQ ID NOs: 5, 6, 7, or 8 Includes.

[0034] According to one embodiment, the Fc-silenced anti-oxMIF antibody described herein further comprises the CH1-CH3 domains of SEQ ID NO:14.

[0035] According to certain embodiments of the invention, the anti-oxMIF antibody comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 15 and 16 or 17.

[0036] According to a further embodiment, there is provided an Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof, comprising a variant Fc region of wild-type human IgG comprising SEQ ID NO: 1 with one or more amino acid substitutions or glycosylation modifications; a light chain CDR1 sequence selected from SEQ ID NO: 72 or 78; a light chain CDR2 sequence selected from SEQ ID NO: 73, 79, 80, or 81; a light chain CDR3 sequence selected from SEQ ID NO: 74 or 82; a heavy chain CDR1 sequence selected from SEQ ID NO: 75; a heavy chain CDR2 sequence selected from SEQ ID NO: 76 or 83, and A heavy chain CDR3 sequence selected from SEQ ID NO: 77 or 84 Provided herein is an Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof, comprising:

[0037] In an alternative embodiment, the Fc-silenced anti-oxMIF antibody is a light chain CDR1 sequence selected from SEQ ID NO: 72 or 78; a light chain CDR2 sequence selected from SEQ ID NO: 73, 79, 80, or 81; a light chain CDR3 sequence selected from SEQ ID NO: 82; a heavy chain CDR1 sequence selected from SEQ ID NO: 75; a heavy chain CDR2 sequence selected from SEQ ID NO: 76 or 83, and Comprising a heavy chain CDR3 sequence selected from SEQ ID NO: 77 or 84.

[0038] In an alternative embodiment, the Fc-silenced anti-oxMIF antibody is a light chain CDR1 sequence selected from SEQ ID NO: 72 or 78; a light chain CDR2 sequence selected from SEQ ID NO: 73, 79, 80, or 81; a light chain CDR3 sequence selected from SEQ ID NO: 82; a heavy chain CDR1 sequence selected from SEQ ID NO: 75; a heavy chain CDR2 sequence selected from SEQ ID NO: 76 or 83, and The heavy chain CDR3 sequence is selected from SEQ ID NO:84.

[0039] In an alternative embodiment, the Fc-silenced anti-oxMIF antibody is a light chain CDR1 sequence selected from SEQ ID NO: 72 or 78; a light chain CDR2 sequence selected from SEQ ID NO: 73, 79, 80, or 81; a light chain CDR3 sequence selected from SEQ ID NO: 82; a heavy chain CDR1 sequence selected from SEQ ID NO: 75 or 83; a heavy chain CDR2 sequence selected from SEQ ID NO: 76 or 84, and The heavy chain CDR3 sequence is selected from SEQ ID NO:85.

[0040] According to further embodiments of the invention, the Fc-silenced anti-oxMIF antibodies described herein have an amino acid substitution at any one of positions E233, L234, L235, G236, G237, P238, I253, D265, S267, H268, N297, S298, T299, H310, E318, L328, P329, A330, P331, H435 of SEQ ID NO: 1, in particular the amino acid substitution is at positions L234 and L235, in particular positions L234, L235, H310 and H435 according to the EU numbering index, and / or have an aglycosylated Fc region.

[0041] The Fc-silenced anti-oxMIF antibodies described herein may be in any format containing CH2 and CH3 antibody domains, specifically a format selected from the group consisting of a monospecific antibody, a bispecific antibody (e.g., a crossmab), scFv-Fc, (scFv)2-Fc (two scFv fragments contained on one arm), scFv / scFv-Fc (i.e., each arm contains an scFv fragment), Fab / scFv-Fc, Fab / (scFv)2-Fc, Fab / Fab-scFv-Fc, Fab / Fab-crossFab-Fc, Fab / crossFab-Fc, IgG-scFv, and IgG-(scFv)2.

[0042] In a further embodiment, the Fc-silenced anti-oxMIF antibody described herein is a bispecific antibody further comprising at least one binding site that specifically recognizes an epitope of CD3 or histamine-succinyl-glycine (HSG). In a specific embodiment, the Fc-silenced anti-oxMIF antibody is for use in the treatment or detection of solid tumors, wherein the antibody is administered to a subject in a first step and an HSG hapten is administered in a second step, and the HSG hapten is conjugated to the antibody and labeled with a radionuclide.

[0043] Also provided herein is an Fc-silenced antibody described herein for use in the preparation of a medicament.

[0044] In further embodiments of the invention, there are also provided herein pharmaceutical compositions comprising an antibody described herein, optionally together with a pharmaceutical carrier or adjuvant.

[0045] Specifically, the composition contains 10 to 250 mg / ml, specifically more than 50 mg / ml, of an antibody of the invention.

[0046] More specifically, the pharmaceutical composition is formulated for subcutaneous administration.

[0047] As provided herein, the pharmaceutical compositions are for administration as a single entity or as a combined formulation with additional pharmaceutical compositions, preferably comprising one or more active agents selected from the group consisting of antiviral, anticancer, anti-inflammatory, and antibiotic agents.

[0048] In further embodiments, provided herein are pharmaceutical compositions for use in the treatment of patients suffering from inflammatory diseases, infectious diseases, in particular in the treatment of asthma, vasculitis, arthritis, sepsis, septic shock, endotoxic shock, toxic shock syndrome, acquired respiratory distress syndrome, glomerulonephritis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, peritonitis, nephritis, NASH (non-alcoholic steatohepatitis), multiple sclerosis, acute and chronic pancreatitis, type 1 diabetes, IgA nephropathy, interstitial cystitis, post-COVID syndrome, and psoriasis.

[0049] According to an alternative embodiment, the pharmaceutical composition is for use in the treatment of patients suffering from a hyperproliferative disorder or cancer, particularly in the treatment of colorectal cancer, ovarian cancer, breast cancer, prostate cancer, pancreatic cancer, gastric cancer, and lung cancer.

[0050] Further provided is an isolated nucleic acid encoding an antibody of the invention.

[0051] Also provided herein are expression vectors comprising the nucleic acid molecule(s) described herein.

[0052] In a further embodiment, a host cell is provided containing a nucleic acid or expression vector described herein.

[0053] Further provided is a method of producing an antibody of the invention, comprising culturing the host cells and recovering said antibody from the cell culture.

[0054] Further provided is a method for producing an antibody of the invention comprising expressing nucleic acid encoding the antibody in a host cell. [Brief explanation of the drawings]

[0055] [Figure 1-1] Chromatography profiles demonstrating the reduced aggregation and hydrophobicity of the newly designed anti-oxMIF antibodies. (A) Comparison of the elution profiles of C0008 (control antibody, gray area) and the parent antibodies (C0083 and C0090, without Fc silencing) of the newly designed antibodies C0115 and C0118 on an Enrich 650 gel filtration column using 1x PBS as the mobile phase; (B) Comparison of the elution profiles of C0008 (control antibody, gray area) and the newly designed antibodies C0115 and C0118 on an Enrich 650 gel filtration column using 1x PBS as the mobile phase. (C) Comparison of the elution profiles of C0008 (control antibody, gray area) and the newly designed antibodies C0115 and C0118 and their parent antibodies C0083 and C0090 (without Fc silencing) on ​​a HiTrap Butyl HP HIC column. [Figure 1-2] Chromatography profiles demonstrating the reduced aggregation and hydrophobicity of the newly designed anti-oxMIF antibodies. (A) Comparison of the elution profiles of C0008 (control antibody, gray area) and the parent antibodies (C0083 and C0090, without Fc silencing) of the newly designed antibodies C0115 and C0118 on an Enrich 650 gel filtration column using 1x PBS as the mobile phase; (B) Comparison of the elution profiles of C0008 (control antibody, gray area) and the newly designed antibodies C0115 and C0118 on an Enrich 650 gel filtration column using 1x PBS as the mobile phase. (C) Comparison of the elution profiles of C0008 (control antibody, gray area) and the newly designed antibodies C0115 and C0118 and their parent antibodies C0083 and C0090 (without Fc silencing) on ​​a HiTrap Butyl HP HIC column. [Figure 2]Figure 1 shows the binding curve (KD determination) of the newly designed anti-oxMIF antibody to immobilized oxMIF. The anti-oxMIF antibody was detected by anti-human IgG (Fc)-HRP conjugate, and C0008 was used as the reference antibody. EC50 values ​​were determined by a sigmoidal four-parameter equation using GraphPad Prism (mean + / - SEM of two experiments is shown). [Figure 3] Figure 1 shows the differential binding of newly designed antibodies to oxMIF compared to redMIF. C0008 was used as the reference antibody and isotype IgG as a negative control. Means + / - SEM of two or three experiments are shown. [Figure 4-1] FIG. 1 shows the strongly reduced effector function of the newly designed Fc-silenced antibodies C0115 and C0118 as determined by reporter assay. (A-B) ADCC reporter bioassay with the newly designed Fc-silenced antibodies C0115 and / or C0118 using engineered Jurkat effector cells stably expressing FcyRIIa (V: high-responder genotype, F: low-responder genotype) and HCT116-pMIF (A) or A2780-pMIF (B) target cells, compared with either the anti-oxMIF control antibody C0008 (B) or its parent anti-oxMIF antibodies C0083 and C0090 (A) with wtFc; (C) ADCP reporter bioassay with the newly designed Fc-silenced antibodies C0115 and / or C0118 using engineered Jurkat effector cells stably expressing FcyRIIa and HCT116-pMIF target cells, compared with their parent antibodies C0083 and C0090 with wtFc. Data were fit to a sigmoidal four-parameter equation using GraphPad Prism (means + / - SD of two replicates are shown). [Figure 4-2]FIG. 1 shows the strongly reduced effector function of the newly designed Fc-silenced antibodies C0115 and C0118 as determined by reporter assay. (A-B) ADCC reporter bioassay with the newly designed Fc-silenced antibodies C0115 and / or C0118 using engineered Jurkat effector cells stably expressing FcyRIIa (V: high-responder genotype, F: low-responder genotype) and HCT116-pMIF (A) or A2780-pMIF (B) target cells, compared with either the anti-oxMIF control antibody C0008 (B) or its parent anti-oxMIF antibodies C0083 and C0090 (A) with wtFc; (C) ADCP reporter bioassay with the newly designed Fc-silenced antibodies C0115 and / or C0118 using engineered Jurkat effector cells stably expressing FcyRIIa and HCT116-pMIF target cells, compared with their parent antibodies C0083 and C0090 with wtFc. Data were fit to a sigmoidal four-parameter equation using GraphPad Prism (means + / - SD of two replicates are shown). [Figure 5] Figure 1 shows the strongly reduced CDC activity of the newly designed Fc-silenced antibody C0115, as determined by complement-dependent cytotoxicity bioassay. CDC bioassays with the newly designed Fc-silenced antibody C0115, using BRC as a source of complement and HCT116-HiBiT-pMIF as target cells, were compared with its parent anti-oxMIF antibody C0083 with wtFc and nivolumab as an IgG4 negative control. Data (where appropriate) were fit to a sigmoidal four-parameter equation using GraphPad Prism (mean + / - SD of two replicates is shown). [Figure 6-1]Figure 1 shows the strongly reduced ADCC activity of the newly designed Fc-silenced antibodies C0115 and C0118, as determined by a PBMC-mediated cytotoxicity bioassay. ADCC bioassays with the newly designed Fc-silenced antibodies C0115 (A) and C0118 (B) using PBMCs as effector cells and HCT116-HiBiT-pMIF as target cells were compared with the anti-oxMIF control antibody C0008 or the parent anti-oxMIF antibody C0115 (C0083) with wtFc. The mean and SEM of two replicates using PBMCs from two healthy donors are shown. Data were fit to a sigmoidal four-parameter equation using GraphPad Prism. [Figure 6-2] Figure 1 shows the strongly reduced ADCC activity of the newly designed Fc-silenced antibodies C0115 and C0118, as determined by a PBMC-mediated cytotoxicity bioassay. ADCC bioassays with the newly designed Fc-silenced antibodies C0115 (A) and C0118 (B) using PBMCs as effector cells and HCT116-HiBiT-pMIF as target cells were compared with the anti-oxMIF control antibody C0008 or the parent anti-oxMIF antibody C0115 (C0083) with wtFc. The mean and SEM of two replicates using PBMCs from two healthy donors are shown. Data were fit to a sigmoidal four-parameter equation using GraphPad Prism. [Figure 7] Figure 1 shows reduced non-specific binding of newly designed anti-oxMIF antibodies to A2780 MIF- / - cells as determined by FACS. Staining of A2780 MIF- / - cells with newly designed anti-oxMIF antibodies C0118 and its parental antibody C0090 (A) and C0115 and its parental antibody C0083 (B) and control antibody C0008 and isotype IgG as a negative control; GeoMean (mean fluorescence intensity of AF488) of viable cells is plotted against antibody concentration. [Figure 8]This figure shows that the newly designed Fc-silenced anti-oxMIF antibody C0115 exhibits strongly reduced cytokine release from human PBMCs compared to the reference antibody C0008. Anti-oxMIF antibody C0115 with Fc-silencing mutations and the reference antibody C0008 were incubated with human PBMCs overnight, and the supernatants were analyzed for human MCP-1 (A), human IL-6 (B), and human TNF-α (C) using a LegendPlex cytometric bead assay (BioLegend). Cytokine concentrations (units: pg / ml) from three different PBMC donors are shown, with the mean + / - SEM. [Figure 9] Infrared in vivo imaging of subcutaneous HCT116 tumor-bearing mice demonstrates tumor penetration and retention of the newly designed Fc-silenced anti-oxMIF antibody C0115 and reference antibody C0008. (A) Infrared images of mice were taken 1, 6, 24, 48, 72, 96, and 168 hours after injection of IRDye 800CW-labeled antibodies C0115 (upper panel) and C0008 (lower panel) administered at 5 mg / kg; (B) Tumor penetration and retention of C0115 and C0008 quantified by digital image analysis. Averages from three mice are shown. [Figure 10] This figure shows that the newly designed Fc-silenced anti-oxMIF antibody C0115 ameliorates disease severity in a collagen II-induced DBA / 1j mouse arthritis model. Cumulative disease score (A) and paw thickness (B) were assessed in a mouse arthritis model upon treatment with C0115 (20 mg / ml), high-dose dexamethasone (0.3 mg / kg) as a standard-of-care corticosteroid, or vehicle. Mean ± SEM is shown. Statistical analysis was performed using ordinary one-way ANOVA followed by Fisher's LSD test in GraphPad Prism V9.4 (*p<0.05; **p<0.01; ***p<0.001). [Figure 11-1]This figure shows that the newly designed Fc-silenced anti-oxMIF antibody C0115 ameliorates disease severity in a nephrotoxic serum (NTS)-induced rat glomerulonephritis model. Hematuria (dipstick test) (A), proteinuria (B), and glomerular macrophage infiltration were assessed in a rat glomerulonephritis model upon treatment of diseased rats with anti-oxMIF antibody C0115, isotype control IgG1, or vehicle. Mean ± SEM is shown, and statistical analysis was performed using ordinary one-way ANOVA followed by Dunnett's correction for multiple testing in GraphPad Prism V9.4 (*p<0.05, ***p<0.001, ****p<0.0001). [Figure 11-2] This figure shows that the newly designed Fc-silenced anti-oxMIF antibody C0115 ameliorates disease severity in a nephrotoxic serum (NTS)-induced rat glomerulonephritis model. Hematuria (dipstick test) (A), proteinuria (B), and glomerular macrophage infiltration were assessed in a rat glomerulonephritis model upon treatment of diseased rats with anti-oxMIF antibody C0115, isotype control IgG1, or vehicle. Mean ± SEM is shown, and statistical analysis was performed using ordinary one-way ANOVA followed by Dunnett's correction for multiple testing in GraphPad Prism V9.4 (*p<0.05, ***p<0.001, ****p<0.0001). [Figure 12] FIG. 1 is a schematic diagram of the newly designed Fc-silenced anti-oxMIF×anti-HSG bispecific antibodies (bsMabs), C0132 (Fab / scFv-Fc) and C0133 (Fab / Fab-scFv-Fc). [Figure 13] Figure 1 shows the binding curves of newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 to immobilized oxMIF. Bound antibodies were detected with an anti-human IgG(Fc)-HRP conjugate, and C0008 was used as a reference antibody for bivalent binding to oxMIF. Data were fit to a sigmoidal four-parameter equation using GraphPad Prism (mean + / - SEM of two replicates is shown). [Figure 14] Figure 1 shows differential binding of newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 to oxMIF compared to redMIF. C0008 was used as the reference anti-oxMIF antibody. Means and SEM of three replicates are shown. [Figure 15] Figure 1 shows tumor penetration and retention of newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 as assessed by infrared in vivo imaging in mice bearing subcutaneous syngeneic CT26 tumors. Infra-red images of mice were taken at 1, 8, 24, 48, 72, 96, and 168 hours after injection of IRDye 800CW-labeled antibody administered at 5 mg / kg. [Figure 16-1] (A) Structure of HSG hapten IMP288. (B) Binding of bsMabs C0132 and C0133 to the 177Lu-IMP288 peptide, assessed by iTLC based on the change in the migration profile of 177Lu-IMP288 upon incubation with bsMabs, compared to the migration profile of the 177Lu-IMP288 peptide alone. [Figure 16-2] (A) Structure of HSG hapten IMP288. (B) Binding of bsMabs C0132 and C0133 to the 177Lu-IMP288 peptide, assessed by iTLC based on the change in the migration profile of 177Lu-IMP288 upon incubation with bsMabs, compared to the migration profile of the 177Lu-IMP288 peptide alone. [Figure 17-1]This figure shows the catabolism of syngeneic CT26 mouse colorectal carcinoma in Balb / c mice using the Fc-silenced anti-oxMIF × anti-HSG bsMab C0132. C0132 was administered on day -3, followed by 177Lu-IMP288 3 days later (day 0). (A) Tumor volume (unit: %) relative to tumor volume measured on day 0; mean ± SEM is shown (n = 10 maximum). Statistical analysis was performed in GraphPad Prism V9.4 using conventional one-way ANOVA with Dunnett's correction for multiple testing; **p < 0.01 vs. 177Lu-IMP288. (B) Kaplan-Meier survival curve (unit: percent survival). (C) Body weight (unit: %) relative to body weight measured on day 0. [Figure 17-2] This figure shows the catabolism of syngeneic CT26 mouse colorectal carcinoma in Balb / c mice using the Fc-silenced anti-oxMIF × anti-HSG bsMab C0132. C0132 was administered on day -3, followed by 177Lu-IMP288 3 days later (day 0). (A) Tumor volume (unit: %) relative to tumor volume measured on day 0; mean ± SEM is shown (n = 10 maximum). Statistical analysis was performed in GraphPad Prism V9.4 using conventional one-way ANOVA with Dunnett's correction for multiple testing; **p < 0.01 vs. 177Lu-IMP288. (B) Kaplan-Meier survival curve (unit: percent survival). (C) Body weight (unit: %) relative to body weight measured on day 0. [Figure 18] Figure 1 shows the PRAIT of syngeneic CT26 murine colorectal carcinoma in Balb / c mice using the Fc-silenced anti-oxMIF × anti-HSG bsMab C0133. C0133 was administered on day -3, followed by 177Lu-IMP288 3 days later (day 0). The figure shows tumor volume (units: %) relative to the tumor volume measured on day 0. Mean ± SEM is shown (n = 10 maximum). Statistical analysis was performed in GraphPad Prism V9.4 using conventional one-way ANOVA with Dunnett's correction for multiple testing; ***p < 0.001 vs. 177Lu-IMP288. [Figure 19]Figure 1 shows the efficacy of the anti-oxMIF × anti-HSG bsMab C0132 using the PRAIT approach in Balb / c mice syngeneically implanted with CT26 murine colorectal carcinoma cells. C0132 was administered at 2.5 mg / ml and 5 mg / ml on day -5, followed by 177Lu-IMP288 5 days later (day 0); mean ± SEM is shown (n = 10 maximum). Statistical analysis was performed in GraphPad Prism V9.4 using standard one-way ANOVA with Dunnett's correction for multiple testing; ***p < 0.001 vs. 177Lu-IMP288. (A) Tumor volume (unit: %) relative to tumor volume measured on day 0. (B) Kaplan-Meier survival curve (unit: percent survival (%)). [Figure 20] Figure 1 shows the efficacy of the anti-oxMIF x anti-HSG bsMab C0132 using the PRAIT approach in Balb / c nude mice xenografted with CFPAC-1 pancreatic adenocarcinoma cells. C0132 was administered at 5 mg / ml on day -5, followed by 177Lu-IMP288 5 days later (day 0). Tumor volume (unit: %) relative to tumor volume measured on day 0; mean ± SEM is shown (n = 10 maximum). Statistical analysis was performed in GraphPad Prism V9.4 using conventional one-way ANOVA with Dunnett's correction for multiple testing; **p < 0.01 vs. vehicle. [Figure 21] Figure 1 shows that the newly designed Fc-silenced anti-oxMIF antibody C0115, as a single agent or in combination with GC, ameliorates disease severity in collagen II-induced arthritis in DBA / 1j mice. Cumulative disease scores were assessed in a mouse arthritis model following treatment with C0115 (20 mg / kg) alone or in combination with a low dose of 0.1 mg / kg dexamethasone ("Dexa"), treatment with low (0.1 mg / kg) and high (0.3 mg / kg) doses of dexamethasone ("Dexa") as a standard-of-care corticosteroid, or treatment with vehicle control. Statistical analysis was performed using a standard one-way ANOVA followed by Fisher's LSD test in GraphPad Prism V9.4 (*p<0.05; **p<0.01). [Figure 22] Figure 1 shows that the newly designed Fc-silenced anti-oxMIF antibody C0115, both as a single agent and in combination with GC, ameliorates disease severity in a T cell-transferred mouse model of colitis. Body weight change (A) and cumulative stool score (B) at the end of the experiment, day 83, were assessed following treatment with C0115 (10 mg / kg; alone or in combination with a low dose of 0.01 mg / kg dexamethasone (“Dexa”)), treatment with low (0.01 mg / kg) and high (0.1 mg / kg) doses of dexamethasone (“Dexa”) as a standard-of-care corticosteroid, or vehicle control treatment. Statistical analysis was performed using a standard one-way ANOVA followed by Fisher's LSD test in GraphPad Prism V9.4 (*p<0.05; **p<0.01). DETAILED DESCRIPTION OF THE INVENTION

[0056] Unless otherwise specified or defined, all terms used herein have their ordinary meaning in the art and will be apparent to those skilled in the art. For example, see standard handbooks, such as Sambrook et al., "Molecular Cloning: A Laboratory Manual" (4th Ed.), Vols. 1-3, Cold Spring Harbor Laboratory Press (2012); Krebs et al., "Lewin's Genes Xi", Jones & Bartlett Learning, (2017), and Murphy & Weaver, "Janeway's Immunobiology" (9th Ed., or later edition), Taylor & Francis Inc., 2017.

