Methods and Compositions Relating to Bioactive Agents

Lipids improve the delivery and efficacy of bioactive agents to target locations, addressing delivery challenges and enhancing therapeutic potential.

JP7825588B2Active Publication Date: 2026-03-06WAVE LIFE SCI LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2023041621
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2016-10-07
Filing Date
2023-03-16
Publication Date
2026-03-06
Estimated Expiration
2037-05-03

AI Technical Summary

Technical Problem

Many bioactive agents face challenges in effectively delivering to their target locations, such as cells, tissues, or organs, particularly intracellular sites, limiting their therapeutic use.

Method used

The use of lipids to facilitate the delivery of bioactive agents, enhancing properties like pharmacokinetics, activity, and immunogenicity, and enabling improved distribution and reduced toxicity.

Benefits of technology

Lipids enhance the delivery of bioactive agents to target locations, allowing for higher levels of agent delivery with lower amounts, improved efficacy, and reduced toxicity, making previously unsuitable agents therapeutically viable.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007825588000438
    Figure 0007825588000438
  • Figure 0007825588000439
    Figure 0007825588000439
  • Figure 0007825588000440
    Figure 0007825588000440
Patent Text Reader

Abstract

To provide a composition and method for delivering a bioactive agent to a target position efficiently and / or effectively.SOLUTION: A composition contains a bioactive agent and lipids. In various embodiments, lipids are selected from lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linolic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid and dilinoleyl. In some embodiments, the composition and method are useful in delivering a bioactive agent to a specific cell or tissue, which is a muscle cell or a muscle tissue, for example.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 331,961, filed May 4, 2016, and U.S. Provisional Patent Application No. 62 / 405,810, filed October 7, 2016, the entire contents of each of which are incorporated herein by reference. [Background technology]

[0002] Many bioactive agents cannot be effectively delivered to their target locations, such as cells, tissues, or organs, thereby limiting their therapeutic use. There is a long-standing need in the art for efficient and / or effective delivery of bioactive agents to such target locations. There is a particularly long-standing need in the art for efficient and / or effective delivery of bioactive agents, particularly to intracellular (i.e., intracellular) sites. Summary of the Invention

[0003] In particular, the present disclosure encompasses the recognition that lipids can surprisingly effect and / or facilitate the delivery of bioactive agents to their target locations (e.g., cells, tissues, organs, etc.). In some embodiments, lipids can be used to efficiently improve the delivery of bioactive agents to their target locations in a subject, e.g., a mammalian or human subject. The present disclosure particularly describes surprising results related to the efficient and / or effective delivery of bioactive agents to intracellular (i.e., intracellular) locations. In some embodiments, the present disclosure also describes surprising results that lipids can improve many properties of bioactive agents, such as pharmacokinetics (e.g., half-life), activity, immunogenicity, etc. For example, in some embodiments, the present disclosure describes that lipids can be utilized to efficiently improve the immune properties of bioactive agents, e.g., by modulating immune responses mediated by TLR9.

[0004] In light of the findings presented herein, those skilled in the art will recognize that the use of lipids can enable or facilitate delivery of bioactive agents, particularly to intracellular locations. Furthermore, in light of the findings presented herein, those skilled in the art will recognize that the use of lipids described herein can enable or facilitate delivery of an effective and / or desired amount of bioactive agent to its target location, such that, for example, the same or higher levels of bioactive agent can reach the target location than would be observed if the bioactive agent were administered without lipid, and in some embodiments, the same or higher levels of bioactive agent can reach the target location even when a lower amount of bioactive agent is administered with lipid than would be observed without lipid. Alternatively, or in addition, in light of the findings presented herein, those skilled in the art will recognize that the use of lipids described herein can enable or facilitate improved distribution (i.e., increased relative levels of bioactive agent at target locations compared to non-target locations) compared to an appropriate control (e.g., the level observed when a bioactive agent, such as an oligonucleotide, is administered in the same amount without lipid). Furthermore, in light of the findings presented herein, one skilled in the art will recognize that the use of lipids described herein may enable or promote improved efficacy and / or reduced toxicity compared to a relative control (e.g., no lipid). For example, in some embodiments, improved characteristics (e.g., activity, pharmacokinetics, etc.) may allow for a smaller unit dose and / or reduced administration frequency. In some embodiments, improved characteristics and / or reduced toxicity (e.g., improved pharmacokinetics, amelioration of undesirable immune responses mediated by TLR9) may allow for a larger unit dose and / or increased administration frequency, if desired. Furthermore, in light of the findings presented herein, one skilled in the art will recognize that the use of lipids described herein may enable bioactive agents that would otherwise be considered unsuitable for therapeutic use to be effectively used in the treatment of various diseases, disorders, and / or conditions.

[0005] In some embodiments, the present disclosure encompasses surprising findings, including the discovery that certain lipids are particularly effective for delivering bioactive agents to specific types of cells and tissues, including, but not limited to, cells and tissues outside the liver (e.g., extrahepatic), including, but not limited to, myocytes and muscle tissue. In some embodiments, the present disclosure provides technologies (e.g., compounds, compositions, methods) that are surprisingly effective for delivering bioactive agents to, for example, cardiac, diaphragmatic, skeletal, gastrocnemius, quadriceps, triceps, and / or smooth muscle cells and tissues.

[0006] In some embodiments, the present disclosure provides compositions containing a bioactive agent and a lipid. Many lipids can be utilized in the techniques provided in accordance with the present disclosure. In some embodiments, the lipid is an optionally substituted C 10 -C 80 wherein one or more methylene units are optionally, and independently, C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R' In some embodiments, the lipid is replaced by an optionally substituted group selected from: -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)-, -S(O)N(R')-, -N(R')S(O)-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein each variable is independently as defined and described herein. In some embodiments, the lipid is replaced by an optionally substituted C 10 -C 80 In some embodiments, the lipid contains a saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of, optionally, one or more C1-4 C substituted with aliphatic groups 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of unsubstituted C 10 -C 80 In some embodiments, the lipid contains one or less optionally substituted C 10 -C 80 In some embodiments, the lipid contains two or more optionally substituted C 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 80 In some embodiments, the lipid contains a saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of, optionally, one or more C 1-4 C substituted with aliphatic groups 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of unsubstituted C 10 -C 80 In some embodiments, the lipid contains one or less optionally substituted C 10 -C 80 In some embodiments, the lipid contains two or more optionally substituted C 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 40 In some embodiments, the lipid contains a saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 40In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of, optionally, one or more C 1-4 C substituted with aliphatic groups 10 -C 40 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of unsubstituted C 10 -C 40 In some embodiments, the lipid contains one or less optionally substituted C 10 -C 80 In some embodiments, the lipid contains two or more optionally substituted C 10 -C 40 It contains a linear saturated or partially unsaturated aliphatic chain of

[0007] In some embodiments, the present disclosure provides compositions containing a bioactive agent and a lipid. Many lipids can be utilized in the techniques provided in accordance with the present disclosure. In some embodiments, the lipid is an optionally substituted C 10 -C 60 wherein one or more methylene units are optionally, and independently, C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R' In some embodiments, the lipid is replaced by an optionally substituted group selected from: -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)-, -S(O)N(R')-, -N(R')S(O)-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein each variable is independently as defined and described herein. In some embodiments, the lipid is replaced by an optionally substituted C 10 -C 80In some embodiments, the lipid contains a saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of, optionally, one or more C 1-4 C substituted with aliphatic groups 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of unsubstituted C 10 -C 80 In some embodiments, the lipid contains one or less optionally substituted C 10 -C 80 In some embodiments, the lipid contains two or more optionally substituted C 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 60 In some embodiments, the lipid contains a saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 60 Contains a linear saturated or partially unsaturated aliphatic chain of In some embodiments, the lipid may optionally contain one or more C 1-4 C substituted with aliphatic groups 10 -C 60 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of unsubstituted C 10 -C 60 In some embodiments, the lipid contains one or less optionally substituted C 10 -C 60 In some embodiments, the lipid contains two or more optionally substituted C 10 -C 60In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 40 In some embodiments, the lipid contains a saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 40 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of, optionally, one or more C 1-4 C substituted with aliphatic groups 10 -C 40 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of unsubstituted C 10 -C 40 In some embodiments, the lipid contains one or less optionally substituted C 10 -C 60 In some embodiments, the lipid contains two or more optionally substituted C 10 -C 40 It contains a linear saturated or partially unsaturated aliphatic chain of

[0008] In some embodiments, the present disclosure provides compositions containing a bioactive agent and a lipid. Many lipids can be utilized in the techniques provided in accordance with the present disclosure. In some embodiments, the lipid is an optionally substituted C 10 -C 40wherein one or more methylene units are optionally, and independently, C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R' In some embodiments, the lipid is replaced by an optionally substituted group selected from: -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)-, -S(O)N(R')-, -N(R')S(O)-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein each variable is independently as defined and described herein. In some embodiments, the lipid is replaced by an optionally substituted C 10 -C 80 In some embodiments, the lipid contains a saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of, optionally, one or more C 1-4 C substituted with aliphatic groups 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of unsubstituted C 10 -C 80 In some embodiments, the lipid contains one or less optionally substituted C 10 -C 80 In some embodiments, the lipid contains two or more optionally substituted C 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 40 In some embodiments, the lipid contains a saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C60 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of, optionally, one or more C 1-4 C substituted with aliphatic groups 10 -C 60 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of unsubstituted C 10 -C 60 In some embodiments, the lipid contains one or less optionally substituted C 10 -C 60 In some embodiments, the lipid contains two or more optionally substituted C 10 -C 60 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 60 In some embodiments, the lipid contains a saturated or partially unsaturated aliphatic chain of optionally substituted C 10 -C 40 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of, optionally, one or more C 1-4 C substituted with aliphatic groups 10 -C 40 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of unsubstituted C 10 -C 40 In some embodiments, the lipid contains one or less optionally substituted C 10 -C 40 In some embodiments, the lipid contains two or more optionally substituted C 10 -C 40 It contains a linear saturated or partially unsaturated aliphatic chain of

[0009] In some embodiments, the present disclosure provides a composition comprising a bioactive agent and C 10 -C 80In some embodiments, the present disclosure provides compositions containing lipids containing a linear saturated or partially unsaturated aliphatic chain of C. In some embodiments, the present disclosure provides compositions containing a lipid containing a biologically active agent and, optionally, one or more C 1-4 C substituted with aliphatic groups 10 -C 80 In some embodiments, the present disclosure relates to a composition comprising a lipid containing a linear saturated or partially unsaturated aliphatic chain of C. 10 -C 60 In some embodiments, the present disclosure provides compositions containing lipids containing a linear saturated or partially unsaturated aliphatic chain of C. In some embodiments, the present disclosure provides compositions containing a lipid containing a biologically active agent and, optionally, one or more C 1-4 C substituted with aliphatic groups 10 -C 60 In some embodiments, the present disclosure relates to a composition comprising a lipid containing a linear saturated or partially unsaturated aliphatic chain of C. 10 -C 40 In some embodiments, the present disclosure provides compositions containing lipids containing a linear saturated or partially unsaturated aliphatic chain of C. In some embodiments, the present disclosure provides compositions containing a lipid containing a biologically active agent and, optionally, one or more C 1-4 C substituted with aliphatic groups 10 -C 40 The present invention relates to a composition containing a lipid containing a linear saturated or partially unsaturated aliphatic chain of the formula:

[0010] In some embodiments, the present disclosure relates to a composition containing a bioactive agent and a lipid selected from the group consisting of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl. In some embodiments, the lipid has any of the following structures: [ka]

[0011] In some embodiments, the lipid is complexed with a bioactive agent. A person of ordinary skill in the art will recognize that various techniques can be used to complex a lipid with a bioactive agent in accordance with the present disclosure. In some embodiments, the lipid is not complexed with a bioactive agent.

[0012] A variety of bioactive agents can be efficiently delivered to their targets in accordance with the present disclosure. In some embodiments, the bioactive agent is selected from the group consisting of small molecules, peptides, proteins, components of the CRISPR-Cas system, carbohydrates, therapeutic agents, chemotherapeutic agents, vaccines, nucleic acids, and lipids. In some embodiments, the nucleic acid contains one or more nucleotides (e.g., natural nucleotides, modified nucleotides, nucleotide analogs, etc.). In some embodiments, the nucleic acid is an oligonucleotide, an antisense oligonucleotide, an RNAi agent, an miRNA, an immunomodulatory nucleic acid, an aptamer, a Piwi-interacting RNA (piRNA), a small nucleolar RNA (snoRNA), a ribozyme, an mRNA, an IncRNA, an ncRNA, an antigomir (e.g., an antagonist to an miRNA, an IncRNA, an ncRNA, or another nucleic acid), a plasmid, a vector, or portions thereof. In some embodiments, the bioactive agent is an oligonucleotide. In some embodiments, the present disclosure provides compositions containing an oligonucleotide and a lipid. In particular, such compositions are surprisingly effective in delivering oligonucleotides to their target locations, and in some embodiments, deliver the oligonucleotides intracellularly at the target locations. In some embodiments, the provided technology is surprisingly effective in delivering oligonucleotides to muscle cells, tissues, etc. In some embodiments, the provided compounds, e.g., lipid-complexed oligonucleotides, have unexpected and improved properties, e.g., improved activity, improved pharmacokinetics, reduced toxicity (e.g., reduced unwanted immune response), improved delivery to the target (e.g., cell, tissue, organ, organism, etc.), etc. In some embodiments, the oligonucleotide is an oligonucleotide described in patent application publications US20120316224, US20140194610, US20150211006, and WO2015107425, and U.S. Patent Nos. 9,243,245, 9,249,416, 9,175,286, 9,234,198, 8,895,309, 8,741,863, 8,097,596, 5,854,223, 5,756,476, and 8,871,918, the oligonucleotide compositions of each of which are incorporated herein by reference.In some embodiments, the oligonucleotide contains one or more chiral internucleotide linkages. In some embodiments, for oligonucleotides containing one or more chiral internucleotide linkages, the compositions provided are stereoirregular compositions of such oligonucleotides, in that the stereochemistry of each of the chiral internucleotide linkages is not controlled. In some embodiments, stereoirregular compositions are prepared by oligonucleotide synthesis without any special attempt, for example, via chiral auxiliaries, to control the stereochemistry of each chiral internucleotide linkage. In some embodiments, for oligonucleotides containing one or more chiral internucleotide linkages, the compositions provided are chiral-controlled oligonucleotide compositions of such oligonucleotides, in that the stereochemistry of at least one of the chiral internucleotide linkages is controlled. In some embodiments, the stereochemistry of each of the chiral internucleotide linkages is independently controlled and provided. The provided compositions are fully chiral controlled oligonucleotide compositions. In some embodiments, the stereochemistry of one or more chiral internucleotide linkages is controlled (chiral controlled internucleotide linkages), while the stereochemistry of one or more chiral internucleotide linkages is not controlled (stereoirregular / non-chiral controlled internucleotide linkages), and the provided compositions are partially chiral controlled oligonucleotide compositions. In some embodiments, chiral controlled oligonucleotide compositions can be prepared by oligonucleotide synthesis involving stereoselective formation of one or more or all chiral internucleotide linkages, such as using techniques described in Patent Application Publications US20120316224, US20140194610, US20150211006, and WO2015107425, each of which is incorporated herein by reference. In some embodiments, provided compositions comprise a lipid and a chiral controlled oligonucleotide composition described in Patent Application Publications US20120316224, US20140194610, US20150211006, and WO2015107425, each of which is incorporated herein by reference. In some embodiments, the lipid is conjugated to an oligonucleotide containing a stereochemically controlled internucleotide linkage.

[0013] In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions, the compositions containing a plurality of oligonucleotides sharing: 1) a common base sequence; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone phosphorus modifications; in this case, the composition is chirality-controlled in that the plurality of oligonucleotides share the same stereochemistry at one or more chiral internucleotide linkages, and the level of the plurality of oligonucleotides in the composition is predetermined; one or more oligonucleotides of the plurality of oligonucleotides are independently conjugated to a lipid; and one or more oligonucleotides of the plurality of oligonucleotides are optionally and independently conjugated to a targeting component.

[0014] In some embodiments, the disclosure provides chiral controlled oligonucleotide compositions, the compositions containing a plurality of oligonucleotides that share: 1) a common base sequence; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone phosphorus modifications; wherein: the composition is characterized in that the plurality of oligonucleotides share the same stereochemistry at one or more chiral internucleotide linkages, and at least 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 100%, 100%, 110%, 1 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% are chiral controlled in that they share the same stereochemistry at one or more chiral internucleotide linkages; one or more oligonucleotides of the plurality are independently conjugated to a lipid; and one or more oligonucleotides of the plurality are optionally and independently conjugated to a targeting component.

[0015] In some embodiments, the present disclosure provides an oligonucleotide composition containing a plurality of oligonucleotides having the following structure: c -[-L LD -(R LD ) a ] b , or [(A c ) a -L LD ] b -R LD , where A c is a bioactive agent; a is 1 to 1000; b is 1 to 1000; each L LD is independently a linker moiety or a covalent bond; and each R LD is independently a lipid moiety or a targeting component.

[0016] In some embodiments, the present disclosure provides an oligonucleotide composition containing a plurality of oligonucleotides having the following structure: c -[-L LD -(R LD ) a ] b , or [(A c ) a -L LD ] b -R LD , in the formula:A c is a bioactive agent; a is 1 to 1000; b is 1 to 1000; each L LD is independently a linker moiety; and each R LD are independently a lipid moiety or a targeting component, in which case at least one R LD is the lipid portion.

[0017] In some embodiments, the present disclosure provides an oligonucleotide composition containing a plurality of oligonucleotides having the following structure: c -[-L LD -(R LD ) a ] b , or [(A c ) a -L LD ] b -R LD , in the formula:A c is a bioactive agent; a is 1 to 1000; b is 1 to 1000; each L LD are independently a covalent bond or an optionally substituted C-C 80 wherein one or more methylene units are optionally and independently selected from the group consisting of: T LDor by an optionally substituted group selected from C-C alkylene, C-C alkenylene, -C≡C-, C-C heteroaliphatic moiety, -C(R')-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)N(R')-, -N(R')S(O)-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-; LD are independently optionally substituted C-C 80 a saturated aliphatic or partially unsaturated aliphatic group, wherein one or more methylene units are optionally, and independently, C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N (R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-; T LD has the following structure: [ka] W is O, S, or Se; each of X, Y, and Z is independently —O—, —S—, —N(—LR 1 )-, or L; L is a covalent bond or an optionally substituted linear or branched C-C 10alkylene, wherein one or more methylene units of L are optionally and independently C-C alkylene, C-C alkenylene, -C≡C-, C-C heteroaliphatic moiety, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2- -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-; R 1 is hydrogen, R, or optionally substituted C-C 50 aliphatic, wherein one or more methylene units are optionally and independently C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2- and each R' is independently -R, -C(O)R, -COR, or -SOR; or two R', together with the atoms between them, form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring; -Cy- is an optionally substituted divalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, and heterocyclylene; and each R is independently hydrogen or an optionally substituted group selected from C-C aliphatic, carbocyclyl, aryl, heteroaryl, and heterocyclyl.

[0018] In some embodiments, A cis an oligonucleotide chain ([H] b -A c is an oligonucleotide). In some embodiments, [H] b -A c is any of the oligonucleotides in the Table. c is a small molecule. In some embodiments, HA c is a peptide. In some embodiments, HA c is a protein.

[0019] In some embodiments, T LD The P in the middle is P * In some embodiments, the complex is c ) a -L LD ] b -R LD In some embodiments, the complex has the structure: c ) a -L LD -R LD In some embodiments, a is 1 to 100. In some embodiments, a is 1 to 50. In some embodiments, a is 1 to 40. In some embodiments, a is 1 to 30. In some embodiments, a is 1 to 20. In some embodiments, a is 1 to 15. In some embodiments, a is 1 to 10. In some embodiments, a is 1 to 9. In some embodiments, a is 1 to 8. In some embodiments, a is 1 to 7. In some embodiments, a is 1 to 6. In some embodiments, a is 1 to 5. In some embodiments, a is 1 to 4. In some embodiments, a is 1 to 3 In some embodiments, a is 1 to 2. In some embodiments, a is 1. In some embodiments, a is 2. In some embodiments, a is 3. In some embodiments, a is 4. In some embodiments, a is 5. In some embodiments, a is 6. In some embodiments, a is 7. In some embodiments, a is 8. In some embodiments, a is 9. In some embodiments, a is 10. In some embodiments, a is greater than 10. In some embodiments, b is 1 to 100. In some embodiments, b is 1 to 50. In some embodiments, b is 1 to 40. In some embodiments, b is 1 to 30. In some embodiments, b is 1 to 20. In some embodiments, b is 1 to 15. In some embodiments, b is 1 to 10. In some embodiments, b is 1 to 9. In some embodiments, b is 1 to 8. In some embodiments, b is 1 to 7. In some embodiments, b is 1 to 6. In some embodiments, b is 1 to 5. In some embodiments, b is 1 to 4. In some embodiments, b is 1 to 3. In some embodiments, b is 1 to 2. In some embodiments, b is 1. In some embodiments, b is 2. In some embodiments, b is 3. In some embodiments, b is 4. In some embodiments, b is 5. In some embodiments, b is 6. In some embodiments, b is 7. In some embodiments, b is 8. In some embodiments, b is 9. In some embodiments, b is 10. In some embodiments, b is greater than 10. In some embodiments, the complex is A c -L LD -R LD In some embodiments, A has the structure c is conjugated via one or more of its sugar, base, and / or internucleotide linkage moieties. c is conjugated via its 5'-OH (5'-O-). c is conjugated via its 3'-OH (3'-O-). In some embodiments, prior to conjugation, Ac -(H) b (b is A c In some embodiments, L is an oligonucleotide described herein, e.g., an oligonucleotide described in any one of the Tables. LD is -L-. In some embodiments, L LD contains a phosphorothioate group. In some embodiments, L LD is -C(O)NH-(CH2)6-OP(=O)(S - )—O—. In some embodiments, the —C(O)NH terminus is R LD and the -O-terminus is linked to the oligonucleotide, e.g., via the 5'-terminus or 3'-terminus. LD is an optionally substituted C 10 , C 15 , C 16 , C 17 , C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , C 24 , or C 25 ~C 20 , C 21 , C 22 , C 23 , C 24 , C 25 , C 26 , C 27 , C 28 , C 29 , C 30 , C 35 , C 40 , C 45 , C 50 , C 60 , C 70 , or C 80 In some embodiments, R LD is an optionally substituted C 10-80 In some embodiments, R LD is an optionally substituted C 20-80 In some embodiments, R LD is an optionally substituted C10-70 In some embodiments, R LD is an optionally substituted C 20-70 In some embodiments, R LD is an optionally substituted C 10-60 In some embodiments, R LD is an optionally substituted C 20-60 In some embodiments, R LD is an optionally substituted C 10-50 In some embodiments, R LD is an optionally substituted C 20-50 In some embodiments, R LD is an optionally substituted C 10-40 In some embodiments, R LD is an optionally substituted C 20-40 In some embodiments, R LD is an optionally substituted C 10-30 In some embodiments, R LD is an optionally substituted C 20-30 In some embodiments, R LD is the unsubstituted C 10 , C 15 , C 16 , C 17 , C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , C 24 , or C 25 ~C 20 , C 21 , C 22 , C 23 , C 24 , C 25 , C 26 , C 27 , C 28 , C 29 , C 30 , C 35 , C 40 , C 45 , C 50 , C 60 , C 70 , or C 80In some embodiments, R LD is the unsubstituted C 10-80 In some embodiments, R LD is the unsubstituted C 20-80 In some embodiments, R LD is the unsubstituted C 10-70 In some embodiments, R LD is the unsubstituted C 20-70 In some embodiments, R LD is the unsubstituted C 10-60 In some embodiments, R LD is the unsubstituted C 20-60 In some embodiments, R LD is the unsubstituted C 10-50 In some embodiments, R LD is the unsubstituted C 20-50 In some embodiments, R LD is the unsubstituted C 10-40 In some embodiments, R LD is the unsubstituted C 20-40 In some embodiments, R LD is the unsubstituted C 10-30 In some embodiments, R LD is the unsubstituted C 20-30 It is aliphatic.

[0020] In some embodiments, a plurality of oligonucleotides share the same stereochemistry at one or more chiral internucleotide linkages (chiral controlled internucleotide linkages). In some embodiments, a plurality of oligonucleotides share the same stereochemistry at two or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at three or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at four or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at five or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at six or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at seven or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at eight or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at nine or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at ten or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at eleven or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 12 or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 13 or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 14 or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 15 or more chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 10% or more of the chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 20% or more of the chiral internucleotide linkages.In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 30% or more of their chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 40% or more of their chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 50% or more of their chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 60% or more of their chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 70% or more of their chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 80% or more of their chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 90% or more of their chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 95% or more of their chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 96% or more of their chiral internucleotide linkages. In some embodiments, a plurality of oligonucleotides share the same stereochemistry at 97% or more of their chiral internucleotide linkages. In some embodiments, the oligonucleotides share the same stereochemistry at 98% or more of their chiral internucleotide linkages. In some embodiments, the oligonucleotides share the same stereochemistry at each chiral internucleotide linkage. As will be readily recognized by those of ordinary skill in the art and as described in the examples, the chiral internucleotide linkages at which the oligonucleotides share the same stereochemistry can independently be either Rp or Sp, for example, at a first chiral internucleotide linkage, the oligonucleotides are all Rp, while at a second position, the oligonucleotides are all Sp (RpSp; if desired, they can be RpRp, SpSp, or SpRp).

[0021] In some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the oligonucleotides in the provided compositions that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications are identical at one or more chiral internucleotide linkages. They share stereochemistry. In some embodiments, this percentage is at least 0.5%. In some embodiments, this percentage is at least 1%. In some embodiments, this percentage is at least 2%. In some embodiments, this percentage is at least 3%. In some embodiments, this percentage is at least 4%. In some embodiments, this percentage is at least 5%. In some embodiments, this percentage is at least 6%. In some embodiments, this percentage is at least 7%. In some embodiments, this percentage is at least 8%. In some embodiments, this percentage is at least 9%. In some embodiments, this percentage is at least 10%. In some embodiments, this percentage is at least 20%. In some embodiments, this percentage is at least 30%. In some embodiments, this percentage is at least 40%. In some embodiments, this percentage is at least 50%. In some embodiments, this percentage is at least 60%. In some embodiments, this percentage is at least 70%. In some embodiments, this percentage is at least 75%. In some embodiments, this percentage is at least 80%. In some embodiments, this percentage is at least 81%. In some embodiments, this percentage is at least 82%. In some embodiments, this percentage is at least 83%. In some embodiments, this percentage is at least 84%. In some embodiments, this percentage is at least 85%. In some embodiments, this percentage is at least 86%. In some embodiments, this percentage is at least 87%. In some embodiments, this percentage is at least 88%. In some embodiments, this percentage is at least 89%. In some embodiments, this percentage is at least 90%. In some embodiments, this percentage is at least 91%. In some embodiments, this percentage is at least 92%. In some embodiments, this percentage is at least 93%. In some embodiments, this percentage is at least 94%. In some embodiments, this percentage is at least 95%. In some embodiments, this percentage is at least 96%. In some embodiments, this percentage is at least 97%.In some embodiments, this percentage is at least 98%. In some embodiments, this percentage is at least 99%.

[0022] In some embodiments, oligonucleotides that share a common base sequence, a common pattern of backbone linkages, a common pattern of backbone phosphorus modifications, and the same stereochemistry at one or more chiral internucleotide linkages are enriched, as compared to, for example, oligonucleotides that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications, but do not share the same stereochemistry at one or more chiral internucleotide linkages. In some embodiments, as will be understood by one of ordinary skill in the art, the enrichment results from the use of one or more of the provided techniques in which each internucleotide linkage is formed stereoselectively (chiral controlled), allowing the oligonucleotides to share the same stereochemistry.

[0023] In some embodiments, oligonucleotides that share a common base sequence, a common pattern of backbone linkages, a common pattern of backbone phosphorus modifications, and the same stereochemistry at one or more chiral internucleotide linkages are enriched by at least 5-fold compared to a stereoirregular preparation of oligonucleotides (such oligonucleotides are enriched by 5*(½) of oligonucleotides that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications). n where n is the number of internucleotide linkages with which such oligonucleotides share the same stereochemistry; or oligonucleotides that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications but do not share the same stereochemistry at one or more chiral internucleotide linkages have a ratio of [1-(1 / 2 n)] / 5 or less). In this case, the internucleotide linkages are not chirally controlled (nucleotides that share a common base sequence, a common pattern of backbone linkages, a common pattern of backbone phosphorus modifications, and the same stereochemistry at one or more chiral internucleotide linkages are often half as common as oligonucleotides that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications). n where n is the number of chiral internucleotide linkages that the oligonucleotides share the same stereochemistry. Oligonucleotides that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications, but are not of a specific oligonucleotide type, are often considered to have a ratio of [1-(1 / 2 n)). In some embodiments, this enrichment is at least 20-fold. In some embodiments, this enrichment is at least 30-fold. In some embodiments, this enrichment is at least 40-fold. In some embodiments, this enrichment is at least 50-fold. In some embodiments, this enrichment is at least 60-fold. In some embodiments, this enrichment is at least 70-fold. In some embodiments, this enrichment is at least 80-fold. In some embodiments, this enrichment is at least 90-fold. In some embodiments, this enrichment is at least 100-fold. In some embodiments, this enrichment is at least 200-fold. In some embodiments, this enrichment is at least 300-fold. In some embodiments, this enrichment is at least 400-fold. In some embodiments, this enrichment is at least 500-fold. In some embodiments, this enrichment is at least 600-fold. In some embodiments, this enrichment is at least 700-fold. In some embodiments, this enrichment is at least 800-fold. In some embodiments, this enrichment is at least 900-fold. In some embodiments, the enrichment is at least 1,000-fold. In some embodiments, the enrichment is at least 2,000-fold. In some embodiments, the enrichment is at least 4,000-fold. In some embodiments, the enrichment is at least 8,000-fold. In some embodiments, the enrichment is at least 10,000-fold. In some embodiments, the enrichment is at least 20,000-fold. In some embodiments, the enrichment is at least (1.5) n In some embodiments, this enrichment is at least (1.6) n In some embodiments, this enrichment is at least (1.7) n In some embodiments, this enrichment is at least (1.1) n In some embodiments, this enrichment is at least (1.8) n In some embodiments, this enrichment is at least (1.9) n In some embodiments, this enrichment is at least 2 n In some embodiments, this enrichment is at least 3 nIn some embodiments, this enrichment is at least 4 n In some embodiments, this enrichment is at least 5 n In some embodiments, this enrichment is at least 6 n In some embodiments, this enrichment is at least 7 n In some embodiments, this enrichment is at least 8 n In some embodiments, this enrichment is at least 9 n In some embodiments, this enrichment is at least 10 n In some embodiments, this enrichment is at least 15 n In some embodiments, this enrichment is at least 20 n In some embodiments, this enrichment is at least 25 n In some embodiments, this enrichment is at least 30 n In some embodiments, this enrichment is at least 40 n In some embodiments, this enrichment is at least 50 n In some embodiments, this enrichment is at least 100 n In some embodiments, enrichment is measured by an increase in the proportion of oligonucleotides that share a common base sequence, a common pattern of backbone linkages, a common pattern of backbone phosphorus modifications, and the same stereochemistry at one or more chiral internucleotide linkages. In some embodiments, enrichment is measured by a decrease in the proportion of oligonucleotides that share a common base sequence, a common pattern of backbone linkages, a common pattern of backbone phosphorus modifications, but do not share the same stereochemistry at one or more chiral internucleotide linkages.

