Treatment of tumors with a combination of oncolytic adenovirus, CDK4 / 6 inhibitors, and further therapeutically active drugs.

Combining oncolytic adenoviruses with CDK4/6 inhibitors and additional agents addresses the limitations of current tumor treatments by enhancing tumor-specific replication and reducing normal tissue damage, thereby improving therapeutic efficacy.

JP7834342B2Active Publication Date: 2026-03-24KLINIKUM REKHTS DER IZAR DER TEKHNISHEN UNIV MYUNKHEN
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2020-09-07
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Current tumor treatment methods using oncolytic viruses, such as adenoviruses, face limitations in efficacy due to their selective replication in tumor cells, leading to potential side effects on normal tissues.

Method used

Combining oncolytic adenoviruses with CDK4/6 inhibitors, such as palbociclib, and additional agents like PARP inhibitors or bromodomain inhibitors, to enhance tumor-specific viral replication and reduce normal tissue damage.

Benefits of technology

The combination increases the efficacy of tumor treatment by selectively targeting and replicating within tumor cells, minimizing damage to normal tissues and enhancing therapeutic outcomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007834342000013
    Figure 0007834342000013
  • Figure 0007834342000014
    Figure 0007834342000014
  • Figure 0007834342000015
    Figure 0007834342000015
Patent Text Reader

Abstract

The present invention relates to the combination of an adenovirus, a CDK4 inhibitor and at least one further agent selected from the group comprising a PARP inhibitor, a bromodomain inhibitor, a nutlin or a nutlin derivative.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to combinations of oncolytic viruses and CDK4 / inhibitors, the use of such combinations in the treatment of diseases, e.g., tumors, oncolytic viruses combined with CDK4 / 6 inhibitors, preferably oncolytic adenoviruses, and CDK4 / 6 inhibitors combined with oncolytic viruses, preferably oncolytic adenoviruses, for use in the treatment of diseases, e.g., tumors.

[0002] Currently, numerous treatment concepts are used to treat tumors. Besides surgery, chemotherapy and radiotherapy are dominant. However, all of these techniques come with considerable side effects. The use of replication-selective oncolytic viruses provides a new platform for tumor treatment. In this context, selective intratumoral replication of the viral agent is initiated, leading to viral replication, lysis of infected tumor cells, and spread of the virus to adjacent tumor cells. Because the viral replication ability is limited to tumor cells, normal tissues are spared from replication and therefore spared from viral lysis.

[0003] The fundamental problem of this invention is to provide means for increasing the efficacy of tumor treatments based on oncolytic viruses, and in particular, adenoviruses.

[0004] These and other issues are resolved by the subject matter of the attached independent claims, and preferred embodiments can be adopted from the attached dependent claims.

[0005] Furthermore, the underlying problem of the present invention is also solved in the first embodiment. The first embodiment is also a first embodiment of such a first embodiment, comprising a combination of adenovirus, a CDK4 / 6 inhibitor, and at least one further agent selected from the group including PARP inhibitors, bromodomain inhibitors, and nutrin or nutrin derivatives.

[0006] Further embodiments of this first embodiment are disclosed below.

[0007] Embodiment 2: A combination of Embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0008] Embodiment 3: A combination of any one of Embodiments 1 and 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0009] Embodiment 4: A combination of Embodiment 3, in which the adenovirus fails to replicate in cells lacking YB-1 in the nucleus, but replicates in cells containing YB-1 in the nucleus.

[0010] Embodiment 5: Any one combination of Embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, the oncogene protein transactivates at least one adenovirus gene, the adenovirus gene being selected from the group comprising E1B55kDa, E4orf6, E4orf3, and E3ADP.

[0011] Embodiment 6: A combination of Embodiment 5, wherein the oncogene protein is the E1A protein.

[0012] Embodiment 7: A combination of Embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0013] Embodiment 8: A combination of Embodiment 6, wherein the E1A protein is unable to bind to the functional Rb tumor suppressor gene product.

[0014] Embodiment 9: Any one combination of Embodiments 6-8, wherein the E1A protein does not induce nuclear localization of YB-1.

[0015] Embodiment 10: Any one combination of Embodiments 5 to 9, wherein the cancer gene protein exhibits one or more mutations or deletions as compared to the wild-type cancer gene protein E1A.

[0016] Embodiment 11: The combination of Embodiment 10, wherein the deletion is selected from the group consisting of a deletion of the CR3 stretch and deletions at the N-terminus and C-terminus.

[0017] Embodiment 12: Any one combination of Embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0018] Embodiment 13: Any one combination of Embodiments 6 to 12, wherein the E1A protein contains one or more mutations or deletions as compared to the wild-type cancer gene protein, and wherein the deletion is preferably a deletion in the CR1 region and / or the CR2 region.

[0019] Embodiment 14: The combination of Embodiment 13, wherein the E1A protein is incapable of binding to Rb.

[0020] Embodiment 15: Any one combination of Embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A-12S protein.

[0021] Embodiment 16: Any one combination of Embodiments 1 to 15, wherein the virus is an adenovirus lacking the expression of the E1A-13S protein.

[0022] Embodiment 17: Any one combination of Embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenovirus E3 region.

[0023] Embodiment 18: Any one combination of Embodiments 1 to 17, wherein the virus is an adenovirus lacking the expression of the E1B 19 kDa protein.

[0024] Embodiment 19: Any one combination of Embodiments 1 to 18, wherein the virus is an adenovirus expressing the RGD motif in the fiber.

[0025] Embodiment 20: Any one combination of Embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0026] Embodiment 21: Any one combination of Embodiments 1 to 20, wherein the adenovirus is selected from the group including XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev, and viruses lacking expressed viral oncogenes capable of binding to functional Rb tumor suppressor gene products.

[0027] Embodiment 22: A combination of Embodiment 21, wherein the adenovirus is XVir-N-31.

[0028] Embodiment 23: A combination of Embodiment 21, wherein the adenovirus is dl520, and the adenovirus E3 region is functionally inactive.

[0029] Embodiment 24: Any combination of Embodiments 21-23, wherein the adenovirus is dl520, where dl520 lacks expression of the E1B 19kDa protein.

[0030] Embodiment 25: Any one combination of Embodiments 21-24, wherein the adenovirus is dl520, which expresses the RGD motif in the fiber.

[0031] Embodiment 26: A combination of any one of Embodiments 1 to 25, wherein the virus encodes YB-1.

[0032] Embodiment 27: A combination of Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter, and / or a YB-1-dependent promoter.

[0033] Embodiment 28: A combination of Embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0034] Embodiment 29: Any one combination of Embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in cells, preferably tumor cells.

[0035] Embodiment 30: Any one combination of Embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in cells, preferably tumor cells.

[0036] Embodiment 31: Any one combination of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group including palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0037] Embodiment 32: Any one combination of Embodiments 1 to 31, wherein a CDK4 / 6 inhibitor stops cells at G1 and inhibits E2F1.

[0038] Embodiment 33: A combination of any one of Embodiments 1 to 32, wherein the composition further comprises a PARP inhibitor.

[0039] Embodiment 34: A combination of Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, lucaparib, and BMN673.

[0040] Embodiment 35: A combination of any one of Embodiments 1 to 32, wherein the composition further comprises a bromodomain inhibitor.

[0041] Embodiment 36: A combination of Embodiment 35, wherein the bromodomain inhibitor is selected from the group including JQ-1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1, and MS436.

[0042] Embodiment 37: A combination of any one of Embodiments 1 to 36, wherein the composition further comprises nutrin or a nutrin derivative.

[0043] Embodiment 38: The composition of Embodiment 37, wherein nutrin is nutrin-3.

[0044] Embodiment 39: The compositions of Embodiments 37 and 38, wherein the nutrin derivative is selected from the group including NVP-HDM201, idasanutrin, AM-8553, SAR405838, nutrin-3a, and AMG232.

[0045] Embodiment 40: Any one of the combinations from Embodiments 1 to 39, wherein the components of the combination are to be administered separately.

[0046] Embodiment 41: Any one of the combinations from Embodiments 1 to 39, wherein the components of the combination are for concomitant administration.

[0047] Furthermore, the underlying problem of the present invention is also solved in a second embodiment. The second embodiment is also a first embodiment of such a second embodiment, comprising a combination of the first embodiment (including any embodiment thereof) for use in the treatment of disease, more preferably tumor or cancer, comprising an adenovirus and a CDK4 / 6 inhibitor.

[0048] Further embodiments of this second embodiment are disclosed below.

[0049] Embodiment 1: For use in methods for the treatment and / or prevention of diseases, preferably tumors or cancer, comprising an adenovirus and a CDK4 / 6 inhibitor, combination.

[0050] Embodiment 2: A combination for use of Embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0051] Embodiment 3: A combination of the use of either Embodiment 1 or 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0052] Embodiment 4: A combination for use in Embodiment 3, wherein the adenovirus is replication-deficient in cells lacking YB-1 in the nucleus, but replicates in cells possessing YB-1 in the nucleus.

[0053] Embodiment 5: A combination for use of any one of Embodiments 2-4, wherein the adenovirus encodes an oncogene protein, the oncogene protein transactivates at least one adenovirus gene, the adenovirus gene being selected from the group comprising E1B55kDa, E4orf6, E4orf3, and E3ADP.

[0054] Embodiment 6: A combination for use in Embodiment 5, wherein the oncogene protein is the E1A protein.

[0055] Embodiment 7: A combination for use in Embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0056] Embodiment 8: A combination for use in Embodiment 6, wherein the E1A protein is incapable of binding to the functional Rb tumor suppressor gene product.

[0057] Embodiment 9: A combination of any one of Embodiments 6-8, wherein the E1A protein does not induce nuclear localization of YB-1.

[0058] Embodiment 10: A combination for the use of any one of Embodiments 5-9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0059] Embodiment 11: A combination for use of Embodiment 10, wherein the deletion is selected from the group including deletions of the CR3 stretch, as well as deletions of the N-terminus and deletions of the C-terminus.

[0060] Embodiment 12: A combination for use of any one of Embodiments 6-11, wherein the E1A protein is capable of binding to Rb.

[0061] Embodiment 13: A combination for use of any one of Embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletion is preferably in the CR1 region and / or the CR2 region.

[0062] Embodiment 14: A combination for use in Embodiment 13, wherein the E1A protein is incapable of binding to Rb.

[0063] Embodiment 15: A combination for the use of any one of Embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0064] Embodiment 16: A combination for the use of any one of Embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0065] Embodiment 17: A combination for use of any one of Embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenovirus E3 region.

[0066] Embodiment 18: A combination for the use of any one of Embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19kDa protein.

[0067] Embodiment 19: A combination for use of any one of Embodiments 1 to 18, wherein the virus is an adenovirus expressing the RGD motif in the fiber.

[0068] Embodiment 20: A combination for use of any one of Embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0069] Embodiment 21: A combination for use of any one of Embodiments 1 to 20, wherein the adenovirus is selected from the group including XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev, and viruses lacking expressed viral oncogenes capable of binding to functional Rb tumor suppressor gene products.

[0070] Embodiment 22: A combination for use of Embodiment 21, wherein the adenovirus is XVir-N-31.

[0071] Embodiment 23: A combination for use of Embodiment 21, wherein the adenovirus is dl520, where the adenovirus E3 region is functionally inactive.

[0072] Embodiment 24: A combination for the use of any one of Embodiments 21-23, wherein the adenovirus is dl520, where dl520 lacks expression of the E1B 19kDa protein.

[0073] Embodiment 25: A combination for the use of any one of Embodiments 21-24, wherein the adenovirus is dl520 expressing the RGD motif in the fiber.

[0074] Embodiment 26: A combination of any one of Embodiments 1 to 25, wherein the virus encodes YB-1.

[0075] Embodiment 27: A combination for use in Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter, and / or a YB-1-dependent promoter.

[0076] Embodiment 28: A combination for use of Embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0077] Embodiment 29: A combination for the use of any one of Embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in cells, preferably tumor cells.

[0078] Embodiment 30: A combination for the use of any one of Embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in cells, preferably tumor cells.

[0079] Embodiment 31: A combination for use of any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group including palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0080] Embodiment 32: A combination of any one of Embodiments 1-31, in which a CDK4 / 6 inhibitor stops cells at G1 and inhibits E2F1.

[0081] Embodiment 33: A combination for use of any one of Embodiments 1 to 32, wherein the composition further comprises a PARP inhibitor.

[0082] Embodiment 34: A combination for use of Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, lucaparib, and BMN673.

[0083] Embodiment 35: A combination for use of any one of Embodiments 1 to 32, wherein the composition further comprises a bromodomain inhibitor.

[0084] Embodiment 36: A combination for use of Embodiment 35, wherein the bromodomain inhibitor is selected from the group including JQ-1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1, and MS436.

[0085] Embodiment 37: A combination for use in any one of Embodiments 1 to 36, wherein the components of the combination are for separate administration.

[0086] Embodiment 38: Tumor cells in which the CDK4 / 6 signaling pathway is disrupted, a combination for the use of any one of Embodiments 1-37.

[0087] Embodiment 39: A combination for the use of any one of Embodiments 1 to 38, wherein tumor cells have an uncontrolled G1-S transition of the cell cycle.

[0088] Embodiment 40: A combination for use of any one of Embodiments 1 to 38, wherein tumor cells have a loss-of-function mutation or deletion in a gene selected from the group including the RB1 gene, the CDKN2A gene, and the CDKN2B gene.

[0089] Embodiment 41: A combination for the use of any one of Embodiments 1 to 38, wherein tumor cells have gene amplification and / or gene activation mutations.

[0090] Embodiment 42: A combination for use of Embodiment 41, wherein the gene is selected from the group comprising CCND1, E2F1, E2F2, E2F3, CDK4, and CDK6.

[0091] Embodiment 43: A combination for use of Embodiment 41, wherein the gene is a gene encoding a component of a mitogenic signaling pathway.

[0092] Embodiment 44: A combination for use of Embodiment 43, wherein the mitotic signaling pathway is selected from the group including the PI3K pathway and the MAPK pathway.

[0093] Embodiment 45: A combination of any one of Embodiments 1 to 44 for use, wherein tumor cells are resistant to or insensitive to one or more pharmaceutically active agents and / or radiation.

[0094] Embodiment 46: A combination for use of Embodiment 45, wherein the pharmaceutically active agent is a cell division inhibitor.

[0095] Embodiment 47: A combination for use of claim 46, wherein resistance is mediated by ABC transporters.

[0096] Embodiment 48: A combination for use of claim 47, wherein the ABC transporter is selected from the group including MRP and MDR, in particular MDR-1.

[0097] Embodiment 49: A combination for use of any one of Embodiments 45-48, wherein the resistance is multiple resistance or polyresistance, in particular to cell division inhibitors and / or radiation.

[0098] Embodiment 50: A combination for use of any one of Embodiments 1 to 49, wherein the tumor cells are Rb-positive.

[0099] Embodiment 51: A combination for the use of any one of Embodiments 1 to 50, wherein tumor cells have YB-1 in their nucleus.

[0100] Embodiment 52: A combination for the use of any one of Embodiments 1 to 51, wherein tumor cells have YB-1 in the nucleus after induction.

[0101] Embodiment 53: A combination for use of Embodiment 52, wherein the transport of YB-1 to the nucleus is induced by at least one means selected from the group including irradiation, administration of cell division inhibitors, and hyperthermia.

[0102] Embodiment 54: A combination for use of Embodiment 53, wherein the means is applied to cells, organs, or organisms, preferably organisms that require it, more preferably organisms suffering from tumors.

[0103] Embodiment 55: A combination for use of any one of claims 1 to 54, wherein the tumor is selected from the group including bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer, and leukemia.

[0104] Furthermore, the underlying problem of the present invention is also solved in a third embodiment. The third embodiment is also a first embodiment of such a third embodiment by adenovirus for use in the treatment and / or prevention of diseases, more preferably tumors or cancers, in a subject. The method here comprises administering an adenovirus and a CDK4 / 6 inhibitor to the subject.

[0105] Further embodiments of this third aspect are disclosed below.

[0106] Embodiment 2: An adenovirus for use in Embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0107] Embodiment 3: An adenovirus for use in either Embodiment 1 or 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0108] Embodiment 4: An adenovirus for use in Embodiment 3, wherein the adenovirus is replication-deficient in cells lacking YB-1 in the nucleus, but replicates in cells possessing YB-1 in the nucleus.

[0109] Embodiment 5: An adenovirus for use in any one of Embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, the oncogene protein transactivates at least one adenovirus gene, the adenovirus gene being selected from the group comprising E1B55kDa, E4orf6, E4orf3, and E3ADP.

[0110] Embodiment 6: Adenovirus for use in Embodiment 5, wherein the oncogene protein is the E1A protein.

[0111] Embodiment 7: Adenovirus for use in Embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0112] Embodiment 8: Adenovirus for use in Embodiment 6, wherein the E1A protein is incapable of binding to the functional Rb tumor suppressor gene product.

[0113] Embodiment 9: Adenovirus for use in any one of Embodiments 6-8, wherein the E1A protein does not induce nuclear localization of YB-1.

[0114] Embodiment 10: An adenovirus for use in any one of Embodiments 5-9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0115] Embodiment 11: An adenovirus for use in Embodiment 10, wherein the deletion is selected from the group including deletions of the CR3 stretch, as well as deletions of the N-terminus and deletions of the C-terminus.

[0116] Embodiment 12: An adenovirus for use in any one of Embodiments 6-11, wherein the E1A protein is capable of binding to Rb.

[0117] Embodiment 13: Adenovirus for use in any one of Embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletion is preferably a deletion in the CR1 region and / or the CR2 region.

[0118] Embodiment 14: Adenovirus for use in Embodiment 13, wherein the E1A protein is incapable of binding to Rb.

[0119] Embodiment 15: An adenovirus for use in any one of Embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0120] Embodiment 16: An adenovirus for use in any one of Embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0121] Embodiment 17: An adenovirus for use in any one of Embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenovirus E3 region.

[0122] Embodiment 18: An adenovirus for use in any one of Embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19kDa protein.

[0123] Embodiment 19: An adenovirus for use in any one of Embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif in the fiber.

[0124] Embodiment 20: An adenovirus for use in any one of Embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0125] Embodiment 21: Adenovirus for use in any one of Embodiments 1 to 20, wherein the adenovirus is selected from the group including XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev, and viruses lacking expressed viral oncogenes capable of binding to functional Rb tumor suppressor gene products.

[0126] Embodiment 22: An adenovirus for use in Embodiment 21, wherein the adenovirus is XVir-N-31.

[0127] Embodiment 23: The adenovirus for use in Embodiment 21, wherein the adenovirus is dl520, and the adenovirus E3 region is functionally inactive.

[0128] Embodiment 24: An adenovirus for use in any one of Embodiments 21-23, wherein the adenovirus is dl520, where dl520 lacks expression of the E1B 19kDa protein.

[0129] Embodiment 25: An adenovirus for use in any one of Embodiments 21-24, wherein the adenovirus is dl520 expressing the RGD motif in the fiber.

[0130] Embodiment 26: An adenovirus for use in any one of Embodiments 1 to 25, wherein the virus encodes YB-1.

[0131] Embodiment 27: An adenovirus for use in Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter, and / or a YB-1-dependent promoter.

[0132] Embodiment 28: Adenovirus for use in Embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0133] Embodiment 29: Adenovirus for use in any one of Embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in cells, preferably tumor cells.

[0134] Embodiment 30: Adenovirus for use in any one of Embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in cells, preferably tumor cells.

[0135] Embodiment 31: Adenovirus for use in any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group including palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0136] Embodiment 32: Adenovirus for use in any one of Embodiments 1-31, wherein a CDK4 / 6 inhibitor stops cells at G1 and inhibits E2F1.

[0137] Embodiment 33: An adenovirus for use in any one of Embodiments 1 to 32, wherein the method further comprises administering a PARP inhibitor to the target.

[0138] Embodiment 34: Adenovirus for use in Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, lucaparib, and BMN673.

[0139] Embodiment 35: An adenovirus for use in any one of Embodiments 1 to 32, wherein the method further comprises administering a bromodomain inhibitor to the target.

[0140] Embodiment 36: Adenovirus for use in Embodiment 35, wherein the bromodomain inhibitor is selected from the group including JQ-1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1, and MS436.

[0141] Embodiment 37: Adenovirus for use in any one of Embodiments 1 to 36, wherein adenovirus, CDK4 / 6 inhibitor, PARP inhibitor and / or bromodomain inhibitor are administered to the subject separately or in any combination.

[0142] Embodiment 38: Tumor cells in which the CDK4 / 6 signaling pathway is disrupted, adenovirus for use in any one of Embodiments 1-37.

