Myasthenia gravis treatment drugs

Abstract

To provide a new therapeutic or prophylactic drug for myasthenia gravis that replaces immunosuppressive therapy or can be used in combination with immunosuppressive therapy to inhibit side effects.SOLUTION: The therapeutic or prophylactic drug for myasthenia gravis contains one or more compounds selected from the group consisting of compounds represented by the formula (I) in the figure and the like, or salts thereof.SELECTED DRAWING: None

Description

[Technical Field]

[0001] This invention relates to a therapeutic or prophylactic agent for myasthenia gravis, comprising a specific compound or a salt thereof. [Background technology]

[0002] Myasthenia gravis (MG) is a type of autoimmune disease known to be caused by the binding of anti-AChR antibodies to nicotinic acetylcholine receptors (AChRs) on the muscle side of acetylcholine, thereby inhibiting acetylcholine-mediated nerve impulse transmission at the neuromuscular junction. According to the 2006 nationwide clinical epidemiological survey, the prevalence in Japan is 11.8 cases per 100,000 people, with 1.7 times more female patients than male patients, and a thymoma comorbidity rate of 32.0%.

[0003] The basic treatment for myasthenia gravis (MG) is immunosuppressive therapy, primarily using steroids, with calcineurin inhibitors such as cyclosporine and tacrolimus used as adjunct therapy. Symptomatic treatment with cholinesterase inhibitors is also performed (see, for example, Non-Patent Document 1). However, the remission rate for MG is less than 20%, and long-term administration of immunosuppressants such as steroids is causing problems with side effects such as a decline in patients' quality of life (QOL) and increased susceptibility to infection.

[0004] Incidentally, a new research concept called drug repositioning (DR) is being discussed as a way to overcome the impasse seen in new drug development research in recent years. This involves finding new therapeutic effects from existing drugs whose safety and pharmacokinetics in humans have already been confirmed through proven results, and then bringing them to practical use. There are further advantages, such as being able to keep development costs low because a lot of existing data can be used, and the existence of accumulated know-how and materials (related compounds, etc.). [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Cochrane Database Syst Rev. 2014(10):CD006986 (2014) [Summary of the Invention] [Problems to be Solved by the Invention]

[0006] Therefore, an object of the present invention is to provide a novel therapeutic or prophylactic agent for myasthenia gravis (MG) that can suppress side effects instead of or in combination with conventional therapies such as immunosuppressive therapy. [Means for Solving the Problems]

[0007] The inventors conceived the idea that compounds that inhibit the binding of nicotinic acetylcholine receptors (AChRs) to anti-AChR antibodies could be candidates for the treatment of myelopathy (MG). To identify such compounds, they focused on the main immunogenic region (MIR) of AChR α1, the autoantibody binding site, in more than 50% of MG patients (J Neurosci. 29(44):13898-908 (2009)). First, the inventors predicted compound pockets located near the MIR using computer simulations, and then performed a primary screening of compounds that could bind to these compound pockets. Subsequently, they performed a secondary screening (docking simulation) on the compounds with the highest scores. The computer simulations used the Namiki Virtual Chemical Library and a library of FDA-approved compounds. Then, by selecting several representative compounds from the list of compounds (hit compounds) identified through the above screening and performing a radioimmunoassay (RIA), it was confirmed that these compounds could inhibit the binding of patient autoantibodies to recombinant acetylcholine receptors. Furthermore, it was confirmed that these compounds could inhibit the binding of patient autoantibodies to human iPS cell-derived neuromuscular junctions, and even suppress the internalization of AChR due to binding with these autoantibodies. Based on these findings, the inventors conducted further research and ultimately completed the present invention.

[0008] In other words, the present invention is as follows: [1] The following formula (I):

[0009] [ka]

[0010] [In formula (I), R1 to R4 each independently represent an atom or group selected from the group consisting of a hydrogen atom, a hydroxyl group, and an amino group or an aliphatic group having 1 to 3 carbon atoms, in which case each hydrogen atom may be substituted. Ring A is given by the following equation (II-1) or equation (II-2):

[0011] [ka]

[0012] [In formula (II-1) or formula (II-2), R5~R 12 Each of these independently represents an atom or group selected from the group consisting of a hydrogen atom, a hydroxyl group, and an amino group or an aliphatic group having 1 to 3 carbon atoms, in which case each hydrogen atom may be substituted. Ring B is given by the following equation (III-1) or equation (III-2):

[0013] [ka]

[0014] [In formula (III-1) or formula (III-2), R 13 ~R 19 Each of these independently represents an atom or group selected from the group consisting of a hydrogen atom, a hydroxyl group, and an amino group in which each hydrogen atom may be substituted. Y is an oxygen atom or -C(H)(R 20 )-[R 20 [This indicates an atom or group selected from the group consisting of a hydrogen atom, a hydroxyl group, and an amino group in which each hydrogen atom may be substituted.] m represents an integer between 0 and 2. L may or may not exist, and if it does exist, then the following equations (IV-1), (IV-2), or (IV-3):

[0015] [ka]