[0024] In some embodiments, the oligonucleotides of a particular type in the chiral controlled oligonucleotide composition are structurally identical (including stereochemically identical) and are enriched by at least 5-fold compared to a stereoirregular preparation of oligonucleotides (a particular type of oligonucleotide is an oligonucleotide 5*(½) having the base sequence, backbone linkage pattern, and backbone phosphorus modification pattern of that particular oligonucleotide type). n), where n is the number of chiral internucleotide bonds. Alternatively, an oligonucleotide having the base sequence, backbone bond pattern, and backbone phosphorus modification pattern of the specific oligonucleotide type, but not of the specific oligonucleotide type, has a ratio of [1-(1 / 2 n )] / 5 or less) (A specific type of oligonucleotide is often 1 / 2 of an oligonucleotide having the base sequence, backbone bond pattern, and backbone phosphorus modification pattern of that specific oligonucleotide type. n where n is the number of chiral internucleotide bonds. An oligonucleotide that has the base sequence, backbone bond pattern, and backbone phosphorus modification pattern of the specific oligonucleotide type, but is not a specific oligonucleotide type, is often considered to have a ratio of [1-(1 / 2 n)). In some embodiments, this enrichment is at least 20-fold. In some embodiments, this enrichment is at least 30-fold. In some embodiments, this enrichment is at least 40-fold. In some embodiments, this enrichment is at least 50-fold. In some embodiments, this enrichment is at least 60-fold. In some embodiments, this enrichment is at least 70-fold. In some embodiments, this enrichment is at least 80-fold. In some embodiments, this enrichment is at least 90-fold. In some embodiments, this enrichment is at least 100-fold. In some embodiments, this enrichment is at least 200-fold. In some embodiments, this enrichment is at least 300-fold. In some embodiments, this enrichment is at least 400-fold. In some embodiments, this enrichment is at least 500-fold. In some embodiments, this enrichment is at least 600-fold. In some embodiments, this enrichment is at least 700-fold. In some embodiments, this enrichment is at least 800-fold. In some embodiments, this enrichment is at least 900-fold. In some embodiments, the enrichment is at least 1,000-fold. In some embodiments, the enrichment is at least 2,000-fold. In some embodiments, the enrichment is at least 4,000-fold. In some embodiments, the enrichment is at least 8,000-fold. In some embodiments, the enrichment is at least 10,000-fold. In some embodiments, the enrichment is at least 20 ... The conversion is at least (1.5) n In some embodiments, this enrichment is at least (1.6) n In some embodiments, this enrichment is at least (1.7) n In some embodiments, this enrichment is at least (1.1) n In some embodiments, this enrichment is at least (1.8) n In some embodiments, this enrichment is at least (1.9) n In some embodiments, this enrichment is at least 2 n In some embodiments, this enrichment is at least 3n In some embodiments, this enrichment is at least 4 n In some embodiments, this enrichment is at least 5 n In some embodiments, this enrichment is at least 6 n In some embodiments, this enrichment is at least 7 n In some embodiments, this enrichment is at least 8 n In some embodiments, this enrichment is at least 9 n In some embodiments, this enrichment is at least 10 n In some embodiments, this enrichment is at least 15 n In some embodiments, this enrichment is at least 20 n In some embodiments, this enrichment is at least 25 n In some embodiments, this enrichment is at least 30 n In some embodiments, this enrichment is at least 40 n In some embodiments, this enrichment is at least 50 n In some embodiments, this enrichment is at least 100 n In some embodiments, enrichment is measured by an increase in the proportion of oligonucleotides of a particular oligonucleotide type among oligonucleotides having the base sequence, backbone bonding pattern, and backbone phosphorus modification pattern of the particular oligonucleotide type. In some embodiments, enrichment is measured by a decrease in the proportion of oligonucleotides that have the base sequence, backbone bonding pattern, and backbone phosphorus modification pattern of the particular oligonucleotide type but are not of the particular oligonucleotide type among oligonucleotides having the base sequence, backbone bonding pattern, and backbone phosphorus modification pattern of the particular oligonucleotide type.

[0025] In some embodiments, the composition further contains a targeting component. The targeting component may or may not be conjugated to a lipid or a bioactive agent. In some embodiments, the targeting component is conjugated to a bioactive agent. In some embodiments, the bioactive agent is conjugated to both the lipid and the targeting component. A variety of targeting components can be used in accordance with the present disclosure, such as lipids, antibodies, peptides, carbohydrates, and the like.

[0026] In some embodiments, the present disclosure encompasses the use of a composition comprising a lipid and a bioactive agent. In some embodiments, the present disclosure provides a method for delivering a bioactive agent to a target location, comprising administering a provided composition. In some embodiments, the provided method delivers a bioactive agent to a cell. In some embodiments, the provided method delivers a bioactive agent to a muscle cell. In some embodiments, the provided method delivers a bioactive agent to a cell in a tissue. In some embodiments, the provided method delivers a bioactive agent to a cell in an organ. In some embodiments, the provided method delivers a bioactive agent into a cell in a subject, comprising administering to the subject a provided composition. In some embodiments, the provided method delivers a bioactive agent into the cytoplasm. In some embodiments, the provided method delivers a bioactive agent into the nucleus.

[0027] In some embodiments, the present disclosure relates to methods for delivering a bioactive agent to muscle cells or tissue, or to muscle cells or tissue in a mammal (e.g., a human subject). The methods involve the use of compositions containing a bioactive agent and a lipid and any one or more additional components selected from the following: a polynucleotide, a dye, an intercalating agent (e.g., acridine), a carbonic anhydrase inhibitor, a crosslinker (e.g., psoralen or mitomycin C), a porphyrin (e.g., TPPC4, texaphyrin, or sapphyrin), a polycyclic aromatic hydrocarbon (e.g., phenazine or dihydrophenazine), an artificial endonuclease, a chelating agent, EDTA, an alkylating agent, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, a radiolabeled marker, an enzyme, a hapten (e.g., biotin), a transport / absorption enhancer (e.g., aspirin, vitamin E, or folic acid), a synthetic ribonuclease, a protein, e.g., a glycoprotein, or a peptide, e.g., a molecule having a specific affinity for a co-ligand, or an antibody, e.g., an antibody, a hormone, a hormone receptor, a non-peptide species, a lipid, a lectin, a carbohydrate, a vitamin, a cofactor, or a drug. In some embodiments, the present disclosure provides a composition comprising a bioactive agent and C 10 -C 80 In some embodiments, the present disclosure relates to a composition comprising, or a method relating to, a lipid containing a linear saturated or partially unsaturated aliphatic chain of the formula: 1-4 C substituted with aliphatic groups 10 -C 80 In some embodiments, the present disclosure relates to a composition comprising, or a method relating to, a lipid containing a linear saturated or partially unsaturated aliphatic chain of the formula: 10 -C 60 In some embodiments, the present disclosure relates to a composition comprising, or a method relating to, a lipid containing a linear saturated or partially unsaturated aliphatic chain of the formula: 1-4 C substituted with aliphatic groups 10 -C 60In some embodiments, the present disclosure relates to a composition comprising, or a method relating to, a lipid containing a linear saturated or partially unsaturated aliphatic chain of the formula: 10 -C 40 In some embodiments, the present disclosure relates to a composition comprising, or a method relating to, a lipid containing a linear saturated or partially unsaturated aliphatic chain of the formula: 1-4 C substituted with aliphatic groups 10 -C 40 The present disclosure relates to compositions containing, or methods relating to, lipids containing linear saturated or partially unsaturated aliphatic chains of the formula: In some embodiments, the present disclosure provides chiral controlled oligonucleotide compositions and a lipid selected from the group consisting of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl, wherein the compositions are suitable for delivery of oligonucleotides to muscle cells or tissues, or muscle cells or tissues in a mammal (e.g., a human subject). In some embodiments, the bioactive agent is an oligonucleotide containing one or more chiral internucleotide linkages, and the compositions provided are chiral controlled oligonucleotide compositions of the oligonucleotides. In some embodiments, the bioactive agent is an oligonucleotide containing one or more chiral internucleotide linkages, and the compositions provided are non-chiral controlled oligonucleotide compositions of the oligonucleotides.

[0028] In some embodiments, the present disclosure relates to a method of delivering a bioactive agent to a cell or tissue, the method comprising: providing a composition comprising a bioactive agent and a lipid; and contacting the cell or tissue with the composition. In some embodiments, the present disclosure relates to a method of administering a bioactive agent to a subject, the method comprising: providing a composition comprising a bioactive agent and a lipid; and administering the composition to the subject. In some embodiments, the lipid is C 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of, optionally, one or more C 1-4 C substituted with aliphatic groups 10 -C 80 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of C 10 -C 60 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of, optionally, one or more C 1-4 C substituted with aliphatic groups 10 -C 60 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of C 10 -C 40 In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of, optionally, one or more C 1-4 C substituted with aliphatic groups 10 -C 40The lipid contains a linear saturated or partially unsaturated aliphatic chain of 1 to 3 carbon atoms. In various embodiments, the lipid is selected from the group consisting of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl. In some embodiments, the bioactive agent is selected from the group consisting of a small molecule, a peptide, a protein, a component of a CRISPR-Cas system, a carbohydrate, a therapeutic agent, a chemotherapeutic agent, a vaccine, a nucleic acid, and a lipid. In some embodiments, the nucleic acid is an oligonucleotide, an antisense oligonucleotide, an RNAi agent, an miRNA, an immunomodulatory nucleic acid, an aptamer, a Piwi-interacting RNA (piRNA), a small nucleolar RNA (snoRNA), a ribozyme, an mRNA, an IncRNA, an ncRNA, an antigomir (e.g., an antagonist to an miRNA, an IncRNA, an ncRNA, or another nucleic acid), a plasmid, a vector, or a portion thereof. In some embodiments, the provided composition is a chiral-controlled oligonucleotide composition of a nucleic acid containing one or more chiral internucleotide linkages. In various embodiments, the extrahepatic cell or tissue is a muscle cell or muscle tissue. In various embodiments, the muscle cell or muscle tissue is in a subject. In various embodiments, the muscle cell or muscle tissue is in a subject suffering from a muscle-related disease or disorder. In various embodiments, the muscle-related disorder is sarcopenia, muscle movement disorders, muscle atrophy-related disorders, muscle degeneration, muscle weakness, muscular dystrophy, Duchenne muscular dystrophy, heart failure, respiratory disorders, skeletal muscle degeneration caused by malnutrition and disease, muscle-related diseases associated with impaired insulin-dependent signaling, amyotrophic lateral sclerosis, spinal muscular atrophy and spinal cord injury, ischemic muscle disease. In some embodiments, the present disclosure relates to a method of administering a nucleic acid (for example, an oligonucleotide or a stereodefined oligonucleotide) to muscle cells or muscle tissue in a subject suffering from a muscle-related disease or disorder, the method comprising the steps of: providing a composition containing a lipid and a nucleic acid, and administering a therapeutically effective amount of the composition to the subject.

[0029] In some embodiments, the bioactive agent is an oligonucleotide, the sequence of which is or contains an element that is substantially complementary to a target element in the cellular nucleic acid. In some embodiments, the target element is or contains a sequence element associated with a muscle disease, disorder, or condition. In some embodiments, the muscle disease, disorder, or condition is DMD. In some embodiments, the cellular nucleic acid is or contains a transcript. In some embodiments, the cellular nucleic acid is a primary transcript or In some embodiments, the cellular nucleic acid is or contains genomic nucleic acid.

[0030] In some embodiments, the present disclosure provides a composition comprising a bioactive agent and a lipid.

[0031] In some embodiments, the present disclosure provides compositions comprising a bioactive agent and a lipid, wherein the composition is characterized in that it delivers the bioactive agent intracellularly.

[0032] In some embodiments, the composition delivers the bioactive agent into the cytoplasm of the cell.

[0033] In some embodiments, the composition delivers the bioactive agent into the nucleus of the cell.

[0034] In some embodiments, the present disclosure provides compositions containing a bioactive agent and a lipid, which deliver the bioactive agent into cells at levels that are elevated compared to the levels observed for the bioactive agent in the absence of lipid.

[0035] In some embodiments, the present disclosure provides a composition comprising a bioactive agent and a lipid, the composition being characterized in that it delivers the bioactive agent into muscle cells.

[0036] In some embodiments, the composition delivers the bioactive agent into the cytoplasm of a muscle cell.

[0037] In some embodiments, the composition delivers the bioactive agent into the nucleus of a muscle cell.

[0038] In some embodiments, the composition is characterized in that, when administered to a subject, the composition delivers the bioactive agent to muscle cells of the subject.

[0039] In some embodiments, the composition delivers the bioactive agent into the cytoplasm of a muscle cell.

[0040] In some embodiments, the composition delivers the bioactive agent into the nucleus of a muscle cell.

[0041] In some embodiments, the present disclosure provides compositions containing a bioactive agent and a lipid for delivering the bioactive agent to muscle cells or muscle tissue.

[0042] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid selected from the list of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl.

[0043] In some embodiments, the present disclosure provides a composition comprising a bioactive agent and a lipid selected from: [ka]

[0044] In some embodiments, the present disclosure provides a composition comprising a bioactive agent and a lipid, wherein the lipid optionally comprises one or more C 1-4 C substituted with aliphatic groups 10 -C 40wherein the bioactive agent is selected from the group consisting of a small molecule, a peptide, a protein, a component of a CRISPR-Cas system, a carbohydrate, a therapeutic agent, a chemotherapeutic agent, a vaccine, a nucleic acid, and a lipid.

[0045] In some embodiments, the present disclosure provides compositions containing a bioactive agent and a lipid for delivering the lipid to muscle cells or muscle tissue.

[0046] In some embodiments, the present disclosure provides oligonucleotide compositions, the compositions containing a plurality of oligonucleotides sharing: 1) a common base sequence; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone phosphorus modifications; wherein one or more of the plurality of oligonucleotides are individually conjugated to a lipid.

[0047] In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions, the compositions containing a plurality of oligonucleotides sharing: 1) a common base sequence; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone phosphorus modifications; in this case, the composition is chirality-controlled in that the plurality of oligonucleotides share the same stereochemistry at one or more chiral internucleotide linkages; one or more oligonucleotides of the plurality of oligonucleotides are individually conjugated to a lipid; and one or more oligonucleotides of the plurality of oligonucleotides are optionally and individually conjugated to a targeting compound or moiety.

[0048] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in the nucleic acid of a cell.

[0049] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in a nucleic acid of a cell in the subject.

[0050] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to a sequence of a target element in the nucleic acid of the cell, where the nucleic acid is genomic nucleic acid.

[0051] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to a sequence of a target element in nucleic acid of a cell in the subject, where the nucleic acid is genomic nucleic acid.

[0052] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in the nucleic acid of a cell, where the target element is an mRNA or a portion thereof.

[0053] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in nucleic acid of a cell in the subject, where the target element is an mRNA or a portion thereof.

[0054] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in the nucleic acid of a cell, where the target element is associated with a disease or disorder.

[0055] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in nucleic acid of a cell in a subject, where the target element is associated with a disease or disorder.

[0056] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in nucleic acid of a muscle cell, where the target element is associated with a muscle-related disease or disorder.

[0057] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in nucleic acid of a muscle cell in a subject, wherein the target element is associated with a muscle-related disease or disorder.

[0058] In some embodiments, multiple oligonucleotides share the same stereochemistry at five or more chiral internucleotide linkages.

[0059] In some embodiments, multiple oligonucleotides share the same stereochemistry at 10 or more chiral internucleotide linkages.

[0060] In some embodiments, multiple oligonucleotides share the same stereochemistry at each chiral internucleotide linkage, such that multiple oligonucleotides share a common pattern of backbone chiral centers.

[0061] In some embodiments, one or more of the oligonucleotides of the plurality of oligonucleotides is independently conjugated to a lipid via a 5'-OH on the oligonucleotide.

[0062] In some embodiments, one or more of the plurality of oligonucleotides is independently conjugated to a lipid via a 3'-OH on the oligonucleotide.

[0063] In some embodiments, each oligonucleotide of the plurality of oligonucleotides is individually conjugated to a lipid.

[0064] In some embodiments, each oligonucleotide of the plurality of oligonucleotides is individually conjugated to the same lipid.

[0065] In some embodiments, the present disclosure provides a composition comprising a bioactive agent and a lipid, wherein the agent is any agent disclosed herein and the lipid is any lipid disclosed herein.

[0066] In some embodiments, the present disclosure provides a method of delivering an oligonucleotide to muscle cells or muscle tissue in a human subject, the method comprising: (a) providing the composition or method of any one of the embodiments; and (b) administering the composition to the human subject, thereby delivering the oligonucleotide to muscle cells or muscle tissue in the subject.

[0067] In some embodiments, the present disclosure provides a method for delivering a bioactive agent to muscle cells or muscle tissue, the method comprising preparing a composition according to any one of the embodiments and treating (contacting) the cells or tissue with the composition.

[0068] In some embodiments, the present disclosure provides a method of modulating the level of a gene transcript or gene product in a cell, the method comprising contacting the cell with a composition according to any one of the embodiments, wherein the bioactive agent is capable of modulating the level of the transcript or gene product.

[0069] In some embodiments, the disclosure provides a method for inhibiting expression of a gene in a muscle cell or muscle tissue, the method comprising preparing a composition according to any one of the embodiments and treating the muscle cell or muscle tissue with the composition.

[0070] In some embodiments, the present disclosure provides a method for inhibiting expression of a gene in a muscle cell or muscle tissue in a mammal, the method comprising preparing a composition according to any one of the embodiments and administering the composition to the mammal.

[0071] In some embodiments, the present disclosure provides a method of treating a disease caused by overexpression of one or more proteins in muscle cells or muscle tissue in a subject, the method comprising administering to the subject a composition according to any one of the embodiments.

[0072] In some embodiments, the present disclosure provides a method of treating a disease caused by reduced, suppressed, or lost expression of one or more proteins in a subject, the method comprising administering to the subject a composition according to any one of the embodiments.

[0073] In some embodiments, the present disclosure provides a method for eliciting an immune response in a subject, the method comprising administering to the subject a composition according to any one of the embodiments, wherein the biologically active compound is an immunomodulatory nucleic acid.

[0074] In some embodiments, the present disclosure provides a composition or method according to any one of the embodiments, and provides a method for treating signs and / or symptoms of a disease, disorder, or condition in a subject selected from cancer, a proliferative disease, disorder, or condition, a metabolic disease, disorder, or condition, an inflammatory disease, disorder, or condition, and a viral infection by administering the composition to the subject.

[0075] In some embodiments, the present disclosure provides a method of modulating the amount of exon skipping in a cell, the method comprising contacting the cell with a composition according to any one of the embodiments, wherein the bioactive agent is capable of modulating the amount of exon skipping.

[0076] In some embodiments, the present disclosure provides a method of administering a bioactive agent to a subject in need thereof, the method comprising providing a composition comprising an agent and a lipid, and administering the composition to the subject, wherein the agent is any agent disclosed herein and the lipid is any lipid disclosed herein.

[0077] In some embodiments, the disclosure provides a method of treating a disease in a subject, the method comprising providing a composition comprising an agent and a lipid, and administering to the subject a therapeutically effective amount of the composition, wherein the agent is any agent disclosed herein, the lipid is any lipid disclosed herein, and the disease is a disease characterized by a compound disclosed herein. Any of the diseases disclosed.

[0078] In some embodiments, the lipid is an optionally substituted C 10 -C 40 The carboxylic acid group contains a saturated or partially unsaturated aliphatic chain of the formula:

[0079] In some embodiments, the lipid is an optionally substituted C 10 -C 40 It contains a linear saturated or partially unsaturated aliphatic chain of

[0080] In some embodiments, the lipid optionally comprises one or more C 1-4 C substituted with aliphatic groups 10 -C 40 It contains a linear saturated or partially unsaturated aliphatic chain of

[0081] In some embodiments, the lipid is an unsubstituted C 10 -C 40 It contains a linear saturated or partially unsaturated aliphatic chain of

[0082] In some embodiments, the lipid comprises one or less optionally substituted C 10 -C 40 It contains a linear saturated or partially unsaturated aliphatic chain of

[0083] In some embodiments, the lipid comprises two or more optionally substituted C 10 -C 40 It contains a linear saturated or partially unsaturated aliphatic chain of

[0084] In some embodiments, the lipid does not include a tricyclic or polycyclic moiety.

[0085] In some embodiments, the lipid is R 1 -COOH structure, wherein R 1 is an optionally substituted C 10 -C 40 is a saturated aliphatic chain or a partially unsaturated aliphatic chain.

[0086] In some embodiments, the lipid is conjugated via its carboxyl group.

[0087] In some embodiments, the lipid is selected from the following: [ka]

[0088] In some embodiments, the lipid is complexed with a bioactive agent.

[0089] In some embodiments, the lipid is directly complexed with the bioactive agent.

[0090] In some embodiments, the lipid is conjugated to the bioactive agent via a linker.

[0091] In some embodiments, the linker is selected from an uncharged linker, a charged linker, an alkyl-containing linker, a phosphate-containing linker, a branched linker, an unbranched linker, a linker containing at least one cleavage group, a linker containing at least one redox cleavage group, a linker containing at least one phosphate-based cleavage group, a linker containing at least one acid cleavage group, a linker containing at least one ester-based cleavage group, and a linker containing at least one peptide-based cleavage group.

[0092] In some embodiments, the nucleic acid is an oligonucleotide, an antisense oligonucleotide, an RNAi agent, an miRNA, a splice switching oligonucleotide (SSO), an immunomodulatory nucleic acid, an aptamer, a ribozyme, an mRNA, an IncRNA, an ncRNA, an antigomir (e.g., an antagonist to an miRNA, IncRNA, ncRNA, or other nucleic acid), a plasmid, a vector, or a portion thereof.

[0093] In some embodiments, the RNAi agent is an siRNA, shRNA, miRNA, sisiRNA, meroduplex RNA (mdRNA), DNA-RNA chimera, siRNA containing two mismatches (or more mismatches), neutral siRNA, aiRNA, or siRNA containing terminal or internal spacers.

[0094] In some embodiments, each oligonucleotide of the plurality of oligonucleotides is individually conjugated to the same lipid at the same location.

[0095] In some embodiments, the lipid is conjugated to the oligonucleotide via a linker.

[0096] In some embodiments, one or more oligonucleotides of the plurality of oligonucleotides are independently conjugated to a targeting compound or targeting moiety.

[0097] In some embodiments, one or more oligonucleotides of the plurality of oligonucleotides are independently complexed to a lipid and a targeting compound or targeting moiety.

[0098] In some embodiments, one or more of the oligonucleotides of the plurality are independently conjugated to a lipid on one end and to a targeting compound or targeting moiety on the other end.

[0099] In some embodiments, multiple oligonucleotides share the same chemical modification pattern.

[0100] In some embodiments, multiple oligonucleotides share the same chemical modification pattern, which contains one or more base modifications.

[0101] In some embodiments, multiple oligonucleotides share the same chemical modification pattern, which contains one or more sugar modifications.

[0102] In some embodiments, the consensus sequence can hybridize to a transcript in a muscle cell that contains a mutation associated with a muscle disease, or a mutation whose level, activity, and / or distribution is associated with a muscle disease.

[0103] In some embodiments, the consensus base sequence is capable of hybridizing to a transcript in a muscle cell, and the composition is characterized in that, when contacted with the transcript in a transcription-splicing system, it alters the splicing of the transcript compared to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0104] In some embodiments, the consensus sequence hybridizes to a transcript of dystrophin, myostatin, huntingtin, myostatin receptor, ActRIIB, ActRIIA, DMPK, Malat1, SMN2, dystrophia myotonica protein kinase (DMPK), proprotein convertase subtilisin / kexin type 9 (PCSK9), SMAD7, or KRT14 (keratin 14).

[0105] In some embodiments, the consensus sequence hybridizes to a dystrophin transcript.

[0106] In some embodiments, the consensus sequence hybridizes to a transcript of dystrophin, and the composition increases production of one or more functional proteins, or partially functional proteins, encoded by dystrophin.

[0107] In some embodiments, the oligonucleotide is a splice switch oligonucleotide.

[0108] In some embodiments, multiple oligonucleotides share a common pattern of sugar modifications, which pattern contains three or more 2'-Fs.

[0109] In some embodiments, multiple oligonucleotides share a common pattern of sugar modifications, which pattern contains three or more consecutive 2'-Fs.

[0110] In some embodiments, multiple oligonucleotides share a common pattern of sugar modifications, which pattern contains three or more consecutive 2'-Fs within 10 nucleotides of the 5' end.

[0111] In some embodiments, multiple oligonucleotides share a common pattern of sugar modifications, which pattern contains three or more 2'-Fs within 10 nucleotides of the 5' end.

[0112] In some embodiments, multiple oligonucleotides share a common pattern of sugar modifications, which pattern contains three or more consecutive 2'-Fs at the 5' end.

[0113] In some embodiments, multiple oligonucleotides share a common pattern of sugar modifications, which pattern contains 5 or more consecutive 2'-Fs within the first 10 nucleotides at the 3' end.

[0114] In some embodiments, multiple oligonucleotides share a common pattern of sugar modifications, which pattern contains 5 or more 2'-Fs within 10 nucleotides of the 3' end.

[0115] In some embodiments, multiple oligonucleotides share a common pattern of sugar modifications, which pattern contains 7 or more consecutive 2'-Fs at the 3' end.

[0116] In some embodiments, the oligonucleotides share a common pattern of sugar modifications that contains three or more consecutive 2'-Fs at the 5' end, three or more consecutive 2'-Fs at the 3' end, and three or more 2'-ORs between the 5'- and 3'-terminal 2'-F modifications.

[0117] In some embodiments, multiple oligonucleotides share a common pattern of sugar modifications that contains three or more 2'-Fs at the 5' end, three or more 2'-Fs at the 3' end, and three or more 2'-ORs between the 5'- and 3'-terminal 2'-F modifications.

[0118] In some embodiments, the oligonucleotides share a common pattern of sugar modifications, the pattern containing five or more 2'-Fs within 10 nucleotides of the 5' terminus.

[0119] In some embodiments, multiple oligonucleotides share a common pattern of sugar modifications, which pattern contains three or more consecutive 2'-Fs at the 5' end.

[0120] In some embodiments, multiple oligonucleotides share a common pattern of sugar modifications, which pattern contains 7 or more 2'-Fs within 10 nucleotides of the 3' terminus.

[0121] In some embodiments, multiple oligonucleotides share a common pattern of sugar modifications, which pattern contains 5 or more consecutive 2'-Fs within 10 nucleotides of the 3' terminus.

[0122] In some embodiments, multiple oligonucleotides share a common pattern of sugar modifications, which pattern contains 7 or more consecutive 2'-Fs at the 3' end.

[0123] In some embodiments, the plurality of oligonucleotides comprises a 5'-wing-core-wing-3' structure, where each wing region independently contains 3 to 10 nucleosides and each core region independently contains 3 to 10 nucleosides.

[0124] In some embodiments, the core contains at least one chiral internucleotide linkage (e.g., in the Sp or Rp configuration) and at least one non-chiral internucleotide linkage (e.g., phosphodiester or phosphorodithioate). In some embodiments, the core contains at least one internucleotide linkage that is a chiral phosphorothioate in the Sp configuration and at least one non-chiral internucleotide linkage (e.g., phosphodiester or phosphorodithioate). In some embodiments, each wing region contains an unmodified sugar moiety. In some embodiments, the core region contains one or more natural phosphate linkages. In some embodiments, each internucleotide linkage after the core nucleoside is a natural phosphate linkage. In some embodiments, the wing contains at least one chiral internucleotide linkage (e.g., a phosphorothioate in the Sp or Rp configuration) and at least one non-chiral internucleotide linkage (e.g., phosphodiester or phosphorodithioate). In some embodiments, the wings contain at least one internucleotide linkage that is a chiral phosphorothioate in the Sp configuration and at least one internucleotide linkage that is not chiral (e.g., phosphodiester or phosphorodithioate). In some embodiments, the wings contain one or more modified internucleotide linkages. In some embodiments, each internucleotide linkage after the core nucleoside is a modified internucleotide linkage.

[0125] In some embodiments, the 5'-wing region contains three or more 2'-Fs.

[0126] In some embodiments, the 5'- The binding region contains three or more consecutive 2'-Fs.

[0127] In some embodiments, the 5'-wing region contains 10% or more 2'-Fs.

[0128] In some embodiments, each sugar in the 5'-wing region contains a 2'-F.

[0129] In some embodiments, the 5'-wing region contains three or more chiral internucleotide linkages.

[0130] In some embodiments, the 5'-wing region contains three or more consecutive internucleotide linkages.

[0131] In some embodiments, the 5'-wing region contains 10% or more internucleotide linkages.

[0132] In some embodiments, each internucleotide linkage in the 5'-wing region is chiral.

[0133] In some embodiments, each internucleotide linkage in the 5'-wing region is a phosphorothioate linkage.

[0134] In some embodiments, the 5'-wing region contains five or more Rp chiral internucleotide linkages.

[0135] In some embodiments, the 5'-wing region contains five or more Rp consecutive internucleotide linkages.

[0136] In some embodiments, the 5'-wing region contains 10% or more Rp internucleotide linkages.

[0137] In some embodiments, each internucleotide linkage in the 5'-wing region is Rp.

[0138] In some embodiments, the 3'-wing region contains three or more 2'-Fs.

[0139] In some embodiments, the 3'-wing region contains five or more consecutive 2'-Fs.

[0140] In some embodiments, the 3'-wing region contains 10% or more 2'-Fs.

[0141] In some embodiments, each sugar in the 3'-wing region contains a 2'-F.

[0142] In some embodiments, the 3'-wing region contains three or more chiral internucleotide linkages.

[0143] In some embodiments, the 3'-wing region contains five or more consecutive internucleotide linkages.

[0144] In some embodiments, the 3'-wing region contains 10% or more internucleotide linkages.

[0145] In some embodiments, each internucleotide linkage in the 3'-wing region is chiral.

[0146] In some embodiments, each internucleotide linkage in the 3'-wing region is a phosphorothioate linkage.

[0147] In some embodiments, the 3'-wing region contains three or more Rp chiral internucleotide linkages.

[0148] In some embodiments, the 3'-wing region contains five or more Rp consecutive internucleotide linkages.

[0149] In some embodiments, the 3'-wing region contains 10% or more Rp internucleotide linkages.

[0150] In some embodiments, each internucleotide linkage in the 3'-wing region is Rp.

[0151] In some embodiments, the 5'-wing and the 3'-wing have the same length, chemical modification pattern, backbone internucleotide linkage pattern, and backbone chiral center pattern.

[0152] In some embodiments, the internucleotide linkage between the 5'-wing region and the core region is a chiral internucleotide linkage.

[0153] In some embodiments, the internucleotide linkage between the 5'-wing region and the core region is a phosphorothioate linkage.

[0154] In some embodiments, the internucleotide linkage between the 5'-wing region and the core region is an Rp phosphorothioate linkage.

[0155] In some embodiments, the internucleotide linkage between the 3'-wing region and the core region is a chiral internucleotide linkage.

[0156] In some embodiments, the internucleotide linkage between the 3'-wing region and the core region is a phosphorothioate linkage.

[0157] In some embodiments, the internucleotide linkage between the 3'-wing region and the core region is an Rp phosphorothioate linkage.

[0158] In some embodiments, the core region contains three or more 2'-ORs.

[0159] In some embodiments, the core region contains five or more consecutive 2'-ORs.

[0160] In some embodiments, the core region contains 10% or more 2'-ORs.

[0161] In some embodiments, each sugar of the core region contains a 2'-OR.

[0162] In some embodiments, the core region contains three or more chiral internucleotide linkages.

[0163] In some embodiments, the core region contains five or more consecutive internucleotide linkages.

[0164] In some embodiments, the core region contains 10% or more internucleotide linkages.

[0165] In some embodiments, each internucleotide linkage of the core region is chiral.