[0143] Embodiment 39: Adenovirus for use in any one of Embodiments 1 to 38, wherein tumor cells have an uncontrolled G1-S transition of the cell cycle.

[0144] Embodiment 40: Adenovirus for use in any one of Embodiments 1 to 38, wherein tumor cells have loss-of-function mutations or deletions in genes selected from the group including the RB1 gene, the CDKN2A gene, and the CDKN2B gene.

[0145] Embodiment 41: Adenovirus for use in any one of Embodiments 1 to 38, wherein tumor cells have gene amplification and / or gene activation mutations.

[0146] Embodiment 42: An adenovirus for use in Embodiment 41, wherein the gene is selected from the group comprising CCND1, E2F1, E2F2, E2F3, CDK4, and CDK6.

[0147] Embodiment 43: An adenovirus for use in Embodiment 41, wherein the gene is a gene encoding a component of a mitotic signaling pathway.

[0148] Embodiment 44: Adenovirus for use in Embodiment 43, wherein the mitotic signaling pathway is selected from the group including the PI3K pathway and the MAPK pathway.

[0149] Embodiment 45: Adenovirus for use in any one of Embodiments 1 to 44, wherein tumor cells are resistant to or insensitive to one or more pharmaceutically active agents and / or radiation.

[0150] Embodiment 46: Adenovirus for use in Embodiment 45, wherein the pharmaceutically active agent is a cell division inhibitor.

[0151] Embodiment 47: Adenovirus for use according to claim 46, wherein resistance is mediated by an ABC transporter.

[0152] Embodiment 48: Adenovirus for use according to claim 47, wherein the ABC transporter is selected from the group including MRP and MDR, in particular MDR-1.

[0153] Embodiment 49: Adenovirus for use in any one of Embodiments 45-48, wherein the resistance is multiple resistance or polyresistance, in particular to cell division inhibitors and / or radiation.

[0154] Embodiment 50: Adenovirus for use in any one of Embodiments 1 to 49, wherein tumor cells are Rb-positive.

[0155] Embodiment 51: Adenovirus for use in any one of Embodiments 1 to 50, wherein tumor cells have YB-1 in their nucleus.

[0156] Embodiment 52: Adenovirus for use in any one of Embodiments 1 to 51, wherein tumor cells have YB-1 in the nucleus after induction.

[0157] Embodiment 53: Adenovirus for use in Embodiment 52, wherein the transport of YB-1 to the nucleus is induced by at least one means selected from the group including irradiation, administration of cell division inhibitors and hyperthermia.

[0158] Embodiment 54: Adenovirus for use in Embodiment 53, wherein the means is applied to cells, organs or organisms, preferably organisms requiring it, more preferably organisms suffering from tumors.

[0159] Embodiment 55: Adenovirus for use according to any one of claims 1 to 54, wherein the tumor is selected from the group including bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer, and leukemia.

[0160] Furthermore, the underlying problem of the present invention is also solved in a fourth embodiment. The fourth embodiment is also a first embodiment of such a fourth embodiment with a CDK4 / 6 inhibitor for use in the treatment and / or prevention of diseases, more preferably tumors or cancers, in a subject. The method here comprises administering an adenovirus and a CDK4 / 6 inhibitor to the subject.

[0161] Further embodiments of this fourth aspect are disclosed below.

[0162] Embodiment 2: A CDK4 / 6 inhibitor for use in Embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0163] Embodiment 3: A CDK4 / 6 inhibitor for use in either Embodiment 1 or 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0164] Embodiment 4: A CDK4 / 6 inhibitor for use in Embodiment 3, wherein the adenovirus is replication-deficient in cells lacking YB-1 in the nucleus but replicates in cells possessing YB-1 in the nucleus.

[0165] Embodiment 5: A CDK4 / 6 inhibitor for use in any one of Embodiments 2-4, wherein the adenovirus encodes an oncogene protein, the oncogene protein transactivates at least one adenovirus gene, the adenovirus gene being selected from the group comprising E1B55kDa, E4orf6, E4orf3, and E3ADP.

[0166] Embodiment 6: A CDK4 / 6 inhibitor for use in Embodiment 5, wherein the oncogene protein is the E1A protein.

[0167] Embodiment 7: A CDK4 / 6 inhibitor for use in Embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0168] Embodiment 8: A CDK4 / 6 inhibitor for use in Embodiment 6, wherein the E1A protein is incapable of binding to the functional Rb tumor suppressor gene product.

[0169] Embodiment 9: A CDK4 / 6 inhibitor for use in any one of Embodiments 6-8, wherein the E1A protein does not induce nuclear localization of YB-1.

[0170] Embodiment 10: A CDK4 / 6 inhibitor for use in any one of Embodiments 5-9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0171] Embodiment 11: A CDK4 / 6 inhibitor for use in Embodiment 10, wherein the deletion is selected from the group including deletions of the CR3 stretch, as well as deletions of the N-terminus and C-terminus.

[0172] Embodiment 12: A CDK4 / 6 inhibitor for use in any one of Embodiments 6-11, wherein the E1A protein is capable of binding to Rb.

[0173] Embodiment 13: A CDK4 / 6 inhibitor for use in any one of Embodiments 6-12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletion is preferably in the CR1 region and / or the CR2 region.

[0174] Embodiment 14: A CDK4 / 6 inhibitor for use in Embodiment 13, wherein the E1A protein is incapable of binding to Rb.

[0175] Embodiment 15: A CDK4 / 6 inhibitor for use in any one of Embodiments 1-14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0176] Embodiment 16: A CDK4 / 6 inhibitor for use in any one of Embodiments 1-15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0177] Embodiment 17: A CDK4 / 6 inhibitor for use in any one of Embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenovirus E3 region.

[0178] Embodiment 18: A CDK4 / 6 inhibitor for use in any one of Embodiments 1-17, wherein the virus is an adenovirus lacking expression of the E1B 19kDa protein.

[0179] Embodiment 19: A CDK4 / 6 inhibitor for use in any one of Embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif in the fiber.

[0180] Embodiment 20: A CDK4 / 6 inhibitor for use in any one of Embodiments 1-19, wherein the virus is adenovirus serotype 5.

[0181] Embodiment 21: A CDK4 / 6 inhibitor for use in any one of Embodiments 1-20, wherein the adenovirus is selected from the group including XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev, and viruses lacking expressed viral oncogenes capable of binding to functional Rb tumor suppressor gene products.

[0182] Embodiment 22: A CDK4 / 6 inhibitor for use in Embodiment 21, wherein the adenovirus is XVir-N-31.

[0183] Embodiment 23: A CDK4 / 6 inhibitor for use in Embodiment 21, wherein the adenovirus is dl520, and the adenovirus E3 region is functionally inactive.

[0184] Embodiment 24: A CDK4 / 6 inhibitor for use in any one of Embodiments 21-23, wherein the adenovirus is dl520, where dl520 lacks expression of the E1B 19kDa protein.

[0185] Embodiment 25: A CDK4 / 6 inhibitor for use in any one of Embodiments 21-24, wherein the adenovirus is dl520 expressing the RGD motif in the fiber.

[0186] Embodiment 26: A CDK4 / 6 inhibitor for use in any one of Embodiments 1-25, wherein the virus encodes YB-1.

[0187] Embodiment 27: A CDK4 / 6 inhibitor for use in Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter, and / or a YB-1-dependent promoter.

[0188] Embodiment 28: A CDK4 / 6 inhibitor for use in Embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0189] Embodiment 29: A CDK4 / 6 inhibitor for use in any one of Embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in cells, preferably tumor cells.

[0190] Embodiment 30: A CDK4 / 6 inhibitor for use in any one of Embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in cells, preferably tumor cells.

[0191] Embodiment 31: A CDK4 / 6 inhibitor for use in any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group including palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0192] Embodiment 32: A CDK4 / 6 inhibitor for use in any one of Embodiments 1-31, wherein the CDK4 / 6 inhibitor stops cells at G1 and inhibits E2F1.

[0193] Embodiment 33: A CDK4 / 6 inhibitor for use in any one of Embodiments 1 to 32, wherein the method further comprises administering a PARP inhibitor to the target.

[0194] Embodiment 34: A CDK4 / 6 inhibitor for use in Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, lucaparib, and BMN673.

[0195] Embodiment 35: A CDK4 / 6 inhibitor for use in any one of Embodiments 1 to 32, wherein the method further comprises administering a bromodomain inhibitor to the target.

[0196] Embodiment 36: A CDK4 / 6 inhibitor for use in Embodiment 35, wherein the bromodomain inhibitor is selected from the group including JQ-1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1, and MS436.

[0197] Embodiment 37: A CDK4 / 6 inhibitor for use in any one of Embodiments 1 to 36, wherein an adenovirus, a CDK4 / 6 inhibitor, a PARP inhibitor, and / or a bromodomain inhibitor are administered to the subject separately or in any combination.

[0198] Embodiment 38: A CDK4 / 6 inhibitor for use in any one of Embodiments 1-37, wherein tumor cells have disrupted CDK4 / 6 signaling pathways.

[0199] Embodiment 39: A CDK4 / 6 inhibitor for use in any one of Embodiments 1-38, wherein tumor cells have an uncontrolled G1-S transition of the cell cycle.

[0200] Embodiment 40: A CDK4 / 6 inhibitor for use in any one of Embodiments 1 to 38, wherein tumor cells have loss-of-function mutations or deletions in genes selected from the group including the RB1 gene, the CDKN2A gene, and the CDKN2B gene.

[0201] Embodiment 41: A CDK4 / 6 inhibitor for use in any one of Embodiments 1 to 38, wherein tumor cells have gene amplification and / or gene activation mutations.

[0202] Embodiment 42: A CDK4 / 6 inhibitor for use in Embodiment 41, wherein the gene is selected from the group comprising CCND1, E2F1, E2F2, E2F3, CDK4, and CDK6.

[0203] Embodiment 43: A CDK4 / 6 inhibitor for use in Embodiment 41, wherein the gene is a gene encoding a component of a mitogenic signaling pathway.

[0204] Embodiment 44: A CDK4 / 6 inhibitor for use in Embodiment 43, wherein the mitotic signaling pathway is selected from the group including the PI3K pathway and the MAPK pathway.

[0205] Embodiment 45: A CDK4 / 6 inhibitor for use in any one of Embodiments 1 to 44, wherein tumor cells are resistant to or insensitive to one or more pharmaceutically active agents and / or radiation.

[0206] Embodiment 46: A CDK4 / 6 inhibitor for use in Embodiment 45, wherein the pharmaceutically active agent is a cell division inhibitor.

[0207] Embodiment 47: A CDK4 / 6 inhibitor for use in claim 46, wherein resistance is mediated by the ABC transporter.

[0208] Embodiment 48: A CDK4 / 6 inhibitor for use in claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, particularly MDR-1.

[0209] Embodiment 49: A CDK4 / 6 inhibitor for use in any one of Embodiments 45-48, wherein the resistance is multiple resistance or polyresistance, particularly to cell division inhibitors and / or radiation.

[0210] Embodiment 50: A CDK4 / 6 inhibitor for use in any one of Embodiments 1-49, wherein the tumor cells are Rb-positive.

[0211] Embodiment 51: A CDK4 / 6 inhibitor for use in any one of Embodiments 1 to 50, wherein tumor cells have YB-1 in their nucleus.

[0212] Embodiment 52: A CDK4 / 6 inhibitor for use in any one of Embodiments 1 to 51, wherein tumor cells have YB-1 in the nucleus after induction.

[0213] Embodiment 53: A CDK4 / 6 inhibitor for use in Embodiment 52, wherein the transport of YB-1 to the nucleus is induced by at least one means selected from the group including irradiation, administration of cell division inhibitors and hyperthermia.

[0214] Embodiment 54: A CDK4 / 6 inhibitor for use in Embodiment 53, wherein the means is applied to cells, organs or organisms, preferably organisms requiring it, more preferably organisms suffering from tumors.

[0215] Embodiment 55: A CDK4 / 6 inhibitor for use in any one of claims 1 to 54, wherein the tumor is selected from the group including bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer, and leukemia.

[0216] Furthermore, the underlying problem of the present invention is also solved in a fifth embodiment. The fifth embodiment is also a first embodiment of such a fifth embodiment, using a PARP inhibitor for use in the treatment and / or prevention of diseases, more preferably tumors or cancers, in a subject. The method here comprises administering an adenovirus, a CDK4 / 6 inhibitor, and a PARP inhibitor to a subject.

[0217] Further embodiments of such a fifth aspect are disclosed below.

[0218] Embodiment 2: A PARP inhibitor for use in Embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0219] Embodiment 3: A PARP inhibitor for use in either Embodiment 1 or 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0220] Embodiment 4: A PARP inhibitor for use in Embodiment 3, wherein the adenovirus is replication-deficient in cells lacking YB-1 in the nucleus, but replicates in cells possessing YB-1 in the nucleus.

[0221] Embodiment 5: A PARP inhibitor for use in any one of Embodiments 2-4, wherein the adenovirus encodes an oncogene protein, the oncogene protein transactivates at least one adenovirus gene, the adenovirus gene being selected from the group comprising E1B55kDa, E4orf6, E4orf3, and E3ADP.

[0222] Embodiment 6: A PARP inhibitor for use in Embodiment 5, wherein the oncogene protein is the E1A protein.

[0223] Embodiment 7: A PARP inhibitor for use in Embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0224] Embodiment 8: A PARP inhibitor for use in Embodiment 6, wherein the E1A protein is incapable of binding to the functional Rb tumor suppressor gene product.

[0225] Embodiment 9: A PARP inhibitor for use in any one of Embodiments 6-8, wherein the E1A protein does not induce nuclear localization of YB-1.

[0226] Embodiment 10: A PARP inhibitor for use in any one of Embodiments 5-9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0227] Embodiment 11: A PARP inhibitor for use in Embodiment 10, wherein the deletion is selected from the group including deletions of the CR3 stretch, as well as deletions of the N-terminus and C-terminus.

[0228] Embodiment 12: A PARP inhibitor for use in any one of Embodiments 6-11, wherein the E1A protein is capable of binding to Rb.

[0229] Embodiment 13: A PARP inhibitor for use in any one of Embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletion is preferably in the CR1 region and / or the CR2 region.

[0230] Embodiment 14: A PARP inhibitor for use in Embodiment 13, wherein the E1A protein is incapable of binding to Rb.

[0231] Embodiment 15: A PARP inhibitor for use in any one of Embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0232] Embodiment 16: A PARP inhibitor for use in any one of Embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0233] Embodiment 17: A PARP inhibitor for use in any one of Embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenovirus E3 region.

[0234] Embodiment 18: A PARP inhibitor for use in any one of Embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19kDa protein.

[0235] Embodiment 19: A PARP inhibitor for use in any one of Embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif in the fiber.

[0236] Embodiment 20: A PARP inhibitor for use in any one of Embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0237] Embodiment 21: A PARP inhibitor for use in any one of Embodiments 1 to 20, wherein the adenovirus is selected from the group including XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev, and viruses lacking expressed viral oncogenes capable of binding to functional Rb tumor suppressor gene products.

[0238] Embodiment 22: A PARP inhibitor for use in Embodiment 21, wherein the adenovirus is XVir-N-31.

[0239] Embodiment 23: A PARP inhibitor for use in Embodiment 21, wherein the adenovirus is dl520, and the adenovirus E3 region is functionally inactive.

[0240] Embodiment 24: A PARP inhibitor for use in any one of Embodiments 21-23, wherein the adenovirus is dl520, where dl520 lacks expression of the E1B 19kDa protein.

[0241] Embodiment 25: A PARP inhibitor for use in any one of Embodiments 21-24, wherein the adenovirus is dl520 expressing the RGD motif in the fiber.

[0242] Embodiment 26: A PARP inhibitor for use in any one of Embodiments 1 to 25, wherein the virus encodes YB-1.

[0243] Embodiment 27: A PARP inhibitor for use in Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter, and / or a YB-1-dependent promoter.

[0244] Embodiment 28: A PARP inhibitor for use in Embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0245] Embodiment 29: A PARP inhibitor for use in any one of Embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in cells, preferably tumor cells.

[0246] Embodiment 30: A PARP inhibitor for use in any one of Embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in cells, preferably tumor cells.

[0247] Embodiment 31: A PARP inhibitor for use in any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group including palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0248] Embodiment 32: A PARP inhibitor for use in any one of Embodiments 1-31, wherein the CDK4 / 6 inhibitor stops cells at G1 and inhibits E2F1.

[0249] Embodiment 33: A PARP inhibitor for use in any one of Embodiments 1 to 32, wherein the method further comprises administering the PARP inhibitor to the target.

[0250] Embodiment 34: PARP for use in Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, lucaparib, and BMN673.

[0251] Embodiment 35: A PARP inhibitor for use in any one of Embodiments 1 to 32, wherein the method further comprises administering a bromodomain inhibitor to a target.

[0252] Embodiment 36: A PARP inhibitor for use in Embodiment 35, wherein the bromodomain inhibitor is selected from the group including JQ-1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1, and MS436.

[0253] Embodiment 37: A PARP inhibitor for use in any one of Embodiments 1 to 36, wherein an adenovirus, a CDK4 / 6 inhibitor, a PARP inhibitor, and / or a bromodomain inhibitor are administered to the subject separately or in any combination.

[0254] Embodiment 38: Tumor cells in which the CDK4 / 6 signaling pathway is disrupted; PARP inhibitor for use in any one of Embodiments 1-37.

[0255] Embodiment 39: A PARP inhibitor for use in any one of Embodiments 1-38, wherein tumor cells have an uncontrolled G1-S transition of the cell cycle.

[0256] Embodiment 40: A PARP inhibitor for use in any one of Embodiments 1 to 38, wherein tumor cells have a loss-of-function mutation or deletion in a gene selected from the group including the RB1 gene, the CDKN2A gene, and the CDKN2B gene.

[0257] Embodiment 41: A PARP inhibitor for use in any one of Embodiments 1 to 38, wherein tumor cells have gene amplification and / or gene activation mutations.

[0258] Embodiment 42: A PARP inhibitor for use in Embodiment 41, wherein the gene is selected from the group comprising CCND1, E2F1, E2F2, E2F3, CDK4, and CDK6.

[0259] Embodiment 43: A PARP inhibitor for use in Embodiment 41, wherein the gene is a gene encoding a component of a mitotic signaling pathway.

[0260] Embodiment 44: A PARP inhibitor for use in Embodiment 43, wherein the mitotic signaling pathway is selected from the group including the PI3K pathway and the MAPK pathway.

[0261] Embodiment 45: A PARP inhibitor for use in any one of Embodiments 1 to 44, wherein tumor cells are resistant to or insensitive to one or more pharmaceutically active agents and / or radiation.

[0262] Embodiment 46: A PARP inhibitor for use in Embodiment 45, wherein the pharmaceutically active agent is a cell division inhibitor.

[0263] Embodiment 47: A PARP inhibitor for use in claim 46, wherein resistance is mediated by an ABC transporter.

[0264] Embodiment 48: A PARP inhibitor for use according to claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, in particular MDR-1.

[0265] Embodiment 49: A PARP inhibitor for use in any one of Embodiments 45-48, wherein the resistance is multiple resistance or polyresistance, particularly to cell division inhibitors and / or radiation.

[0266] Embodiment 50: A PARP inhibitor for use in any one of Embodiments 1 to 49, wherein the tumor cells are Rb-positive.

[0267] Embodiment 51: A PARP inhibitor for use in any one of Embodiments 1 to 50, wherein tumor cells have YB-1 in their nucleus.

[0268] Embodiment 52: A PARP inhibitor for use in any one of Embodiments 1 to 51, wherein tumor cells have YB-1 in the nucleus after induction.

[0269] Embodiment 53: A PARP inhibitor for use in Embodiment 52, wherein the transport of YB-1 to the nucleus is induced by at least one means selected from the group including irradiation, administration of cell division inhibitors and hyperthermia.

[0270] Embodiment 54: A PARP inhibitor for use in Embodiment 53, wherein the means is applied to cells, organs or organisms, preferably organisms requiring it, more preferably organisms suffering from a tumor.

[0271] Embodiment 55: A PARP inhibitor for use in any one of claims 1 to 54, wherein the tumor is selected from the group including bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer, and leukemia.

[0272] The underlying problem of the present invention is solved in the sixth embodiment. The sixth embodiment is also a first embodiment of such a sixth embodiment, using a bromodomain inhibitor for use in the treatment and / or prevention of diseases, more preferably tumors or cancers, in a subject. The method here comprises administering an adenovirus, a CDK4 / 6 inhibitor, and a bromodomain inhibitor to a subject.

[0273] Further embodiments of such a sixth aspect are disclosed below.