[0016] [In formulas (IV-1), (IV-2), or (IV-3), The dotted line indicates that a double bond may be present at any of the positions. X is an oxygen atom or =C(R) 21 )-or-C(H)(R 21 )-[R 21 [This indicates an atom or group selected from the group consisting of a hydrogen atom, a hydroxyl group, and an amino group in which each hydrogen atom may be substituted.] The dotted line indicates that a double bond may exist at any of these positions. A therapeutic or prophylactic agent for myasthenia gravis, comprising one or more compounds selected from the group consisting of the compounds shown and compounds represented by compound numbers 1 to 19, or a salt thereof. [2-1] The therapeutic or prophylactic agent according to [1], wherein R1 in formula (I) is a hydrogen atom or an aliphatic group having 1 to 3 carbon atoms, in which each hydrogen atom may be substituted. [2-2] The therapeutic or prophylactic agent according to [1] or [2-1], wherein R1 in formula (I) is an aliphatic group having at least one amino group. [2-3] The therapeutic or prophylactic agent according to [2-1] or [2-2], wherein the aliphatic group is a methyl group. [3-1] A therapeutic or prophylactic agent according to any one of [1] to [2-3], wherein R4 in formula (I) is an amino group in which each hydrogen atom may be substituted. [3-2] A therapeutic or prophylactic agent according to any one of [1] to [3-1], wherein R4 in formula (I) is an unsubstituted amino group. [3-3] A therapeutic or prophylactic agent according to any one of [1] to [3-2], wherein R2 and R3 in formula (I) are both hydrogen atoms. [3-4] A therapeutic or prophylactic agent according to any one of [1] to [3-2], wherein R2 and R3 in formula (I) are both hydroxyl groups. [4-1] The therapeutic or preventive agent according to any one of [1] to [3-4], wherein R7 in formula (II-1) is an aliphatic group having 1 or 2 carbon atoms in which each hydrogen atom may be substituted. [4-2] The therapeutic or preventive agent according to any one of [1] to [4-1], wherein R7 in formula (II-1) is an aliphatic group having at least one hydroxy group. [4-3] The therapeutic or preventive agent according to [4-1] or [4-2], wherein the aliphatic group is a methyl group. [5-1] The therapeutic or preventive agent according to any one of [1] to [4-3], wherein R9 in formula (II-2) is an amino group in which each hydrogen atom may be substituted. [5-2] The therapeutic or preventive agent according to any one of [1] to [5-1], wherein R9 in formula (II-2) is an amino group having at least one methyl group. [6-1] R in formula (II-2) 10 The therapeutic or preventive agent according to any one of [1] to [5-2], wherein is an aliphatic group having 1 or 2 carbon atoms in which each hydrogen atom may be substituted. [6-2] R in formula (II-2) 10 The therapeutic or preventive agent according to any one of [1] to [6-1], wherein is an aliphatic group having no substituent. [[ID=​​​​​​​​​​​​​​​​​R8 and R in equation (II-2) 11 A therapeutic or prophylactic agent according to any one of [1] to [7-2], wherein at least one of the members is a hydroxyl group. [7-4] R in equation (II-2) 12 A therapeutic or prophylactic agent described in any one of [1] to [7-3], wherein is a hydrogen atom. [8-1] R in equation (III-1) or equation (III-2) 13 ~R 19 The therapeutic or prophylactic agent according to any one of [1] to [7-4], wherein each is independently a hydrogen atom, a hydroxyl group, or an amino group in which each hydrogen atom may be substituted. [8-2] R in equation (III-1) 13 and R 15 However, the therapeutic or prophylactic agent described in any one of [1] to [8-1], wherein the amino group is unsubstituted. [8-3] R in equation (III-1) 14 A therapeutic or prophylactic agent described in any one of [1] to [8-2], wherein is a hydrogen atom. [8-4] R of Y in equation (III-1) 20 A therapeutic or prophylactic agent according to any one of [1] to [8-3], wherein the group is a hydroxyl group. [8-5] R in equation (III-1) 13 ~R 15 A therapeutic or prophylactic agent according to any one of [1] to [8-1], wherein all of the groups are hydroxyl groups. [8-6] A therapeutic or prophylactic agent according to any one of [1] to [8-1] and [8-5], wherein Y in formula (III-1) is an oxygen atom. [8-7] R in equation (III-2) 16 A therapeutic or prophylactic agent according to any one of [1] to [8-1], wherein the group is a hydroxyl group. [8-8] R in equation (III-2) 17 and R 19The therapeutic or prophylactic agent according to any one of [1] to [8-1] and [8-7], wherein the amino group is unsubstituted. [8-9] R in equation (III-2) 18 A therapeutic or prophylactic agent according to any one of [1] to [8-1], [8-7], and [8-8], wherein is a hydrogen atom. [9] A therapeutic or prophylactic agent according to any one of [1] to [8-9], wherein the compound represented by formula (I) is sisomicin, rosarin, or ribostamycin.

[10] A therapeutic or prophylactic agent according to any one of [1] to [9], further comprising an immunosuppressant or a cholinesterase inhibitor.

[11] A method for treating or preventing myasthenia gravis in a mammal, characterized by administering to the mammal an effective amount of one or more compounds selected from the group consisting of the compound represented by formula (I) above and compounds represented by compound numbers 1 to 19, or a salt thereof.

[12] One or more compounds selected from the group consisting of the compound represented by formula (I) above and compounds represented by compound numbers 1 to 19, or a salt thereof, for use in the treatment or prevention of myasthenia gravis.

[13] Use of one or more compounds selected from the group consisting of the compound represented by formula (I) and compounds represented by compound numbers 1 to 19, or a salt thereof, for the manufacture of a drug for the treatment or prevention of myasthenia gravis. [Effects of the Invention]

[0017] According to the present invention, treatment for MG becomes possible. Furthermore, by using it as an adjunct to existing drugs, it is possible to reduce the dosage of existing drugs and suppress side effects. In particular, by using existing drugs whose safety has been confirmed as the active ingredient of the therapeutic agent of the present invention, it is expected that the development period toward clinical application can be shortened. [Brief explanation of the drawing]

[0018] [Figure 1] This shows the compound pocket predicted to be located near the major immunogenicity region (MIR) of the nicotinic acetylcholine receptor (AChR). [Figure 2] This shows the predicted docking position with AChR for the compound with the highest score in computer simulations from the Namiki Virtual Chemical Library. [Figure 3] This shows the predicted docking pose of sisomicin sulfate with AChR. [Figure 4] This diagram shows a schematic representation of the method for inducing differentiation of human iPS cells into motor neurons. [Figure 5] The results of measuring motor neuron-specific gene expression levels in neurons differentiated in the examples are shown. Error bars indicate the standard error, and * indicates p<0.05. n=3 for each example. [Figure 6] The results of immunohistochemical staining in the differentiated nerve cells described in the example are shown. [Figure 7] The results of immunohistochemical staining in co-culture of motor neuron (or similar) cells differentiated in the example and skeletal muscle cells are shown. [Figure 8] This study demonstrates that α-Bungarotoxin covalently binds to AchR. Fluorescently labeled α-Bungarotoxin was used to indicate its location on skeletal muscle. [Figure 9] Similar to Figure 8, α-Bungarotoxin with a fluorescent label was used to indicate its location on skeletal muscle. [Figure 10] Similar to Figure 9, α-Bungarotoxin with a fluorescent label was used to indicate its location on skeletal muscle. [Figure 11] A schematic diagram of the method for evaluating the efficacy of hit compounds is shown. [Figure 12] The results of the efficacy evaluation of the hit compounds (left figure) and a schematic diagram of the estimated mechanism (right figure) are shown. Error bars indicate the standard error, and ** indicates p<0.01. n=5 for both. [Modes for carrying out the invention]