[0166] In some embodiments, each internucleotide linkage in the core region is a phosphorothioate linkage.

[0167] In some embodiments, the core region contains three or more Sp chiral internucleotide linkages.

[0168] In some embodiments, the core region contains five or more Sp consecutive internucleotide linkages.

[0169] In some embodiments, the core region contains 10% or more Sp internucleotide linkages.

[0170] In some embodiments, each internucleotide linkage of the core region is Sp.

[0171] In some embodiments, the 5'-wing region contains five or more Sp chiral internucleotide linkages.

[0172] In some embodiments, the 5'-wing region contains five or more Sp consecutive internucleotide linkages.

[0173] In some embodiments, the 5'-wing region contains 10% or more Sp internucleotide linkages.

[0174] In some embodiments, each internucleotide linkage in the 5'-wing region is Sp.

[0175] In some embodiments, the 3'-wing region contains three or more Sp chiral internucleotide linkages.

[0176] In some embodiments, the 3'-wing region contains five or more Sp consecutive internucleotide linkages.

[0177] In some embodiments, the 3'-wing region contains 10% or more Sp internucleotide linkages.

[0178] In some embodiments, each internucleotide linkage in the 3'-wing region is Sp.

[0179] In some embodiments, the internucleotide linkage between the 5'-wing region and the core region is an Sp phosphorothioate linkage.

[0180] In some embodiments, the internucleotide linkage between the 3'-wing region and the core region is an Sp phosphorothioate linkage.

[0181] In some embodiments, the nucleic acid is a splice switch oligonucleotide (SSO).

[0182] In some embodiments, the nucleic acid is a splice switch oligonucleotide (SSO) that targets dystrophin.

[0183] In some embodiments, the nucleic acid is a splice switch oligonucleotide (SSO) that targets exon 51, 45, 53, or 44 of dystrophin.

[0184] In some embodiments, the nucleic acid is a splice switch oligonucleotide (SSO) that targets exon 51 of dystrophin.

[0185] In some embodiments, the immunomodulatory nucleic acid is a CpG oligonucleotide.

[0186] In some embodiments, the immunomodulatory nucleic acid is a CpG oligonucleotide capable of stimulating a TLR9-mediated or TLR9-associated immune response.

[0187] In some embodiments, the immunomodulatory nucleic acid is a CpG oligonucleotide capable of antagonizing a TLR9-mediated or TLR9-associated immune response.

[0188] In some embodiments, the oligonucleotide contains strands of about 14 to about 49 nucleotides.

[0189] When the oligonucleotide further comprises a second strand.

[0190] In some embodiments, the oligonucleotide contains at least one modification to the base, sugar, or internucleoside linkage.

[0191] In some embodiments, the modification is a sugar modification at the 2' carbon.

[0192] In some embodiments, the modification is a sugar modification at the 2' carbon selected from the following: 2'-MOE, 2'-OMe, and 2'-F.

[0193] In some embodiments, the bioactive agent is a nucleic acid.

[0194] In some embodiments, the bioactive agent is an immunomodulatory nucleic acid.

[0195] In some embodiments, the bioactive agent is a CpG oligonucleotide that stimulates or antagonizes an immune response.

[0196] In some embodiments, the bioactive agent is a CpG oligonucleotide that stimulates or antagonizes a TLR9-mediated or TLR9-associated immune response.

[0197] In some embodiments, the bioactive agent is a small molecule, in which case the small molecule is hydrophobic.

[0198] In some embodiments, the bioactive agent is a hydrophobic small molecule selected from the group consisting of sterols and hydrophobic vitamins.

[0199] In some embodiments, the bioactive agent is cholesterol.

[0200] In some embodiments, the bioactive agent is a protein selected from the group consisting of a nucleoprotein, a mucoprotein, a lipoprotein, a synthetic polypeptide, a small molecule linked to a protein, and a glycoprotein.

[0201] In some embodiments, the bioactive agent is a nucleic acid in the form of a single-stranded or partially double-stranded oligomer or polymer composed of ribonucleotides.

[0202] In some embodiments, the bioactive agent is a nucleic acid selected from the group consisting of miRNA, antisense oligonucleotide, siRNA, immunostimulatory oligonucleotide, aptamer, Piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), ribozyme, and a plasmid encoding a specific gene or siRNA.

[0203] In some embodiments, the cell or tissue is a muscle cell or muscle tissue.

[0204] In some embodiments, the bioactive agent is a nucleic acid.

[0205] In some embodiments, the bioactive agent is an oligonucleotide.

[0206] In some embodiments, the bioactive agent is an oligonucleotide that modulates exon skipping.

[0207] In some embodiments, the bioactive agent is a stereospecific oligonucleotide that modulates exon skipping.

[0208] In some embodiments, the disease or disorder is a muscle-related disease or disorder.

[0209] In some embodiments, the muscle-related disorder is sarcopenia, muscle movement disorders, muscle atrophy-related disorders, muscle degeneration, muscle weakness, muscular dystrophy, Duchenne muscular dystrophy, heart failure, respiratory disorders, skeletal muscle degeneration caused by malnutrition and disease, muscle-related disorders associated with impaired insulin-dependent signaling, amyotrophic lateral sclerosis, spinal muscular atrophy and spinal cord injury, ischemic muscle disease.

[0210] In some embodiments, the cell or tissue is a muscle cell or muscle tissue, in which case the bioactive agent is a stereospecific oligonucleotide that is a splice switch oligonucleotide, and the subject is suffering from a muscle disorder.

[0211] In some embodiments, the cell or tissue is a muscle cell or muscle tissue, in which case the bioactive agent is a stereospecific oligonucleotide that is a splice switch oligonucleotide, and the subject suffers from a muscular dystrophy.

[0212] In some embodiments, the cell or tissue is a muscle cell or muscle tissue, in which case the bioactive agent is a stereospecific oligonucleotide that is a splice switch oligonucleotide, and the subject has Duchenne muscular dystrophy.

[0213] In some embodiments, the lipid is an optionally substituted C 10 -C 80 and wherein one or more methylene units are optionally and independently selected from C1-C6 alkylene, ... and an optionally substituted group selected from alkenylene, —C≡C—, C1-C6 heteroaliphatic moiety, —C(R′)2—, —Cy—, —O—, —S—, —SS—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—, wherein each variable is independently as defined and described herein.

[0214] In some embodiments, the lipid is an optionally substituted C 10 -C 80 The carboxylic acid group contains a saturated or partially unsaturated aliphatic chain of the formula:

[0215] In some embodiments, the lipid is an optionally substituted C 10 -C 80 It contains a linear saturated or partially unsaturated aliphatic chain of

[0216] In some embodiments, the lipid is an optionally substituted C 10 -C 60 The carboxylic acid group contains a saturated or partially unsaturated aliphatic chain of the formula:

[0217] In some embodiments, the lipid is an optionally substituted C 10 -C 60 It contains a linear saturated or partially unsaturated aliphatic chain of

[0218] In some embodiments, the lipid is an optionally substituted C 10 -C 40 The carboxylic acid group contains a saturated or partially unsaturated aliphatic chain of the formula:

[0219] In some embodiments, the lipid is an optionally substituted C 10 -C 40 It contains a linear saturated or partially unsaturated aliphatic chain of

[0220] In some embodiments, the lipid is an optionally substituted C 10 -C 60 wherein one or more methylene units are optionally, and independently, C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R' )—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)—, —S(O)N(R′)—, —N(R′)S(O)—, —SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—, wherein each variable is independently as defined and described herein.

[0221] In some embodiments, the lipid is an optionally substituted C 10 -C 80 The carboxylic acid group contains a saturated or partially unsaturated aliphatic chain of the formula:

[0222] In some embodiments, the lipid is an optionally substituted C 10 -C 60 It contains a linear saturated or partially unsaturated aliphatic chain of

[0223] In some embodiments, the lipid is an optionally substituted C 10 -C 40 It contains a linear saturated or partially unsaturated aliphatic chain of

[0224] In some embodiments, the lipid is an optionally substituted C 10 -C 40wherein one or more methylene units are optionally, and independently, C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R' )—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)—, —S(O)N(R′)—, —N(R′)S(O)—, —SC(O)—, —C(O)S—, —OC(O)—, and —C(O)O—, wherein each variable is independently as defined and described herein.

[0225] In some embodiments, the lipid is an optionally substituted C 10 -C 40 The carboxylic acid group contains a saturated or partially unsaturated aliphatic chain of the formula:

[0226] In some embodiments, the lipid is an optionally substituted C 10 -C 40 It contains a linear saturated or partially unsaturated aliphatic chain of

[0227] In some embodiments, the composition further contains one or more additional components selected from the following: a polynucleotide, a carbonic anhydrase inhibitor, a dye, an intercalating agent, an acridine, a crosslinker, a psoralen, a mitomycin C, a porphyrin, a TPPC4, a texaphyrin, a sapphyrin, a polycyclic aromatic hydrocarbon phenazine, a dihydrophenazine, an artificial endonuclease, a chelating agent, an EDTA, an alkylating agent, a phosphate, an amino, a mercapto, a PEG, a PEG-40K, a MPEG, an [MPEG]2, a polyamino, an alkyl, a substituted alkyl, a radiolabeled marker, an enzyme, a hapten biotin, a transport / absorption enhancer, aspirin, a vitamin E, a folic acid, a synthetic ribonuclease, a protein, a glycoprotein, a peptide, a molecule with specific affinity for a co-ligand, an antibody, a hormone, a hormone receptor, a non-peptide species, a lipid, a lectin, a sugar, a vitamin, a cofactor, or a drug.

[0228] In some embodiments, the lipid is C 10 -C 80 It contains a linear saturated or partially unsaturated aliphatic chain of

[0229] In some embodiments, the composition further comprises a linker connecting the bioactive agent and the lipid, wherein the linker is selected from an uncharged linker, a charged linker, an alkyl-containing linker, a phosphate-containing linker, a branched linker, an unbranched linker, a linker containing at least one cleavage group, a linker containing at least one redox cleavage group, a linker containing at least one phosphate-based cleavage group, a linker containing at least one acid cleavage group, a linker containing at least one ester-based cleavage group, or a linker containing at least one peptide-based cleavage group.

[0230] In some embodiments, the bioactive agent consists of, is, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral controlled oligonucleotide composition.

[0231] In some embodiments, the bioactive agent consists of, is, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral controlled oligonucleotide composition, wherein the sequence of the oligonucleotide contains or consists of the sequence of any of the oligonucleotides described herein.

[0232] In some embodiments, the bioactive agent consists of, is, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral controlled oligonucleotide composition, wherein the sequence of the oligonucleotide contains or consists of the sequence of any of the oligonucleotides listed in Table 4A.

[0233] In some embodiments, the bioactive agent consists of, is, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral control oligonucleotide composition, wherein the sequence of the oligonucleotide contains or consists of the sequence of a splice switch oligonucleotide.

[0234] In some embodiments, the bioactive agent consists of, is, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral controlled oligonucleotide composition, wherein the sequence of the oligonucleotide contains or consists of the sequence of an oligonucleotide that is capable of skipping or mediating exon skipping of the dystrophin gene.

[0235] In some embodiments, the bioactive agent consists of, is, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral controlled oligonucleotide composition, wherein the sequence of the oligonucleotide contains or consists of the sequence of an oligonucleotide that is capable of skipping or mediating the skipping of exon 51 of the dystrophin gene.

[0236] In some embodiments, the bioactive agent consists of, is, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral controlled oligonucleotide composition, wherein the sequence of the oligonucleotide contains or consists of the sequence of an oligonucleotide that can skip or mediate skipping of exon 51, 45, 53, or 44 of the dystrophin gene.

[0237] In some embodiments, the bioactive agent consists of, is, or contains an oligonucleotide, or oligonucleotide composition, or chiral controlled oligonucleotide composition, wherein the sequence of the oligonucleotide contains or consists of any of the following: WV-887, WV-896, WV-1709, WV-1710, WV-1714, WV-2095, WV-2100, WV-2106, WV-2107, WV-2108, WV-2109, WV-2223, WV-2224, WV-2225, WV-2226, WV-2227, WV-2228, WV-2229, WV-2230, WV-2231, WV-2232, WV-2233, WV-2234, WV-2235, WV-2236, WV-2237, WV-2238, WV-2239 ...9, WV-2239, WV-2239, WV-2239, WV-2239, WV-2239, WV-2239, WV-2239, WV-2239, WV-2239, WV-2239, WV-2239, WV-2239, WV-2239, WV-2239, WV-2239, W V-2227, WV-2228, WV-2229, WV-2230, WV-2438, WV-2444, WV-2445, WV-2526, W V-2527, WV-2528, WV-2529, WV-2530, WV-2531, WV-2533, WV-2578, WV-2580, WV -2587, WV-3047, WV-3152, WV-3472, WV-3473, WV-3507, WV-3508, WV-3509, WV -3510, WV-3511, WV-3512, WV-3513, WV-3514, WV-3515, WV-3545, or WV-3546.

[0238] In some embodiments, the consensus base sequence is UCAAGGAAGAUGGCAUUUCU. In some embodiments, the consensus base sequence contains UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 30 bases. In some embodiments, the consensus base sequence contains UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 40 bases. In some embodiments, the consensus base sequence contains UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 50 bases. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 30 bases. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 40 bases. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 50 bases. In some embodiments, the consensus sequence contains a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, The nucleotides have a length of up to 30 bases. In some embodiments, the consensus base sequence contains a sequence with five or fewer mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, and the oligonucleotides have a length of up to 40 bases. In some embodiments, the consensus base sequence contains a sequence with five or fewer mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, and the oligonucleotides have a length of up to 50 bases.

[0239] In some embodiments, the common base sequence is UCAAGGAAGAUGGCAUUUCU, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the consensus base sequence contains a sequence with 5 or fewer mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least one chiral control center.In some embodiments, the consensus base sequence contains a sequence with no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 40 bases, and the consensus pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the consensus base sequence contains a sequence with no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 50 bases, and the consensus pattern of backbone chiral centers contains at least one chiral control center.

[0240] In some embodiments, the consensus base sequence is UCAAGGAAGAUGGCAUUUCU, and the common pattern of backbone chiral centers contains at least one chiral control center that is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is phosphorothioate in the Sp configuration.In some embodiments, the consensus base sequence contains a sequence with five or fewer mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains a sequence with five or fewer mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains a sequence with five or fewer mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is phosphorothioate in the Sp configuration.

[0241] In some embodiments, the consensus base sequence is UCAAGGAAGAUGGCAUUUCU, and the consensus pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the consensus base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 30 bases, and the consensus pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the consensus base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 40 bases, and the consensus pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the consensus base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 50 bases, and the consensus pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the consensus base sequence contains a sequence with five or fewer mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least three chiral control centers.In some embodiments, the consensus base sequence contains a sequence with five or fewer mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 40 bases, and the consensus pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the consensus base sequence contains a sequence with five or fewer mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 50 bases, and the consensus pattern of backbone chiral centers contains at least three chiral control centers.

[0242] In some embodiments, the consensus base sequence is UCAAGGAAGAUGGCAUUUCU, and the common pattern of backbone chiral centers contains at least five chiral control centers, each of which is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least five chiral control centers, each of which is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least five chiral control centers, each of which is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least five chiral control centers, each of which is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least five chiral control centers, each of which is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least five chiral control centers, each of which is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 50 bases, and the consensus pattern of backbone chiral centers contains at least five chiral control centers that are each phosphorothioate in the Sp configuration.In some embodiments, the consensus base sequence contains a sequence with five or fewer mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least five chiral control centers, each of which is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains a sequence with five or fewer mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least five chiral control centers, each of which is phosphorothioate in the Sp configuration. In some embodiments, the consensus base sequence contains a sequence with five or fewer mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least five chiral control centers, each of which is phosphorothioate in the Sp configuration.

[0243] In some embodiments, the common pattern of backbone chiral centers is selected from the following: SSS, SSSS, SSSSS, SOS, SSOSS, SSSOSSS, SSSSOSSSS, SSSSSOSSSSS, SSSSSSOSSSSSS, SSSSSSSOSSSSSS, SSSSSSSOSSSSSS, SSSSSSSSOSSSSSS, SSSSSSSOSSSSSSSS, SOSOSOSOS, SSOSOSOSOSS, SSSOSOSOSOSSS, SSSSOSOSOSOSSSS, SSSSSOSOSOSOSSSSS, SSSSSSOSOSOSOSSSSSS, SOSOSSOOS, SSOSOSSOOSS, SSSOSOSSOOSSS, SSSSOSOSSOOSSSS, SSSSSOSOSSOOSSSSS, SSSSSSOSOSSOOSSSSSS, SOSOOSOOS, SSOSOOSOOSS, SSSOSOOSOOSSS, SSSSOSOOSOOSSSS, SSSSSOSOOSOOSSSSS, SSSSSSOSOOSOOSSSSS, SSSSSSOSOOSOOSSSSS S, SOSOSSOOS, SSOSOSSOOSO, SSSOSOSSOOSOS, SSSSOSOSSOOSOSS, SSSSSOSOSSOOSOSSS, SSSSSSOSOSSOOSOSSSS, SOSOOSOOSO, SSOSOOSOOSOS, SSSOSOOSOOSOS, SSSOSOOSOOSOS, SSSSSOSOOSOOSOSS, SSSSSOSOOSOOSOSSS, SSSSSSOSOOSOOSOSSSS, SSOSOSSOO, SSSOSOSSOOS, SSSSOSOSSOOS, SSSSSOSOSSOOS, SSSSSOSOSSOOSS, SSSSSSOSOSSOOSSS, OSSSSSSOSOSSOSSOOSSS, OOSSSSSSOSOSSOOS, OOSSSSSSOSOSSOOSS, OOSSSSSSOSOSSOOSSSS, OOSSSSSSOSOSSOOSSSS, and OOSSSSSSOSOSSOOSSSSSS, where O is a non-chiral center and S is a chiral center of the Sp configuration. In some embodiments, the non-chiral center is a phosphodiester. In some embodiments, the chiral center of the Sp configuration is a phosphorothioate.

[0244] In some embodiments, the sequence of the oligonucleotide comprises any one or more of the following: base sequence (including length); pattern of chemical modifications to the sugar and base moieties; pattern of backbone linkages; pattern of natural phosphate linkages, phosphorothioate linkages, phosphorothioate triester linkages, and combinations thereof; pattern of backbone chiral centers; pattern of chiral internucleotide linkage stereochemistry (Rp / Sp); pattern of backbone phosphorus modifications; pattern of modifications on the phosphorus atom between nucleotides, e.g., -S in Formula I - , and -LR 1 .

[0245] In some embodiments, the muscle cells or muscle tissue are selected from: skeletal muscle, smooth muscle, cardiac muscle, diaphragm, gastrocnemius, quadriceps, triceps, and / or heart.

[0246] In some embodiments, the method delivers a bioactive agent into the cytoplasm of a cell.

[0247] In some embodiments, the method delivers a bioactive agent into the nucleus of a cell.

[0248] In some embodiments, the chiral internucleoside linkage is phosphorothioate.

[0249] In some embodiments, the consensus sequence hybridizes to a transcript of dystrophin, myostatin, huntingtin, myostatin receptor, ActRIIB, ActRIIA, DMPK, Malat1, SMN2, dystrophia myotonica protein kinase (DMPK), proprotein convertase subtilisin / kexin type 9 (PCSK9), SMAD7, or KRT14 (keratin 14). [Brief explanation of the drawings]

[0250] [Figure 1]Exon skipping regulated by the bioactive agent oligonucleotide WV-942 delivered via gymnotic delivery (not complexed with lipids) or complexed with lipids (listed in Table 1).

[0251] [Figure 2] Examples of lipid complexes

[0252] [Figure 3] In vivo pharmacokinetic (PK) data for delivery of oligonucleotide WV-942 via gymnotic delivery (uncomplexed to lipid) or complexed to lipid into gastrocnemius, cardiac, and quadriceps muscle tissue. Test articles are listed in Table 1.

[0253] [Figure 4] In vivo pharmacokinetic (PK) data for delivery of WV-942 via gymnotic delivery (not complexed to lipids) or complexed to lipids to gastrocnemius, cardiac and quadriceps, and diaphragm muscle tissues.

[0254] [Figure 5] Standard curves of lipid complexes in different tissues (quadriceps and diaphragm).

[0255] [Figure 6] Standard curves of lipid complexes in different tissues (heart and gastrocnemius muscle).

[0256] [Figure 7] Example lipid and linker structures for conjugation with bioactive agents. Abbreviations: Oligo: Example oligonucleotides

[0257] [Figure 8]Hybridization assay for detecting ASO: sandwich. Abbreviations: B: biotin; SA: streptavidin; AP: alkaline phosphatase; ASO: antisense oligonucleotide.

[0258] [Figure 9A] Figures 9A-9E LC-MS and deconvoluted masses of lipid complexes of various oligonucleotides. [Figure 9B] Same as above. [Figure 9C] Same as above. [Figure 9D] Same as above. [Figure 9E] Same as above.

[0259] [Figure 10A] Figures 10A and 10B show the sequences and chemistries of various oligonucleotides: WV395 and WV884-WV897. Suffices .01 and .02 indicate batch numbers. These include stereochemically pure (chirally pure) oligonucleotides or oligonucleotide compositions containing 2'-OMe modifications. [Figure 10B] Same as above.

[0260] [Figure 11A] Figures 11A and 11B show the ability of various oligonucleotides to induce skipping of exon 51 of human dystrophin. Figure 11B shows the compiled data, including three or more replicate experiments. Controls: WV-942, WV-1714, and untreated; Concentration: 10 μM; Duration: 4 days in differentiation medium; Treatment was gymnotic (without transfection reagent); Cells: Del 48-50 (primary human myoblasts derived from a patient with a dystrophin deletion of exons 48-50), DL 589.2 (dystrophin deletion of exons 51-55)). [Figure 11B] Same as above.

[0261] [Figure 12A]Figures 12A and 12B. Composition of PS (phosphorothioate) and 2'-F on the wings of various oligonucleotides, including WV-2095 to WV-2109. WV-2106 to WV-2109 are hemimers. [Figure 12B] Same as above.

[0262] [Figure 13A] Figures 13A and 13B. Ability of various oligonucleotides to induce skipping of dystrophin exon 51. Figure 13B shows additional data for WV-1714. The negative control for this experiment, WV-1683, targets mouse exon 23. [Figure 13B] Same as above.

[0263] [Figure 14A] Figures 14A and 14B. Sequences and chemistries of various oligonucleotides, WV-1108 and WV-2381 through WV-2395, which have PS (phosphorothioate) in the wings and PO (phosphorodiester) in the core. [Figure 14B] Same as above.

[0264] [Figure 15] Ability of various oligonucleotides to induce skipping of dystrophin exon 51. Control: WV-942 (Drisapersen, stereoirregular) and untreated; concentration: 10 μM; duration: 4 days in differentiation medium; cells: Del 48-50; treatment was gymnotic (no transfection reagent).

[0265] [Figure 16A] Figures 16A and 16B. Sequences and chemistries of various oligonucleotides, WV-2366 to WV-2370, which have Sp configuration phosphorothioates in the wings and PO (phosphorodiester) in the core. [Figure 16B] Same as above.

[0266] [Figure 17] Ability of various oligonucleotides to induce skipping of dystrophin exon 51. Control: WV-942 and untreated; concentration 10 μM; duration: 4 days in differentiation medium; cells: Del 48-50; treatment was gymnotic (no transfection reagent).

[0267] [Figure 18] The sequences and chemistries of various 20-mer or 25-mer oligonucleotides, including WV-2313 to WV-2320, and WV-2223 to WV-2230.

[0268] [Figure 19] Positions of various 20-mer or 25-mer oligonucleotide sequences, including WV-2313 to WV-2320 and WV-2223 to WV-2230, relative to the human (H) and mouse (M) dystrophin sequences.

[0269] [Figure 20] Ability of various oligonucleotides to induce skipping of dystrophin exon 51. Control: WV-942 and untreated; concentration 10 μM; duration: 4 days in differentiation medium; cells: Del 48-50; treatment was gymnotic (no transfection reagent).

[0270] [Figure 21] Figure 21 shows the efficacy of stereochemically pure oligonucleotides with a 2'-F wing and either a PO or Rp core in skipping exon 51 of human dystrophin compared to WV-942 (drisapersen). Treatment was 10 μM gymnotic treatment.

[0271] [Figure 22]Figure 22 shows the effectiveness of stereo-pure oligonucleotides in skipping exon 51 of human dystrophin compared to WV-942. Data are presented for two different doses (3 μM and 10 μM). The bottom left shows stereo-irregular materials with different patterns of 2'-F and 2'-OMe modifications. The bottom right shows stereo-pure oligonucleotides.

[0272] [Figure 23] Figure 23 shows the efficacy of various oligonucleotides; fold changes compared to WV-942 are shown. Data for two different doses (3 μM and 10 μM) are presented.

[0273] [Figure 24] FIG. 24 shows examples of CA (carbonic anhydrase) inhibitors and example linkers for attachment to bioactive agents (as a non-limiting example, an oligonucleotide).

[0274] [Figure 25] Figure 25 shows an example of the skipping efficiency of oligonucleotides containing lipid moieties in skipping exon 51 of human dystrophin. Data are presented for different doses, from 0.3 μM to 30 μM. Generally, skipping efficiency improves with increasing concentration. WV-3545 (WV-3473 conjugated to stearic acid via a PO and C6 amino linker) and WV-3546 (WV-3473 conjugated to turbinaric acid via a PO and C6 amino linker), both of which contain lipid moieties, showed high efficiency. The treatment was gymnotic (no transfection reagent used). The experiment was repeated three times, and the average data is shown.

[0275] [Figure 26] Figure 26 shows that the oligonucleotides provided in some examples have no hTLR9 agonist activity under the conditions tested. The experiment was repeated three times and the average data is shown.

[0276] [Figure 27] Figure 27 shows that the oligonucleotides provided in the examples, which contain lipid moieties, can effectively attenuate (and antagonize) hTLR9 activity. As shown, conjugation of lipids (e.g., stearic acid (WV-3545) or turbinaric acid (WV-3546)) with oligonucleotides (e.g., WV-3473 (WV-3545 and WV-3546)) significantly increased hTLR9 antagonist activity. The concentration of the agonistic oligonucleotide ODN2006 was kept constant at 0.3 μM. Each oligonucleotide was tested at the following decreasing concentrations: 5, 2.5, 1.25, 0.6, 0.3, 0.15, and 0.075 μM (from left to right). The treatment was gymnotic (without transfection reagent). The experiment was repeated three times, and the average data is shown.

[0277] [Figure 28] Figure 28 shows that the oligonucleotides provided in the Examples, which contain lipid moieties, can effectively attenuate (and antagonize) hTLR9 activity. As shown, conjugates of lipids (e.g., stearic acid (WV-3545) or turbinaric acid (WV-3546)) with oligonucleotides (e.g., WV-3473 (WV-3545 and WV-3546)) significantly increased hTLR9 antagonist activity. neg: negative control (buffer only). ODN2006c: agonist control in which the CpG sequence was replaced with GpC. PMO: eteplirsen. The concentration of the agonistic oligonucleotide ODN2006 was kept constant at 0.3 μM. Each oligonucleotide was tested at the following decreasing concentrations: 5, 2.5, 1.25, 0.6, 0.3, 0.15, and 0.075 μM (from left to right). Treatment was gymnotic (no transfection reagent). Experiments were repeated three times, and average data are shown.

[0278] [Figure 29]Figure 29 shows that the oligonucleotides provided in the examples containing various lipids can significantly improve skipping efficiency compared to WV-942. Data are shown for two doses: 3 μM (right column) and 10 μM (left column). Treatment was gymnotic (no transfection reagent used). ND: Not determined.

[0279] [Figure 30] Figure 30 shows an example of the skipping efficiency of the oligonucleotides provided in the Examples for skipping exon 51 of human dystrophin. Lipid complexes (WV-3534, WV-3553, WV-3546, and WV-4106) significantly improved the efficiency. Generally, skipping efficiency increases with increasing concentration. Data are presented for four different doses: 1 μM, 3 μM, 10 μM, and 10 μM. DMD del48-50 cells were used. Treatment was gymnotic (without transfection reagent).

[0280] [Figure 31A] Ibid. Figures 31A-31D. Figures 31A-31D show the distribution of oligonucleotides in various muscles: gastrocnemius (Figure 31A), triceps (Figure 31B), heart (Figure 31C), and diaphragm (Figure 31D). The following oligonucleotides were tested: WV-3473, WV-3545, and WV-3546. WV-942 served as a control. Example oligonucleotides containing lipid moieties may have improved distribution to one or more muscle tissues and / or may be cleared more quickly after a period of time compared to controls. [Figure 31B] Same as above. [Figure 31C] Same as above. [Figure 31D] Same as above. DETAILED DESCRIPTION OF THE INVENTION

[0281] 1. Definitions As used herein, the following definitions apply unless otherwise indicated. For purposes of this disclosure, chemical elements are identified according to the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Edition. Furthermore, the general principles of organic chemistry are described in "Organic Chemistry," Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry," 5th Ed., Ed.: Smith, M.B. and March, J., John Wiley & Sons, New York: 2001, the entire contents of which are incorporated herein by reference.

[0282] Aliphatic: As used herein, "aliphatic" means a linear (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more units of unsaturation, or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is fully saturated or contains one or more units of unsaturation (not aromatic), or a combination thereof. Unless otherwise specified, an aliphatic group contains 1-100 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-20 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-10 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-9 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-8 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-7 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-6 aliphatic carbon atoms. In yet other embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups, and hybrids thereof.

[0283] Alkenyl: The term "alkenyl," as used herein, refers to an alkyl group, as defined herein, having one or more double bonds.

[0284] Alkyl: As used herein, the term "alkyl" has its usual meaning in the art and can include saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl-substituted cycloalkyl groups, and cycloalkyl-substituted alkyl groups. In some embodiments, an alkyl has 1 to 100 carbon atoms. In some embodiments, a straight-chain or branched alkyl has about 1 to 20 carbon atoms in its backbone (e.g., C1-C6 for straight chain). 20 , C2-C for branched chain 20 ), or about 1-10 carbon atoms. In some embodiments, cycloalkyl rings have from about 3-10 carbon atoms in their ring structure whether the ring is monocyclic, bicyclic or polycyclic, or about 5, 6 or 7 carbons in the ring structure. In some embodiments, alkyl groups can be lower alkyl groups, which lower alkyl groups have from 1-4 carbon atoms (e.g., C1-C4 for a straight chain lower alkyl).

[0285] Alkynyl: The term "alkynyl," as used herein, refers to an alkyl group, as defined herein, having one or more triple bonds.

[0286] Animal: As used herein, the term "animal" refers to any of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and / or worms. In some embodiments, the animal may be a transgenic animal, a genetically modified animal, and / or a clone.