[0057] The claimed subject matter specifically relates to artificial products or methods of using or producing such artificial products, which may be variants of naturally occurring (wild-type) products. While there may be some sequence identity to naturally occurring structures, it is well understood that the materials, methods, and uses of the invention, including, specifically, the isolated nucleic acid sequences, amino acid sequences, fusion constructs, expression constructs, transformed host cells, and engineered proteins, are "artificial" or synthetic and therefore cannot be considered the result of the "laws of nature."

[0058] The terms "comprise," "contain," "have," and "include," as used herein, can be used interchangeably and should be understood as broad definitions, allowing for additional members, parts, or elements. "Consisting of" is interpreted as the most closed definition, with no additional elements of the defining characteristic it comprises. Thus, "comprising" is broader and includes the definition of "consisting of."

[0059] The term "about" as used herein refers to the same value or a value that differs by + / - 5% from a given value.

[0060] As used in this specification and claims, the singular forms "a," "an," and "the" include plural forms unless the context clearly dictates otherwise.

[0061] As used herein, amino acid refers to the 20 naturally occurring amino acids coded for by 61 triplet codons. These 20 amino acids can be divided into neutrally charged, positively charged, and negatively charged amino acids:

[0062] The "neutral" amino acids, along with their respective three-letter and one-letter codes and polarities, are listed below: alanine (Ala, A; non-polar, neutral), asparagine (Asn, N; polar, neutral), cysteine ​​(Cys, C; non-polar, neutral), glutamine (Gln, Q; polar, neutral), glycine (Gly, G; non-polar, neutral), isoleucine (Ile, I; non-polar, neutral), leucine (Leu, L; non-polar, neutral), methionine (Met, Ile ... The amino acids are: methyl (Met, M; nonpolar, neutral), phenylalanine (Phe, F; nonpolar, neutral), proline (Pro, P; nonpolar, neutral), serine (Ser, S; polar, neutral), threonine (Thr, T; polar, neutral), tryptophan (Trp, W; nonpolar, neutral), tyrosine (Tyr, Y; polar, neutral), valine (Val, V; nonpolar, neutral), and histidine (His, H; polar, positive (10%) and neutral (90%).

[0063] The "positively" charged amino acids are: arginine (Arg, R; polar, positive), and lysine (Lys, K; polar, positive).

[0064] The "negatively" charged amino acids are: aspartic acid (Asp, D; polar, negative), and glutamic acid (Glu, E; polar, negative).

[0065] The antibodies or antigen-binding fragments of the present invention comprise at least one binding site that specifically recognizes oxMIF and, due to targeted amino acid substitutions in the variable heavy and light chain domains, exhibit reduced aggregation tendency and reduced hydrophobicity compared to unmodified antibodies lacking the amino acid substitutions.

[0066] The reduced aggregation ability is due to amino acid substitutions at selected positions within the variable domains of the antibodies described herein.

[0067] The level of antibody aggregation can be measured using a variety of known techniques, including mass spectrometry, size exclusion chromatography (SEC), hydrophobic interaction chromatography (HIC), dynamic light scattering (DLS), light obscuration (LO), dynamic image particle analysis (DIPA) techniques such as microflow imaging (MFI), and Coulter Counter (CC), differential scanning fluorimetry (DSF).

[0068] As used herein, reduced hydrophobicity and reduced aggregation potential refer to the reduced surface hydrophobicity and reduced aggregation potential of the newly designed antibody compared to a reference antibody, such as antibody C0008, comprising SEQ ID NOs: 44, 2, and 3, as disclosed herein. The sequence of C0008 contains the sequence of imalumab published in Proposed INN List 111 (WHO Drug Information, Vol. 28, No. 2, 2014), but lacks the C-terminal lysine. Measurements can be performed using various known techniques, including, but not limited to, hydrophobic interaction chromatography (HIC) or affinity capture self-interacting nanoparticle spectroscopy (AC-SINS, Estep P. et al., 2015).

[0069] In one embodiment, the oxMIF antibody of the present invention with reduced aggregation potential and reduced hydrophobicity is in combination with a light chain variable domain having one or more amino acid substitutions, in particular at positions M30, F49, A51, P80, W93 according to the Kabat numbering, in particular M30L, F49Y, A51G, P80S, W93F, or a heavy chain variable domain comprising SEQ ID NO: 3, or in combination with a heavy chain variable domain comprising an amino acid substitution at position L5 or W97 according to the Kabat numbering, in particular L5Q or W97Y. or a heavy chain variable domain comprising SEQ ID NO:3 with 1, 2, 3, 4 or 5 amino acid substitutions further comprising one or both of an amino acid substitution at position L5 or W97, specifically L5Q or W97Y.

[0070] In alternative embodiments, the light chain variable domain comprising SEQ ID NO:2 has one, two, three, four or five amino acid substitutions, provided that the tyrosine at position 36 is conserved and at least one of the amino acids is substituted with M30, F49, A51, P80 or W93.

[0071] According to a particular embodiment, the amino acid W93 is substituted by F, Y or H.

[0072] In a further embodiment, the anti-oxMIF antibody of the present invention with reduced aggregation ability and reduced hydrophobicity comprises a heavy chain variable domain comprising, in particular, SEQ ID NO: 3 and an amino acid substitution at position W97, in particular W97Y, an amino acid substitution at L5, in particular L5Q, or amino acid substitutions L5Q and W97Y, or a heavy chain variable domain comprising SEQ ID NO: 3 with 1, 2, 3, 4 or 5 amino acid substitutions, optionally further comprising the amino acid substitution W97Y, in combination with L5Q.

[0073] According to a particular embodiment, the amino acid W97 is substituted by F, Y or H.

[0074] In alternative embodiments, the heavy chain variable domain comprising SEQ ID NO:3 has one, two, three, four, five amino acid substitutions, and furthermore at least one of the amino acids is substituted at positions L5 and W93.

[0075] In a preferred embodiment, the anti-oxMIF antibodies of the invention with reduced aggregation potential and reduced hydrophobicity comprise amino acid substitutions specifically at positions W93 and W97.

[0076] The tyrosine at position 36 of the light chain is specifically left unmodified to preserve the binding properties of the antibodies described herein. Any modification at this amino acid position may result in unwanted, impaired binding properties.

[0077] Specifically, the variable light chain domain comprises SEQ ID NO:5 and the variable heavy chain domain comprises any one or more of SEQ ID NOs:3, 4, 9, or 43.

[0078] Specifically, the variable light chain domain comprises SEQ ID NO:6 and the variable heavy chain domain is any one or more of SEQ ID NOs:3, 4, 9, or 43.

[0079] Specifically, the variable light chain domain comprises SEQ ID NO:7 and the variable heavy chain domain is any one or more of SEQ ID NOs:3, 4, 9, or 43.

[0080] Specifically, the variable light chain domain comprises SEQ ID NO:8 and the variable heavy chain domain is any one or more of SEQ ID NOs:3, 4, 9, or 43.

[0081] In a further embodiment, the anti-oxMIF antibody comprises SEQ ID NOs: 14 and 18 in combination with any one of the variable light and heavy chain domains listed above.

[0082] Fcγ receptors (FcγRs) are a well-described family of proteins that include membrane-bound surface receptors, atypical intracellular receptors, and cytoplasmic glycoproteins. FcγRs regulate humoral and innate immunity and are essential for the appropriate response to infection and the prevention of chronic inflammatory or autoimmune diseases. Examples of membrane-bound receptors are FcγRIIa, FcyRIIb, FcyRIIIa, and FcyRIa receptors. Antibodies can regulate immune responses through interaction with FcγRs. In innate immune effector cells, activating and inhibitory FcγRs set the threshold for cell activation by immune complexes. Important examples of effector responses regulated by FcγRs are phagocytosis, ADCC, and the release of inflammatory mediators. In dendritic cells (DCs), the expression of paired FcγRs controls cell maturation and antigen presentation, thereby indirectly regulating cellular immune responses. In B cells, inhibitory FcγRIIB is essential for maintaining humoral tolerance. It acts as a late checkpoint at the level of class-switched memory B cells, plasmablasts, or plasma cells. Furthermore, FcγRIIB plays an important role in regulating plasma cell homeostasis and survival. Antibody-FcγR interactions are influenced by several factors that affect the expression levels of activating and inhibitory FcγRs (e.g., cytokines) or alter the affinity of antibody-FcγR interactions (e.g., differential antibody glycosylation). Depending on the specific glycosylation pattern, IgG molecules can have pro- or anti-inflammatory activities. Importantly, the glycosylation of antibodies is regulated during the immune response.

[0083] Atypical FcγRs are the neonatal Fc receptor (FcRn) and cytoplasmic glycoproteins, such as the complement factor C1q protein. FcRn is expressed by endothelial cells and internalizes serum components, including soluble IgG, from the bloodstream by pinocytosis. IgG binding to FcRn is pH-dependent; the acidic pH (pH 6.0) within endosomal compartments allows IgG to bind to FcRn. After recycling to the cell surface, IgG dissociates from FcRn at physiological pH (approximately pH 7.2) and is released back into the circulation, thereby protecting it from lysosomal degradation and extending its half-life. Thus, FcRn functions as a transcytotic recycling receptor responsible for maintaining IgG and albumin in the circulation. Modifications of the Fc region that result in an Fc with reduced or silenced FcRn binding are known in the art and are described, for example, in Kenanova V. et al., 2005 and Pyzik M. et al. 2019.

[0084] As used herein, "effector function" refers to a biochemical event that results from the interaction of an antibody Fc region with an Fc receptor or ligand. Effector functions include, but are not limited to, ADCC, ADCP, and CDC.

[0085] As used herein, "effector cells" refer to cells of the immune system that express one or more Fc receptors and mediate one or more effector functions. Effector cells include, but are not limited to, monocytes, macrophages, neutrophils, dendritic cells, eosinophils, mast cells, platelets, B cells, large granular lymphocytes, Langerhans cells, natural killer (NK) cells, and T cells, and can be derived from any organism, including, but not limited to, humans, mice, rats, rabbits, and monkeys. According to the present invention, the anti-oxMIF antibodies described herein have silenced effector functions due to amino acid substitutions at selected positions in the heavy chain constant region, specifically the Fc region. The reduced or silenced effector functions of these antibodies due to reduced complement and FcγR-mediated activity can include reduced or eliminated complement-dependent cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC), and / or antibody-dependent cellular phagocytosis (ADCP).

[0086] The term "Fc" or "Fc region" (or fragment crystallizable region), as used herein, refers to a polypeptide comprising the constant region of an antibody excluding the first constant region immunoglobulin domain (CH1 domain), and in some cases, a portion of the hinge. The Fc region refers to the C-terminal region of an antibody. The Fc region is composed of two identical protein fragments derived from the second and third constant domains of the two heavy chains of an antibody: the A chain and the B chain. The second and third constant domains are known as the CH2 domain and CH3 domain, respectively. The CH2 domain contains the CH2 domain sequence of the A chain and the CH2 domain sequence of the B chain. The CH3 domain contains the CH3 domain sequence of the A chain and the CH3 domain sequence of the B chain. As used herein, the Fc region includes the hinge region or a portion thereof.

[0087] The "CH2 domain" of a human IgG Fc region sequence typically extends from about amino acid 231 to about amino acid 340 according to the EU numbering index. The CH2 domain sequence is unique and does not strictly match with another domain sequence. Rather, two N-linked branched carbohydrate chains are sandwiched between the two CH2 domain sequences of an intact, native IgG molecule.

[0088] The "CH3 domain" comprises the stretch of the CH2 domain sequence from the C-terminal residue in the Fc region sequence (ie, from about amino acid residue 341 to about amino acid residue 447 of IgG according to the EU numbering index).

[0089] A "functional Fc region" possesses the "effector functions" and FcRn binding of a native Fc region. Exemplary "effector functions" include C1q binding; complement-dependent cytotoxicity; Fc receptor binding; antibody-dependent cellular cytotoxicity (ADCC); and the like. Such effector functions typically require the Fc region to be associated with a binding domain (e.g., an antibody variable domain) and can be assessed using various assays known in the art and disclosed herein.

[0090] A "native Fc region" comprises an amino acid sequence identical to that of an Fc region found in nature. Native-sequence human Fc regions include native-sequence human IgG1 Fc regions (non-A and A allotypes); native-sequence human IgG2 Fc regions; and native-sequence human IgG3 Fc regions, as well as naturally occurring variants thereof.

[0091] A "variant Fc region" comprises an amino acid sequence that differs from that of a native Fc region sequence by "one or more amino acid substitutions." The variant Fc region sequence has at least one amino acid substitution compared to the native Fc region sequence or the Fc region sequence of the parent polypeptide, e.g., from about 1 to about 20 amino acid substitutions, and preferably from about 1 to about 17 amino acid substitutions, in the native Fc region sequence or the Fc region sequence of the parent polypeptide. In certain embodiments, the variant Fc region sequences herein are at least about 80% identical to the native Fc region sequence and / or the Fc region sequence of the parent polypeptide, most preferably at least about 90% identical thereto, and more preferably at least about 95% identical thereto.

[0092] In a particular embodiment, the amino acid substitution is at any one of positions E233, L234, L235, G236, I253, G237, P238, D265, S267, H268, N297, S298, T299, H310, E318, L328, P329, A330, P331 and H435 relative to IgG1 according to the EU numbering index.

[0093] Modifications of the Fc region that result in reduced or silenced Fc with respect to effector function are known in the art and are described in Saunders K., 2019 and Liu R. et al., 2020.

[0094] In an alternative embodiment, the amino acid substitutions are at any one or all of the following positions: L234F, H268Q, K274Q, Y296F, A327G, A330S, P331S in the CH2 domain and R355Q, K409R, Q419E, P445L in the CH3 domain.

[0095] Specifically, the Fc-silenced anti-oxMIF antibodies described herein contain one or more of the following combinations of amino acid substitutions or deletions, resulting in an aglycosylated antibody: i) L235, G237 and E318, specifically L235A, G237A and E318A; ii) L234, L235, specifically L234A, L235A; iii) S228, L235, specifically S228P, L235E; iv) G236, L328, specifically G236R, L328R; v) S298, T299, specifically S298G, T299A; vi) L234, L235, P331, specifically L234F, L235E, P331S; vii) H268, V309, A330, P331, specifically H268Q, V309L, A330S, P331S; viii) E233, L234, L235, G236, S267, specifically E233P, L234V, L235A, G236del, S267K; ix) L234, L235, P329, specifically L234A, L235A, P329G; x) V234, G237, P238, H268, A330, P331, specifically V234A, G237A, P238S, H268A, A330S, P331S; xi) L234, L235, D265, specifically L234F, L235E, D265A; xii) D265, specifically D265A; xiii) G237, specifically G237A; xiv) E318, specifically E318A; xv) E233, specifically E233P; xvi) G236, L328, specifically G236R, L328R; xvii) L235, specifically L235E; xviii) L234, L235, P331, specifically L234Q, L235F, P331S; xix) L234, L235, G237, P238, H268, A330, P331, specifically L234A, L235A, G237A, P238S, H268A, A330S, P331S xx) N297, specifically N297A, N297Q or N297G.

[0096] Glycosylation, O- and N-glycosylation, is a post-translational modification of Abs and can be regulated by a range of B cell stimuli, including environmental factors such as stress or disease, cytokine activity, and innate immune signaling receptors, such as Toll-like receptors. The glycosylation pattern of the parent antibody can be modified by methods well known in the art. Specifically, O-linked glycosylation sites are located in the CH2 and hinge regions.

[0097] In a further embodiment, the amino acid substitutions are at any one or all of positions 1253 and H310 in the CH2 domain and H435 in the CH3 domain.

[0098] Specifically, the Fc-silenced anti-oxMIF antibodies described herein contain one or more of the following combinations of amino acid substitutions: i) I253A ii) H310A iii) H435, specifically H435A, H345Q or H435R iv) I253A and H310A v) I253A, H310A and one of H435Q, H435A, and H435R vi) Contains H310A and one of H435Q, H435A, and H435R.

[0099] The silencing and further mutations in the CH domain described herein can, however, also be introduced into the Fc of wild-type IgG2, IgG3 or IgG4 at the corresponding positions according to the EU numbering index.

[0100] The term "aglycosylated" indicates that the Fc region is not glycosylated. All human constant regions of the IgG isotype are known to be glycosylated at the asparagine residue at position 297, forming part of an N-glycosylation motif, asparagine 297-X298-serine 299 or threonine 299, where X is any amino acid residue except proline. The glycan has a heptasaccharide core and variable extensions, e.g., fucose, galactose, and / or sialic acid. Antibodies of the present invention can therefore be aglycosylated by substitution of asparagine 297 in such constant regions with another amino acid that is not glycosylated or deglycosylated by enzymatic means. Any other amino acid residue can be used, but alanine is most preferred. Alternatively, glycosylation at asparagine 297 can be prevented by altering one of the other residues in the motif, e.g., by substituting residue 298 with proline or residue 299 with any amino acid other than serine or threonine. Techniques for performing this site-directed mutagenesis are well known to those skilled in the art and can be performed, for example, using commercially available site-directed mutagenesis kits.

[0101] The term "silenced Fc" refers to an antibody Fc region whose effector function and / or FcRn binding is reduced or eliminated by amino acid substitutions or altered glycosylation patterns resulting in modified glycans that reduce or eliminate binding of the antibody to any FcγR, e.g., FcγRIIaH, FcγRIIaR, FcyRIIb, FcyRIIIaF, FcyRIIIaV, and FcyRIa and / or FcRn receptors, and complement factor C1q protein. Such reduction or elimination of effector function and / or FcRn binding resulting in reduced or eliminated binding is typically mediated by wild-type IgG Fc regions.

[0102] The term "Fc null" may be used herein when FcγR binding, such as any one of FcγRIIa, FcyRII, FcyRIIIa and FcyRIa and / or FcRn receptors and complement factor C1q protein, is completely abolished.

[0103] Most Fc silencing can be achieved by combining mutations. L234 and L235, residues located near the hinge region, reduce FcyR binding when substituted with alanine. For example, the combination of L234A and L235A with P329G can result in nearly complete inhibition of FcyR interaction for all FcyR isoforms.

[0104] An Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof having greatly reduced, silenced, negligible, or eliminated FcyR and C1q binding affinities has reduced FcyR and C1q binding activity compared to the parent polypeptide or a polypeptide comprising a native Fc region sequence. In some embodiments, an Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof having greatly reduced, silenced, negligible, or eliminated FcR and C1q binding affinities also has greatly reduced, silenced, negligible, or eliminated ADCC, ADCP, and CDC activity compared to the parent polypeptide or a polypeptide comprising a native Fc region sequence. An Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof that exhibits reduced or undetectable binding to FcyRs may bind to all FcyRs with lower affinity than the parent polypeptide. Such variants that exhibit reduced binding to FcyRs may have little or no appreciable binding to FcyRs. In a specific embodiment, the variant exhibits 0-20% binding to FcyR compared to a native IgG Fc region, e.g., as measured by a change in equilibrium multiplier. In one embodiment, the variant exhibits 0-10% binding to FcyR compared to a native IgG Fc region. In one embodiment, the variant exhibits 0-5% binding to FcyR compared to a native IgG Fc region. In one embodiment, the variant exhibits 0-1% binding to FcyR compared to a native IgG Fc region.

[0105] Antibodies described herein that have silenced complement activity can be determined by cell-based CDC assays and, i.e., reduced or abolished binding to C1q as determined by SPR or ELISA.

[0106] The reduced or silenced CDC activity is determined to be downregulated by at least 1.5-fold, particularly at least 2-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, and more particularly at least 10-fold compared to a reference, i.e., unmodified, wild-type antibody, e.g., C0008. The reduced ADCC or ADCP activity was determined to be at least 2-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or more specifically, at least 10-fold reduced compared to a reference antibody, i.e., an unmodified, wild-type antibody, such as C0008.

[0107] In certain embodiments, the Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof exhibits reduced binding to FcRn due to amino acid substitutions at selected positions in the heavy chain constant region. The reduced binding of the Fc-silenced anti-oxMIF antibody of the present invention to FcRn results in a reduced half-life in the circulation and faster in vivo clearance. FcRn binding and in vivo clearance / half-life determinations can also be performed using methods known in the art (see, e.g., Petkova, SB, et al., 2006).

[0108] The Fc domain of an Fc-silenced anti-oxMIF antibody, or an antigen-binding fragment thereof, that exhibits reduced FcRn binding compared to an anti-oxMIF antibody, or an antigen-binding fragment thereof, comprising a wild-type IgG Fc region may preferably comprise an Fc domain comprising one, two, or three amino acid substitutions at any one of positions I253, H310, and H435.

[0109] Decreased FcRn binding (i.e., affinity) is determined to be at least a 2-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or more specifically, at least a 10-fold decrease in binding (i.e., affinity) compared to a reference antibody, i.e., an unmodified, wild-type antibody, e.g., C0008.

[0110] In a further embodiment, even greater Fc silencing may be achieved by combining mutations at amino acid positions L234, L235, H310, and H435. These residues are located in the Fc region and may result in near complete inhibition of FcyR interaction.

[0111] Specifically, the Fc-silenced anti-oxMIF antibody comprises any one or more of the CDRs listed in Table 1A as defined according to Kabat, IMGT and MacCallum RM et al., 1996 (CONTACT).

[0112] [Table 1]

[0113] oxMIF binding specificity can be determined by any assay suitable for determining selective binding to oxMIF, for example, any competitive assay against a control antibody, such as imalumab, for binding to oxMIF, or various assays known in the art and disclosed herein.

[0114] The term "antibody" herein is used in the broadest sense and includes polypeptides or proteins consisting of or comprising antibody domains, understood as constant and / or variable domains of immunoglobulin heavy and / or light chains, with or without linker sequences. The term encompasses various antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies such as bispecific antibodies and trispecific antibodies, and antibody fragments that bind to oxMIF, so long as they exhibit the desired antigen-binding activity. The term also encompasses fusion proteins, such as fusions with immunotoxins, or antibody conjugates, such as antibody-drug conjugates that bind to oxMIF.

[0115] Antibody domains may be native structures or modified by mutagenesis or derivatization to, for example, modify antigen binding properties or any other properties, such as stability or functional properties, for example, binding to an Fc receptor, such as FcRn and / or Fc gamma receptor. A polypeptide sequence is considered to be an antibody domain if it comprises a beta-barrel structure consisting of at least two beta strands of the antibody domain structure connected by a loop sequence.

[0116] The term "antibody" will be understood to encompass antigen-binding derivatives, variants, and fragments thereof. Derivatives or variants are any combination of one or more antibody domains or antibodies of the invention and / or fusion proteins in which any domain of an antibody of the invention may be fused at any position to one or more other binding proteins, such as other antibodies or antibody formats, e.g., CDR loops, receptor polypeptides, as well as binding structures including ligands, scaffold proteins, enzymes, labels, toxins, etc.

[0117] The term "antibody" specifically refers to a polypeptide or protein that exhibits binding properties for the target antigen oxMIF.