[0019] As shown in the examples below, computer simulations demonstrated that several compounds with high scores inhibit the binding of nicotinic acetylcholine receptors (AChRs) to anti-AChR antibodies, thereby suppressing the internalization of AChRs, which are one of the causes of MG. Therefore, the compounds used in these examples, and other compounds with high scores (hereinafter, these compounds may be collectively referred to as "compounds of the present invention"), can suppress the internalization of AChRs, which are one of the causes of MG, and thereby treat or prevent MG. Accordingly, the present invention provides a therapeutic or prophylactic agent for MG (hereinafter, sometimes referred to as "pharmaceutical of the present invention") containing the compounds of the present invention.

[0020] The pharmaceutical product of the present invention can be administered orally or parenterally as a pharmaceutical composition in a suitable dosage form, either by administering the compound of the present invention, which is the active ingredient, alone, or by mixing it with a pharmacologically acceptable carrier, excipient, diluent, etc. Furthermore, the pharmaceutical product of the present invention can be administered to mammals (e.g., humans, rats, mice, guinea pigs, rabbits, sheep, horses, pigs, cattle, dogs, cattle, monkeys). Therefore, a method for treating or preventing MG in mammals is also provided, characterized by administering an effective amount of the compound of the present invention to the mammal.

[0021] In the present invention, the MG that is the target of treatment or prevention is not particularly limited and may be adult-onset MG or childhood-onset MG, including the neonatal transient type. Furthermore, the MGFA (Myasthenia Gravis Foundation of America) classification includes adult type I (ocular type), adult type II (generalized type), adult type III (acute severe symptoms), adult type IV (late severe type), and adult type V (muscle atrophy type).

[0022] In this specification, "therapeutic drugs" include not only pharmaceuticals aimed at curing MG, but also pharmaceuticals aimed at inhibiting the progression of these diseases, alleviating symptoms (e.g., improving to minimal manifestations MM, where symptoms do not interfere with daily life or work), or reducing sequelae. For example, since myasthenia gravis is a disease that progresses over a long period (usually years), initiating treatment early can prevent the progression of symptoms. Furthermore, in this specification, "preventive drugs" include not only pharmaceuticals aimed at reducing the risk of developing MG in subjects who have not yet developed MG, but also pharmaceuticals aimed at reducing the risk of MG recurrence in subjects who have already developed MG. For example, it is possible to prevent the onset of MG by administering the pharmaceuticals of the present invention to patients who have a genetic background that makes them potentially susceptible to MG before they exhibit symptoms of MG.

[0023] Furthermore, the compounds of the present invention can also be used as inhibitors of the binding of AChR to anti-AChR antibodies or inhibitors of AChR internalization (hereinafter sometimes referred to as "the agents of the present invention"). The agents of the present invention can be prepared as general pharmaceutical compositions or pharmaceutical preparations, or as cosmetics or foods, and administered orally or parenterally. The agents of the present invention can also be used as test reagents. The agents of the present invention can be administered to subjects including humans (e.g., mammals, cells, tissues, organs of mammalian animals, etc.). Therefore, a method for inhibiting the binding of AChR to anti-AChR antibodies or inhibiting the internalization of AChR in a subject, comprising administering the compounds of the present invention to the subject, is also provided.

[0024] Specifically, the compound of the present invention is the following formula (I):

[0025] [ka]

[0026] [In formula (I), R1 to R4 each independently represent an atom or group selected from the group consisting of a hydrogen atom, a hydroxyl group, and an amino group or an aliphatic group having 1 to 3 carbon atoms, in which case each hydrogen atom may be substituted. Ring A is given by the following equation (II-1) or equation (II-2):

[0027] [ka]

[0028] [In formula (II-1) or formula (II-2), R5~R 12 Each of these independently represents an atom or group selected from the group consisting of a hydrogen atom, a hydroxyl group, and an amino group or an aliphatic group having 1 to 3 carbon atoms, in which case each hydrogen atom may be substituted. Ring B is given by the following equation (III-1) or equation (III-2):

[0029] [ka]

[0030] [In formula (III-1) or formula (III-2), R 13 ~R 19 Each of these independently represents an atom or group selected from the group consisting of a hydrogen atom, a hydroxyl group, and an amino group in which each hydrogen atom may be substituted. Y is an oxygen atom or -C(H)(R 20 )-[R 20 [This indicates an atom or group selected from the group consisting of a hydrogen atom, a hydroxyl group, and an amino group in which each hydrogen atom may be substituted.] m represents an integer between 0 and 2 (preferably 0 or 1), L may or may not exist, and if it does exist, then the following equations (IV-1), (IV-2), or (IV-3):

[0031] [ka]

[0032] [In formulas (IV-1), (IV-2), or (IV-3), The dotted line indicates that a double bond may be present at any of the positions. X is an oxygen atom or =C(R) 21 )-or-C(H)(R 21 )-[R 21 [This indicates an atom or group selected from the group consisting of a hydrogen atom, a hydroxyl group, and an amino group in which each hydrogen atom may be substituted.] The dotted line indicates that a double bond may exist at any of these positions. Examples of compounds shown are:

[0033] In one embodiment, a compound is provided in which R1 of formula (I) is a hydrogen atom or a C1-C3 aliphatic group in which each hydrogen atom may be substituted (in other words, may have substituents). When R1 of formula (I) is an aliphatic group, the fatty acid group is a C1 or C2 (preferably C1) aliphatic group (preferably a methyl group) which may have at least one (preferably one) substituent (preferably an amino group). It is also preferable that R4 is an amino group which may have substituents (preferably unsubstituted). It is also preferable that both R2 and R3 are hydrogen atoms or hydroxyl groups.

