Nucleic acid extraction container and nucleic acid extraction method

The nucleic acid extraction container facilitates rapid, cost-effective nucleic acid extraction by using a filter unit with a hydrophilic filter and air pressure to recover nucleic acids, addressing the inefficiencies and cost issues of traditional methods.

JP7828586B2Active Publication Date: 2026-03-12GOFOTON INC +1
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-08-05
Publication Date
2026-03-12

AI Technical Summary

Technical Problem

Existing nucleic acid extraction methods are time-consuming, require skilled labor, and involve significant variation in measurement results due to the complexity and cost of equipment and reagents, limiting their efficiency and reliability.

Method used

A nucleic acid extraction container with a filter unit containing a hydrophilic filter for capturing nucleic acids, a sample injection port, an air communication port, and a sample outlet, allowing for simple, rapid extraction by passing a sample through the filter, injecting a nucleic acid extract, and recovering the solution containing nucleic acids using air pressure.

Benefits of technology

Enables efficient, low-cost nucleic acid extraction in a short time with reduced variability, simplifying the process and reducing the need for specialized equipment and reagents.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007828586000006
    Figure 0007828586000006
  • Figure 0007828586000007
    Figure 0007828586000007
  • Figure 0007828586000008
    Figure 0007828586000008
Patent Text Reader

Abstract

A nucleic acid extraction container 160 that is provided with a filter part 166, wherein the filter part 166 comprises a hydrophilic filter 168 for collecting biological materials including a nucleic acid from a sample, a biological material collection area 166a for collecting the biological materials on the filter 168, and a sample permeation area 166b for allowing the passage of the sample having permeated through the filter. A sample injection port 174 is communicated with the biological material collection area 166a. An air communication port 178 is communicated with the biological material collection area 166a. A sample discharge port 176 is communicated with the sample permeation area 166b. The air communication port 178 is configured so as to be outwardly openable and closable.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a nucleic acid extraction container and a nucleic acid extraction method. [Background technology]

[0002] Genetic testing is widely used in various medical fields, for identifying agricultural crops and pathogenic microorganisms, for evaluating food safety, and for testing for pathogenic viruses and various infectious diseases. To detect minute amounts of nucleic acid, which is a gene, with high sensitivity, a method is known in which a portion of the nucleic acid is amplified and analyzed. Among these, the polymerase chain reaction (PCR) is a notable technology that selectively amplifies a portion of very small amounts of nucleic acid collected from living organisms. To perform PCR, nucleic acid must be extracted from the biological sample.

[0003] One example of such genetic testing is a technique that uses PCR to analyze the presence or absence of DNA derived from a specific organism (called environmental DNA) in order to determine whether a specific organism can inhabit an environment such as water, soil, or air (see, for example, Non-Patent Documents 1 to 3). For this analysis, the Environmental DNA Society has created an "Environmental DNA Survey Experiment Manual" and recommends that qualitative and quantitative measurements be performed using this method (hereinafter referred to as the Society's standard method) as a standard method (see Non-Patent Document 4). In the Society's standard method, water from a river or sea is drawn up in a beaker or the like, filtered, and then DNA is extracted. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Hideyuki Doi et.al, Freshwater Biology (2017) 62, 30-39 [Non-patent document 2] PLOS ONE | DOI:10.1371 / journal.pone.0149786 March 2, 2016 [Non-patent document 3] PLOS ONE | DOI:10.1371 / journal.pone.0142008 November 4, 2015 [Non-patent document 4] "Environmental DNA Survey Experiment Manual (ver2.1)", Environmental DNA Society, Internet<URL: http: / / ednasociety.org / eDNA_manual_ver2_1_3.pdf> Summary of the Invention [Problem to be solved by the invention]

[0005] The academic standard method is considered to be a method that can obtain relatively reliable measurement results and is highly efficient (the rate at which DNA is extracted from the environment to a state where it can be amplified by PCR, etc.). However, this method has problems such as the many steps required to extract DNA from the sample, which is time-consuming, requires skill for extraction, and there is a large amount of variation in measurement results depending on the operator, and the parts, equipment, and reagents required for extraction are numerous and expensive. These problems are not limited to environmental DNA, but can also be seen in the extraction of nucleic acids for the identification of microorganisms and viruses.

[0006] The present invention has been made in view of the above circumstances, and one of its objects is to provide a technique that enables nucleic acid to be extracted from a sample simply, in a short time, and at low cost. [Means for solving the problem]

[0007] One aspect of the present invention is a container for nucleic acid extraction, which comprises a filter unit including a hydrophilic filter for capturing biological substances containing nucleic acids from a sample, a biological substance capturing region on the filter for capturing the biological substances, and a sample permeation region through which the sample that has permeated the filter passes; a sample injection port communicating with the biological material collection region; an air communication port communicating with the biological material capture region; a sample outlet communicating with the sample transmission region; Equipped with The air communication port is configured so as to be openable and closable to the outside.

[0008] Another aspect of the present invention is a method for extracting nucleic acids, the method comprising the steps of: a step of passing a sample through a filter section equipped with a hydrophilic filter and collecting biological substances containing nucleic acids on the filter; a step of placing a nucleic acid extract in the filter section and extracting nucleic acids on the filter; recovering the solution containing the extracted nucleic acids on the filter from the filter portion; Includes.

[0009] Yet another aspect of the present invention is a method for extracting nucleic acids. a step of passing a sample through a filter section equipped with a hydrophilic filter and collecting biological substances containing nucleic acids on the filter; a step of placing a nucleic acid extract in the filter section and extracting nucleic acids on the filter; a step of transferring the solution containing the extracted nucleic acid on the filter into a flow path communicating with the filter part; dispensing a solution containing nucleic acid by injecting air into the channel; Includes. [Effects of the Invention]

[0010] According to the present invention, nucleic acid can be extracted from a sample simply, in a short time, and at low cost. [Brief explanation of the drawings]

[0011] [Figure 1] 1(a) and 1(b) are diagrams illustrating a nucleic acid extraction container according to a first embodiment of the present invention. [Figure 2] FIG. 2 is a cross-sectional view of the nucleic acid extraction container taken along the line AA in FIG. [Figure 3] FIG. 2 is a cross-sectional view of the nucleic acid extraction container shown in FIG. 1(a) taken along the line BB. [Figure 4] FIG. 2 is a plan view of a substrate provided in the nucleic acid extraction container shown in FIG. 1(a). [Figure 5] FIG. 10 is a diagram illustrating a first modified example of a nucleic acid extraction container. [Figure 6] FIG. 10 is a diagram illustrating a second modified example of the nucleic acid extraction container. [Figure 7] FIG. 10 is a diagram for explaining the flow of a sample passing through a filter portion. [Figure 8] FIG. 1 is a diagram for explaining nucleic acid extraction on a filter using a nucleic acid extract. [Figure 9] 9(a) and 9(b) are diagrams for explaining a nucleic acid extraction container according to a second embodiment of the present invention. [Figure 10] FIG. 9(b) is a cross-sectional view of the nucleic acid extraction container taken along the line AA in FIG. 9(a). [Figure 11] FIG. 9(b) is a cross-sectional view of the nucleic acid extraction container shown in FIG. 9(a) taken along the line BB. [Figure 12] 9(b) is a cross-sectional view of the nucleic acid extraction container taken along the line CC shown in FIG. 9(a). [Figure 13] FIG. 10 is a DD cross-sectional view of the nucleic acid extraction container shown in FIG. 9(a). [Figure 14] FIG. 10 is a plan view of a substrate provided in the nucleic acid extraction container shown in FIG. 9(a). [Figure 15] 15(a) and 15(b) are diagrams for explaining a nucleic acid extraction container according to a third embodiment of the present invention. [Figure 16] FIG. 15(b) is a cross-sectional view of the nucleic acid extraction container taken along the line AA in FIG. 15(a). [Figure 17] 15(a) is a cross-sectional view taken along the line E-E of the nucleic acid extraction container shown in FIG. [Figure 18] FIG. 15(b) is a plan view of a substrate provided in the nucleic acid extraction container shown in FIG. 15(a). [Figure 19] FIG. 10 is a diagram schematically illustrating a state in which a solution containing nucleic acid is present in a region C of the third flow channel. [Figure 20] 20(a) and 20(b) are diagrams for explaining a nucleic acid extraction container according to a fourth embodiment of the present invention. [Figure 21] FIG. 21 is a cross-sectional view of the nucleic acid extraction container taken along line AA in FIG. 20(a). [Figure 22]FIG. 21 is a BB cross-sectional view of the nucleic acid extraction container shown in FIG. 20(a). [Figure 23] 20(a) is a cross-sectional view taken along CC of the nucleic acid extraction container shown in FIG. 20(a). [Figure 24] FIG. 21 is a DD cross-sectional view of the nucleic acid extraction container shown in FIG. 20(a). [Figure 25] FIG. 21 is a plan view of a substrate provided in the nucleic acid extraction container shown in FIG. 20(a). [Figure 26] 26(a) and 26(b) are diagrams for explaining a nucleic acid extraction container according to a fifth embodiment of the present invention. [Figure 27] FIG. 26(b) is a cross-sectional view of the nucleic acid extraction container taken along line AA in FIG. 26(a). [Figure 28] FIG. 26(b) is a cross-sectional view of the nucleic acid extraction container shown in FIG. 26(a) taken along the line BB. [Figure 29] 26(a) is a cross-sectional view of the nucleic acid extraction container taken along the line CC. FIG. [Figure 30] FIG. 26(b) is a DD cross-sectional view of the nucleic acid extraction container shown in FIG. 26(a). [Figure 31] 26(a) is a cross-sectional view taken along the line E-E of the nucleic acid extraction container shown in FIG. 26(a). [Figure 32] FIG. 27 is an FF cross-sectional view of the nucleic acid extraction container shown in FIG. 26(a). [Figure 33] FIG. 26(b) is a plan view of a substrate provided in the nucleic acid extraction container shown in FIG. 26(a). [Figure 34] 34(a) and 34(b) are diagrams for explaining a presser plate provided in a nucleic acid extraction container according to the fifth embodiment of the present invention. [Figure 35] FIG. 35 is a cross-sectional view of the pressing plate shown in FIG. 34(a) taken along line JJ. [Figure 36] FIG. 35 is a cross-sectional view of the pressing plate shown in FIG. 34(a) taken along line HH. [Figure 37] 34(a) is a view of the GG cross section and the II cross section of the pressing plate shown in FIG. [Figure 38] 10 is a graph showing the relationship between the amount of extract and the DNA concentration when the volume of the biological substance capture region is 20 μL. DETAILED DESCRIPTION OF THE INVENTION