[0118] The terms "antibody fragment, antigen-binding fragment, antigen-binding variant, or antibody variant" can be used interchangeably and refer to molecules other than intact antibodies that contain an antigen-binding portion of an intact antibody that binds to the antigen to which the intact antibody binds, as well as multispecific antibodies formed from antibody fragments or variants and further comprising a variant Fc region as described herein. Examples of antigen-binding portions include, but are not limited to, Fv, Fab, Fab', Fab'-SH, single-chain antibody molecules (e.g., scFv), diabodies, cross-Fab fragments, and linear antibodies. According to the present invention, the antibody fragment or variant is fused to a silenced Fc portion or silenced Fc domain via a hinge region and / or linker (e.g., (scFv)-Fc, (scFv)2-Fc, scFv / scFv-Fc, Fab / scFv-Fc, Fab / (scFv)2-Fc, Fab / Fab-scFv-Fc, Fab / Fab-crossFab-Fc, IgG-scFv, and IgG-(scFv)2).

[0119] Furthermore, antibody fragments have the characteristics of a VH domain, i.e., V L Domains can be aggregated together or V L The antibody fragments referred to herein include single-chain polypeptides having the characteristics of a VH domain, i.e., capable of assembling together with a VH domain into a functional antigen-binding site, thereby providing the antigen-binding properties of a full-length antibody. The antibody fragments referred to herein also include silenced Fc domains that contain one or more structural loop regions that contain an antigen-binding region, e.g., an Fcab™, or a full-length antibody format having an IgG structure in which the silenced Fc region is replaced by an Fcab™ containing a second, different antigen-binding site.

[0120] As used herein, "Fab fragment or Fab" refers to an antibody fragment comprising a light chain fragment containing the VL domain and constant domain of the light chain (CL), and a VH domain and first constant domain (CH1) of the heavy chain. The antibody of the present invention can comprise at least one Fab fragment, in which either the variable or constant regions of the heavy and light chains are exchanged. Due to the exchange of either the variable or constant regions, the Fab fragment is also referred to as a "cross-Fab fragment" or "crossover Fab fragment." Two different chain compositions of crossover Fab molecules are possible and included in the antibodies of the present invention: the variable regions of the Fab heavy and light chains can be exchanged, i.e., the crossover Fab molecule is composed of peptide chains. According to the present invention, the Fab is fused to a silenced Fc portion or a silenced Fc domain via the hinge region.

[0121] As used herein, "Fab arm" refers to a silenced Fc portion or a Fab fragment fused by the hinge region to a silenced Fc domain.

[0122] "(scFv)2" refers to an artificial monoclonal antibody that is a fusion protein consisting of two single-chain variable fragments (scFvs) of different or the same antibody, i.e., amino acid sequences from four or two different genes, on a single peptide chain of approximately 50 kilodaltons.

[0123] "bs(scFv)2" refers to an artificial monoclonal antibody that is a fusion protein consisting of two single-chain variable fragments (scFvs) of antibodies with different target antigens, i.e., amino acid sequences from four different genes, on a single peptide chain of approximately 50 kilodaltons.

[0124] The term "functional variant" or "functionally active variant" encompasses naturally occurring allelic variants as well as mutants or any other non-naturally occurring variants. As known in the art, allelic variants (also called homologs) are alternative forms of nucleic acids or peptides characterized as having one or more nucleotide or amino acid substitutions, deletions, or additions that do not fundamentally alter the biological function of the nucleic acid or polypeptide. Specifically, functional variants may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid residue substitutions, deletions, and / or additions, or combinations thereof, where the substitutions, deletions, and / or additions are conservative modifications and do not alter the antigen-binding characteristics. Specifically, functional variants described herein contain up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, and / or additions, which are conservative modifications and do not alter the function of the antibody. Specifically, functionally active variants described herein contain up to 15, preferably 10 or 5, amino acid substitutions, deletions, and / or additions, which are conservative modifications and do not alter the function of the antibody.

[0125] Functional variants can be obtained by sequence alterations, such as one or more point mutations, in a polypeptide or nucleotide sequence, which, when used in the combinations of the present invention, retain or improve the function of the unaltered polypeptide or nucleotide sequence. Such sequence alterations can include, but are not limited to, (conservative) substitutions, additions, deletions, mutations, and insertions. Conservative substitutions are those that occur within a family of amino acids that are related by their side chains and chemical properties. Examples of such families are amino acids with basic side chains, acidic side chains, nonpolar aliphatic side chains, nonpolar aromatic side chains, uncharged polar side chains, small side chains, large side chains, etc.

[0126] Point mutation is specifically recognized as a manipulation of a polynucleotide that results in the expression of an amino acid sequence that differs from the unmanipulated amino acid sequence by the deletion or insertion of one or more individual amino acids, or by the replacement of amino acids by substitution.

[0127] According to certain embodiments, the antibodies described herein may comprise one or more tags for purification and / or detection, for example, but not limited to, affinity tags, solubility-enhancing tags, and monitoring tags.

[0128] Specifically, the affinity tag is selected from the group consisting of a polyhistidine tag, a polyarginine tag, a peptide substrate for an antibody, a chitin-binding domain, an RNase S peptide, protein A, β-galactosidase, a FLAG tag, a Strep II tag, a streptavidin-binding peptide (SBP) tag, a calmodulin-binding peptide (CBP), a glutathione S-transferase (GST), a maltose-binding protein (MBP), an S-tag, an HA tag, and a c-Myc tag; specifically, the tag is a His tag containing one or more Hs, such as a hexahistidine tag.

[0129] By "fused" or "conjugated" is meant that the components (e.g., a Fab molecule and an Fc domain subunit) are linked by a peptide bond, either directly or via one or more peptide linkers.

[0130] The term "linker," as used herein, refers to a peptide linker, which is preferably a peptide having an amino acid sequence having a length of 2, 3, 4, 5, 6, 7 or more amino acids, preferably 2 to 10 amino acids, and more preferably 3 to 5 amino acids.

[0131] The term "immunoglobulin" refers to a protein having the structure of a naturally occurring antibody. For example, IgG class immunoglobulins are heterotetrameric glycoproteins of approximately 150,000 daltons composed of two light chains and two heavy chains linked by disulfides. Each heavy chain has, from N- to C-terminus, a variable region (VH), also called a variable heavy domain or a heavy chain variable domain, followed by three constant domains (CH1, CH2, and CH3), also called a heavy chain constant region. Similarly, each light chain has, from N- to C-terminus, a variable region (VL), also called a variable light domain or a light chain variable domain, followed by a constant light (CL) domain, also called a light chain constant region. IgG class immunoglobulins essentially consist of two Fab molecules and an Fc domain linked via an immunoglobulin hinge region. The heavy chains of immunoglobulins may be assigned to one of five types, called α (IgA), δ (IgD), ε (IgE), γ (IgG), or μ (IgM), some of which may be further divided into subtypes, e.g., γ1 (IgG1), γ2 (IgG2), γ3 (IgG3), γ4 (IgG4), α1 (IgA1), and α2 (IgA2). The light chains of immunoglobulins may be assigned to one of two types, called kappa (κ) and lambda (λ).

[0132] The term "chimeric antibody" refers to an antibody in which a portion of the heavy and / or light chain is derived from a particular source or species, while the remainder of the heavy and / or light chain is derived from a different source or species, usually prepared by recombinant DNA techniques. Chimeric antibodies may contain rabbit or mouse variable regions and human constant regions. Chimeric antibodies are the product of expressed immunoglobulin genes containing DNA segments encoding immunoglobulin variable regions and DNA segments encoding immunoglobulin constant regions. Methods for producing chimeric antibodies involve conventional recombinant DNA and gene transfection techniques well known in the art (Morrison, SL, et al., 1984).

[0133] A "human antibody" possesses an amino acid sequence that corresponds to that of an antibody produced by a human or human cell, or an antibody derived from a non-human source that utilizes a human antibody repertoire, or other human antibody coding sequence. This definition of human antibody specifically excludes humanized antibodies, which comprise non-human antigen-binding residues. As mentioned with respect to chimeric and humanized antibodies, the term "human antibody," as used herein, also includes such antibodies that have been modified in the constant region, for example, by "class switching," i.e., changes or mutations in the Fc portion (e.g., IgG1 to IgG4 and / or IgG1 / IgG4 mutations).

[0134] The term "recombinant human antibody," as used herein, is intended to encompass all human antibodies that are prepared, expressed, created, or isolated by recombinant means, such as antibodies isolated from host cells such as HEK, NS0, or CHO cells, or from animals (e.g., mice) transgenic for human immunoglobulin genes, or antibodies expressed using recombinant expression vectors transfected into host cells. The amino acid sequences of the VH and VL regions of the recombinant antibodies, while derived from and related to human germline sequences, are sequences that may not naturally occur within the human antibody repertoire in vivo.

[0135] A "human consensus framework" is a framework that represents the most commonly occurring amino acid residues in a selection of human immunoglobulin VL or VH framework sequences. Generally, the selection of human immunoglobulin VL or VH sequences is from a subgroup of variable domain sequences. Generally, the subgroup of sequences is a subgroup as described in Kabat et al., 1991.

[0136] A "humanized" antibody refers to a chimeric antibody comprising amino acid residues from non-human HVRs and amino acid residues from human framework regions (FRs) that have been humanized. In certain embodiments, a humanized antibody comprises substantially all of at least one, and typically two, variable domains, in which all or substantially all of the HVRs (e.g., CDRs) correspond to those of a non-human antibody and all or substantially all of the FRs correspond to those of a human antibody. A humanized antibody may optionally comprise at least a portion of an antibody constant region derived from a human antibody. Specifically, forms of humanized antibodies are encompassed by the present invention in which the constant region has been further modified or altered from the constant region of the original antibody to impart new properties, i.e., with respect to reduced or abolished C1q binding and / or Fc receptor (FcR) binding.

[0137] The term "bispecific," as used herein, refers to a binding reaction with at least the oxMIF antigen and an additional antigen, such as, but not limited to, a CD3 or HSG antigen. Specifically, a bispecific antibody can contain at least two sites with specific binding properties, where two different target antigens, i.e., oxMIF and the additional antigen, are recognized by the antibody. An exemplary bispecific antibody format can contain two binding sites, each capable of specifically binding to a different antigen, e.g., CD3 or HSG, as well as oxMIF. Further exemplary bispecific formats can contain more than two binding sites, where one or more binding sites bind oxMIF and one or more binding sites capable of specifically binding one or more different antigens, e.g., CD3 or HSG.

[0138] A "bispecific antibody" according to the present invention is an antibody with two different binding specificities. Bispecific antibodies can be prepared as full-length antibodies or antibody fragments as described herein, but still contain a silenced Fc region. Immunoglobulin Fc heterodimers can be engineered by modifications to the CH3 domain interface, with different mutations on each domain such that engineered Fc fragments with CH3 variant pairs preferentially form heterodimers over homodimers (Ha JH. et al., 2016). Examples of bispecific antibody formats include, but are not limited to, bispecific IgG (BsIgG), i.e., IgG with an additional antigen-binding moiety attached, BsAb fragments, bispecific fusion proteins, BsAb conjugates, hybrid bsIgG, modified Fc fusion proteins, attached IgGs-HC fusions, attached IgGs-LC fusions, attached IgGs-HC&LC fusions, Fc fusions, CH3 fusions, F(ab')2 fusions, CH1 / CL, modified IgG, Fc-modified IgG, diabodies, etc., as described in Spiess C. et al., 2015, and Brinkmann U. and Kontermann RE, 2017.

[0139] In alternative embodiments encompassing the bispecific antibodies or antibody fragments described herein, the term "IgG-scFv" refers to a type of bispecific antibody engineered by fusing one scFv to a monospecific immunoglobulin G (IgG) for bispecificity. According to the present invention, the bispecific antibody is Fc-silenced, i.e., comprises a mutant Fc region of wild-type human IgG with one or more amino acid substitutions or glycosylation modifications as described herein. The specificity of the IgG can be for oxMIF, and the specificity of the scFv can be for CD3 or HSG, or vice versa. Furthermore, scFvs can be added to either the amino or C-terminus of one of the light or heavy chains to form various types of IgG-scFv bispecific antibodies (BsAbs): (i) IgG(H)-scFv, i.e., scFv linked to the C-terminus of one of the full-length IgG HCs; (ii) scFv-(H)IgG (which is the same as IgG(H)-scFv except that the scFv is linked to the N-terminus of the HC); (iii) IgG(L)-scFv or (iv) scFv-(L)IgG, i.e., scFv linked to the C-terminus or N-terminus of the IgG light chain (forming IgG(L)-scFv or scFv-(L)IgG, respectively). Specifically, IgG-scFvs range from 165 kDa to 185 kDa, and are typically approximately 175 kDa.

[0140] According to an alternative embodiment, fusing recombinant variable domains, such as diabodies, to silenced Fc regions (e.g., scDb-Fc) can significantly increase binding valency. The increased size can also extend the half-life of diabodies in serum. The term "diabody" refers to a group of heavy chain variable (V) molecules joined by a small peptide linker. H ) and light chain variable (V L(scFv) refers to a non-covalent dimer of single-chain Fv (scFv) fragments consisting of two scFv regions. Another form of diabody is the single-chain (Fv)2, in which two scFv fragments are covalently linked to each other. Furthermore, by linking the genes for each chain in tandem using an internal linker, the four VH and VL domains can be expressed in tandem and folded into a single-chain diabody (scDb), which is also an effective strategy for producing bispecific antibodies. Specifically, diabody-CH3 has a molecular weight of approximately 125 kDa.

[0141] In certain embodiments, the term Fab / bs(scFv)2-Fc refers to a bispecific antibody that is an IgG in which one Fab arm is replaced by bs(scFv)2 while the other IgG arm is preserved.

[0142] In certain embodiments, the term Fab / scFv-Fc refers to a bispecific antibody that is an IgG in which one Fab arm is replaced by an scFv, while the other IgG arm is preserved. Antibody C0132 described herein, shown schematically in Figure 12, serves as a non-limiting example of a Fab / scFv-Fc.

[0143] In certain embodiments, the term Fab / Fab-scFv-Fc refers to a bispecific antibody that is an IgG in which one Fab arm is replaced by a Fab-scFv, while the other IgG arm is preserved. The antibody C0133 described herein, shown schematically in Figure 12, serves as a non-limiting example of a Fab / Fab-scFv-Fc.

[0144] The term "CrossMAb" (where MAb refers to monoclonal antibody) refers to a bispecific Ab format derived from independent parent antibodies. Heavy chain mismatching is avoided by applying the knobs-into-holes (KIH) method. Light chain mismatching is avoided because bispecific antibodies are produced by antibody domain exchange, where either the variable domain or the constant domain (CL and CH1) of one Fab arm is swapped between the light chain and the heavy chain. This "crossover" maintains antigen-binding affinity and also preserves the two different arms to avoid light chain mismatching. Examples of CrossMAb include, but are not limited to, Fabs with different domains swapped, VH-VL, and CH1-CL. In CrossMAb Fab, all of the VH-CH1 and VL-CL domains are swapped; in CrossMAb VH-VL format, only the VH and VL domains are swapped; and in CrossMAb CH1-CL1 format, the CH1 and CL domains of the bispecific antibody are swapped. Specifically, the CrossMab is approximately 150 kDa.

[0145] The oxMIF antibodies of the present invention may further comprise at least one binding site that specifically recognizes an additional epitope of CD3, specifically an epitope of human CD3, including the CD3γ (gamma) chain, CD3δ (delta) chain, and CD3ε (epsilon) chain present on the cell surface. For example, clustering of CD3 on T cells by immobilized anti-CD3 antibodies results in T cell activation similar to T cell receptor binding but independent of the typical specificity of the clone. In certain embodiments, the CD3-binding domain of the antibodies described herein not only exhibits strong CD3-binding affinity with human CD3 but also exhibits excellent cross-reactivity with the respective cynomolgus monkey CD3 protein. In some examples, the CD3-binding domain of the antibody cross-reacts with CD3 from cynomolgus monkeys. In one embodiment, the anti-CD3 binding site comprises one or more (e.g., all three) light chain complementarity determining regions of an anti-CD3 binding domain described herein and / or one or more (e.g., all three) heavy chain complementarity determining regions of an anti-CD3 binding domain described herein, e.g., an anti-CD3 binding domain comprising one or more, e.g., all three LC CDRs, and one or more, e.g., all three HC CDRs.

[0146] According to further embodiments, the antibody may comprise one or more additional binding sites which specifically recognize one or more antigens expressed on effector T cells, NK cells or macrophages, in particular one or more of CD3, ADAM17, CD2, CD4, CD5, CD6, CD8, CD11a, CD11b, CD14, CD16, CD16b, CD25, CD28, CD30, CD32a, CD40, CD40L, CD44, CD45, CD56, CD57, CD64, CD69, CD74, CD89, CD90, CD137, CD177, CEAECAM6, CEACAM8, HLA-DR alpha chain, KIR, LSECtin or SLC44A2, or one or more hapten antigens, i.e. HSG.

[0147] According to an alternative embodiment, the antibody of the invention is a bispecific antibody further comprising one or more CD3 variable binding domains of mosunetuzumab, pasotuxizumab, civisatamab, otelixizumab, teplizumab, visilizumab or foralarumab.

[0148] According to certain embodiments, the anti-CD3 binding moiety is selected from the group consisting of muromonab-CD3 (OKT3), otelixizumab (TRX4), teplizumab (MGA031), visilizumab (Nuvion), solitomab, blinatumomab, pasotuxizumab, civisatamab, mosunetuzumab, SP34, X35, VIT3, BMA030 (BW264 / 56), CLB-T3 / 3, CRIS7, YTH12.5, Complementarity determining regions (CDRs) selected from the group consisting of F111-409, CLB-T3.4.2, TR-66, WT32, SPv-T3b, 11D8, XIII-141, XIII-46, XIII-87, 12F6, T3 / RW2-8C8, T3 / RW2-4B6, OKT3D, M-T301, SMC2, F101.01, UCHT-1 and WT-31, and, if applicable, any humanized derivatives thereof.

[0149] Specifically, the CD3-binding domain of the present invention can be one or more CDRs of the anti-CD3 variable region, or a CDR that comprises or has at least 70%, specifically 80%, 90%, 95%, or 99% sequence identity with any of the CDR sequences of muromonab, otelixizumab, teplizumab, visilizumab, solitomab, blinatumomab, pasotuxizumab, civisatamab, or mosunetuzumab.

[0150] The specific CDRs that bind to CD3 are as follows:

[0151] [Table 2]

[0152] [Table 3]

[0153] More specifically, the bispecific anti-oxMIF / anti-CD3 antibodies contain 0, 1, or 2 point mutations in each of the CDR sequences listed above.

[0154] A further specific embodiment refers to an anti-oxMIF / anti-CD3 bs(scFv)2, wherein the corresponding variable heavy chain region (VH) and the corresponding variable light chain region (VL) are VH(oxMIF)-V L The bs(scFv)2 is arranged from N-terminus to C-terminus in the order of (oxMIF)-VH(CD3)-VL(CD3), VH(CD3)-VL(CD3)-VH(oxMIF)-VL(oxMIF), or VH(CD3)-VL(CD3)-VL(oxMIF)-VH(oxMIF). According to the present invention, the bs(scFv)2 is fused to the silenced Fc portion or silenced Fc domain via the hinge region.

[0155] According to a further embodiment, the Fc-silenced anti-oxMIF antibody of the invention may further comprise at least one binding site which further specifically recognizes the HSG (histamine-succinyl-glycine) hapten.

[0156] According to certain embodiments, the anti-HSG binding site comprises a complementarity determining region (CDR) selected from the murine (m) anti-HSG antibody 679 (m679), and, where applicable, any humanized (hz) derivative thereof.

[0157] Such bispecific anti-oxMIF antibodies may comprise a binding site that specifically recognizes HSG comprising the CDRs listed in Tables 3 and 4 below (hz anti-HSG antibody 679 (hz679) sequence is from US2009 / 0240037A1).

[0158] [Table 4]

[0159] [Table 5]

[0160] More specifically, the bispecific anti-oxMIF / anti-HSG antibody contains 0, 1, or 2 point mutations in each of the CDR sequences listed above.

[0161] A further specific embodiment refers to an anti-oxMIF / anti-HSG bs(scFv)2, wherein the corresponding variable heavy chain region (VH) and the corresponding variable light chain region (VL) are VH(oxMIF)-V L The bs(scFv)2 is arranged from N-terminus to C-terminus in the order of (oxMIF)-VH(HSG)-VL(HSG), VH(HSG)-VL(HSG)-VH(oxMIF)-VL(oxMIF), or VH(HSG)-VL(HSG)-VL(oxMIF)-VH(oxMIF). According to the present invention, the bs(scFv)2 is fused to the silenced Fc portion or silenced Fc domain via the hinge region.

[0162] In a further embodiment, the antibody is an Fc-silenced bispecific antibody, specifically selected from the group consisting of bispecific IgG, IgG with added CD3 or HSG binding sites, BsAb fragments, bispecific fusion proteins, BsAb conjugates.

[0163] Directly radiolabeled antibodies have slow blood clearance and delayed tumor uptake in solid tumors, resulting in continuously high radiation dose exposure to healthy tissues and organs. In vivo pretargeted radioimmunotherapy (PRAIT) can overcome these limitations, but the selection and design of bsMAb formats for PRAIT remains challenging. PRAIT aims to improve the therapeutic index (tumor-to-normal tissue ratio) by increasing the absorbed dose delivered to the tumor compared to directly radiolabeled antibodies or antibody fragments. PRAIT involves administering a bsMAb directed against HSG and tumor targets, followed several days later by the administration of a radiolabeled bivalent HSG hapten. Using this technique, a significant amount of bsMAb accumulates in the tumor and is largely cleared from the circulation. The radiolabeled bivalent HSG hapten binds to the tumor-accumulated bsMAb, while the unbound radioactive HSG hapten is cleared from the circulation by the kidney within a few hours. Therefore, exposure of normal organs to radiation is minimized (US2005 / 0025709, Sharkey RM et al., 2005, Rossi EA et al., and Karacay H. et al., 2005).

[0164] Targeted radionuclide therapy includes, for example, the HSG hapten IMP288 (as described in US 2005 / 0025709) and 177 Lu can be used as the radionuclide. IMP288 is a DOTA-conjugated D-Tyr-D-Lys-D-Glu-D-Lys-NH2 tetrapeptide in which both lysine residues are derivatized with HSG moieties via their ε-amino groups.

[0165] The term "antigen," when used interchangeably herein with the terms "target" or "target antigen," refers to the entire target molecule or a fragment of such a molecule that is recognized by an antibody binding site. Specifically, substructures of antigens, generally referred to as immunologically relevant "epitopes," e.g., B-cell epitopes or T-cell epitopes, e.g., polypeptide or carbohydrate structures, can be recognized by such binding sites.