[0274] Embodiment 2: A bromodomain inhibitor for use in Embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0275] Embodiment 3: A bromodomain inhibitor for use in either Embodiment 1 or 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0276] Embodiment 4: A bromodomain inhibitor for use in Embodiment 3, wherein the adenovirus is replication-deficient in cells lacking YB-1 in the nucleus, but replicates in cells possessing YB-1 in the nucleus.

[0277] Embodiment 5: A bromodomain inhibitor for use in any one of Embodiments 2-4, wherein the adenovirus encodes an oncogene protein, the oncogene protein transactivates at least one adenovirus gene, the adenovirus gene being selected from the group comprising E1B55kDa, E4orf6, E4orf3, and E3ADP.

[0278] Embodiment 6: A bromodomain inhibitor for use in Embodiment 5, wherein the oncogene protein is the E1A protein.

[0279] Embodiment 7: A bromodomain inhibitor for use in Embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0280] Embodiment 8: A bromodomain inhibitor for use in Embodiment 6, wherein the E1A protein is incapable of binding to the functional Rb tumor suppressor gene product.

[0281] Embodiment 9: A bromodomain inhibitor for use in any one of Embodiments 6-8, wherein the E1A protein does not induce nuclear localization of YB-1.

[0282] Embodiment 10: A bromodomain inhibitor for use in any one of Embodiments 5-9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0283] Embodiment 11: A bromodomain inhibitor for use in Embodiment 10, wherein the deletion is selected from the group including deletions of the CR3 stretch, as well as deletions of the N-terminus and C-terminus.

[0284] Embodiment 12: A bromodomain inhibitor for use in any one of Embodiments 6-11, wherein the E1A protein is capable of binding to Rb.

[0285] Embodiment 13: A bromodomain inhibitor for use in any one of Embodiments 6 to 12, wherein the E1A protein contains one or more mutations or deletions as compared to the wild-type cancer gene protein, and wherein the deletion is preferably a deletion in the CR1 region and / or the CR2 region.

[0286] Embodiment 14: A bromodomain inhibitor for use in Embodiment 13, wherein the E1A protein is unable to bind to Rb.

[0287] Embodiment 15: A bromodomain inhibitor for use in any one of Embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0288] Embodiment 16: A bromodomain inhibitor for use in any one of Embodiments 1 to 15, wherein the virus is an adenovirus lacking the expression of the E1A13S protein.

[0289] Embodiment 17: A bromodomain inhibitor for use in any one of Embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenovirus E3 region.

[0290] Embodiment 18: A bromodomain inhibitor for use in any one of Embodiments 1 to 17, wherein the virus is an adenovirus lacking the expression of the E1B 19 kDa protein.

[0291] Embodiment 19: A bromodomain inhibitor for use in any one of Embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif in the fiber.

[0292] Embodiment 20: A bromodomain inhibitor for use in any one of Embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0293] Embodiment 21: A bromodomain inhibitor for use in any one of Embodiments 1 to 20, wherein the adenovirus is selected from the group including XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev, and viruses lacking expressed viral oncogenes capable of binding to functional Rb tumor suppressor gene products.

[0294] Embodiment 22: A bromodomain inhibitor for use in Embodiment 21, wherein the adenovirus is XVir-N-31.

[0295] Embodiment 23: A bromodomain inhibitor for use in Embodiment 21, wherein the adenovirus is dl520, and the adenovirus E3 region is functionally inactive.

[0296] Embodiment 24: A bromodomain inhibitor for use in any one of Embodiments 21-23, wherein the adenovirus is dl520, where dl520 lacks expression of the E1B 19kDa protein.

[0297] Embodiment 25: A bromodomain inhibitor for use in any one of Embodiments 21-24, wherein the adenovirus is dl520 expressing the RGD motif in the fiber.

[0298] Embodiment 26: A bromodomain inhibitor for use in any one of Embodiments 1 to 25, wherein the virus encodes YB-1.

[0299] Embodiment 27: A bromodomain inhibitor for use in Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter, and / or a YB-1-dependent promoter.

[0300] Embodiment 28: A bromodomain inhibitor for use in Embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0301] Embodiment 29: A bromodomain inhibitor for use in any one of Embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in cells, preferably tumor cells.

[0302] Embodiment 30: A bromodomain inhibitor for use in any one of Embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in cells, preferably tumor cells.

[0303] Embodiment 31: A bromodomain inhibitor for use in any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group including palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0304] Embodiment 32: A bromodomain inhibitor for use in any one of Embodiments 1-31, wherein the CDK4 / 6 inhibitor stops cells at G1 and inhibits E2F1.

[0305] Embodiment 33: A bromodomain inhibitor for use in any one of Embodiments 1 to 32, wherein the method further comprises administering a PARP inhibitor to a target.

[0306] Embodiment 34: A bromodomain inhibitor for use in Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, lucaparib, and BMN673.

[0307] Embodiment 35: A bromodomain inhibitor for use in any one of Embodiments 1 to 32, wherein the method further comprises administering the bromodomain inhibitor to the target.

[0308] Embodiment 36: The bromodomain inhibitor is a bromodomain inhibitor for use according to Embodiment 35, selected from the group consisting of JQ-1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS436.

[0309] Embodiment 37: The bromodomain inhibitor for use according to any one of Embodiments 1 to 36, wherein the adenovirus, CDK4 / 6 inhibitor, PARP inhibitor and / or bromodomain inhibitor is administered to the subject separately or as any combination.

[0310] Embodiment 38: The bromodomain inhibitor for use according to any one of Embodiments 1 to 37, wherein the tumor cells have a disrupted CDK4 / 6 signaling pathway.

[0311] Embodiment 39: The bromodomain inhibitor for use according to any one of Embodiments 1 to 38, wherein the tumor cells have an uncontrolled G1-S transition in the cell cycle.

[0312] Embodiment 40: The bromodomain inhibitor for use according to any one of Embodiments 1 to 38, wherein the tumor cells have a loss-of-function mutation or deletion in a gene selected from the group consisting of the RB1 gene, CDKN2A gene and CDKN2B gene.

[0313] Embodiment 41: The bromodomain inhibitor for use according to any one of Embodiments 1 to 38, wherein the tumor cells have gene amplification and / or activating mutations of the gene.

[0314] Embodiment 42: The bromodomain inhibitor for use according to Embodiment 41, wherein the gene is selected from the group consisting of CCND1, E2F1, E2F2, E2F3, CDK4 and CDK6.

[0315] Embodiment 43: The bromodomain inhibitor for use according to Embodiment 41, wherein the gene is a gene encoding a component of the mitogenic signaling pathway.

[0316] Embodiment 44: A bromodomain inhibitor for use in Embodiment 43, wherein the mitotic signaling pathway is selected from the group including the PI3K pathway and the MAPK pathway.

[0317] Embodiment 45: A bromodomain inhibitor for use in any one of Embodiments 1 to 44, wherein tumor cells are resistant to or insensitive to one or more pharmaceutically active agents and / or radiation.

[0318] Embodiment 46: A bromodomain inhibitor for use in Embodiment 45, wherein the pharmaceutically active agent is a cell division inhibitor.

[0319] Embodiment 47: A bromodomain inhibitor for use in claim 46, wherein resistance is mediated by an ABC transporter.

[0320] Embodiment 48: A bromodomain inhibitor for use according to claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, particularly MDR-1.

[0321] Embodiment 49: A bromodomain inhibitor for use in any one of Embodiments 45-48, wherein the resistance is multiple resistance or polyresistance, particularly to cell division inhibitors and / or radiation.

[0322] Embodiment 50: A bromodomain inhibitor for use in any one of Embodiments 1 to 49, wherein the tumor cells are Rb-positive.

[0323] Embodiment 51: A bromodomain inhibitor for use in any one of Embodiments 1 to 50, wherein tumor cells have YB-1 in their nucleus.

[0324] Embodiment 52: A bromodomain inhibitor for use in any one of Embodiments 1 to 51, wherein tumor cells have YB-1 in the nucleus after induction.

[0325] Embodiment 53: A bromodomain inhibitor for use in Embodiment 52, wherein the transport of YB-1 to the nucleus is induced by at least one means selected from the group including irradiation, administration of cell division inhibitors and hyperthermia.

[0326] Embodiment 54: A bromodomain inhibitor for use in Embodiment 53, wherein the means is applied to cells, organs, or organisms, preferably organisms requiring it, more preferably organisms suffering from tumors.

[0327] Embodiment 55: A bromodomain inhibitor for use according to any one of claims 1 to 54, wherein the tumor is selected from the group including bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer, and leukemia.

[0328] The underlying problem of the present invention is solved in the seventh embodiment. The seventh embodiment is also a first embodiment of such a sixth embodiment, with nutrin or a nutrin derivative for use in the treatment and / or prevention of diseases, more preferably tumors or cancers, in a subject. The method here comprises administering an adenovirus, a CDK4 / 6 inhibitor, and a bromodomain inhibitor to a subject.

[0329] Further embodiments of such a sixth aspect are disclosed below.

[0330] Embodiment 2: Nutrin or a nutrin derivative for use in Embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0331] Embodiment 3: Nutrin or a nutrin derivative for use in Embodiments 1 and 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0332] Embodiment 4: Nutrin or a nutrin derivative for use in Embodiment 3, wherein the adenovirus is replication-deficient in cells lacking YB-1 in the nucleus, but replicates in cells possessing YB-1 in the nucleus.

[0333] Embodiment 5: Nutrin or a nutrin derivative for use in any one of Embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, the oncogene protein transactivating at least one adenovirus gene, the adenovirus gene being selected from the group comprising E1B55kDa, E4orf6, E4orf3, and E3ADP.

[0334] Embodiment 6: Nutrin or a nutrin derivative for use in Embodiment 5, wherein the oncogene protein is the E1A protein.

[0335] Embodiment 7: Nutrin or a nutrin derivative for use in Embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0336] Embodiment 8: Nutrin or a nutrin derivative for use in Embodiment 6, wherein the E1A protein is incapable of binding to the functional Rb tumor suppressor gene product.

[0337] Embodiment 9: Nutrin or a nutrin derivative for use in any one of Embodiments 6-8, wherein the E1A protein does not induce nuclear localization of YB-1.

[0338] Embodiment 10: Nutrin or a nutrin derivative for use in any one of Embodiments 5 to 9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0339] Embodiment 11: Nutrin or a nutrin derivative for use in Embodiment 10, wherein the deletion is selected from the group including deletions of the CR3 stretch, N-terminus, and C-terminus.

[0340] Embodiment 12: Nutrin or a nutrin derivative for use in any one of Embodiments 6-11, wherein the E1A protein is capable of binding to Rb.

[0341] Embodiment 13: Nutrin or a nutrin derivative for use in any one of Embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletion is preferably in the CR1 region and / or the CR2 region.

[0342] Embodiment 14: Nutrin or a nutrin derivative for use in Embodiment 13, wherein the E1A protein is incapable of binding to Rb.

[0343] Embodiment 15: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0344] Embodiment 16: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0345] Embodiment 17: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenovirus E3 region.

[0346] Embodiment 18: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B19kDa protein.

[0347] Embodiment 19: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif in the fiber.

[0348] Embodiment 20: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0349] Embodiment 21: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 20, wherein the adenovirus is selected from the group including XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev, and viruses lacking expressed viral oncogenes capable of binding to functional Rb tumor suppressor gene products.

[0350] Embodiment 22: Nutrin or a nutrin derivative for use in Embodiment 21, wherein the adenovirus is XVir-N-31.

[0351] Embodiment 23: Nutrin or a nutrin derivative for use in Embodiment 21, wherein the adenovirus is dl520 and the adenovirus E3 region is functionally inactive.

[0352] Embodiment 24: Nutrin or a nutrin derivative for use in any one of Embodiments 21-23, wherein the adenovirus is dl520, where dl520 lacks expression of the E1B19kDa protein.

[0353] Embodiment 25: Nutrin or a nutrin derivative for use in any one of Embodiments 21-24, wherein the adenovirus is dl520 expressing the RGD motif in the fiber.

[0354] Embodiment 26: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 25, wherein the virus encodes YB-1.

[0355] Embodiment 27: Nutrin or a nutrin derivative for use in Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter, and / or a YB-1-dependent promoter.

[0356] Embodiment 28: Nutrin or a nutrin derivative for use in Embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0357] Embodiment 29: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in cells, preferably tumor cells.

[0358] Embodiment 30: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in cells, preferably tumor cells.

[0359] Embodiment 31: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group including palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0360] Embodiment 32: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 31, wherein a CDK4 / 6 inhibitor arrests cells in the G1 phase and inhibits E2F1.

[0361] Embodiment 33: A method for the use of any one of Embodiments 1 to 32, further comprising administering a PARP inhibitor to a target.

[0362] Embodiment 34: Nutrin or a nutrin derivative for use in Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, lucaparib, talazoparib, and BMN673.

[0363] Embodiment 35: A method for the use of any one of Embodiments 1 to 32, further comprising administering a bromodomain inhibitor to a target.

[0364] Embodiment 36: Nutrin or a nutrin derivative for use in Embodiment 35, wherein the bromodomain inhibitor is selected from the group including JQ-1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1, and MS436.

[0365] Embodiment 37: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 36, wherein an adenovirus, a CDK4 / 6 inhibitor, a PARP inhibitor, a bromodomain inhibitor, and / or nutrin or a nutrin derivative is administered to a subject separately or in any combination.

[0366] Embodiment 38: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 37, wherein the nutrin derivative is selected from the group including NVP-HDM201, idasanutrin, AM-8553, SAR405838, nutrin-3a, and AMG232.

[0367] Embodiment 39: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 37, wherein the nutrin derivative is different from nutrin-3a.

[0368] Embodiment 40: Tumor cells in which the CDK4 / 6 signaling pathway is disrupted, nutrin or a nutrin derivative for use in any one of Embodiments 1 to 39.

[0369] Embodiment 41: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 40, wherein tumor cells have uncontrolled G1-S transitions in the cell cycle.

[0370] Embodiment 42: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 40, wherein tumor cells have loss-of-function mutations or deletions in genes selected from the group including the RB1 gene, the CDKN2A gene, and the CDKN2B gene.

[0371] Embodiment 43: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 40, wherein tumor cells have gene amplification and / or activating mutations in the genes.

[0372] Embodiment 44: Nutrin or a nutrin derivative for use in Embodiment 43, wherein the gene is selected from the group comprising CCND1, E2F1, E2F2, E2F3, CDK4, and CDK6.

[0373] Embodiment 45: Nutrin or a nutrin derivative for use in Embodiment 43, wherein the gene is a gene encoding a component of a mitogenic signaling pathway.

[0374] Embodiment 46: Nutrin or a nutrin derivative for use in Embodiment 45, wherein the mitogenic signaling pathway is selected from the group including the PI3K pathway and the MAPK pathway.

[0375] Embodiment 47: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 46, wherein tumor cells are resistant to or insensitive to one or more pharmaceutically active agents and / or radiation.

[0376] Embodiment 48: Nutrin or a nutrin derivative for use in Embodiment 47, wherein the pharmaceutically active agent is a cell division inhibitor.

[0377] Embodiment 49: Nutrin or a nutrin derivative for use in Embodiment 48, wherein resistance is mediated by an ABC transporter.

[0378] Embodiment 50: Nutrin or a nutrin derivative for use in Embodiment 49, wherein the ABC transporter is selected from the group including MRP and MDR, particularly MDR-1.

[0379] Embodiment 51: Nutrin or a nutrin derivative for use in any one of Embodiments 47 to 50, wherein the resistance is multiple resistance or polyresistance, in particular to cell division inhibitors and / or radiation.

[0380] Embodiment 52: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 51, wherein the tumor cells are Rb-negative.

[0381] Embodiment 53: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 52, wherein the tumor cells are Rb-positive.

[0382] Embodiment 54: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 53, wherein tumor cells have YB-1 in the nucleus.

[0383] Embodiment 55: Nutrin or a nutrin derivative for use in any one of Embodiments 1 to 54, wherein tumor cells have YB-1 in the nucleus after induction.

[0384] Embodiment 56: Nutrin or a nutrin derivative for use in Embodiment 55, wherein the transport of YB-1 to the nucleus is induced by at least one means selected from the group including radiation, administration of cell division inhibitors and hyperthermia.

[0385] Embodiment 57: Nutrin or a nutrin derivative for use in Embodiment 56, wherein the means is applied to cells, organs or organisms, preferably organisms requiring it, more preferably organisms suffering from tumors.

[0386] The underlying problem of the present invention is solved in the eighth embodiment. Furthermore, the eighth embodiment is also a first embodiment of such a seventh embodiment using combination therapy. Here, such combination therapy is, a) Adenoviruses, in particular as defined herein according to a third aspect including any embodiment thereof; CDK4 / 6 inhibitors, in particular as defined herein according to a fourth aspect including any embodiment thereof; and PARP inhibitors, in particular as defined herein according to a fourth aspect, b) Adenoviruses, in particular those defined herein according to a third aspect including any embodiment thereof; CDK4 / 6 inhibitors, in particular those defined herein according to a fourth aspect including any embodiment thereof; and bromodomain inhibitors, in particular those defined herein according to a fifth aspect, c) Adenoviruses, in particular those defined herein according to a third embodiment including any embodiment thereof; CDK4 / 6 inhibitors, in particular those defined herein according to a fourth embodiment including any embodiment thereof; and nutrins or nutrin derivatives, in particular those defined herein according to a sixth embodiment. d) Adenoviruses, in particular those defined herein according to a third aspect including any embodiment thereof; CDK4 / 6 inhibitors, in particular those defined herein according to a fourth aspect including any embodiment thereof; bromodomain inhibitors, bromodomain inhibitors, in particular those defined herein according to a fifth aspect; and nutrins or nutrin derivatives, in particular those defined herein according to a sixth aspect. e) Adenoviruses, in particular those defined herein according to a third aspect including any embodiment thereof; CDK4 / 6 inhibitors, in particular those defined herein according to a fourth aspect including any embodiment thereof; bromodomain inhibitors, bromodomain inhibitors, in particular those defined herein according to a fifth aspect; and PARP inhibitors, in particular those defined herein according to a fifth aspect, and f) administering to subjects in need of adenoviruses, in particular those defined herein according to a third aspect including any embodiment thereof; CDK4 / 6 inhibitors, in particular those defined herein according to a fourth aspect including any embodiment thereof; bromodomain inhibitors, in particular those defined herein according to a fifth aspect; PARP inhibitors, in particular those defined herein according to a fifth aspect; and nutrins or nutrin derivatives, in particular those defined herein according to a sixth aspect.

[0387] It is within the scope of the present invention that the various embodiments described in relation to the third embodiment including any embodiment, the fourth embodiment including any embodiment, the fifth embodiment including any embodiment, and the sixth embodiment including any embodiment may be embodiments of the eighth embodiment of the combination therapy in various forms, as defined above as a), b), c), d), e), and f).

[0388] The underlying problem of the present invention is solved in the ninth embodiment. The ninth embodiment is also a first embodiment of such a seventh embodiment by means of a method for the treatment and / or prevention of a disease in a subject, wherein the method includes administering an adenovirus and a CDK4 / 6 inhibitor to the subject.

[0389] Further embodiments of such a ninth aspect are disclosed below.

[0390] Embodiment 2: The method of Embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0391] Embodiment 3: The method according to either Embodiment 1 or 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0392] Embodiment 4: The method of Embodiment 3, wherein the adenovirus fails to replicate in cells lacking YB-1 in the nucleus, but replicates in cells containing YB-1 in the nucleus.

[0393] Embodiment 5: Any one of Embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, the oncogene protein transactivates at least one adenovirus gene, the adenovirus gene being selected from the group comprising E1B55kDa, E4orf6, E4orf3, and E3ADP.

[0394] Embodiment 6: The method of Embodiment 5, wherein the oncogene protein is the E1A protein.

[0395] Embodiment 7: The method of Embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0396] Embodiment 8: The method of Embodiment 6, wherein the E1A protein is unable to bind to the functional Rb tumor suppressor gene product.

[0397] Embodiment 9: Any one of Embodiments 6-8, wherein the E1A protein does not induce nuclear localization of YB-1.

[0398] Embodiment 10: A method according to any one of Embodiments 5 to 9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0399] Embodiment 11: The method of Embodiment 10, wherein the deletion is selected from the group including deletions of the CR3 stretch, N-terminus deletions, and C-terminus deletions.

[0400] Embodiment 12: Any one of Embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0401] Embodiment 13: The method of any one of Embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletion is preferably in the CR1 region and / or the CR2 region.

[0402] Embodiment 14: The method of Embodiment 13, wherein the E1A protein is unable to bind to Rb.

[0403] Embodiment 15: Any one of Embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0404] Embodiment 16: Any one of Embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0405] Embodiment 17: Any one of Embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenovirus E3 region.

[0406] Embodiment 18: Any one of Embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B19kDa protein.