[0034] The ring C in formula (I) is preferably a ring structure represented by the following formulas (V-1), (V-2), or (V-3).

[0035] [ka]

[0036] [In formulas (V-1), (V-2), and (V-3), R1 to R4 and R 21 The definition and preferred embodiment are the same as the definition and preferred embodiment in formula (I).

[0037] When ring C has the ring structure shown by formula (V-3) above, R1 to R4 and R 21 Preferably, at least one, and preferably all, of these are hydrogen atoms.

[0038] When the ring A of equation (I) is represented by equation (II-1), then R5, R6, R8, R of equation (II-1) 11 and R 12 However, each is preferably independently a hydrogen atom, a hydroxyl group, or an amino group which may have a substituent (preferably without a substituent). In particular, it is more preferable that at least one of R5 and R6, preferably both, are hydroxyl groups. Furthermore, it is preferable that R7 is a fatty acid group (preferably a methyl group) having 1 or 2 carbon atoms (preferably 1 carbon atom) which may have one or more substituents (preferably 1 carbon atom, preferably a hydroxyl group).

[0039] When ring A of formula (I) is represented by formula (II-2), it is preferable that R9 of formula (II-2) is an amino group which may have at least one substituent (preferably a methyl group). 10 However, it is preferable that it be an aliphatic group (preferably a methyl group) having 1 or 2 carbon atoms (preferably 1 carbon atom) which may have at least one substituent (preferably without substituents). Furthermore, R8, R 11 and R 12 However, each is preferably independently a hydrogen atom, a hydroxyl group, or an amino group which may have a substituent (preferably without a substituent). Among these, R8 and R 11 It is more preferable that at least one, preferably both, of are hydroxyl groups. Also, R 12 It is also preferable that it be a hydrogen atom.

[0040] When the ring B of equation (I) is represented by equation (III-1), then R of equation (III-1) 13 ~R 15 and R 20(If present) is preferably independently a hydrogen atom, a hydroxyl group, or an amino group which may have a substituent (preferably without a substituent). In a preferred embodiment, R 13 and R 15 However, it is an amino group that may have a substituent (preferably without a substituent), R 14 is a hydrogen atom, and R 20 Examples include compounds in which R is a hydroxyl group. In another preferred embodiment, R 13 ~R 15 Examples include compounds in which Y is a hydroxyl group and Y is an oxygen atom.

[0041] When the ring B of equation (I) is represented by equation (III-2), then R of equation (III-2) 16 ~R 19 However, each is preferably independently a hydrogen atom, a hydroxyl group, or an amino group which may have a substituent (preferably without a substituent). Among these, R 16 It is preferable that R is a hydroxyl group. 17 and R 19 However, it is preferable that the amino group may have a substituent (preferably unsubstituted). 18 It is also preferable that it be a hydrogen atom.

[0042] If L of formula (I) is present, L is preferably a compound represented by the above formula (IV-3), and among these, the compound represented by the following formula (IV-3-a) is preferred.

[0043] [ka]

[0044] Preferred combinations of rings A to C include: (1) a combination in which ring A is represented by (II-2), ring B is represented by (III-1), and ring C is represented by (V-1); (2) a combination in which ring A is represented by (II-1), ring B is represented by (III-2), and ring C is represented by (V-2); and (3) a combination in which ring A is represented by (II-1), ring B is represented by (III-1), and ring C is represented by (V-3). In the case of combination (1) or (2) above, it is preferable that m is 0 and / or that L is absent. In the case of combination (3) above, it is preferable that m is 1 and / or that L is represented by the above formula (IV-3) (preferably the above formula (IV-3-a)).

[0045] The compounds of the present invention also include those represented by compound numbers 1 to 19, as listed in Tables 1 and 2.

[0046] [Table 1-1]

[0047] [Table 1-2]

[0048] [Table 1-3]

[0049] [Table 2]

[0050] More specific examples of compounds represented by formula (I) above include sisomicin (compound number 2), rosarin (compound number 16), and ribostamycin (compound number 1).

[0051] In this specification, "aliphatic group" means a linear or branched hydrocarbon chain that is fully saturated or contains one or more unsaturated bonds. Examples of aliphatic groups include linear or branched alkyl groups (e.g., methyl group, ethyl group, propyl group, isopropyl group, butyl group, 2-butyl group, 2-methylpropyl group, 1,1-dimethylethyl group, pentyl group, 3-pentyl group, 3-methylbutyl group, hexyl group, 3-hexyl group, etc.) and alkenyl groups (e.g., vinyl group, allyl group, 2-propynyl group, 2-butenyl group, 3-methyl-2-butenyl group). Examples include ethyl methyl groups (such as 3-hexenyl group) and alkynyl groups (e.g., ethynyl group, 1-propynyl group, 2-propynyl group, 1-butynyl group, 2-butynyl group, 3-butynyl group, 1-pentynyl group, 2-pentynyl group, 3-pentynyl group, 4-pentynyl group, 1-hexynyl group, 2-hexynyl group, 3-hexynyl group, 4-hexynyl group, 5-hexynyl group, 4-methyl-2-pentynyl group, etc.).

[0052] In this specification, "each hydrogen atom may be substituted" means that at least one hydrogen atom of the group may be substituted with another atom or group. In other words, a group in which each hydrogen atom may be substituted can be rephrased as a group that may have substituents. Examples of substituents in this specification include halogen atoms, cyano groups, benzyloxy groups, trifluoromethyl groups, hydroxyl groups, lower fatty acid groups, lower alkoxy groups, lower alkanoyloxy groups, amino groups, amino groups, monolower alkylamino groups, dilower alkylamino groups, carbamoyl groups, lower alkylaminocarbonyl groups, dilower alkylaminocarbonyl groups, lower alkoxycarbonylamino groups, carboxyl groups, lower alkoxycarbonyl groups, lower alkylthio groups, lower alkylsulfinyl groups, lower alkylsulfonyl groups, lower alkanoylamino groups, and lower alkylsulfonamide groups. Each hydrogen atom of these substituents may be substituted. In this specification, unless otherwise specified, the term "unsubstituted hydrogen atom" means an unsubstituted group unless otherwise stated. Furthermore, in this specification, "lower" means a group with 5 or fewer carbon atoms (preferably 3 or fewer).