[0166] The term "epitope," as used herein, specifically refers to a molecular structure that may entirely constitute a specific binding partner or may be part of a specific binding partner for an antibody-type binding site of the present invention. Epitopes may be composed of carbohydrates, peptide structures, fatty acids, organic substances, biochemicals, or inorganic substances, or derivatives thereof, and any combination thereof. When an epitope is contained in a peptide structure, such as a peptide, polypeptide, or protein, the epitope typically contains at least 3 amino acids, particularly 5 to 40 amino acids, and particularly 10 or fewer amino acids, particularly 4 to 10 amino acids. Epitopes may be either linear or conformational. A linear epitope is composed of a single segment of the primary sequence of a polypeptide or carbohydrate chain. Linear epitopes may be contiguous or overlapping. A conformational epitope is composed of amino acids or carbohydrates that are grouped together by folding a polypeptide to form a tertiary structure, where the amino acids are not necessarily adjacent to each other in the linear sequence. Such an oxMIF epitope may be the sequence EPCALCS (SEQ ID NO: 42), which is located within the central region of oxMIF.

[0167] The term "antigen-binding domain" or "binding domain" or "binding site" refers to a portion of an antigen-binding moiety that specifically binds to and comprises an area complementary to part or all of an antigen. When an antigen is large, an antigen-binding molecule may bind only to a specific portion of the antigen, which specific portion is called an epitope. An antigen-binding domain may be provided, for example, by one or more antibody variable domains (also called antibody variable regions). Preferably, the antigen-binding domain comprises an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH).

[0168] The term "binding site," as used herein with respect to an antibody of the present invention, refers to a molecular structure capable of binding interaction with an antigen. Typically, binding sites are located within the complementarity-determining regions (CDRs) of an antibody, also referred to herein as "CDR-binding sites," which are specific regions with different structures that confer binding function to different antigens. The different structures can be derived from natural antibody repertoires, e.g., murine or human repertoires, or can be produced recombinantly or synthetically, e.g., by mutagenesis, particularly by randomization techniques. These include mutagenized CDR regions, loop regions of variable antibody domains, particularly CDR loops of antibodies, e.g., the CDR1, CDR2, and CDR3 loops of either the VL and / or VH antibody domains. An antibody format, as used herein, typically comprises one or more CDR-binding sites, each specific for an antigen.

[0169] The oxMIF-binding site of the antibody described herein is specific for the oxidized form of MIF, i.e., animal, particularly mammalian oxMIF, for example, but not limited to, mouse, rat, monkey, and human, particularly human oxMIF, but does not exhibit substantial cross-reactivity with reduced MIF. oxMIF is a disease-associated structural isoform of MIF that can be specifically and predominantly detected in the circulation of subjects with inflammatory diseases and in tumor tissues of cancer patients. In one embodiment, the humanized or human anti-oxMIF binding site comprises one or more (e.g., all three) light chain complementarity-determining regions of the humanized or human anti-oxMIF binding domain described herein, e.g., CDRs contained in SEQ ID NOs: 2, 5, 6, 7, or 8, and / or one or more (e.g., all three) heavy chain complementarity-determining regions of the humanized or human anti-oxMIF binding domain described herein, e.g., SEQ ID NOs: 3, 4, 9, or 43.

[0170] The term "specific" as used herein refers to the binding reaction that determines the cognate ligand of interest in a heterogeneous group of molecules.In this specification, the binding reaction is the reaction with at least oxMIF antigen.Therefore, under specified conditions, such as immunoassay conditions, an antibody that specifically binds to a specific target does not bind to other molecules present in the sample in significant amounts, and in particular, the antibody does not show substantial cross-reactivity to reduced MIF.

[0171] A specific binding site typically does not cross-react with other targets. Yet, a specific binding site may specifically bind to one or more epitopes, isoforms, or variants of a target, or may be cross-reactive with other related target antigens, such as homologs or analogs.

[0172] Specific binding means that binding is selected for target identity, high, medium, or low affinity or avidity, depending on the selection. Selective binding is typically achieved when the binding constant or kinetics for a target antigen, such as oxMIF, differs by at least 10-fold, preferably by at least 100-fold, and more preferably by at least 1000-fold, compared to the binding constant or kinetics for an antigen that is not the target antigen.

[0173] The term "valent" as used within this application refers to the presence of a designated number of binding sites in an antibody molecule. Thus, the terms "bivalent," "tetravalent," and "hexavalent" refer to the presence of two binding sites, four binding sites, and six binding sites, respectively, in an antibody molecule.

[0174] The term "monovalent," as used herein with respect to antibody binding sites, refers to a molecule that contains only one binding site directed against a target antigen. The term "valency" is therefore understood as the number of binding sites that specifically bind to the same or different epitopes of an antigen directed against the same target antigen.

[0175] Antibodies of the present invention are understood to include monovalent, bivalent, tetravalent or multivalent binding sites that specifically bind oxMIF.

[0176] The term "hypervariable region" or "HVR," as used herein, refers to each region of an antibody variable domain that is hypervariable in sequence and / or forms structurally defined loops ("hypervariable loops"). Generally, a natural four-chain antibody contains six HVRs: three in the VH (H1, H2, H3) and three in the VL (L1, L2, L3). HVRs generally contain amino acid residues from the hypervariable loops and / or from the "complementarity-determining regions" (CDRs), the latter of which have the highest sequence variability and / or are involved in antigen recognition (Kabat et al., 1991). Hypervariable regions (HVRs) are also referred to as complementarity-determining regions (CDRs), and these terms are used interchangeably herein in reference to the portions of the variable regions that form the antigen-binding region. The exact number of residues encompassing a particular CDR varies depending on the sequence and size of the CDR. Given the amino acid sequence of the variable regions of an antibody, one skilled in the art can routinely determine which residues comprise a particular CDR.

[0177] Kabat defined a numbering system for variable region sequences that is applicable to any antibody. One skilled in the art can unambiguously assign this system of "Kabat numbering" to any variable region sequence without reliance on any experimental data beyond the sequence itself. The Kabat numbering of residues can be determined for a given antibody by alignment of the antibody's sequence in regions of homology with a "standard" Kabat numbered sequence. As used herein, "Kabat numbering" refers to the numbering system described by Kabat et al., 1983, US Department of Health and Human Services, "Sequence of Proteins of Immunological Interest." Unless otherwise specified, references to the numbering of specific amino acid residue positions in antibody variable regions follow the Kabat numbering system. Numbering of constant regions follows the EU numbering index.

[0178] CDRs also contain "specificity-determining residues" or "SDRs," which are residues that contact the antigen. SDRs are contained within regions of CDRs called abbreviated CDRs, or a-CDRs. Unless otherwise specified, HVR residues and other residues in the variable domain (e.g., FR residues) are numbered herein according to Kabat et al., supra. CDRs can also be determined according to IMGT (Lefranc MP. 1997). IMGT has its own definitions for framework regions (designated FR-IMGT) and CDRs (designated CDR-IMGT). The IMGT numbering method counts residues consecutively from 1 to 128 based on a germline V sequence alignment.

[0179] CDRs (or SDRs) can also be determined according to MacCallum RM et al., 1996. Herein, antigen-contacting residues are analyzed and combined with the site geometry in crystal structures of antibody Fv and Fab available from the Protein Data Bank. Antigen contact propensity is shown for each antibody residue, allowing for proposed CDR definitions based on observed antigen contacts. Contacts are more prevalent with CDR residues located in the center of the combining site; contacts occur only with large antigens with some less central CDR residues. Non-contacting residues in CDRs correspond to residues identified as important for defining "typical" conformations by Chothia and coworkers (Chothia C et al., 1987).

[0180] A "point mutation" is specifically recognized as a manipulation of a polynucleotide that results in the expression of an amino acid sequence that differs from the unmanipulated amino acid sequence, in the substitution or exchange, deletion or insertion of one or more single (non-consecutive) or double amino acids for different amino acids. A preferred point mutation refers to the exchange of amino acids of the same polarity and / or charge. In this context, amino acids refer to the 20 naturally occurring amino acids coded for by 61 triplet codons. These 20 amino acids can be divided into neutrally charged, positively charged, and negatively charged amino acids.

[0181] "Percent (%) sequence identity" with respect to the polypeptide sequences identified herein is defined as the percent of amino acid residues in a candidate sequence that are identical with amino acid residues in the particular polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and does not take into account any conservative substitutions as part of the sequence identity. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0182] According to the present invention, the sequence identity of the variable or constant region sequences is at least 95%, 96%, 97%, 98%, 99%, 99.5% or 100% with each of the sequences described herein.

[0183] A "subject" is a mammal. Mammals include, but are not limited to, domestic animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates, such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is a human.

[0184] An "isolated nucleic acid" refers to a nucleic acid molecule that has been separated from a component of its natural environment. An isolated nucleic acid includes a nucleic acid molecule contained in a cell that ordinarily contains the nucleic acid molecule, but where the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[0185] "Isolated nucleic acid encoding an anti-oxMIF antibody" refers to one or more nucleic acid molecules encoding antibody heavy and light chains (or fragments thereof), including such nucleic acid molecules in a single vector or separate vectors, and such nucleic acid molecules present in one or more locations in a host cell.

[0186] "No substantial cross-reactivity" means that a molecule (e.g., an antibody) does not recognize or specifically bind to an antigen other than the actual target antigen of the molecule (e.g., an antigen closely related to the target antigen), specifically reduced MIF, particularly when compared to the target antigen. For example, an antibody may bind less than about 10% to less than about 5% of an antigen other than the actual target antigen, or may bind an antigen other than the actual target antigen in an amount that is less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1%, preferably less than about 2%, 1%, or 0.5%, and most preferably less than about 0.2% or 0.1% of the antigen other than the actual target antigen. Binding may be determined by methods known in the art, such as, but not limited to, ELISA or surface plasmon resonance.

[0187] Recombinant production of the antibodies of the invention preferably involves an expression system including, for example, an expression construct or vector containing a nucleotide sequence encoding the antibody format.

[0188] The term "expression system" refers to a nucleic acid molecule containing desired coding and control sequences in operable linkage so that a host transformed or transfected with these sequences is capable of producing the encoded protein. To achieve transformation, the expression system may be contained on a vector, but the relevant DNA may subsequently be integrated into the host chromosome. Alternatively, the expression system may be used for in vitro transcription / translation.

[0189] As used herein, an "expression vector" is defined as a DNA sequence required for the transcription of cloned recombinant nucleotide sequences, i.e., recombinant genes, and the translation of their mRNA in a suitable host organism. An expression vector contains an expression cassette and also typically contains an origin for autonomous replication in a host cell or a genome integration site, one or more selectable markers (e.g., amino acid synthesis genes or genes conferring resistance to antibiotics such as zeocin, kanamycin, G418, or hygromycin), multiple restriction enzyme cleavage sites, a suitable promoter sequence, and a transcription terminator, and these components are operably linked together. As used herein, the terms "plasmid" and "vector" encompass autonomously replicating nucleotide sequences and genome-integrating nucleotide sequences.

[0190] Specifically, the term refers to a vehicle by which a DNA or RNA sequence (e.g., a foreign gene), such as a nucleotide sequence encoding an antibody format of the invention, can be introduced into a host cell to transform the host and promote the expression (e.g., transcription and translation) of the introduced sequence. Plasmids are preferred vectors of the present invention.

[0191] A vector usually contains a transmissible piece of DNA into which a foreign gene is inserted. A common method for inserting one segment of DNA into another segment of DNA involves the use of enzymes called restriction enzymes, which cut the DNA at specific sites (specific groups of nucleotides) called restriction sites.

[0192] A "cassette" refers to a DNA coding sequence or segment of DNA encoding an expression product that can be inserted into a vector at defined restriction sites. The cassette restriction sites are designed to ensure insertion of the cassette in the proper reading frame. Generally, foreign DNA is inserted at one or more restriction sites in the vector DNA and then transported by the vector along with the transmissible vector DNA into a host cell. A DNA segment or sequence into which DNA has been inserted or added, such as an expression vector, can also be referred to as a "DNA construct." A common type of vector is the plasmid, which is generally a self-contained molecule of double-stranded DNA that can readily accept additional (foreign) DNA and can be easily introduced into a suitable host cell. Vectors of the present invention often contain coding DNA and expression control sequences, such as promoter DNA, and have one or more restriction sites suitable for inserting foreign DNA. Coding DNA is a DNA sequence that encodes a specific amino acid sequence for a particular polypeptide or protein, such as an antibody format of the present invention. Promoter DNA is a DNA sequence that initiates, regulates, or otherwise mediates or controls expression of coding DNA. The promoter DNA and coding DNA may be from the same gene or from different genes, and may be from the same or different organisms. Recombinant cloning vectors of the invention often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g., antibiotic resistance, and one or more expression cassettes.

[0193] For example, the procedures used to ligate DNA sequences providing or encoding the elements of the invention, and / or proteins of interest, promoters, terminators and further sequences, respectively, and insert them into suitable vectors containing the information necessary for integration or host replication are well known to those skilled in the art and are described, for example, in Sambrook et al., 2012.

[0194] A host cell is understood in particular to be a cell, recombinant cell or cell line which has been transfected with an expression construct such as a vector according to the invention.

[0195] The term "host cell line," as used herein, refers to an established clone of a particular cell type that has acquired the ability to grow over an extended period of time. The term host cell line refers to a cell line that is used to express endogenous or recombinant genes to produce a polypeptide, such as a recombinant antibody format of the present invention.

[0196] "Production host cells" or "production cells" are generally understood to be cell lines or cultures of cells ready for cultivation in a bioreactor to obtain the recombinant antibody format of the invention that is the product of the production process. The host cell type according to the present invention can be any prokaryotic or eukaryotic cell.

[0197] The term "recombinant," as used herein, means "prepared by genetic manipulation" or "the result of genetic manipulation," e.g., specifically with heterologous sequences incorporated in a recombinant vector or recombinant host cell.

[0198] Antibodies of the invention can be produced using any of the well-established known expression systems and recombinant cell culture techniques, for example, by expression in bacterial hosts (prokaryotic systems) or eukaryotic systems such as yeast, fungi, insect cells, or mammalian cells. Antibody molecules of the invention can also be produced in transgenic organisms such as goats, plants, or transgenic mice, which are engineered mouse strains carrying large fragments of the human immunoglobulin loci and deficient in mouse antibody production. Antibodies may also be produced by chemical synthesis.

[0199] According to particular embodiments, the host cells are producer cell lines selected from the group consisting of CHO, PerC6, CAP, HEK, HeLa, NS0, SP2 / 0, hybridoma and Jurkat cells, more particularly, the host cells are derived from CHO cells.

[0200] The host cells of the present invention are specifically cultured or maintained in serum-free cultures that contain other components, such as, for example, plasma proteins, hormones and growth factors, as an alternative to serum.

[0201] The host cells are most preferred when they are established, adapted and cultured entirely in serum-free conditions, optionally in a medium that is free of any proteins / peptides of animal origin.

[0202] Anti-oxMIF antibodies of the invention can be recovered from the culture medium using standard protein purification methods.

[0203] The term "pharmaceutical formulation" refers to a preparation that is present in a form that allows the biological activity of the active ingredients contained in the preparation to be effective and that does not contain additional components that are unacceptably toxic to the subject to which the formulation is administered.

[0204] A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical formulation, other than the active ingredient, that is non-toxic to a subject. Some examples of pharmaceutically acceptable carriers are water, saline, phosphate-buffered saline, amino acids such as glycine or histidine, dextrose, glycerol, ethanol, and the like, as well as combinations thereof. In many cases, it is preferable to include an isotonic agent in the composition, for example, a sugar, a polyalcohol such as mannitol or sorbitol, or sodium chloride. Further examples of pharmaceutically acceptable substances are wetting agents, or minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives, or buffers, which enhance the shelf life or effectiveness of the antibody.

[0205] As used herein, "treatment," "treat," or "treating" refers to a clinical intervention that seeks to alter the natural course of the individual being treated and can be performed prophylactically or during the course of clinical pathology. Desired effects of treatment include, but are not limited to, preventing the onset or recurrence of disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, improving or palliating the disease state, and achieving remission or improving prognosis. In some embodiments, the antibodies of the invention are used to delay the onset of disease or slow the progression of disease.

[0206] The anti-oxMIF antibodies of the present invention and pharmaceutical compositions comprising the same may be administered in combination with one or more other therapeutic, diagnostic, or prophylactic agents, including other anti-cancer, anti-tumor, anti-angiogenic, and chemotherapeutic agents, steroids, or checkpoint inhibitors, depending on the disease to be treated.

[0207] The pharmaceutical compositions of the present invention may be in various forms, such as liquid, semi-solid, and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes, and suppositories. The preferred form depends on the intended mode of administration and therapeutic application. Typical preferred compositions are in the form of injectable or infusible solutions, e.g., compositions similar to those used for passive immunization of humans. The preferred mode of administration is parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular). In a preferred embodiment, the antibody is administered by intravenous infusion or injection. In another preferred embodiment, the antibody is administered by intramuscular or subcutaneous injection. As will be appreciated by those skilled in the art, the route and / or mode of administration will vary depending on the desired results.

[0208] The optimized advantageous properties of the antibodies of the present invention allow for the administration of high doses of the antibody composition, specifically compositions containing about 10-250 mg / ml of antibody, specifically 25-100 mg / ml, specifically 50 mg / ml or more.

[0209] The anti-oxMIF antibody can be administered once, but more preferably multiple times. For example, the antibody can be administered three times a day to once every six months or more. Administration can be performed three times a day, twice a day, once a day, once every two days, once every three days, once a week, once every two weeks, once a month, once every two months, once every three months, or once every six months, etc.

[0210] The present invention also relates to compositions comprising anti-oxMIF antibodies or antigen-binding portions thereof for the treatment of a subject in need of treatment for an MIF-related condition, particularly an immune disorder, e.g., an inflammatory disease or a hyperproliferative disorder. In some embodiments, the subject in need of treatment is a human.

[0211] The term "cancer", as used herein, refers to a proliferative disease, and specifically refers to solid cancers such as colorectal cancer, ovarian cancer, pancreatic cancer, lung cancer, melanoma, squamous cell carcinoma (SCC) (e.g., of the head and neck, esophagus, and oral cavity), hepatocellular carcinoma, colorectal adenocarcinoma, renal cancer, medullary thyroid carcinoma, papillary thyroid carcinoma, astrocytoma, neuroblastoma, Ewing's sarcoma, cervical cancer, endometrial cancer, breast cancer, prostate cancer, gastric cancer, and malignant seminiferous carcinoma, including any refractory version of the above cancers, or a combination of one or more of the above cancers.

[0212] Hyperproliferative disorders such as cancer or cancer that can be treated by the anti-oxMIF antibodies of the present invention involve any tissue or organ, and include, but are not limited to, brain cancer, lung cancer, squamous cell carcinoma, bladder cancer, stomach cancer, pancreatic cancer, breast cancer, head cancer, neck cancer, liver cancer, kidney cancer, ovarian cancer, prostate cancer, colorectal cancer, esophageal cancer, gynecological cancer, nasopharyngeal cancer, or thyroid cancer, melanoma, lymphoma, leukemia, or multiple myeloma. In particular, the anti-oxMIF antibodies of the present invention are useful for treating ovarian, pancreatic, colon, and lung cancer.

[0213] In certain embodiments, Antibodies that are highly suitable for the treatment of cancer diseases, in particular for the treatment of solid tumors, include: A recombinant anti-oxMIF antibody, antigen-binding fragment thereof, bispecific anti-oxMIF / anti-CD3 antibody, or bispecific anti-oxMIF / anti-HSG antibody, having a silenced Fc and reduced aggregation potential and reduced hydrophobicity, comprising: (a1) a light chain variable domain comprising SEQ ID NO: 2 with at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F; or (a2) comprises SEQ ID NO: 2 with one, two, three, four, or five amino acid substitutions; - a conserved tyrosine at position 36, and - a light chain variable domain further comprising at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F; and (b1) a heavy chain variable domain comprising SEQ ID NO: 3; or (b2) a heavy chain variable domain comprising SEQ ID NO: 3 and the amino acid substitutions L5Q and / or W97Y; or (b3) a heavy chain variable domain comprising SEQ ID NO: 3 with at least one amino acid substitution L5Q or W97Y and one, two, three, four, or five additional amino acid substitutions. Including, where the amino acid positions are numbered according to Kabat: the mutant Fc region exhibits reduced FcγR binding compared to the wild-type IgG1 Fc region; The antibody or antigen-binding fragment thereof is a recombinant anti-oxMIF antibody, an antigen-binding fragment thereof, a bispecific anti-oxMIF / anti-CD3 antibody, or a bispecific anti-oxMIF / anti-HSG antibody, which has reduced aggregation ability and reduced hydrophobicity compared to an antibody comprising SEQ ID NO: 2 and SEQ ID NO: 3 lacking the amino acid substitutions.

[0214] The present invention also encompasses methods for the treatment of inflammatory diseases in a subject, including a human, such as vasculitis, arthritis, sepsis, septic shock, endotoxic shock, toxic shock syndrome, acquired respiratory distress syndrome, glomerulonephritis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, peritonitis, nephritis, atopic dermatitis, asthma, conjunctivitis, fever, malaria, NASH (non-alcoholic steatohepatitis), multiple sclerosis, acute and chronic pancreatitis, type 1 diabetes, IgA nephropathy, interstitial cystitis, post-COVID syndrome, psoriasis, glomerulonephritis, inflammatory bowel disease, nephritis and peritonitis, systemic lupus erythematosus (including SLE - lupus nephritis), asthma, rheumatoid arthritis (RA), and inflammatory bowel disease (IBD), comprising the step of administering to the subject in need thereof a therapeutically effective amount of an anti-oxMIF antibody or an antigen-binding portion thereof.

[0215] In certain embodiments, Antibodies that are highly suitable for treating inflammatory or infectious diseases include: A recombinant anti-oxMIF antibody or antigen-binding fragment thereof, having a silenced Fc and reduced aggregation potential and reduced hydrophobicity, comprising the following variable domains: (a1) a light chain variable domain comprising SEQ ID NO: 2 with at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F; or (a2) comprises SEQ ID NO: 2 with one, two, three, four, or five amino acid substitutions; - a conserved tyrosine at position 36, and - a light chain variable domain further comprising at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F; and (b1) a heavy chain variable domain comprising SEQ ID NO: 3; or (b2) a heavy chain variable domain comprising SEQ ID NO: 3 and the amino acid substitutions L5Q and / or W97Y; or (b3) a heavy chain variable domain comprising SEQ ID NO: 3 with at least one amino acid substitution L5Q or W97Y and one, two, three, four, or five additional amino acid substitutions. Including, where the amino acid positions are numbered according to Kabat: the mutant Fc region exhibits reduced FcγR binding compared to the wild-type IgG1 Fc region; The above antibody or antigen-binding fragment thereof is a recombinant anti-oxMIF antibody or antigen-binding fragment thereof, which has reduced aggregation ability and reduced hydrophobicity compared to an antibody comprising sequence numbers 2 and 3 that lack the amino acid substitutions.

[0216] In a further specific embodiment, antibodies highly suitable for treating inflammatory or infectious diseases are recombinant anti-oxMIF antibodies described herein that also have increased preferential binding to the inhibitory receptor FcγRIIB or have enhanced α2,6-N-linked sialylation.