[0407] Embodiment 19: Any one of Embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif in the fiber.

[0408] Embodiment 20: Any one of Embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0409] Embodiment 21: Any one of Embodiments 1 to 20, wherein the adenovirus is selected from the group including XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev, and viruses lacking expressed viral oncogenes capable of binding to functional Rb tumor suppressor gene products.

[0410] Embodiment 22: The method of Embodiment 21, wherein the adenovirus is XVir-N-31.

[0411] Embodiment 23: The method of Embodiment 21, wherein the adenovirus is dl520, and the adenovirus E3 region is functionally inactive.

[0412] Embodiment 24: Any one of Embodiments 21-23, wherein the adenovirus is dl520, where dl520 lacks expression of the E1B 19kDa protein.

[0413] Embodiment 25: Any one of Embodiments 21 to 24, wherein the adenovirus is dl520 expressing the RGD motif in the fiber.

[0414] Embodiment 26: A method according to any one of Embodiments 1 to 25, wherein the virus encodes YB-1.

[0415] Embodiment 27: The method of Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter, and / or a YB-1-dependent promoter.

[0416] Embodiment 28: The method of Embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0417] Embodiment 29: Any one of Embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in cells, preferably tumor cells.

[0418] Embodiment 30: Any one of Embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in cells, preferably tumor cells.

[0419] Embodiment 31: Any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group including palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0420] Embodiment 32: Any one of Embodiments 1 to 31, wherein a CDK4 / 6 inhibitor arrests cells at G1 and inhibits E2F1.

[0421] Embodiment 33: Any one of Embodiments 1 to 32, wherein the method further comprises administering a PARP inhibitor to the target.

[0422] Embodiment 34: The method of Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, lucaparib, and BMN673.

[0423] Embodiment 35: Any one of Embodiments 1 to 32, wherein the method further comprises administering a bromodomain inhibitor to the target.

[0424] Embodiment 36: The method of Embodiment 35, wherein the bromodomain inhibitor is selected from the group including JQ-1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1, and MS436.

[0425] Embodiment 37: Any one of Embodiments 1 to 36, wherein an adenovirus, a CDK4 / 6 inhibitor, a PARP inhibitor, and / or a bromodomain inhibitor are administered to a subject separately or in any combination.

[0426] Embodiment 38: Tumor cells have disrupted CDK4 / 6 signaling pathway, according to any one of Embodiments 1 to 37.

[0427] Embodiment 39: Any one of Embodiments 1 to 38, wherein tumor cells have an uncontrolled G1-S transition of the cell cycle.

[0428] Embodiment 40: Any one of Embodiments 1 to 38, wherein tumor cells have a loss-of-function mutation or deletion in a gene selected from the group including the RB1 gene, the CDKN2A gene, and the CDKN2B gene.

[0429] Embodiment 41: Any one of Embodiments 1 to 38, wherein tumor cells have gene amplification and / or gene activation mutations.

[0430] Embodiment 42: The method of Embodiment 41, wherein the gene is selected from the group comprising CCND1, E2F1, E2F2, E2F3, CDK4, and CDK6.

[0431] Embodiment 43: The method of Embodiment 41, wherein the gene is a gene encoding a component of a mitogenic signaling pathway.

[0432] Embodiment 44: The method of Embodiment 43, wherein the mitotic signaling pathway is selected from the group including the PI3K pathway and the MAPK pathway.

[0433] Embodiment 45: Any one of Embodiments 1 to 44, wherein tumor cells are resistant to or insensitive to one or more pharmaceutically active agents and / or radiation.

[0434] Embodiment 46: The method of Embodiment 45, wherein the pharmaceutically active agent is a cell division inhibitor.

[0435] Embodiment 47: The method of claim 46, wherein resistance is mediated by an ABC transporter.

[0436] Embodiment 48: The method of claim 47, wherein the ABC transporter is selected from the group including MRP and MDR, in particular MDR-1.

[0437] Embodiment 49: Any one of Embodiments 45 to 48, wherein the resistance is multiple resistance or polyresistance, in particular to cell division inhibitors and / or radiation.

[0438] Embodiment 50: Any one of Embodiments 1 to 49, wherein the tumor cells are Rb-positive.

[0439] Embodiment 51: Any one of Embodiments 1 to 50, wherein tumor cells have YB-1 in their nucleus.

[0440] Embodiment 52: Any one of Embodiments 1 to 51, wherein tumor cells have YB-1 in their nuclei after induction.

[0441] Embodiment 53: The method of Embodiment 52, wherein the transport of YB-1 to the nucleus is induced by at least one means selected from the group including irradiation, administration of a cell division inhibitor, and hyperthermia.

[0442] Embodiment 54: The method of Embodiment 53, wherein the means is applied to cells, organs or organisms, preferably organisms that require them, more preferably organisms suffering from tumors.

[0443] Embodiment 55: The method according to any one of claims 1 to 54, wherein the tumor is selected from the group including bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer, and leukemia.

[0444] In a tenth embodiment, the present invention also relates to the use of a composition for the manufacture of a pharmaceutical, wherein the composition is a composition disclosed in relation to a first aspect of the present invention, including any embodiment thereof, and the pharmaceutical is for the treatment and / or prevention of a disease specified in relation to a second aspect of the present invention, including any embodiment thereof.

[0445] In an eleventh embodiment, the present invention also relates to the use of adenoviruses for the manufacture of pharmaceuticals, wherein the adenovirus is an adenovirus disclosed in connection with a third aspect of the present invention, including any embodiment thereof, and the pharmaceutical is for the treatment and / or prevention of a disease specified in connection with a third aspect of the present invention, including any embodiment thereof.

[0446] In a twelfth embodiment, the present invention also relates to the use of a CDK4 / 6 inhibitor for the manufacture of a pharmaceutical, wherein the CDK4 / 6 inhibitor is a CDK4 / 6 inhibitor disclosed in connection with a fourth aspect of the present invention, including any embodiment thereof, and the pharmaceutical is for the treatment and / or prevention of a disease identified in connection with a fourth aspect of the present invention, including any embodiment thereof.

[0447] In a thirteenth embodiment, the present invention also relates to the use of a PARP inhibitor for the manufacture of a pharmaceutical product, wherein the PARP inhibitor is a PARP inhibitor disclosed in relation to a fifth aspect of the present invention, including any embodiment thereof, and the pharmaceutical product is for the treatment and / or prevention of a disease specified in relation to a fifth aspect of the present invention, including any embodiment thereof.

[0448] In a fourteenth embodiment, the present invention also relates to the use of a bromodomain inhibitor for the manufacture of a pharmaceutical product, wherein the bromodomain inhibitor is a bromodomain inhibitor disclosed in relation to a sixth aspect of the present invention, including any embodiment thereof, and the pharmaceutical product is for the treatment and / or prevention of a disease specified in relation to a sixth aspect of the present invention, including any embodiment thereof.

[0449] In a fifteenth embodiment, the present invention also relates to the use of nutrin or a derivative thereof for the manufacture of a pharmaceutical, wherein nutrin or a derivative thereof is nutrin or a derivative thereof disclosed in connection with a seventh aspect of the present invention, including any embodiment thereof, and the pharmaceutical is for the treatment and / or prevention of a disease specified in connection with a seventh aspect of the present invention, including any embodiment thereof.

[0450] In each of the embodiments disclosed herein, including any of its embodiments, and in any embodiment thereof, a CDK4 / 6 inhibitor is a drug that inhibits or can inhibit CDK4 / 6, and for this reason, arrests appropriately treated cells in the G1 phase.

[0451] In each of the embodiments disclosed herein, including any embodiment thereof, and in any embodiment thereof, the bromodomain inhibitor is a divalent bromodomain inhibitor, and more preferably the bromodomain inhibitor is the following formula [ka] This is the AZD5153, indicated by [this symbol].

[0452] In each of the embodiments disclosed herein, including any of those embodiments, and in any embodiment of that embodiment, the bromodomain inhibitor is a BET degrader, and preferably the bromodomain inhibitor is selected from the group including dBET6 represented by the following formula and ARV771 represented by the following formula (see, for example, Scheepstra M et.al. (Computational and Structural Biotechnology Journal 17(2019)160-179)). [ka]

[0453] Those skilled in the art will recognize that each embodiment and any embodiment of one aspect of the present invention are also embodiments of other aspects and any embodiments of the present invention (including any of those embodiments).

[0454] While we do not wish to be bound by any theory, we have surprisingly found that combining oncolytic viruses, preferably oncolytic adenoviruses, with CDK4 / 6 inhibitors improves the efficacy of tumor treatments based on such oncolytic adenoviruses. More specifically, CDK4 / 6 inhibitors inhibit E2F1 (also referred to herein as E2F-1), which preferably reduces its effective concentration in tumor cells and is thought to synchronize G1 arrest in the cells. As a result, as the number of infected cells increases, the entire life cycle of the virus can be completed.

[0455] Based on the evidence and insights provided herein, those skilled in the art will understand that any mutant adenovirus is suitable for use in the implementation of the present invention. Such use allows such adenoviruses to achieve activity of at least 10%, 20%, or 30% of wild-type expression of E1B55K and E4orf6, respectively. Those skilled in the art will understand that such mutant adenoviruses can be produced by modifying E1A. Exemplary mutant adenoviruses include adenovirus XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev, and viruses lacking expressed viral oncogenes capable of binding to functional Rb tumor suppressor gene products.

[0456] The name adenovirus originates from the first isolation of the virus from human tonsil and pharyngeal tonsil tissue in 1953 by Wallace P. Rowe and Robert J. Huebner (Rowe, et al., 1953). The Adenoviridae family includes five genera: Mastadenoviruses, Aviadenoviruses, Siadenoviruses, Atadenoviruses, and Ichtadenoviruses (Modeow, 2013). Due to their carcinogenicity in neonate rodents, they can be classified into seven subgroups, HAdV-A to HAdV-G (Boulanger and Blair, 1991), and a total of 62 serotypes. Consequently, research on oncolytic virus therapy has primarily focused on Mastadenovirus type C serotype 5.

[0457] An uncoated icosahedral capsid, measuring 80–110 nm in size, consists of 252 capsomeres, each comprising 12 pentons constructed from spike-like protein structures called penton bases and fibrous structures at the vertices of the capsid, and 249 faces called hexons (Modrow, 2013). The entire life cycle of an adenovirus can be subdivided into an early stage involving cell entry, nuclear translocation of the viral genome, transcription and translation of early genes, and a later stage involving transcription and translation of late genes. Thus, late proteins are primarily responsible for the construction of structural proteins and virion maturation (Russell, 2000). In gravitas, the early stage takes approximately 6–8 hours, followed by the later stage of approximately 4–6 hours. Binding occurs, at least for adenoviruses HAdV-A, -C, -E, and -F, via the interaction of knob structures present at every end of the fibrous structure with receptors on the target cell. This receptor was detected as being the same as the one responsible for coxsackie B virus adsorption, and is therefore called the coxsackie and adenovirus receptor (CAR) (Bergelson, 1997). In addition, binding to the surface of target cells is supported by "cross-linking molecules," which are soluble proteins in body fluids that mediate the binding of specific adenovirus-type fibrous proteins, such as blood coagulation factors VII and X (Modrow, 2013). After this adsorption step, the RGD motif (arginine-glycine-aspartate) in the penton base interacts with heterodimeric integrin αvβ3 or αvβ5, which functions as a co-receptor in this process. This interaction leads to viral internalization (Wickham et al., 1993). Subsequently, endocytosis occurs in the cell membrane via clathrin-mediated internalization, and the virus resides in endosomes. After the acidification of intracellular vesicles, viral fibrous proteins change their conformation and disrupt the endosomal membrane (Greber et al., 1996). At this point, viral particles are suspended in the cytoplasm. The viral genome is then transferred into the nucleus by the binding of the remaining particles to dynein on microtubules (Modrow, 2013).

[0458] The adenovirus genome consists of double-stranded, linear DNA 36–38 kb in length. A quasi-cyclic structure is formed by the interaction of two terminal protein (TP) molecules covalently bonded to both 5' ends (Modrow, 2013). Generally, the five coding regions of the adenovirus genome can be subdivided into early genes E1–E4, which are mainly active in the early stages of infection, and late genes (L1–L5), which mainly encode proteins necessary for viral particle formation (Modrow, 2013).

[0459] Adenovirus replication is particularly dependent on the expression of the initial viral gene E2, which is strongly attracted by the large E1A protein (E1A13S). The first viral gene transcribed after infection is the initial region 1A (E1A). The primary E1A transcript is processed by differential splicing, generating five distinct messages with sedimentation coefficients of 13S, 12S, 11S, 10S, and 9S. 13S and 12S mRNAs are most abundant in the early stages of infection, while 9S mRNA is most abundant in the later stages. 11S and 10S mRNAs are minor species that become more abundant in the later stages after infection. The 13S, 12S, 11S, 10S, and 9S E1A mRNAs encode proteins at 289 residues (R), 243R, 217R, 171R, and 55R, respectively, and all are detectable in vivo, except for the 9S product, which is only detectable in vitro. Generally, adenovirus gene expression is highly regulated and complex during the infection process. As a result, the transcription of the E2 gene, which encodes viral DNA polymerase and other proteins necessary for efficient viral replication, is controlled by two promoters: the E2 early promoter and the E2 late promoter.

[0460] Due to its two overlapping transcriptional regulatory regions, the E2-initial promoter can be subdivided into a major promoter starting at position +1 and a secondary promoter starting at position -26, both containing TATA motifs (Swaminathan and Thimmapaya, 1996). These motifs function as binding sites for TATA box-binding protein (TBP). Furthermore, one binding site for activating transcription factor (ATF) between positions -68 and -77, and two E2F1 / DP-1 binding sites (TTTCGCGC) oriented in opposite directions are located at positions -35 and -63 of the major E2 initial promoter (Swaminathan and Thimmapaya, 1996). Activation of the E2 initial promoter via E1A relies primarily on the two E2F1 binding sites localized to the major promoter region.

[0461] In the intermediate stage of infection, approximately 6 hpi (post-infection time), E2 gene expression is regulated by the late E2 promoter. A TATA box is present at positions nt-33 to -22 of its 157 bp sequence, which can bind to and be activated by intracellular TBP (Swaminathan and Thimmapaya, 1996). Furthermore, two SP1 recognition sites and three CCAAT boxes are characteristic of the late E2 promoter.

[0462] Since the cellular factor YB-1 has been shown to be able to bind to the reverse CCAAT box, the interaction between Y-box binding protein 1 (YB-1) and the late E2 promoter was investigated. In 2002, Holm et al. demonstrated that a specific interaction between the Y-box (reverse CCAAT box) present in the late E2 promoter and YB-1 has the ability to regulate the activity of this promoter (Holm et al., 2002). To exert its transactivating activity, YB-1 must be translocated into the nucleus via the adenovirus complex E1B-55k / E4-orf6. These early viral genes are expressed after transactivation by E1A-13S (Frisch and Mymryk, 2002).

[0463] The cellular factor YB-1, encoded by the YBX1 gene, is a cold shock domain-carrying DNA-binding protein with multiple functions in transcription, splicing, translational regulation, and DNA damage repair (Kohno et al., 2003). Furthermore, cellular factor YB-1 plays a crucial role in drug resistance through its activation of the MDR1 and MRP1 genes, which are involved in the development of multidrug resistance phenotypes in cancer cells (Mantwill et al., 2006). YB-1 expression is induced by nuclear transport after exposure to exogenous stressors, such as adenovirus infection, chemotherapy, or UV irradiation (Mantwill et al., 2006).

[0464] Transcriptional activation of early and late adenovirus genes is crucial to the viral life cycle. In short, the viral life cycle begins with the activation of E1A transcription, followed by a cascade of E2, E3, and E4 gene activations. Finally, the main late promoter (MLP) is activated, regulating the expression of capsid and accessory proteins, primarily involved in genomic capsid formation (Turner et al 2015). To overcome the defenses against viral DNA replication present in non-proliferating cells, the virus expresses early 1A protein (E1A). These very early proteins transition cells into the S phase and induce the expression of all other early viral genes. During infection, several E1A isoforms are expressed as 289, 243, 217, 171, and 55 residue proteins present in human adenovirus type 5. Regarding infection, the main driver of viral gene expression is the large E1A 289R protein (Radko et al 2015).

[0465] During infection, the expression of the adenovirus E1A protein promotes cell cycle progression from G0 / G1 phase to S phase and viral replication, even in terminally differentiated epithelial cells, the primary target of human adenovirus. This process is considered essential to the adenovirus life cycle.

[0466] Adenoviruses were designed to infect, replicate, and kill cancer cells while preserving normal cells. Following infection and replication in tumor cells, the oncolytic virus kills the cells and releases virions for a subsequent amplification cycle. Two genetic modifications were made to achieve replication exclusively within tumor cells, resulting in the design of three subclasses of oncolytic adenoviruses (also known herein as CRAd), all of which can be used in the implementation of the present invention. Furthermore, oncolytic adenoviruses suitable for use in the implementation of the present invention are described in particular in WO 2003 / 099859.

[0467] Type I CRAds are characterized by mutations or deletions in the E1 region of the genome, interfering with the inactivation of cell cycle regulators, such as p53 and retinoblastoma protein (Rb). As a result, Type I CRAds replicate in actively dividing tumor cells. For example, Onyx-015 (also known as dl1520), which cannot express the E1B-55kDa protein, cannot inactivate p53 and therefore cannot avoid p53-induced cell cycle arrest. Several studies suggested that the molecular basis of Onyx-015 selectivity lies in the absence of expression of p53 or one of the genes involved in the p53 pathway. However, O'Shea et al. showed that Onyx-015 viral selectivity is determined not by p53 inactivation, but by late viral RNA efflux. Other Type I CRAds with deletions in the E1A region cannot bind to Rb and therefore cannot induce progression to S phase. For example, dl922-947 and Δ24 contain a 24-nucleotide deletion in the CR2 domain of the E1A region, inhibiting the E1A-Rb interaction. As a result, these viruses primarily replicate in tumor cells where free, unbound E2F1 is available.

[0468] Another method to restrict adenovirus replication to tumor cells is to regulate the transcription of viral genes necessary for viral replication. In type II CRAds, the genome is controlled by tumor-specific promoters. These promoters are derived from genes known to be preferentially expressed in some tumors compared to normal tissue (e.g., telomerase or cyclooxygenase II); or genes overexpressed in tumors compared to normal tissue (e.g., prostate-specific antigen, PSA, or α-fetoprotein, AFP). Type III CRAds, such as XVir-N-31 (Ad-Delo3-RGD), are characterized by a deletion of the transactivation domain CR3 in the E1A13S protein. XVir-N-31 is a replication-deficient adenovirus in normal cells. The replication ability of XVir-N-31 is restored by the presence of the cellular pluripotent protein YB-1 in the nucleus. Therefore, CRAds can only replicate in tumor cells, which ultimately leads to their lysis. Mutations in p53, ras, and RB are not effective in compensating for the replication deficiency of XVir-N-31. Because XVir-N-31 lacks E1A13S, the E1B55k and E4orf6 proteins are not expressed. This deficiency is compensated for by the presence of YB-1 in the tumor cell nucleus, which independently induces the expression of E1B55k and E4orf6. Once attracted by the presence of YB-1 in the nucleus, E1B55k and E4orf6 further transport cellular YB-1 into the nucleus, promoting viral replication.

[0469] The cell cycle progresses sequentially through Gap 1 (G1), synthesis (S), Gap 2 (G2), and mitotic (M) phases. This progression is regulated via a complex signaling network. The CDK (cyclin-dependent kinase) proteins CDK1, CDK2, CDK4, and CDK6, when complexed with specific cyclin proteins, become the primary regulators of cell cycle progression. Constitutive expression of CDKs and the temporal control of various cyclins enable the regulation of specific cell cycle phases by different cyclin-CDK complexes. CDK activity is negatively regulated by several inhibitory proteins. Various aspects of the biology and function of CDKs have been comprehensively reviewed previously.

[0470] CDK4 and CDK6, exhibiting structural and functional homology, regulate the transition of resting cells from G1 phase to S phase when they form a complex with cyclin D protein. Cyclin D protein has three subtypes, cyclin D1-D3, and accumulates in the presence of pro-mitotic stimuli. Negative regulators of CDK4 / 6 include p16INK4A, p15INK4B, p18INK4C, and p19INK4D, which are inhibitors of the CDK4(INK4) protein. These inhibit CDK4 / 6 activity by reducing binding to cyclin D1 or by directly occupying their catalytic domains.