[0053] The compounds of the present invention can be manufactured using commercially available products or by methods known for each compound. For example, the distributors of each compound in the United States can be found on Drugs@FDA, etc.

[0054] The compounds of the present invention include not only the free form but also their pharmaceutically acceptable salts. Pharmacologically acceptable salts vary depending on the type of compound, but examples include inorganic base salts such as alkali metal salts (sodium salts, potassium salts, etc.), alkaline earth metal salts (calcium salts, magnesium salts, etc.), aluminum salts, and ammonium salts, as well as base addition salts such as organic base salts such as trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, and N,N'-dibenzylethylenediamine; or acid addition salts such as inorganic acid salts such as hydrochloride, hydrobromide, sulfate, hydroiodide, nitrate, and phosphate; and organic acid salts such as citrate, oxalate, acetate, formate, propionate, benzoate, trifluoroacetate, maleate, tartrate, methanesulfonate, benzenesulfonate, and p-toluenesulfonate.

[0055] If the compounds of the present invention have isomers such as optical isomers, stereoisomers, positional isomers, and rotational isomers, then any one of these isomers or a mixture thereof is included in the compounds of the present invention. For example, if at least one of compounds 1 to 19 has an optical isomer, then the optical isomers separated from the racemate are also included in the compounds of the present invention. These isomers can each be obtained individually by known synthesis methods, separation methods (e.g., concentration, solvent extraction, column chromatography, recrystallization, etc.), optical resolution methods (e.g., fractional recrystallization, chiral column chromatography, diastereomerization, etc.).

[0056] The compounds of the present invention may be crystalline, and the compounds of the present invention are encompassed whether they are a single crystalline form or a mixture of crystalline forms. Crystals can be produced by crystallization using crystallization methods that are known to the present.

[0057] The compounds of the present invention may be solvates (e.g., hydrates, etc.) or solvates (e.g., nonhydrates, etc.), and both are included in the compounds of the present invention.

[0058] Also, isotopes (e.g., 3 H, 14 C, 35 S, 125 Compounds labeled with (I, etc.) are also included in the compounds of the present invention.

[0059] Compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (including soft capsules), syrups, emulsions, suspensions, etc. On the other hand, compositions for parenteral administration include, for example, injections and suppositories, and injections may include dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, and drip infusions. These preparations contain excipients (e.g., sugar derivatives such as lactose, sucrose, glucose, mannitol, and sorbitol; starch derivatives such as corn starch, potato starch, α-starch, and dextrin; cellulose derivatives such as crystalline cellulose; organic excipients such as gum arabic, dextran, and pullulan; and inorganic excipients such as light anhydrous silicic acid, synthetic aluminum silicate, calcium silicate, and magnesium aluminometasilicate; phosphates such as calcium hydrogen phosphate; carbonates such as calcium carbonate; and sulfates such as calcium sulfate), lubricants (e.g., metal stearates such as stearic acid, calcium stearate, and magnesium stearate; talc; colloidal silica; waxes such as beeswax and gynesium wax; boric acid; adipic acid; sulfates such as sodium sulfate; glycols; fumaric acid; sodium benzoate; DL-leucine; and sodium lauryl sulfate) Lauryl sulfates such as magnesium lauryl sulfate; silicic acids such as anhydrous silicic acid and silicic acid hydrate; and starch derivatives of the above); binders (e.g., hydroxypropyl cellulose, hydroxypropyl methylcellulose, polyvinylpyrrolidone, macrogol, and compounds similar to the above excipients); disintegrants (e.g., cellulose derivatives such as low-substituted hydroxypropyl cellulose, carboxymethyl cellulose, calcium carboxymethylcellulose, and internally crosslinked sodium carboxymethylcellulose; chemically modified starch celluloses such as carboxymethyl starch, sodium carboxymethyl starch, and crosslinked polyvinylpyrrolidone); emulsifiers (e.g., colloidal clays such as bentonite and beegum; metal hydroxides such as magnesium hydroxide and aluminum hydroxide; anionic surfactants such as sodium lauryl sulfate and calcium stearate);It is manufactured by a well-known method using additives such as cationic surfactants (e.g., benzalkonium chloride; and nonionic surfactants (e.g., polyoxyethylene alkyl ethers, polyoxyethylene sorbitan fatty acid esters, sucrose fatty acid esters)), stabilizers (e.g., para-hydroxybenzoic acid esters such as methylparaben and propylparaben; alcohols such as chlorobutanol, benzyl alcohol, and phenylethyl alcohol; benzalkonium chloride; phenols such as phenol and cresol; thimerosal; dehydroacetic acid; and sorbic acid), flavoring and deodorizing agents (e.g., commonly used sweeteners, acidulants, and flavorings), and diluents.

[0060] The dosage of the compound of the present invention, which is the active ingredient of the pharmaceutical or agent of the present invention, may vary depending on various conditions such as the type of compound, the symptoms of the target patient, age, body weight, and drug tolerance. However, for oral administration, a minimum of 0.1 mg (preferably 0.5 mg) and a maximum of 1000 mg (preferably 500 mg) per dose may be administered to an adult 1 to 6 times per day. For parenteral administration, a minimum of 0.01 mg (preferably 0.05 mg) and a maximum of 100 mg (preferably 50 mg) per dose may be administered 1 to 6 times per day. The dosage may be increased or decreased depending on the symptoms. In particular, if the compound of the present invention is already on the market as a pharmaceutical for diseases other than those mentioned above, the appropriate dosage can be selected for each compound within the range in which safety has been confirmed.

[0061] The pharmaceutical or agent of the present invention can be used in combination with surgical therapy for MG (e.g., thymectomy, etc.) or with other therapeutic or prophylactic agents for MG (hereinafter sometimes referred to as "existing drugs") (e.g., immunosuppressants, cholinesterase inhibitors, immunoglobulins, etc.). Accordingly, in one embodiment of the present invention, a therapeutic or prophylactic agent for GM is provided, comprising the compound of the present invention and one or more existing drugs.