[0012] The present invention will be described below with reference to the accompanying drawings and preferred embodiments. The embodiments are illustrative and do not limit the invention, and all features and combinations thereof described in the embodiments are not necessarily essential to the invention.

[0013] [First embodiment] Figures 1(a) and 1(b) are diagrams illustrating a nucleic acid extraction container 10 according to a first embodiment of the present invention. Figure 1(a) is a plan view of the nucleic acid extraction container 10, and Figure 1(b) is a front view of the nucleic acid extraction container 10. Figure 2 is an AA cross-sectional view of the nucleic acid extraction container shown in Figure 1(a). Figure 3 is a BB cross-sectional view of the nucleic acid extraction container shown in Figure 1(a). Figure 4 is a plan view of a substrate provided in the nucleic acid extraction container shown in Figure 1(a).

[0014] The nucleic acid extraction container 10 comprises a resin substrate 12 having a groove-shaped first flow path 14, a second flow path 16, a third flow path 18, and a filter section 20 equipped with a hydrophilic filter 22 formed on its lower surface 12a and upper surface 12b, a first sealing film 24 attached to the lower surface 12a of the substrate 12 for sealing a part of the first flow path 14 and the second flow path 16, and two sealing films (a second sealing film 26 and a third sealing film 28) attached to the upper surface 12b of the substrate 12.

[0015] The substrate 12 is preferably formed from a material that is stable against temperature changes and is resistant to corrosion by the sample solution used. Furthermore, the substrate 12 is preferably formed from a material that is easily moldable, has good transparency and barrier properties, and has low autofluorescence. Examples of such materials include inorganic materials such as glass, as well as resins such as polypropylene, acrylic, polyester, and silicone, with cycloolefin polymer (COP) resin being particularly preferred. The dimensions of the substrate 12 are, for example, 72 mm long, 26 mm short, and 4 mm thick. A suitable size for the substrate 12 that is easy to work with is a long side of 50 to 200 mm. From the viewpoint of moldability, a thickness of 1 to 4 mm is preferred. From the viewpoint of molding costs, a short side of 10 to 50 mm is preferred. Such a substrate can be fabricated by injection molding, cast molding, cutting using an NC machine, or the like.

[0016] The first and second sealing films 24 and 26 may have one of their main surfaces provided with adhesive properties, or may have a functional layer formed on one of their main surfaces that exhibits adhesiveness or bonding properties upon pressure, irradiation with energy such as ultraviolet light, or heating. This allows them to be easily integrated with the lower surface 12a and upper surface 12b of the substrate 12. The first and second sealing films 24 and 26 are preferably made of a material with low autofluorescence, including the adhesive. In this regard, transparent films made of resins such as cycloolefin polymers, polyesters, polypropylene, polyethylene, or acrylic are suitable, but are not limited to these. The first and second sealing films 24 and 26 may also be made of plate-shaped glass or resin. This rigidity helps prevent warping and deformation of the nucleic acid extraction container 10. The portions of the first and second sealing films 24 and 26 that contact the flow path preferably have low protein adsorption.

[0017] The lower surface 12a and upper surface 12b of the substrate 12 are formed with groove-like first, second, and third flow channels 14, 16, and 18. In the nucleic acid extraction container 10 according to this embodiment, most of the first, second, and third flow channels 14, 16, and 18 are formed as grooves exposed on the lower surface 12a and upper surface 12b of the substrate 12. This is to allow for inexpensive and easy molding by injection molding using a mold or the like. To seal these grooves and utilize them as flow channels, a first sealing film 24 is attached to the lower surface 12a of the substrate 12, and a second sealing film 26 is attached to the upper surface 12b. The first and second flow channels 14, 16 each have, for example, a width of 1.0 mm and a depth of 1.0 mm. The third flow channel 18 has, for example, a width of 0.6 mm and a depth of 0.6 mm. To reduce the total volume of the third flow channel, the average cross-sectional area of ​​the third flow channel 18 is preferably smaller than that of the first flow channel 14. This applies pressure to the first flow path 14 during filtering, reducing the amount of sample entering the third flow path 18 and preventing the extract from remaining in the third flow path 18 when the extract is recovered.

[0018] The first flow channel 14 communicates between the sample injection port 30 and the biological substance capture region 20a of the filter section 20. The sample injection port 30 is formed so as to be exposed on the upper surface 12b of the substrate 12. The sample injection port 30 may be formed to facilitate fitting with a syringe. For example, a cylindrical tube may be extended from the substrate 12. Furthermore, the sample injection port 30 may be formed so as to be connectable to a syringe by a luer lock system so that a syringe containing a sample can be stably fixed.

[0019] The sample is introduced into the first flow channel 14 through a sample inlet 30. A pre-filter having a pore size larger than that of the filter 22 may be provided in the first flow channel 14 to remove foreign matter.

[0020] A circular filter unit 20 is formed so as to be exposed on the upper surface 12b of the substrate 12. The filter unit 20 is sealed by a second sealing film 26. A circular hydrophilic filter 22 is installed in the filter unit 20. It is preferable to form a filter unit so that the presence or absence of a sample on the filter 22 can be visually confirmed from the outside during nucleic acid extraction. For example, a transparent film can be used as the second sealing film 26. As shown in FIG. 2, the filter unit 20 includes a biological substance capture region 20a that captures biological substances containing nucleic acids on the filter 22, and a sample permeation region 20b through which the sample that has permeated the filter 22 passes. If the filter 22 is adjacent to a hydrophilic substance in the sample permeation region 20b, water is likely to remain between the filter 22 and this substance when air is injected to discharge the sample from the flow path after the biological substances are captured by the filter 22. This remaining water facilitates permeation of the nucleic acid extract through the filter 22 during nucleic acid extraction. Therefore, it is desirable that the filter 22 is not adjacent to a hydrophilic substance in the sample permeation region 20b.

[0021] The filter 22 is hydrophilic. Examples of materials for such a filter include polyvinylidene fluoride (PVDF), glass fiber, polyethersulfone (PES), polyester, and cellulose. Among these, PVDF and PES, which are less likely to adsorb proteins, are preferred. The pore size of the filter 22 can be appropriately selected depending on the biological material to be collected. For example, the pore size of the filter 22 is 1 μm or less.

[0022] Here, nucleic acids include DNA, RNA, and derivatives thereof, and biological substances include substances that constitute the living body of an organism, as well as microorganisms such as bacteria and viruses.

[0023] In the biological material capture region 20a, the filter 22 is fixed by an O-ring 32. An example of the filter size is 4 mm in diameter, and an example of the O-ring 32 size is 4 mm in outer diameter and 2 mm in inner diameter. As shown in FIG. 2 , the O-ring 32 has notches 32a and 32b formed therein to allow the sample to be delivered from the first flow path 14 onto the filter 22 and the nucleic acid extract to be delivered from the third flow path 18 onto the filter 22. The notch 32a on the first flow path side is formed on the upper side of the O-ring 32, but the notch 32a may also be formed on the lower side of the O-ring 32. The notch 32b on the third flow path side is formed on the lower side of the O-ring 32. This is to allow all of the nucleic acid extract on the filter 22 to be collected.

[0024] The second flow path 16 connects the sample outlet 34 to the sample permeation region 20b so that the liquid that has passed through the filter 22 passes through the sample permeation region 20b, passes through the second flow path, and is discharged from the sample outlet 34. As shown in Fig. 2, in this embodiment, the sample outlet 34 is formed so as to be exposed on the upper surface 12b of the substrate 12, but it may also be formed so as to be exposed on the lower surface 12a.