[0471] The kinase activity of CDK4 / 6 leads to the phosphorylation of members of the retinoblastoma (Rb) protein family, including Rb, p107, and p130, which in turn leads to their functional inactivation. In resting cells, active hypophosphorylated Rb, along with other corepressors, binds to members of the E2F1 transcription factor family that form a complex with DP-1 / 2, suppressing E2F1 function (Rubin et al 2005). Upon phosphorylation, Rb dissociates from this complex, enabling transcription of E2F1 target genes, including cyclin A, cyclin E, and DHFR, which are necessary for transition to the S phase of the cell cycle. Therefore, inhibition of CDK4 / 6 activity leads to Rb dephosphorylation and repression of E2F1 activity, thereby promoting G0 / G1 arrest. This has accelerated the development of CDK4 / 6 inhibitors as targeted therapies for cancer cells.

[0472] Disruption of the CDK4 / 6-Rb signaling pathway and unregulated G1-S transition of the cell cycle are common characteristics of cancer cells. This can be caused by various molecular changes, including loss-of-function mutations or deletions of the RB1 gene (encoding Rb), CDKN2A (encoding p16INK4A and p14ARF), or CDKN2B (encoding p15INK4B). Such deregulation may also be due to amplification or activating mutations of components of CCND1 (encoding cyclin D1), E2F1-3, CDK4, CDK6, or various pro-mitotic signaling pathways, such as the PI3K pathway or MAPK pathway.

[0473] Several ATP-competitive small molecule CDK inhibitors have been developed. However, first-generation inhibitors, such as flavopyridol, are nonselective and may inhibit multiple CDKs, potentially resulting in limited efficacy and high toxicity. Next-generation CDK4 / 6 inhibitors exhibit high selectivity and include palbociclib (PD-0332991 from Pfizer), abemaciclib (LY-2835219 from Eli Lilly), ribociclib (LEE011 from Novartis), and trilaciclib (G1T28). These CDK4 / 6 inhibitors have been preclinically tested in in vitro and in vivo models of several cancer entities, including leukemia, breast cancer, melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer, and metastatic breast cancer (mBC). In most studies, they demonstrated a consistent molecular and functional phenotype involving dose-dependent decreases in Rb phosphorylation, E2F1 target gene protein expression, and transcription, correlated with G0 / G1 arrest and inhibition of cell proliferation. Furthermore, all these reports demonstrate that Rb expression is a prerequisite for sensitivity to these inhibitors.

[0474] CDK4 / 6 inhibitors, such as PD-0332991, induce a dose-dependent decrease in total Rb protein, which correlates with a decrease in phosphorylated Rb. This decrease in total Rb partially correlates with a decrease in RB1 transcript levels and the transcription of E2F1 target genes CCNA2 and CCNE2. E2F1 expression levels are also significantly downregulated.

[0475] A CDK4 / 6 inhibitor suitable for use in the implementation of the present invention is disclosed in Figure 25.

[0476] As is evident from the examples, any CDK4 / 6 inhibitor is suitable for use in combination with a virus, preferably an adenovirus, more preferably an oncolytic adenovirus. Thereafter, the CDK4 / 6 inhibitor arrests cells at G1 and inhibits E2F1, more specifically, E2F1 activity.

[0477] Those skilled in the art will understand that any CDK4 / 6 inhibitor can be used at therapeutically effective concentrations.

[0478] PARP1 is a protein crucial for repairing single-strand breaks (DNA "nicks"). In mammals, 17 PARP family members have been discovered, and only six of these synthesize poly-ADP-ribose (pADPr). PARP1, PARP2, and PARP3 all play a role in DNA repair. PARP1 binds to DNA that has suffered single-strand breaks (SSBs) and double-strand breaks (DSBs). Subsequently, PARP1 enhances its activity by undergoing conformational changes that align key amino acid residues in its active site. When PARP1 is activated, it synthesizes pADPr. pADPr binds to proteins and alters their function. The level of pADPr present reflects DNA damage, and to ensure that the response to pADPr terminates after DNA repair, pADPr is rapidly degraded by pADPr glycohydrolase.

[0479] By inhibiting the DNA repair pathway, PARP1 inhibitors increase single-strand breaks in DNA. Because BER no longer occurs, this DNA damage is not repaired and is passed on to daughter cells after replication. This leads to an increase in DSBs in tumors with BRCA1 and BRCA2 mutations (Scott et al. 2015, J Clin Oncol., 33(12): 1397-140). The chemical structures of PARP inhibitors, including candidate PARP drugs rucaparib, veliparib, and olaparib, including the benzamide moiety that characterizes all PARP inhibitor structures, are shown in Figure 26 and are described in Antolin and Mestres 2014, Oncotarget, 30;5(10):3023-8.

[0480] In addition, it is well established that YB-1 enhances PARP activity and reduces the efficacy of PARP1 inhibitors (Alemasova et al. 2018, Oncotarget, 34, 23349-65). This suggests that YB-1-dependent oncolytic adenoviruses may act synergistically in cancer cell killing when combined with both CDK4 / 6 inhibitors and PARP inhibitors. Olaparib and BMN673 (Talazolarib developed from Pfizer, USA, Clin Cancer Res. 2013, 15;19(18):5003-15) are examples of PARP inhibitors.

[0481] Those skilled in the art will understand that any PARP inhibitor can be used at therapeutically effective concentrations.

[0482] A CDK4 / 6 inhibitor suitable for use in the implementation of the present invention is disclosed in Figure 25.

[0483] Abnormalities in epigenetic contexts are characteristic of cancer, and acetylation of lysine residues is a post-translational modification widely related to cellular signaling and disease biology. Enzymes that "write" acetylation sites (histone acetyltransferases, HATs) and enzymes that "erase" acetylation sites (histone deacetylases, HDACs) represent a broad area of ​​research in current drug development. Recruitment of proteins into macromolecular complexes by acetylated lysine residues is mediated by bromodomains (BRDs). Bromodomains are evolutionarily highly conserved protein interaction modules that recognize ε-N-lysine acetylation motifs. The conserved BRD fold is deep and primarily contains hydrophobic acetyllysine binding sites. These sites present an attractive pocket for the development of low molecular weight, pharmaceutically active molecules. Proteins containing BRDs are involved in the development of a wide variety of diseases.

[0484] In recent years, two highly potent and selective inhibitors targeting BRDs of the BET (bromodomain and extraterminal) family have provided compelling data supporting the targeting of these BRDs in cancer. The BET (bromodomain and extraterminal domain) subfamily of bromodomain proteins, consisting of BRD2, BRD3, BRD4, and BRDT, plays diverse roles in RNA polymerase II (POLII) transcriptional regulation and represents a new class of epigenetic drug targets. These proteins promote the initiation and elongation phases of transcription by binding to activated chromatin at acetylated lysine residues. Recognition of activated chromatin by these so-called epigenetic "leaders" facilitates the recruitment of the RNA polymerase II complex to the active transcription site. The BRD4 / P-TEFb interaction is crucial for rapid transcriptional restart after mitosis (Muller et al., 2011, Expert Rev. Mol. Medicine, 13, e19). P-TEFb was identified and purified as a factor necessary for the generation of long-run-off transcripts using an in vitro transcription system derived from Drosophila cells. P-TEFb is a cyclin-dependent kinase containing the catalytic subunit Cdk9 and the regulatory subunit cyclin T in Drosophila. In humans, multiple forms of P-TEFb exist, containing Cdk9 and one of several cyclin subunits, cyclin T1, T2, and K. P-TEFb has been found to associate with other factors, including the bromodomain protein BRD4, and to associate with a large protein complex called the superelongation complex (Yang Z, et al., 2005. Mol Cell; 19:535-45; Fu et al., 1999, J Biol Chem., 274:34527-30).

[0485] JQ-1 (thieno-triazolo-1-4-diazepine) is a potent inhibitor of the BET family of bromodomain proteins, including BRD2, BRD3, and BRD4 (Filippakopoulos et al., 2010 Nature 468, 1067-1073). JQ-1 disrupts the interaction between the bromodomain and the acetyl group, downregulating specific genes. Further BET bromodomain inhibitors, including OTOX15, BAY1238097, GSK2820151, I-BET762, and PLX51107, have been described (Perez-Salvia and Esteller 2017, EPIGENETICS, 12, 323-339; Brandt et al., 2015 ACS Chem. Biol., 10, 22-39). JQ-1 is structurally related to benzodiazepines. The formula is C23H25ClN4O2S.

[0486] In recent years, the BET inhibitor JQ-1 has been shown to promote adenovirus infection and adenovirus vector-mediated gene delivery. Treatment of cells with JQ-1 induces increased BRD4 association with CDK9, a P-TEFb subunit of transcriptional elongation. However, as described in the paper, further research is needed to refine the mechanism by which BRD4 utilizes adenovirus infection and transgene expression (Baojie Lv et al 2018, Scientific reports, 8, 11554). Importantly, viral replication and viral transcription were not investigated. However, it is known that CDK9 stimulates the restart of stalled polymerases and activates transcription by increasing the number of polymerases in transcription and thus the amount of mRNA synthesized per unit time (Gressel et al. 2017, eLife, 6, e29736). In addition, resistance to BET inhibitors has been shown to be overcome by CDK4 / 6 inhibitors (Jin et al. 2018, Mol Cell;71(4):592-605). Recently, a dramatic increase in P-TEFb-Brd4 interaction from anaphase to early G1 phase of the cell cycle, and active recruitment of P-TEFb to chromosomes, followed by transcription initiation of genes crucial for G1 progression, have been demonstrated. Importantly, Brd4 depletion halts the entire process by reducing transcription of essential G1 genes, leading to G1 cell cycle arrest and apoptosis (Yang et al., 2008, Mol Cell Biol., 28:967-976, Kohoutek, 2009, Cell Division, 4. 19).

[0487] However, nothing is known about the use of YB-1-dependent oncolytic adenovirus in combination with CDK4 / 6 inhibitors and BET inhibitors.

[0488] It will be understood that other bromodomain inhibitors would be equally suitable for use in triple therapy using viruses, preferably adenoviruses, more preferably oncolytic adenoviruses, such as XVir-N-31 and CDK4 / 6 inhibitors, and this falls within the scope of the present invention.

[0489] It will be understood by those skilled in the art that any bromodomain (Bet) inhibitor can be used at therapeutically effective concentrations.

[0490] Bromodomain inhibitors suitable for use in the implementation of the present invention are disclosed in Figure 27.

[0491] The role of MDM2 for p53 and E2F1 p53 and retinoblastoma (Rb) proteins are two important tumor suppressors. Mutations in one or both are found in all human cancer tumors, and both are extensively studied as potential therapeutic targets in drug development programs. Because p53 and E2F1 are critical regulators of cell proliferation and survival (cell death), their abundance and activity are tightly regulated. Mouse double mynewt 2 protein (MDM2), also known as the E3 ubiquitin-protein ligase, is thought to regulate both the MDM2-p53 pathway and the Rb-E2F1 pathway. Since Rb and p53 cannot interact directly, MDM2 is suggested to be a bridge between Rb and p53 (Polager and Ginsberg, Nat Rev Cancer 2009, 9, 738-48). Further supporting the role of MDM2 as an oncogene, several human tumor types, including soft tissue sarcoma, osteosarcoma, and breast tumors, have been shown to have elevated MDM2 levels. The MDM2 oncoprotein ubiquitinates and antagonizes p53, but may also perform p53-independent functions. MDM2 directly binds to p53 and inhibits its transcriptional activity. In addition, as a p53-selective E3 ubiquitin ligase, MDM2 promotes p53 ubiquitination and targets p53 for proteasomal degradation (Eischem et al, Hum. Mutant. 2014, 35, 728-737). On the other hand, there is evidence that MDM2 is also necessary for the survival of p53-deficient cancer cells (Feeley et al, Cancer Res 2017, 77, 3823-3833).

[0492] In line with the positive effects of MDM2 on the E2F1 pathway, MDM2 can physically interact with Rb, E2F1, and DP1, the heterodimer partner of E2F1, to promote G1 / S cell cycle transition. Therefore, the interaction between MDM2 and E2F1 or DP1 can stimulate the transcription of E2F1 target genes involved in cell cycle progression. Furthermore, the targeting of E2F1 for degradation by the F-box protein SKP2 is antagonized by MDM2 binding. Thus, there is evidence that MDM2 binding improves the stability of E2F1 (Zhang et al. Oncogene 2005, 24, 7238-7247), while MDM2 inhibition is associated with a decrease in E2F1 protein levels. Like many other oncoproteins, MDM2 selectively binds to low-phosphorylated Rb. The interaction between MDM2 and Rb inhibits Rb-E2F1 complex formation, resulting in suppression of Rb function. In addition, the interaction between RB and MDM2 leads to MDM2-mediated Rb degradation. Based on current findings, it is considered that MDM2 (in addition to p53) is also an important negative regulator of Rb (Shi and Gu, Genes Cancer. 2012, 3: 240-248; Yap et al., Oncogene 1999, 18, 7681-7689, Wu et al., JBC 2009, 284, 26315-26321).

[0493] Nutrin-3 Nutrin is a cis-imidazoline analog that inhibits the interaction between MDM2 and the tumor suppressor p53. Nutrin-3 is the most commonly used compound in anti-cancer research. Nutrin small molecules occupy the p53-binding pocket of MDM2 and effectively disrupt the p53-MDM2 interaction, which leads to activation of the p53 pathway in p53 wild-type cells. In response to nutrin-3 treatment, p53 cancer cells undergo either cell cycle arrest (G0 / G1 or G2 / S) or apoptosis. In addition, nutrin-3 can induce differentiation and cellular senescence. A range of factors, including mononucleotide polymorphisms of MDM2, MDM4, p73, ATM, and E2F1, have been shown to influence the outcomes of nutrin-3 treatment. Activation of p53 upregulates p21 and MDM2, both of which are important regulators of Rb. In recent years, it has been shown that nutrin-3 negatively affects both Rb and E2F1 protein levels and Rb phosphorylation, and that this significantly impacts the cellular response to nutrin-3 (Du et al., JBC 2009, 284, 26315-26321).

[0494] Previous studies have suggested that MDM2 tumorigenicity is due to its negative regulation of p53, but p53-independent interactions may be equally important. Recent studies using MDM2 inhibitors have highlighted that E2F transcription factor 1 (E2F1) is downregulated upon MDM2 inhibition, regardless of the cancer's p53 status. One publication describes the use of antisense RNA to inhibit MDM2 function. The authors concluded that MDM2 plays a role in prostate cancer growth through both p53-dependent and p53-independent mechanisms. Furthermore, it has been shown that Bcl2, Rb, pRb, and E2F1 protein levels decreased, while p21 increased (Zhang et al 2003, PNAS 2003, 100, 11636-11641). On the other hand, MDM2 has been shown to extend the half-life of the E2F1 protein by inhibiting its ubiquitination. MDM2 replaces SCF(SKP2), an E2F1 E3 ligase. Direct binding between MDM2 and E2F1 is essential for MDM2's negative effect on E2F1 ubiquitination, and the loss of MDM2's nuclear localization signal does not result in a loss of its ability to enhance E2F1 protein levels. The downregulation of E2F1 upon MDM2 inhibition was not due to either pRB or p14(Arf). In addition, E2F1 was responsible for at least part of the inhibition of cell proliferation induced by MDM2 knockdown. In conclusion, this study provides evidence that E2F1 protein stabilization is likely another p53-independent component of MDM2-mediated tumorigenesis (Zhang et al., Oncogene 2005, 24, 7238-7247).

[0495] Clearly, the Rb-E2F1 and MDM2-p53 pathways, along with the multifaceted crosstalk between them, are critical regulators of cell cycle progression and viability. However, clinical studies using MDM2-targeting agents have not met initial expectations, at least when used as monotherapy. This has spurred investigation into the optimized combination of MDM2 inhibitors with other anticancer drugs.

[0496] Several derivatives of nutrin have been developed and are progressing to human studies (Figure 1). These compounds are thought to act best on tumors containing normal or "wild-type" p53. However, recent results suggest that E2F1 transcriptional activity is a key determinant of MDM2 antagonist-induced apoptosis, and that p73 is important for nutrin-3-induced E2F1-mediated apoptosis (Burgess et al., Frontiers in Oncology 2016, 6, article 7; Skalniak et al., 2019, 29, 151-170; Kitagawa et al., Oncogene 2008, 27, 5303-5314).

[0497] Nuthrin and its derivatives (NVP-HDM201, Idasanutrin, AM-8553, SAR405838, Nuthrin-3a, AMG232) are shown in Figure 43.

[0498] Tumors that can be particularly treated with the viruses and combinations of the present invention described herein are preferably tumors selected from the group including tumors of the nervous system, eye tumors, skin tumors, soft tissue tumors, gastrointestinal tumors, respiratory tumors, skeletal tumors, endocrine tumors, female reproductive system tumors, mammary gland tumors, male reproductive system tumors, urinary excretion system tumors, hematopoietic tumors including mixed tumors and embryonic tumors, and leukemia. It is within the scope of the invention that these tumors are particularly resistant tumors, as specifically defined herein.

[0499] The group of tumors of the nervous system preferably includes the following:

[0500] 1. Tumors of the skull and brain (intracranial), preferably astrocytoma, oligodendroglioma, meningioma, neuroblastoma, gangliomas, ependymomas, schwannomas, neurofibromas, hemangioblastomas, lipomas, craniopharyngiomas, teratomas, and chordomas;

[0501] 2. Tumors of the spinal cord and spinal canal, preferably glioblastoma, meningioma, neuroblastoma, neurofibroma, osteosarcoma, chondrosarcoma, angiosarcoma, fibrosarcoma and multiple myeloma; and

[0502] 3. Tumors of peripheral nerves, preferably Schwann glioma, neurofibroma, neurofibrosarcoma, and perineurial fibroblastoma.

[0503] The group of eye tumors preferably includes the following:

[0504] 1. Tumors of the eyelids and eyelid glands, preferably adenoma, adenocarcinoma, papilloma, histiocytoma, mast cell tumor, basal cell tumor, melanoma, squamous cell carcinoma, fibroma and fibrosarcoma;

[0505] 2. Tumors of the conjunctiva and tumors of the nictitating membrane, preferably squamous cell carcinoma, hemangioma, angiosarcoma, adenoma, adenocarcinoma, fibrosarcoma, melanoma and papilloma; and

[0506] 3. Tumors of the orbit, optic nerve, and eyeball, preferably retinoblastoma, osteosarcoma, mast cell tumor, meningioma, reticular cell tumor, glioma, Schwann glioma, chondroma, adenocarcinoma, squamous cell carcinoma, plasma cell tumor, lymphoma, rhabdomyosarcoma, and melanoma.

[0507] The group of skin tumors preferably includes histiocytoma, lipoma, fibrosarcoma, fibroma, mast cell tumor, malignant melanoma, papilloma, basal cell tumor, keratoacanthoma, periangiocarcinoma, hair follicle tumor, sweat gland tumor, sebaceous gland tumor, hemangioma, angiosarcoma, lipoma, liposarcoma, malignant fibrous histiocytoma, plasmacytoma, and lymphangioma.

[0508] The group of soft tissue tumors preferably includes alveolar soft tissue sarcoma, epithelioid cell sarcoma, soft tissue chondrosarcoma, soft tissue osteosarcoma, soft tissue Ewing's sarcoma, primitive neuroectodermal tumor (PNET), fibrosarcoma, fibroma, leiomyosarcoma, leiomyoma, liposarcoma, malignant fibrous histiocytoma, malignant periangiocarcinoma, hemangioma, angiosarcoma, malignant mesenchymal tumor, malignant peripheral nerve sheath tumor (MPNST), malignant Schwann glioma, malignant melanocyte Schwann glioma, rhabdomyosarcoma, synovial sarcoma, lymphangioma, and lymphangiosarcoma.

[0509] The group of gastrointestinal tumors preferably includes the following:

[0510] 1. Tumors of the oral cavity and tongue, preferably squamous cell carcinoma, fibrosarcoma, Merkel cell tumor, inducible fibroblastoma, fibroma, fibrosarcoma, viral papillomatosis, idiopathic papillomatosis, nasopharyngeal polyps, leiomyosarcoma, myoblastoma, and mast cell tumors;

[0511] 2. Tumors of the salivary glands, preferably adenocarcinomas;

[0512] 3. Tumors of the esophagus, preferably squamous cell carcinoma, leiomyosarcoma, fibrosarcoma, osteosarcoma, Barrett's carcinoma, and paraesophageal tumors;

[0513] 4. Exocrine tumors of the pancreas, preferably adenocarcinoma; and

[0514] 5. Tumors of the stomach, preferably adenocarcinoma, leiomyoma, leiomyosarcoma, and fibrosarcoma.