[0062] Examples of the above-mentioned immunosuppressants include steroids (e.g., prednisone, prednisolone, lindelon, etc.), calcineurin inhibitors (e.g., tacrolimus, cyclosporine, etc.), azathioprine, cyclophosphamide, and rituximab. Examples of the above-mentioned cholinesterase inhibitors include ambenonium (trade name: Myterase), pyridostigmine (trade name: Mestinon), distigmine (trade name: Ubretid), neostigmine (trade name: Wagostigmine), and edrophonium (trade name: Antirex). These compounds or their salts can also be used in combination as appropriate.

[0063] As mentioned above, remission of MG is difficult to achieve, so MG treatment is usually long-term, and the effects of side effects from the administration of existing drugs such as immunosuppressants and cholinesterase inhibitors increase. Therefore, by using the pharmaceutical product of the present invention as an adjunct to existing drugs, it is possible to reduce the dosage of existing drugs and suppress side effects. Furthermore, as a treatment strategy for MG, a treatment method (early intensive treatment strategy) has been proposed in which oral steroids are used in small amounts, calcineurin inhibitors are used aggressively from an early stage, and the remaining MG symptoms are improved in a short period of time with strong and rapid-acting treatments. The pharmaceutical product of the present invention may also be useful in such an early intensive treatment strategy.

[0064] When used as a concomitant agent, such concomitant agent may be formulated together with the compound of the present invention and administered as a single formulation, or it may be formulated separately from the compound of the present invention (for example, as a kit) and administered simultaneously or with a time delay via the same or a different route as the pharmaceutical or agent of the present invention. Furthermore, the dosage of these concomitant agents may be the amount normally used when the drug is administered alone, or it may be reduced from the amount normally used.

[0065] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples. [Examples]

[0066] Example 1: Computer Simulation This example uses myPresto, a collection of molecular simulation calculation programs created for drug development support and provided free of charge by the Bio-Industry Information Consortium (JBIC: TIME24 Building 10F, 2-4-32 Aomi, Koto-ku, Tokyo 135-8073, Japan). First, the three-dimensional structure information (ID: 2BG9) of the AchRα subunit was obtained from the Protein Database (PDB). Next, a program named MolSite, included in myPresto, was used to search for molecular pockets located near the MIR site of AchR. Then, a docking simulation of a compound library was performed on these pockets using a program named (sievgene_M).

[0067] Based on the scores shown in these results, top-performing compounds were selected. Furthermore, for these compounds, the delta G value, which represents the change in free energy in the simulated bond, and the root-mean-square deviation of atomic positions (RMSD), which is an indicator of the accuracy of bond prediction, were calculated, and a secondary screening was performed based on these results. The group of compounds with high scores in this second screening was compiled into a list (Table 1 above). In addition, only compound pockets closer to MIR were screened, and some of the hit compounds were compiled into a list (Table 2 above).

[0068] Example 2: Radioimmunoassay This assay was conducted by RSR Limited (Avenue Park Pentwyn Cardiff CF23 8HE) RiaRSR (United Kingdom) TM The tests were conducted in accordance with the AChRAb operating instructions. The test results described herein were performed by SRL Co., Ltd. (2-1-1 Nishi-Shinjuku, Shinjuku-ku, Tokyo).

[0069] The results are shown in Table 3. Rosarin, ribostamycin, and sisomicin were all confirmed to inhibit the binding of AChR to autoantibodies (anti-AChR antibodies). Among them, sisomicin showed the highest inhibitory effect.

[0070] [Table 3]

[0071] Example 3: Evaluation of the efficacy of the hit compound The efficacy of the hit compounds was evaluated using motor neurons. First, motor neurons were differentiated from human iPS cells. Human iPS cells maintained in culture were detached using TrypLE Express (Thermo Fisher Scientific Inc.) and centrifuged at 120×g, 25°C for 5 minutes. The supernatant was then removed using an aspirator, and the cells were suspended in 2 mL of Dulbecco's phosphate buffer saline(-) (D-PBS(-), Nacalai Tesque Co., Ltd., Kyoto) containing 0.15% bovine serum albmin (BSA, Thermo Fisher Scientific Inc.). In a 6 cm dish coated with Matrigel (Thermo Fisher Scientific Inc., MA, USA), DMEM / F12 (Fujifilm Wako Pure Chemical Industries, Ltd., Osaka):Neurobasal medium (Thermo Fisher Scientific Inc.) = 1:1, 10% Knockout Serum Replacement (Thermo Fisher Scientific Inc.), 1% Non-Essential Amino Acid (Sigma-Aldrich Inc., MO, USA), 1% GlutaMAX (Thermo Fisher Scientific Inc.), and 3 μM CHIR99021 (Cayman Chemical Company Inc., MI, USA), 2.5 μM Dorsomorphin (Cayman Chemical Company Inc.), and 10 μM SB431542 (Tokyo Chemical Industries, Ltd.) were added as differentiation-inducing factors for neural crest cells. In this mixture, 0.5 × 10⁶ human iPS cells prepared earlier were added. 6The cells were seeded individually and cultured for 3 days. During this time, 10 μM Y-27632 was added to prevent cell death of the human iPS cells. Differentiated neural crest cells were then mixed with MN basal medium (DMEM / F12:Neurobasal medium = 1:1, 10% Knockout Serum Replacement, 1% Non-Essential Amino Acid, 1% GlutaMAX, 1% B-27 (Thermo Fisher Scientific Inc.), 1% N-2 (Thermo Fisher Scientific Inc.), 0.1 mM L-ascorbic acid (Sigma-Aldrich Inc.)), 3 μM CHIR99021, 2.5 μM Dorsomorphin, and 10 μM SB431542. Furthermore, 1 μM Purmmorphamine (Cayman Chemical Company Inc.), 1 μM Smoothened agonist (SAG) Dihydrochloride (AdipoGen Life Sciences Inc., Basel, Switzerland), and 100 ng / ml Sonic hedgehog (SHH) (Pepro Tech Inc. NJ, USA) were added to provide ventral positional information, and the cells were cultured for 4 days. Subsequently, 1 μM Purmmorphamine, 1 μM SAG Dihydrochloride, 100 ng / ml SHH, and 1 μM All-trans retinoic acid (Fujifilm Wako Pure Chemical Industries, Ltd.), which provides thoracic positional information, were added to MN basal medium and the cells were cultured. 11-14 days after the start of differentiation induction, 1 mL of Accutase (Innovative Cell Technologies Inc., CA, USA) was added, the cells were detached, and collected. Then, 1000 cells / well were seeded into a 96-well plate (Sumitomo Bakelite Co., Ltd., Tokyo), and cultured in MN basal medium for 10-20 days to form spheres.