[0025] The third flow path 18 communicates between the air communication port 36 and the biological substance capture region 20a of the filter section 20. The air communication port 36 is formed so as to be exposed on the upper surface 12b of the substrate 12. As shown in FIG. 1(a), a third sealing film 28 is attached to the air communication port 36. The third sealing film 28 is sized to seal the air communication port 36. When a sample is passed from the sample injection port 30 through the first flow path to the filter 22, the air communication port 36 is closed by the third sealing film 28, preventing the sample from entering the third flow path. When the biological substance captured on the filter 22 is extracted with a nucleic acid extraction solution, the third sealing film 28 is peeled off and the air communication port 36 is opened. By configuring the air communication port to be openable and closable to the outside in this manner, nucleic acids can be extracted on the filter 22. In this embodiment, the air communication port 36 is opened and closed by the third sealing film, but it can also be opened and closed by other methods such as inserting a resin or metal plug.

[0026] The nucleic acid extract can be introduced into the biological material capture region 20a of the filter section 20 from either the sample injection port 30 or the air communication port 36, for example, using a pipetter. The amount of nucleic acid extract can be any amount that can contact the entire surface of the filter 22, or any amount that can contact the entire surface by moving the extract in contact with a portion of the surface. The extract that has come into contact with the surface of the filter 22 can be recovered from either the air communication port 36 or the sample injection port 30, for example, using a pipetter. The air communication port 36 may be configured to fit onto the tip of a pipetter.

[0027] 1(a), the first flow path 14 and the third flow path 18 preferably extend on opposite sides of the biological material capture region 20a, and more preferably the first flow path 14 and the third flow path 18, which communicate with the filter section 20, are in a straight line. This makes it possible to prevent the sample from remaining in the first flow path 14 and the filter section 20 after it has passed through the filter 22.

[0028] In the nucleic acid extraction container 10, all of the flow paths are formed in a straight line, but the shape of the flow paths is not limited to this. For example, the flow paths may be formed in a so-called meandering shape that combines curved and straight lines, or may widen along the way. Multiple filter units 20 may be arranged in series. This increases the area occupied by the filter units 20 on the substrate 12, allowing more biological substances to be collected.

[0029] (Variation 1) Next, modified examples of the nucleic acid extraction container according to the first embodiment will be described. Fig. 5 is a diagram illustrating modified example 1 of the nucleic acid extraction container. The nucleic acid extraction container 50 shown in Fig. 5 differs from the nucleic acid extraction container 10 shown in Fig. 1(a) in that a nucleic acid extract solution inlet 52 is further provided on the upper surface 12b of the substrate 12, and a first branch channel 54 communicating with the nucleic acid extract solution inlet 52 is connected to the third channel 18. The first branch channel 54 may also be connected to the first channel 14.

[0030] (Variation 2) Fig. 6 is a diagram illustrating modified example 2 of the nucleic acid extraction container. The nucleic acid extraction container 60 shown in Fig. 6 differs from the nucleic acid extraction container 10 shown in Fig. 1(a) in that a nucleic acid extract outlet 62 is further provided on the upper surface 12b of the substrate 12, and a second branch channel 64 communicating with the nucleic acid extract outlet 62 is connected to the third channel 18. The second branch channel 64 may be connected to the first channel 14.

[0031] (Variation 3) In this embodiment, the above-described first and second modifications may be combined, and the substrate 12 may be provided with a nucleic acid extract inlet, a nucleic acid extract outlet, a first branch channel, and a second branch channel.

[0032] (Variation 4) In an embodiment, a nucleic acid extract may be sealed in advance in either the third flow path or the first flow path, and air may be sealed between the region where the nucleic acid extract is present and the filter section, thereby further simplifying the nucleic acid extraction process.

[0033] (Variation 5) In this embodiment, a filter with a large pore size may be used in the sample permeation region of the filter section if the target object to be captured is large. In this case, the nucleic acid extract solution will pass through the filter, but applying a weak pressure from the sample outlet side can prevent the nucleic acid extract solution from passing through the filter. This pressure need only be sufficient to prevent air from passing through a moist hydrophilic filter. For example, a Murata Manufacturing microblower pump (MZB1001T02) can be used to apply a pressure of approximately 1 kP from the sample outlet. Alternatively, a channel and filter section may be formed in the substrate so that the sample passes from the bottom surface of the substrate through the filter to the top surface, and the nucleic acid extract solution passes through the bottom of the filter.

[0034] (Variation 6) In this embodiment, one channel including the first flow path, the filter section, the second flow path, and the third flow path is formed on one substrate. Considering the cost per channel, it is preferable to form multiple channels on one substrate.

[0035] Next, a method for using the nucleic acid extraction container 10 configured as described above will be described. First, a sample is introduced into the first flow channel 14 from the sample inlet 30, and the sample is allowed to pass through the filter section 20. The method for introducing the sample is not limited to these, but an appropriate amount of sample may be introduced directly from the inlet using a pipette, dropper, syringe, or the like. Furthermore, after the sample is discharged or introduced using a pipette, dropper, syringe, or the like, the sample may be moved to the filter section by further applying pressure or by sucking through the sample outlet 34.

[0036] FIG. 7 is a diagram illustrating the flow of a sample passing through the filter unit. As indicated by arrow A in FIG. 8, the sample moves from first flow path 14 to filter unit 20 and passes through filter 22. During this process, biological substances containing nucleic acids are captured on filter 22 in biological substance capture region 20a of filter unit 20. The sample that has passed through filter 22 moves to second flow path 16. Next, air is injected through sample injection port 30, and the sample is discharged from first flow path 14, filter unit 20, and second flow path 16. During these steps, air communication port 36 remains sealed by third sealing film 28.

[0037] Next, the third sealing film 28 is peeled off, and the nucleic acid extract is injected into the third flow path through the air communication port 36. FIG. 8 is a diagram illustrating nucleic acid extraction on a filter using the nucleic acid extract. As shown by arrow B1 in FIG. 8, the nucleic acid extract moves from the third flow path to the filter section 20 and comes into contact with the surface of the filter 22. Alternatively, the nucleic acid extract may be injected into the first flow path 14 through the sample injection port 30 and then moved to the filter section 20.

[0038] Because the pore size of the filter 22 is, for example, 1 μm or less as described above, the nucleic acid extract solution does not pass through the filter 22 and remains on the filter 22. The amount of nucleic acid extract solution may be an amount that allows contact with the entire surface of the filter 22, or an amount that does not allow contact with the entire surface. If the amount of nucleic acid extract solution is sufficient to allow contact with the entire surface of the filter 22, nucleic acids can be extracted from the biological material on the filter 22 by leaving the nucleic acid extract solution on the filter 22 for, for example, 1 minute. If the amount of nucleic acid extract solution is sufficient to allow contact with the entire surface of the filter 22, for example, a pipettor can be inserted into the air communication port 36 or the sample injection port 30, and the nucleic acid extract solution can be moved back and forth on the filter 22 by pushing or sucking air with the pipettor, as shown by arrow B2 in Figure 8. This reciprocating movement of the nucleic acid extract solution allows nucleic acids to be extracted from the biological material collected on the filter 22. Note that the reciprocating movement of the nucleic acid extract solution performed by the pipettor can also be achieved using a microblower pump or the like. This reciprocating movement can be achieved, for example, by the method described in JP 2019-180418 A.

[0039] For example, if the sample contains many broken cells and mitochondria and nucleic acids have been released from the cells, the nucleic acids captured on the filter 22 can be extracted by contacting it with a nucleic acid extraction solution at room temperature. On the other hand, if the sample is bacteria or the like, nucleic acids may not be extracted at room temperature. In such cases, nucleic acids can be extracted by applying a temperature of about 95°C. For example, nucleic acids can be extracted from samples such as bacteria by placing the substrate 12 on a high-temperature metal plate and raising the temperature of the biological material capture region 20a to around 95°C.

[0040] The solution containing the extracted nucleic acids on the filter 22 is recovered from the filter part 20 by inserting a pipetter into the air communication port 36 or the sample injection port 30 and sucking out the solution. This completes the extraction of nucleic acids from the sample.

[0041] [Second embodiment] The nucleic acid extraction container according to the second embodiment of the present invention also comprises a substrate, a sealing film attached to the substrate, and a filter. The same reference numerals are used for components common to the nucleic acid extraction container 10 according to the first embodiment, and redundant explanations will be omitted where appropriate.

[0042] 9(a) and 9(b) are diagrams illustrating a nucleic acid extraction container according to a second embodiment of the present invention. FIG. 10 is an AA cross-sectional view of the nucleic acid extraction container shown in FIG. 9(a). FIG. 11 is a BB cross-sectional view of the nucleic acid extraction container shown in FIG. 9(a). FIG. 12 is a CC cross-sectional view of the nucleic acid extraction container shown in FIG. 9(a). FIG. 13 is a DD cross-sectional view of the nucleic acid extraction container shown in FIG. 9(a). FIG. 14 is a plan view of the substrate provided in the nucleic acid extraction container shown in FIG. 9(a). A nucleic acid extraction container 80 according to the second embodiment has a different configuration from the nucleic acid extraction container 10 according to the first embodiment with respect to the filter part and the second flow path.