[0515] The group of tumors of the respiratory system preferably includes the following:

[0516] 1. Tumors of the nose and nasal cavity, tumors of the larynx and trachea, preferably squamous cell carcinoma, fibrosarcoma, fibroma, lymphosarcoma, lymphoma, hemangioma, angiosarcoma, melanoma, mast cell tumor, osteosarcoma, chondrosarcoma, oncocytoma (rhabdomyoma), adenocarcinoma and myoblastoma; and

[0517] 2. Tumors of the lung, preferably squamous cell carcinoma, fibrosarcoma, fibroma, lymphosarcoma, lymphoma, hemangioma, angiosarcoma, melanoma, mast cell tumor, osteosarcoma, chondrosarcoma, oncocytoma (rhabdomyomas), adenocarcinoma, myoblastoma, small cell carcinoma, non-small cell carcinoma, bronchial adenocarcinoma, bronchoalveolar adenocarcinoma, and pulmonary alveolar adenocarcinoma.

[0518] The group of skeletal tumors preferably includes osteosarcoma, chondrosarcoma, paraosteosarcoma, angiosarcoma, synovial cell sarcoma, angiosarcoma, fibrosarcoma, malignant mesenchymal tumor, giant cell tumor, osteoma, and polylobular osteoma.

[0519] The group of endocrine tumors preferably includes the following:

[0520] 1. Tumors of the thyroid / parathyroid gland, preferably adenomas and adenocarcinomas;

[0521] 2. Tumors of the adrenal gland, preferably adenoma, adenocarcinoma, and pheochromocytoma (adrenal medullae);

[0522] 3. Tumors of the hypothalamus / pituitary gland, preferably adenomas and adenocarcinomas;

[0523] 4. Endocrine pancreatic tumors, preferably insulinoma (β-cell tumor, APUDom) and Zollinger-Ellison syndrome (gastrin-secreting delta-cell tumors of the pancreas); and

[0524] 5. Multiple endocrine neoplasms (MEN) and chemical ectodermoma.

[0525] The group of tumors of the female genital system preferably includes the following:

[0526] 1. Tumors of the ovary, preferably adenoma, adenocarcinoma, cystadenoma, and undifferentiated carcinoma;

[0527] 2. Tumors of the uterus, preferably leiomyoma, leiomyosarcoma, adenoma, adenocarcinoma, fibroma, fibrosarcoma and lipoma;

[0528] 3. Tumors of the cervix, preferably adenocarcinoma, adenoma, leiomyosarcoma and leiomyoma;

[0529] 4. Tumors of the vagina and vulva, preferably leiomyoma, leiomyosarcoma, fibroleiomyoma, fibroma, fibrosarcoma, polyps and squamous cell carcinoma.

[0530] The group of mammary gland tumors preferably includes fibroadenoma, adenoma, adenocarcinoma, mesenchymal tumor, carcinoma, and carcinosarcoma.

[0531] Tumors of the male genital system preferably include the following:

[0532] 1. Tumors of the testis, preferably seminoma, stromal cell tumor, and Sertoli cell tumor;

[0533] 2. Tumors of the prostate, preferably adenocarcinoma, undifferentiated carcinoma, squamous cell carcinoma, leiomyosarcoma and transitional cell carcinoma; and

[0534] 3. Tumors of the penis and vulva, preferably mast cell tumors and squamous cell carcinomas.

[0535] Tumors of the urinary excretion system preferably include the following:

[0536] 1. Tumors of the kidney, preferably adenocarcinoma, transitional cell carcinoma (epithelial tumor), fibrosarcoma, chondrosarcoma (mesenchymal tumor), Wilms' tumor, nephroblastoma, and embryonal nephromatous nephromatous (embryonic pluripotent blastoma);

[0537] 2. Tumors of the ureter, preferably leiomyoma, leiomyosarcoma, fibropapilloma, transitional cell carcinoma;

[0538] 3. Tumors of the bladder, preferably transitional cell carcinoma, squamous cell carcinoma, adenocarcinoma, botrioid (embryonic rhabdomyosarcoma), fibroma, fibrosarcoma, leiomyoma, leiomyosarcoma, papilloma and angiosarcoma; and

[0539] 4. Tumors of the urethra, preferably transitional cell carcinoma, squamous cell carcinoma, and leiomyosarcoma.

[0540] The group of hematopoietic tumors preferably includes the following:

[0541] 1. Lymphoma, lymphocytic leukemia, non-lymphocytic leukemia, myeloproliferative leukemia, Hodgkin lymphoma, non-Hodgkin lymphoma.

[0542] The group of mixed tumors and germ tumors preferably includes angiosarcoma, thymoma, and mesothelioma.

[0543] Preferably, these tumors are selected from the group including breast cancer, ovarian cancer, prostate cancer, osteosarcoma, glioblastoma, melanoma, small cell lung cancer, and colorectal cancer. Further tumors are also tumors that are resistant as described herein, preferably multi-resistant tumors, in particular the tumor groups described above.

[0544] Furthermore, the identification and screening of subjects to whom each combination of the present invention is administered is also within the scope of the present invention. Such identification of patients who can benefit from the present invention in its various forms is based on the detection of YB-1 in the nuclei of the subject samples.

[0545] In this embodiment, examination of tumor tissue is performed by using an agent selected from the group comprising antibodies against YB-1, aptamers against YB-1, spiegelmer against YB-1, and antikalin against YB-1. Basically, the same means can be prepared and used for the corresponding marker. The production of antibodies, particularly monoclonal antibodies, is known to those skilled in the art. A further means for the specific detection of YB-1 or the marker is a target structure, in this case, a peptide that binds with high affinity to YB-1 or the marker. Prior art has known methods for generating such peptides, such as phage display. Typically, a peptide library is used as a starting point, where each peptide has an amino acid length of 8 to 20, and the library size is approximately 10² to 10¹⁸, preferably 10⁸ to 10¹⁵, of different peptides. A special form of the target molecule-binding polypeptide is so-called antikalin, which is described, for example, in German Patent Application DE 19742706.

[0546] Further means for the specific binding of YB-1 or the corresponding marker disclosed herein, and for the detection of cell cycle-independent localization of YB-1 in the cell nucleus, are so-called aptamers, i.e., D-nucleic acids that exist as either RNA or DNA, as either single-stranded or double-stranded, and specifically bind to a target molecule. The generation of aptamers is described, for example, in European Patent EP 0533838. A special form of aptamer is the so-called aptazyme, which is described, for example, in Piganeau, N. et al. (2000), Angew. Chem. Int. Ed., 39, no. 29, pages 4369-4373. These are special embodiments of aptamers in that they include a ribozyme moiety separately from the aptamer moiety, acquire catalytic activity upon binding or release of a target molecule bound to the aptamer moiety, cleavage a nucleic acid substrate, and this cleavage proceeds with signal generation.

[0547] A further form of aptamer is the so-called Spiegelmer, i.e., a target molecule-binding nucleic acid prepared with L-nucleic acid. Methods for producing such Spiegelmers are described, for example, in WO No. 98 / 08856.

[0548] Tumor tissue samples can be obtained by aspiration or surgery. Evaluation of whether YB-1 is localized in the nucleus independently of the cell cycle is often performed by using microscopic techniques and / or immunohistoanalysis, preferably by using antibodies or any of the other aforementioned means. Further means for detecting YB-1 in the nucleus, in particular for detecting that YB-1 is localized there independently of the cell cycle, are known to those skilled in the art. For example, the localization of YB-1 can be readily detected in stained tissue sections when they are screened. The frequency of YB-1 presence in the nucleus already indicates that localization is independent of the cell cycle. Further options for detecting the cell cycle independence of YB-1 in the nucleus involve staining for YB-1 and detecting whether YB-1 is localized in the nucleus, as well as determining the cell stage. This can also be done by using the aforementioned means for YB-1, similar to the detection of YB-1. Detection by this means is performed by methods known to those skilled in the art. The agent specifically binds to YB-1 and does not bind to any other structures in the sample being analyzed, particularly cells. Therefore, due to their localization and their specific binding to YB-1, the localization of YB-1 can also be detected and established by appropriate labeling of the means. Methods for labeling the means are known to those skilled in the art. [Brief explanation of the drawing]