[0072] Next, the gene expression levels and protein expression patterns in the obtained motor neurons were investigated. The culture medium was removed from the human iPS cell-derived NMJ model, 2 mL of Dulbecco's phosphate buffer saline(-) containing 0.15% bovine serum albmin was added, and after washing, 500 μL of ISOGEN (Nippon Gene Co., Ltd., Tokyo) was added and the cells were collected using a cell scraper (Sumitomo Bakelite Co., Ltd.). Undifferentiated human iPS cells were detached using TrypLE Express and centrifuged at 120 × g, 25°C for 5 minutes. The supernatant was then removed using an aspirator, 500 μL of ISOGEN was added, and the cells were collected. 100 μL of chloroform (Fujifilm Wako Pure Chemical Industries, Ltd.) was added to both the human iPS cell-derived NMJ recovery solution and the undifferentiated human iPS cell recovery solution, and the mixture was vigorously shaken for 15 seconds. After standing at room temperature for 3 minutes, the mixture was centrifuged at 12000 × g, 4°C for 10 minutes. Only the uppermost aqueous phase was collected, 250 μL of 2-propanol (Fujifilm Wako Pure Chemical Industries, Ltd.) was added, and the mixture was left at room temperature for 10 minutes. Then, it was centrifuged at 12000 × g at 4°C for 10 minutes. The supernatant was removed, 1 mL of 70% ethanol was added and vortexed, and then the mixture was centrifuged at 7500 × g at 4°C for 5 minutes. After that, the supernatant was removed, the mixture was air-dried for 15 minutes, and then 30 μL of diethylpyrocarbonate (DEPC) treated water (Nacalai Tesque Corporation) was added to obtain total RNA.

[0073] The reverse transcription reaction was performed using the Verso cDNA Synthesis Kit (Thermo Fisher Scientific Inc.). 4 μL of 5×cDNA Synthesis buffer, 2 μL of dNTP Mix, 1 μL of RNA Primer (anchored oligo dT), 1 μL of RT Enhancer, 1 μL of Verso Enzyme Mix, and 2 μg / tube of total RNA prepared by the above method were added. DEPC-treated water was then added to a 200 μL PCR tube until the total volume was 20 μL. The reaction was then carried out using a thermal cycler (PC320, Astec Co., Ltd., Fukuoka) at 42°C for 31 minutes, 95°C for 2 minutes, and 4°C to produce cDNA. To 100 ng / 1 μL of the obtained cDNA, 10 μL of Power SYBR® Green PCR Master Mix (×2) (applied biosystems Inc., MA, USA), 0.5 μL of 50 μM Forward Primer, 0.5 μL of 50 μM Reverse Primer, and 8 μL of DEPC-treated water were added to a 100 μL PCR tube. The results were analyzed by real-time PCR using Rotor-Gene Q (QIAGEN Sciences Inc, MD, USA) (holding stage: 95°C 10 min, cycling stage: 95.0°C 30 sec, 50°C 30 sec, and 72.0°C 1 min for 45 cycles, get signal: 72.0°C). The primers used in real-time PCR are as follows.

[0074] hChAT-Fw (Fasmac Co., Ltd., Kanagawa) GGAGGCGTGGAGCTCAGCGACACC (Sequence ID 1) hChAT-Rv (Fasmac Co., Ltd.) CGGGGAGCTCGCTGACGGAGTCTG (Sequence ID 2) hIslet1(primer 1)-Fw(Fasmac Co., Ltd.)AAGGACAAGAAGCGAAGCAT(Sequence ID 3) hIslet1(primer 1)-Rv(FASMAC Corporation)TTCCTGTCATCCCCTGGATA(Sequence ID 4) hIslet1(primer 2)-Fw(Fasmac Co., Ltd.)GTTACCAGCCACCTTGGAAA(Sequence ID 5) hIslet1(primer 2)-Rv(FASMAC Corporation)GGACTGGCTACCATGCTGTT(Sequence ID 6) Olig2-Fw (Fasmac Co., Ltd.) AGCTCCTCAAATCGCATCC (Sequence ID 7) Olig2-Rv (Fasmac Co., Ltd.) ATAGTCGTCGCAGATTTCG (Sequence ID 8) h18S-Fw (Fasmac Co., Ltd.) TCAACTTTCGATGGTAGTCGCC (Sequence ID 9) h18S-Rv (Fasmac Co., Ltd.) TCCTTGGATGTGGTAGCCGTTTCT (Sequence ID 10)

[0075] The results are shown in Figures 5 and 6. Figures 5 and 6 confirm the presence of motor neurons.

[0076] Human iPS cell-derived skeletal myoblasts were differentiated. Human iPS cell colonies were cultured for 6 days in a Matrigel-coated 6-well plate (CORNING Inc.) with DMEM / F12 (Fujifilm Wako Pure Chemical Industries, Ltd.) supplemented with 1x concentration ITS (Thermofisher) and 3.5 μM CHIR99021. They were then cultured for 10 days in DMEM / F12 supplemented with 1x concentration ITS (Thermofisher) and 20 ng / ml bFGF (Fujifilm Wako Pure Chemical Industries, Ltd.). Subsequently, human iPS cell-derived skeletal myoblasts were obtained by culturing for 10 days in DMEM / F12 supplemented with 1x concentration ITS (Thermofisher).