[0043] As shown in FIG. 9(a), in a nucleic acid extraction container 80 according to the second embodiment, a groove-shaped filter section 82 is formed so as to be exposed on the upper surface 12b of the substrate 12. A rectangular hydrophilic filter 84 is disposed in the filter section 82. The filter section 82 includes a biological substance capture region 82a above the filter 84 and a sample permeation region 82b below the filter 84. As shown in FIG. 9(a), in the biological substance capture region 82a, the filter 84 is fixed by disposing silicone rubbers 86 and 88 on both sides of its long sides. For example, the filter 84 has long sides of 21 mm and short sides of 4.0 mm, and the silicone rubbers 86 and 88 have long sides of 21 mm, short sides of 1.5 mm, and a thickness of 0.5 mm. Therefore, the biological substance capture region 82a forms a flow path with a width of 1.0 mm and a depth of 0.5 mm. The filter part 82 of the nucleic acid extraction container 80 according to the second embodiment has a larger sample permeation area than the filter part 20 of the nucleic acid extraction container 10 according to the first embodiment. Therefore, in the second embodiment, the efficiency of nucleic acid extraction can be further improved.

[0044] 9(a), the exposed portion of the filter 84 (the portion sandwiched between the silicone rubbers 86 and 88) is on the same straight line as the first flow path 14 and the third flow path 18. This facilitates replacement of the air in the flow path after the sample has permeated, and facilitates the movement and recovery of the extract.

[0045] 10, the sample permeation region 82b communicates with a first tributary channel 90a, a second tributary channel 90b, a third tributary channel 90c, and a fourth tributary channel 90d of the second channel 90. The number of tributaries can be changed as appropriate depending on the shape of the filter 84.

[0046] The nucleic acid extraction container 80 according to the second embodiment configured as described above can be used in the same manner as the nucleic acid extraction container 10 according to the first embodiment described above to extract nucleic acids from a sample.

[0047] The above-mentioned modifications 1 to 6 can also be applied to the nucleic acid extraction container 80 according to the second embodiment.

[0048] [Third embodiment] The nucleic acid extraction container according to the third embodiment of the present invention also comprises a substrate, a sealing film attached to the substrate, and a filter, similar to the nucleic acid extraction container according to the second embodiment. The same reference numerals are used for components common to the nucleic acid extraction container 80 according to the second embodiment, and redundant explanations will be omitted where appropriate.

[0049] 15(a) and 15(b) are diagrams illustrating a nucleic acid extraction container according to a third embodiment of the present invention. FIG. 16 is an AA cross-sectional view of the nucleic acid extraction container shown in FIG. 15(a). FIG. 17 is an EE cross-sectional view of the nucleic acid extraction container shown in FIG. 15(a). FIG. 18 is a plan view of a substrate included in the nucleic acid extraction container shown in FIG. 15(a). The nucleic acid extraction container 100 according to the third embodiment has a nucleic acid extract outlet 102 on the upper surface 12b of the substrate 12, a second branch channel 104 that communicates with the nucleic acid extract outlet 102 and is connected to the third channel 18, an air inlet 106 on the upper surface 12b of the substrate 12, and a third branch channel 108 that communicates with the air inlet 106 and is connected to the third channel 18. The nucleic acid extract outlet 102 and the air inlet 106 are sealed with a fourth sealing film 110. This configuration differs from the nucleic acid extraction container 80 according to the second embodiment. In the third embodiment, a predetermined amount of nucleic acid extract can be dispensed and sent to the nucleic acid extract outlet 102 by using region C of the third flow path 18 between the connection position of the third flow path 18 with the second branch flow path 104 and the connection position of the third flow path 18 with the third branch flow path 108.

[0050] 17, the nucleic acid extract outlet 102 may have a shape that allows it to store the nucleic acid extract. Reagents for PCR amplification can be directly mixed into the nucleic acid extract outlet 102 that stores the nucleic acid extract.

[0051] Next, we will explain how to use the nucleic acid extraction container 100 configured as above. First, in the same way as the method of using the nucleic acid extraction container 10 according to the first embodiment described above, a sample is passed through the filter part 82, biological substances containing nucleic acids are collected on the filter 84, a nucleic acid extract is poured into the filter part 82, and nucleic acids are extracted on the filter 84.

[0052] Next, the solution containing the extracted nucleic acids on the filter 84 is moved to a position including region C of the third flow path 18 by inserting a pipetter into the air communication port 36 and operating the pipetter. During nucleic acid extraction, the third sealing film 28 is peeled off, leaving the air communication port 36 open. Figure 19 schematically illustrates the state in which the solution containing nucleic acids is present in region C of the third flow path 18. Next, the third sealing film 28 is replaced to close the air communication port 36, and the sample injection port 30 is closed with a new sealing film (not shown). Thereafter, the fourth sealing film 110 is peeled off, and the nucleic acid extract outlet 102 and air inlet 106 are opened. A pipetter is inserted into the air inlet 106, and air is forced in, sending only the solution containing nucleic acids in region C to the nucleic acid extract outlet 102. This dispenses the solution containing nucleic acids. The shape of the nucleic acid extract outlet 102 is such that it can store the solution, as described above. Furthermore, by setting the volume of region C to a volume that allows direct mixing with PCR amplification reagents, that volume of solution can be stored in nucleic acid extract outlet 102. In this case, reagents for PCR amplification can be directly added to the solution stored in nucleic acid extract outlet 102.

[0053] The above-mentioned modifications 1 and 4 to 6 can also be applied to the nucleic acid extraction container 100 according to the third embodiment.

[0054] [Fourth embodiment] Figures 20(a) and 20(b) are diagrams for explaining a container for nucleic acid extraction according to a fourth embodiment of the present invention. Figure 21 is an AA cross-sectional view of the container for nucleic acid extraction shown in Figure 20(a). Figure 22 is a BB cross-sectional view of the container for nucleic acid extraction shown in Figure 20(a). Figure 23 is a CC cross-sectional view of the container for nucleic acid extraction shown in Figure 20(a). Figure 24 is a DD cross-sectional view of the container for nucleic acid extraction shown in Figure 20(a). Figure 25 is a plan view of a substrate provided in the container for nucleic acid extraction shown in Figure 20(a).

[0055] The nucleic acid extraction container 120 comprises a resin substrate 122 having a groove-shaped first flow path 124, a second flow path 126, a third flow path 128, and a filter section 130 equipped with a hydrophilic filter 132 formed on a lower surface 122a and an upper surface 122b thereof, a first sealing film 134 attached to the lower surface 122a of the substrate 122 for sealing the second flow path 126 and the filter section 130, and two sealing films (a second sealing film 136 and a third sealing film 138) attached to the upper surface 122b of the substrate 122.

[0056] The material and dimensions of the substrate 122 are the same as those of the substrate 12 in the first embodiment. Furthermore, like the substrate 12 in the first embodiment, the substrate 122 can be produced by injection molding, cast molding, or cutting using an NC processing machine or the like.

[0057] The configuration and material of the first sealing film 134 and the second sealing film 136 are similar to those of the first sealing film 24 and the second sealing film 26 in the first embodiment. It is preferable that the portions of the first sealing film 134 and the second sealing film 136 that come into contact with the flow path have low protein adsorption.

[0058] Groove-shaped first, second, and third flow channels 124, 126, and 128 are formed on the lower and upper surfaces 122a, 122b, of the substrate 122. As in the first embodiment, most of the first, second, and third flow channels 124, 126, and 128 in the nucleic acid extraction container 120 according to the fourth embodiment are formed as grooves exposed on the lower and upper surfaces 122a, 122b, of the substrate 122. This is to allow inexpensive and easy molding by injection molding using a mold or the like. To seal these grooves and utilize them as flow channels, a first sealing film 134 is attached to the lower surface 122a of the substrate 122, and a second sealing film 136 is attached to the upper surface 122b. The dimensions of the first, second, and third flow channels 124, 126, and 128 are similar to those of the first, second, and third flow channels 14, 16, and 18 in the first embodiment.

[0059] The first flow channel 124 communicates between the sample injection port 140 and the biological substance capture region 130a of the filter section 130. The sample injection port 140 is formed so as to protrude above the upper surface 122b of the substrate 122. The shape of the sample injection port 140 is not limited to that shown in the figure, and like the sample injection port 30 in the first embodiment, the sample injection port 140 may be formed so as to fit well with a syringe, or may be formed so as to be connectable to a syringe by a luer lock system.

[0060] The sample is introduced into the first channel 124 through a sample inlet 140. A pre-filter having a larger pore size than the filter 132 may be provided in the first channel 124 to remove foreign matter.

[0061] A groove-shaped filter unit 130 is formed so as to be exposed on the lower surface 122a of the substrate 122. The filter unit 130 is sealed by a first sealing film 134. A hydrophilic filter 132 is provided in the filter unit 130. As shown in FIG. 21 , the filter unit 130 includes a biological substance capture region 130a that captures biological substances containing nucleic acids on the filter 132, and a sample permeation region 130b through which the sample that has permeated the filter 132 passes. As described in the first embodiment, in order to prevent the nucleic acid extract from permeating the filter 132 during nucleic acid extraction, it is desirable that the filter 132 is not in close proximity to hydrophilic substances in the sample permeation region 130b.