[0549] The present invention will be further demonstrated below with reference to the drawings and samples. Novel features, embodiments, and advantages can be obtained from these. [Figure 1]Figure 1a is a bar graph showing the relative absorbance as an indicator of cell viability for XVir-N-31 (XVir), wild-type adenovirus (WT), and control (Ctrl) when used in combination with the CDK4 / 6 inhibitors LY (LY-2835219), PD (PD-032991), or LEE (LEE011). Figure 1b is a bar graph showing the viral titers for XVir-N-31 (XVir) and wild-type adenovirus (WT) when used in combination with the CDK4 / 6 inhibitors LY (LY-2835219), PD (PD-032991), or LEE (LEE011). Figure 1c is a bar graph showing the relative filamentous DNA of XVir-N-31 (XVir) and wild-type adenovirus (WT) when combined with the CDK4 / 6 inhibitors LY (LY-2835219), PD (PD-032991), or LEE (LEE011). [Figure 2] Figure 2 shows the results of the Western blot analysis. [Figure 3] Figures 3a to 3d are bar graphs. [Figure 4] Figures 4a to 4d are bar graphs. [Figure 5] Figure 5 is a bar graph. [Figure 6] Figure 6 shows a series of microscopic images. [Figure 7] Figure 7 shows fluorescence microscopy images of T24 cells infected with GFP-expressing E1 deletion adenovirus, with and without palbociclib treatment. [Figure 8] Figure 8 is a bar graph showing the viral DNA replication of adenovirus dl703 after 48 hours using the compounds Nutlin 3a, Lee, Cl1040, and Roscovertine. [Figure 9A]Figures 9A-9C show the results of Western blot analysis of UMUC cells treated with the indicated concentrations of Nutlin-3a and LEE011 (ribociclib) (Figure 9A), roscovitine (Figure 9B), and CI-1040 (Figure 9C). Rb stands for retinoblastoma protein. phRB stands for phosphorylated retinoblastoma protein. E2F-1 stands for transcription factor E2F-1. GAPDH served as a loading control. [Figure 9B] Figures 9A-9C show the results of Western blot analysis of UMUC cells treated with the indicated concentrations of Nutlin-3a and LEE011 (ribociclib) (Figure 9A), roscovitine (Figure 9B), and CI-1040 (Figure 9C). Rb stands for retinoblastoma protein. phRB stands for phosphorylated retinoblastoma protein. E2F-1 stands for transcription factor E2F-1. GAPDH served as a loading control. [Figure 9C] Figures 9A-9C show the results of Western blot analysis of UMUC cells treated with the indicated concentrations of Nutlin-3a and LEE011 (ribociclib) (Figure 9A), roscovitine (Figure 9B), and CI-1040 (Figure 9C). Rb stands for retinoblastoma protein. phRB stands for phosphorylated retinoblastoma protein. E2F1 stands for transcription factor E2F1. GAPDH served as a loading control. [Figure 10] Figure 10 is a bar graph showing the cell cycle distribution in UMUC3 cells measured 48 hours after treatment. The concentrations of the CDK4 / 6 inhibitors used were as follows: Roscovetine: 10 μM, CI-1040: 1 μM, Nutlin-3a: 10 μM, and LEE011: 10 μM. [Figure 11] Figure 11 is a panel of microscopic images showing adenovirus hexone gene expression with and without palbociclib treatment. [Figure 12]Figure 12 is a bar graph showing the results of efficacy assays of T24 cells exposed to XVir-N-31 alone, the 15nM PARP inhibitor PARPi, 500nM PD (palbociclib), or a combination of 15nM PARPi and 500nM PD, expressed as cell viability. Here, cells were either uninfected (left column), infected with 10 MOI (center column), or infected with 50 MOI (right column). [Figure 13] Figure 13 is a panel of photographs showing SRB-stained T24 cell cultures after treatment with XVir-N-31 (20 MOI), XVir-N-31 and 15 nM PARPi, XVir-N-31 and 500 nM PD, and XVir-N-31, 15 nM PARPi and 500 nM PD (1 dpi, 2 dpi, 3 dpi, 4 dpi, 5 dpi, and 6 dpi). [Figure 14] Figure 14 is a panel of photographs showing SRB-stained UMUC cell cultures after treatment with XVir-N-31 (10 MOI), XVir-N-31 and 160 nM PARPi, XVir-N-31 and 400 nM PD, and XVir-N-31, 160 nM PARPi and 400 nM PD (1 dpi, 2 dpi, 3 dpi, 4 dpi, 5 dpi, and 6 dpi). [Figure 15] Figure 15 is a bar graph showing the results of efficacy assays on T24 cells 5 days post-infection with XVir-N-31, the CDK4 / 6 inhibitor palbociclib, and the bromodomain inhibitor JQ-1. Y-axis: % cell survival. [Figure 16] Figure 16 is a bar graph showing the results of a efficacy assay of SK-N-MC cells 5 days after exposure to XVir-N-31 alone, 200 nM abemaciclib, 500 nM JQ-1, or a combination of 200 nM abemaciclib and 500 nM JQ-1, as cell viability. Here, cells were either uninfected or infected with 5, 10, or 20 MOI. [Figure 17]Figure 17 shows the results of Western blot analysis at 24 and 48 hours post-treatment of SK-N-MC cells treated with the indicated concentrations of the CDK4 / 6 inhibitor LY-2835219 (abemaciclib) and the Wee inhibitor MK-1775 (adavocertib). Rb stands for retinoblastoma protein. phRB stands for phosphorylated retinoblastoma protein. E2F1 stands for transcription factor E2F1. GAPDH served as a loading control. [Figure 18] Figure 18 shows the results of efficacy assays on SK-N-MC cells 5 days post-infection with XVir-N-31, the CDK4 / 6 inhibitors palbociclib and adavocertib (Wee inhibitor, MK-1775). Results are expressed as cell viability. [Figure 19] Figure 19 shows the cell cycle distribution after treatment of SK-N-MC cells with the indicated inhibitors. [Figure 20] Figure 20 is a bar graph showing the effect of E2F1-targeting siRNA on E2F1 expression in various cell lines. Y-axis: % E2F1 expression normalized to actin in siCTRL-transfected cells. [Figure 21] Figure 21 is a bar graph showing that E2-initial expression increases in T24 cells treated with siRNA-E2F1 by E2F1 inhibition. Y-axis: Adenovirus gene expression normalized to actin (% siCTRL). [Figure 22] Figure 22 is a scheme showing the primer positions for determining the initial expression of adenovirus E2. [Figure 23] Figure 23 shows the nucleotide sequences of the wild-type E2 initial promoter (top) and the mutant E2 initial promoter (bottom) of adenovirus, which has a mutation in the E2F1 binding site. [Figure 24] Figure 24 is a bar graph showing RNA expression in AdWT-RGD and AdE2Fm (which also contains RGD motifs in the fibers) infected T24 cells obtained by RT-qPCR 24 hours after infection. AD-WT gene expression was set to 100%. [Figure 25-1] Figure 25 shows various CDK4 / 6 inhibitors suitable for use in the present invention. [Figure 25-2] Figure 25 shows various CDK4 / 6 inhibitors suitable for use in the present invention. [Figure 26-1] Figure 26 shows various PARP inhibitors suitable for use in the present invention. [Figure 26-2] Figure 26 shows various PARP inhibitors suitable for use in the present invention. [Figure 27-1] Figure 27 shows various Bet inhibitors suitable for use in the present invention. [Figure 27-2] Figure 27 shows various Bet inhibitors suitable for use in the present invention. [Figure 27-3] Figure 27 shows various Bet inhibitors suitable for use in the present invention. [Figure 28] Figure 28 shows the structure of adenovirus dl520, an oncolytic adenovirus that expresses only the E1A12 protein due to deletions in the CR3 domain of the WT-Ad5 and E1A genes. [Figure 29] Figure 29 shows the structure of XVir-N-31, characterized by the deletion of the E1B19K protein, a 2kb deletion in the E3 region, the deletion of the E1A13S protein, and the introduction of the RGD motif into the fibrous protein. [Figure 30] Figure 30, also described by Kleijn et al. (Kleijn et al., PLoS One. 2014; 9(5): e97495), shows the structures of Ad-delta24 and Ad-delta24-RGD, characterized by a deletion in the CR2 domain of the E1A gene. They replicate only in tumor cells with a deregulated retinoblastoma pathway (Rb). Ad-delta24-RGD further contains an RGD motif in the fiber knob, as shown in XVir-N-31. Note that the oncolytic adenovirus dl922-947 is similar to delta24, as the deletion in this virus is also located in the E1A-CR2 domain and affects RB binding (retinoblastoma protein). [Figure 31]Figure 31 shows that the structure of VCN-01, a highly replicable adenovirus specifically engineered to replicate in tumors lacking the RB pathway, exhibits enhanced infectivity through modified fibers and improved distribution through the expression of soluble hyaluronidase (Pascual-Pasto et al. Sci Transl Med. 2019, 11 476). The deletion in E1A of VCN-01 is similar to the deletion in delta 24 (deletion of the CR2 domain in E1A). Furthermore, the expression of this E1A protein is regulated by introducing an E2F1 binding site into the E1A promoter. In addition, it contains an RGD motif in its fiber knob and expresses soluble hyaluronidase (Martinez-Velez et al. 2016, Clin Cancer Res. 1;22(9):2217-25. The Oncolytic Adenovirus VCN-01 as Therapeutic Approach Against Pediatric Osteosarcoma). [Figure 32] Figure 32 shows the structures of E1Adl1107 and E1Adl1101. Here, deletions of these two oncolytic adenoviruses affect their binding to p300 (histone acetyltransferase p300, also known as p300 HAT or E1A-related protein p300) or pRb (retinoblastoma protein) (Howe et al., MOLECULAR THERAPY 2000, 2, 485-495). [Figure 33] Figure 33 shows the structure of oncolytic adenovirus CB016 (and one of the wild-type adenovirus 5 (WT-Ad5) strains). Here, the deletion in the E1A-CR2 domain is similar to that in Ad-delta 24. In addition, CB016 contains a deletion in the CR1 domain. Furthermore, CB016 contains either an RGD motif or a serotype 3-derived fiber in its filaments (LaRocca et al., Oral Oncol. 2016, 56, 25-31). [Figure 34]Figure 34 shows the structure of adenovirus ORCA-010 containing the E1AΔ24 deletion in the E1A CR2-domain, the potency-enhancing T1 mutation and the infectivity-enhancing fiber RGD modification in the E3 / 19K protein (Dong et al., Hum Gene Ther. 2014 Oct 1; 25(10): 897-904). [Figure 35] Figure 35 is a bar graph showing the results of efficacy assays, expressed as % cell viability, to determine the cytotoxic effect of XVir-N-31 alone, in combination with palbociclib alone, in combination with thalazoparib alone, or in combination with both palbociclib and thalazoparib ("combination") in UMUC-3 cells at 5 days post-infection (5 dpi). Here, the MOI of XVir-N-31 was set to 10, 20, or 50. [Figure 36] Figure 36 is a bar graph showing the results of efficacy assays, expressed as % cell viability, to determine the cytotoxic effect of XVir-N-31 alone, in combination with palbociclib alone, in combination with thalazoparib alone, or in combination with both palbociclib and thalazoparib ("combination") on T24 cells at 4 days post-infection (4 dpi). Here, the MOI of XVir-N-31 was set to 10, 50, or 100. [Figure 37] Figure 37 is a bar graph showing the results of efficacy assays, expressed as % cell viability, to determine the cytotoxic effect of XVir-N-31 alone, in combination with palbociclib alone, in combination with thalazoparib alone, or in combination with both palbociclib and thalazoparib ("combination") in 253J cells at 5 days post-infection (5 dpi). Here, the MOI of XVir-N-31 was set to 10, 20, or 50. [Figure 38] Figure 38 is a bar graph showing the percentage of T24 cells (left) and UMUC-3 cells (right) in cell cycle stages G0 / G1, S, and G2 48 hours after infection, when treated with talazoparib alone, palbociclib alone, or both (combination) of talazoparib and palbociclib. [Figure 39]Figure 39 is a bar graph showing the percentage of viable cells in efficacy assays against A673 cells 4 days after infection with 5, 10, and 20 MOI XVir-N-31, 200 nM abemaciclib (CDK4 / 6 inhibitor), and 200 nM JQ-1 (bromodomain inhibitor). [Figure 40] Figure 40 is a panel of photographs showing SRB-stained Cal-33 cell cultures 4 days post-infection after treatment with XVir-N-31 (1, 5, and 10 MOI), 100 nM palbociclib alone, 100 nM JQ-1 alone, or in combination (both palbociclib and JQ-1). [Figure 41] Figure 41 is a bar graph showing the results of the efficacy tests shown in Figure 40, expressed as % cell viability of Cal-33 cells at day 4 post-infection in 5MOI XVir-N-31, using 100nM palbociclib, 100nM JQ-1, or a combination of both palbociclib and JQ-1. [Figure 42A] Figure 42(A,B) is a bar graph showing XVir-N-31 replication as "relative fibers" in Cal-33 at 24 hours (Figure 42A) and 48 hours (Figure 42B) post-infection. The MOI was set to 10, the palbociclib concentration to 100 nM, and the JQ-1 concentration to 100 nM. [Figure 42B] Figure 42(A,B) is a bar graph showing XVir-N-31 replication as "relative fibers" in Cal-33 at 24 hours (Figure 42A) and 48 hours (Figure 42B) post-infection. The MOI was set to 10, the palbociclib concentration to 100 nM, and the JQ-1 concentration to 100 nM. [Figure 43-1] Figure 43 shows nutrin and its derivatives, namely NVP-HDM201, idasanutrin, AM-8553, SAR405838, nutrin-3a, and AMG232. [Figure 43-2] Figure 43 shows nutrin and its derivatives, namely NVP-HDM201, idasanutrin, AM-8553, SAR405838, nutrin-3a, and AMG232. [Figure 43-3]Figure 43 shows nutrin and its derivatives, namely NVP-HDM201, idasanutrin, AM-8553, SAR405838, nutrin-3a, and AMG232. [Figure 43-4] Figure 43 shows nutrin and its derivatives, namely NVP-HDM201, idasanutrin, AM-8553, SAR405838, nutrin-3a, and AMG232. [Figure 44] Figure 44 is a panel of photographs showing SRB-stained T24 cell cultures treated with XVir-N-31 alone, XVir-N-1 with 30 μM Nutrin-3a, XVir-N-31 with 500 nM Palbociclib, and XVir-N-31 with both Nutrin-3a and Palbociclib. Here, the MOI of XVir-N-31 was set to 0, 1, 5, 10, 20, or 30. [Figure 45] Figure 45 is a bar graph showing the results of the efficacy test shown in Figure 44, expressed as % cell viability compared to the control. [Figure 46] Figure 46 is a panel of photographs showing SRB-stained T24shRb cell cultures after treatment with XVir-N-31 alone, XVir-N-31 with 30 μM Nutrin-3a, XVir-N-31 with 500 nM Palbociclib, and XVir-N-31 with both Nutrin-3a and Palbociclib. Here, the MOI of XVir-N-31 was set to 0, 1, 5, 10, 20, or 30. [Figure 47] Figure 47 is a bar graph showing the results of the efficacy test shown in Figure 46, expressed as % viable cells compared to the control. [Figure 48] Figure 48 is a panel of photographs showing SRB-stained T24 cell cultures treated with XVir-N-31 alone, XVir-N-1 with 10 μM idasanutrin, XVir-N-31 with 500 nM palbociclib, and XVir-N-31 with both idasanutrin and palbociclib. Here, the MOI of XVir-N-31 was set to 0, 5, 10, 20, 40, and 60. [Figure 49] Figure 49 is a bar graph showing the results of the efficacy test shown in Figure 48, expressed as % viable cells compared to the control. [Figure 50] Figure 50 is a panel of photographs showing SRB-stained T24shRb cell cultures after treatment with XVir-N-31 alone, XVir-N-1 with 10 μM idasanutrin, XVir-N-31 with 500 nM palbociclib, and XVir-N-31 with both idasanutrin and palbociclib. Here, the MOI of XVir-N-31 was set to 0, 5, 10, 20, 40, or 60. [Figure 51] Figure 51 is a bar graph showing the results of the efficacy test shown in Figure 50, expressed as % viable cells compared to the control. [Figure 52] Figure 52 is a bar graph showing XVir-N-31 replication, represented as "relative fibers," in T24shRb cells (left) and T24 cells (right) at 24 and 48 hours, respectively. The MOI is set to 20. The palbociclib concentration was set to 500 nM, and the nutrin-3a concentration to 30 μM. [Figure 53] Figure 53 shows the results of the Western blot analysis. [Figure 54] Figure 54 is a bar graph showing the relative amounts of E2F1 protein when T24shRB cells were exposed to palbociclib, nutrin-3a, or a combination of both. [Figure 55-1] Figures 55(A)-(D) are bar graphs showing the percentage of cells in cell cycle stages G0 / G1, S, and G2 for T24 cells (A), T24shRb cells (B), UMUC-3 cells (C), and RT112 cells (D) after exposure to palbociclib, nutrin-3a, or a combination of both at the indicated concentrations. [Figure 55-2] Figures 55(A)-(D) are bar graphs showing the percentage of cells in cell cycle stages G0 / G1, S, and G2 for T24 cells (A), T24shRb cells (B), UMUC-3 cells (C), and RT112 cells (D) after exposure to palbociclib, nutrin-3a, or a combination of both at the indicated concentrations. [Figure 56-1]Figures 56(A)-(D) are bar graphs showing the percentage of cells in cell cycle stage G1 (T24 cells (A), T24shRb cells (B), UMUC-3 cells (C), and RT112 cells (D)) after exposure to palbociclib, nutrin-3a, or a combination of both at the indicated concentrations. [Figure 56-2] Figures 56(A)-(D) are bar graphs showing the percentage of cells in cell cycle stage G1 (T24 cells (A), T24shRb cells (B), UMUC-3 cells (C), and RT112 cells (D)) after exposure to palbociclib, nutrin-3a, or a combination of both at the indicated concentrations. [Figure 57] Figure 57 is a bar graph showing the relative survival of U87 cells after XVir-N-31 infection, in the case of cells with 100nM ribociclib (also known as LEE011), in the case of cells with 100nM JQ1, and in the case of cells with both 100nM ribociclib (LEE) and 100nM JQ1. The MOI for XVir-N-31 is set to 5. [Figure 58] Figure 58 is a bar graph showing the relative survival of LN229 cells after XVir-N-31 infection, with 100 nM ribociclib (also known as LEE011), with 200 nM JQ1, and with both 100 nM ribociclib (LEE) and 200 nM JQ1. The MOI for XVir-N-31 is set to 20. [Figure 59] Figure 59 is a bar graph showing the relative survival of T98G cells after XVir-N-31 infection, in the presence of 1 μM ribociclib (LEE, also known as LEE011), 200 nM JQ1, and both 100 nM ribociclib (LEE) and 200 nM JQ1. The MOI for XVir-N-31 is set to 50. [Figure 60] Figure 60 is a bar graph showing the relative amounts of adenovirus XVir-N-31 filamentous DNA in U87 cells exposed to ribociclib (LEE) (500 nM), JQ1 (50 nM), or a combination of ribociclib (500 nM) and JQ1 24 (50 nM) 24 hours after infection with XVir-N-31 (hpi). [Figure 61] Figure 61 is a bar graph showing the relative amounts of adenovirus XVir-N-31 filamentous DNA in LN229 cells exposed to ribociclib (LEE) (500 nM), JQ1 (100 nM), or a combination of ribociclib (500 nM) and JQ1 (100 nM) 48 hours (hpi) after infection with XVir-N-31. [Figure 62] Figure 62 is a bar graph showing the relative amounts of adenovirus XVir-N-31 filamentous DNA in T98G cells exposed to ribociclib (LEE) (1 μM), JQ1 (100 nM), or a combination of ribociclib (1 μM) and JQ1 (100 nM) 48 hours (hpi) after infection with XVir-N-31. [Figure 63] Figure 63 shows the results of Western blot analysis of LN229 cells exposed to 500 nM LEE, 200 nM JQ-1, or a combination of both 500 nM LEE and 200 nM JQ-1 24 hours after infection with XVir-N-31 (MOI20). [Figure 64] Figure 64 shows the results of Western blot analysis of LN229 cells exposed to 500 nM LEE, 200 nM JQ-1, or a combination of both 500 nM LEE and 200 nM JQ-1 48 hours after infection with XVir-N-31 (MOI20). [Figure 65] Figure 65 shows the results of Western blot analysis of LN229 cells exposed to 500 nM LEE, 200 nM JQ-1, or a combination of both 500 nM LEE and 200 nM JQ-1 72 hours after infection with XVir-N-31 (MOI20). [Figure 66] Figure 66 shows the results of Western blot analysis of LN229 cells exposed to 500 nM LEE, 200 nM JQ-1, or a combination of both 500 nM LEE and 200 nM JQ-1 72 hours after infection with XVir-N-31 (MOI20). [Figure 67] Figure 67 shows the locations of the interaction partners and conserved regions CR1-CR4 of E1A. [Figure 68] Figure 68 is a bar graph showing the relative increase in adenovirus DNA in LN229 cells 24 hours after infection (PI) with adenoviruses AdWT, dl1119, Addelta 24, XVir-N-31, and AdWT / E2Fm (MOI20) following JQ-1 treatment (200 nM). [Figure 69] Figure 69 is a bar graph showing the relative increase in adenovirus DNA in LN229 cells 48 hours post-infection (PI) after JQ-1 treatment (200 nM) with adenoviruses AdWT, dl1119, Addelta 24, XVir-N-31, and AdWT / E2Fm (MOI20). [Figure 70] Figure 70 shows the quantified fibrous DNA in UMUC-3 cells 24 hours after infection with XVir-N-31 (expressed as filaments / actin normalized to the filaments at 4 hours) after priming or co-treatment with either 100 nM JQ-1 (left) or 500 nM JQ-1 (right). [Figure 71] Figure 71 shows the particle formation of XVir-N-31 in UMUC-3 cells at 39, 49, 62, or 72 hours (hpi) post-infection, depending on the presence or absence of 500 nM JQ-1 (expressed as PFU / ml). [Figure 72] Figure 72 is a panel of bright-field micrographs of XVir-N-31 infected cells (10 MOI) after hexone titer testing at 39, 49, 62, or 72 hours (hpi) post-infection, with and without JQ-1 (top panel) and with 500 nM JQ-1 (bottom panel). [Figure 73] Figure 73 shows the Western blot analysis of UMUC-3 cells treated with XVir-N-31 with and without 500 nM JQ-1 at 12 hours, 24 hours, 36 hours, and 48 hours post-infection, illustrating the quantified viral expression dynamics. [Figure 74]Figure 74 is a bar graph showing the percentage of UMUC-3 cells (%) (left) and RT112 cells (%) (right) in the G0 / G1, S, and G2 phases under the influence of 100nM JQ-1, 300nM JQ-1, 500nM palbociclib, combination therapy of 100nM JQ-1 and 500nM palbociclib, and combination therapy of 300nM JQ-1 and 500nM palbociclib. [Figure 75] Figure 75 shows the results of Western blot analysis of UMUC-3 cells (left) and RT-112 cells (right) exposed to 0, 0.2 μM, and 0.5 μM JQ-1 and / or palbociclib 24 hours after treatment. [Figure 76] Figure 76 is a bar graph showing the effect of XVir-N31 (5 MOI) on killing UMUC-3 cells when treated with 200 nM JQ-1, 100 nM palbociclib, and a combination of 200 nM JQ-1 and 100 nM palbociclib, respectively, 5 days after infection. [Figure 77] Figure 77 is a bar graph showing the effect of XVir-N31 (40 MOI) on killing RT112 cells when treated with 200 nM JQ-1, 300 nM palbociclib, and a combination of 200 nM JQ-1 and 300 nM palbociclib, respectively, 5 days after infection. [Figure 78] Figure 78 is a bar graph showing the effect of XVir-N31 (40 MOI) on killing T24 cells when treated with 100 nM JQ-1, 200 nM palbociclib, and a combination of 100 nM JQ-1 and 200 nM palbociclib, respectively, 5 days after infection. [Figure 79] Figure 79 is a bar graph showing the replication of XVir-N-31 (10 MOI) in UMUC-3 cells 24 hours after infection with XVir-N-31 after priming and after co-treatment with JQ-1 (300 nM), palbociclib (100 nM), or a combination of JQ-1 (300 nM) and palbociclib (100 nM). Here, XVir-N-31 replication is quantified as relative fibrous DNA levels. [Figure 80]Figure 80 is a bar graph showing the replication of XVir-N-31 in T24 cells 24 hours after infection with XVir-N-31 (50 MOI) after priming and after co-treatment with JQ-1 (100 nM), palbociclib (200 nM), or a combination of JQ-1 (100 nM) and palbociclib (200 nM). Here, XVir-N-31 replication is quantified as relative fibrous DNA levels. [Figure 81] Figure 81 is a bar graph showing the replication of XVir-N-31 in RT112 cells 24 hours after infection with XVir-N-31 (20 MOI) after priming and after co-treatment with JQ-1 (200 nM), palbociclib (300 nM), or a combination of JQ-1 (200 nM) and palbociclib (300 nM). Here, XVir-N-31 replication is quantified as relative filamentous DNA levels. [Figure 82] Figure 82 is a bar graph showing the quantitative average production of virus-producing UMUC-3 cells infected with XVir-N-31 (9 MOI) with 200 nM JQ-1, 500 nM palbociclib, or a combination of both 200 nM JQ-1 and 500 nM palbociclib. Here, the average production is quantified as stained cells per field of view (fov). [Figure 83] Figure 83 is a panel of bright-field micrographs of XVir-N-31-infected UMUC-3 cells (9 MOI) after hexone titer testing. These cells were infected with XVir-N-31 alone, XVir-N-31 in combination with 200 nM JQ-1, XVir-N-31 in combination with 500 nM palbociclib, or XVir-N-31 in combination with 200 nM JQ-1 and 500 nM palbociclib. [Figure 84] Figure 84 is a bar graph showing the relative survival of UMUC-3 cells after infection with XVir-N-31 (0, 5, and 10 MOI) in combination with the BET inhibitors OTX (300 nM), AZD (5 nM), dBet6 (50 nM), and ARV (50 nM) shown. [Figure 85]Figure 85 is a bar graph showing the relative survival of RT112 cells after infection with XVir-N-31 (0, 20, and 50 MOI) in combination with the BET inhibitors OTX (130 nM), AZD (10 nM), dBet6 (150 nM), and ARV (10 nM) shown. [Figure 86] Figure 86 is a bar graph showing viral replication in UMUC-3 cells 24 hours after infection with XVir-N-31 (10 MOI) in combination with the BET inhibitors shown (OTX: 50 nM, AZD: 50 nM, dBet6: 50 nM, and ARV: 50 nM). [Figure 87] Figure 87 is a bar graph showing viral replication in RT112 cells 24 hours after infection with XVir-N-31 (50 MOI) in combination with the BET inhibitors shown (OTX: 40 nM, AZD: 15 nM, dBet6: 25 nM, and ARV: 15 nM). [Figure 88] Figure 88 shows the dosage and scheduled administration of XVir-N-31 and ribociclib in an animal study. Ribociclib succinate (LEE011) was administered orally at a dose of 200 mg / kg body weight daily for a total of 5 days (from day X to day X+4). A solvent without LEE011 was administered to animals receiving only PBS and XVir-N-31. XVir-N-31 was injected into the tumor twice, on day X+1 and day X+3. Each of the control animals that did not receive XVir-N-31 received PBS injections via it. [Figure 89] Figure 89 shows volume growth curves for various treatment groups (PBS, LEE, XVir alone, and in combination). Each data point represents the mean ± tumor size on the indicated day after the start of treatment. [Figure 90] Figure 90 is a box plot showing tumor volume [mm3] for various treatment groups (number of PBS in animals = 5), LEE (number of PBS in animals = 6), XVir alone (number of PBS in animals = 7), and combination therapy (number of PBS in animals = 7) at 12 to 21 days after the start of treatment. [Figure 91]Figure 91 is a bar graph showing the viral genome (expressed as filaments / 1000 actin) in tumors of representative animals treated with XVir-N-31 in combination with XVir-N-31 alone, compared to XVir-N-31 treatment alone. Evaluation 2 days after the second it injection of XVir-N31.

[0550] Example 1: Materials and Method cell culture Human bladder cancer cell lines were cultured in RPMI or DMEM medium (Biochrom AG) supplemented with 10% FBS (Biochrom AG) and 1% NEA (Biochrom AG), respectively, under subconfluent conditions at 5% or 10% CO2. Depending on the cell line and experimental conditions, 0.2–1 × 10⁶, 0.5–1 × 10⁵, 0.25–0.5 × 10⁵, and 500–700 cells were seeded per 10 cm in 6-well, 12-well, and 96-well formats.

[0551] cell line HeLaP HeLaP cells (ATCC CCL-2) are epithelial cells derived from cervical adenocarcinoma, named after patient Henrietta Lacks. This cell line is the most widely distributed and oldest (Rahbari et al., 2009), as it was the first permanent cell line established in 1951 (Gey et al., 1952). Culture was performed in DMEM (10% FBS, 1% PS) under 37°C and 10% CO2 conditions.

[0552] HeLaRDB HeLaRDB is a subcell line of the HeLaP cell line and possesses resistance to daunoblastin based on the overexpression of glycoprotein P. Resistance was achieved by culturing in a medium containing this anthracycline. This cell proliferation inhibitor intervenes in the double-stranded DNA sequence and inhibits cell transcription and replication (Mizuno et al., 1975). As a result of the stress response induced by daunoblastin treatment, the cellular factor YB-1 shows higher nuclear localization compared to the parent cell line (Holm et al., 2004). To maintain resistance to daunoblastin, cells were cultured every 14 days at 37°C under 10% CO2 conditions in DMEM (10% FBS, 1% PS) containing 0.25 μg / ml daunoblastin.

[0553] A549 A549 cells (ATCC CCL-185) were isolated from human alveolar basal adenocarcinoma in 1972 (Giard et al., 1973). They were cultured at 37°C and 10% CO2 in Dulbecco's MEM (10% FBS and 1% PS).

[0554] T24 T24 cells (ATCC HTB-4) were obtained from primary human bladder cancer in 1970 (Bubenik, Baresova et al., 1973). Point mutations in the HRAS gene (Reddy et al., 1982) activate the MAPK and PI3K pathways. Furthermore, this cell line has additional mutations at the p53 tumor suppressor gene locus (Pinto-Leite et al., 2014). The cells were cultured at 37°C and 5% CO2 under RPMI containing 10% FCS, 1% PS, and 1% non-essential amino acids.

[0555] HEK293 HEK293 cells (ATCC CRL-1573) are human embryonic kidney cells isolated in 1973. For stable transfection of a 4.5kb-sized portion of the genome of adenovirus serotype 5, including the entire E1 region (Graham and Smiley, 1977), this cell line is used for the production of E1-deficient adenovirus and the measurement of viral titers.

[0556] [Table 1] TIFF0007834342000004.tif240161

[0557] Virus characteristics Ad-WT+AdWT-RGD wild-type mastadenovirus, type C, serotype 5 and ADWT and further RGD fiber motifs AdWT-E2F1mut. Mastoadenovirus, type C, serotype 5, mutations in both E2F1 binding sites of the E2 initial promoter, an additional RGD fibril motif, and a 2.7kb deletion (ΔE3) in the E3 region. XVir-N-31 is a mastadenovirus, type C, serotype 5, characterized by deletions in the E1B region (1.716-1915, 200 bp), the E3 region (28.132-30.813), and a 12-nucleotide deletion in the E1A region. It replicates in cancer cells that express only nuclear YB-1. XVir-N-31 / E2F1M Mastoadenovirus, type C, serotype 5 It is characterized by deletions in the E1B region (1.716–1915, 200 bp), the E3 region (28.132–30.813), and a 12-nucleotide deletion in the E1A region. It replicates in cancer cells that express only nuclear YB-1. It also involves mutations in both E2F1 binding sites of the E2 initial promoter, an additional RGD fiber motif, and a 2.7 kb deletion (ΔE3) in the E3 region.

[0558] Manufacturers of target gene siRNA constructs Control: Control (non-sil.) siRNA, 20 μM Qiagen, the Netherlands E2F1 E2F1(SASI_Hs01_00162220), 10μM Sigma, Merck, Germany YB-1 YBX1 siRNA FlexiTube, 10μM Qiagen, the Netherlands

[0559] method siRNA transfection Downregulation of specific genes was performed using siRNA transfection. Here, 5 μl of lipofectamine RNAiMAX (Thermo Fischer) reagent was added to 150 μl of Opti-MEM in one tube, and 36 pmol of siRNA was added to 150 μl of Opti-MEM in the other tube. The contents of both tubes were combined, gently vortexed, and the solution was incubated at room temperature for 5 minutes. Then, 250 μl of the siRNA-lipid complex was added to 250,000–1,000,000 cells seeded the previous day in a 6-well plate, without changing the medium, until a final siRNA concentration of 30 pmol per well was reached. After incubation at 37°C and 10% CO2 for 48 hours, infection or lysis occurred.

[0560] RNA quantification combined with siRNA RNA in cells transfected with the virus using siRNA was also quantified. Here, 125,000 cells were seeded and transfected the following day with 30 pmol of control-, YB-1-, and E2F1-siRNA constructs. Infection occurred after 48 hours of incubation, and lysis occurred 24 hours post-infection. Lysates were stored at -20°C.