[0287] Antibody: The terms "antibody," "immunoglobulin," and related terms, as used herein, refer to proteins (or fragments thereof, or biologically active fragments thereof) produced primarily by plasma cells, which are used by the immune system to recognize, identify, and / or neutralize specific antigens, epitopes, structures, pathogens, nucleic acids, and other molecules. In some embodiments, antibodies recognize specific molecules of harmful entities, so-called antigens, via their variable regions. In some embodiments, antibodies include, but are not limited to, monoclonal antibodies (including full-length antibodies having an immunoglobulin Fc region), antibody compositions with polyepitopic specificity, multispecific antibodies (e.g., bispecific antibodies, diabodies, and single-chain molecules), and antibody fragments. In some embodiments, antibodies are monoclonal, e.g., antibodies obtained from a substantially homogeneous antibody population. In some embodiments, the antibody is a chimeric antibody, in which a portion of the heavy and / or light chain is identical to or homologous to corresponding sequences in antibodies from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical to or homologous to corresponding sequences in antibodies from another species or belonging to a different antibody class or subclass, as well as in antibody fragments so long as such fragments exhibit the desired biological activity. Chimeric antibodies of interest herein include, but are not limited to, "primatized" antibodies containing variable domain antigen-binding sequences derived from a non-human primate (e.g., an Old World monkey) and human constant region sequences. In some embodiments, the antibody fragment contains a portion of an intact antibody, preferably the antigen-binding region and / or the variable region of the intact antibody. Non-limiting examples of antibody fragments include Fab, Fab', F(ab')2, and Fc fragments; diabodies; linear antibodies; nanobodies; single-chain antibody molecules formed from antibody fragments; and multispecific antibodies.In some embodiments, antibodies may be any of five classes: IgA, IgD, IgE, IgG, and IgM, each of which may be encoded by mRNA containing heavy chains designated alpha, delta, epsilon, gamma, and mu. In some embodiments, any antibody subclass may be encoded in whole or in part, and may include the following subclasses: IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. In various embodiments, antibodies may be used to treat conditions or diseases in many therapeutic areas, including, but not limited to, hematology, cardiovascular, CNS, poisoning (including antitoxins), dermatology, endocrinology, gastrointestinal tract, medical imaging, skeletal muscle, cancer, immunology, respiratory, sensory, and anti-infective fields. In some embodiments, the antibody may be any of antibody variants, including, but not limited to, substitutional variants, conservative amino acid substitutions, insertional variants, deletional variants, and / or covalent variants. In one embodiment, the primary construct and / or mmRNA disclosed herein may encode an immunoglobulin Fc region. In another embodiment, the primary construct and / or mmRNA may encode a variant immunoglobulin Fc region. In some embodiments, the primary construct and / or mmRNA may encode an antibody having a variant immunoglobulin Fc region as described in U.S. Patent No. 8,217,147.

[0288] Antisense oligonucleotide: The term "antisense oligonucleotide" or "ASO," as used herein, refers to an oligonucleotide or the like having, containing, or consisting of a base sequence or the like that allows the oligonucleotide or the like to hybridize to a target molecule, such as another nucleic acid, a modified nucleic acid, or a nucleic acid analog, for example, by Watson-Crick base pairing or non-Watson-Crick base pairing. In some embodiments, the antisense oligonucleotide is perfectly complementary or nearly perfectly complementary to the target molecule. In some embodiments, any oligonucleotide of any type described herein or known in the art can be used as an antisense oligonucleotide. In various embodiments, the antisense oligonucleotide can perform or participate in any of a variety of biological functions, including RNA interference, RNase H-mediated cleavage, exon skipping, inhibition of exon skipping, enhancing or inhibiting the binding of an entity (e.g., a protein, RNA, a protein-RNA complex, or any other molecule) to another nucleic acid, or any other biological function performed by antisense oligonucleotides described herein or known in the art. In some embodiments, the antisense oligonucleotide is an oligonucleotide that participates in RNase H-mediated cleavage. For example, the antisense oligonucleotide hybridizes to a portion of the target mRNA in a sequence-specific manner, thereby targeting the mRNA for RNase H cleavage. In some embodiments, the antisense oligonucleotide can distinguish between wild-type and mutant alleles of the target. In this method, the antisense oligonucleotide specifically participates in RNase H-mediated cleavage of the mutant allele but barely participates in RNase H-mediated cleavage of the wild-type allele (e.g., does not specifically participate in RNase H-mediated cleavage of the targeted wild-type allele).

[0289] Approximately: As used herein, the term "approximately" or "about" when in reference to a number is generally taken to include that number within 5%, 10%, 15%, or 20% in either direction (greater or lesser) of that number (except where such number is a value that may be less than 0% or greater than 100%) unless otherwise stated or otherwise apparent from the context. In some embodiments, the use of the term "about" when in reference to dosage means ±5 / mg / kg / day.

[0290] Aptamer: As used herein, the term "aptamer" refers to a nucleic acid molecule, e.g., a molecule containing RNA, DNA, or nucleotide analogs, that can bind to a specific molecule with high affinity and specificity (Ellington et al., Nature 346, 818-22 (1990); and Tuerk et al., Science 249, 505-10 (1990)). In various embodiments, ligands that bind to aptamers include, but are not limited to, small molecules such as drugs, metabolites, intermediates, cofactors, transition-state analogs, ions, metals, nucleic acids, and toxins. In some embodiments, aptamers may bind to natural and synthetic polymers, including proteins, peptides, nucleic acids, polysaccharides, glycoproteins, hormones, receptors, and cell surface materials, e.g., cell walls and membranes. In some embodiments, aptamers are about 10 to about 300 nucleotides in length. In some embodiments, aptamers are about 30 to about 100 nucleotides in length. In some embodiments, aptamers are generated that bind to a wide variety of molecules. Each of these molecules can be used as a regulator of gene expression. In some embodiments, organic molecules, nucleotides, amino acids, polypeptides, target functions on cell surfaces, ions, metals, salts, and saccharides have all been shown to be suitable for isolating aptamers capable of specifically binding to their respective ligands. For example, organic dyes such as Hoechst 33258 have been reported to be used as target ligands in in vitro aptamer selection (Werstuck and Green, Science 282:296-298 (1998)). Other small organic molecules, such as dopamine, theophylline, sulforhodamine B, and cellobiose, have also been reported as ligands in aptamer isolation. In some embodiments, aptamers are isolated against antibiotics, such as kanamycin A, lividomycin, tobramycin, neomycin B, viomycin, chloramphenicol, and streptomycin. For a review of aptamers that recognize small molecules, see Famulok, Science 9:324-9 (1999).In some embodiments, the aptamer ligand of an aptamer-controlled nucleic acid of the invention is a cell-permeable small organic molecule. Small organic molecules that do not have a pan-inhibitory effect on translation may be used as the ligand. Small molecules may also exhibit sufficient in vivo persistence to achieve a desired level of translation inhibition. Such molecules may also be screened to identify those that are bioavailable, for example, after oral administration. In some embodiments, the ligand is non-toxic. Optionally, the ligand may be a drug, such as a steroid. In some embodiments, the ligand may be pharmacologically inert as part of a method for regulating gene expression. In some embodiments, the ligand is a polypeptide whose presence in a cell is indicative of a disease or pathological condition. In other embodiments, the ligand for the aptamer is an antibiotic, such as chloramphenicol. In another embodiment, the aptamer ligand is an organic dye, such as Hoechst 33258 dye. In yet another embodiment, the ligand may be a metal ion. In certain embodiments, the aptamer domain of an aptamer-controlled nucleic acid responds to binding to caffeine. In some embodiments, aptamers are developed to bind to specific ligands using a known in vivo or in vitro (most typically in vitro) selection technique known as SELEX (Ellington et al., Nature 346, 818-22 (1990); and Tuerk et al., Science 249, 505-10 (1990)).Methods for producing aptamers are also described, for example, in U.S. Pat. No. 5,582,981, International Patent Application Publication No. WO 00 / 20040, U.S. Pat. No. 5,270,163, Lorsch and Szostak, Biochemistry, 33:973 (1994), Mannironi et al., Biochemistry 36:9726 (1997), Blind, Proc. Nat'l. Acad. Sci. USA 96:3606-3610 (1999), Huizenga and Szostak, Biochemistry, 34:656-665 (1995), International Patent Application Publication Nos. WO 99 / 54506, WO 99 / 27133, WO 97 / 42317, and U.S. Pat. No. 5,756,291. In some embodiments, aptamers also include those that target any of the following: VEGF, tissue factor pathway inhibitor (TFPI), factor IXa, complement component 5 (C5), HIV Tat protein, and HIV Rev protein.

[0291] Aryl: As used herein, the term "aryl," used alone or as part of a larger moiety within "aralkyl," "aralkoxy," or "aryloxyalkyl," refers to a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 30 ring members, wherein at least one ring within the system is aromatic. In some embodiments, an aryl group is a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 14 ring members, wherein at least one ring within the system is aromatic, and wherein each ring within the system contains 3 to 7 ring members. In some embodiments, an aryl group is a biaryl group. The term "aryl" may be used interchangeably with the term "aryl ring." In some embodiments of the present disclosure, "aryl" refers to an aromatic ring system, including, but not limited to, phenyl, biphenyl, naphthyl, binaphthyl, anthracyl, etc., which may bear one or more substituents. Also included within the scope of the term "aryl" as used herein are groups in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthymidyl, phenanthridinyl, or tetrahydronaphthyl. In some embodiments, the aryl group has its radical or point of attachment on the aromatic ring.