[0062] In the sample transmission region 130b, the filter 132 is fixed by placing silicone rubber 142, 144 on both sides of its long side, but the filter may also be glued or fused to the groove surface of the lower surface 122a of the substrate 122. The filter 132 has, for example, a long side of 40 mm and a short side of 4.0 mm, and the silicone rubber 142, 144 has, for example, a long side of 40 mm, a short side of 1.5 mm, and a thickness of 0.5 mm. Therefore, the sample transmission region 130b forms a flow path with a width of 1.0 mm and a depth of 0.5 mm. The biological substance collection region 130a is formed in a groove shape on the lower surface 122a of the substrate 122, and the flow path is formed by placing the filter 132 in the sample transmission region 130b. For example, the biological substance collection region 130a has a width of 1.0 mm and a depth of 0.5 mm. By forming filter section 130 on lower surface 122a of substrate 122 in this manner and fixing filter 132 from the side of sample transmission region 130b, it is possible to prevent foreign matter from being mixed into the nucleic acid extract even if foreign matter is attached to a filter fixing device such as silicone rubber in this embodiment or if foreign matter is introduced during assembly of the nucleic acid extraction container. Furthermore, since pressure is applied to the biological substance capture region of the substrate when passing the sample through the filter, there is a risk that the film sealing the filter section will peel off depending on the magnitude of the pressure, but the configuration of filter section 130 in this embodiment reduces the area sealing biological substance capture region 130a, thereby reducing the risk of the film sealing the filter section peeling off.

[0063] The material and pore size of the filter 132 are the same as those of the filter 22 in the first embodiment.

[0064] The second flow channel 126 communicates the sample outlet 146 with the sample permeation region 130b so that the liquid that has passed through the filter 132 passes through the sample permeation region 130b, passes through the second flow channel 126, and is discharged from the sample outlet 146. In this embodiment, the sample outlet 146 is formed so as to protrude from the upper surface 122b of the substrate 122, but it may also be formed on the lower surface 122a.

[0065] The third flow path 128 communicates between the air communication port 148 and the biological material capture region 130a of the filter section 130. The air communication port 148 is formed so as to protrude from the upper surface 122b of the substrate 122. As shown in FIG. 20(a), a third sealing film 138 is attached to the air communication port 148. The configurations of the air communication port 148 and the third sealing film 138 are similar to the air communication port 36 and the third sealing film 28 in the first embodiment.

[0066] As in the first embodiment, the nucleic acid extract can be introduced into the biological substance capture region 130a of the filter unit 130 through either the sample inlet 140 or the air communication port 148. The amount of nucleic acid extract may be any amount sufficient to contact the entire surface of the filter 132, or any amount sufficient to contact a portion of the surface and move the extract to contact the entire surface. As in the first embodiment, the extract that has come into contact with the surface of the filter 132 can be collected through either the air communication port 148 or the sample inlet 140. Alternatively, pressure may be applied to the biological substance capture region 130a to cause the extract to pass through the filter 132 and be collected through the sample outlet 146. The air communication port 148 may be configured to fit onto the tip of a pipettor.

[0067] 20(a), the first flow path 124 and the third flow path 128 preferably extend on opposite sides of the biological material capture region 130a, and more preferably the first flow path 124 and the third flow path 128, which communicate with the filter section 130, are in a straight line. This makes it possible to prevent the sample from remaining in the first flow path 124 and the filter section 130 after the sample has passed through the filter 132.

[0068] In the nucleic acid extraction container 120, all of the flow paths are formed in a straight line, but the shape of the flow paths is not limited to this. For example, the flow paths may be formed in a so-called meandering shape that continuously turns back and forth, combining curved and straight lines, or may widen along the way. Multiple filter units 130 may be arranged in series. This increases the area occupied by the filter units 130 on the substrate 122, allowing more biological substances to be collected.

[0069] The nucleic acid extraction container 120 according to the fourth embodiment configured as described above can be used in the same manner as the nucleic acid extraction container 10 according to the first embodiment described above to extract nucleic acids from a sample.

[0070] The above-mentioned modifications 1 to 6 can also be applied to the nucleic acid extraction container 120 according to the fourth embodiment.

[0071] [Fifth embodiment] 26(a) and 26(b) are diagrams illustrating a nucleic acid extraction container according to a fifth embodiment of the present invention. FIG. 27 is an AA cross-sectional view of the nucleic acid extraction container shown in FIG. 26(a). FIG. 28 is a BB cross-sectional view of the nucleic acid extraction container shown in FIG. 26(a). FIG. 29 is a CC cross-sectional view of the nucleic acid extraction container shown in FIG. 26(a). FIG. 30 is a DD cross-sectional view of the nucleic acid extraction container shown in FIG. 26(a). FIG. 31 is an EE cross-sectional view of the nucleic acid extraction container shown in FIG. 26(a). FIG. 32 is an FF cross-sectional view of the nucleic acid extraction container shown in FIG. 26(a). FIG. 33 is a plan view of a substrate provided in the nucleic acid extraction container shown in FIG. 26(a). FIGS. 34(a) and 34(b) are diagrams illustrating a presser plate provided in the nucleic acid extraction container according to the fifth embodiment of the present invention. FIG. 35 is a JJ cross-sectional view of the presser plate shown in FIG. 34(a). FIG. 36 is an HH cross-sectional view of the presser plate shown in FIG. 34(a). FIG. 37 is a view of the GG cross section and the II cross section of the pressing plate shown in FIG. 34(a).

[0072] The nucleic acid extraction container 160 comprises a resin substrate 162 having a groove-shaped flow path 164 formed on a lower surface 162a and an upper surface 162b, and a filter section 166 equipped with a hydrophilic filter 168; a first sealing film 170 attached to the lower surface 162a of the substrate 162 for sealing the flow path 164 and the filter section 166; and a pressing plate 180 for fixing the filter 168 to the filter section 166.

[0073] The material and dimensions of the substrate 162 are the same as those of the substrate 12 in the first embodiment. Furthermore, like the substrate 12 in the first embodiment, the substrate 162 can be produced by injection molding, cast molding, cutting using an NC processing machine, or the like.

[0074] The configuration and material of the first sealing film 170 are similar to those of the first sealing film 24 and the second sealing film 26 in the first embodiment. The portion of the first sealing film 170 that comes into contact with the flow path preferably has low protein adsorption.

[0075] A groove-like channel 164 is formed on the lower surface 162a of the substrate 162. In the nucleic acid extraction container 160 according to the fifth embodiment, the channel 164 is formed as a groove exposed on the lower surface 162a of the substrate 162. This is to enable inexpensive and easy molding by injection molding using a mold or the like. To seal this groove and utilize it as a channel, a first sealing film 170 is attached to the lower surface 162a of the substrate 162. The dimensions of the channel 164 are the same as those of the second channel 16 in the first embodiment.

[0076] The sample injection port 174 communicates with the biological substance collection region 130a of the filter section 166. The sample injection port 174 is formed so as to protrude above the upper surface 162b of the substrate 162. The shape of the sample injection port 174 is not limited to that shown in the figure, and like the sample injection port 30 in the first embodiment, the sample injection port 174 may be formed so as to fit well with a syringe, or may be formed so as to be connectable to a syringe by a luer lock system.

[0077] The sample is introduced into the biological material collection region 166a of the filter section 166 through the sample injection port 174. A pre-filter having a larger pore size than the filter 168 may be provided in the sample injection port 174 for removing foreign matter.

[0078] A groove-shaped filter unit 166 is formed so as to be exposed on the lower surface 162a of the substrate 162. A hydrophilic filter 168 is disposed in the filter unit 166. As shown in FIG. 27 , the filter unit 166 includes a biological substance capture region 166a that captures biological substances containing nucleic acids on the filter 168, and a sample transmission region 166b through which a sample that has passed through the filter 168 passes. In the sample transmission region 166b, the filter 168 is fixed by disposing a pressing plate 180, but the filter 168 may also be glued or fused to the groove surface of the lower surface 162a of the substrate 162. The filter unit 166 is sealed with a first sealing film 170. As described in the first embodiment, in order to prevent the nucleic acid extract from passing through the filter 168 during nucleic acid extraction, it is desirable that the filter 168 is not in close proximity to a hydrophilic substance in the sample transmission region 166b.

[0079] The filter 168 has, for example, long sides of 46 mm and short sides of 6 mm, and the presser plate 180 has, for example, long sides of 46 mm, short sides of 6 mm, and a thickness of 1 mm. The sample transmission region 166b forms a flow path with a width of 1 mm and a depth of 1 mm. The biological substance collection region 166a is formed as a groove on the lower surface 162a of the substrate 162, and a flow path is formed by placing the filter 168 in the sample transmission region 166b. The biological substance collection region 166a has, for example, a width of 1 mm and a depth of 0.5 mm. By forming the filter section 166 on the lower surface 162a of the substrate 162 in this manner and fixing the filter 168 from the sample transmission region 166b side with the presser plate 180, it is possible to prevent foreign matter from being mixed into the nucleic acid extract even if foreign matter is attached to the presser plate in this embodiment or is introduced during assembly of the nucleic acid extraction container. Furthermore, when a sample is passed through the filter, pressure is applied to the biological substance capture region of the substrate, and depending on the magnitude of the pressure, there is a risk that the film sealing the filter portion will peel off. However, according to the configuration of filter portion 166 in this embodiment, the area sealing biological substance capture region 166a is reduced, and the risk that the film sealing the filter portion will peel off is reduced.

[0080] The material and pore size of the filter 168 are the same as those of the filter 22 in the first embodiment.