[0077] Next, DMEM (Low Glucose) (Fujifilm Wako Pure Chemical Industries, Ltd.), 5% FCS (Cytiva Inc., ON, Canada), 10 μM SB431542, and 10 μM N-[(3,5-Difluorophenyl)acetyl]-L-alanyl-2-phenyl]glycine-1,1-dimethylethyl ester (DAPT, Sigma-Aldrich Inc.) were added to a Matrigel-coated 6-well plate (CORNING Inc.). 1 / 16 of the human iPS cell-derived myoblasts recovered from a T75 flask (Thermo Fisher Scientific Inc.) were seeded and differentiated into skeletal muscle cells.

[0078] Finally, the motor neuron clusters and skeletal muscle cells were co-cultured and cultured for about one week. After collecting the prepared motor neuron spheres, 8 spheres / well were added to a 6-well plate containing human iPS cell-derived skeletal muscle cells. MN basal medium, nerve growth factors 10 ng / mL CNTF (Pepro Tech Inc.), 10 ng / mL BDNF (Bio Legend Inc., CA, USA), 10 ng / mL NT-3 (Bio Legend Inc.), and 10 ng / mL GDNF (Pepro Tech Inc.) were added, and the cells were co-cultured. Nerve axons were observed extending from the motor neuron clusters and connecting to surrounding skeletal muscle cells. Figure 7 shows the morphological presence of the neuromuscular junction.

[0079] Figures 8-10 show that neuromuscular junctions, which are clusters of acetylcholine receptors, are formed adjacent to individual skeletal muscle cells. The culture medium was removed from the human iPS cell-derived NMJ model, washed with 2 mL of D-PBS (-) containing 0.15% BSA, then 1 mL of 4% paraformaldehyde (Fujifilm Wako Pure Chemical Corporation) was added and left at room temperature for 10 minutes. Subsequently, the 4% paraformaldehyde was removed, and the cells were washed with 2 mL of a mixture of 1× Tris Buffered Saline (Nacalai Tesque Co., Ltd.) and 0.1 w / v% Tween 20 (Nacalai Tesque Co., Ltd.) (TBS-T), then 1 mL of Immunoblock (K.A.C. Co., Ltd., Kyoto) containing Block Ace (K.A.C. Co., Ltd.) was added and the cells were left to stand at 4°C. After 24 hours, the immunoblock containing Block Ace was removed, and 100 μL each of Anti-HB9 mouse monoclonal antibody (Divelopmental Studies Hybridoma Bank, IA, USA) and Anti-Neurofilament rabbit polyclonal antibody (Sigma-Aldrich Inc.), diluted 100-fold with an equal mixture of the immunoblock containing Block Ace and TBS-T, was added, and the mixture was allowed to stand at 4°C. After 24 hours, the mixture was washed twice with 1 mL of TBS-T, and 100 μL each of Alexa Fluor 546-labeled donkey (anti-rabbit IgG(H+L))IgG (Thermo Fisher Scientific Inc.) and Alexa Fluor 488-labeled donkey (anti-mouse IgG(H+L))IgG (Thermo Fisher Scientific Inc.), diluted 100-fold with an equal mixture of the immunoblock containing Block Ace and TBS-T, was added, and the mixture was allowed to stand at 4°C. After 24 hours, the sample was washed three times with 2 mL of TBS-T, and 1 mL of 4,6-diamidino-2-phenylindole (DAPI, Molecular Probes Inc., OR, USA) diluted 1000-fold with TBS-T was added. The sample was left at room temperature for 5 minutes. Subsequently, it was washed three times with 2 mL of TBS-T and observed using a fluorescence microscope (ECLIPSE Ti2-E / B, Nikon Corporation, Tokyo).

[0080] Finally, the efficacy of the hit compound was evaluated using the skeletal muscle-neuron co-culture system with the obtained neuromuscular junction. A summary of the evaluation method is shown in Figure 11. A 20% MG patient serum (AChR Ab "Cosmic II" positive control, Cosmic Corporation, Tokyo) was added to the prepared human iPS cell-derived NMJ model to create the MG model. Two samples were prepared: one with sisomicin, the hit compound, added at a concentration of 10 μM, and another with the same amount of solvent added. These samples were cultured for 24 hours. The culture medium was removed using an aspirator, and 1 μL of α-BTX CF(registered trademark) 555 conjugate (Biotium Inc., CA, USA) was added to 1 mL of MN basal medium and left at 37°C for 60 minutes. Afterward, the samples were washed twice with 1 mL of MN basal medium, and one field of view (1.69 mm) was examined using a fluorescence microscope (ECLIPSE Ti2-E / B) to evaluate the efficacy of the hit compound. 2 The number of AChR detected per α-BTX CF(registered trademark) 555 conjugate was counted in 5 randomly selected fields of view.

[0081] The results are shown in Figure 12. From Figure 12, it was confirmed that the internalization of AChR was significantly suppressed by adding the hit compound.

[0082] Based on these results, it was confirmed that the hit compounds can inhibit the binding of patient autoantibodies to the neuromuscular junction derived from human iPS cells, and furthermore, can suppress the internalization of AChR through binding with these autoantibodies. Therefore, these compounds are strongly suggested to exert therapeutic or prophylactic effects on MG. [Industrial applicability]

[0083] The compounds of the present invention are useful for the treatment or prevention of myasthenia gravis. Furthermore, the compounds of the present invention are also useful as adjunctive agents for the treatment of myasthenia gravis. In particular, because drugs already marketed for other diseases have accumulated clinical and nonclinical data on safety, etc., and a library of related compounds already exists, there is a possibility of developing drugs capable of treating or preventing myasthenia gravis quickly and at low cost.

Claims

1. A therapeutic or prophylactic agent for myasthenia gravis, comprising one or more compounds selected from the group consisting of sisomicin, rosarin, and ribostamycin, or a salt thereof.

2. The therapeutic or prophylactic agent according to claim 1, comprising at least sisomicin or a salt thereof.

3. The therapeutic or prophylactic agent according to claim 1 or 2, further comprising an immunosuppressant or a cholinesterase inhibitor.

4. An inhibitor for the binding of AChR to an anti-AChR antibody, comprising one or more compounds selected from the group consisting of sisomicin, rosarin, and ribostamycin, or a salt thereof.

Images