[0292] Bioactive Agent: As used herein, the term "bioactive agent" refers to any entity (including, but not limited to, an active ingredient) that has, mediates, or participates in biological activity. In various embodiments, bioactive agents may be organic or inorganic. Non-limiting examples of bioactive agents include small molecules, peptides, proteins, components of the CRISPR-Cas system, carbohydrates, therapeutic agents, chemotherapeutic agents, vaccines, nucleic acids, and lipids. In some embodiments, bioactive agents include inorganic or organic molecules, including small molecules, peptides (e.g., cell-penetrating peptides), carbohydrates (including monosaccharides, oligosaccharides, and polysaccharides), proteins (including nucleoproteins, mucoproteins, lipoproteins, synthetic polypeptides, or small molecules linked to proteins, glycoproteins), steroids, nucleic acids, lipids, hormones, or combinations thereof, that exert a biological effect when administered in vivo to animals, including mammals, including, but not limited to, birds and humans. In some embodiments, bioactive agents are electrically charged. In some embodiments, bioactive agents are positively charged. In some embodiments, the bioactive agent is negatively charged. In some embodiments, the bioactive agent is selected from the following: 16-alphafluoroestradiol, 16-alphagitoxin, 16-epiestriol, 17-alphadihydroequilenin, 17-alpha estradiol, 17-beta estradiol, 17-hydroxyprogesterone, 1-alpha-hydroxyvitamin D2, 1-dodecpyrrolidinone, 20-epi-1,25 dihydroxyvitamin D3, 22-oxacalcitriol, 2CW, 2'-nor-cGMP, 3-isobutyl GABA, 5-ethynyluracil, 6-FUDCA, 7-methoxytacrine, abamectin, avanochil, abecarnil, abiraterone, avulukast, avulukast sodium, acadesine, acamprosate, acarbose, acebutolol, acecamide hydrochlorideHydrochloride), aceclidine, aceclofenae, acedapsone, aceglutamide aluminum, acemannan, acetaminophen, acetazolamide, acetohexamide, acetohydroxamic acid, acetomepregenol, acetophenazine maleate, sodium acetosulfonate, acetylcholine chloride, acetylcysteine, acetyl-L-carnitine, acetylmethadol, acifran, acipimox, acitemate, acitretin, acivicin, aclarubicin, aclatonium, acodazole hydrochloride hydrochloride), aconiazid, acrisorcin, acrivastine, acronine, actisomide, actodigin, acyclovir, acylfulvene, adafenoxate, adapalene, adatanserin, adatanserin hydrochloride, adecipenol, adecipenol, adefovir, adelmidrol, ademethionine, adenosine, adinazolam, adipheinine hydrochloride hydrochloride), adiposine, adzelesin, adrafinil, adrenaline, airbutamine, alacepril, alamecin, alanine, alaproclate, araptide, albendazole, albolabrin, albuterol, albutoin, alclofenac, alclometasone dipropionate, alcloxa, aldecarmycin, aldesleukin, aldioxa, alendronate sodium, alendronate, alentemol, alentemol hydrobromide, aletamine hydrochloride, aleuronium chloride chloride), alexidine, alfacalcidol, alfentanil hydrochloride, alfuzosin, algestone acetonide, alglucerase, aliflurane, alinastine, alipamide, allantoin, allobarbital, allopurinol, ALL-TK antagonist, alonimide, alosetron, alosetron hydrochloride, alovudine, alpertin, alpha amylase, alphaidsoneidosone), alpidem, alprazolam, alprenolol hydrochloride, alprenoxime hydrochloride, alprostadil, alrestatin sodium, altanserin tartrate, alteplase, althiazide, altretamine, althromycin B, alverinc citrate, alvircept sudotox, amadinone acetate, amantadine hydrochloride, ambamustine, ambomycin, ambruticin, ambufilin , ambuside, amcinafal, amcinonide, amdinocillin, amdinocillin pivoxil, amedalin hydrochloride, amelomethasone, ameltolide, amesergide, amethanthrone acetate, amezinium methylsulfate, amfebutamone, amfenac sodium, amflutisol, amicycline, amidefrin mesylate, amidox, amifloxacin, amifostine, amikacin, amiloride hydrochloride, aminacrine hydrochloride, potassium aminobenzoate, sodium aminobenzoate, aminocaproic acid, aminoglutethimide, sodium aminohippurate, amicycline Nolevulinic acid, aminophylline, Aminorex, sodium aminosalicylate, aminosalicylic acid, amiodarone, amiprilose hydrochloride, amiquincin hydrochloride, amisulpride, amitraz, amitriptyline hydrochloride, amlexanox, amlodipine, amobarbital sodium, amodiaquine, amodiaquine hydrochloride, amorolfine, amoxapine, amoxicillin, amfechloral, amphetamine sulfate, amphomycin, amphotericin B, ampicillin, ampiroxicam, ampidin sulfate, amquinate, amrinone, aminon (ami none), amrubicin, amsacrine, amylin, amythiamycin, anagestone acetate, anagrelide, anakinra, ananain, anaritide, anaritide acetate, anastrozole, anazolene sodium, ancrod, andrographolide, androstenedione, angiogenesis inhibitors, angiotensin amide, anidoxime, anileridine, anilopam hydrochloride, aniracetam, anilolac, anisotropine methylbromide, anistreplase, anitrazafen, anordrin, antagonist D, antagonist G, antarelix, angiotensin phosphate antazoline, anthermycin, anthralin, anthramycin, antiandrogens, acedapsone, felbamate, antiestrogens, antineoplastons, antipyrine, antisense oligonucleotides, apadrine, apafant, apalcillin sodium, apaxifylline, apazone, aphidicolin glycinate, apixifylline, apomorphine hydrochloride, apraclonidine, apraclonidine hydrochloride, apramycin, aprindine, aprindine hydrochloride, aprosulate sodium, aprotinin,Aptazapine maleate, aptiganel, apurinic acid, aranidipine, aranotin, albanoprostil, arbexin, arbidol, albutamine hydrochloride, alclofenin, ardeparin sodium, argatroban, arginine, argipressin tannate, aryldone, aripiprazole, arotinolol, arpinoside, artefren, altilide fumarate, asimadoline, aspartone, asparaginase, aspartic acid, aspartocin, asperfuran, aspirin, aspoxilin, asprelin, astemizole, astromicin sulfate, asulaculin, atamestane, atenolol, atevirdine, atipamezole, atiprosin maleate maleate), Atolid, Atorvastatin calcium, Atosiban, Atovaquone, Atpenin B, Atracurium besylate, Atrimustine, Atrinositol, Atropine, Auranofin, Aureobasidin A, Aurothioglucose, Avilamycin, Avoparcin, Abridine, Axid, Axinastatin 1, Axinastatin 2, Axinastatin 3, Azabon, Azacitidine, Azacloldine hydrochloride, Azaconazole, Azadirachtine, Azalanstat dihydrochloride, Azaroxan fumarate, Azanitol maleate, Azanidazole, Azaperone, Azaribine, Azaserine, Azasetron, Maleic acid Azatadine, azathioprine, azathioprine sodium, azatoxin, azatyrosine, azelaic acid, azelastine, azelnidipine, azepindole, azetepa, azimilide, azithromycin, azlocillin, azolimine, azosemide, azotomycin, aztreonam, azumolene sodium, bacampicillin hydrochloride, baccatin III, bacitracin, baclofen, bacoside A, bacoside B, bactoboramine, balanol, baladipone, balhimycin, balofloxacin, balsalazide, bambellmycin, bambuterol, bamethan sulfate, bamifylline hydrochloride, bamidazole, bafuoside 1, barmastine, barnidipine,Basifungin, batanopride hydrochloride, bateblast, baterapine maleate, batimastat, beauvericin, becanthone hydrochloride, becaplermin, becliconazole, beclomethasone dipropionate, befloxatone, beinserazide, velfosdil, belladonna, beloxamide, bemesetron, bemitrazine, bemoradan, benaprizine hydrochloride, benazepril hydrochloride, benazeprilat, bendacalol mesylate mesylate), bendazac, bendroflumethiazide, benflumetol, benidipine, benolterone, benoxaprofen, benoxinate hydrochloride, benperidol, bentazepam, bentiromide, benurestat, benzbromarone, benzethonium chloride, benzethimide hydrochloride, benzilonium bromide, benzindopyrine hydrochloride, benzisoxazole, benzocaine, benzochlorin, benzoctamine hydrochloride, benzodepa, benzidazoxan, benzonatate, benzoyl peroxide, calcium benzoyl persulfate, benzoylstaurosporine, benzyl Benzamide, benzthiazide, benztropine, benztropine mesylate, benzidamine hydrochloride, benzylpenicilloylpolylysine, bepridil, bepridil hydrochloride, beractant, beraprost, berefrin, verlafenone, vertosamil, berithromycin, besipirdine, beta-arretin, betaclamycin B, betamethasone, betamipron, betaxolol, betaxolol hydrochloride, bethanechol chloride, betanidine sulfate, betulinic acid, bevantolol, bevantolol hydrochloride, bezafibrate, bFGF inhibitors, bialamicol hydrochloride, biapenem, bicalutamide, bicifadine hydrochloride, biclodil hydrochloride hydrochloride), bidisomide, bifemelane, bifonazole, bimakalim, bimithili, bindarit, biniramycin, binospirone, bioxalomycin alpha 2, bipenamol hydrochloride, biperiden, biphenamine hydrochloride, biriperone, bisantrene, bisalamil, bisaziridinylspermine, bis-benzimidazole A, bis-benzimidazole B,Visafide, bisobrine lactate, bisoprolol, bispyrithione magsulfex, bisstramide D, bisstramide K, bisstraten A, sodium bithionolate, bitolterol mesylate, bivalirudin, bizelesin, bleomycin sulfate, bolandiol dipropionate, bolasterone, boldenone undecylenate, boldine, borenol, bormantalate, bopindolol, bosentan, boxidine, brefeldin, brefrat, brequinar sodium, bretazenil, bretylium tosylate, brefentanil hydrochloride, brimonidine, brinolactone, brocresine, brocrinat, brofoxine, bromadoline maleate maleate, bromazepam, bromchlorenone, bromelain, bromfenac, brominidione, bromocriptine, bromodiphenhydramine hydrochloride, bromoxamide, bromperidol, bromperidol decanoate, brompheniramine maleate, broperamol, bropirimine, brotizolam, bucamide maleate maleate), bucindolol, buclizine hydrochloride, buclomarone, budesonide, budipine, budotitane, buformin, bumetamide, bunaprolast, bunazosin, bunolol hydrochloride, bupikomide, bupivacaine hydrochloride, buprenorphine hydrochloride, bupropion hydrochloride, buramate, buserelin acetate, buspirone hydrochloride, busulfan, butabarbital, butacetin, butaclamol hydrochloride, butalbital, butamben, butamirate citrate, butaperazine, butaprost, butedronate tetrasodium tetrasodium), butenafine, buteridine, buthionine sulfoximine, buticacin, butylphenine, butirosin sulfate, butixirate, butixocort propionate, butoconazole nitrate, butonate, butopamine, butoprozin hydrochloride, butorphanol, butoxamine hydrochloride, buttriptyline hydrochloride, cactinomycin, cadexomer iodine, caffeine,Calanolide A, calcifediol, calcipotriene, calcipotriol, calcitonin, calcitriol, calcium undecylenate, calphostin C, calsterone, cambendazole, camonagrel, camptothecin derivatives, canarypox IL-2, candesartan, candicidin, candoxatril, candoxatrilat, caniglibose, potassium canrenoate, canrenone, capecitabine, sodium capobenate, capobenic acid, capreomycin sulfate, capromab, capsaicin, captopril, capride, carasemide, carbachol, carbadox, carbamazepine, carbamide peroxide, carbantel lauryl sulfate, carbaspirin calcium, carbazeran, carbazomycin C, carbenicillin potassium, carbenoxolone sodium, carbetimer, carbetocin, carbidopa, carbidopa-levodopa, carbinoxamine maleate, carbifene hydrochloride, carbochloral, carbocysteine, carbol-fuchsin, carboplatin, carboprost, carbovir, carboxamido-amino-triazole, carboxyamidotriazole, carboxymethylated beta-1,3-glucan, carbuterol hydrochloride, CaRest M3, carfentanil citrate, carisoprodol, carmantadine, carmustine, CARN 700, camidazole, caroxazone, carperitide, carphenazine maleate, carprofen, calsatrin succinate, cartazolate, carteolol, carteolol hydrochloride, cartilage-derived inhibitor, carbicin hydrochloride, carmonam sodium, carvedilol, carbothrin, carbothrin hydrochloride, carzelesin, casein kinase inhibitor (ICOS), castanospermine, caurumonam, sevalacetam, cecropin B, cedefingol, cefaclor, cefadroxil, cefamandole, cefaparol, cefatrizine, cefazaflour sodium, cefazolin, cefbuperazone, cefcapene pivoxil, cefdaloxime pentexil tosylate tosilate), cefdinir, cefditoren pivoxil, cefepime, cefetamet,Cefetecol, cefixime, cefluprenam, cefimenoxime hydrochloride, cefinetazole, cefminlox, cefodizime, cefonicid sodium, cefoperazone sodium, cefo, Ceforamide, cefoselis, cefotaxime sodium, cefotetan, cefotiam, cefoxitin, cefozopran, cefpimizole, cefpiramide, cefpirome, cefpodoxime proxetil, cefprozil, cefroxadine, cefsulodin, ceftazidime, cefteram, ceftibuten, ceftizoxime sodium, ceftriaxone, cefuroxime, celastrol, cericalim, celiprolol, cepacidiine A, cephacetrile sodium, cephalexin, cephaloglycin, cephaloridine, cephalothin sodium, cephapirin sodium, cephradine, cericlamine, cerivastatin, seronapril, certoparin sodium, ceruletide, cetaben sodium, cetalkonium chloride, cetamolol hydrochloride hydrochloride), cetiedil, cetirizine, cetofenicol, cetraxate hydrochloride, cetrorelix, cetylpyridinium chloride, chenodiol, chlophedianol hydrochloride, chloral betaine, chlorambucil, chloramphenicol, chlordantoin, chlordiazepoxide, chlorhexidine gluconate, chlorin, chlormadinone acetate, chloroorienticin A, chloroprocaine hydrochloride, chloropropamide, chloroquine, chloroquinoxaline sulfonamide, chlor Chlothiazide, chlorotrianisene, chloroxine, chloroxylenol, chlorphenesin carbamate, chlorpheniramine maleate, chlorpromazine, chlorpropamide, chlorprothixene, chlortetracycline bisulfate, chlorthalidone, chlorzoxazone, cholestyramine resin, chromonal hydrochloride, cibenzoline, cicaprost, cyclafrine hydrochloride, cyclazindol, ciclesonide, cicletanine, ciclopirox, cycloprofen, cycloprolol, cidofovir, cidoxepin hydrochloride hydrochloride), cifenline, ciglitazone, ciladopa hydrochloride, cilansetron, cilastatin sodium, cilazapril, cilnidipine, cilobamine mesylate, cilobradine, cilofungin, cilostazol, cimaterol, cimetidine, cimetropium bromide, sinalukast,Cinanserin hydrochloride, cinepazet maleate, cinflumide, syngestr, cinitapride, cinnamedrine, cinnarizine, cinolazepam, cinoxacin, cinperen, cinromide, synthazone, cintriamide, cioteronel, cipamfylline, cyprefadol succinate, cyprocinonide, ciprofibrate, ciprofloxacin, ciprostene, ciramadol, cirolemycin, cisapride, cisatracurium besylate, cisconazole, cisplatin, cis-porphyrin, ciprofloxacin Cistinexine, citalopram, sitenamide, citicoline, citreamicin alpha, cladribine, clamoxiquin hydrochloride, clarithromycin, clausenamide, potassium clavulanate, clazolam, clazolimine, clebopride, clemastine, clentiazem maleate, clidinium bromide, clinafloxacin, clindamycin, clioquinol, clioxamide, criprofen, clobazam, clobetasol propionate, clobetasone butyrate, clocortolone acetate, clodanolene, Clodazon hydrochloride, clodronic acid, clofazimine, clofibrate, clofilium phosphate, clogenestone acetate, clomacrane phosphate, clomegestone acetate, clometerone, clomethiazole, clomiphene analogues, clominorex, clomiphene, clomipramine hydrochloride, clonazepam, clonidine, clonitrate, clonixeril, clonixin, clopamide, clopenthixol, cloperidone hydrochloride, clopidogrel, clopimozide, clopipazan mesylate, clopirac, cloprednol, cloprosteno sodium, clorazepate dipotassium, chloretate, chlorexolone, chloroperone hydrochloride, cloprenaline hydrochloride, clorsulon, chlortermine hydrochloride, closantel, closilamine aceturate, clothiapine, clotixamide maleate, cloticasone propionate, clotrimazole, cloxacillin benzathine, cloxiquin, clozapine, cocaine, coccidioidin, codeine, codoxime, colchicine, colestimide, colestipol hydrochloride, colestolone, colforsin, colfosseryl palmitate,Colistimethate Sodium, colistin sulfate, colismycin A, colismycin B, colterol mesylate, combretastatin A4, combretastatin analogs, compressestatin, conagenin, conorphone hydrochloride, contignasterol, contortrostatin, colmethasone acetate, corticorelin orbain triflutate, corticotropin, cortisone acetate, cortivazol, cortodoxone, cosalan, costotolide, cosyntropin, cotinine, Coumadin, coumermycin, crambecidin 816, crilvastatin, crisnatol, clomitril sodium sodium), cromolyn sodium, crotamiton, cryptophycin 8, cucumariosid, cuprimyxin, curacin A, curdlan sulfate, curiosin, cyclacillin, cyclazocine, cyclazocine, cyclic HPMPC, cyclindole, cyclilamine maleate, cyclizine, cyclobendazole, cyclobenzaprine, cyclobutan A, cyclobutan G, cyclocapron, cycloguanyl pamoate, cycloheximide, cyclopentanthraquinone, cyclopenthiazide, cyclopentolate hydrochloride, cyclophenazine hydrochloride, cyclophosphamide, cycloplatam tam), cyclopropane, cycloserine, cyclosine, cyclosporine, cyclothiazide, cyclothiazomycin, cyheptamide, sipemycin, sipenamine hydrochloride, cyprazepam, cyproheptadine hydrochloride, cyprolidol hydrochloride, cyproterone, cyproximide, cysteamine, cysteine ​​hydrochloride, cystine, cytarabine, cytarabine hydrochloride, cytarabine ocfosfate, cytochalasin B, cytolytic factors, cytostatin, dacarbazine, dacliximab, dactimicin, dactinomycin, daidzein, daledalin tosylate, dalfopristin, dalteparin sodium, daltroban, dalvastatin, danaparoid, danazol, dantrolene,Daphnodrin A, dapiprazole, dapitant, dapoxetine hydrochloride, dapsone, daptomycin, darglitazone sodium, darifenacin, darulsin A, dalodipine, darsidomine, daunorubicin hydrochloride, dazadrol maleate, dazepinil hydrochloride, dazmegrel, dazopride fumarate, dazoxiben hydrochloride, debrisoquine sulfate, decitabine, deferiprone, deflazacort, dehydrocholic acid, dehydrodidemnin B, dehydroepiandrosterone, delapril, delapril hydrochloride rile, delavirdine mesylate, derexamine, delfaprazine, delmadinone acetate, delmopinol, delphinidin, demecarium bromide, demeclocycline, demecycline, demoxepam, denofungin, deoxypyridinoline, Depakote, Deprodone, deprostil, depsidomycin, deramciclane, dermatan sulfate, desciclovir, descinolone acetonide, desflurane, desipramine hydrochloride, desciclovir Siludine, deslanoside, deslorelin, desmopressin, desogestrel, desonide, desoximetasone, desoxamiodarone, desoxycorticosterone acetate, detazimium bitartrate, deterenol hydrochloride, detirelix acetate, devazepide, dexamethasone, dexamisole, dexbrompheniramine maleate, dexchlorpheniramine maleate, dexclamol hydrochloride, dexetimide, dexfenfluramine hydrochloride, dexifosfamide, deximafen afen), dexivacaine, dexketoprofen, dexloxiglumide, dexmedetomidine, dexormaplatin, dexoxadrol hydrochloride, dexpanthenol, dexpemedrac, dexpropranolol hydrochloride, dexrazoxane, dexsotalol, 2-dextrin sulfate, dextroamphetamine, dextromethorphan, dextrorphan hydrochloride, dextrothyroxine sodium, dexverapamil, desaguanine, dedinamide, dezocine,Diacetolol hydrochloride, diamocine cyclamate, diapamide, meglumine diatrizoate, diatrizoic acid, diaveridine, diazepam, diaziquone, diazoxide, dibenzepin hydrochloride, dibenzothiophene, dibucaine, dichlorvos, dichloralphenazone, dichlorphenamide, disirenone, diclofenac sodium, dicloxacillin, dicranin, dicumarol, dicyclomine hydrochloride, didanosine, didemnin B, didox, dienestrol, dienogest, diethylcarbamazine citrate, diethylhomospermine, diethylnorspermine, diethylpropion hydrochloride, diethylstilbestrol, difenoximide hydrochloride, dipheno Difluoxacin, diflorasone diacetate, difloxacin hydrochloride, difluanine hydrochloride, diflucortolone, diflumidone sodium, diflunisal, difluprednate, diphthalone, digitalis, digitoxin, digoxin, dihexyverine hydrochloride, dihydrexidine, dihydro-5-azacytidine, dihydrocodeine bitartrate, dihydroergotamine mesylate, dihydrotestosterone, dihydrostreptomycin sulfate, dihydrotachysterol, dihydrotaxol, 9-, Dilantin, dilevalol hydrochloride, diltiazem hydrochloride, dimephadane, dimeflin hydrochloride, dimenhydrinate, dimercaprol, dimethadione, dimethindene maleate, dimethisterone, dimethyl prostaglandins A1, dimethyl sulfoxide, dimethylhomospermine, dimiracetam, dimoxamine hydrochloride, dinoprost, dinoprostone, dioxadrol hydrochloride, dioxamycin, diphenhydramine citrate, difenidol, diphenoxylate hydrochloride, diphenylspiromustine, dipivefrin hydrochloride, dipivefrin, diphencyprone, diprafenone, dipropylnorspermine, dipyridamole, dipyrithione, dipyrone, dirithromycin, discodermolide, disobutamide, disofenin, disopyramide, disoxalil,Disulfuram, ditekiren, divalproex sodium, dizocilpine maleate, dobutamine, docarpamine, docebenone, docetaxel, doconazole, docosanol, dofetilide, dolasetron, ebastine, ebiratide, ebrotidine, ebselen, ecabapide, ecabet, ecadotril, ecdisterone, echicetin, echistatin, ecothio iodide, Fate, eclanamine maleate, eclazolast, ecomustine, econazole, ecteinascidin 722, edaravone, edatrexate, edelfosine, edifolone acetate, edobacomab, edoxudine, edrecolomab, edrophonium chloride, hydroxyprogesterone acetate acetate), efegatran, eflornithine, efonidipine, egualcen, elantrin, elcatonin, elemene, eletriptan, elgodipine, eliprodil, elsamitrucin, eltenae, elcain, emalkalim, emedastine, emetine hydrochloride, emiglitate, emilium tosylate, emiteflur, emoctakin, enadrine hydrochloride, enalapril, enalaprilat, enalkiren, enazadrem, ensiprate, endralazine mesylate, endrisone, enflurane, englitazone, enilconazole, enisoprost, enlimomab, enloplatin, enoferast, enolicam sodium sodium), enoxacin, enoxacin, enoxaparin sodium, enoximone, enpiroline phosphate, enprofylline, enpromate, entacapone, enterostatin, enviraden, enviroxime, ephedrine, epicillin, epimestrol, epinephrine, epinephryl borate, epipropidine, epirizole, epirubicin, epitetracycline hydrochloride, epithiazide, epoetin alfa, epoetin beta, epoprostenol, epopros Sodium sterol, epoxymexrenone, epristeride, eprosartan, eptastigmine, equilenin, equilin, elbrozole, erdosteine, ergoloid mesilates, ergonovine maleate, ergotamine tartrate, ersentilide, ersofermin, erythritol, erythrityl tetranitrate, erythromycin, esmolol hydrochloride, esorubicin hydrochloride, esproquine hydrochloride, estazolam, estradiol, estramustine, estramustine analogs,Estradiol hydrobromide, estriol, estroflate, estrogen agonist, estrogen antagonist, estrogen, esterified conjugated estrogens, estrone, estropipate, esprone, etafedrine hydrochloride, etanidazole, etanterol, etharotene, etazolate hydrochloride, eterovalve, etacizin, sodium ethacrynate, ethacrynic acid, ethambutol hydrochloride, etamivan, ethanolamine oleate, ethchlorvynol, ether, ethinyl estra Diol, iodized poppy seed oil ethyl ester, ethionamide, ethonam nitrate, ethopropazine hydrochloride, ethosuximide, ethotoin, etoxazene hydrochloride, ethibenztropine, ethyl chloride, ethyl dibunate, ethylestrenol, ethynodiol, ethinelone, ethynodiol diacetate, etibendazole, etidocaine, etidronate disodium, etidronic acid, etifenine, etintidine hydrochloride, etizolam, etodolac, etofenamate, etoformin hydrochloride, etomidate, etonogestre , etoperidone hydrochloride, etoposide, etoprine, etoxadrol hydrochloride, etozolin, etrabamine, etretinate, etryptamine acetate, euquatropine hydrochloride, eugenol, euprocin hydrochloride, eveminomicin, examethazime, examorelin, exaprolol hydrochloride, exemestane, ezetimibe, estrone, estropipate, esupron, etafedrine hydrochloride, etanidazole, etanterol, ethanterol, Tarotene, etazolate hydrochloride, eterovalve, etacizin, sodium ethacrynate, ethacrynic acid, ethambutol hydrochloride, etamivan, ethanolamine oleate, ethchlorvynol, ether, ethinylestradiol, iodized poppy oil ethyl ester, ethionamide, ethonam nitrate, ethopropazine hydrochloride, ethosuximide, ethotoin, ethoxazene hydrochloride, ethibenztropine, ethyl chloride, ethyl dibunate, ethylestrenol, ethynodiol, ethyneone, ethynodiol diacetate,Etibendazole, etidocaine, etidronate disodium, etidronic acid, etifenine, etintidine hydrochloride, etizolam, etodolac, etofenamate, etoformin hydrochloride, etomidate, etonogestrel, etoperidone hydrochloride, etoposide, etoprine, etoxadrol hydrochloride, etozolin, etrabamine, etretinate, etryptamine acetate, euquatropine hydrochloride, eugenol, eucatropine hydrochloride Prosin, eveminomicin, examethazime, examorelin, exaprolol hydrochloride, exemestane, fadrozole, ferriefungin, famciclovir, famotidine, fampridine, fantofarone, fantridone hydrochloride, faropenem, fasidotril, fasudil, fazarabine, fedotozine, felbamate, felbinac, felodipine, felypressin, fenalamide, fe Namol, fenbendazole, fenbufen, fencibutyrol, fenclofenac, fenclonine, fenclorac, fendosal, fenestrel, fenethylline hydrochloride, fenfluramine hydrochloride, fengabin, fenimide, fenisorex, phenmetzole hydrochloride, phenmetramide, fenobam, fenoctimine sulfate, fenofibrate, fenoldopam, fenoprofen, fenoterol, fenpiperone, fenprinast hydrochloride, fen Enprostalen, fenquizone, fenretinide, fenspiride, fentanyl citrate, fentiazac, fentichlor, fenticonazole, phenylipol hydrochloride, feprazinol, felpifosate sodium, feristen, ferrixan, dried ferrous sulfate, ferumoxides, ferumoxil, fetoxylate hydrochloride, fexofenadine, fezolamine fumarate, fiacitabine, fialuridine, fibrinogen I 125, filgrastim, filipina, finasteride, flavodilol maleate, flavopiridol, flavoxate hydrochloride, furazarone, flecainide (flecamide), flerobuterol, fleroxacin, flesinoxan, flestrol sulfate, fletazepam, flezelastine, flobufen, floctafenine, flomoxef, flordipine,Florfenicol, florifenin, flusatidil, flosequinan, floxacillin, floxuridine, fluasterone, fluazacort, fluvanilate hydrochloride, flubendazole, flucindole, flucloronide, fluconazole, flucytosine, fludalanine, fludarabine phosphate, fludazonium chloride, fludeoxyglucose F 18, fludrex, fludrocortisone acetate, flufenamic acid, flufenisal, flumazenil, flumecinol, flumequine, flumeridone, flumethasone, flumetramide, flumezapine, fluminorex, flumizole, flumoxonide, flunarizine, flunidazole, flunisolide, flunitrazepam, flunixin, fluocalcitriol, fluocinolone acetonide, fluocinol Nido, fluocortin butyl, fluocortolone, fluorescein, fluorodaunorubicin hydrochloride, fluorodopa F18, fluorometholone, fluorouracil, fluotracene hydrochloride, fluoxetine, fluoxymesterone, fluparoxane, fluperamide, fluperolone acetate, fluphenazine decanoate, flupirtine, fluprednisolone, fluproquazone, fluprostenol sodium, fluquazone, fluradrin hydrochloride, flurandrenolide, flura hydrochloride Zepam, flurbiprofen, fluretofen, flurithromycin, fluorocitabine, fluorofamide, fluorogestone acetate, flurothyl, fluoroxene, fluspiperone, fluspirilene, fluticasone propionate, flutrimazole, flutroline, fluvastatin, fluvastatin sodium, fluvoxamine, fludinamide, folic acid, follicle regulatory protein, follicle clostatin lliculostatin), fomepizole, fosazine mesylate, forasartan, forfenimex, forfenirmex, formestane, formocortal, formoterol, fosarilate, fosazepam, foscarnet sodium, fosfomycin, phosphonet sodium, fosinopril, fosinoprilat, fosphenyloin, foskidone, fostedil, fostriecin,Fotemustine, basic fuchsin, fumoxicillin, fungimycin, furaprofen, furazolidone, furazolium chloride, furegrelate sodium, flobufen, frodazole, furosemide, sodium fusidate, fusidic acid, gabapentin, gadobenate dimeglumine, gadobenic acid, gadobutrol, gadodiamide, gadolinium texaphyrin, gadopentetate dimeglumine dimegiumine, gadoteric acid, gadoteridol, gadoversetamide, galantamine, galdansetron, galdansetron hydrochloride, gallamine triethiodide, gallium nitrate, gallopamil, galocitabine, gamfexine, gamolenic acid, ganciclovir, ganirelix, gelatinase inhibitors, gemcadilol, gemcitabine, gemeprost, gemfibrozil, gentamicin sulfate, gentian violet, gepirone, gestacron, gestodene, gestonorone caproate, gestrinone, gevotroline hydrochloride, gilisopam, glaspimod, glaucocalyxin A A), glemanserin, gliamilide, glibornuride, glicetanil sodium, gliflumide, glimepiride, glipizide, gloximonam, glucagon, glutapyrone, glutathione inhibitors, glutethimide, glyburide, glycopine, glycopril, glycopyrrolate, glyhexamide, glymidine sodium, glioctamide, glyparamide, colloidal gold Au 198, gonadoctrinins, gonadorelin, gonadotropin, goserelin, gramicidin, granisetron, grepafloxacin, griseofulvin, guaiaparin, guaicillin, guanabenz, guanabenz acetate, guanadrel sulfate, guancidine, guanethidine monosulfate, guanfacine hydrochloride, guanisoquin sulfate, guanochlor sulfate, guanoctin hydrochloride, guanoxabenz, guanoxan sulfate, guanoxyfen sulfate, gusperimus trihydrochloride, halazepam, halcinonide, halichondrin B, halobetasol propionate, halofantrine, halofantrine hydrochloride,Halofenate, halofuginone hydrobromide, halomon, halopemide, haloperidol, halopredone, haloprogesterone, haloprogin, halothane, halquinol, hamycin, human menopausal gonadotropin (han menopau, sal gonadotropins), hatomamicin, hatomalvigin A, hatomalvigin B, hatomalvigin C, hatomalvigin D, heparin sodium, hepsulfam, heregulin, hetacillin, heteronium bromide, hexachlorophene, hydrogen peroxide, hexafluorenium bromide, hexamethylene bisacetamide, hexedine, hexobendine, hexoprenaline sulfate, hexylresorcinol, histamine phosphate, histidine, histoplasmin, histrelin, homatropine hydrobromide, foquidil hydrochloride, human chorionic gonadotropin, hycanthone, hydralazine hydrochloride, hydralazine polistirex polistirex), hydrochlorothiazide, hydrocodone bitartrate, hydrocortisone, hydroflumethiazide, hydromorphone hydrochloride, hydroxyamphetamine hydrobromide, hydroxychloroquine sulfate, hydroxyphenamate, hydroxyprogesterone caproate, hydroxyurea, hydroxyzine hydrochloride, hymecromone, hyoscyamine, hypericin, ibafloxacin, ibandronic acid, ibogaine, ibopamine, ibudilast, ibufenac, ibuprofen, ibutilide fumarate, icatibant acetate, ichthammol, icotidin, idarubicin, idoxifene, idoxuridine, idramant flucloxacin, remefloxacin, iesopitron, ifetroban, ifosfamide, ilepeimide, ilimaquinone, ilmofosine, ilomastat, ilonidap, iloperidone, iloprost, imafen hydrochloride, imazodan hydrochloride, imidapril, imidazenil, imidazoacridone, imidecyl iodine, imidocarb hydrochloride, imidoline hydrochloride, imidurea, imiloxan hydrochloride, imipenem, imipramine hydrochloride, imiquimod, immunostimulatory peptide, impromidine hydrochloride, indacrinone, indapamide, indecamide hydrochloride hydrochloride), indeloxazine hydrochloride, indigotine disulfate sodium, indinavir, indocyanine green, indolapril hydrochloride, indolidane, indomethacin, indomethacin sodium, indoprofen, indoramine, indorenate hydrochloride, indoxol,Indoliline hydrochloride, inocoterone, inogatran, inolimomab, inositol nicotinate, insulin, interferon, interleukin, intrazol, intriptyline hydrochloride, iobenguane, iobenzamic acid, iobitridol, iocarmate meglumine, iocarmate, ioctamic acid, iodomide, iodine, iodipamide meglumine, iodixanol, iodoamiloride, iodoantipyrine I-131, iodocholesterol I-131, iododoxorubicin, sodium iodohippurate I-131, iodopyracet I-125, iodoquinol, iodoxamic acid meglumine, iodoxamic acid, ioglycinic acid, iofetamine I hydrochloride 123, Iofritol, Ioglucol, Ioglucomide, Ioglycamic acid, Iogulamide, Iohexyl, Iomeprol, Iomethin I 125, Iopamidol, Iopanoic acid, Iopentol, Iofendilate, Ioprocemic acid, Iopromide, Iopronic acid, Iopidol, Iopidon, Iopyrrol, Iosefamic acid, Ioselic acid, Iosulamide meglumine, Iosumetic acid, Iotasul, Iotetolic acid, Iothalamate sodium, Iothalamic acid, Iotriside, Iotrolan, Iotroxic acid, Iotyrosine I 131, Ioversol, Sodium Ioxaglate, Meglumine Ioxaglate, Ioxaglic Acid, Ioxilan, Ioxotrizoate, Ipadil, Ipenoxazone, Ipidacrine, Calcium Ipodate, Ipomeanol, 4-, Ipratropium Bromide, Ipriflavone, Iprindole, Iprofenin, Ipronidazole, Iproplatin, Iproxamine Hydrochloride, Ipsapirone, Irbesal Tan, irinotecan, irloxacin, ilopract, irsogladine, irtemazole, isarsteine, isamoxol, isbogrel, isepamicin, isobengazole, isobutamben, isocarboxazid, isoconazole, isoetharine, isofloxythepin, isoflupredone acetate, isoflurane, isoflurophate,Isohomohalichondrin B, isoleucine, isomazole hydrochloride, isomylamine hydrochloride, isoniazid, isopropamide iodide, isopropyl alcohol, isopropyl unoprostone, isoproterenol hydrochloride, isosorbide, isosorbide mononitrate, isotikimide, isotretinoin, isoxepac, isoxicam, isoxsuprine hydrochloride, isradipine, itamelin, itasetron, itazigrel, itopride, itraconazole, ivermectin, jasplakinolide, jo Samycin, Kahalalide F, Calafungin, Kanamycin sulfate, Ketamine hydrochloride, Ketanserin, Ketazocine, Ketazolam, Ketoxal, Ketipramine fumarate, Ketoconazole, Ketoprofen, Ketorfanol, Ketorolac, Ketotifen fumarate, Kitasamycin, Labetalol hydrochloride, Lacidipine, Lactitol, Lactibicin, Laennec, Lafutidine, Lamellarin-n triacetate, Lamifiban, Lamivudine, Lamotrigine, Lanoconazole, Lanoxin, Lanperisone, Lanreotide, La Soprazole, latanoprost, lateritin, laurocapram, lauryl bromide isoquinoline, lavortidine succinate, lazabemide, reciimibide, leinamycin, remildipine, leminoprazole, lenercept, renictin, lenograstim, lenperone, lentinan sulfate, leptin, leptolstatin, lercanidipine, lergotrile, lerisetron, retimide hydrochloride, letrazuril, letrozole, leucine, leucomyzin, leuprolide acetate, leuprolide + estrogen + progesterone, leuprolide levofloxacin, levamfetamine succinate, levamisole, levdobutamine lactobionate, levcromakalim, levetiracetam, leveycloserine, levobetaxolol, levobunolol, levobupivacaine, levocabastine, levocarnitine, levodopa, levodropropizine, levofloxacin, levofuraltadone, levoleucovorin calcium, levomethadyl acetate, levomethadyl acetate hydrochloride, levomoprolol, levonantradol hydrochloride, levonordefrin, levonorgestrel,Levopropoxyphene napsylate, levopropylcylin potassium, levormeloxifene, levorphanol tartrate, levosimendan, levosulpiride, levothyroxine sodium, levoxadrol hydrochloride, lexipafant, lexithromycin, liarozole, libenzapril, ridamidine hydrochloride, lidocaine, lidofenine, lidoflazine, rifaridine, lifibrate, lifibrol, linarotene, lincomycin, linear polyamine analogs, linoglilide, linopirdine, linotroban, linsidomine, lintitript, lintopride, liothyronine I 125, liothyronine sodium, liotrix, lirexapride, lisinopril, risoclinamide 7, lixazinone sulfate, lobaplatin, lobenzarit sodium, lobucavir, lodelaben, lodoxamide, lofemizole hydrochloride, lofentanil oxalate, lofepramine hydrochloride, lofexidine hydrochloride, lombricine, lomefloxacin, lomerizine, lometraline hydrochloride, lometrexol, romofungin, lornoxicam, lomustine, lonapalen, lonazolac, lonidamine, loperamide hydrochloride, loracarbef, loradium hydrochloride, loratadine, lorazepam, lorbamate, lorcainide hydrochloride hydrochloride), lorecrezol, loreinadol, lorglumide, lormetazepam, lornoxicam, lortalamine, lorzafone, losartan, rosigamone, losoxantrone, rosulazine hydrochloride, loteprednol, lovastatin, loviride, loxapine, loxoribine, lubelozole, lucanthone hydrochloride, lufironil, lurosetron mesylate, lurtotecan, luteinizing hormone lutetium, lutrelin acetate, luzindole, liaporate sodium, lycetamine, lyzicamycin, lydimycin, lynestrenol, lypressin, lysine, lysofylline, lysostaphin, lytic peptide, maduramicin, mafenide, magainin 2 amide, magnesium salicylate, magnesium sulfate, magnolol, maytansine, malethamer, malotchromene, malotjaponin, malotilate,Malotilate, mangafodipir, manidipine, maniwamycin A, mannitol, mannostatin A, manumycin E, manumycin F, mapinastine, maprotiline, marimastat, Martek 158708, Martek 92211, masoprocol, maspin, massetolide, matrilysin inhibitors, maytansine, mazapertine succinate, mazindol, mebendazole, mebeverine hydrochloride, mebrofenin, mebutamate, mecamylamine hydrochloride, mechlorethamine hydrochloride, meclocycline, meclofenamate sodium, mecloqualone, meclorisone dibutyrate, medazepam hydrochloride, medrinone, medrogestone, medroxalol, medroxyprogesterone, medrysone, meclizine hydrochloride hydrochloride), mefenamic acid, mefenidyl, mefenorex hydrochloride, mefexamide, mefloquine hydrochloride, mefruside, megalomycin potassium phosphate, megestrol acetate, meglumine, meglutol, melengestrol acetate, melitracen hydrochloride, melphalan, memotin hydrochloride, menabitan hydrochloride, menoctone, menogaril, menotropin, meobentine sulfate, mepartricin, mepenzolate bromide, meperidine hydrochloride, mephentermine sulfate, mephenytoin, mephobarbital, mepivacaine hydrochloride, meprobamate, meptazinol hydrochloride, mequidox, melalaine sodium, mervalone, mercaptopurine, Merck phenol chloride, mercury, ammonia Antibacterial, merisoprol Hg197, meropenem, mesalamine, meseclazone, mesoridazine, mesterolone, mestranol, mesprine hydrochloride, methalamine hydrochloride, metaproterenol politirex, metaraminol bitartrate, metaxalone, meteneprost, meterelin, metformin, methacholine chloride, methacycline, methadone hydrochloride, methadyl acetate, methathiazide, methamphetamine hydrochloride, methaqualone, methazolamide, methdilazine, methenamine, methenolone acetate, methetoin, methicillin sodium, methimazole, methioninase, methionine, methisazone, metixene hydrochloride, methocarbamol, methohexital sodium, metofolin, methotrexate, methotrimeprazine,Methoxatone, methoxyflurane, methsuximide, methyclothiazide, palmoxirate methyl 10, methylatropine nitrate, methylbenzethonium chloride, methyldopa, methyldopa hydrochloride, methylene blue, methylergonovine maleate, R-α methylhistamine, methylinosine monophosphate, methylphenidate hydrochloride, me, Tilprednisolone, methyltestosterone, methynodiol diacelate, methysergide, methysergide maleate, metiamide, metiapine, methioprim, metipamide, metipranolol, metizoline hydrochloride, metokefamide acetate, metoclopramide, methocrine iodide, metogest, metolazone, metopimazine, metoprine, metoprolol, methoxidine, metrifonate, metrizamide, sodium metrizoate, metronidazole, meturedepa, metyrapone, metyrosine, mexiletine hydrochloride, potassium mexilenoate, mezlocillin, amfonelic acid acid), mianserin hydrochloride, mibefradil, mibefradil dihydrochloride, mibolerone, mikelamine B, miconazole, miclocorin A, midaflur, midazolam hydrochloride, midodrine, mifepristone, mifobad, miglitol, milacemide, miramelin, mildronate, mirenperone, miripertine, milnacipran, milrinone, miltefosine, minban hydrochloride, minaprine, minaxolone, minocromil, minocycline, minoxidil, miofulazine hydrochloride, miokamycin, mipragoside, mirfentanil, mirimostim, mirincamycin hydrochloride, mirisetron maleate maleate), mirtazapine, mismatched double-stranded RNA, misonidazole, misoprostol, mitindomide, mitocarcin, mitochromin, mitogillin, mitoguazone, mitolactol, mitomalcin, mitomycin, mitonafide, mitosper, mitotane, mitoxantrone, mivacurium chloride, mivazerol, mixampril, mixidine, mizolastine , mizoribine, moclobemide, modafinil, modalin sulfate, modecamide, moexipril, mofalotene, mofegiline hydrochloride, mofezolac, molgramostim, molinasone, molindone hydrochloride, molsidomine, mometasone, monatepir maleate, monensin, monoctanoin, montelukast sodium, montirelin, mopidamol, moracidine, morantel tartrate, moricidine, morniflumate,Morphine sulfate, sodium morrhuate, mosapramine, mosapride, motilide, motretinide, moxalactam disodium, moxazosin, moxiraprine, moxnidazole, moxonidine, mumps skin test antigen, mustard anticancer agent, muzolimine, mycaperoxide B, mycophenolic acid, myriapolone, nabazenil, nabilone, nabitan hydrochloride, naboctate hydrochloride hydrochloride), nabumetone, N-acetyldinaline, nadide, nadifloxacin, nadolol, nadroparin calcium, nafadotride, nafamostat, nafarelin, nafcillin sodium, nafenopin, nafimidone hydrochloride, naflocculate, nafomine malate, nafoxidine hydrochloride, nafronyl oxalate, naftifine hydrochloride, naftopidil, naglivan, nagrestip, nalbuphine hydrochloride, nalidixic acid sodium, nalmefene, nalmexone hydrochloride, naloxone + pentazocine, nalto Lexon, namoxylate, nandrolone phenpropionate, nantradol hydrochloride, napactadine hydrochloride, napadisilate, napamezole hydrochloride, napaviin, naphazoline hydrochloride, naphterpin, naproxen, naproxol, napsagatran, naranol hydrochloride, narasin, naratriptan, nartograstim, nasaruplase, natamycin, nateplase, naxagolide hydrochloride, nebivolol, nebramycin, nedaplatin, nedocromil, nefazodone hydrochloride, neflumozide hydrochloride hydrochloride), nefopam hydrochloride, nelezaprine maleate, nemazoline hydrochloride, nemorubicin, neomycin palmitate, neostigmine bromide, neridronic acid, netilmicin sulfate, neutral endopeptidase, neuthramycin, nevirapine, nexeridine hydrochloride, niacin, nibroxan, nicardipine hydrochloride, nicergoline, niclosamide, nicorandil, nicotinyl alcohol, nicotine, nifedipine, nifirmerone, nifluridide, nifuraden, nifuraldeson, nifuratel, nifuratron, nifurdazil,Nifurimide, nifurpirinol, nifurquinazol, nifurthiazole, nilutamide, nilvadipine, nimazone, nimodipine, niperotidine, niravoline, niridazole, nisamycin, nisbuterol mesylate, nisin, nisobamate, nisoldipine, nisoxetine, nisterim acetate, nitarsone, nitazoxamide, nitecapone, nitrafda hydrochloride nitramine hydrochloride, nitramisole hydrochloride, nitrazepam, nitrendipine, nitrocycline, nitrodan, nitrofurantoin, nitrofurazone, nitroglycerin, nitromersol, nitromide, nitromiphen citrate, nitrous oxide, nitric oxide antioxidants, nitrullyn, nivazol, nivimedone sodium, nizatidine, nobelastine, nocodazole, nogalamycin, nolinium bromide bromide), nomifensine maleate, noracimetadol hydrochloride, norbolethone, norepinephrine bitartrate, norethindrone, norethynodrel, norfloxacin, norflurane, norgestimate, norgestomet, norgestrel, nortriptyline hydrochloride, noscapine, novobiocin sodium, N-substituted benzamides, nufenoxol, nilestriol, nystatin, O6-benzylguanine, obidoxime chloride, ocaperidone, ocfentanyl hydrochloride , ocinapron, octanoic acid, octazamide, octenidine hydrochloride, octodrine, octreotide, octriptyline phosphate, ofloxacin, oformine, oxenone, olanzapine, oligonucleotides, olopatadine, olprinone, olsalazine, olsalazine sodium, olvanil, omeprazole, onapristone, ondansetron, ontazolast, oocyte maturation inhibitors, opipramol hydrochloride, oracin, orconazole nitrate, orgotein, orlistat, ormaplatin, ormetoprim, ornidazole, orpanoxin, orphenadrine citrate, osaterone, otenzepad, oxacillin sodium, oxagrelate, oxaliplatin, oxamarin hydrochloride,Oxamisole, oxamniquine, oxandrolone, oxantel pamoate, oxaprotiline hydrochloride, oxaprozin, oxalbazole, oxatomide, oxaunomycin, oxazepam, oxcarbazepine, oxendolone, oxethazaine, oxetrone fumarate, oxfendazole, oxfenicin, oxibendazole, oxiconazole, oxidopamine, oxidronate, oxyfungin hydrochloride, oxilorphan, oximonam, oximonam sodium, oxiperomide, oxiracetam, oxira Mido, Oxisuran, Oxmetidine Hydrochloride, Oxodipine, Oxogestone Phenpropionate, Oxolinic Acid, Oxprenolol Hydrochloride, Oxtriphylline, Oxybutynin Chloride, Oxychlorosene, Oxycodone, Oxymetazoline Hydrochloride, Oxymetholone, Oxymorphone Hydrochloride, Oxypertine, Oxyphenbutazone, Oxypurinol, Oxytetracycline, Oxytocin, Ozagrel, Ozolinone, Paclitaxel, Palauamine, Paldimycin, Parinavir, Palmitoylrhizoxin, Sodium Palmoxirate, Pamaqueside , pamatolol sulfate, pamicogrel, pamidronate disodium, pamidronic acid, panadiplon, panamesin, panaxytriol, pancopride, pancuronium bromide, panipenem, pannolin, panomifen, pantethine, pantoprazole, papaverine hydrochloride, parabactin, parachlorophenol, paraldehyde, paramethasone acetate, paraniline hydrochloride, parapenzolate bromide, pararosaniline pamoate, parbendazole, parconazole hydrochloride, paregoric, pareptide sulfate, pargyline hydrochloride, parnaparin sodium, paramomycin sulfate, Paroxetine, parthenolide, partricin, paulomycin, pazelliptin, pazinacron, pazoxide, pazufloxacin, pefloxacin, pegaspargase, pegorgotein, peranserin hydrochloride, perdecin, periomycin, perretin, perlinone hydrochloride, pemedolac, pemelide nitrate, pemirolast, pemoline, penamecillin, penbutolol sulfate, penciclovir, penfluridol, penicillin G benzathine, penicillin G potassium,Penicillin G procaine, penicillin G sodium, penicillin V, penicillin V benzathine, penicillin V hydrabamine, penicillin V potassium, pentabamate, pentaerythritol tetranitrate, pentafuside, pentamidine, pentamorphone, pentamustine, pentapiperium methylsulfate, pentazocine, pentetate, pentiapine maleate, pentigetide, pentisomicin, pentizidone sodium, pentobarbital, pentomone, pentopril, pentosan, pentostatin, pentoxifylline, pentrinitrol, pentrozole, peplomycin sulfate, pepstatin, perflubron, perfofamide, perfosfamide, pergolide, perhexyline maleate maleate), perillyl alcohol, perindopril, perindoprilat, perlapine, permethrin, perospirone, perphenazine, phenacemide, phenarizine, phenazinomycin, phenazopyridine hydrochloride, phenbutazone sodium glycerate, phencarbamide, phencyclidine hydrochloride, phendimetrazine tartrate, phenelzine sulfate, phenmetrazine hydrochloride, phenobarbital, phenoxybenzamine hydrochloride, phenprocoumon, phenserine, phensuccinal, phensuximide, phentermine, phentermine hydrochloride, phentolamine mesylate, pentoxifylline, Phenyl minosalicylate, phenyl acetate, phenylalanine, phenylalanylketoconazole, phenylbutazone, phenylephrine hydrochloride, phenylpropanolamine hydrochloride, phenylpropanolamine polistirex, phenylamidol hydrochloride, phenytoin, phosphatase inhibitors, physostigmine, picenadol, picibanil, picotrindiolamine, picroliv, picmeterol, pidotimod, pifamine, pilocarpine, pilsicamide, pimagedine, pimetine hydrochloride, pimilprost, pimobendan, pimozide, pinacidil, pinadrine, pindolol,Pinenol, pinocembrin, pinoxepin hydrochloride, pioglitazone, pipamperone, pipazetate, pipecuronium bromide, piperacetazine, piperacillin sodium, piperamide maleate, piperazine, pipobroman, piposulfan, pipotiazine palmitate, pipoxolan hydrochloride, piprozolin, piquindone hydrochloride, , Piquidil hydrochloride, Piracetam, Pyrandamine hydrochloride, Pirarubicin, Pirazumonam sodium, Pirazolac, Pirbenicillin sodium, Pirbuterol acetate, Pirenperone, Pirenzepine hydrochloride, Piretanide, Pirfenidone, Piridisillin sodium, Piridronate sodium, Piriprost, Piritrexim, Pirlimycin hydrochloride, Pirlindole, Pirmagrel, Pirmenol hydrochloride, Pirnavine, Piroctone, Pirodavir, Pirodomest, Piroglilide tartrate, Pirolate, Pirrolazamide, Piroxantrone hydrochloride hydrochloride), piroxicam, piroximone, pirprofen, pirquinozole, pirsidomine, prenylamine, pitavastatin, posterior pituitary gland, pivampicillin hydrochloride, pivopril, pizotyline, placetin A, platinum compounds, platinum-triamine complexes, plicamycin, promestane, povilcastor edamine, podofilox, sumac extract, polzine methylsulfate, poliglusam, polignate sodium sodium), polymyxin B sulfate, polythiazide, ponalrestat, porfimer sodium, porfiromycin, potassium chloride, potassium iodide, potassium permanganate, povidone-iodine, practolol, pralidoxime chloride, pramiracetam hydrochloride, pramoxine hydrochloride, pranolium chloride, pravadrine maleate, pravastatin (pravachol), prazepam, prazosin, prazosin hydrochloride, prednazate, prednicarbate, prednimustine, prednisolone, prednisone, Donival, pregnenolone succinate, prenalterol hydrochloride, pridefine hydrochloride, prifelone, prilocaine hydrochloride, prilosec, primaquine phosphate, primidrol, primidone, prinivil, prinomide tromethamine, prinoxodan, prididilol hydrochloride, proadifen hydrochloride, probenecid, probicromil calcium, probucol, procainamide hydrochloride, procaine hydrochloride, procarbazine hydrochloride, procaterol hydrochloride, prochlorperazine, procinonide, proclonol,Procyclidine hydrochloride, Prodilidine hydrochloride, Prodol acid, Profadol hydrochloride, Progabide, Progesterone, Proglumide, Human proinsulin, Proline, Prolintane hydrochloride, Promazine hydrochloride, Promethazine hydrochloride, Propafenone hydrochloride, Propagermanium, Propanidizide, Propantheline bromide, Proparacaine hydrochloride, Propatyl nitrate, Propentofylline, Propenzolate hydrochloride, Propicacin, Propiomazine, Propionic acid, Propionylcarnitine, L-, Propiram, Propiram + Paracetamol , propiverine, propofol, propoxycaine hydrochloride, propoxyphene hydrochloride, propranolol hydrochloride, propulsid, propyl bis-acridone, propylhexedrine, propyliodone, propylthiouracil, proquasone, potassium prorenoate, proloxan hydrochloride, proscillaridin, prostalene, prostratin, protamine sulfate, protegrin, protirelin, protosufloxacin, protriptyline hydrochloride Chirin, proxazole, proxazole citrate, proxicromil, proxorphan tartrate, prulifloxacin, pseudoephedrine hydrochloride, puromycin, purpurin, pyrabrom, pyrantel, pamoate, pyrazinamide, pyrazofurin, pyrazoloacridine, pyridostigmine bromide, pyrilamine maleate, pyrimethamine, pyrinoline, sodium pyrithione, zinc pyrithione, pyrovalerone hydrochloride, pyroxamine maleate, pyrrocaine, pyrrorifene hydrochloride, pyrrolnitrite Pyrroinitrin, pyrvinium pamoate, quadazocine mesylate, quazepam, quazinone, quazodine, quazolast, quetiapine, quiflapone, quinagolide, quinaldine blue, quinapril, quinaprilat, quinazocine hydrochloride, quinborone, quinctolate, quindecamine acetate, quindonium bromide, quinelorane hydrochloride, quinestrol, quinfamide, quingestanol acetate, quingestrone, quinidine gluconate, quinielorane hydrochloride, quinine sulfate, quinpirole hydrochloride, quinterenol sulfate, quinucurium bromide, quinupristin, quipazine maleate,Rabeprazole sodium, racefenicol, racepinephrine, RAF antagonists, rafoxamide, ralitrine, raloxifene, raltitrexed, ramatroban, ramipril, ramoplanin, ramosetron, ranelic acid, ranimycin, ranitidine, ranolazine, rauwolfia serpentina), recainam, recainam hydrochloride, reclazepam, regavirumab, regramostim, relaxin, reromycin, remacemide hydrochloride, remifentanil hydrochloride, remiprostol, remoxipride, repirinast, repromycin, reproterol hydrochloride, reserpine, resiniferatoxin, resorcinol, demethylated reteriptin, reticulon, reviparin sodium, revidinone, rhenium re 186 Etidronate, rhizoxin, ribaminol, ribavirin, ribopurin, ribozyme, ricasetron, ridogrel, rifabutin, rifametan, rifamexil, rifamide, rifampin, rifapentine, rifaximin, retinamide, rilopirox, riluzole, rimantadine, rimcazole hydrochloride, rimexolone, rimiterol hydrobromide, rimoprogin, riodipine, rioprostil, ripazepam, ripisartan, risedronate sodium, risedronate, lisocaine, lisotilide hydrochloride, rispenzepine, risperdal, risperidone, ritanserin, ritipenem, ritodrine, litorukast, ritonavi , rizatriptan benzoate, locastin hydrochloride, rocuronium bromide, rodocaine, loflurane, rogletimide, rohitukine, rokitamycin, loletamiside, lorgamidin, rolicyprine, rolipram, rolitetracycline, rolodine, romazarit, romurtide, ronidazole, ropinirole, ropitoin hydrochloride, ropivacaine, ropidine, roquinimex, rosamicin, rosoxacin, rotoxamine, roxatidine, roxarsone, roxindol, roxithromycin, rubiginone B1, ruboxil, rufloxacin, rupatidine, rutamycin, ruzadran,Sabeluzole, safingol, safilonil, saintpine, salbutamol, R-, salcolex, saletamide maleate, salicyl alcohol, salicylamide, meglumine salicylate, salicylic acid, salmeterol, salnacediin, salsalate, samerizin, sampatrilat, sancycline, sanfetrinem, sanguinarium chloride, saperconazole, saprisartan, sapropterin, saquinavir, sarafloxacin hydrochloride, saralasin acetate, SarCNU, sarcophytol A, sargramostim, salmoxicillin, salpicillin, sarpogrelate, saruplase, saterinone, satigrel, satumomab pentetide pendetide, Schick test control, scopafungin, scopolamine hydrobromide, scrazaipine hydrochloride, SDI 1 mimetic, secalciferol, secobarbital, seelzone, seglitide acetate, selegiline, selegiline hydrochloride, selenium sulfide, selenomethionine SE 75, selthotel, sematilide, senduramycin, semotiadil, semustine, sense oligonucleotide, sepazonium chloride, ceperidol hydrochloride, seprilose, seproxetine hydrochloride, seractide acetate acetate), sergolexol maleate, serine, sermetasin, sermorelin acetate, sertaconazole, sertindole, sertraline, setiptiline, setoperone, sevirumab, sevoflurane, sezolamide, sibopirdine, sibutramine hydrochloride, signal transduction inhibitors, silandrone, silipide, silteplase, silver nitrate, simendan, simtrazene, simvastatin, sincalid, sinef ingin, cinirotil, sinnabidol, sipatrigine, sirolimus, sisomicin, sitoglucide, sizofuran, sobuzoxane, sodium amylosulfate, sodium iodide I123, sodium nitroprusside, sodium oxybate, sodium phenylacetate, sodium salicylate, sorberol, solipertine tartrate, somalapor,Somantadine hydrochloride, somatomedin B, somatomedin C, somatrem, somatropin, somenopor, somidobove, sonermin, sorbinil, sorivudine, sotalol, soterenol hydrochloride, sparfloxacin, sparfosate sodium, sparfosic acid acid), sparsomycin, sparteine ​​sulfate, spectinomycin hydrochloride, spicamycin D, spiperone, spiradoline mesylate, spiramycin, spirapril hydrochloride, spiraprilat, spirogermanium hydrochloride, spiromustine, spironolactone, spiroplatin, spiroxasone, splenopentin, spongistatin 1, sprodiamide, squalamine, stannous hydrochloride, stannous pyrophosphate, stannous sulfur colloid, stanozolol, statolone, staurosporine, stavudine, stefimycin, stenbolone acetate, stepronin, stilbazium iodide, stilonium iodide iodide), stipiamide, stiripentol, stobadine, streptomycin sulfate, streptonicozid, streptonigrin, streptozocin, stromelysin inhibitor, strontium chloride 89, succinimer, succinylcholine chloride, sucralfate, sucrosophate potassium, sudoxicam, sufentanil, sufotidine, sulazepam, sulbactam pivoxil, sulconazole nitrate, sulfabenz, sulfabenzamide, sulfacetamide, sulfacytine, sulfadiazine, sulfadoxine, sulfalene, sulfamerazine, sulfamethazine, sulfamethazine Sulfamethizole, sulfamethoxazole, sulfamonomethoxine, sulfamoxole, zinc sulfanilate, sulfanitran, sulfasalazine, sulfasomizole, sulfazameth, sulfinalol hydrochloride, sulfinosine, sulfinpyrazone, sulfisoxazole, sulfomixin, sulfonterol hydrochloride, sulfoxamine, sulindac, sulmarin, sulnidazole, suloctidil, sulofenur,Sulopenem, suloxifene oxalate, sulpiride, sulprostone, sultamicillin, sulthiame, sultopride, sulkast, sumarotene, sumatriptan, suncillin sodium, suproclone, suprofen, sura, dista, suramin, sulfomer, suricamide maleate, slitozole, sulonacrine maleate, suxemelide sulfate, swainsonine, symakalim, simclosene, cimetine hydrochloride, synthetic glycosaminoglycans, taciamine hydrochloride hydrochloride), tacrine hydrochloride, tacrolimus, talampicillin hydrochloride, taleranol, tallysomycin, talimustine, talmetacin, talniflumate, talopram hydrochloride, talosalate, tametraline hydrochloride, tamoxifen, tampramine fumarate, tamsulosin hydrochloride, tandamine hydrochloride, tandospirone, tapgen, taprosten, tasosartan, tauromustine, taxane, taxoid, tazadren succinate, tazanolast, tazarotene, tazifylline hydrochloride, tazobactam, tazoferon, tazolol hydrochloride, tebufelone, tebuquin, technetium Tc 99m bicisate, teclozan, tecogalan sodiumsodium), teceleukin, teflurane, tegafur, tegretol, teicoplanin, telenzepine, tellurapyrylium, telmesteine, telmisartan, telomerase inhibitors, teloxantrone hydrochloride, terdipine hydrochloride, temafloxacin hydrochloride, tematropium methylsulfate, temazepam, temelastine, temocapril, temocillin, temoporfin, temozolomide, tenida P, teniposide, tenosal, tenoxicam, tepirindol, tepoxalin, teprotide, terazosin, terbinafine, terbutaline sulfate, terconazole, terfenadine, terflavoxate, terguride, teriparatide acetate, terlaquiline, terlipressin, terodiline, teroxalen hydrochloride, teroxirone, tertatolol, tesicam, tesimide, testolactone, testosterone, tetracaine, tetrachloro Decaoxide, tetracycline, tetrahydrozoline hydrochloride, tetramisole hydrochloride, tetrazolast meglumine, tetrazomine, tetrofosmin, tetroquinone, tetroxoprim, tetridamine, thaliblastine, thalidomide, theofibrate, theophylline, thiabendazole, thiamiprine, thiamphenicol, thiamylal, thiazesim hydrochloride, thiazinamium chloride, thiethylperazine, thimerosal sodium, thimerosal, thimerosal Ocoraline, thiofedrine, thioguanine, thiomarinol, thiopental sodium, thioperamide, thioridazine, thiotepa, thiothixene, thifenamil hydrochloride, tifencillin potassium, thiram, thozalinone, threonine, thrombin, thrombopoietin, thrombopoietin mimetics, thymalfasin, thymopoietin receptor agonist, thymotrin, thyromedan hydrochloride, thyroxine I 125, thyroxine I131, thiacrilast, thiacrilast sodium, tiagabine, tiamenidine, tianeptine, tiapafant, tiapamil hydrochloride, tiaramide hydrochloride, tiazofurin, tibenelast sodium, tibolone, tibulic acid, ticabesone propionate, ticarbodine, ticarcillin cresyl sodium, ticlaton, ticlopidine, ticrynafen, thienoxolol, tifurac sodium, tigemonam dicholine, tigestol, tiletamine hydrochloride, tilidine hydrochloride, tilisolol, tilnoprofen albamel arbamel), tilorone hydrochloride, tiludronate disodium, tiludronic acid, timefron, timobesone acetate, timolol, ethyl etiopurinse, tinabinol, timidazole, tinzaparin sodium, tioconazole, tiodazocin, thiodonium chloride, thioperidone hydrochloride, thiopinac, thiaspirone hydrochloride, tiotidine, tiotropium bromide, tioxidazole, tipentosin hydrochloride hydrochloride), tipredan, tiprenolol hydrochloride, tiplinast meglumine, tipropidil hydrochloride, tiqueside, tiquinamide hydrochloride, tilandalidigine, tirapazamine, tirilazad, tirofiban, tiropramide, titanocene dichloride, tixanox, tixocortol pivalate, tizanidine hydrochloride, tobramycin, tocamide, tocamfil, tofenacin hydrochloride, tolamolol, tolazamide, tolazoline hydrochloride, tolbutamide, tolcapone, tolciclate, tolfamide, tolgabide, lamotrigine, tolimidone, tolindate, tolmetin, tolnaftate, tolpovidone131, tolpiramide, tolrestat, tomerkast, tomoxetine hydrochloride, tonazosin mesylate, topiramate, topotecan, topotecan hydrochloride, topsentin, topterone, toxidine, torasemide, toresemide, tosifen, tosufloxacin, totipotent stem cell factor, tracazolate, trafermin, tralonide, tramadol hydrochloride, tramazoline hydrochloride, trandolapril, tranexamic acid, tranilast, transcamide, translation inhibitors, trazanox, trazodone hydrochloride, trazodone-HCl, trebenzomine hydrochloride hydrochloride), trefentanil hydrochloride, toleroxinate, trepipam maleate, trestron acetate, tretinoin, triacetin, triacetyluridine, triafungin, triamcinolone, triampidine sulfate, triamterene, triazolam, tribenoside, tricaprylin, tricetamide, trichlormethiazide, trichohyalin, triciribine, tricitrate, triclofenol piperazine, triclofos sodium, triclonide, trientine, triphenag Rel, triflavin, triflosine, triflubazam, triflumidate, trifluoperazine hydrochloride, trifluperidol, triflupromazine, triflupromazine hydrochloride, trifluridine, trihexyphenidyl hydrochloride, trilostane, trimazosin hydrochloride, trimegestone, trimeprazine tartrate, trimethadione, trimethaphan camsylate, trimethobenzamide hydrochloride, trimethoprim, trimetozine, trimetrexate, trimipramine, trimoprostil, trimoxamine hydrochloride, triolein I 125, triolein I 131, trioxifene mesylatemesylate), tripamide, tripelennamine hydrochloride, triprolidine hydrochloride, triptorelin, trisulfapyrimidines, trocrossene potassium, troglitazone, trolamine, troleandomycin, thrombodipine, trometamol, tropanserine hydrochloride, tropicamide, tropine ester, tropisetron, trospectomycin, trovafloxacin, trovirdine, tryptophan, tuberculin, tubocurarine chloride, tubrozole hydrochloride, tucarcsol, tulobuterol, turosteride, tibamate, tyrogenin, tyro Sodium propranolol, tyrosine, tyrothricin, tyrphostin, ubenimex, urdazepam, undecylenic acid, uracil mustard, urapidil, urea, uredepa, uridine triphosphate, urofollitropin, urokinase, ursodiol, valacyclovir, valine, valnoctamide, sodium valproate, valproic acid, valsartan, vamicamide, vanadeine, vancomycin, vaminolol, bapiprost hydrochloride, vapreotide, valiolin B, vasopressin, vecuronium bromide, veraresol, velnacrine maleate, venlafaxine, veradoline hydrochloride hydrochloride), veramine, verapamil hydrochloride, verdine, berilopam hydrochloride, verlukast, verofylline, veroxan, verteporfin, vesnarinone, bexivinol, vidarabine, vigabatrin, viloxazine hydrochloride, vinblastine sulfate, vinbrunin citrate, vincophos, vinconate, vincristine sulfate, vindesine, vindesine sulfate, vinepidine sulfate, vinglisinate sulfate, vinleurosine sulfate, vinorelbine, vinpocetine, vintoperol, vinxaltine, vinzolidine sulfate, biprostol, virginiamycin,Viridofulvin, viroxime, vitaxin, borazosine, voriconazole, vorozole, voxergolide, warfarin sodium, xamoterol, xanomeline, xanoxate sodium, xanthinol nicotinate, zemilofiban, xenaripine, xenbucin, xylobam, ximoprofen, xipamide, xorphanol mesylate, xylamidine tosylate, xylazine hydrochloride, xylometazoline hydrochloride, Xylose, yangabin, zavicipril, zacopride, zafirlukast, zalcitabine, zaleplon, zalospirone, zartidine hydrochloride, zaltoprofen, zanamivir, zankiren, zanoteron, Zantac, zafirlukast, zatebradine, zatosetron, zatosetron maleate, zenarestat, zenazocine mesilate mesylate), zeniplatin, zeranol, zidometacin, zidovudine, diflosilone, dirantel, zilascorb, zileuton, zimeldine hydrochloride, zinc undecylenate, zindotrin, dinoconazole hydrochloride, zinostatin, zinterol hydrochloride, zinviroxime, ziprasidone, zobolt, zofenopril calcium, zofenoprilat, zolamine hydrochloride, zolazepam hydrochloride, zoledronic acid acid), zolertine hydrochloride, zolmitriptan, zolpidem, zomepirac sodium, zometapine, zoniclesol hydrochloride, zonisamide, zopiclone, zopolrestat, zorbamycin, zorubicin hydrochloride, zotepine, zucapsaicin, JTT-501 (PNU-182716) (reglitazar), AR-H039122, MCC- 555 (netoglitazone), AR-H049020 (tesaglitazar), CS-011 (CI-1037), GW-409544X, KRP-297, RG-12525, BM-15.2054, CLX-0940, CLX-0921, DRF-2189, GW-1929, GW-9820, LR-90, LY-510929, NIP-221, NIP-223, JTP-20993, LY 29311 Na, FK 614, BMS 298585, R 483, TAK 559, DRF2725 (ragaglitazar), L-686398, L-168049, L-805645, L-054852, (demethyl asteriquinone) B1 (L-783281), L-363586, KRP-297, P32 / 98, CRE-16336, EML-1625, a pharmaceutically acceptable salt thereof, or a biologically active fragment, variant or derivative thereof, or a combination thereof. In some embodiments, the bioactive agent is selected from leuprolide, octreotide, brimonidine, latanoprost, latanoprost acid, travoprost, travoprost acid, brinzolamide, dorzolamide, betaxolol, terbinafine, risperidone, and / or rapamycin, or a combination thereof.