[0081] As shown in Figures 34(a), 34(b), and 35 to 37, the presser plate 180 is made of a resin substrate 182, and the substrate 182 has a cutout 182a formed therein that defines the sample transmission region 166b. The material of the substrate 182 is the same as that of the substrate 12 in the first embodiment. The size and shape of the substrate 182 can be adjusted as appropriate depending on the size and shape of the desired filter section 166. The size and shape of the cutout 182a can be adjusted as appropriate depending on the size and shape of the desired sample transmission region 166b. Furthermore, like the substrate 12 in the first embodiment, the substrate 182 can be manufactured by injection molding, cast molding, or cutting using an NC machine or the like.

[0082] The flow channel 164 communicates between the sample outlet 176 and the sample permeation region 166b so that the liquid that has passed through the filter 168 passes through the sample permeation region 166b, passes through the flow channel 164, and is discharged from the sample outlet 176. In this embodiment, the sample outlet 176 is formed so as to protrude from the upper surface 162b of the substrate 162, but it may also be formed on the lower surface 162a.

[0083] The air communication port 178 communicates with the biological material capture region 166a of the filter section 166. The air communication port 178 is formed so as to protrude from the upper surface 162b of the substrate 162. As shown in FIG. 26(a), a second sealing film 172 is attached to the air communication port 178. The configurations of the air communication port 178 and the second sealing film 172 are similar to the air communication port 36 and the third sealing film 28 in the first embodiment.

[0084] As in the first embodiment, the nucleic acid extract can be introduced into the biological substance capture region 166a of the filter section 166 through either the sample inlet 174 or the air communication port 178. The amount of nucleic acid extract may be any amount that allows it to come into contact with the entire surface of the filter 168, or any amount that allows it to come into contact with a portion of the surface and move to contact the entire surface. As in the first embodiment, the extract that has come into contact with the surface of the filter 168 can be collected through either the air communication port 178 or the sample inlet 174. Alternatively, pressure may be applied to the biological substance capture region 166a to cause the extract to pass through the filter 168 and be collected through the sample outlet 176. The air communication port 178 may be configured to fit onto the tip of a pipetter.

[0085] 26(a) and 27, the sample injection port 174 and the air communication port 178 are directly connected to the biological substance capture region 166a. Furthermore, the number of sealing films is smaller than in the first to fourth embodiments. Therefore, the nucleic acid extraction container according to the fifth embodiment can be manufactured at a lower cost than in the first to fourth embodiments.

[0086] 26(a) and 27, the sample injection port 174 and the air communication port 178 are preferably arranged on opposite sides of the biological material capture region 166a, so that the sample does not remain in the filter section 166 after passing through the filter 168.

[0087] In the nucleic acid extraction container 160, the flow path is formed in a straight line, but the shape of the flow path is not limited to this. For example, the flow path may be formed in a so-called meandering shape that continuously turns back and forth, combining curved and straight lines, or the width may increase along the way. Multiple filter units 166 may be arranged in series. This increases the area occupied by the filter units 166 on the substrate 162, allowing more biological substances to be collected.

[0088] The nucleic acid extraction container 160 according to the fifth embodiment configured as described above can be used in the same manner as the nucleic acid extraction container 10 according to the first embodiment described above to extract nucleic acids from a sample.

[0089] The above fifth and sixth modifications can also be applied to the nucleic acid extraction container 160 according to the fifth embodiment. [Example]

[0090] Examples of the present invention will be described below, but these examples are merely illustrative examples for suitably explaining the present invention and do not limit the present invention in any way.

[0091] In this example, we compared the analysis of environmental DNA using a nucleic acid extraction solution according to the embodiment with the conventional academic standard method. Here, environmental DNA (eDNA) refers to DNA released into the environment and derived from organisms living there. More specifically, various organisms living in the environment constantly release their DNA into their surroundings. For example, in the case of animals, their DNA is released through their skin, hair, excrement, and carcasses. Detecting or quantifying environmental DNA in an environment can identify the species living in that environment and understand the biodiversity of that environment. The type of DNA analyzed is often mitochondrial DNA due to its stability. In the academic standard method, several hundred mL to 1 L of sample water is filtered, and DNA is extracted from the particles containing environmental DNA collected there, ultimately resulting in a 200 μL solution. A portion of this solution (approximately 2 μL) is then used for PCR detection to determine whether the target organism is present and to what extent.

[0092] The reagents used in the PCR in this example are shown in Table 1 below. [Table 1]

[0093] The sequences of the forward primer (primer F), reverse primer (primer R), and probe used in PCR are as follows:

[0094] Rainbow trout primer F: 5'-AGTCTCTCCCTGTATATCGTC-3' (SEQ ID NO: 1) Rainbow trout primer R: 5'-GATTTAGTTCATGAAGTTGCGAGAGTA-3' (SEQ ID NO: 2) Rainbow trout probe: 5'-CCAACAACTCTTTAACCATC-3' (SEQ ID NO: 3) The 5' end of the probe was labeled with FAM and the 3' end with [NFQ]-[MGB]. (Reference: Wilcox, TM, Carim, KJ, McKelvey, KS, Young, MK, & Schwartz, MK 2015(4 Nov.). The dual challenges of generality and specificity when developing environmental DNA markers for species and subspecies of Oncorhynchus. PLoS ONE, 10(11) e0142008. doi:10.1371 / journal.pone.0142008.)

[0095] Carp primer F: 5'-GGTGGGTTCTCAGTAGACAATGC-3' (SEQ ID NO: 4) Carp primer R: 5'-GGCGGCAATAACAAATGGTAGT-3' (SEQ ID NO: 5) Carp probe: 5'- CACTAACACG ATTCTTCGCA TTCCACTTCC-3'' (SEQ ID NO: 6) The 5' end of the probe was labeled with FAM and the 3' end with TAMRA. (Reference: Takahara, T., Minamoto, T., Yamanaka, H., Doi, H. & Kawabata, Z. 2012. Estimation of fish biomass using environmental DNA. PLoS ONE, 7: e35868.)

[0096] Bonito primer F: 5'-TACCCCTGACGTAGAATCAGCC-3' (SEQ ID NO: 7) Bonito primer R: 5'-GGCCAATATGGGAGTAAATGCAG-3' (SEQ ID NO: 8) Skipjack probe: 5'- TGCCGAGACGTAAACTTCGG -3' (SEQ ID NO: 9) The 5' end of the probe was labeled with Cy5 and the 3' end with BHQ3. (Reference: Lin, W.-F. & Hwang, D.-F. 2008. Application of species-specific PCR for the identification of dried bonito product (Katsuobushi). Food Chemistry 106: 390-396.)

[0097] The PCR amplification reaction conditions are as follows: 95°C for 15 seconds, followed by a cycle of 60°C for 10 seconds and 95°C for 3.5 seconds.

[0098] Example 1 The nucleic acid extraction container 10 shown in Figures 1(a) and 1(b) was fabricated. The nucleic acid extraction container 10 is a plate-shaped container measuring 26 x 75 x 4 mm, made of cycloolefin polymer (COP). The flow paths, filter section, and air vent were sealed with 3M's polyolefin microsealing tape (9795). The first flow path 14 and second flow path 16 are 1.0 mm wide and 1.0 mm deep, and the third flow path 18 is 0.6 mm wide and 0.6 mm deep. The hydrophilic filter is 4 mm in diameter. The filter 22 is fixed in place by an O-ring 32 measuring 4 mm in diameter and 2 mm in diameter. The filter 22 is made of polyvinylidene fluoride (PVDF) and has a pore size of 0.45 μm. The effective surface of the filter 22 is 3 mm in diameter.

[0099] Using this nucleic acid extraction vessel, an extract from which DNA was extracted was obtained according to the following procedure. (1) A 10 mL syringe was inserted into the sample inlet 30, and 2 mL of sample was poured in through this syringe. At this time, a tube was inserted into the sample outlet 34, and the discharged solution was discarded. (2) The syringe was removed, 10 mL of air was sucked in, and then it was reinserted into the sample injection port 30, and 10 mL of air was poured into the flow paths, thereby discharging the sample from the first flow path 14 and the second flow path 16. (3) The seal film on the air vent 36 was peeled off, and 5 μL of DNA extract was injected from the air vent 36 using a pipetter. While visually checking the position, the DNA extract was pushed into the filter section 20 and left for 1 minute. (4) A pipetter was inserted into the air communication port 36 and the extracted liquid was sucked up.

[0100] The sample was a dilution of a suspension of raw bonito meat suspended in pure water. A 200 mM Na2CO3 solution was used as the DNA extraction solution.

[0101] A 1.6 μL aliquot of the extract obtained using the nucleic acid extraction container 10 was mixed with 14.4 μL of PCR amplification reagent and amplified using a PCR1100 (Nippon Sheet Glass Co., Ltd.), resulting in a cycle threshold (Ct value) of 38.9. The time required for filtering and extraction was approximately 3 minutes. In this example, the extract was mixed directly with the PCR amplification reagent, but it may also be mixed with a neutralizing solution or the like before being mixed with the PCR reagent.

[0102] (Comparative Example 1) "Environmental DNA Survey Experiment Manual (ver2.1)" (Environmental DNA Society, Internet<URL: http: / / ednasociety.org / eDNA_manual_ver2_1_3.pdf> ), 50 mL of the same sample as in Example 1 was filtered through a cartridge filter (Sterivex 0.45 μm; manufactured by Merck), and DNA was extracted using Qiagen's Dneasy Blood and Tissue kit. 1.6 μL of the resulting extract was mixed with 14.4 μL of PCR amplification reagent and amplified using the same mobile PCR device (product name PicoGene PCR1100) as in Example 1, resulting in a Ct value of 40.1. The time required for filtering and extraction was approximately 2 hours.