[0217] The present invention further encompasses the following embodiments. 1. An Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof, comprising a mutant Fc region of wild-type human IgG comprising SEQ ID NO: 1 with one or more amino acid substitutions or glycosylation modifications, and (a1) a light chain variable domain comprising SEQ ID NO: 2 with at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F; or (a2) comprises SEQ ID NO: 2 with one, two, three, four, or five amino acid substitutions; - a conserved tyrosine at position 36, and - a light chain variable domain further comprising at least one of the amino acid substitutions M30L, A51G, P80S, W93F; and (b1) a heavy chain variable domain comprising SEQ ID NO: 3; or (b2) a heavy chain variable domain comprising SEQ ID NO: 3 and the amino acid substitutions L5Q and / or W97Y; or (b3) a heavy chain variable domain comprising SEQ ID NO: 3 with at least one amino acid substitution L5Q or W97Y and one, two, three, four, or five additional amino acid substitutions. Including, where the amino acid positions are numbered according to Kabat: the mutant Fc region exhibits reduced FcγR binding compared to the wild-type IgG1 Fc region; An Fc-silenced anti-oxMIF antibody or its antigen-binding fragment, wherein the antibody or its antigen-binding fragment has reduced aggregation ability and reduced hydrophobicity compared to an antibody comprising sequence numbers 2 and 3 lacking amino acid substitutions. 2. The recombinant anti-oxMIF antibody of embodiment 1, comprising the amino acid substitutions W93F and / or W97Y. 3. The Fc-silenced anti-oxMIF antibody of embodiment 1 or 2, wherein the amino acid substitution is at any one of positions E233, L234, L235, G236, G237, P238, D265, S267, H268, N297, S298, T299, E318, L328, P329, A330, P331 of SEQ ID NO: 1 according to the EU numbering index. 4. An Fc-silenced anti-oxMIF antibody according to any one of embodiments 1 to 3, wherein the Fc region is aglycosylated. 5. The Fc-silenced anti-oxMIF antibody according to any one of embodiments 1 to 4, wherein the amino acid substitutions are at positions L234 and L235, specifically L234A and L235A. 6. The Fc-silenced anti-oxMIF antibody of embodiment 1, comprising a variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 5, 6, 7, 8, 9, and 43. 7.i.) SEQ ID NOs: 3 and 6; ii.) SEQ ID NOs: 9 and 6; iii.) SEQ ID NOs: 4 and 6; iv.) SEQ ID NOs: 4 and 8, or v.) SEQ ID NOs: 4 and 5 vi.) SEQ ID NO: 43 and any one of 5, 6, 7, or 8 2. The Fc-silenced anti-oxMIF antibody of embodiment 1, comprising: 8. The Fc-silenced anti-oxMIF antibody of embodiment 7, further comprising SEQ ID NO: 14. 9. The Fc-silenced anti-oxMIF antibody of embodiment 1, comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 15, and 16 or 17. 10. An Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof, comprising a variant Fc region of wild-type human IgG comprising SEQ ID NO: 1 with one or more amino acid substitutions or glycosylation modifications; a light chain CDR1 sequence selected from SEQ ID NO: 72 or 78; a light chain CDR2 sequence selected from SEQ ID NO: 73, 79, 80, or 81; a light chain CDR3 sequence selected from SEQ ID NO: 74 or 82; a heavy chain CDR1 sequence selected from SEQ ID NO: 75; a heavy chain CDR2 sequence selected from SEQ ID NO: 76 or 83, and A heavy chain CDR3 sequence selected from SEQ ID NO: 77 or 84 with the proviso that SEQ ID NO: 74 and SEQ ID NO: 77 are not included together. 11. The Fc-silenced anti-oxMIF antibody according to any one of embodiments 1 to 10, wherein the amino acid substitution is at any one of positions E233, L234, L235, G236, G237, P238, I253, D265, S267, H268, N297, S298, T299, H310, E318, L328, P329, A330, P331, H435 of SEQ ID NO: 1, in particular the amino acid substitution is at positions L234 and L235, in particular positions L234, L235, H310 and H435 according to the EU numbering index, and / or the Fc region is aglycosylated. 12. The Fc-silenced anti-oxMIF antibody of any one of embodiments 1 to 11, selected from the group consisting of bispecific antibodies (i.e., crossmab), scFv-Fc, (scFv)2-Fc, scFv / scFv-Fc, Fab / scFv-Fc, Fab / (scFv)2-Fc, Fab / Fab-scFv-Fc, Fab / Fab-crossFab-Fc, IgG-scFv and IgG-(scFv)2. 13. The Fc-silenced anti-oxMIF antibody of any one of embodiments 1 to 12, wherein the antibody is a bispecific antibody further comprising at least one binding site that specifically recognizes an epitope of CD3 or histamine-succinyl-glycine (HSG). 14. The Fc-silenced anti-oxMIF antibody according to item 13 for use in the treatment or detection of solid tumors, wherein the antibody is administered to a subject in a first step and an HSG hapten is administered in a second step, and the HSG hapten is conjugated to the antibody and labeled with a radionuclide. 15. An Fc-silenced antibody according to any one of embodiments 1 to 13 for use in the preparation of a medicament. 16. A pharmaceutical composition comprising an antibody according to any one of embodiments 1 to 13, optionally together with a pharmaceutical carrier or adjuvant. 17. The pharmaceutical composition according to embodiment 16, comprising 10 to 250 mg / ml, in particular more than 50 mg / ml, of the antibody according to any one of embodiments 1 to 13. 18. The pharmaceutical composition of embodiment 16 or 17, which is formulated for subcutaneous administration. 19. The pharmaceutical composition according to any one of embodiments 16 to 18, for administration as a single substance or together with a further pharmaceutical composition comprising one or more active substances, preferably selected from the group consisting of antiviral, anticancer, anti-inflammatory, and antibiotic. 20. The pharmaceutical composition according to any one of embodiments 16 to 19 for use in the treatment of patients suffering from inflammatory diseases, infectious diseases, in particular in the treatment of asthma, vasculitis, arthritis, sepsis, septic shock, endotoxic shock, toxic shock syndrome, acquired respiratory distress syndrome, glomerulonephritis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, peritonitis, nephritis, NASH (non-alcoholic steatohepatitis), multiple sclerosis, acute and chronic pancreatitis, type 1 diabetes, IgA nephropathy, interstitial cystitis, post-COVID syndrome, and psoriasis. 21. A pharmaceutical composition according to any one of embodiments 16 to 19 for use in the treatment of patients suffering from a hyperproliferative disorder or cancer, in particular in the treatment of colorectal cancer, ovarian cancer, breast cancer, prostate cancer, pancreatic cancer, gastric cancer, and lung cancer. 22. An isolated nucleic acid encoding the antibody of any one of embodiments 1 to 13. 23. An expression vector comprising the nucleic acid of embodiment 22. 24. A host cell containing a nucleic acid according to embodiment 22 or an expression vector according to embodiment 23. 25. A method for producing an antibody according to any one of embodiments 1 to 13, comprising culturing a host cell according to embodiment 24, and recovering said antibody from the cell culture. [Example]

[0218] The examples described herein are illustrative of the present invention and are not intended to limit it. Many modifications and variations can be made to the techniques described and illustrated herein without departing from the scope of the present invention. Therefore, it should be understood that the examples are illustrative only and do not limit the scope of the present invention.

[0219] Example 1: Mutant IDs, sequence combinations and sequences of anti-oxMIF antibodies (Table 5A) and anti-oxMIF x anti-HSG bispecific antibodies (Table 5B) used in the Examples section

[0220] [Table 6]

[0221] [Table 7]

[0222] Example 2: Reduced aggregation tendency and reduced hydrophobicity of newly designed anti-oxMIF antibodies To assess hydrophobicity and aggregation, the newly designed antibodies C0115 and C0118 were analyzed in comparison with the control anti-oxMIF antibody C0008 and their non-Fc-silenced parent antibodies C0083 and C0090 using gel filtration (SEC) and hydrophobic interaction chromatography (HIC) using two different SEC columns and running buffer conditions.

[0223] For SEC, samples were diluted to 1 mg / ml in 1x phosphate-buffered saline (1x PBS), and 100 μl of sample was applied to an Enrich 650 (Bio-Rad) gel filtration column at a flow rate of 1.25 ml / min. Separation and equilibration were performed in 1x PBS at room temperature. Protein peaks were monitored using absorbance at 280 nm, and spectra were analyzed using the ChromLab software package (Bio-Rad). Results were reported as the retention volume (Vr, ml) of the main peak, and the presence of aggregates was manually ranked.

[0224] For hydrophobic interaction chromatography (HIC) analysis, all samples were diluted to a final concentration of 1 mg / ml using 50 mM phosphate and 0.75 M ammonium sulfate, pH 6.9. Highly purified antibody samples (approximately 100 μg) were independently loaded onto a 1 ml HiTrap Butyl HP column. 100 μl of sample was injected, and the column flow rate was maintained at 1 ml / min at 22 °C. Peak separation was performed using a 20 column volume (CV) gradient from 0 to 100% B (Buffer B: 50 mM phosphate, 20% isopropanol; pH 7.0). Protein peaks were monitored using absorbance at 280 nm, and spectra were analyzed using the ChromLab software package (Bio-Rad).

[0225] Results: The control antibody C0008 exhibited a retention volume close to the total volume of the size-exclusion column (approximately 16–18 ml Enrich 650), corresponding to a much smaller molecular weight than expected for human IgG (Figures 1A and 1B). The unusually long retention was primarily due to hydrophobic interactions with the stationary phase surface. Furthermore, at the high retention volume, C0008 exhibited significant amounts of IgG dimers and aggregates. All newly designed antibodies exhibited reduced retention volumes (Vr), demonstrating reduced interactions with the column and thus reduced hydrophobicity of the molecules (Table 6, Figures 1A and 1B). The newly designed antibodies C0115 and C0118 exhibited retention volumes corresponding to the molecular weight of monomeric human IgG when compared to molecular weight standards (Table 6, Figure 1B). Furthermore, antibody dimers and aggregation were significantly reduced in samples of the newly designed antibodies C0115 and C0118 (Figure 1B). The Fc-silencing mutations of the newly designed antibodies C0115 and C0118 did not alter their SEC profile compared to their parent antibodies C0083 and C0090, respectively, which have wtFc.

[0226] The HIC column retention volume is a measure of hydrophobicity, and antibodies with low retention volumes are less hydrophobic than those with high retention volumes (Figure 1C). The newly designed antibodies C0115 and C0118 were shown to be less hydrophobic (retention volume 15-16 ml) compared to the control antibody C0008, which exhibited very high hydrophobicity (retention volume approximately 21 ml). The Fc-silencing mutations in the newly designed antibodies C0115 and C0118 did not alter their HIC profiles compared to their parent antibodies C0083 and C0090, respectively, which possess wtFc.

[0227] Conclusion: SEC and HIC analyses reveal that the newly designed antibodies have improved biochemical properties, specifically reduced hydrophobicity and aggregation tendency, compared to the control anti-oxMIF antibody C0008.

[0228] [Table 8]

[0229] Figure 1 shows chromatographic profiles demonstrating the reduced aggregation and hydrophobicity of the newly designed anti-oxMIF antibodies. (A) Comparison of the elution profiles of C0008 (control antibody, gray area) and the parent antibodies (C0083 and C0090, without Fc silencing) of the newly designed antibodies C0115 and C0118 on an Enrich 650 gel filtration column using 1x PBS as the mobile phase; (B) Comparison of the elution profiles of C0008 (control antibody, gray area) and the newly designed antibodies C0115 and C0118 on an Enrich 650 gel filtration column using 1x PBS as the mobile phase; (C) Comparison of the elution profiles of C0008 (control antibody, gray area), the newly designed antibodies C0115 and C0118, and their parent antibodies C0083 and C0090 (without Fc silencing) on ​​a HiTrap Butyl HP HIC column.

[0230] Example 3: Binding of newly designed anti-oxMIF antibodies to immobilized MIF (K D decision). Recombinant human MIF diluted in PBS at 1 μg / ml was immobilized on an ELISA plate overnight at 4°C (MIF was converted to oxMIF according to Thiele et al., 2015). After blocking, serial dilutions of anti-oxMIF antibody were added to the plate. Finally, bound antibody was detected using a goat anti-human IgG (Fc)-HRP conjugate and tetramethylbenzidine (TMB) as a substrate. The color reaction was stopped with 3 M H2SO4, and the OD was measured at 450 nm. Data from different experiments were normalized to the maximum OD (=100%) of the anti-oxMIF antibody C0008 in each experiment, and EC 50 Values ​​were determined by a four parameter fit using GraphPad Prism (means + / - SEM of two experiments are shown).

[0231] Results and conclusions: The binding of the newly designed antibodies to immobilized MIF (oxMIF) was measured over a wide range of concentrations, and the resulting binding curves are shown in Figure 2. Anti-oxMIF antibody C0008 was used as a reference for oxMIF binding. Binding curves and K D Represents the calculated EC 50 The values ​​clearly showed that the newly designed antibodies C0115 and C0118 retained their low nanomolar affinity for oxMIF compared to C0008 (Figure 2, Table 7).

[0232] Figure 2 shows the binding curves (K D Anti-oxMIF antibodies were detected by anti-human IgG(Fc)-HRP conjugate, and C0008 was used as the reference antibody. EC 50 Values ​​were determined by a sigmoidal 4-parameter equation using GraphPad Prism (means + / - SEM of two experiments are shown).

[0233] [Table 9]

[0234] Example 4: Differential binding of newly designed anti-oxMIF antibodies to oxMIF compared to redMIF Anti-oxMIF antibodies and human IgG isotype controls were immobilized on microplates at a concentration of 15 nM overnight at 4°C. After blocking, wells were incubated with 50 ng / ml redMIF or the oxMIF surrogate NTB-MIF (Schinagl et al., 2018). Captured oxMIF was detected with a polyclonal rabbit anti-MIF antibody and goat anti-rabbit IgG-HRP. Plates were stained with tetramethylbenzidine (TMB), and the color reaction was stopped by adding 30% H2SO4. OD was measured at 450 nm. Data from different experiments were normalized to the maximum OD (=100%) of the anti-oxMIF antibody C0008 in each experiment. Means + / - SEM of two or three experiments are shown.

[0235] Results and Conclusions: The binding of the newly designed antibodies to soluble oxMIF and redMIF is shown in Figure 3. The results clearly demonstrated that the newly designed antibodies C0115 and C0118 strongly bound to oxMIF but not to redMIF. The newly designed antibodies exhibited very similar ODs to the reference antibody C0008, which has been described to distinguish between oxMIF and redMIF (Thiele et al., 2015). No binding was observed with the IgG isotype. Thus, the newly designed antibodies with reduced hydrophobicity and aggregation, as well as Fc silencing, retained their ability to distinguish between oxMIF and redMIF.

[0236] Figure 3 shows the differential binding of the newly designed antibodies to oxMIF compared to redMIF. C0008 was used as the reference antibody and isotype IgG as a negative control. Means + / - SEM of two or three experiments are shown.

[0237] Example 5: Strongly reduced effector functions of newly designed anti-oxMIF antibodies C0115 and C0118 determined by reporter assay As mentioned above, efforts have been made to reduce the ADCC and ADCP capabilities of antibodies by point mutations in the Fc portion, i.e., L234A / L235A. If the Fc portion of a target-binding antibody also binds to Fc receptors on the cell surface of effector cells, multiple cross-linking of the two cell types can occur, leading to activation of the ADCC or ADCP pathways, which is undesirable for a target-neutralizing antibody to prevent functional Fc-related adverse events.

[0238] Using engineered Jurkat cells stably expressing either human FcγRIIIa V158 (high affinity genotype) to elicit ADCC or human FcγRIIa-H131 to elicit ADCP as effector cells, and NFAT response element-driven expression of firefly luciferase, antibody biological activity was quantified by luciferase produced as a result of NFAT pathway activation in the effector cells.

[0239] ADCC or ADCP reporter assays were performed essentially as recommended by the manufacturer (Promega #G7010 and #G9991).

[0240] To generate highly responsive target cells, HCT116 and A2780 cells were transfected with the huMIF-pDisplay plasmid (Invitrogen), selected with Geneticin, and sorted by FACS to generate cell lines (HCT116-pMIF or A2780-pMIF) stably expressing membrane-tethered monomeric human MIF, i.e., MIF is presented as a monomeric protein in which the oxMIF epitope is accessible to anti-oxMIF antibodies (Schinagl et al., Biochemistry 2018). These cell lines exhibit increased cell surface presentation of oxMIF and are therefore sensitive tools for in vitro analysis. Briefly, 1 x 10 cells were cultured in 100 μl of culture medium (RPMI 1640 medium supplemented with Pen / Strept / L-Glutamine and 4% low-IgG FBS). 4HCT116-pMIF (Figures 4A and 4C) or A2780-pMIF (Figure 4B) cells / well were seeded into 96-well plates and allowed to adhere overnight in a humidified incubator at 37°C / 5% CO. The next day, the culture medium was removed and replaced with 25 μl of fresh culture medium. 25 μl of serial dilutions of the newly designed Fc-silenced anti-oxMIF antibodies C0115 and C0118, or their parent antibodies C0083 and C0090, and the control antibody C0008 with wtFc (final concentrations of 0.01–100 nM) were added to 25 μl of Jurkat effector cells (Figure 4A–B, highly responsive FcγRIIIa receptor effector cells of genotype V158; Figure 4C, FcγRIIa receptor effector cells) at an effector-to-target cell ratio of approximately 6:1. The cells were incubated with the antibodies and effector cells for 6 hours at 37°C / 5°C CO2 in a humidified incubator. Finally, the assay plate was equilibrated to room temperature, and 75 μl of Bio-Glo Luciferase Reagent was added. Luminescence (RLU) was measured after 10-20 min of incubation (0.5 s integration time) using a Tecan multiplate reader. Data (where appropriate) were fit to a sigmoidal 4-parameter equation using GraphPad Prism (means + / - SD of two replicates are shown).

[0241] Results: The newly designed antibodies C0115 and C0118 with Fc-silencing mutations did not activate any reporter cells in ADCC (Figures 4A-B) or ADCP (Figure 4C) reporter assays, whereas the control antibody C0008 (Figure 4B) and their parental antibodies with wtFc, C0083 and C0090 (Figure 4A), induced strong FcyRIIIa (ADCC, Figures 4A-B) or FcyRIIa (ADCP, Figure 4C)-mediated activation of effector cells, as evidenced by Figures 4A-C.

[0242] Conclusion: The newly designed mutants C0115 and C0118 carrying Fc-silencing mutations (L234A / L235A) did not show either ADCC or ADCP initiation in reporter bioassays, thus demonstrating strongly reduced ADCC and ADCP effector functions.

[0243] FIG. 4 shows the strongly reduced effector function of the newly designed Fc-silenced antibodies C0115 and C0118 as determined by reporter assay. (A-B) ADCC reporter bioassay with the newly designed Fc-silenced antibodies C0115 and / or C0118 using engineered Jurkat effector cells stably expressing FcyRIIa and HCT116-pMIF (A) or A2780-pMIF (B) target cells compared to either the anti-oxMIF control antibody C0008 (B) or their parent antibodies C0083 and C0090 (A) with wtFc; (C) ADCP reporter bioassay with the newly designed Fc-silenced antibodies C0115 and / or C0118 using engineered Jurkat effector cells stably expressing FcyRIIa and HCT116-pMIF target cells compared to their parent antibodies C0083 and C0090 with wtFc. Data were fit to a sigmoidal four-parameter equation using GraphPad Prism (means + / - SD of two replicates are shown).

[0244] Example 6: Strongly reduced complement-dependent cytotoxicity (CDC) function of the newly designed anti-oxMIF antibody C0115 as determined by CDC assay This assay was performed to determine cell lysis resulting from antibody-driven complement-dependent cytotoxicity (CDC) induced by a newly designed anti-oxMIF antibody. Cytotoxicity was measured by the HiBiT detection assay (Promega), which quantifies the release of HiBiT-tagged proteins from target cells using a non-lytic detection reagent containing LgBiT (LargeBiT) and furimazine (substrate). HiBiT and LgBiT spontaneously assemble into functional NanoBiT® enzymes, which emit a quantifiable luminescent signal in the presence of substrate.

[0245] To generate highly responsive reporter target cells, HCT116 cells were transfected with the HaloTag-HiBiT plasmid (Promega #CS1956B17), selected with blasticidin, and sorted as cell pools by FACS. The stable HiBiT-expressing cell pool was then transfected with the huMIF-pDisplay plasmid (Invitrogen), selected with geneticin, and sorted by FACS to generate a cell pool (HCT116-HiBiT-pMIF) stably expressing intracellular HiBiT and membrane-tethered monomeric human MIF. This means that MIF is presented as a monomeric protein in which the oxMIF epitope is accessible to anti-oxMIF antibodies (Schinagl et al., Biochemistry 2018). These cell lines exhibit increased cell surface presentation of oxMIF and are therefore sensitive tools for in vitro analysis.

[0246] Briefly, 1 × 10 cells were cultured in 100 μl of culture medium (RPMI 1640 medium supplemented with Pen / Strept / L-Glutamine and 10% FBS). 4HCT116-HiBiT-pMIF cells were seeded at 100 cells / well into a 96-well plate and allowed to adhere overnight in a humidified incubator at 37°C and 5% CO2. The next day, culture medium was removed, and 50 μl of serum-free RPMI 1640 was added. 50 μl of serial dilutions of the newly designed Fc-silenced anti-oxMIF antibody C0115 or its parent antibody C0083 with wtFc, and nivolumab (human IgG4, negative control) (final concentrations 1-100 nM) in serum-free RPMI 1640 were added. After incubation of the antibodies with the cells at 37°C for 30 minutes, 50 μl of baby rabbit complement (BRC, Sedarlane, diluted 1:10 in serum-free RPMI immediately before the assay) was added to the plate. After complement addition, plates were incubated overnight in a humidified incubator at 37°C and 5% CO2. The following day, 10 μl of Nano-Glo HiBiT Extracellular Detection Reagent (Promega #N2421) was added, and luminescence signals (RLU, 0.1 s integration time) were measured 3 minutes later using a Tecan plate reader. Data (where appropriate) were fit to a sigmoidal four-parameter equation using GraphPad Prism (means + / - SD of two replicates are shown).

[0247] Results and Conclusions: Figure 5 clearly shows that the newly designed antibody C0115 with Fc-silencing mutations (L234A / L235A) did not induce CDC activity, and the measured signal was even lower than that of the negative control (nivolumab, IgG4). In contrast, the parent antibody C0083 with wtFc showed complement-dependent cytolysis of HCT116-pMIF cells, as expected for human IgG1. Therefore, the newly designed antibody C0115 with Fc-silencing mutations (L234A / L235A) exhibits strongly reduced CDC activity.