[0293] Carbohydrate: As used herein, the term "carbohydrate" refers to a carbohydrate. Carbohydrate refers to a biological molecule that contains nitrogen, oxygen, and hydrogen. In some embodiments, carbohydrates include saccharides, sugars, starches, or cellulose. In some embodiments, saccharides include monosaccharides, disaccharides, oligosaccharides, and polysaccharides. In some embodiments, polysaccharides act as structural building blocks or act as energy storage. In some embodiments, carbohydrates are involved in the immune system, fertilization, disease inhibition, blood clotting, and / or development. In some embodiments, the bioactive agent contains a carbohydrate.

[0294] Cell-penetrating peptide: As used herein, the terms "cell-penetrating peptide," "cell-penetrating protein," "CPP," and the like refer to a peptide or protein capable of crossing a cell membrane. In various embodiments, a CPP is complexed with a bioactive agent to facilitate transport of the agent across the membrane. In some embodiments, a CPP serves to facilitate uptake of the agent across a cell membrane, e.g., the plasma membrane of a mammalian cell, and / or the nuclear membrane of a mammalian cell. In some embodiments, a CPP is capable of being internalized within a cell and crossing cell membranes (particularly including the outer "boundary" cell membrane (commonly also referred to as the "plasma membrane"), the endosomal membrane, and the membrane of the endoplasmic reticulum) and / or directing the passage of a given agent or cargo across these cell membranes. In some embodiments, any potential internalization mechanism is expected to include both energy-dependent (i.e., active) transport mechanisms (e.g., endocytosis) and energy-independent (i.e., passive) transport mechanisms (e.g., diffusion). In various embodiments, internalization involves localization of at least a portion of the peptide passing through the plasma membrane into the cytoplasm (as opposed to localization in a different cellular compartment, e.g., in a vesicle, endosome, or within the nucleus). A non-limiting example of a CPP is a peptide having the amino acid sequence GRKKRRQRRRPPQ (Vives; E. et al. (1997), supra).Non-limiting examples of CPPs include the HIV-1 TAT translocation domain (Green; M. and Loewenstein, P. M. (1988) Cell 55, 1179-1188) and the homeodomain of the Antennapedia protein from Drosophila (Joliot; A. et al. (1991) Proc. Natl. Acad. Sci. USA 88, 1864-1868); the 16 amino acid sequence of the so-called penetratin or pAntp Antennapedia protein (Derossi, D. et al. (1994) J. Biol. Chem. 269, 10444-10450); and the basic sequence of the HIV-1 TAT protein (Vives, E. et al. (1997) J. Biol. Chem. 272, 16010-16017). The synthetic peptides developed are amphipathic model peptides MAP (Oehlke, J. et al. (1998) Biochim. Biophys. Acta 1414, 127-139). Additional non-limiting examples of CPPs are described in U.S. Patent Nos. 9,303,076 and 9,302,014.

[0295] Characteristic portion: As used herein, the phrase "characteristic portion" of a protein or polypeptide refers to a portion containing consecutive amino acids, or a collection of consecutive amino acids, both of which are characteristic of the protein or polypeptide. Each such consecutive stretch will generally contain at least two amino acids. Moreover, those skilled in the art will recognize that in many cases, at least 5, 10, 15, 20, or more amino acids are required to be characteristic of a protein. Generally, a characteristic portion is one that shares at least one functional characteristic with the related intact protein, in addition to the sequence identity specified above.

[0296] Characteristic sequence: As used herein, a "characteristic sequence" is a sequence that is present in all members of a family of polypeptides or nucleic acids and can therefore be used by those skilled in the art to define members of that family.

[0297] Characteristic structural element: As used herein, the term "characteristic structural element" refers to a distinct structural element (e.g., a core backbone, a collection of pendant moieties, sequence elements, etc.) that is present in all members of a family of polypeptides, small molecules, or nucleic acids and thus can be used by those skilled in the art to define the members of that family.

[0298] Chemotherapeutic Agent: As used herein, the term "chemotherapeutic agent" refers to a drug or agent capable of killing proliferating cells, including cancer cells. Chemotherapeutic agents are frequently used to treat various forms of cancer. In some embodiments, non-limiting examples of chemotherapeutic agents include adriamycin, paclitaxel (Taxol), docetaxel (Taxotere), actinomycin D, doxorubicin, daunorubicin, valrubicin, idarubicin, epirubicin, bleomycin, plicamycin, camptothecin and its derivatives, bleomycin, etoposide, teniposide, mitomycin, vinca alkaloids such as vinblastine and vincristine, and platinum-based compounds such as cisplatin and gemcitabine. In some embodiments, the composition contains a lipid and a portion of the chemotherapeutic agent capable of mediating at least one function of the chemotherapeutic agent.

[0299] Comparable: As used herein, the term "comparable" is used herein to describe two (or more) settings of conditions or circumstances that are sufficiently similar to one another to allow for a comparison of the results obtained or the phenomena observed. In some embodiments, comparable settings of conditions or circumstances are characterized by multiple substantially identical characteristics and one or a few altered characteristics. One of ordinary skill in the art will recognize that sets of conditions are equivalent to one another when they are characterized by a sufficient number and type of substantially identical characteristics to reasonably justify concluding that differences in the results obtained and phenomena observed under the different sets of conditions or circumstances are caused by, or indicative of, changes in those altered characteristics.

[0300] Complex: As used herein, the term "complex" refers to a composition containing two or more components, moieties, or molecules that are physically linked to one another, e.g., covalently, either directly or indirectly (for example, by using one or more linkers interposed between two adjacent components, moieties, or molecules). As used herein, the term "complexed" in reference to a composition containing two or more components, moieties, or molecules refers to the state in which the two or more components, moieties, or molecules are physically linked to one another. In some embodiments, the composition contains a lipid and a bioactive agent, in which case the lipid and the bioactive agent are complexed.

[0301] CRISPR and Related Terms: As used herein, the terms "CRISPR" and "CRISPR / Cas system" refer to a biologically active system comprising clustered regularly interspaced short palindromic repeats (CRISPRs), which are segments of prokaryotic DNA containing short repeats of base sequences, or various artificial systems derived or inspired by natural prokaryotic systems. In some embodiments, the bioactive agent comprises components of a CRISPR / Cas system. In some embodiments, CRISPR / Cas components include, but are not limited to, genes encoding Cas proteins (non-limiting examples include Cas9, dCas9, and their variants, both natural and artificial variants) or the proteins themselves; guide RNAs; any components of the CAS crRNA complex; cas (CRISPR-associated) genes or gene products; and any other biologically active molecules involved in natural or artificial CRISPR / Cas systems. See, for example, Jinek et al. 2012 Science 337:816-821; Cong et al. 2013 Science 339:819-823; U.S. Patent Application 20140234972; DiCarlo 2013 Nucl. Acids Res. 41:4336-43; Hwang et al. 2013 Nat. Biotech. 31:227-9; and Flowers et al. 2014 Development 141:2165-71.

[0302] Alicyclic: As used herein, the term "alicyclic" refers to a saturated or partially unsaturated aliphatic monocyclic, bicyclic, or polycyclic ring system, e.g., having 3 to 30 ring members, where the aliphatic ring system may be substituted. Alicyclic groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl. In some embodiments, cycloalkyl has 3 to 6 carbons. The term "alicyclic" can also include an aliphatic ring fused to one or more aromatic or non-aromatic rings, e.g., decahydronaphthyl or tetrahydronaphthyl, where the radical or point of attachment is on the aliphatic ring. In some embodiments, a carbocyclic group is bicyclic. In some embodiments, a carbocyclic group is tricyclic. In some embodiments, a carbocyclic group is polycyclic. In some embodiments, "alicyclic" (or "carbocyclic" or "cycloalkyl") refers to a monocyclic C3-C6 hydrocarbon or C8-C6 alkyl group that is fully saturated or contains one or more units of unsaturation, but is not aromatic, and has a single point of attachment to the rest of the molecule. 10 Bicyclic hydrocarbons or C9-C that are fully saturated or contain one or more units of unsaturation, but are not aromatic, and have a single point of attachment to the rest of the molecule 16 Refers to tricyclic hydrocarbons.

[0303] Dosage regimen: As used herein, "dosage regimen" or "treatment regimen" often refers to a set of unit doses (often two or more) administered individually to a subject, separated by a period of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may include one or more dosages. In some embodiments, a dosing regimen includes multiple doses, each separated from the other by a period of equal length. In some embodiments, a dosing regimen includes multiple doses and at least two different periods separating the individual doses. In some embodiments, all doses within a dosing regimen are the same unit dose. In some embodiments, different doses within a dosing regimen are different amounts. In some embodiments, a dosing regimen includes a first administration at a first dosage, followed by one or more additional doses at a second dosage that is different from the first dosage. In some embodiments, a dosing regimen includes a first administration at a first dosage, followed by one or more additional doses at a second dosage that is the same as the first dosage.

[0304] Equivalent Agents: Upon reading this disclosure, one of ordinary skill in the art will recognize that the range of agents useful in the context of the present invention is not limited to those specifically mentioned or exemplified herein. Specifically, one of ordinary skill in the art will recognize that active agents often have a structure consisting of a core and pendant moieties attached thereto, and will therefore understand that simple alterations to such core and / or pendant moieties may not significantly alter the activity of the agent. For example, in some embodiments, equivalent Substitution of one or more pendant moieties with groups of the three-dimensional structure and / or chemical reactivity characteristics of the original reference compound or moiety may produce a substitute compound or moiety equivalent to the original reference compound or moiety. In some embodiments, addition or removal of one or more pendant moieties may produce a substitute compound equivalent to the original reference compound. In some embodiments, alteration of the core structure, for example, by addition or removal of a small number of bonds (often no more than 5, 4, 3, 2, or 1 bond, and often only single bonds), may produce a substitute compound equivalent to the original reference compound. In many embodiments, equivalent compounds can be synthesized, for example, by the methods shown in the general reaction schemes below, or modifications thereof, using readily available starting materials, reagents, and conventional or provided synthetic procedures. In these reactions, variants known per se but not mentioned herein are also possible.

[0305] Equivalent Dosage: As used herein, the term "equivalent dosage" is used herein to compare dosages of different pharmaceutically active agents that produce the same biological result. Doses of two different agents are considered "equivalent" to one another according to the present invention if they achieve a similar level or degree of biological result. In some embodiments, equivalent dosages of different drugs for use according to the present invention are determined using the in vitro and / or in vivo assays described herein. In some embodiments, one or more lysosome activators for use according to the present invention are utilized at dosages equivalent to the dosage of a reference lysosome activator. In some embodiments, the reference lysosome activator for such purposes is selected from the group consisting of small molecule allosteric activators (e.g., pyrazole pyrimidines), iminosugars (e.g., isofagomine), antioxidants (e.g., n-acetyl-cysteine), and cell trafficking regulators (e.g., Rab1a polypeptides).

[0306] Halogen: The term "halogen" as used herein means F, Cl, Br, or I.

[0307] Heteroaliphatic: The term "heteroaliphatic" is given its ordinary meaning in the art and refers to an aliphatic group, as described herein, in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). In some embodiments, one or more units selected from C, CH, CH, or CH are independently replaced with one or more heteroatoms (including oxidized and / or substituted forms thereof). In some embodiments, a heteroaliphatic group is a heteroalkyl. In some embodiments, a heteroaliphatic group is a heteroalkenyl.

[0308] Heteroalkyl: As used herein, the term "heteroalkyl" is given its ordinary meaning in the art and refers to an aliphatic group, as described herein, in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). Examples of heteroalkyl groups include, but are not limited to, alkoxy, poly(ethylene glycol)-, alkyl-substituted amino, tetrahydrofuranyl, piperidinyl, morpholinyl, etc.

[0309] Heteroaryl: As used herein, the terms "heteroaryl" and "heteroar-," used alone or as part of a larger moiety, such as "heteroaralkyl" or "heteroaralkoxy," refer to a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 30 ring members, in which at least one ring in the system is aromatic and at least one aromatic ring atom is a heteroatom. Heteroaryl groups, in some embodiments, are groups having 5 to 10 ring atoms (i.e., monocyclic, bicyclic, or polycyclic), in some embodiments, 5, 6, 9, or 10 ring atoms. In some embodiments, heteroaryl groups have 6, 10, or 14 pi electrons shared in the cyclic arrangement and having 1 to 5 heteroatoms in addition to the carbon atoms. Heteroaryl groups include, but are not limited to, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. In some embodiments, a heteroaryl is a heterobiaryl group, such as bipyridyl. As used herein, the terms "heteroaryl" and "heteroaralkyl" also include groups in which a heteroaromatic ring is fused to one or more aryl, alicyclic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. Heteroaryl groups may be monocyclic, bicyclic, or polycyclic.The term "heteroaryl" can be used interchangeably with the terms "heteroaryl ring," "heteroaryl group," or "heteroaromatic," any of which terms include rings that are optionally substituted. The term "heteroaralkyl" refers to an alkyl group substituted with a heteroaryl group, where the alkyl and heteroaryl portions independently may be substituted.

[0310] Heteroatom: As used herein, the term "heteroatom" refers to an atom that is neither carbon nor hydrogen. In some embodiments, a heteroatom is any oxidized form of nitrogen, sulfur, phosphorus, or silicon, any basic nitrogen or quaternized form of a substitutable nitrogen of a heterocyclic ring (e.g., N in 3,4-dihydro-2H-pyrrolyl), NH (in pyrrolidinyl), or NR (in N-substituted pyrrolidinyl). + The element is oxygen, sulfur, nitrogen, phosphorus, or silicon, including the like.

[0311] Heterocyclyl: As used herein, the terms "heterocycle," "heterocyclyl," "heterocyclic radical," and "heterocyclic ring" are used interchangeably and refer to a monocyclic, bicyclic, or polycyclic ring moiety (e.g., 3-30 members) that is saturated or partially unsaturated and has one or more heteroatom ring atoms. In some embodiments, a heterocyclyl group is a stable 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated and has, in addition to carbon atoms, one or more heteroatoms, preferably 1 to 4 heteroatoms as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. For example, in a saturated or partially unsaturated ring having 0 to 3 heteroatoms selected from oxygen, sulfur, or nitrogen, the nitrogen can be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or N-substituted pyrrolidinyl. +It can be NR. The heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure, and any ring atom can be substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, but are not limited to, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms "heterocycle," "heterocyclyl," "heterocyclyl ring," "heterocyclic group," "heterocyclic group," "heterocyclic moiety," and "heterocyclic radical" are used interchangeably herein and include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or alicyclic rings, such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. Heterocyclyl groups may be monocyclic, bicyclic, or polycyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted with a heterocyclyl, where the alkyl and heterocyclyl portions are optionally independently substituted.