[0103] The results of Example 1 and Comparative Example 1 are shown in Table 2 below. [Table 2]

[0104] The sample volume in Example 1 is less than one-tenth that of Comparative Example 1. Furthermore, in Example 1, the process from filtering to extraction is simpler than in Comparative Example 1, and the process time is approximately three minutes compared to two hours in Comparative Example 1. Furthermore, as shown in Table 2, the Ct value obtained in Example 1 is almost equivalent to that obtained in Comparative Example 1, indicating that Example 1 can achieve detection sensitivity equivalent to that of Comparative Example 1, even with a sample volume that is one-tenth that of Comparative Example 1. The number of consumables used in Example 1 is small, and the nucleic acid extraction container 10 used for extraction has a simple structure and can be manufactured at low cost. Generally, in nucleic acid measurement, many items are disposable to avoid contamination known as carryover, so reducing the cost of consumables is important. Furthermore, since the sample volume in Example 1 is small, it is easy to send the sample water to the testing company. Furthermore, in Example 1, no special equipment is required and the work procedures are few and simple, making extraction easy for anyone, even on-site. In addition, filtering and extraction can be performed in a closed space in Example 1, reducing the risk of contamination.

[0105] Example 2 A nucleic acid extraction container 80 shown in Figures 9(a) and 9(b) was fabricated. The nucleic acid extraction container 80 is a plate-shaped container measuring 26 x 75 x 4 mm, and is made of cycloolefin polymer (COP). The flow paths, filter section, and air vent were sealed by applying 3M polyolefin microsealing tape (9795). The first flow path 14 and the second flow path 16 are 1.0 mm wide and 1.0 mm deep, and the third flow path 18 is 0.6 mm wide and 0.6 mm deep. The filter 84 is 21 mm long and 4 mm wide. The filter 84 was fixed by pressing both sides of the filter 84 from above with silicone rubber 86 and 88, each 1.5 mm wide and 0.5 mm thick. The filter 84 is made of polyvinylidene fluoride (PVDF), and has a pore size of 0.45 μm. The effective area of ​​the filter 84 is 20 mm. 2 is.

[0106] Using this nucleic acid extraction container 80, an extract from which DNA was extracted was obtained in the following procedure. (1) A 10 mL syringe was inserted into the sample inlet 30, and 10 mL or 5 mL of sample was poured in through the syringe. At this time, a tube was inserted into the sample outlet 34, and the discharged solution was discarded. (2) The syringe was temporarily removed, and 10 mL of air was sucked into it. Then, the syringe was reinserted into the sample injection port 30, and 10 mL of air was allowed to flow into the first flow path and the second flow path. (3) The third sealing film 28 on the air communication port 36 was peeled off, and 5 μL of DNA extract was injected from this port using a pipetter, and the extract was pushed down to the filter part 82. After that, while visually checking the position, the DNA extract was moved back and forth using the pipetter for 1 minute so that the DNA extract came into contact with the entire effective surface of the filter 84. (4) A pipetter was inserted into the air communication port 36 and the extracted liquid was sucked up.

[0107] The samples used were 10 mL of rainbow trout tank water diluted 100 times with pure water (Example 2-1) and 5 mL of water from a carp pond in Tsukuba City (Example 2-2). DNA extraction solutions used were a 200 mM Na2CO3 aqueous solution (Example 2-1) and Kaneka's Easy Extraction Kit Version 2 (Example 2-2).

[0108] 1.6 μL of the resulting DNA extract was mixed directly with 14.4 μL of PCR amplification reagent and amplified using the same mobile PCR device as in Example 1, yielding the results shown in Table 3 below. In this example, the extract was mixed directly with the PCR amplification reagent, but it may also be mixed with a neutralizing solution or the like before being mixed with the PCR reagent. The time required for filtering and extraction was approximately 3 minutes. [Table 3]

[0109] In the DNA extraction in this example, the DNA extraction solution only contacted about half of the filter, but by passing it back and forth, it was found that DNA trapped on the entire surface of the filter could be extracted. This suggests that sensitivity can be further improved by increasing the length of the filter and increasing the amount of sample that passes through.

[0110] Typically, nucleic acid extraction involves immersing the sample (such as a mouse tail or a plant) in an extraction solution, dissolving it, and extracting the nucleic acid. In this example, it was found that extraction is possible without immersion in the extraction solution, simply by allowing the extraction solution to flow over the filter on which the biological material has been captured. The fact that extraction can be achieved simply by flowing means that less extraction solution is required than when the entire sample is immersed, which leads to a higher nucleic acid concentration in the extraction solution.

[0111] (Comparative Example 2) DNA was extracted from 100 mL of the same sample as in Example 2-1 (Comparative Example 2-1) and 50 mL of the same sample as in Example 2-2 (Comparative Example 2-2) in the same manner as in Comparative Example 1. 1.6 μL of the resulting extract was mixed with 14.4 μL of PCR amplification reagent and amplified using the same mobile PCR device as in Example 1, yielding the results shown in Table 4. The time required for filtering and extraction was approximately 2 hours. [Table 4]

[0112] In Example 2, even though the same sample as in Comparative Example 2 was used, almost the same Ct value was obtained with 1 / 10 the sample amount, and the same amount of DNA was detected. In other words, the detection sensitivity in Example 2 is equivalent to that of Comparative Example 2, and Example 2, like Example 1, has the advantages of being easy to send samples to testing companies, having a simple extraction procedure, and low contamination.

[0113] Example 3 A nucleic acid extraction container 100 shown in Figures 15(a) and 15(b) was fabricated. The nucleic acid extraction container 100 was a plate-shaped container measuring 26 x 75 x 4 mm, made of cycloolefin polymer (COP). The channels, filter, and inlet were sealed by applying 3M polyolefin microsealing tape (9795). The first channel 14 and second channel 16 were 1.0 mm wide and 1.0 mm deep. The third channel 18 was 0.6 mm wide and 0.6 mm deep. The second branch channel 104 and third branch channel 108 were the same size as the third channel 18. The filter 84 was 21 mm long and 4 mm wide. The filter 84 was fixed by pressing both sides of the filter 84 from above with silicone rubber 86 and 88, each 1.5 mm wide and 0.5 mm thick. The material of the filter 84 is polyvinylidene fluoride (PVDF), and the pore size is 0.45 μm. The effective area of ​​the filter 84 is 20 mm 2 is.

[0114] An extract from which DNA was extracted was obtained using this nucleic acid extraction container 100 according to the following procedure: The sample was 10 mL of water as in Example 2-1. (1) A 10 mL syringe was inserted into the sample inlet 30, and 10 mL of sample was poured in through the syringe. At this time, a tube was inserted into the outlet, and the discharged solution was discarded. (2) The syringe was removed once, and 10 mL of air was sucked in. Then, the syringe was inserted into the sample injection port 30 again, and 10 mL of air was allowed to flow into the flow path. (3) The third sealing film 28 was peeled off, and 5 μL of extraction liquid was injected through the air communication port 36 using a pipettor. The extraction liquid was then pushed up to the filter 84. After visually checking the position, the pipettor was moved back and forth for 1 minute so that the extraction liquid touched the entire effective surface of the filter 84, and finally the extraction liquid was stopped at the part including region C of the third flow path 18. (4) The third sealing film was reattached to seal the air communication port 36, and the sample injection port 30 was blocked with a new sealing film. Then, the fourth sealing film 110 was peeled off, a pipetter was inserted into the air injection port 106, and air was pushed in with the pipetter to collect the previous extract in the liquid reservoir of the nucleic acid extract outlet 102.

[0115] The extract collected in the liquid reservoir was dispensed in 1.6 μL portions. 14.4 μL of PCR amplification reagent was added and mixed. The DNA in this mixture was amplified using the same mobile PCR device as in Example 1, resulting in a Ct value of 30.2. The time required for filtering and extraction was approximately 3 minutes. In this example, the extract was mixed directly with the PCR amplification reagent, but it may also be mixed with a neutralizing solution or the like and then mixed with the PCR reagent. Compared to Example 2, this eliminates the need to dispense 1.6 μL and the need for a tube for mixing with the PCR amplification reagent, making it easier to move from extraction to PCR amplification. [Table 5]

[0116] Example 4 A nucleic acid extraction container 160 shown in Figures 26(a) and 26(b) was fabricated. The nucleic acid extraction container 160 is a plate-like container measuring 26 x 75 x 4 mm, and is made of cycloolefin polymer (COP). The flow channel, filter section, and inlet were sealed by applying 3M polyolefin microsealing tape (9795). The flow channel 164 measures 1.0 mm wide and 1.0 mm deep. The sample permeation region 166b is a flow channel measuring 1 mm wide and 1 mm deep. The biological substance capture region 166a is a flow channel measuring 1 mm wide and 0.5 mm deep. The filter 168 measures 46 mm long and 6 mm wide. The filter 168 was fixed by inserting a retaining plate 180 shown in Figure 34 into the nucleic acid extraction container 160. The retaining plate 180 is a plate-like container measuring 6 x 46 x 1 mm. The material of the filter 168 is polyvinylidene fluoride (PVDF), and the pore size is 0.65 μm. The effective area of ​​the filter 168 is 40 mm 2 The volume of the biological material collection region 166a is 20 μL.