[0248] Figure 5 shows the strongly reduced CDC activity of the newly designed Fc-silenced antibody C0115, as determined by a complement-dependent cytotoxicity bioassay. CDC bioassays with the newly designed Fc-silenced antibody C0115, using BRC as the complement source and HCT116-pMIF as the target cells, were compared with its parent anti-oxMIF antibody C0083 with a wtFc and nivolumab as an IgG4 negative control. Data (where appropriate) were fit to a sigmoidal four-parameter equation using GraphPad Prism (mean + / - SD of two replicates is shown).

[0249] Example 7: Strongly reduced ADCC function of newly designed anti-oxMIF antibodies C0115 and C0118 as determined by PBMC cytolytic bioassay This assay was performed to determine cell lysis resulting from antibody-dependent cellular cytotoxicity (ADCC) induced by a newly designed anti-oxMIF antibody. Cytotoxicity was measured by the HiBiT detection assay (Promega), which quantifies the release of HiBiT-tagged proteins from target cells using a non-lytic detection reagent containing LgBiT (LargeBiT) and furimazine (substrate). HiBiT and LgBiT spontaneously assemble into functional NanoBiT® enzymes, which emit a quantifiable luminescent signal in the presence of substrate.

[0250] HCT116-HiBiT-pMIF reporter target cells were generated as described in Example 6.

[0251] Briefly, 1 × 10 cells were cultured in 50 μl of culture medium (RPMI 1640 medium supplemented with Pen / Strept / L-Glutamine and 5% ultra-low IgG FBS (Thermo Scientific)). 4HCT116-HiBiT-pMIF target cells were seeded at 1000 cells / well in a 96-well plate and allowed to adhere overnight in a humidified incubator at 37°C / 5% CO2. The following day, serial dilutions of the newly designed Fc-silenced anti-oxMIF antibodies C0115 and C0118 or the parent antibody of C0115 (C0083 with wtFc) and / or the reference antibody C0008 with wtFc (final concentrations of 0.01-100 nM) in 50 μl of culture medium were added to 50 μl of human PBMC effector cells (4 × 10) from two healthy donors. 5 Cells / well (effector-to-target cell ratio 40:1) were added to the plate. After antibody and PBMC addition, the plate was incubated overnight at 37°C and 5% CO in a humidified incubator. The next day, 10 μl of Nano-Glo HiBiT Extracellular Detection Reagent (Promega #N2421) was added, and luminescence signals (RLU, 0.1 s integration time) were measured 3 minutes later using a Tecan plate reader.

[0252] Results and Conclusions: It is clear from Figure 6 that the newly designed antibodies C0115 and C0118, which carry Fc-silencing (L234A / L235A) mutations, exhibit no or strongly reduced ADCC activity. In contrast, the parent antibody of C0115 (C0083, with wtFc) and the control anti-oxMIF antibody C0008 with wtFc exhibited antibody-dependent cell lysis of HCT116-HiBiT-pMIF cells, as expected for a human IgG1. Therefore, the newly designed antibody C0115, which carries Fc-silencing (L234A / L235A) mutations, exhibits strongly reduced ADCC activity.

[0253] Figure 6 shows the strongly reduced ADCC activity of the newly designed Fc-silenced antibodies C0115 and C0118, as determined by a PBMC-mediated cytotoxicity bioassay. Using PBMCs as effector cells and HCT116-HiBiT-pMIF as target cells, the ADCC bioassay with the newly designed Fc-silenced antibodies C0115 (A) and C0118 (B) was compared with the anti-oxMIF control antibody C0008 (B) and the parent anti-oxMIF antibody of C0115 with wtFc, i.e., C0083 (A). The mean and SEM of two replicates using PBMCs from two healthy donors are shown. Data were fit to a sigmoidal four-parameter equation using GraphPad Prism.

[0254] Example 8: A2780 MIF - / - Reduced non-specific binding of newly designed anti-oxMIF antibodies C0115 and C0118 to cells Materials and Methods. A2780MIF - / - Cell lines were generated by CRISPR / Cas9 gene editing of the human MIF gene in the A2780 ovarian cancer cell line. Briefly, the target gene sequence was analyzed, and the target site was positioned according to the standard design rules for targeting guide RNAs (gRNAs) in the GenCRISPR™ system. The guide RNA (gRNA) was designed to specifically recognize the 5' region of the MIF gene (TTGGTGTTTACGATGAACATCGG, SEQ ID NO: 40), and the gRNA sequence was cloned into the PX459 (Addgene) vector containing the S. pyogenes Cas9 (SpCas9) nuclease. A2780 cells were transiently transfected by electroporation and plated into 96-well plates by limiting dilution to generate isogenic single clones. Isogenic single clones in which the endogenous MIF gene was effectively mutated, resulting in reduced (or eliminated) expression of MIF protein, were identified by Sanger sequencing screening. The final clone showed a 10 bp deletion at position +2 after the start codon of the human MIF gene. A2780MIF - / -The absence of endogenous human MIF protein in the cell lines was confirmed by Western blotting using a polyclonal anti-human MIF antibody.

[0255] A2780MIF - / - The cells were detached using a Cell Stripper (Corning, Cat#25-056-C1), washed with staining buffer (PBS + 5% BSA), and plated at 2 × 10 cells per well in a 96-well U-bottom plate. 5 Cells were plated on 1000 wells. Cells were stained with the fixable viability dye eFluor 780 (ThermoFisher, 1:2000 dilution in PBS) for 20 minutes at 4°C and washed with staining buffer. Cells were resuspended in 50 μl of staining buffer and 50 μl of serial dilutions of the newly designed anti-oxMIF antibodies C0115 and C0118 or their parent antibodies C0083 and C0090, respectively, or the control anti-oxMIF antibody C0008 or isotype IgG (final concentrations 37 nM to 9.4 nM) was added. After 40 minutes of incubation at 4°C, cells were washed with staining buffer and resuspended in 100 μl of secondary antibody (goat anti-human IgG (H+L)-AlexaFluor 488, 1:100 dilution). After a 30 minute incubation at 4°C, cells were washed with staining buffer, resuspended in PBS + 2% BSA, and acquired on a CytoFlex-S flow cytometer (Beckman Coulter).

[0256] Data were analyzed using FlowJo (BD), and GeoMean (mean fluorescence intensity in the AF488 channel) of viable cells was plotted against antibody concentration using GraphPad Prism.

[0257] Results and conclusions: The newly designed anti-oxMIF antibody C0118 and its parent antibody C0090 (A) and C0118 and its parent antibody C0083 (B) demonstrated the A2780 MIF activity, as their GeoMean values ​​were very close to that of the isotype IgG negative control. - / - 7A and B clearly show that the anti-oxMIF antibody C0008 does not bind to A2780MIF cells.- / - The A2780 showed significant binding to cells that did not express MIF. Therefore, the reduction in hydrophobicity was - / - This resulted in a strong reduction or elimination of non-specific binding of the newly designed anti-oxMIF antibody to the cell surface, whereas the anti-oxMIF control antibody C0008 binds non-specifically to the cell surface due to its hydrophobicity.

[0258] Figure 7 shows the A2780 MIF determined by FACS. - / - Figure 1 shows the reduced non-specific binding of newly designed anti-oxMIF antibodies to cells. Figure 2 shows the reduced non-specific binding of newly designed anti-oxMIF antibodies C0118 and its parent antibody C0090 (A) and C0115 and its parent antibody C0083 (B) to A2780 MIF cells with control antibody C0008 and isotype IgG as a negative control. - / - Cell staining; GeoMean (mean fluorescence intensity in the AF488 channel) of viable cells was plotted against antibody concentration.

[0259] Example 9: Strongly reduced non-specific cytokine release from human PBMCs by the newly designed anti-oxMIF antibody C0115 Cytokine release syndrome (CRS) is a form of systemic inflammatory response syndrome (SIRS) that can be triggered by various factors, such as infection. CRS is also known as an adverse effect of some monoclonal antibody drugs. CRS occurs when many leukocytes, including B cells, T cells, natural killer cells, macrophages, dendritic cells, and monocytes, become activated and release proinflammatory cytokines, such as IL-6, IFN-γ, IL-8, and MCP-1, which activate more leukocytes in a positive feedback loop of pathogenic inflammation. If this process becomes dysregulated, it can lead to life-threatening systemic hyperinflammation, hypotensive shock, and multiple organ failure. Therefore, we evaluated the ability of the newly designed anti-oxMIF antibody C0115 to induce proinflammatory cytokine release from PMBCs in an in vitro assay.

[0260] Materials and Methods: The newly designed anti-oxMIF antibody C0115 and the anti-oxMIF reference antibody C0008 were incubated with freshly thawed PBMCs (4-5 × 10 per well) from three healthy donors in RPMI 1640 medium supplemented with 150 μl of 5% ultra-low IgG serum in a 96-well plate. 5 Cells were incubated with 100 μg of 10 ... Data were analyzed using LegendPlex analysis software (BioLegend) and graphs were generated in GraphPad Prism. Mean + / - SEM from three different PMBC donors is shown.

[0261] Results and Conclusions: As can be seen from Figure 8, the newly designed antibody C0115, which contains manufacturing mutations in the variable region and Fc silencing mutations (L234A / L235A), showed undetectable or minimal release of MCP-1, IL-6, and TNF-α from PBMCs at concentrations up to 70 nM. The reference anti-oxMIF antibody C0008 induced significant release of MCP-1, IL-6, and TNF-α at the highest concentration (70 nM), consistent with its high aggregation tendency and nonspecific binding due to its hydrophobicity. Aggregation of antibody therapeutics, even if slight, is known to strongly enhance cytokine release from immune cells.

[0262] Figure 8 shows that the newly designed anti-oxMIF antibody C0115 exhibits significantly reduced cytokine release from human PBMCs compared with the reference antibody C0008. Anti-oxMIF antibody C0115 with Fc silencing mutations and the reference anti-oxMIF antibody C0008 were incubated overnight with human PBMCs over a wide concentration range (70 nM, 7 nM, 0.7 nM, and 0.07 nM), and the supernatants were analyzed for human MCP-1 (A), human IL-6 (B), and human TNF-α (C) using a LegendPlex cytometric bead assay (BioLegend). Cytokine concentrations (units: pg / ml) from three different PBMC donors are shown, with the mean ± SEM.

[0263] Example 10: Biodistribution of the newly designed anti-oxMIF antibody C0115 and control antibody C0008 in Balb / c nude mice bearing xenografted human HCT116 colon cancer tumors Materials and Methods: The biodistribution of the newly designed anti-oxMIF antibody C0115 was investigated in comparison with the reference anti-oxMIF antibody C0008 in female Balb / c nude mice bearing subcutaneous tumors of human colon cancer cell line HCT116. Female Balb / c nude mice were injected with 5 × 10 β-glucan in 50% PBS and 50% Matrigel in a total injection volume of 100 μl. 6 Each mouse received a subcutaneous injection of 100 HCT116 cells. Each tumor volume was 150–300 mm. 3 Once this was reached, mice were assigned to treatment groups and received a single intravenous dose of 5 mg / kg IRDye 800CW-labeled C0115 and C0008.

[0264] C0115 and C0008 were labeled with IRDye800CW using the IRDye800CW Protein Labeling Kit (High MW, LI-COR Biosciences) according to the manufacturer's instructions. After the labeling process and before injecting the labeled antibody into mice, the protein concentration and labeling efficiency of the IRDye800CW-labeled antibody were determined using Nanodrop technology, and mice were dosed based on the protein concentration after labeling. In vivo imaging was performed with a LI-COR Pearl® Trilogy imaging system at the following time points: 1, 6-8, 24, 48, 72, 96, and 168 hours post-administration of the labeled antibody. Image analysis was performed to quantify the relative fluorescence units (RFU) of the antibody in the tumor (RFU / area = RFU tumor area / mm). 2 Tumor area-RFU background / mm 2 background area).

[0265] Results and Conclusions: Figure 9 shows significant intratumoral distribution of intravenously administered IRDye 800CW-labeled C0115 and C0008, respectively, with tumor retention up to 7 days. Compared to the reference anti-oxMIF antibody C0008, which peaked at approximately 24 hours, it is evident from Figure 9(A) and quantitative image analysis (Figure 9(B)) that tumor uptake of the newly designed anti-oxMIF antibody C0115 is strongly enhanced and increased over 7 days.

[0266] Figure 9 shows tumor penetration and retention of the newly designed anti-oxMIF antibody C0115 and reference antibody C0008 by infrared in vivo imaging of mice bearing subcutaneous HCT116 tumors. A: Infrared images of mice were taken 1, 6, 24, 48, 72, 96, and 168 hours after injection of IRDye 800CW-labeled antibodies C0115 (top panel) and C0008 (bottom panel) administered at 5 mg / kg; (B) Tumor penetration and retention of C0115 and C0008 quantified by digital image analysis. Averages for three mice are shown.

[0267] Example 11:

[0268] [Table 10-1]

[0269] [Table 10-2]

[0270] [Table 10-3]

[0271] [Table 10-4]

[0272] [Table 10-5]

[0273] Example 12: Efficacy of C0115 antibody in a collagen II-induced arthritis (CIA) mouse model Materials and Methods: This study used 8-9 week-old male DBA / 1j (Harlan Laboratories, Italy) mice (weight range: 18-20 g). Bovine type II collagen (CII; Chondrex, USA) was dissolved at 2 mg / ml in 0.05 M acetic acid by gentle overnight stirring at 4°C. CFA (complete Freund's adjuvant) was prepared by adding Mycobacterium tuberculosis H37Ra (Difco, Detroit, MI) to IFA (incomplete Freund's adjuvant; Sigma-Aldrich, Milano, Italy) at a concentration of 2 mg / ml. Before injection, CII was emulsified with an equal volume of CFA. To induce CIA, mice were injected intradermally at the base of the tail with 100 μl of the resulting emulsion containing CII and CFA (100 μg / mouse). On day 21, a second booster of 100 μl of CII in IFA (100 μg / mouse) was administered. At the onset of disease (arthritis score ranging from 1 to 2), mice were treated twice weekly (ip) for 20 days with vehicle, isotype control IgG1 (40 mg / kg), C0115 (20 mg / kg), or a daily injection of standard treatment dexamethasone (0.3 mg / kg). At the end of treatment, animals were euthanized, blood was collected, and tissues (front and rear paws) were harvested. Clinical severity of arthritis was assessed by monitoring body weight and paw thickness (all four paws, using a pachymeter) twice weekly. Paw thickness index was determined by calculating the area under the curve (AUC) of the sum of the thickness of each of the four paws for each mouse during treatment. The arthritis score for each mouse's four paws ranged from 0 to 4 and was scored as follows: 0 = no signs of arthritis; 1 = swelling and / or redness of the paw or one toe; 2 = involvement of two joints; 3 = involvement of more than two joints; 4 = severe arthritis of the entire paw and toes (resulting in a maximum score of 12 per mouse). The cumulative disease score for each mouse was calculated for each individual mouse by summing the scores over the treatment period. Calculations were performed in GraphPad Prism, and statistical analysis used standard one-way ANOVA followed by Fisher's LSD test.

[0274] Results and Conclusions: Figure 10 demonstrates that treatment with C0115 at 20 mg / kg resulted in significant improvements in disease score (A) and paw edema (B) compared to the vehicle-treated group. These effects (particularly the reduction in paw thickness) were comparable to treatment with high doses of the standard of care corticosteroid drug dexamethasone (0.3 mg / kg). The isotype control (IgG)-treated group did not experience a reduction in disease score. All treatment groups experienced similar changes in body weight over the course of the disease.

[0275] Figure 10 shows that the newly designed Fc-silenced anti-oxMIF antibody C0115 ameliorates disease severity in a collagen II-induced DBA / 1j mouse arthritis model. Cumulative disease score (A) and paw thickness (B) were assessed in the mouse arthritis model upon treatment with C0115 (20 mg / ml), high-dose dexamethasone (0.3 mg / kg) as a standard-of-care corticosteroid, or vehicle. Statistical analysis was performed using a standard one-way ANOVA followed by Fisher's LSD test in GraphPad Prism V9.4 (Figure 10). * p<0.05; ** p<0.01; *** p<0.001).

[0276] Example 13: Efficacy of C0115 antibody in a rat model of glomerulonephritis (GN) Materials and Methods: The efficacy of the newly designed Fc-silenced anti-oxMIF antibody C0115 was evaluated in NTN in WKY rats. This model has a rapid onset of disease accompanied by macrophage infiltration, fibrin deposition, and tissue destruction (Tam, FWK, et al., 1999). The time course and morphology of this model closely resemble crescentic glomerulonephritis in humans. This model is highly robust, with all animals developing nephritis after induction by injection of nephrotoxic serum (NTS). Glomerulonephritis was induced in male WKY rats (weight range: 190-220 grams) by intravenous injection of 100 μl of rabbit anti-rat NTS (nephrotoxic serum). On days 4 and 6 after NTS injection, animals were treated (ip) with vehicle, isotype control IgG1, or C0115 (30 mg / kg). Urine was collected on days 0 (baseline), 4 (disease onset), and 7 (post-treatment). At the end of the study (day 8), animals were euthanized and blood and tissues (kidneys, liver, spleen, and lungs) were collected. Histological (crescent counts; ED-1 macrophage staining, rat and rabbit IgG deposition) and biochemical (proteinuria and hematuria) analyses were performed to assess disease severity. Statistical analysis was performed in GraphPad Prism V9.4 using conventional one-way ANOVA followed by Dunnett's correction for multiple testing ( * p<0.05, ** p<0.01; *** p<0.001, **** p<0.0001).

[0277] Results and Conclusions: Treatment with C0115 (30 mg / kg) significantly ameliorated disease as evidenced by a reduction in hematuria, proteinuria, and glomerular macrophage infiltration compared to the vehicle-treated group (Figure 11). Treatment with isotype control IgG did not reduce hematuria compared to the vehicle group.

[0278] Figure 11 shows that the newly designed Fc-silenced anti-oxMIF antibody C0115 ameliorates disease severity in a nephrotoxic serum (NTS)-induced rat glomerulonephritis model. Urinary hematuria (dipstick) (A), proteinuria (B), and glomerular macrophage infiltration (C) were assessed in the rat glomerulonephritis model upon treatment of diseased rats with anti-oxMIF antibody C0115, isotype control IgG1, or vehicle. Mean ± SEM is shown, and statistical analysis was performed using ordinary one-way ANOVA followed by Dunnett's correction for multiple testing in GraphPad Prism V9.4 (Figure 11). * p<0.05, *** p<0.001, **** p<0.0001).

[0279] Example 14: Binding of bispecific antibodies (bsMab) C0132 and C0133 (anti-oxMIF x anti-HSG) to oxMIF Materials and Methods: Recombinant human MIF (MIF converted to oxMIF according to Thiele et al., 2015) diluted in PBS was immobilized on ELISA plates overnight at 4°C. After blocking, serial dilutions of antibody were added to the plates, and ELISA was performed as described in Example 3.

[0280] Results and conclusions: The binding of the C0132 and C0133 antibodies to immobilized MIF (oxMIF) was measured over a wide range of concentrations, and the resulting binding curves are shown in Figure 13. The anti-oxMIF antibody C0008 was used as a reference antibody for bivalent oxMIF binding. Binding curves and calculated EC 50 The values ​​indicate that C0133, a bsMab with two anti-oxMIF arms, binds to oxMIF with similar affinity to C0008 (EC 50 = 242 pM (C0133) and 158 pM (C0008)), whereas C0132, a bsMab with only one anti-oxMIF arm, exhibited higher EC values ​​for oxMIF due to the loss of the avidity effect. 50 The binding was clearly demonstrated with a value of 2508 pM.

[0281] Figure 12: Schematic diagram of the newly designed Fc-silenced anti-oxMIF x anti-HSG bispecific antibodies (bsMabs), C0132 (Fab / scFv-Fc) and C0133 (Fab / Fab-scFv-Fc).

[0282] Figure 13 shows the binding curves of the newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 to immobilized oxMIF. Bound antibodies were detected with an anti-human IgG (Fc)-HRP conjugate, and C0008 was used as a reference antibody for bivalent binding to oxMIF. Data were fit to a sigmoidal four-parameter equation using GraphPad Prism (mean + / - SEM of two replicates is shown).

[0283] Example 15: Differential binding of C0132 anti-oxMIF x anti-HSG bsMab and C0133 anti-oxMIF x anti-HSG bsMab to oxMIF compared to redMIF Materials and Methods: Anti-oxMIF × anti-HSG bsMAbs C0132 and C0133, reference anti-oxMIF mAb C0008, and a human IgG1 isotype control were immobilized overnight at 4°C on microplates (15 nM for oxMIF bivalent antibodies and 30 nM for oxMIF monovalent antibodies). After blocking, wells were incubated with 50 ng / ml (approximately 1.3 nM) of redMIF or the oxMIF surrogate NTB-MIF (Schinagl et al., 2018). Captured oxMIF was detected with a polyclonal rabbit anti-MIF antibody and goat anti-rabbit IgG-HRP. Plates were stained with tetramethylbenzidine (TMB), and the color reaction was stopped by adding 30% H2SO4. OD was measured at 450 nm.

[0284] Results and Conclusions: The binding of C0132 and C0133 to soluble oxMIF and redMIF is shown in Figure 14. The results clearly demonstrated that both C0132 and C0133 strongly bound to oxMIF but not to redMIF. The newly designed antibodies showed very similar OD values ​​to the reference antibody C0008, which has been described to distinguish between oxMIF and redMIF (Thiele et al., 2015). No binding was observed with isotype IgG. Thus, the anti-oxMIF x anti-HSG bsMAbs C0132 and C0133 retained the ability to distinguish between oxMIF and redMIF.

[0285] Figure 14 shows the differential binding of newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 to oxMIF compared to redMIF. C0008 was used as the reference anti-oxMIF antibody. Means and SEM of three replicates are shown.

[0286] Example 16: Biodistribution of newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 in Balb / c mice bearing syngeneic CT26 colon tumors

[0287] Materials and Methods: The biodistribution of the newly designed Fc-silenced anti-oxMIF × anti-HSG bsMAbs C0132 and C0133 was investigated in female Balb / c mice bearing subcutaneous tumors of the murine colon carcinoma CT26 cell line. Female Balb / c mice were injected with 3 × 10 β-lactams in PBS in a total injection volume of 100 μl. 6 Each mouse received a subcutaneous injection of CT26 cells. Each tumor volume was 150–300 mm. 3 Once this was reached, mice were assigned to treatment groups and received a single intravenous dose of 5 mg / kg IRDye 800CW-labeled C0132 or IRDye 800CW-labeled C0133, or no treatment (control group).

[0288] C0132 and C0133 were labeled with IRDye800CW using the IRDye800CW Protein Labeling Kit (high MW, LI-COR Biosciences) according to the manufacturer's instructions. After the labeling process and before injecting the labeled antibody into mice, the protein concentration and labeling efficiency of the IRDye800CW-labeled antibody were determined using Nanodrop technology, and mice were dosed based on the protein concentration after labeling. In vivo imaging was performed with a LI-COR Pearl® Trilogy imaging system (performed at an excitation wavelength of 785 nm and an emission wavelength of 820 nm) at the following time points: 1 hour, 8 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours, and 168 hours after administration of the labeled antibody.