[0312] Immunomodulatory Nucleic Acids and CpG Oligonucleotides and Related Terms: As used herein, the term "immunomodulatory nucleic acid" refers to a nucleic acid that can modulate an immune response, e.g., in a mammalian, e.g., human, subject. In various embodiments, an immunomodulatory nucleic acid can stimulate (agonize) an immune response. In other embodiments, a different immunomodulatory nucleic acid can decrease (antagonize) an immune response. In a non-limiting example, an immunomodulatory nucleic acid includes a CpG oligonucleotide. As used herein, the term "CpG oligonucleotide" refers to an oligonucleotide containing an unmethylated CpG motif, where the oligonucleotide can contain nucleotides, modified nucleotides, and / or nucleotide analogs. In some embodiments, the CpG oligonucleotide can stimulate a TLR9-mediated and / or TLR9-associated immune response in at least one assay. In some embodiments, the CpG oligonucleotide can antagonize an immune response in at least one assay. Others do neither. In some embodiments, CpG oligonucleotides can optionally contain sugar, base, or phosphate (phosphodiester) modifications, as well as secondary and tertiary structures. See, e.g., Vollmer et al. 2009 Adv. Drug. Del. Rev. 61:195-204. In some embodiments, an example of a modified phosphodiester is phosphorothioate. In some embodiments, one or more phosphorothioates (PS) are incorporated into the backbone of a CpG oligonucleotide (in place of phosphodiester or PO). PS reduces nuclease degradation and, in at least some instances, has been reported to enhance the immunogenic activity of CpG oligonucleotides by 10-100-fold. See, e.g., Vollmer et al. 2009 Adv. Drug Del. Rev. 61:195-204. In some embodiments, CpG oligonucleotides can contain all phosphodiesters in the backbone, or a mixture of phosphodiesters and internucleoside linkers in the backbone.Or it can contain all internucleoside linkers in the backbone. For example, WO2015 / 108047 reports CpG oligonucleotides with a mixture of phosphodiester and internucleoside (e.g., phosphorothioate) linkages. In this example, the CpG region motif contains phosphodiester with phosphorothioates adjacent to the CpG region motif. In various embodiments, the CpG oligonucleotide may contain phosphorothioates in the Rp or Sp configuration. As used in the literature and herein, the term "CpG ODN" or "CpG oligodeoxynucleotide" is not strictly limited to oligonucleotides, where "p" is phosphate. These terms have been used previously in the literature, and herein, refer to oligonucleotides containing one or more phosphorothioates instead of phosphodiesters. Furthermore, the term "immunomodulatory" CpG oligonucleotides may be used to encompass oligonucleotides containing all phosphorothioates in their backbones and / or other modifications. In some embodiments, "immunomodulatory" CpG oligonucleotides may stimulate immune responses. In some embodiments, CpG oligonucleotides may contain a single strand, or may optionally contain a second or other additional strand. In some embodiments, CpG oligonucleotides may further contain or be complexed with other non-nucleotide components. In some embodiments, the composition contains a lipid and a portion of an immunomodulatory nucleic acid that can modulate at least one function of the immunomodulatory nucleic acid.

[0313] Intraperitoneal: As used herein, the terms "intraperitoneal administration" and "administered intraperitoneally" have their art-recognized meaning of referring to administration of a compound or composition into the peritoneal membrane of a subject.

[0314] In vitro: As used herein, the term "in vitro" refers to events that occur not within a living organism (e.g., an animal, plant, and / or microorganism) but in an artificial environment, e.g., in a test tube or reactor, in cell culture, etc.

[0315] In vivo: As used herein, the term "in vivo" refers to events that take place within an organism (e.g., an animal, a plant, and / or a microorganism).

[0316] Linker: As used herein, the term "linker" refers to a moiety that connects two parts of a composition. As a non-limiting example, a linker physically connects a bioactive agent to a lipid. Non-limiting examples of suitable linkers include uncharged linkers, charged linkers, alkyl-containing linkers, phosphate-containing linkers, branched linkers, unbranched linkers, linkers containing at least one cleavage group, linkers containing at least one redox cleavage group, linkers containing at least one phosphate-based cleavage group, linkers containing at least one acid cleavage group, linkers containing at least one ester-based cleavage group, and linkers containing at least one peptide-based cleavage group. Other non-limiting examples of linkers are described herein or detailed in Figure 7.

[0317] Lower alkyl: As used herein, the term “lower alkyl” refers to a C 1-4 Examples of lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

[0318] Lipid: As used herein, the term "lipid" refers to any member of a large group of molecules that are generally at least partially hydrophobic or amphipathic, including phospholipids, triglycerides, diglycerides, monoglycerides, fat-soluble vitamins, sterols, fats, and waxes, among others. In some embodiments, lipids include fatty acids, glycerolipids, glycerophospholipids, sphingolipids, sterol lipids, prenol lipids, saccharolipids, polyketides, and other molecules. In some embodiments, the present disclosure provides a method for preparing a lipid-containing composition comprising a bioactive agent and a C 10 -C 80 In some embodiments, the present disclosure relates to compositions containing lipids containing a linear saturated or partially unsaturated aliphatic chain of the formula: 1-4 C substituted with aliphatic groups 10 -C 80 In some embodiments, the present disclosure relates to a composition comprising a lipid containing a linear saturated or partially unsaturated aliphatic chain of C. 10 -C 60 In some embodiments, the present disclosure relates to compositions containing lipids containing a linear saturated or partially unsaturated aliphatic chain of the formula: 1-4 C substituted with aliphatic groups 10 -C 60 In some embodiments, the present disclosure relates to a composition comprising a lipid containing a linear saturated or partially unsaturated aliphatic chain of C. 10 -C 40 In some embodiments, the present disclosure relates to compositions containing lipids containing a linear saturated or partially unsaturated aliphatic chain of the formula: 1-4 C substituted with aliphatic groups 10 -C 40The present invention relates to compositions containing lipids containing linear saturated or partially unsaturated aliphatic chains of the formula: In some embodiments, the lipids include, but are not limited to, lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl. In some embodiments, lipids include, but are not limited to, amino lipids; amphipathic lipids; anionic lipids; apolipoproteins; cationic lipids; low molecular weight cationic lipids; cationic lipids, such as CLinDMA and DLinDMA; ionizable cationic lipids; cloaking components; helper lipids; lipopeptides; neutral lipids; neutral zwitterionic lipids; hydrophobic small molecules; hydrophobic vitamins; PEG-lipids; uncharged lipids modified with one or more hydrophilic polymers; phospholipids; phospholipids such as 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine; stealth lipids; sterols; cholesterol; and targeting lipids; and any other lipids described herein or reported in the art. In some embodiments, the composition comprises a lipid and a portion of another lipid that can mediate at least one function of another lipid. In various embodiments, the composition of the present disclosure contains any one or more of any lipids described herein or known in the art.

[0319] lncRNA: As used herein, the terms "long non-coding RNA" and "lncRNA" refer to non-protein-coding RNA transcripts longer than about 200 nucleotides. This numerical limitation distinguishes long ncRNAs from small regulatory RNAs, such as microRNAs (miRNAs), short interfering RNAs (siRNAs), Piwi-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs), and other short RNAs. In some embodiments, lncRNAs possess one or more characteristics of mRNAs, including 5' capping, splicing, and polyadenylation, but have little or no open reading frame (ORF). In some embodiments, the lncRNA is Air or Xist. In some embodiments, the lncRNA functions in regulating the expression of another gene. In some embodiments, the lncRNA is a lncRNA listed in any lncRNA database, including but not limited to: ChIPBase, C-It-Loci, LNCipedia, lncRNABase, lncRNAdb, lncRNome, MONOCLdb, NONCODE, and NRED. In some embodiments, the composition comprises a lipid and a portion of a lncRNA that can mediate at least one function of the lncRNA.

[0320] mRNA: As used herein, the terms "messenger RNA," "mRNA," and the like refer to any of a large family of RNA molecules that transfer genetic information from DNA to ribosomes, where the mRNA specifies the amino acid sequence of the protein product of gene expression. In various embodiments, following transcription of the primary transcript mRNA (known as pre-mRNA) by RNA polymerase, the processed mature mRNA is translated into an amino acid polymer: protein, as summarized in the central dogma of molecular biology. In some embodiments, the mRNA comprises modified mRNA or mmRNA. U.S. Patent No. 9,220,792. In some embodiments, the mRNA encodes any of the following: an allergen, a blood component, a gene therapy product, a human tissue or cell product used in transplantation, a vaccine, an antibody, a cytokine, a growth factor, an enzyme, a thrombolytic agent, or an immunomodulatory substance. In some embodiments, a composition comprises a lipid and a portion of the mRNA that can mediate at least one function of the mRNA.

[0321] Muscle: As used herein, the term "muscle" refers to a type of tissue present in animals (including, but not limited to, mammals, including humans). Muscle tissue is a type of fibrous tissue capable of contracting, moving, or maintaining the position of a body part. Muscle cells or muscle tissue include any skeletal muscle cells or tissue, cardiac muscle cells or tissue, smooth muscle cells or tissue, and / or myoepithelial cells or tissue. In some embodiments, muscle cells or muscle tissue include cardiac muscle cells or tissue. In some embodiments, muscle cells or muscle tissue include diaphragm muscle cells or tissue. In some embodiments, muscle cells or muscle tissue include skeletal muscle cells or tissue. In various embodiments, the muscle cells or muscle tissue are selected from: abductor digiti minimi (foot), abductor digiti minimi (hand), abductor pollicis, abductor pollicis brevis, abductor pollicis longus, adductor brevis, adductor hallucis, adductor longus, adductor magnus, adductor pollicis, anconeus, arytenoid, epiglottis, aryjordanicus, auricular, biceps brachii, biceps femoris, brachialis, brachioradialis, buccinator, bulbocavernosus, constrictor of the hypopharynx, constrictor of the oropharynx, constrictor of the superior pharynx, coracobrachialis, corrugator supercilii, cremaster, cricothyroid, dartos, deep transverse perineal perinei), deltoid, depressor anguli oris, depressor labii inferior, diaphragm, digastric, digastric (anterior view), erector spinae-spinalis, erector spinae-iliocostalis, erector spinae-longissimus, extensor carpi radialis brevis, extensor carpi radialis longus, extensor carpi ulnaris, extensor digitorum minimi (hand), extensor digitorum (hand), extensor digitorum brevis (foot), extensor digitorum longus (foot), extensor hallucis longus, extensor digitorum index, extensor pollicis brevis, extensor pollicis longus, external oblique abdominis), flexor carpi radialis, flexor carpi ulnaris, flexor digitorum minimi brevis (foot), flexor digitorum minimi brevis (hand), flexor digitorum brevis, flexor digitorum longus (foot), flexor digitorum profundus, flexor digitorum superficialis, flexor hallucis brevis, flexor hallucis longus, flexor pollicis brevis, flexor pollicis longus, frontalis, gastrocnemius, inferior gemellus, superior gemellus, genioglossus, geniohyoid, gluteus maximus, gluteus medius, gluteus minimus, gracilis, hyoglossus, iliacus, inferior oblique, inferior rectus, infraspinatus, external intercostal, innermost intercostal, internal intercostal, internal obliqueabdominis), dorsal interosseous muscles of the hand, dorsal interosseous muscles of the foot, palmar interosseous muscles of the hand, plantar interosseous muscles of the foot, interspinous muscles, intertransverse muscles, intrinsic muscles of the tongue, ischiocavernosus muscles, lateral cricoarytenoid muscles, lateral pterygoid muscles, lateral rectus muscles, latissimus dorsi, levator anus anus-coccygeus muscles, levator ani-iliococcygeus muscles, levator ani-pubococcygeus muscles, levator ani-puborectalis muscles, levator ani-pubic Vaginal muscles, levator labii superioris, levator labii superioris, levator ala naris superioris, levator palpebrae superioris, levator scapulae, levator veli palatini, levator costae superioris, longus capitis, longus colli, medius muscle of the foot (4), medius muscle of the hand, masseter, medial pterygoid muscle, medial rectus muscle, mentalis muscle, uvula muscle, mylohyoid muscle, nasal muscles, oblique arytenoid muscle, oblique capitis inferior, oblique capitis superior, obturator externus, obturator internus (A), obturator internus (B), omohyoid muscle, pair of fingers Erectus muscles (hand), opponens pollicis, orbicularis oculi, orbicularis oris, glossopalatine, palatopharyngeus, palmaris brevis, palmaris longus, pubococcus, pectoralis major, pectoralis minor, peroneus brevis, peroneus longus, peroneus third, piriformis (A), piriformis (B), plantaris, platysma, popliteus, posterior cricoarytenoid, pronator pronator, pronator teres, psoas major, psoas minor, pyramidalis, quadratus femoris, quadratus lumborum, quadratus plantaris Muscles: rectus abdominis, rectus capitis anterior, rectus capitis lateralis, rectus capitis posterior major, rectus capitis posterior minor, rectus femoris, rhomboid major, rhomboid minor, sartorius, scalene anterior, scalene middle, scalene smallest, scalene posterior, semimembranosus, semitendinosus, serratus anterior, serratus posterior inferior, serratus posterior superior, soleus, anal sphincter, urethral sphincter, splenius capitis, splenius cervix, stapedius, sternocleidomastoid, Sternohyoid, sternothyroid, styloglossus, stylohyoid, stylohyoid (anterior view), stylopharyngeus, subclavius, subcostal, subscapularis, transverse perineal muscle superficialis, superior oblique, superior rectus, supinator, supraspinatus, temporalis, temporoparietalis, tensor fasciae latae, tensor tympani, tensor veli palatini, teres major, teres minor, thyroarytenoid and vocalis muscles, thyroepiglottis, thyrohyoid, tibialis anterior, tibialis posterior, arytenoid transversely, spinospinalis transversus-multifidus, spinospinalis transversus-rotator, spinospinalis transversus-semispinalis, transverse abdominis, transverse thoracic, trapezius, vastus intermedius, vastus lateralis, vastus medialis, zygomaticus major, and zygomaticus minor. In some embodiments, the muscle cells or muscle tissue are smooth muscle cells or smooth muscle tissue. In various embodiments, the muscle cells or muscle tissue are selected from muscle cells or muscle tissue present in any of the following: the esophagus, stomach, intestine, bronchi, uterus, urethra, bladder, blood vessels, and the arrector pili muscles of the skin. In various embodiments, the muscle cells or muscle tissue include any structure or substructure that is part of a muscle, including but not limited to: epimysium, myocyte, sarcomere, tendon, bundle, myofiber, perimysium, collagen, collagen fiber, muscle spindle, sarcolemma, sarcoplasmic reticulum, thin filaments, thick filaments, Z-discs, H-bands, I-bands, A-bands, or M-rays. In some embodiments, the muscle cells or muscle tissue are healthy. In some embodiments, the muscle cells or muscle tissue are afflicted with a disease or disorder.

[0322] Muscle-Related Disorders, etc.: As used herein, the terms "muscle-related disorder," "muscle-related disease," and the like refer to diseases or disorders associated with muscle cells or tissue or the nervous system, including skeletal muscle cells or tissue, cardiac muscle cells or tissue, smooth muscle cells or tissue, or myoepithelial cells or tissue, or other muscle cells or tissue. In various embodiments, the present disclosure relates to methods involving compositions containing a lipid and a bioactive agent, wherein the composition is administered to a subject suffering from a muscle-related disorder. In various embodiments, the muscle-related disorder is muscle weakness, muscle movement disorders, muscle atrophy-related disorders, muscle degeneration, muscle weakness, muscular dystrophy, Duchenne muscular dystrophy, heart failure, respiratory disorders, skeletal muscle degeneration caused by malnutrition and disease, muscle-related diseases associated with impaired insulin-dependent signaling, amyotrophic lateral sclerosis, spinal muscular atrophy and spinal cord injury, or ischemic muscle disease. In some embodiments, muscle-related disorders include, for example, stiff shoulders, frozen shoulder (age-related stiff shoulders), rheumatoid arthritis, fasciitis, stiff neck muscles, shoulder-arm-hand syndrome, cervical sprain syndrome, sprains, tendonitis, lower back pain syndrome, skeletal muscle atrophy, etc. In some embodiments, muscle movement disorders include conditions associated with one or more of teeth grinding, periodic limb movement disorder, restless legs syndrome, muscular dystrophy, myositis, pinched nerve, peripheral nerve injury, amyotrophic lateral sclerosis, myasthenia gravis, and herniated discs, and sleep-related involuntary muscle movement disorder. In some embodiments, muscle wasting-related disorders are diseases or conditions whose symptoms include, for example, gradual loss of muscle mass.In some embodiments, muscle wasting is due to any of a variety of causes, including genetic predisposition; age-related diseases such as hypertension, impaired glucose tolerance, diabetes, obesity, dyslipidemia, atherosclerosis, and cardiovascular disease; chronic diseases such as cancer, autoimmune diseases, infectious diseases, AIDS, chronic inflammatory diseases, arthritis, malnutrition, kidney disease, chronic obstructive pulmonary disease, emphysema, rickets, chronic lower spinal pain, peripheral nerve injury, central nervous system injury, and chemical injury; prolonged immobilization, failure-like conditions such as fractures or trauma, and bed rest after surgery; and the progressive loss of skeletal muscle mass and strength that occurs with aging. Muscle wasting-related diseases can lead to a weakening of the body's physical condition, which can lead to a decline in health and an inability to perform physical activities. In some embodiments, sarcopenia is the gradual loss of skeletal muscle mass with aging, which can directly contribute to a decrease in muscle strength, resulting in a decline and impairment of various physical functions. In some embodiments, muscular dystrophy is a disorder in which strength and muscle mass are gradually lost.Non-limiting examples of muscular dystrophy diseases include Becker muscular dystrophy, tibial muscular dystrophy, Duchenne muscular dystrophy, Emery-Dreyfus muscular dystrophy, facioscapulohumeral muscular dystrophy, sarcoglycanopathy, congenital muscular dystrophies, such as congenital muscular dystrophy due to partial LAMA2 deficiency, merosin-deficient congenital muscular dystrophy, type 1D congenital muscular dystrophy, Fukuyama congenital muscular dystrophy, type 1A limb-girdle muscular dystrophy, type 2A limb-girdle muscular dystrophy, and type 2B limb-girdle muscular dystrophy. Include type B muscular dystrophy, limb-girdle type 2C muscular dystrophy, limb-girdle type 2D muscular dystrophy, limb-girdle type 2E muscular dystrophy, limb-girdle type 2F muscular dystrophy, limb-girdle type 2G muscular dystrophy, limb-girdle type 2H muscular dystrophy, limb-girdle type 21 muscular dystrophy, limb-girdle type 21 muscular dystrophy, limb-girdle type 2J muscular dystrophy, limb-girdle type 2K muscular dystrophy, limb-girdle type IC muscular dystrophy, ankylosing spinal muscular dystrophy with epidermolysis bullosa simplex, oculopharyngeal muscular dystrophy, Ullrich congenital muscular dystrophy and Ullrich scleroatonic muscular dystrophy.In some embodiments, object has Duchenne muscular dystrophy. In some embodiments, muscle degeneration is caused by injury, by a degenerative muscle disease or disorder, or by a disease, disorder, or injury to the nervous system that results in muscle denervation, including, but not limited to, degenerative or inflammatory muscle diseases such as muscular dystrophy, myotonic dystrophy, facioscapulohumeral dystrophy, limb-girdle dystrophy, distal muscular dystrophy, or myositis, or peripheral neuropathy associated with diabetic neuropathy, acute transient nerve conduction dysfunction, neurotmesis, or axotomy.Additionally, the methods described herein can be used to diagnose or monitor neurodegenerative diseases, particularly diseases associated with degeneration of motor neurons, such as amyotrophic lateral sclerosis, spinal muscular atrophy, post-polio syndrome, childhood muscular atrophy, poliovirus infection, or Charlotte-Marie-Tooth disease, or inflammatory or demyelinating neurological diseases or disorders, such as Guillain-Barré syndrome or chronic inflammatory demyelinating polyneuropathy. The methods of the present invention may also be used to diagnose or monitor degeneration caused by nerve injury, such as carpal tunnel syndrome, compression, mechanical nerve transection, or tumor-related nerve injury. Furthermore, the methods disclosed herein may be used to diagnose nervous system tumors or non-nervous system tumors.

[0323] ncRNA: As used herein, the term "ncRNA" refers to non-coding RNA, of which there are several types, including, but not limited to, lncRNA (long non-coding RNA). In some embodiments, ncRNAs participate in the regulation of gene, protein, or gene product expression. Wahlestedt 2013 Nat. Rev. Drug Disc. 12:433-446. Antagonists to ncRNAs have been reported. Meng et al. 2015 Nature 518:409-412; and Ling et al. 2013 Nature Rev. Drug Discov. 12:847-865. In some embodiments, the composition contains a bioactive agent and a lipid, wherein the bioactive agent is a nucleic acid or other antagonist to the ncRNA. In some embodiments, the composition includes a lipid and a portion of a lncRNA that can mediate at least one function of the lncRNA.

[0324] Optionally substituted: As described herein, for example, oligonucleotides of the present disclosure may contain optionally substituted and / or substituted moieties. In general, the term "substituted," whether preceded by the term "optionally" or not, means that one or more hydrogens of the specified moiety have been replaced with a suitable substituent. Unless otherwise indicated, an "optionally substituted" group may have a suitable substituent at each substitutable position of the group, and if more than one position in any given structure can be substituted with more than one substituent selected from a specified group, the substituents may be the same or different at every position. In some embodiments, an optionally substituted group is unsubstituted. Combinations of substituents envisioned by the present disclosure are preferably those that result in the formation of stable or chemically feasible compounds. As used herein, the term "stable" refers to a compound that is not substantially altered when subjected to conditions that allow for the production, detection, and, in some embodiments, recovery, purification, and use of the compounds for one or more purposes disclosed herein.

[0325] Preferred monovalent substituents are halogen; -(CH2) 0-4 R o ;-(CH2) 0-4 OR o ;-O(CH2) 0-4 R o ,-O-(CH2) 0-4 C(O)OR°;-(CH2) 0-4 CH(OR o )2; optionally substituted with R° -(CH2) 0-4 Ph; optionally substituted with R° -(CH2) 0-4 O(CH2) 0-1 Ph; optionally substituted with R° -CH=CHPh; optionally substituted with R° -(CH2) 0-4 O(CH2) 0-1 -pyridyl; -NO2; -CN; -N3; ​​-(CH2) 0-4 N(R o )2;-(CH2) 0-4 N(R o )C(O)R o ;-N(Ro )C(S)R o ;-(CH2) 0-4 N(R o )C(O)NR o 2;-N(R o )C(S)NR o 2;-(CH2) 0-4 N(R o )C(O)OR o ;-N(R o )N(R o )C(O)R o ;-N(R o )N(R o )C(O)NR o 2;-N(R o )N(R o )C(O)OR o ;-(CH2) 0-4 C(O)R o ;-C(S)R o ;-(CH2)& 0-4 C(O)OR o ;-(CH2) 0-4 C(O)SR o ;-(CH2) 0-4 C(O)OSiR o 3;-(CH2) 0-4 OC(O)R o ;-OC(O)(CH2) 0-4 SR,-SC(S)SR°;-(CH2) 0-4 SC(O)R o ;-(CH2) 0-4 C(O)NR o 2;-C(S)NR o 2;-C(S)SR°;-SC(S)SR°,-(CH2) 0-4 OC(O)NR o 2;-C(O)N(OR o )R o ;-C(O)C(O)R o ;-C(O)CH2C(O)R o ;-C(NOR o )R o ;-(CH2) 0-4 SSR o ;-(CH2) 0-4 S(O)2R o ;-(CH 2) 0-4S(O)2OR o ;-(CH2) 0-4 OS(O)2R o ;-S(O)2NR o 2;-(CH2) 0-4 S(O)R o ;-N(R o )S(O)NR o 2;-N(R o )S(O)2R o ;-N(OR o )R o ;-C(NH)NR o 2;-P(O)2R o ;-P(O)R o 2;-OP(O)R o 2;-OP(O)(OR o )2;-SiR o 3;-OSiR o 3;-(C 1-4 Linear or branched alkylene)ON(R o )2; or -(C 1-4 Straight or branched chain alkylene)C(O)ON(R o )2, (where each R o are optionally substituted as defined below and independently represent hydrogen, C 1-20 C having 1 to 5 heteroatoms independently selected from aliphatic, nitrogen, oxygen, sulfur, silicon, and phosphorus 1-20 , heteroaliphatic, -CH2-(C 6-14 aryl), -O(CH2) 0-1 (aryl), (C 6-14 aryl), -CH2- (5-14 membered heteroaryl ring), a 5-20 membered monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated, or aryl ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus, or two independently occurring aryl rings, regardless of the above definition. o together with their intervening atoms form a 5-20 membered, monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated, or aryl ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus, which may be optionally substituted as defined below.

[0326] Suitable R o The above monovalent substituents (or the ring formed by two independently occurring R° together with the intervening atoms) are independently selected from halogen, -(CH2) 0-2 R●, -(haloR●), -(CH2) 0-2 OH, -(CH2) 0-2 OR●, -(CH2) 0-2 CH(OR●)2; -O(haloR●), -CN, -N3, -(CH2) 0-2 C(O)R●, -(CH2) 0-2 C(O)OH, -(CH2) 0-2 C(O)OR●, -(CH2) 0-2 SR●, -(CH2) 0-2 SH, -(CH2) 0-2 NH2, -(CH2) 0-2 NHR●, -(CH2) 0-2 NR●2, -NO2, -SiR●3, -OSiR●3, -C(O)SR● 、 -(C 1-4 straight or branched chain alkylene)C(O)OR●, or -SSR●, where each R● is unsubstituted or, if preceded by "halo", substituted only with one or more halogens, and independently, C 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents on a saturated carbon atom of R° include ═O and ═S.

[0327] Preferred divalent substituents are ═O, ═S, ═NNR * 2, =NNHC(O)R * , =NNHC(O)OR * , =NNHS(O)2R * , =NR * , =NOR * , -O(C(R * 2)) 2-3 O- or -S(C(R * 2)) 2-3 S-, (wherein each R *is hydrogen, optionally substituted as defined below, C 1-6 aliphatic or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Preferred divalent substituents attached to adjacent substitutable carbon atoms of an "optionally substituted" group include -O(CR * 2) 2-3 O-, (wherein each R * is hydrogen, optionally substituted as defined below, C 1-6 aliphatic or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0328] R * Suitable substituents on an aliphatic group include halogen, —R●, —(haloR●), —OH, —OR●, —O(haloR●), —CN, —C(O)OH, —C(O)OR●, —NH2, —NHR●, —NR●2, or —NO2, where each R● is unsubstituted or, when preceded by “halo”, substituted only with one or more halogens, and independently, C 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph or a 5-6 membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen and sulfur.

[0329] In some embodiments, suitable substituents on a substitutable nitrogen include -R † , -NR † 2. -C(O)R † , -C(O)OR † , -C(O)C(O)R † , -C(O)CHC(O)R † , -S(O)2R † , -S(O)NR † 2. -C(S)NR † 2. -C(NH)NR † 2, or -N(R † )S(O)2R †wherein each R † are independently hydrogen, optionally substituted as defined below, C 1-6 an aliphatic, unsubstituted -OPh, or an unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or two independently occurring R † together with their intervening atoms form an unsubstituted 3-12 membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0330] R † Suitable substituents on an aliphatic group of are independently halogen, —R●, —(haloR●), —OH, —OR●, —O(haloR●), —CN, —C(O)OH, —C(O)OR●, —NH2, —NHR●, —NR●2, or —NO2, where each R● is unsubstituted or, when preceded by “halo”, substituted only with one or more halogens, and independently, C 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph or a 5-6 membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen and sulfur.

[0331] Oral: As used herein, the terms "oral administration" and "orally administered" have their art-understood meaning to refer to administration of a compound or composition by mouth.

[0332] Parenteral: As used herein, the terms "parenteral administration" and "parenterally administered" have their art-recognized meaning to refer to modes of administration other than enteral and topical administration, usually by injection, including, but not limited to, intravenous, intramuscular, intra-arterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratracheal, subcutaneous, subcuticular, intra-articular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

[0333] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a moiety that contains at least one double or triple bond. The term "partially unsaturated" is intended to include groups with multiple sites of unsaturation, but is not intended to include either aryl or heteroaryl moieties.

[0334] Peptide: As used herein, the term "peptide" refers to a molecule containing multiple amino acids linked together via peptide bonds. In some embodiments, peptides include dipeptides, tripeptides, oligopeptides, and polypeptides. In some embodiments, dipeptides contain two amino acids. Tripeptides contain three amino acids. And oligopeptides contain from about 2 to about 50 or more amino acids. In some embodiments, peptides contain more than about 50 amino acids. In some embodiments, polypeptides and proteins are also molecules containing multiple amino acids linked together via peptide bonds. In some embodiments, peptides include any therapeutic peptide listed in the SATPdb database of therapeutic peptides. Singh et al. 2015 Nucl. Acids Res. doi:10.1093 / nar / gkv1114. In some embodiments, a composition includes a lipid and a portion of a peptide capable of mediating at least one function of the peptide.

[0335] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dosage suitable for administration in a treatment regimen that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, the pharmaceutical composition may be specifically formulated for administration in solid or liquid form, including those adapted for oral administration, such as drenches (aqueous or non-aqueous solutions or suspensions), tablets, such as tablets targeted for buccal, sublingual, and systemic absorption, bolus administration, powders, granules, and pastes for application to the tongue; parenteral administration, such as sterile solutions or suspensions or sustained-release formulations, subcutaneous, intramuscular, intravenous, or epidural injection; topical administration, such as creams, ointments, or controlled-release patches or sprays applied to the skin, lungs, or oral cavity; vaginal or rectal administration, such as pessaries, creams, or foams; sublingual administration; intraocular administration; transdermal administration; or administration to nasal, pulmonary, and other mucosal surfaces.

[0336] Pharmaceutically Acceptable: Pharmaceutically Acceptable: As used herein, the phrase "pharmaceutically acceptable" refers to compounds, substances, compositions, and / or dosage forms that are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, within the scope of sound medical judgment, commensurate with a reasonable benefit / risk ratio.

[0337] Pharmaceutically acceptable carrier: As used herein, the term "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, that is involved in the transport or transportation of a compound of interest from one organ or part of the body to another. The body must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of materials that can be used as pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffer solutions; polyesters, polycarbonates, and / or polyanhydrides; and other non-toxic compatible substances used in pharmaceutical formulations.

[0338] Pharmaceutically acceptable salts: As used herein, the term "pharmaceutically acceptable salts" refers to salts of such compounds that are suitable for use in pharmaceutical contexts, i.e., salts that are suitable for use in contact with the tissues of humans and lower animals without undue harm, irritation, allergic response, and the like, within the scope of sound medical judgment and commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are known in the art. For example, S. M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66:1-19 (1977). In some embodiments, pharmaceutically acceptable salts include non-toxic acid addition salts, such as, but not limited to, salts of amino groups formed with inorganic acids such as, for example, hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or with organic acids such as, for example, acetic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or formed using other methods, such as those used with sugars, such as ion exchange. In some embodiments, pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptanoate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, and the like. Representative salts of alkali or alkaline earth metals include, but are not limited to, sodium, lithium, potassium, calcium, magnesium, and the like.In some embodiments, pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyls having 1 to 6 carbon atoms, sulfonates, and arylsulfonates, where appropriate.

[0339] Plasmid: As used herein, the term "plasmid" refers to an extrachromosomal (separate from a chromosome) length of DNA. Plasmids are generally circular and generally capable of independent replication, except for linear plasmids and plasmids incapable of independent replication (including, but not limited to, suicide vectors). In some embodiments, a plasmid is extrachromosomal under some conditions (e.g., in a laboratory) but can also be integrated into a chromosome (e.g., act as a suicide vector that can also be integrated into a chromosome in a cell or subject). Plasmids exist naturally in many organisms, including bacteria and some eukaryotic organisms, and are commonly engineered and artificially produced to carry genes within organisms. Plasmids are generally double-stranded, or may be single-stranded, or partially single-stranded and double-stranded, or may have other stranding properties. Artificial plasmids are commonly used in genetic engineering. Plasmids include those capable of encoding or expressing nucleic acids, including, but not limited to, mRNA, an RNAi agent or precursor thereof, an antagonist to another nucleic acid (including, but not limited to, an antagonist to miRNA, RNAi agent, mRNA, etc.) or precursor thereof, or other nucleic acids of therapeutic interest. Additional portions of the plasmid may optionally include one or more copies of any one or more components selected from the following: a gene encoding a protein associated with replication, an origin of replication, a gene encoding a replication initiator protein, a replication origin enhancer, a gene encoding a nucleic acid of therapeutic interest (or a precursor thereof), one or more promoters, one or more transcription enhancers, one or more transcription terminators, one or more marker genes (e.g., a gene encoding resistance to an antibiotic or a gene encoding an enzyme required for survival and / or growth under certain experimental conditions). In some embodiments, the plasmid is a suicide vector. A suicide vector may lack any of the following: an origin of replication, a gene encoding a DNA replication initiator protein, or any other component required for independent replication.In some embodiments, two plasmids may be physically separated but produce products that act in concert. For example, one plasmid may encode a transcription enhancer gene that enhances the transcription of a gene encoded on the other plasmid. In another example, one plasmid may contain a gene encoding a DNA replication initiator protein that initiates replication at a DNA replication origin on the other plasmid. Various plasmids are known in the art. In some embodiments, the composition includes a lipid and a portion of a plasmid that can mediate at least one function of the plasmid.