[0117] Using this nucleic acid extraction container 160, an extract from which DNA was extracted was obtained in the following procedure. (1) A 10 mL syringe was inserted into the sample inlet 174, and 10 mL of sample was poured in from there. At this time, a tube was inserted into the outlet, and the discharged solution was discarded. (2) The syringe was temporarily removed, and 10 mL of air was sucked in. Then, it was inserted into the sample injection port 174 again, and 10 mL of air was allowed to flow into the flow path. (3) The second sealing film 172 was peeled off, and a predetermined amount of extract was injected through the air communication port 178 using a pipetter. The extract was then pushed into the filter 168, and the pipetter was then moved back and forth for 2 minutes while visually checking the position so that the extract came into contact with the entire effective surface of the filter 168. (4) The extract was collected from the air communication port 178 using the same pipettor.

[0118] The sample was 10 mL of rainbow trout tank water diluted 50 times with pure water. Kaneka's Simple Extraction Kit Version 2 was used as the DNA extraction solution.

[0119] A 1.5 μL aliquot of the DNA extract was mixed with 13.5 μL of PCR amplification reagent and amplified using a StepOne Plus Real Time PCR System (Applied Biosystems). The relationship between the volume of extract and the DNA concentration (copy number / μL) is shown in Figure 38. The DNA concentration was calculated from the Ct value obtained by creating a calibration curve during PCR.

[0120] From Figure 38, it can be seen that the DNA concentration of the extract increases when a small amount of extract is used.

[0121] The present invention has been described above based on the embodiments. These embodiments are merely examples, and it will be understood by those skilled in the art that various modifications are possible in the combination of the components and treatment processes, and that such modifications are also within the scope of the present invention. [Industrial Applicability]

[0122] The present invention can be used in a nucleic acid extraction vessel and a nucleic acid extraction method. [Explanation of symbols]

[0123] 10 nucleic acid extraction container, 14 first flow path, 16 second flow path, 18 third flow path, 20 filter section, 20a biological substance collection area, 20b sample permeation area, 22 filter, 30 sample inlet, 34 sample outlet, 36 air communication port, 50 nucleic acid extraction container, 52 nucleic acid extract solution inlet, 54 first branch flow path, 60 nucleic acid extraction container, 62 nucleic acid extract solution outlet, 64 second branch flow path, 80 nucleic acid extraction container, 82 filter section, 82a biological substance collection area, 82b sample permeation area, 84 filter, 90 second flow path, 100 nucleic acid extraction container, 102 nucleic acid extract solution outlet, 104 second branch flow path, 106 air inlet, 108 third branch flow path, 120 nucleic acid extraction container, 124 first flow path, 126 second flow path, 128 third flow path, 130 filter section, 130a biological substance capture area, 130b sample permeation area, 132 filter, 140 sample injection port, 146 sample discharge port, 148 air communication port, 160 nucleic acid extraction container, 164 flow path, 166 filter section, 166a biological substance capture area, 166b sample permeation area, 168 filter, 174 sample injection port, 176 sample discharge port, 178 air communication port. [Sequence List Free Text]

[0124] SEQ ID NO: 1: Rainbow trout forward PCR primer SEQ ID NO: 2: Rainbow trout reverse PCR primer SEQ ID NO: 3: Rainbow trout probe SEQ ID NO: 4: Carp forward PCR primer SEQ ID NO: 5: Coi reverse PCR primer SEQ ID NO: 6: Carp probe SEQ ID NO: 7: Skipjack forward PCR primer SEQ ID NO: 8: Bonito reverse PCR primer SEQ ID NO: 9: Bonito probe

Claims

1. a filter unit including a hydrophilic filter for capturing biological substances including nucleic acids from a sample, a biological substance capturing region on the filter for capturing the biological substances, and a sample permeation region through which the sample that has permeated the filter passes; a sample injection port communicating with the biological material collection region; an air communication port communicating with the biological material capture region; a sample outlet communicating with the sample transmission area; Equipped with The air communication port is configured to be openable and closable to the outside, A nucleic acid extraction container, wherein the biological substance capture region is configured as a flow path that is elongated in the direction of fluid flow along the surface of the filter that captures the biological substances.

2. 2. The nucleic acid extraction vessel according to claim 1, wherein the filter extends along the flow path of the biological material capture region.

3. 3. The nucleic acid extraction container according to claim 1, wherein the sample injection port and the air communication port are arranged on opposite sides of the biological substance capture region.

4. a first flow path communicating the sample injection port with the biological material collection region; a second flow path communicating the sample outlet and the sample permeation area; a third flow path communicating the air communication port with the biological material capture region; The nucleic acid extraction container according to claim 1 or 2, further comprising:

5. 5. The nucleic acid extraction container according to claim 4, wherein the first channel and the third channel extend on opposite sides of the biological material capture region.

6. 6. The nucleic acid extraction container according to claim 4, further comprising a nucleic acid extract inlet and a first branched flow path communicating with the nucleic acid extract inlet, the first branched flow path being connected to the third flow path.

7. 7. The nucleic acid extraction container according to claim 6, wherein a nucleic acid extraction solution is sealed in the first branch flow path, and air is sealed between the region where the nucleic acid extraction solution is present and the filter section.

8. 8. The nucleic acid extraction container according to claim 4, further comprising a nucleic acid extract outlet and a second branched flow path communicating with the nucleic acid extract outlet, the second branched flow path being connected to the third flow path.

9. 9. The nucleic acid extraction container according to claim 8, further comprising an air inlet and a third branch channel communicating with the air inlet, the third branch channel being connected to the third channel.

10. 10. The nucleic acid extraction container according to claim 9, wherein a region of the third flow path between a connection position of the third flow path with the second branch flow path and a connection position of the third flow path with the third branch flow path is configured to dispense a predetermined amount of extraction liquid.

11. 11. The nucleic acid extraction container according to claim 4, wherein a nucleic acid extraction solution is sealed in the third flow path, and air is sealed between the region where the nucleic acid extraction solution is present and the filter section.

12. 11. The nucleic acid extraction container according to claim 9, wherein a nucleic acid extraction solution is sealed in the third branch flow path, and air is sealed between the region where the nucleic acid extraction solution is present and the filter section.

13. 13. The nucleic acid extraction vessel according to claim 4, wherein the average cross-sectional area of ​​the third flow channel is smaller than the average cross-sectional area of ​​the first flow channel.

14. 14. The nucleic acid extraction container according to claim 1, wherein the air communication port is an inlet for injecting a nucleic acid extract solution.

15. 15. The nucleic acid extraction vessel according to claim 1, wherein the filter portion is configured so that the presence or absence of a sample on the filter can be visually confirmed from the outside.

16. a step of passing a sample through a filter section that includes a hydrophilic filter and a biological substance capture region that captures biological substances including nucleic acids on the filter, the biological substance capture region being configured as a flow path that is elongated in the direction of fluid flow along the surface of the filter that captures the biological substances, and capturing the biological substances on the filter; a step of pouring a nucleic acid extract into the biological substance collection region of the filter section and extracting nucleic acids on the filter; recovering the solution containing the extracted nucleic acids on the filter from the filter portion; A method for extracting nucleic acids, comprising:

17. The nucleic acid extraction method according to claim 16, characterized in that the nucleic acids on the filter are extracted by bringing a nucleic acid extract into contact with a portion of the filter and moving the nucleic acid extract in the flow path of the biological substance capture region so that the entire filter comes into contact with the nucleic acid extract.

18. 18. The nucleic acid extraction method according to claim 16, wherein the nucleic acid on the filter is extracted without allowing the nucleic acid extract to pass through the filter.

19. a step of passing a sample through a filter section that includes a hydrophilic filter and a biological substance capture region that captures biological substances including nucleic acids on the filter, the biological substance capture region being configured as a flow path that is elongated in the direction of fluid flow along the surface of the filter that captures the biological substances, and capturing the biological substances on the filter; a step of pouring a nucleic acid extract into the biological substance collection region of the filter section and extracting nucleic acids on the filter; a step of transferring the solution containing the extracted nucleic acid on the filter into a flow path communicating with the filter section; dispensing the nucleic acid-containing solution by injecting air into the channel; A method for extracting nucleic acids, comprising:

20. The nucleic acid extraction method according to claim 19, characterized in that the nucleic acid on the filter is extracted by bringing a nucleic acid extract into contact with a portion of the filter and moving the nucleic acid extract in the flow path of the biological substance capture region so that the entire filter comes into contact with the nucleic acid extract.

21. 18. The nucleic acid extraction method according to claim 16, wherein the nucleic acid on the filter is extracted without allowing the nucleic acid extract to pass through the filter.

Citation Information

Patent Citations

  • Method for separating and purifying nucleic acid

    JP2005185161A

  • Method and system for preparing microfluidic DNA samples

    JP2011528552A

  • Devices and Equipment

    JP2013509173A

  • Nucleic acid extraction kit, nucleic acid extraction method, and nucleic acid extraction apparatus

    JP2017018053A

  • Pressuring adapter for nucleic acid separation device and nucleic acid separation device

    JP2019154333A