[0289] Results and Conclusions: Figure 15 shows significant intratumoral distribution of intravenously administered IRDye 800CW-labeled C0132 and C0133, respectively, with tumor retention up to day 7. It is evident from Figure 15 that the infrared signal observed in the tumor was above background at 1 hour post-injection and at all subsequent imaging time points, indicating preferential accumulation of the antibody in the tumor.

[0290] Figure 15 shows tumor penetration and retention of the newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 as assessed by infrared in vivo imaging in mice bearing subcutaneous syngeneic CT26 tumors. Infra-red images of mice were taken at 1, 8, 24, 48, 72, 96, and 168 hours after injection of IRDye 800CW-labeled antibody administered at 5 mg / kg.

[0291] Example 17: Anti-oxMIF x anti-HSG bispecific antibodies (bsMabs) C0132 and C0133 and their analogs in a syngeneic CT26 colon cancer mouse model in Balb / c mice 177 Pretargeted Radioimmunotherapy (PRAIT) using Lu-labeled IMP288

[0292] In this example, the efficacy of newly designed Fc-silenced bispecific anti-oxMIF x anti-HSG antibodies C0132 and C0133 was evaluated using the HSG hapten IMP288 (as described in US2005 / 0025709) and the radionuclide 177 IMP288, along with IMP288, was evaluated using the PRAIT approach. IMP288 is a DOTA-conjugated D-Tyr-D-Lys-D-Glu-D-Lys-NH2 tetrapeptide in which both lysine residues are derivatized with HSG moieties via the ε-amino groups (Figure 16A). The DOTA chelating group of IMP288 is 177 It is specifically designed for use with radiometals, including Lu.

[0293] Materials and Methods: The in vivo efficacy of pre-RAIT was evaluated in Balb / c mice bearing subcutaneous CT26 murine colorectal cancer tumors. IMP288 (Genepep, France) has a specific activity of approximately 220 MBq / nmol. 177 The IMP288 was labeled with 1000 1111 Lu and showed a radiochemical purity (RCP) of 95% or greater. Briefly, IMP288 was diluted with sterile water to a final concentration of 1 mM (1.45 mg / ml). A 1 / 10 dilution of the IMP288 stock solution was performed in 2-(N-morpholino)ethanesulfonic acid (MES) buffer (500 mM, pH 5.5). 5 mCi (185 MBq) of IMP288 in 0.04 N HCl was used. 177 LuCl3 (EndolucinBeta®, ITG, Germany) was added to the radiolabeling vial, followed by the addition of 40 μl of MES buffer (250 mM, pH 5.5) and 0.84 nmol of diluted IMP288 solution (8.4 μl). The reaction mixture was incubated at 95°C for 15 min. Afterwards, 5 μl of 10 mM diethylenepentadiaminetetraacetic acid sodium salt (DTPA-Na) was added to remove unincorporated ATP. 177Lu was complexed and the solution was diluted to 370 MBq / mL in 0.9% NaCl / 10 g / L ascorbate / 0.05% (m / v) BSA. Chelation efficiency and binding to C0132 and C0133 were analyzed by iTLC (instant thin layer chromatography, Agilent Technology, SGI001). Briefly, 1.68 nmol / mL of IMP288 was obtained, corresponding to 220 MBq / nmol and 0.084 nmol of IMP288. 177 50 μl of Lu-IMP288 solution was mixed with a 10-fold molar excess of each bsMab (0.84 nmol), and each reaction was incubated at 37°C for 30 minutes under gentle agitation. 177 Lu-IMP288 solution and 177 The Lu-IMP288-bsMab solution was applied to an iTLC strip and eluted with a 1:1 (v / v) solution of 0.15 M ammonium acetate (pH 5.5):MeOH. After elution, the iTLC plate was exposed to a phosphorus screen (MS, BAS-IP, Fujifilm 2025) and revealed using a Typhoon IP (Amersham) and associated software, ImageQuant TL version 8.2.

[0294] CT26 murine colorectal carcinoma (ATCC-CRL-2638) cells were expanded in RPMI 1640 medium supplemented with 10% heat-inactivated FBS and 2 mM glutamine at 37°C / 5% CO2. A suspension of CT26 cells was prepared in sterile PBS at a concentration of 10 × 10 6 Balb / c mice received 1 × 10 viable cells / mL suspended in 100 μL of PBS. 6 CT26 cells were injected subcutaneously into the right flank. 3 Once the immunization time reached 0.05 mg / kg (approximately 7-9 days post-inoculation), mice were randomly assigned to treatment groups with 10 mice per group. Antibodies (C0132 or C0133) were injected intravenously at 5 mg / kg on the day of randomization (day -3). 177Lu-IMP288 was administered intravenously at a 10:1 bsMAb / HSGIMP288 hapten molar ratio (approximately 4 nmol / kg C0132 bsMAb or approximately 3 nmol / kg C0133 bsMAb, corresponding to 18.5 MBq, respectively) 3 days after the injection of the bispecific mAb (day 0). Additionally, a control group received 37 MBq of Lu-IMP288 on day 0 without any prior treatment. 177 Either Lu-IMP288 or vehicle was administered. Tumor volumes and body weights were monitored by day 21 or when the mice reached 1000 mm 3 Tumor volume was measured every 2–3 days until the humane endpoint was reached, and the survival percentage was determined. Relative tumor volume (tumor volume on day 0 = 100%), relative body weight (body weight on day 0 = 100%), and Kaplan-Meier survival curves (units: survival percentage) for each treatment group were plotted against time using GraphPrism software. Statistical analysis was performed in GraphPad Prism v9.4 using ordinary one-way ANOVA with Dunnett's correction for multiple testing.

[0295] Results and Conclusions: Figure 16B shows 177 Lu-IMP288 and 177 The iTLC profile for Lu-IMP288-bsMab is shown in Figure 16B. 177 A change in the migration profile for Lu-IMP288 was observed after incubation with bsMabs C0132 and C0133. 177 Lu-IMP288 was confirmed to be bound by the bsMabs. Both bsMabs showed >94% binding, calculated from pixel intensities revealed by ImageQuant TL version 8.2. 177 The Lu-IMP288 peptide was bound.

[0296] As shown in Figures 17A-B, PRAIT using 5 mg / kg of the Fc-silenced anti-oxMIF x anti-HSG bsMab C0132 and 18.5 MBq of IMP288 resulted in potent and significant tumor growth inhibition (Figure 17A) that persisted throughout the 21-day monitoring period (100% survival, Figure 17B). Statistical analysis (ordinary one-way ANOVA with Dunnett's correction for multiple testing; ** p<0.01) was performed only on day 8 because almost half of the animals in the vehicle group had to be sacrificed after day 8 due to excessive tumor growth. 177 Lu-IMP288 treatment group 177 Lu-IMP288 group. Furthermore, Figure 17C shows that PRAIT using C0132 was well tolerated, as it did not result in substantial weight loss throughout the entire monitoring period (21 days). As can be seen from Figure 18, PRAIT using 5 mg / kg of bsMab C0133 and 18.5 MBq of IMP288 resulted in potent and significant tumor growth inhibition. Statistical analysis (ordinary one-way ANOVA with Dunnett's correction for multiple testing; *** p<0.001) was performed only on day 8 because almost half of the animals in the vehicle group had to be sacrificed after day 8 due to excessive tumor growth. 177 Lu-IMP288 treatment group 177 Lu-IMP288 group. In summary, these results highlight the potency of the Fc-silenced anti-oxMIF × anti-HSG bsMab combined with radiolabeled HSG hapten as a PRAIT. Figure 16 shows: (A) the structure of HSG hapten IMP288 and (B) the structures of bsMab C0132 and C0133. 177 Binding to the Lu-IMP288 peptide, assessed by iTLC, was observed upon incubation with bsMab. 177 Based on the changes in the migration profile of Lu-IMP288, 177 The migration profile was compared with that of the Lu-IMP288 peptide alone.

[0297] Figure 17 shows PRAIT of syngeneic CT26 murine colorectal carcinoma in Balb / c mice using the Fc-silenced anti-oxMIF x anti-HSG bsMab C0132. C0132 was administered on day -3, followed by 3 days later (day 0). 177 Lu-IMP288 was administered. (A) Tumor volume (unit: %) relative to the tumor volume measured on day 0; mean ± SEM is shown (n = 10 maximum). Statistical analysis was performed in GraphPad Prism V9.4 using conventional one-way ANOVA with Dunnett's correction for multiple testing. ** p<0.01 vs. 177 (B) Kaplan-Meier survival curve (unit: percent survival (%)), (C) body weight relative to body weight measured on day 0 (unit: %).

[0298] Figure 18 shows PRAIT of syngeneic CT26 murine colorectal carcinoma in Balb / c mice using the Fc-silenced anti-oxMIF x anti-HSG bsMab C0133. C0133 was administered on day -3, followed by 3 days later (day 0). 177 Lu-IMP288 was administered. The figure shows tumor volume (unit: %) relative to the tumor volume measured on day 0. Mean ± SEM is shown (n = maximum 10). Statistical analysis was performed in GraphPad Prism V9.4 using conventional one-way ANOVA with Dunnett's correction for multiple testing; *** p<0.001 vs. 177 Lu-IMP288.

[0299] Example 18: Anti-oxMIF x anti-HSG bispecific antibody (bsMab) C0132 and C0132 5 days after application in a syngeneic CT26 colon cancer mouse model in Balb / c mice 177 Pretargeted Radioimmunotherapy (PRAIT) using Lu-labeled IMP288

[0300] In this example, the efficacy of the newly designed Fc-silenced bispecific anti-oxMIF x anti-HSG antibody C0132 was evaluated in combination with the HSG hapten IMP288 (as described in US2005 / 0025709) and the radionuclide 177 Together with Lu, the PRAIT approach was used for evaluation.

[0301] Materials and Methods: The in vivo efficacy of RRAIT was evaluated in Balb / c mice bearing subcutaneous CT26 murine colorectal carcinoma tumors. The study was performed as described in Example 16, with some modifications. Briefly, Balb / c mice (Balb / c ByJ, Janvier Labs, France) were treated with 1 x 10 IgG1-associated ... 6 CT26 cells were injected subcutaneously into the right flank. Tumor growth was monitored by visual observation and palpation until 7 days after inoculation. In vivo treatment studies were performed with tumors of approximately 100–200 mm in size across the three treatment groups (10 mice per group). 3 and one control group (10 mice per group) at approximately 400–500 mm 3 The bsMab C0132 was administered intravenously at two doses: 2.5 mg / ml and 5 mg / ml, while 177 Lu-labeled IMP288 was injected iv 5 days (vs. 3 days in Example 16) after administration of C0132 (day 0). Keeping the C0132 / radiolabelled HSG IMP288 hapten molar ratio constant at 10 / 1 (same as in Example 16) 177 Lu-labeled IMP288 was administered at 2 nmol / kg (9.3 MBq) and 4 nmol / kg (18.5 MBq), respectively. The control group consisted of mice that were not pretreated with bsMab on day 0. 177The study consisted of one cohort administered Lu-IMP288 at 8 nmol / kg (37 MBq). Animal weights and tumor volumes were assessed every 2–3 days for 21 days after administration. Tumor volume was determined by measuring the length, width, and depth of the tumor using digital calipers. Tumor volume was calculated using the following formula: tumor volume = (length × width × depth) × 0.5. Mice were maintained until day 21 or when they reached the predetermined experimental endpoint: tumor volume >1500 mm. 3 The mice were monitored until they reached a body weight loss of more than 20%. Relative tumor volume (tumor volume on day 0 = 100%) and Kaplan-Meier survival curves (units: survival percentage) for each treatment group were plotted against time using GraphPad Prism software. Statistical analysis (ordinary one-way ANOVA with Dunnett's correction for multiple testing) was performed. * p<0.05, ** p<0.01, *** p<0.001) in the control group ( 177 Lu-IMP288, no bsMab) had to be sacrificed after day 11 due to excessive tumor growth, so only days 8 and 10 were performed using GraphPad Prism, and each of the two C0132 treatment groups was compared with the control group ( 177 Lu-IMP288 only, without bsMab).

[0302] Results and Conclusions: It is clear from Figure 19 that pre-targeted treatment with C0132 at 2.5 and 5 mg / ml resulted in significant tumor regression (Figure 19A) and survival benefit (Figure 19B). The best survival percentage (100%) was achieved when C0132 was administered at 5 mg / ml, which was sustained for up to 21 days of monitoring.

[0303] Figure 19 shows the efficacy of the anti-oxMIF x anti-HSG bsMab C0132 using the PRAIT approach in Balb / c mice syngeneically implanted with CT26 mouse colorectal cancer cells. C0132 was administered at 2.5 mg / ml and 5 mg / ml on day -5, followed by 5 days later (day 0). 177Lu-IMP288 was administered. (A) Tumor volume (unit: %) relative to the tumor volume measured on day 0; mean ± SEM is shown (n = 10 maximum). Statistical analysis was performed in GraphPad Prism V9.4 using conventional one-way ANOVA with Dunnett's correction for multiple testing. *** p<0.001 vs. 177 Lu-IMP288. (B) Kaplan-Meier survival curve (unit: percent survival (%)).

[0304] Example 19: Anti-oxMIF x anti-HSG bispecific antibody (bsMab) C0132 and C0132 5 days after application in a xenograft CFPAC-1 pancreatic cancer mouse model in Balb / c nude mice 177 Pretargeted Radioimmunotherapy (PRAIT) using Lu-labeled IMP288 In this example, the efficacy of a newly designed Fc-silenced bispecific anti-oxMIF x anti-HSG antibody, C0132, was evaluated in a xenograft model of pancreatic cancer using the HSG hapten IMP288 (as described in US2005 / 0025709) and the radionuclide IMP288. 177 Together with Lu, the PRAIT approach was used for evaluation.

[0305] Materials and Methods: The in vivo efficacy of PRAIT was evaluated in Balb / c nude mice bearing subcutaneous CFPAC-1 pancreatic ductal adenocarcinoma tumors. The study was essentially performed as described in Examples 16 and 17, with some modifications. Human pancreatic ductal adenocarcinoma cells, CFPAC-1, were provided by ATCC (Cat#CRL-1918). Cells were cultured in RPMI 1640 medium supplemented with 10% FBS and 2 mM L-glutamine. A suspension of CFPAC-1 cells was prepared in sterile PBS at a concentration of 50 × 10 6 The cells were cultured at 1000 x 1000 cells / mL in a Balb / c nude mouse (Balb / c ByAnNRj-Foxn1 nu / nu ) 5 × 10 suspended in 100 μL of PBS 6CFPAC-1 cells were injected subcutaneously into the right flank. Tumor growth was monitored by visual observation and palpation until 4 days after inoculation. In vivo treatment studies were performed until tumor size reached approximately 150–300 mm in the treatment groups (10 mice per group). 3 and two control groups (10 mice per group) with a mean of approximately 350–500 mm 3 Treatment was initiated when the β-amyloid ... 177 Lu-labeled HSG hapten IMP288 was administered at 4 nmol / kg (18.5 MBq) to the control group. 177 One cohort received Lu-IMP288 at 8 nmol / kg (37 MBq) but no BsMAb, and one cohort received 177 One cohort received only the vehicle used to dilute Lu-IMP288, and the other cohort received only the vehicle used to dilute Lu-IMP288. Animal weights and tumor volumes were assessed every 2–3 days for 28 days after administration. Tumor volume was determined by measuring the length, width, and depth of the tumor using digital calipers. Tumor volume was calculated using the following formula: tumor volume = (length × width × depth) × 0.5. Mice were monitored until day 28 or when the mice reached the predetermined experimental endpoint: tumor volume >1500 mm. 3 The mice were monitored until they reached a body weight loss of more than 20% or reached a weight loss of more than 20%. The relative tumor volume (tumor volume on day 0 = 100%) for each treatment group was plotted against time using GraphPad Prism software. Statistical analysis (ordinary one-way ANOVA with Dunnett's correction for multiple testing; ** p<0.01) was performed in GraphPad Prism V9.4 on day 14 only, comparing the C0132-treated group with the vehicle group.

[0306] Results and Conclusions: It is clear from Figure 20 that pre-targeted treatment with C0132 at 5 mg / ml resulted in significant tumor regression (Figure 20).

[0307] Figure 20 shows the efficacy of the anti-oxMIF x anti-HSG bsMab C0132 using the PRAIT approach in Balb / c nude mice xenografted with CFPAC-1 pancreatic adenocarcinoma cells. C0132 was administered at 5 mg / ml on day -5, followed by 5 days later (day 0). 177 Lu-IMP288 was administered. Tumor volume (unit: %) relative to tumor volume measured on day 0; mean ± SEM is shown (n = 10 max). Statistical analysis was performed in GraphPad Prism V9.4 using conventional one-way ANOVA with Dunnett's correction for multiple testing. ** p<0.01 vs. vehicle.

[0308] Example 20: Efficacy of C0115 antibody in combination with glucocorticoids (GCs) in a mouse model of type II collagen-induced arthritis (CIA) Glucocorticoids (such as dexamethasone) are potent immunosuppressants commonly used as long-term therapy to control rheumatic diseases in human patients, but are associated with a variety of side effects. In this example, the efficacy of C0115 was evaluated as monotherapy or in combination with dexamethasone.

[0309] Materials and Methods: This study used 8-9 week-old male DBA / 1j (Harlan Laboratories, Italy) mice (weight range: 18-20 g). Bovine type II collagen (CII; Chondrex, USA) was dissolved at 2 mg / ml in 0.05 M acetic acid by gentle overnight stirring at 4°C. CFA (complete Freund's adjuvant) was prepared by adding Mycobacterium tuberculosis H37Ra (Difco, Detroit, MI) to IFA (incomplete Freund's adjuvant; Sigma-Aldrich, Milano, Italy) at a concentration of 2 mg / ml. Before injection, CII was emulsified with an equal volume of CFA. To induce CIA, mice were injected intradermally at the base of the tail with 100 μl of the resulting emulsion containing CII and CFA (100 μg / mouse). On day 21, a second booster of 100 μl (100 μg / mouse) of CII in IFA was administered. At the onset of disease, mice were treated with vehicle, C0115 (20 mg / kg) alone, or C0115 (20 mg / kg) in combination with daily injections of low-dose dexamethasone (0.1 mg / kg) twice weekly (ip) for 20 days. A control group of mice received daily injections of high-dose dexamethasone (0.3 mg / kg) as standard treatment. At the end of treatment, animals were euthanized, blood collected, and tissues (front and rear paws) were harvested for further histological analysis. Clinical severity of arthritis was assessed by monitoring body weight and paw thickness (all four paws, using a pachymeter) twice weekly. The arthritis score of each mouse's four paws ranged from 0 to 4 and was scored as follows: 0 = no signs of arthritis; 1 = swelling and / or redness of the paw or one toe; 2 = involvement of two joints; 3 = involvement of more than two joints; 4 = severe arthritis of the entire paw and toes (resulting in a maximum score of 12 per mouse). The cumulative disease score for each mouse was calculated for each individual mouse by summing the scores over the treatment period. Statistical analysis was performed in GraphPad Prism using a standard one-way ANOVA followed by Fisher's LSD test. Results and Conclusions: Figure 21 demonstrates that treatment with C0115 (20 mg / kg) resulted in significant improvement in clinical arthritic signs as indicated by cumulative disease score compared to the vehicle-treated group. Furthermore, combination treatment of C0115 (20 mg / kg) with low-dose dexamethasone (0.1 mg / kg) was comparable in efficacy to high-dose dexamethasone (0.3 mg / kg) and further improved clinical arthritic signs compared to treatment as single agents.

[0310] Example 21: Efficacy of C0115 antibody and C0115 antibody in combination with glucocorticoids (GCs) in a T cell transfer mouse model of colitis In this example, the efficacy of C0115 antibody as a single agent or in combination with low-dose dexamethasone was evaluated during chronic intestinal inflammation.

[0311] Materials and Methods: Eight- to nine-week-old female BALB / c and CB-17 SCID (Envigo, San Pietro al Natisone, Udine, Italy) mice (weight range: 18-20 grams) were used in this study.

[0312] To induce colitis, CD4+CD25- T cells from BALB / c mice were transferred into CB-17 SCID mice (which lack B and T cells). Briefly, splenocytes isolated from BALB / c mice were stimulated in vitro with 4 μg / ml concanavalin A. T cells were isolated by magnetic selection of CD4+CD25- cells. Cell preparations were stained with a viability dye (7-actinomycin-D), FITC-conjugated anti-mouse CD4 antibody (BD, Heidelberg, Germany), and APC-conjugated anti-mouse CD25 antibody (BD, Heidelberg, Germany). Purity control (>95% viable T cells in the CD4+CD25- gate) was performed by flow cytometry using a FACS Calibur (BD Biosciences, Heidelberg, Germany) and CellQuest software. Isolated CD4+CD25- T cells were injected i.p. into CB-17 SCID mice at a concentration of 500,000 cells in a final volume of 0.2 ml of saline. One week after T cell transfer, mice were treated (twice weekly i.p.) for 83 days with vehicle, C0115 (10 mg / kg) as a single agent, or C0115 (10 mg / kg) combined with daily injections of low-dose dexamethasone (0.01 mg / kg). A control group of mice received daily injections of high-dose dexamethasone (0.1 mg / kg) as standard treatment. At the end of treatment, blood, feces, and colon tissue samples were collected for further analysis. The clinical severity of colitis was assessed by regular monitoring of body weight change and stool consistency. The cumulative stool score for each mouse was determined by summing the daily stool scores (0 = well-formed pellet; 1 = loose stool; 2 = diarrhea). For statistical analysis, one-way ANOVA followed by Fisher's LSD test was used in GraphPad Prism V9.4.

[0313] Results and Conclusions: Figure 22 shows that treatment with C0115 (10 mg / kg) resulted in a significant improvement in disease severity as evidenced by a significant reduction in cumulative stool score (A) compared to the vehicle-treated group, which was comparable to high-dose dexamethasone (0.1 mg / kg). Combination treatment with 10 mg / kg C0115 and low-dose dexamethasone (0.01 mg / kg) further improved disease severity, as evidenced by a further significant reduction in cumulative stool score. Surprisingly, combination treatment with 10 mg / kg C0115 and low-dose dexamethasone (0.01 mg / kg) resulted in further improvement in colitis, as assessed by a significant increase in body weight at the end of treatment (day 83), compared to the vehicle-treated group and treatment with the standard-of-care corticosteroid drug dexamethasone.

[0314] Figure 22 shows that the newly designed Fc-silenced anti-oxMIF antibody C0115, as a single agent and in combination with GC, ameliorates disease severity in T cell-transferred mice in a colitis model. Body weight change (A) and cumulative stool score (B) at the end of the experiment, D83, were assessed following treatment with C0115 (10 mg / kg) alone or in combination with a low dose of 0.01 mg / kg dexamethasone, treatment with low (0.01 mg / kg) and high (0.1 mg / kg) doses of dexamethasone as a standard of care corticosteroid, or vehicle control treatment. Data are presented as mean ± SEM, and statistical analysis was performed using conventional one-way ANOVA followed by Fisher's LSD test ( ). * p<0.05; ** p<0.01).