[0340] Protecting group: As used herein, the term "protecting group" is known in the art and is described in Protecting Groups in Organic Synthesis, T.W. Greene and P.G.M. Butts, 3 rdIncluded are protecting groups detailed in "Current Protocols in Nucleic Acid Chemistry," edited by Serge L. Beaucage et al., 1999, John Wiley & Sons, 1999, which is incorporated herein by reference in its entirety. Also included are protecting groups specifically adapted for nucleoside and nucleotide chemistry described in "Current Protocols in Nucleic Acid Chemistry," edited by Serge L. Beaucage et al., 06 / 2012, the entirety of Chapter 2 of which is incorporated herein by reference. Suitable amino protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluorenylmethyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2-Phenylethyl (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc), 1,1-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), 1-methyl-1-(4-biphenylyl)ethyl carbamate (Bpoc), 1-(3,5-di-t-butylphenyl)-1-methylethyl carbamate (t-Bumeoc), 2-(2'- and 4'-pyridyl)ethyl carbamate (Pyoc), 2-(N,N-Dicyclohexylcarboxamido)ethyl, t-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyldithiocarbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz), p-nitrocarbamate Tobenzyl, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfinylbenzyl carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl carbamate, 2-methylthioethyl carbamate, 2-methylsulfonylethyl carbamate, 2-(p-toluenesulfonyl)ethyl carbamate, [2-(1,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenyl carbamate (Mtpc), 2,4-dimethylthiobenzyl carbamate Phenyl (Bmpc), 2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl carbamate (Ppoc), 1,1-dimethyl-2-cyanoethyl carbamate, m-chloro-p-acyloxybenzyl carbamate, p-(dihydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobenzyl carbamate , 3,4-dimethoxy-6-nitrobenzyl carbamate, phenyl(o-nitrophenyl)methyl carbamate, phenothiazinyl-(10)-carbonyl derivatives, N'-p-toluenesulfonylaminocarbonyl derivatives, N'-phenylaminothiocarbonyl derivatives, t-amyl carbamate, S-benzyl thiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, p-decyloxybenzyl carbamate, 2,2-Dimethoxycarbonylvinyl, o-(N,N-dimethylcarboxamido)benzyl carbamate, 1,1-dimethyl-3-(N,N-dimethylcarboxamido)propyl carbamate, 1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isoborinyl carbamate, isobutyl carbamate, isonicotinyl carbamate, p-(p'-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl carbamate, 1-methylcyclohexyl carbamate, 1-methyl-1-cyclopropylmethyl carbamate, 1-methyl-1-(3,5-dimethoxyphenyl)ethyl carbamate, 1-methyl, 1-(4-pyridyl)ethyl-1-(p-phenylazophenyl)ethyl, 1-methyl-1-phenylethyl carbamate, 1-methyl-1-(4-pyridyl)ethyl carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate, 2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6-trimethylbenzyl carbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivatives, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N'-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxybenzoyl) 2-methyl-2-(o-nitrophenoxy)propanamide, 3-(o-nitrophenyl)propanamide, 2-methyl-2-(o-nitrophenoxy)propanamide, 2-methyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine derivatives, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl -3-Oxazolin-2-one, N-phthalimide, N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N-1,1,4,4-tetramethyldisilylazacyclopentane adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexan-2-one, 5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexan-2-one, 1-substituted 3,5-Dinitro-4-pyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyrrolin-3-yl)amine, quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosuberylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluoromethylamine N-phenylenylamine (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fcm), N-2-picolylamino N'-oxide, N-1,1-dimethylthiomethyleneamine, N-benzylideneamine, Np-methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, N,N'-isopropylidenediamine, Np-nitrobenzylideneamine, N-salicylideneamine, N-5-chloro Lorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivatives, N-diphenylboronic acid derivatives, N-[phenyl(pentacarbonylchromium- or tungsten)carbonyl]amine, N-copper chelates, N-zinc chelates, N-nitroamines, N-nitrosamines, amine N-oxides, diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt) , diphenylthiophosphinamide (Ppt), dialkyl phosphoramidate, dibenzyl phosphoramidate, diphenyl phosphoramidate, benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4-dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3-nitropyridine sulfenamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6,4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4',8'-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide.

[0341] Suitable protected carboxylic acids include, but are not limited to, silyl-, alkyl-, alkenyl-, aryl-, and arylalkyl-protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, and tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), and 2- and 4-picolyl.

[0342] Suitable hydroxyl protecting groups include methyl, methoxylmethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl ( MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl] -4-Methoxypiperidin-4-yl (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1-ethoxymethyl, 1-(2-chloroethoxy)methyl, 1-methyl-1-methoxymethyl, 1-methyl-1-benzyloxymethyl, 1-methyl-1-benzyloxy-2-fluoromethyl, 2,2,2-trimethyl- methyl, 2-trimethylsilylmethyl, 2-(phenylselenyl)methyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxide, diphenylmethyl, p,p'-Dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4'-bromophenacyloxyphenyl)diphenylmethyl, 4,4',4''-tris(4,5-dichlorophthalimidophenyl)methyl, 4,4',4''-tris(levulinoyloxyphenyl)methyl, 4,4',4''-tris(benzoyloxyphenyl)methyl )methyl, 3-(imidazol-1-yl)bis(4',4''-dimethoxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxide, trimethylsilyl (TMS), trimethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), dimethylisopropylsilyl isopropylsilyl (DEIPS), dimethylthexylsilyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoyl formate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxy oxyacetate, p-chlorophenoxyacetate, 3-phenyl propionate, 4-oxovalerate (levulinate), 4,4-(methylenedithio)valerate (levulinoyl dithioacetal), pivaloate, adamantoate, crotonate, 4-methoxycrotonate, benzoate, p-phenyl benzoate, 2,4,6-trimethyl benzoate (mesitoate), alkyl methyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkyl methyl carbonate, 2,2,2-Trichloromethyl alkyl carbonate (Troc), 2-(trimethylsilyl)methyl carbonate (TMSEC), 2-(phenylsulfonyl)methyl carbonate (Psec), 2-(triphenylphosphonio)methyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate, alkyl allyl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4-ethoxy-1-naphthyl carbonate, methyl dithiocarbonate, 2-iodobenzoic acid, 4-azidobutyrate, 4-nitro-4-methyl valerate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy)methyl ol, 4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinoate, (E)-2-methyl-2-butanoate, o-(methoxycarbonyl)benzoate, α-naphthoic acid, nitrate, alkyl N,N,N',N'-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), benzyl sulfonate, and tosylate (T, For the protection of 1,2- or 1,3-diols, examples of the protecting group include methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene acetal, and the like. orthoesters, 1-methoxyethylidene orthoesters, 1-ethoxyethylidine orthoesters, 1,2-dimethoxyethylidene orthoesters, α-methoxybenzylidene orthoesters, 1-(N,N-dimethylamino)ethylidene derivatives, α-(N,N'-dimethylamino)benzylidene derivatives, 2-oxacyclopentylidene orthoesters, di-t-butylsilylene group (DTBS), 1,3-(1,1,3,3-tetraisopropyldisiloxanylidene) derivatives (TIPDS), tetra-t-butoxydisiloxane-1,3-diylidene derivatives (TBDS), cyclic carbonates, cyclic boronate esters, ethyl borate, and phenyl borate.

[0343] In some embodiments, the hydroxyl protecting group is acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl(trityl), 4,4′-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl carbonate, mesylate, tosylate, triflate, trityl, monomethoxytrityl (MMTr), 4,4′-dimethoxytrityl, (D MTr) and 4,4',4''-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4''-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl (pixyl), or 9-(p-methoxyphenyl)xanthin-9-yl (MOX). In some embodiments, each of the hydroxyl protecting groups is independently selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, and 4,4'-dimethoxytrityl. In some embodiments, the hydroxyl protecting groups are selected from the group consisting of trityl, monomethoxytrityl, and 4,4'-dimethoxytrityl groups.

[0344] In some embodiments, the phosphite protecting group is a group that is added to the internucleotide phosphite bond throughout oligonucleotide synthesis. In some embodiments, the phosphite protecting group is added to the sulfur atom of the internucleotide phosphorothioate bond. In some embodiments, the phosphite protecting group is added to the oxygen atom of the internucleotide phosphorothioate bond. In some embodiments, the phosphite protecting group is added to the oxygen atom of the internucleotide phosphate bond. In some embodiments, the phosphite protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.

[0345] Protein: As used herein, the term "protein" refers to a polypeptide (i.e., a chain of at least two amino acids linked together by peptide bonds). In some embodiments, a protein contains only naturally occurring amino acids. In some embodiments, a protein contains one or more non-naturally occurring amino acids (e.g., a moiety that forms one or more peptide bonds with adjacent amino acids). In some embodiments, one or more residues in a protein chain contain a non-amino acid moiety (e.g., a glycan, etc.). In some embodiments, a protein contains two or more polypeptide chains linked, for example, by one or more disulfide bonds or associated by other means. In some embodiments, a protein contains l-amino acids, d-amino acids, or both. In some embodiments, a protein contains one or more amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, etc. The term "peptide" is generally used to refer to polypeptides having a length of less than about 100 amino acids, less than about 50 amino acids, less than about 20 amino acids, or less than about 10 amino acids. In some embodiments, the protein is an antibody, an antibody fragment, a biologically active portion thereof, and / or a characteristic portion thereof.

[0346] Ribozyme: As used herein, the term "ribozyme" refers to a catalytic RNA that functions as an enzyme but does not require a protein for catalysis. In some embodiments, ribozymes are self-processing RNAs that catalyze RNA cleavage and ligation reactions. In some embodiments, the substrate recognition domain of a ribozyme is engineered to stimulate site-specific cleavage in cis (the same nucleic acid strand) or trans (non-covalently linked nucleic acids). Scherer et al. 2003 Nat Biotechnol. 21:1457-1465. In some embodiments, ribozymes are subjected to in vitro selection and directed evolution to improve properties and develop new functions as therapeutic and diagnostic reagents. In some embodiments, ribozymes are engineered to be allosterically activated by effector molecules, leading to the development of artificial "riboswitches" as biosensors and synthetic biology tools. Wieland et al. 2010 Chem Biol. 17:236-242; Liang et al. 2011 Mol Cell. 43:915-926. In some embodiments, the ribozyme is derived from a "hammerhead" or "hairpin / paperclip" motif. In some embodiments, the ribozyme may be delivered to target cells in the form of RNA or transcribed from a therapeutic gene. In some embodiments, the ribozyme is chemically modified with any one or more of the following modifications: 5'-PS backbone linkage, 2'-O-Me, 2'-deoxy-2'-C-allyl uridine, and terminal inverted 3'-3' deoxyabasic nucleotides. A non-limiting example of a ribozyme is Angiozyme (RPI.4610), which targets vascular endothelial growth factor receptor-1 (VEGFR-1) mRNA and inhibits angiogenesis and tumor growth. Kobayashi et al.2005 Cancer Chemother Pharmacol.56:329-336; Weng et al.2005 Mol Cancer Ther.4:948-955.Another non-limiting example of a ribozyme is Heptazyme, a synthetic ribozyme against hepatitis C virus (HCV). Sandberg et al. 2001 Hepatology 34:333a-333a; Tong et al. 2002 Hepatology 36:360a-360a; Berk 2006 Hepatology 43:S13-S30. In some embodiments, the ribozyme also includes those targeting any of the following: VEGFR-1, HCV IRES, HIV U5 and pol, HIV Tat and Vpr, CCR5, HIV Tat and Rev. In some embodiments, the composition comprises a lipid and a portion of a ribozyme that can mediate at least one function of the ribozyme.

[0347] RNAi agent: As used herein, the term "RNAi agent" refers to a molecule that can mediate RNA interference. This term encompasses a variety of natural and artificial structures that can mediate RNA interference, as well as various structures and formats, including siRNA (including but not limited to "canonical" structures). As used herein, the term "RNA interference" or "RNAi" refers to the post-transcriptional targeted gene silencing technology, which uses RNAi agent to degrade messenger RNA (mRNA) that contains the same or very similar sequence as RNAi target. See Zamore and Haley, 2005, Science, 309, 1519-1524; Zamore et al., 2000, Cell, 101, 25-33; Elbashir et al., 2001, Nature, 41, 1,494-498; and Kreutzer et al., PCT International Patent Application Publication No. WO 00 / 44895; Fire, PCR International Patent Application Publication No. WO 99 / 32619; Mello and Fire, PCT International Patent Application Publication No. WO 01 / 29058, etc. The process of RNAi occurs naturally when long dsRNA is introduced into cells and cleaved into short fragments called siRNAs by ribonuclease III (Dicer). Naturally produced siRNAs are often about 21 nucleotides long and contain a duplex of about 19 base pairs with two 2-nt overhangs (the "canonical" structure). One strand of the siRNA is reported to be incorporated into the RNA-induced silencing complex (RISC). This strand (known as the antisense or guide strand) guides the RISC to the complementary mRNA. One or more nucleases in the RISC then mediate cleavage of the target mRNA, resulting in silencing. Cleavage of the target RNA is reported to occur in the middle of the region complementary to the antisense strand.See Nykanen, et al. 2001 Cell 107:309; Sharp et al. 2001 Genes Dev. 15:485; Bernstein, et al. 2001 Nature 409:363; Elbashir, et al. 2001 Genes Dev. 15:188. Various non-limiting examples of RNAi agents include: siRNA (including but not limited to those with canonical structures), shR. RNAi agents include NA, miRNA, sisiRNA, meroduplex RNA (mdRNA), DNA-RNA chimera, siRNA containing two mismatches (or more mismatches), neutral siRNA, aiRNA, or siRNA containing terminal spacers or internal spacers (for example, 18-mer siRNA). In various non-limiting examples, RNAi agents are reported to be shRNAs (short hairpin RNAs or short hairpin RNAs), which form tight hairpin turns and contain RNA sequences that silence targets through RISC like siRNA. Therefore, antisense and sense strands connected by hairpins have been reported. It has been reported that shRNAs can be expressed, for example, via plasmid delivery or via viral or bacterial vectors. Various types of shRNAs have been reported in the field. See, for example, Xiang et al. 2006. Nature Biotech. 24:697-702; Macrae et al. 2006 Science 31 1:195-8; Lombardo et al. 2007. Nature Biotech. 25:1298-1306; Wang et al. 2011. Pharm. Res. 28:2983-2995; Senzer et al. 2011 Mol. Ther. 20:679-686. In various non-limiting examples, RNAi agents have been reported to be miRNAs (microRNAs), which are small RNA molecules (approximately 22nt) that also silence targets via RISC, similar to siRNAs. Natural miRNAs are encoded by the nuclear DNA of eukaryotic cells. miRNAs are produced by post-transcriptional RNA processing and function through base pairing with complementary sequences in mRNA molecules, usually resulting in translational repression, target degradation, or gene silencing. It has been reported that the human genome can encode over 1000 miRNAs, which can target approximately 60% of mammalian genes and are abundant in many human cell types. Various types of naturally occurring miRNAs and artificial derivatives of miRNAs have been reported in the field.See for example: Lewis et al.2003.Cell 1 15:787-798;Lim et al.2003.Genes Dev.17:991-1008;He et al.2004.Nat.Rev.Genet.5:522-31;Bentwich et al.2005.Nat.Genet.37:766-70;Lewis et al.2005.Cell 120:15-20;Kusenda et al.2006.Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub 150:205-15;Zhang et al.2006.J.Gen.Gen.36:1-6;Brodersen et al.2008.Science 320:1 185-90;Friedman et al.2009.Genome Res. 19(1):92-105; Bartel 2009. Cell 136(2):215-33. In various non-limiting examples, the RNAi agent is a sisiRNA (small internally segmented interfering RNA), in which the sense strand contains at least one nick in single stranding. This nick reduces incorporation of the sense strand into the RISC complex, thereby reducing off-target effects. See WO2007 / 107162. In various non-limiting examples, the RNAi agent is a DNA-RNA chimera, in which the seed portion of each strand is DNA, while the remainder of each strand is RNA. See Yamato et al. 2011 Cancer Gene Ther. 18:587-597. In various non-limiting examples, the RNAi agent is a siRNA containing two mismatches, in which the molecule is reported to contain three short double-stranded regions. In one embodiment of this RNAi agent, the guide (antisense) strand is a 22-mer, while the sense strand is a 20-mer (only one 2-nt overhang is generated on the 3' end of the antisense strand). Two mismatches have been reported to generate double-stranded regions of 6, 8, and 4 bp.See U.S. Patent Application No. 2009 / 0209626. In various embodiments, the RNAi agent is a neutral siRNA, the negative charge of whose phosphate backbone is reversibly hidden. Meade et al. 2014 Nat. Biotech. 32:1256-1261. In various non-limiting examples, the RNAi agent is an aiRNA (asymmetrical interfering RNA) containing a sense strand shorter than 19 nt in length, which has been reported to preferentially incorporate the antisense strand into RISC and reduce off-target effects. In various embodiments of this RNAi agent, the antisense strand is 21 nt in length, while the sense strand is only 15 or 16 nt in length. See Sun et al. 2008 Nature Biotech. 26:1379-1382; and Chu and Rana. 2008 RNA 14:1714-1719. In various non-limiting examples, RNAi agents are siRNAs containing terminal or internal spacers (e.g., 18-mer siRNAs) and are reported to contain shorter strands than canonical siRNAs, in which the strands contain internal or terminal spacers, such as ribitol or other types of non-nucleotide spacers. See WO2015 / 051366. In some embodiments, RNAi agents include those targeting any of the following: miR-122, VEGF, VEGF-R1, RTP801, caspase 2, KRT6A(N171K), ADRB2, TRPV1, Syk kinase, RSV nucleocapsid, beta-catenin, KRASG12D, Apo B, PLK1, KSP and VEGF, TTR, Bcr-Abl, PKN3, p53, RRM2, Furin and GM-CSF, LMP2, LMP7, MECL1, HIV Tat and Rev. In some embodiments, the composition comprises a lipid and a portion of an RNAi agent that can mediate at least one function of the RNAi agent.

[0348] Sample: As used herein, a "sample" refers to a particular organism or a substance obtained therefrom. In some embodiments, the sample is a biological sample obtained or derived from a source of interest, as described herein. In some embodiments, the source of interest contains an organism, such as an animal or a human. In some embodiments, the biological sample contains biological tissue or bodily fluid. In some embodiments, the biological sample is or comprises bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy sample; cell-containing bodily fluid; suspended nucleic acid; sputum; saliva; urine; cerebrospinal fluid, ascites; pleural effusion; feces; lymphatic fluid; gynecological fluid; skin swab; vaginal swab; oral swab; nasal swab; washings or lavage fluids, such as ductal lavage or bronchoalveolar lavage; aspirates; scrapings; bone marrow specimens; tissue biopsy specimens; surgical specimens; feces, other bodily fluids, secretions, and / or excretions; and / or cells derived therefrom. In some embodiments, the biological sample is or contains cells obtained from an individual. In some embodiments, a sample is a "primary sample" obtained directly from a source of interest by any appropriate means. For example, in some embodiments, a primary biological sample is obtained by a method selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of bodily fluids (e.g., blood, lymph, stool, etc.), and the like. In some embodiments, as is clear from the context, the term "sample" refers to a preparation obtained by processing a primary sample (e.g., by removing one or more components thereof and / or adding one or more agents thereto), such as by filtration using a semipermeable membrane. Such a "processed sample" may contain, for example, nucleic acids or proteins extracted from the sample, or nucleic acids or proteins obtained by subjecting the primary sample to techniques such as mRNA amplification or reverse transcription, isolation and / or purification of certain components, etc. In some embodiments, the sample is an organism. In some embodiments, the sample is a plant. In some embodiments, the sample is an animal. In some embodiments, the sample is a human. In some embodiments, the sample is a non-human organism.

[0349] Small molecule: As used herein, terms such as "small molecule" or "low molecular weight molecule" or "LMW molecule" refer to molecules with relatively low molecular weight. Non-limiting examples of small molecules include molecules with molecular weights of less than about 7500, 7000, 6000, 5000, 4000, 3000, 2500, 2000, 1500, 1000, 900, 800, 700, 600, 500, 400, 300, 200, or 100. In some embodiments, small molecules are bioactive agents that inhibit or reduce the level, product, and / or activity of a target gene or target gene product. Examples of small molecules include, but are not limited to, small organic molecules (e.g., Cane et al. 1998. Science 282:63) and natural product extract libraries. In another embodiment, small molecules are small organic non-peptide compounds. In some embodiments, the small molecule inhibitor directly or indirectly inhibits or reduces the target gene or product level, product, and / or activity of the target gene. In some embodiments, the composition comprises a lipid and a portion of a small molecule that can mediate at least one function of the small molecule.

[0350] Small nucleolar RNA (snoRNA): As used herein, the terms "small nucleolar RNA," "snoRNA," and the like refer to any of a class of small RNA molecules that induce, for example, chemical modifications of other RNAs. In some embodiments, snoRNAs can induce chemical modifications of other RNAs, including ribosomal RNA, transfer RNA, and small nuclear RNAs. In some embodiments, two major classes of snoRNAs have been reported: C / D box snoRNAs are involved in methylation, and H / ACA box snoRNAs are involved in pseudouridylation.

[0351] Splice Switch Oligonucleotide (SSO): As used herein, the term "splice switch oligonucleotide" or "SSO" refers to an oligonucleotide that can alter the splicing of pre-mRNA. In a non-limiting example, an SSO can bind to a 5' or 3' splice junction, or to a splicing enhancer or silencing site. In doing so, the SSO can alter splicing in various ways, such as by altering exon usage, exon exclusion, or exon inclusion. In various embodiments, the SSO can cause exon skipping, and in other examples, can inhibit exon skipping. Crooke 2004 Curr. Mol. Med. 4:465-487; Bennett et al. 2010 Ann. Rev. Pharmacol. Toxicol. 50:259-293; and Kole et al. 2012 Nat. Rev. Drug Discov. 11:125-140. S A non-limiting example of an SO is an oligonucleotide that has been reported to mediate exon skipping in dystrophin pre-mRNA. A non-limiting example of an SSO is WV-942. A non-limiting example of an SSO is an oligonucleotide that can inhibit exon skipping in SMN2 pre-mRNA. See Rigo et al. 2012 J. Cell Biol. 199:21-25; and Kaczmarek et al. 2015 Exp. Opin. Exp. Drugs 24:867-881. In some embodiments, the composition comprises a lipid and a portion of an snoRNA that can mediate at least one function of the snoRNA. In some embodiments, the SSO switches splicing in a gene associated with a muscle-related disorder. In some embodiments, the SSO can skip an exon or mediate exon skipping, where a mutation in the exon is associated with a muscle-related disorder. In some embodiments, the SSO can inhibit exon skipping or mediate the inhibition of exon skipping, where a mutation in the exon is associated with a muscle-related disorder. In some embodiments, the SSO can effect or mediate exon skipping in the dystrophin gene. In some embodiments, the SSO can effect or mediate the skipping of exons 51, 45, 53, or 44 in the dystrophin gene. In some embodiments, the SSO can inhibit exon skipping or mediate the inhibition of exon skipping in a gene associated with SMA. In some embodiments, the SSO can inhibit exon skipping or mediate the inhibition of exon skipping in the SMN2 gene. In some embodiments, the SSO can inhibit exon 7 skipping or mediate the inhibition of exon 7 skipping in the SMN2 gene.

[0352] Stereochemical isomers: As used herein, the terms "stereochemical isomer" and "stereoisomer" refer to different compounds composed of the same atoms joined by the same sequence of bonds, but having different, non-interchangeable three-dimensional structures. In some embodiments of the present invention, the provided chemical compositions may be or comprise pure preparations of individual stereochemical isomers of the compound. In some embodiments, the provided chemical compositions may be or comprise mixtures of two or more stereochemical isomers of the compound. In some embodiments, such mixtures contain equal amounts of different stereochemical isomers. In some embodiments, such mixtures contain unequal amounts of at least two different stereochemical isomers. In some embodiments, the chemical composition may contain all diastereomers and / or enantiomers of the compound. In some embodiments, the chemical composition may contain less than all diastereomers and / or enantiomers of the compound. In some embodiments, if a specific enantiomer of a compound of the present invention is desired, the resulting diastereomeric mixture can be separated and the auxiliary cleaved to provide the desired enantiomer in pure form, e.g., by asymmetric synthesis or by derivatization with a chiral auxiliary. Alternatively, if the molecule contains a basic functionality, e.g., amino, diastereomeric salts are formed with appropriate optically active acids and resolved, e.g., by fractional crystallization. In some embodiments, the stereoirregular compositions contain two or more stereoisomers.

[0353] Subject and Related Terms: As used herein, the terms "subject," "human subject," "test subject," and related terms refer to any organism to which a provided compound or composition is administered in accordance with the present invention, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; others, etc.) and plants. In some embodiments, the subject may be suffering from and / or susceptible to a disease, disorder, and / or condition. In some embodiments, the subject is a human or other mammal. In some embodiments, the subject may be male or female. In non-limiting examples, the animal is a vertebrate, such as a primate, rodent, livestock, or game animal. In non-limiting examples, primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaque monkeys, e.g., rhesus monkeys. Rodents include mice, rats, woodchucks, ferrets, rabbits, and hamsters. In non-limiting examples, livestock and game animals include cattle, horses, pigs, deer, bison, buffalo, felines, such as domestic cats, canines, such as dogs, foxes, wolves, birds, such as chickens, emus, ostriches, and fish, such as trout, catfish, and salmon. In certain embodiments of the aspects described herein, the subject is a mammal, such as a primate, such as a human. In non-limiting examples, the mammal may be a human, a non-human primate, a mouse, a rat, a dog, a cat, a horse, or a cow, but is not limited to these examples. In some embodiments, non-human mammals may be beneficially used as subjects that represent animal models of autoimmune diseases or inflammation-related disorders. In some embodiments, the methods and compositions described herein may be used to treat livestock and / or pets.

[0354] Substantial: As used herein, the term "substantial" refers to the qualitative state of exhibiting all or nearly all extent or degree of a characteristic or property of interest. Those skilled in the art of biology will understand that biological and chemical phenomena rarely go to completion and / or proceed to completion, or achieve or avoid absolute consequences. Thus, the term "substantial" is used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena.

[0355] Suffering from: An individual "suffering from" a disease, disorder, and / or condition has been diagnosed with and / or exhibits one or more symptoms of the disease, disorder, and / or condition.

[0356] Susceptible: An individual who is "susceptible" to a disease, disorder, and / or condition is an individual who is at a higher risk than individuals in the general population of developing the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not have been diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition.

[0357] Systemic: As used herein, the terms "systemic administration," "systemically administered," "peripheral administration," and "peripherally administered" have their art-recognized meaning of referring to administering a compound or composition so that it enters the recipient's entire body.

[0358] Targeting compound or moiety or component: As used herein, terms such as "targeting moiety," "targeting compound or moiety," "targeting compound," "targeting component," and the like, refer to a structure that can target a compound or composition to a particular cell or tissue, or a subset of cells or tissues. In some embodiments, the targeting moiety is designed to take advantage of cell- or tissue-specific expression of a particular target, receptor, protein, or other intracellular component. In some embodiments, the targeting moiety is a ligand (e.g., a small molecule, antibody, peptide, protein, carbohydrate, aptamer, etc.) that targets the compound or composition to a cell or tissue and / or binds to the target, receptor, protein, or other intracellular component. In some embodiments, the targeting moiety targets a composition containing a lipid and a bioactive agent to muscle cells or muscle tissue. In some embodiments, the targeting moiety contains a compound that targets muscle cells or muscle tissue. In some embodiments, the targeting moiety contains fetuin, epidermal growth factor, fibroblast growth factor, insulin, and / or dexam...

Claims

1. 1. A chiral controlled oligonucleotide composition comprising a plurality of oligonucleotides, the plurality of oligonucleotides comprising: 1) consensus base sequence, 2) common patterns of skeletal bonds, and 3) share a common pattern of backbone phosphorus modifications; The consensus base sequence has a base sequence represented by UCAAGGAAGAUGGCAUUUCU, each of the plurality of oligonucleotides having a first block of 2'-F modified sugars at its 5'-terminus, the first block comprising five or more consecutive 2'-Fs, and a second block of 2'-F modified sugars at its 3'-terminus, the second block comprising five or more consecutive 2'-Fs; 50% or more of the sugar moieties in each of said plurality of oligonucleotides are 2'-F modified sugars; each of the plurality of oligonucleotides comprises at its 5'-end five or more consecutive phosphorothioate bonds of Sp configuration and at its 3'-end five or more consecutive phosphorothioate bonds of Sp configuration, and between these phosphorothioate bonds, one or more phosphodiester internucleotide bonds and / or phosphorothioate bonds of Rp configuration; One or more of the oligonucleotides of the plurality of oligonucleotides are individually conjugated to a lipid, the lipid comprising an optionally substituted C 10 -C 60 A composition comprising a linear, saturated or partially unsaturated aliphatic chain of

2. 10. The composition of claim 1, A composition wherein said plurality of oligonucleotides share the same stereochemistry at each chiral internucleotide linkage.

3. 3. The composition of claim 1 or 2, wherein the modified internucleotide linkages are independently phosphorothioate internucleotide linkages.

4. 4. The composition of claim 3, wherein at least 80% of the phosphorothioate internucleotide linkages in each of the plurality of oligonucleotides are in the Sp configuration.

5. 4. The composition of claim 3, wherein at least 90% of the phosphorothioate internucleotide linkages in each of the plurality of oligonucleotides are in the Sp configuration.

6. The composition according to any one of claims 1 to 5, A composition wherein said plurality of oligonucleotides have one or more natural phosphate linkages.

7. The composition according to any one of claims 1 to 6, The plurality of oligonucleotides may comprise one or more 2'-OR 1 and R 1 is optionally substituted C 1 -C 6 The composition is an aliphatic group.

8. 8. The composition of claim 7, A composition wherein each of said plurality of oligonucleotides has one or more 2'-OMe modified sugar moieties.

9. The composition according to any one of claims 1 to 8, The composition, wherein said plurality of oligonucleotides are identical.

10. A composition according to any one of claims 1 to 9, A pharmaceutical composition comprising at least one pharmaceutically acceptable inactive ingredient selected from a pharmaceutically acceptable diluent, a pharmaceutically acceptable excipient, and a pharmaceutically acceptable carrier.

11. 11. The pharmaceutical composition of claim 10, The pharmaceutical composition, wherein the multiple oligonucleotides may independently be in the form of a pharmaceutically acceptable salt.

12. A composition according to any one of claims 1 to 9, or a pharmaceutical composition according to any one of claims 10 and 11, for delivery to muscle cells or muscle tissue of a human subject.

13. A composition according to any one of claims 1 to 9 or a pharmaceutical composition according to any one of claims 10 and 11, which is used for regulating the level of a gene transcription product or gene product in a cell.

14. A compound used to treat muscular dystrophy, A composition according to any one of claims 1 to 9 or a pharmaceutical composition according to any one of claims 10 and 11.

Citation Information

Patent Citations

  • Lipid covalently conjugated oligonucleotide

    JP1992503957A

  • Modified oligonucleotides for telomerase inhibition

    JP2007504830A

  • Method and means for efficient skipping of exon 45 of Duchenne muscular dystrophy mRNA precursor

    JP2012506697A

  • Chiral design

    WO2015107425A2