[0315] Example 22: Reduced aggregation tendency and reduced hydrophobicity of newly designed anti-oxMIF antibodies and retention of their binding to immobilized oxMIF (K D Estimated)

[0316] [Table 11]

[0317] To assess hydrophobicity and aggregation, the newly designed antibodies will be analyzed by gel filtration (SEC) and by hydrophobic interaction chromatography (HIC) in a head-to-head comparison with the control anti-oxMIF antibody C0008.

[0318] For SEC, antibodies are diluted to 1 mg / ml in 1x phosphate-buffered saline (1x PBS), and 100 μl of sample is applied to an Enrich 650 (Bio-Rad) gel filtration column at a flow rate of 1.25 ml / min. Separation and equilibration are performed in 1x PBS at room temperature. Protein peaks are monitored using absorbance at 280 nm, and spectra are analyzed using the ChromLab software package (Bio-Rad). Results are reported as the retention volume (Vr, ml) of the main peak, and the presence of aggregates is manually ranked.

[0319] For HIC analysis, antibodies were diluted to a final concentration of 1 mg / ml using 50 mM phosphate and 0.75 M ammonium sulfate, pH 6.8. 1 mg of each antibody was injected onto a 1 ml HiTrap Butyl HP column using a 1 ml loading loop, and the column flow rate was maintained at 1 ml / min at room temperature. Peak separation was performed with a 20 column volume (CV) gradient of 0 to 100% Buffer B (50 mM phosphate, 20% isopropanol; pH 7.0). Protein peaks were monitored using absorbance at 280 nm, and spectra were analyzed using the Unicorn Emulsion software package (GE Healthcare). Results are reported for each peak as Vr (ml) at the maximum peak.

[0320] To assess binding to oxMIF (apparent affinity), the newly designed antibodies are analyzed by ELISA. Briefly, 1 μg / ml of recombinant human MIF diluted in PBS is immobilized on an ELISA plate overnight at 4°C (MIF is converted to oxMIF according to Thiele et al., 2015). After blocking, serial dilutions of anti-oxMIF antibodies are added to the plate. Finally, bound antibodies are detected using a goat anti-human IgG (Fc)-HRP conjugate and tetramethylbenzidine (TMB) as the substrate. The color reaction is stopped with 3M H2SO4, and the OD is measured at 450 nm. The apparent affinity (K D ) stands for EC 50 Values ​​are determined by a four parameter fit using GraphPad Prism.

[0321] References Aeberli D, et al. Endogenous macrophage migration inhibitory factor modulates glucocorticoid sensitivity in macrophages via effects on MAP kinase phosphatase-1 and p38 MAP kinase. FEBS Lett. 2006;580(3):974-981 Bacher M, et al. An essential regulatory role for macrophage migration inhibitory factor in T-cell activation. Proc Natl Acad Sci US A. 1996;93(15):7849-7854 Bacher M, et al. Migration inhibitory factor expression in experimentally induced endotoxemia. Am J Pathol. 1997;150(1):235-246. Bando, H., et al. (2002). Expression of macrophage migration inhibitory factor in human breast cancer: association with nodal spread. Jpn J Cancer Res 93, 389-396. Barnes PJ, Adcock IM. How do corticosteroids work in asthma? Ann Intern Med. 2003;139(5 Pt 1):359-370 Bernhagen, J. et al. (1993). MIF is a pituitary-derived cytokine that potentiates lethal endotoxaemia. Nature 365, 756-759 Bernhagen, J., et al. (1994). Purification, bioactivity, and secondary structure analysis of mouse and human macrophage migration inhibitory factor (MIF). Biochemistry 33, 14144-14155 Bernhagen, J., et al. (2007). MIF is a noncognate ligand of CXC chemokine receptors in inflammatory and atherogenic cell recruitment. Nat Med 13, 587-596 Bloom B.R. and Bennet, B., 1966, Mechanism of a reaction in vitro associated with delayed-type hypersensitivity, Science 153, 80-82 Bozza FA, et al. Macrophage migration inhibitory factor levels correlate with fatal outcome in sepsis. Shock. 2004;22(4):309-313 Brinkmann U. and Kontermann R.E., 2017, The making of bispecific antibodies, MABS, 9, 2, 182-212 Bucala, R., and Donnelly, S. C. (2007). Macrophage migration inhibitory factor: a probable link between inflammation and cancer. Immunity 26, 281-285 Calandra T, et al. The macrophage is an important and previously unrecognized source of macrophage migration inhibitory factor. J Exp Med. 1994;179(6):1895-1902 Calandra T, et al. MIF as a glucocorticoid-induced modulator of cytokine production. Nature. 1995;377(6544):68-71 Chen, R., et al. (2010). Pilot study of blood biomarker candidates for detection of pancreatic cancer. Pancreas 39, 981-988 Chothia C., et al. (1987) Canonical structures for the hypervariable regions of immunoglobulins. J.Mol.Biol., 196, 901-17 Coleman, A. M., et al (2008). Cooperative regulation of non-small cell lung carcinoma angiogenic potential by macrophage migration inhibitory factor and its homolog, D-dopachrome tautomerase. J Immunol 181, 2330-2337 Conroy, H., et al. (2010). Inflammation and cancer: macrophage migration inhibitory factor (MIF)--the potential missing link. Qjm 103, 831-836 Coussens, L. M., and Werb, Z. (2002). Inflammation and cancer. Nature 420, 860-867 David, J.R., 1966, Delayed hypersensitivity in vitro: its mediation by cell-free substances formed by lymphoid cell-antigen interaction, Proc. Natl. Acad. Sci. U.S.A. 56, 72-77 de Jong et al., (2001). Development of chronic colitis is dependent on the cytokine MIF, Nat. Immunol. (11) 1061:6 del Rincon ID, et al. High incidence of cardiovascular events in a rheumatoid arthritis cohort not explained by traditional cardiac risk factors. Arthritis Rheum. 2001;44(12):2737-2745 Ehrenmann F., et al. 2010, MGT / 3Dstructure-DB and IMGT / DomainGapAlign: a database and a tool for immunoglobulins or antibodies, T cell receptors, MHC, IgSF and MhcSF, Nucleic Acids Res. 38, D301-307 El-Magadmi M, et al. Systemic lupus erythematosus: an independent risk factor for endothelial dysfunction in women. Circulation. 2004;110(4):399-404. Emonts M, et al. Association between high levels of blood macrophage migration inhibitory factor, inappropriate adrenal response, and early death in patients with severe sepsis. Clin Infect Dis. 2007;44(10):1321-1328 Estep P. et al., 2015, An alternative assay to hydrophobic interaction chromatography for high-throughput characterization of monoclonal antibodies, MAbs, 7(3), 553-561 Ewert S. et al., 2003, Structure-based improvement of the biophysical properties of immunoglobulin VH domains with a generalizable approach, Biochemistry, 18, 42(6), 1517-28 Fingerle-Rowson G, et al. Regulation of macrophage migration inhibitory factor expression by glucocorticoids in vivo. Am J Pathol. 2003;162(1):47-56 Ha J-H. et al., 2016, Immunoglobulin Fc heterodimer platform technology: From design to applications in therapeutic antibodies and proteins, frontiers Immunol., 7, article 394 Hagemann, T., and Balkwill, F. (2005). MIFed about cancer? Gastroenterology 129, 1785-1787. Hagemann, T., et al. (2007). Ovarian cancer cell-derived migration inhibitory factor enhances tumor growth, progression, and angiogenesis. Mol Cancer Ther 6, 1993-2002 Hong, P., et al. (2012). A review size-exclusion chromatography for the analysis of protein biotherapeutics and their aggregates. In Journal of Liquid Chromatography and Related Technologies (Vol. 35, Issue 20, pp. 2923-2950). Taylor & Francis. https: / / doi.org / 10.1080 / 10826076.2012.743724 Hudson, J. D., et al. (1999). A proinflammatory cytokine inhibits p53 tumor suppressor activity. J Exp Med 190, 1375-1382. Hussain F. et al., 2013, Human anti-macrophage migration inhibitory factor antibodies inhibit growth of human prostate cancer cells in vitro and in vivo, Mol Cancer Ther. Jul;12(7):1223-34 Ianello A. and Ahmad A., 2005, Role of antibody-dependent cell-mediated cytotoxicity in the efficacy of therapeutic anti-cancer monoclonal antibodies, Cancer and Metastasis Review, 24, 487-499 Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, NIH Publication 91-3242, Bethesda MD (1991), vols. 1-3 Kamimura, A., et al. (2000). Intracellular distribution of macrophage migration inhibitory factor predicts the prognosis of patients with adenocarcinoma of the lung. Cancer 89, 334-341 Karacay H. et al., (2005) Pretargeting with bispecifics aCEA x aHSG, Clin Cancer Res, 11(21) Karin, M. (2009). NF-kappaB as a critical link between inflammation and cancer. Cold Spring Harb Perspect Biol 1, a000141 Kenanova V. et al. (2005) Tailoring the Pharmacokinetics and Positron Emission Tomography Imaging Properties of Anti-Carcinoembryonic Antigen Single-Chain Fv-Fc Antibody Fragments. Cancer Res. 2005, 65:622-633 Kessenbrock, K., et al. (2010). Matrix metalloproteinases: regulators of the tumor microenvironment. Cell 141, 52-67. Lefranc MP. Unique database numbering system for immunogenetic analysis. Immunol Today (1997) 18:509. Liu R. et al., 2020, “Fc-Engineering for modulated effector functions-improving antibodies for cancer treatment”, Antibodies, 9, 64 Lue, H., et al. (2007). Macrophage migration inhibitory factor (MIF) promotes cell survival by activation of the Akt pathway and role for CSN5 / JAB1 in the control of autocrine MIF activity. Oncogene 26, 5046-5059 MacCallum R.M et al. (1996) Antibody-antigen Interactions: Contact Analysis and Binding Site Topography, J.Mol.Biol., 262, 5:732-745 Mahalingam D. et al., 2015, ASCO Abstract ID2518 Mahalingam et al. 2020, Phase I study of Imalumab (BAX69), a fully human recombinant antioxidized macrophage migration inhibitory factor antibody in advanced solid tumours, Br J Clin Pharmacol. 86(9):1836-1848 Manzi S, et al. Prevalence and risk factors of carotid plaque in women with systemic lupus erythematosus. Arthritis Rheum. 1999;42(1):51-60 Meyer-Siegler, K., and Hudson, P. B. (1996). Enhanced expression of macrophage migration inhibitory factor in prostatic adenocarcinoma metastases. Urology 48, 448-452. Mitchell RA, et al. Sustained mitogen-activated protein kinase (MAPK) and cytoplasmic phospholipase A2 activation by macrophage migration inhibitory factor (MIF). Regulatory role in cell proliferation and glucocorticoid action. J Biol Chem. 1999;274(25):18100-18106 Mitchell RA, et al. Macrophage migration inhibitory factor (MIF) sustains macrophage proinflammatory function by inhibiting p53: regulatory role in the innate immune response. Proc Natl Acad Sci U S A. 2002;99(1):345-350 Mitchell, R. A., and Bucala, R. (2000). Tumor growth-promoting properties of macrophage migration inhibitory factor (MIF). Semin Cancer Biol 10, 359-366. Morand EF, et al. Macrophage migration inhibitory factor in rheumatoid arthritis: clinical correlations. Rheumatology (Oxford). 2002;41(5):558-562. Morrison, S.L., et al., 1984, Chimeric human antibody molecules: mouse antigen-binding domains with human constant region domains, Proc. Natl. Acad. Sci. 81, 6851-6855 Natsume A. et al., 2009, “Improving effector functions of antibodies for cancer treatment: Enhancing ADCC and CDC”, Drug, Design, development and Therapy, 3, 7-16 Niino M., et al. Macrophage migration inhibitory factor in the cerebrospinal fluid of patients with conventional and optic-spinal forms of multiple sclerosis and neuro-Behcet's disease. J Neurol Sci. 2000;179(S 1-2):127-131 Onodera S., et al. High expression of macrophage migration inhibitory factor in the synovial tissues of rheumatoid joints. Cytokine. 1999;11(2):163-167. Petkova, S.B., et al., 2006, Enhanced half-life of genetically engineered human IgG1 antibodies in a humanized FcRn mouse model: potential application in humorally mediated autoimmune disease, Int'l. Immunol. 18(12) 1759-1769 Pisu M., et al. The cost of glucocorticoid-associated adverse events in rheumatoid arthritis. Rheumatology (Oxford). 2005;44(6):781-788 Pyzik M. et al. 2019. The Neonatal Fc Receptor (FcRn): A Misnomer?, Frontiers in Immunol., Vol 10, 1540: 1-24 Ramsey-Goldman R. Missed opportunities in physician management of glucocorticoid-induced osteoporosis? Arthritis Rheum. 2002;46(12):3115-3120 Ren, Y., et al. (2004). Upregulation of macrophage migration inhibitory factor contributes to induced N-Myc expression by the activation of ERK signaling pathway and increased expression of interleukin-8 and VEGF in neuroblastoma. Oncogene 23, 4146-4154 Rendon, B. E., et al. (2007). Regulation of human lung adenocarcinoma cell migration and invasion by macrophage migration inhibitory factor. J Biol Chem 282, 29910-29918 Rendon, B. E., et al. (2009). Mechanisms of macrophage migration inhibitory factor (MIF)-dependent tumor microenvironmental adaptation. Exp Mol Pathol 86, 180-185. Rinta S., et al. Apoptosis-related molecules in blood in multiple sclerosis. J Neuroimmunol. 2008;205(1-2):135-141 Rossi EA et al., (2006) Stably tethered multifunctional structures of defined composition made by the dock and lock method for use in cancer targeting, PNAS, 103, 18, 6841-6846 Sampey AV, et al. (2001) Regulation of synoviocyte phospholipase A2 and cyclooxygenase 2 by macrophage migration inhibitory factor. Arthritis Rheum. 44(6):1273-1280. Saunders K.O., (2019) “Conceptual approaches to modulating antibody effector functions and circulation half-life, frontiers Immunol., 10, 1-20, doi: 10.3389 / fimmu.2019.01296 Sambrook et al, "Molecular Cloning: A Laboratory Manual" (4th Ed.), Vols. 1 -3, Cold Spring Harbor Laboratory Press (2012). Sharkey RM et al. (2005) Pretargeting with bispecific aCD20 x aHSG, Leukemia, 15,1064-1069 Schacke H., et al. (2002) Mechanisms involved in the side effects of glucocorticoids. Pharmacol Ther. 96(1):23-43 Schinagl, A., et al., (2018) Role of the Cysteine 81 Residue of Macrophage Migration Inhibitory Factor as a Molecular Redox Switch. Biochemistry, 57(9), 1523-1532. https: / / doi.org / 10.1021 / acs.biochem.7b01156 Schinagl. A. et al., (2016) Oxidized macrophage migration inhibitory factor is a potential new tissue marker and drug target in cancer, Oncotarget. Nov 8;7(45):73486-73496 Shimizu, T, et al. (1999). High expression of macrophage migration inhibitory factor in human melanoma cells and its role in tumor cell growth and angiogenesis. Biochem Biophys Res Commun 264, 751-758 Shimizu T., et al. (2001) High macrophage migration inhibitory factor (MIF) serum levels associated with extended psoriasis. J Invest Dermatol. 116(6):989-990 Solomon DH, et al. (2003) Cardiovascular morbidity and mortality in women diagnosed with rheumatoid arthritis. Circulation. 107(9):1303-1307 Spiess C. et al., (2015) Alternative molecular formats and therapeutic applications for bispecific antibodies, Mol.Immunol., 67, 95-106 Sprong T, et al. Macrophage migration inhibitory factor (MIF) in meningococcal septic shock and experimental human endotoxemia. Shock. 2007;27(5):482-487. Strohl W.R. et al. (2012) Antibody Fc engineering for optimal antibody performance, Therapeutic Antibody Engineering, Woodhead Publishing Series in Biomedicine, No. 11, pp. 225-249 Takahashi, N., et al. (1998). Involvement of macrophage migration inhibitory factor (MIF) in the mechanism of tumor cell growth. Mol Med 4, 707-714. Tam FWK, et al., (1999) Development of scarring and renal failure in a rat model of crescentic glomerulonephritis. Nephrol Dial Transplant 14:1658-1666 Tang J., et al., (2018) Comprehensive analysis of the clinical immuno-oncology landscape, Ann Oncol.;29(1):84-91 Thiele, M. et al., (2017). Selective Targeting of a Disease-Related Conformational Isoform of Macrophage Migration Inhibitory Factor Ameliorates Inflammatory Conditions. Journal of Immunology, 195(5), 2343-2352. https: / / doi.org / 10.4049 / jimmunol.1500572 Van der Kant, R. et al., (2017) Prediction and Reduction of the Aggregation of Monoclonal Antibodies, J.Mol.Biol., 429(8), 1244-1261 Verjans, E., et al. (2009). Dual role of macrophage migration inhibitory factor (MIF) in human breast cancer. BMC Cancer 9, 230 Walsh LJ, et al. (1996) Use of oral corticosteroids in the community and the prevention of secondary osteoporosis: a cross sectional study. BMJ. 313(7053):344-346 Wang P, et al., (2008) A systematic assessment of MHC class II peptide binding predictions and evaluation of a consensus approach, PLoS Comput Biol. 4(4):e1000048; Wang P, et al., (2010) Peptide binding predictions for HLA DR, DP and DQ molecules, BMC Bioinformatics. 11:568 Wei Li et al., (2016) Antibody Aggregation: Insights from Sequence and Structure, Antibodies, 5(3), 19 WHO Drug Information, Vol. 28, No. 2, 2014 Willuda J. et al., (1999) High thermal stability is essential for tumor targeting of antibody fragments: engineering of a humanized anti-epithelial glycoprotein-2 (epithelial cell adhesion molecule) single-chain Fv fragment, Cancer Res., 15; 59(22), 5758-67 Winner, M., et al. (2007). Amplification of Tumor Hypoxic Responses by Macrophage Migration Inhibitory Factor-Dependent Hypoxia-Inducible Factor Stabilization. Cancer Research 67, 186-193

Claims

1. 1. An Fc-silenced anti-oxMIF antibody, comprising a variant Fc region of wild-type human IgG comprising SEQ ID NO: 1 with one or more amino acid substitutions or glycosylation modifications, and the following variable domains: (a1) a light chain variable domain comprising SEQ ID NO: 2 with one, two, three, four, or five amino acid substitutions selected from M30L, F49Y, A51G, P80S, and W93F; and, (b1) a heavy chain variable domain comprising SEQ ID NO: 3; or (b2) a heavy chain variable domain comprising SEQ ID NO: 3 with one or two amino acid substitutions selected from L5Q and W97Y; Including, where the amino acid positions are numbered according to Kabat: the variant Fc Region exhibits reduced FcγR binding compared to a wild-type IgG1 Fc Region, wherein one or more amino acid substitutions in the variant Fc Region are at any one of positions E233, L234, L235, G236, G237, P238, 1253, D265, S267, H268, N297, S298, T299, H310, E318, L328, P329, A330, P331, H435 of SEQ ID NO: 1 according to the EU numbering index, and / or the Fc Region is aglycosylated; The antibody has reduced aggregation potential and reduced hydrophobicity compared to an antibody comprising SEQ ID NO: 2 and SEQ ID NO: 3 lacking the amino acid substitution. The Fc-silenced anti-oxMIF antibody.

2. An Fc-silenced anti-oxMIF antibody as described in claim 1, wherein one or more amino acid substitutions in the mutant Fc region are at positions L234 and L235 of SEQ ID NO: 1 according to the EU numbering index.

3. 2. The Fc-silenced anti-oxMIF antibody of claim 1, wherein the light chain variable domain comprises the amino acid substitution W93F and the heavy chain variable region comprises the amino acid substitution W97Y.

4. 2. The Fc-silenced anti-oxMIF antibody of claim 1, comprising a variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 5, 6, 7, 8, 9, and 43.

5. i.) SEQ ID NOs: 3 and 6; ii.) SEQ ID NOs: 9 and 6; iii.) SEQ ID NOs: 4 and 6; iv.) SEQ ID NOs: 4 and 8; v.) SEQ ID NOs: 4 and 5, or vi.) SEQ ID NO: 43 and any one of SEQ ID NOs: 5, 6 or 8; The Fc-silenced anti-oxMIF antibody of claim 1 , comprising:

6. 6. The Fc-silenced anti-oxMIF antibody of claim 5, further comprising SEQ ID NO:

14.

7. 2. The Fc-silenced anti-oxMIF antibody of claim 1, comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 15 and 16, or SEQ ID NOs: 15 and 17.

8. Bispecific antibody, scFv-Fc, (scFv) ２ -Fc, scFv / scFv-Fc, Fab / scFv-Fc, Fab / (scFv) ２ -Fc, Fab / Fab-scFv-Fc, Fab / crossFab-Fc, IgG-scFv and IgG-(scFv) ２ 2. The Fc-silenced anti-oxMIF antibody of claim 1, selected from the group consisting of:

9. 2. The Fc-silenced anti-oxMIF antibody of claim 1, wherein the antibody is a bispecific antibody further comprising at least one binding site that specifically recognizes an epitope of CD3 or histamine-succinyl-glycine (HSG).

10. 10. The Fc-silenced antibody of any one of claims 1 to 9 for use in the preparation of a medicament.

11. A pharmaceutical composition comprising an antibody according to any one of claims 1 to 9, optionally together with a pharmaceutical carrier or adjuvant.

12. 12. The pharmaceutical composition of claim 11, formulated for subcutaneous administration.

13. 12. The pharmaceutical composition according to claim 11, for administration as a single substance or together with a further active substance, preferably selected from the group consisting of antiviral, anticancer, anti-inflammatory and antibiotic.

14. 12. The pharmaceutical composition of claim 11 for use in treating a patient suffering from an inflammatory disease, an infectious disease, or in treating a patient suffering from a hyperproliferative disorder or cancer.

15. The pharmaceutical composition of claim 11 for use in the treatment of asthma, vasculitis, arthritis, sepsis, septic shock, endotoxic shock, toxic shock syndrome, acquired respiratory distress syndrome, glomerulonephritis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, peritonitis, nephritis, NASH (non-alcoholic steatohepatitis), multiple sclerosis, acute and chronic pancreatitis, type 1 diabetes, IgA nephropathy, interstitial cystitis, post-COVID syndrome and psoriasis.

16. The pharmaceutical composition of claim 11 for use in the treatment of colorectal cancer, ovarian cancer, breast cancer, prostate cancer, pancreatic cancer, gastric cancer, and lung cancer.

17. An isolated nucleic acid encoding the antibody of any one of claims 1 to 9.

18. An expression vector comprising the nucleic acid of claim 17.

Images