[0561] RNA isolation The cells were rinsed with PBS, lysed in lysis buffer (mirVana miRNA isolation kit, Life Technologies), and transferred to a 1.5 ml reaction tube. 50 μl of homogenate additive (mirVana miRNA isolation kit, Life Technologies) was added to the lysate, resuspended, and incubated on ice for 10 minutes. 500 μl of acid-phenol-chloroform was added, vortexed for approximately 30 seconds, and incubated on ice for 2 minutes. After centrifugation at 14.000 g at room temperature for 5 minutes, the aqueous and organic phases were separated. The upper aqueous phase was transferred to a new snap cap, combined with an equal volume of isopropanol, and mixed by inversion. After incubation at room temperature for 10 minutes, the sample was centrifuged at 4°C and 14.000 g for 30 minutes. Subsequently, the supernatant was removed, and the RNA pellet was washed with 1 ml of 75% ethanol. The sample was gently centrifuged at 7500 g at 4°C for 5 minutes. After removing the supernatant, the air-dried pellet was dissolved in 20 μl of nuclease-free water and incubated in a thermomixer at 55°C and 500 rpm for 10 minutes. Subsequently, the RNA concentration was measured by spectrophotometric analysis. To avoid amplification of DNA rut, DNase digestion was performed. Here, a deoxyribonuclease I amplification grade kit (Invitrogen, Life Technologies) was used. 1 μg RNA was mixed with 1 μl of 10× DNase I reaction buffer and 1 μl of DNase I, and the mixture was filled to a final volume of 10 μl with DEPC-treated water and incubated at room temperature for exactly 15 minutes. Adding 1 μl of 25 mM EDTA solution inactivated DNase I, thereby stopping the progress of DNase digestion. The sample was incubated at 65°C for 10 minutes and then used for reverse transcription.

[0562] Reverse transcription A high-performance cDNA reverse transcription kit (Thermo Scientific) was used to convert RNA to cDNA. RNA from 2 μg of DNA digestion samples was added to a Mastermix containing transcription buffer, 100 mM dNTPs, and an RNAse inhibitor in a PCR soft tube. It was assumed that RNA transcribed via the E2 early and E2 late promoters could not be rewritten using the random primers typically used for reverse transcription, as these random primers would bind to both strands of the double-stranded adenovirus genome. For this reason, RNA-to-cDNA conversion was performed for the samples used for E2 early and E2 late quantification by using specific E2 early reverse primers (Table 1). For actin, a housekeeping gene used to normalize the results, random primers were used.

[0563] DNA replication analysis DNA replication analysis was performed to investigate viral replication within infected cells. 125,000 cells were seeded in a 6-well plate and infected at 10-20 MOI. Lysination was performed 2, 8, 12, 24, 36, and 48 hours after infection. The culture medium was then removed, and the adherent cells were washed with 1 ml of PBS. After adding 200 μl of DNA lysis buffer, the adherent cells were scraped off the plate using a cell scraper. The lysates were then transferred to snap caps. 3 μl of the enzyme proteinase K was added, and the mixture was incubated overnight in a thermomixer at 56°C and 550 rpm. DNA isolation was performed the following day.

[0564] DNA isolation For DNA purification, 200 μl of phenol-chloroform-isoamyl alcohol was added to the lysate. After vortexing and subsequent incubation on ice for 5 minutes, phase separation was achieved by centrifugation at 4°C and 16430 g for 3 minutes. The upper aqueous phase was transferred to a new snap cap containing 200 μl of chloroform in 10 mM TrisCl and 20 μl of cresol red for better visualization of the phase. After vortexing and incubation on ice for 5 minutes, centrifugation was performed at 4°C and 16430 g for 3 minutes. Again, the upper aqueous phase was combined with 800 μl of ethanol and 50 μl of 3M sodium acetate solution. To achieve better precipitation, 2 μl of glycogen was added. After a short inversion and mixing of the tube, this solution was centrifuged at 4°C and 16430 g for 30 minutes. Next, the DNA pellet was covered with 400 μl of 70% ethanol and incubated at room temperature for 10 minutes. After centrifugation at room temperature and 4760 g for 7 minutes, the DNA pellet was dried at 37°C for approximately 5-10 minutes. Subsequently, this pellet was dissolved in 100 μl of 0,1×TE buffer and shaken at 40°C and 400 rpm for approximately 3 hours. Once the DNA was completely dissolved, the DNA concentration was measured using a spectrophotometer with 2 μl of DNA solution for measurement and 0,1×TE buffer as a blank solution. The DNA was then stored at 4°C.

[0565] qPCR For further quantification, real-time quantitative PCR was used. 5 μl of template DNA or cDNA was used at a final concentration of 10 ng / μl. qPCR was performed in a 96-well plate pipetteted with 10 μl of Mastermix GoTaq PCR (Promega Corporation) (Mastermix 7.5 μl, primer 1.5 μl, H2O 1 μl) and 5 μl of DNA template. Relative quantification was performed using the comparative CT method with two normalized genes. The plate was foil-bound and centrifuged at room temperature at 220 g for 2 minutes. The plate was then incubated in a thermal cycler according to a specific temperature-time program. The primers used are listed in Table 1. The reaction was performed using a CFX96 real-time PCR detection system (Bio-Rad Laboratories).

[0566] qPCR cycle conditions Fibers: 2 minutes at 94°C, 15 seconds at 94°C, 15 seconds at 60°C, and 15 seconds at 72°C, for 45 cycles. Other viral genes: 1.5 minutes at 94°C, 15 seconds at 94°C, 15 seconds at 58°C, and 15 seconds at 72°C, for 45 cycles. Rb: 2 minutes at 94°C, 15 seconds at 94°C, 30 seconds at 60°C, and 1 minute at 72°C, for 44 cycles. E2F1: 2 minutes at 95°C, 15 seconds at 95°C, 30 seconds at 60°C, and 30 seconds at 72°C, for 40 cycles.

[0567] Protein isolation Cells were lysed using 1% SDS buffer to achieve nuclear membrane disruption. The entire process was performed on ice to avoid protein denaturation. After aspirating the medium, the cells were washed twice with cold PBS. Adherent cells from one well of the daplicate approach were lysed with 200 μl of 1% SDS buffer and scraped off with a cell scraper. The lysate was then transferred to the other well of the daplicate approach and scraped off again. The lysates from both wells were then combined and transferred to a snap-cap tube. Subsequently, the lysate was processed with a syringe to disrupt the viscous DNA and centrifuged at 4°C and 31000 rpm for 30 minutes. Since proteins were present in the supernatant, the supernatant was transferred to a new snap-cap tube and used for further steps.

[0568] Protein quantification To quantify the amount of protein, a bicinchoninic acid (BCA) assay was performed using the Pierce™ BCA Protein Kit. Here, 112.5 μl of BCA solution A+B (50:1) and 12.5 μl of the sample were added to one well of a 96-well plate and incubated at 37°C for 30 minutes. Staining of the solution occurred depending on the protein concentration. The protein concentration of the sample was determined by photometric measurement at 562 nm using a microplate reader, using a standard series with known protein concentrations.

[0569] SDS gel electrophoresis To separate proteins in subsequent sodium dodecyl sulfate polyacrylamide gel electrophoresis, a calculated amount of lysate and lysis buffer was mixed with 15 μl of loading buffer-DDT mixture (6:1). The protein loading material was then heated at 100°C for 5 minutes. 5 μl of color protein standards and 40 μl of sample were loaded onto the gel. A 10% gel was used for protein separation for viral protein detection. A 12% gel was used to study downregulated genes by siRNA. The compositions of the separation gels and stacking gels are listed in the buffers and solutions section. The gels were run in TGS buffer at 90 V for approximately 20 minutes to collect all proteins into a single band. Subsequently, the gels were run in TGS buffer at 150 V for approximately 60 minutes to separate proteins by size.

[0570] Western blot The proteins were blotted using Western blotting techniques to transfer them from the gel to the membrane. The hydrophobic PVDF membrane was incubated in methanol for approximately 2 minutes to activate it. Subsequently, the membrane was deposited in blotting buffer along with sponge, filter paper, and gel. The proteins were transferred to the membrane in blotting buffer by electrophoresis at 4°C, 100V for approximately 2 hours. To avoid nonspecific antibody binding, the membranes were blocked by rotating them at room temperature for 1 hour in 10 ml of 5% milk powder in TBST for the analysis of cellular proteins, and in 5 ml of 5% BSA-TBST for the subsequent use of antibodies to detect viral proteins. After washing the membranes five times in TBST for 5 minutes each, the membranes were incubated overnight at 4°C with primary antibody solution, rotating as needed. For antibodies GAPDH, E1A, E1B55K, E2A, and E4orf6, this process was repeated at room temperature for 1 hour. Here, the antibodies were diluted at different concentrations in 5% BSA in TBST containing 0.02% sodium azide. After five further washing steps, the membranes were incubated in a 1:10,000 dilution of secondary antibody at room temperature for 30 minutes by rotation. The secondary antibody against the viral antibody (anti-mouse) was diluted in 5% BSA-TBST, and all other antibodies were diluted in 5% powdered milk in TBST. These secondary antibodies were conjugated with horseradish peroxidase. After five final washing steps, the membranes were incubated in Enhanced-Chemi-Luminescence (ECL) solution for 5 minutes to visualize the peroxidase signal. For membranes incubated with primary antibodies DP-1 and E2F1, a brighter signal was achieved using Amersham ECL Prime Western blot detection reagent from GE-Healthcare. For all others, laboratory-prepared ECL solution was used. The compositions of ECL A and ECL B, mixed 1:1 immediately before use, are listed in the Buffers and Solutions section. Finally, the protein could be detected by the signal it produced on the film.

[0571] [Table 2]

[0572] Treatment with small molecule inhibitors PD-0332991 isethionate (palbociclib, Sigma-Aldrich Chemie GmbH) and LY-2835219 (abemaciclib, Selleck Chemicals) were dissolved in sterile water as a 10 mM stock solution. LEE011 (ribociclib, MedChem Express) and Nutlin-3a (Sigma) were dissolved in DMSO as 10 mM and 5 μM stock solutions, respectively. The solutions were prepared fresh for immediate use at the working concentration.

[0573] Viral infection and combined treatment Cells were seeded in 12-well plates to determine virus-induced cell death. Cells were pre-treated with inhibitors for 24 hours for combined treatment with PD-033299, LY-2835219, and LEE011. These cells were infected with the viruses indicated by the given MOI in 200–400 μl of FBS-free medium. Complete medium containing or without the small molecule inhibitor at 1 hpi was added to the cells.

[0574] Cell survival (SRB assay) Cells were fixed with 10% TCA at 4°C for 1 hour, stained with 0.5% sulfohodamine B (SRB, Sigma-Aldrich Chemie GmbH) in 1% acetic acid for 30 minutes using RT, and then washed with 1% acetic acid to remove excess SRB. The dried SRB was dissolved in 10 mM Tris buffer and quantified by photometric measurement at 590 nm.

[0575] Potency test To determine infectious virus particle production, infected cells and supernatant were collected at 3 dpi using a cell scraper. Viruses were released from intact cells by multiple freeze-thaw cycles followed by centrifugation at 1600 rcf. Cell lysates supernatant were tested for virus particle production using Hek293 cells as described in the AdEasy virus titer kit instructions (972500). The following reagents were used: goat anti-hexone antibody (1056, Chemicon), rabbit anti-goat antibody (P0449, Dako), and DAB solution (Dako).

[0576] Example 2: Effect of CDK4 / 6 inhibitor PD0332991 on replication of E1-negative adenovirus E1-deficient adenoviruses have been shown to replicate in cancer cells, albeit with very low potency. T24 cells were infected with E1-negative adenovirus (Ad-GFP) expressing 100 MOI green fluorescent protein and treated with 500 nM PD0332991 one day before infection and during incubation. Under these conditions, increased GFP expression was observed, indicating E1A-independent viral replication and gene expression mediated by activation of the adenovirus E2 early promoter.

[0577] Example 3: Combination therapy with wild-type adenovirus or XVir-N-31 and various CDK4 / 6 inhibitors Based on results obtained using E2 early mutant adenovirus Ad-WT / E2M and Ad-GFP in combination with PD0332991, experiments were conducted using various CDK4 / 6 inhibitors in combination with either wild-type adenovirus Ad-WT or XVir-N-31. Since these drugs halt cells in the G1 phase, it was surprising to find that all inhibitors were able to support viral replication.

[0578] Furthermore, we investigated whether treatment of cells with three clinically advanced CDK4 / 6 inhibitors—PD-033299, LY-2835219, and LEE011—could affect infection in terms of cell viability, viral replication, and viral titer production.

[0579] Upon treatment, all three inhibitors exhibited similar effects on RB expression and phosphorylation levels, as has been previously documented in numerous publications. Even after nearly complete dephosphorylation and total protein downregulation within 24 hours, phosphorylation levels partially recovered over time. CDK2 levels were upregulated upon treatment, while cyclin D2 and cyclin E2 levels were downregulated.

[0580] Example 4: Synergistic effect of combining a CDK4 / 6 inhibitor with oncolytic adenovirus The CDK4 / 6 inhibitors PD-033299, LY-2835219, and LEE011 were combined with adenovirus infection of cells. Cell infection was performed 24 hours after treatment because downstream effects on target molecules can only be detected between 8 and 24 hours after treatment.

[0581] The results are shown in Figure 1.

[0582] Synergistic effects were induced on cell viability, viral replication, and viral titer by CDK4 / 6 inhibitors. (a) Cells were pretreated for 24 hours with three CDK4 / 6 inhibitors, PD-033299, LY-2835219, and LEE011, and infected with XVir-N-31 (Moi60) or wild-type adenovirus (Moi80). Cell viability was measured by SRB assay 4 days post-infection. Graphs show the mean of at least three independent experiments. (b) Lysate was prepared from cells 3 days post-infection, and titer testing was performed on HEK293 cells. Viral titer is shown as a double change relative to the control. (c) DNA was extracted from infected cells at 4, 24, 36, and 48 hpi, and viral replication was analyzed using qPCR for fibrous cDNA. Values ​​are normalized to GAPDH at 4 hpi. Graphs show representative values ​​from at least two independent experiments. Error bars represent the standard error.

[0583] As is evident from Figure 1, all three CDK4 / 6 inhibitors dramatically supported cell lysis (Figure 1a), intracellular replication (Figure 18), and viral particle formation (Figure 1b).

[0584] Example 5: Effect of the CDK4 / 6 inhibitor palbociclib (PD-033299) on selected viral protein expression levels. To analyze these effects in more detail, the expression levels of selected viral proteins were determined in treated and untreated cells. For this experiment, the inhibitor palbociclib (PD-033299) was used as a representative CDK4 / 6 inhibitor. Cells were infected at 15 MOI. PD treatment at 500 nM was performed 24 hours after infection and until protein isolation. Protein isolation was performed at 12, 24, and 36 hours using 1% SDS buffer. Actin was included as a positive control. Since the loading control shows the same protein levels of cellular actin in all lines, appropriate comparisons between lines are ensured. hpi: time after infection.

[0585] The results are shown in Figure 2. Figure 2 shows the viral protein expression results of Ad-WT and XVir-N-31 infected T24 cells combined with the CDK4 / 6 inhibitor PD0332991 (PD). All viral proteins investigated in this experiment (E1A, E1B-55k, DBP (E2A), and hexone) were expressed at higher levels in cells treated with the CDK4 / 6 inhibitor PD-0332991 compared to wild-type adenovirus. This effect could be observed as early as 12 hpi for E1A and 24 hpi for the other proteins.

[0586] Example 6: Specificity of effects mediated by CDK4 / 6 inhibitors The class of CDK4 / 6 inhibitors according to Example 5 requires RB expression. Therefore, three RB-positive and two RB-negative bladder cancer-derived cell lines were used, and these cells were treated with combination therapy. The cell lines were pre-treated for 24 hours with PD-0332991 (T24: 500 nM, RT112: 2000 nM, 253J: 100 nM) at IC50 concentrations and infected with XVir-N-31 (T24 MOI 50, 253J MOI 25, RT112 MOI 450). Values ​​are the mean of at least two independent experiments. Error bars indicate the standard error. Cell viability was measured at 4 dpi using SRB assays (a, c). (b, d) Cell lysates were prepared at 3 dpi and titer testing was performed on Hek293 cells. Viral titers are shown as a double change relative to the control.

[0587] The results are shown in Figure 3.

[0588] As is clear from Figure 3, only RB-positive cell lines showed a significant decrease in both cell proliferation and cell survival (Figure 3a, c). Furthermore, viral particle formation increased only in RB-positive cell lines after treatment with PD-0332991 (Figure 3b, d).

[0589] Example 7: Effect of combination therapy with CDK4 / 6 inhibitor PD-0332991 and XVir-N-31 To investigate the effect of PD-0332991 on viral replication in RB-positive cell lines, relative quantification of filamentous DNA copies was performed using qPCR. Bladder cancer cell lines were pre-treated for 24 hours and infected with XVir-N-31 (T24 MOI40, UMUC3 and 253J MOI20, RT112 MOI400). DNA was extracted at 24–48 hpi and analyzed for viral filaments using qPCR. Values ​​were normalized to GAPDH. Data are representative of at least two independent experiments. Error bars are SD.

[0590] The results are shown in Figure 4.

[0591] As can be seen in Figure 4, combined treatment with the CDK4 / 6 inhibitor PD-0332991 and XVir-N-31 dramatically increases viral replication.

[0592] Example 8: Time-dependent dynamics of CDK4 / 6 inhibitors The temporal characteristics of the CDK4 / 6 inhibitor against RB dephosphorylation and degradation were approximately 10 hours after cell treatment. Furthermore, the results shown above indicated a temporal and partial recovery of RB downstream targets (Figure 1). This observation suggests that the temporal characteristics of the CDK4 / 6 inhibitor and its effect on virus-induced cell death are important parameters of this combination therapy, as illustrated in Example 7. Different time points for cell pretreatment were tested for the application of the combination therapy. Accordingly, cells were treated either pre-infection (days / hours before infection, dai / hai) or 1 hour after infection, and cell proliferation was measured using the SRB assay. Error bars represent SE, and the values ​​are the average of three independent experiments.

[0593] The results are shown in Figure 5.

[0594] As is clear from Figure 5, parallel processing was already sufficient to increase cell death.

[0595] Example 9: Combined treatment of various adenoviruses with the CDK4 / 6 inhibitor PD0332991 This example was conducted to provide experimental evidence that various oncolytic adenoviruses can be used with CDK4 / 6 inhibitors, such as PD0332991, for cell toxication, and that the observed increases in viral replication and cell toxication were not limited to XVir-N-31. Accordingly, T24 cancer cells with Ad-Delta-24 and Onyx-015: T24 bladder cancer cells were infected with 20 MOI oncolytic adenoviruses as follows. Treatment with 500 nM CDK4 / 6 inhibitor PD0332991 was performed one day before infection and for four days after infection. Images were taken four days after infection. The occurrence of cytopathic effects (CPE) indicates viral replication and cell toxication.

[0596] The results are shown in Figure 6.

[0597] As can be seen in Figure 6, the CDK4 / 6 inhibitor PD0332991, a representative example of a CDK4 / 6 inhibitor that reduces RB phosphorylation, increased cell killing when combined with other oncolytic adenoviruses, such as Ad-Delta-24 and Onyx-015.

[0598] Example 10: When T24 cells are infected with recombinant E1 deletion adenovirus (Ad-negative / GFP) expressing GFP in combination with palbociclib, GFP expression increases. 100,000 T24 cells / well were seeded into 6-well plates and grown in RPMI medium containing 10% FCS at 5% CO2 and 37°C. T24 cells were treated with 500 nM palbociclib 24 hours before infection and 1 hour after reinfection. Infection with GFP-expressing E1 deletion adenovirus (Ad-negative / GFP) was performed in 400 μl of serum-free medium. Photographs were taken 48 hours post-infection using a 10x fluorescence microscope.

[0599] Figure 7 shows the results of fluorescence microscopy analysis of GFP expression with and without palbociclib treatment.

[0600] The results indicate that treatment of T24 cells with palbociclib strongly increased GFP expression mediated by palbociclib-induced viral DNA replication.

[0601] Example 11: E1A-independent viral replication in UMUC cells treated with various cell cycle inhibitors DNA replication analysis was performed to investigate differences in dl703 replication under different treatment conditions (Mantwill et al. 2013, Journal of Translational Medicine, 11, 216). 100,000 UMUC cells were seeded in 6-well plates and grown in DMEM medium containing 10% FCS under 5% CO2 conditions at 37°C. 24 hours after seeding, cells were treated with 10 μM Lee (ribociclib), 1 μM CI-1040, 10 μM Nutrin-3a, and 10 μM Roscovertine for 24 hours. After infection, appropriate amounts of the inhibitors were added to the medium again. Infection with 50 MOI dl703 (mastoadenovirus, type C, serotype 5, with a 3.2 kb deletion in the E1 region) was performed 24 hours after treatment. DNA was isolated at 4 and 48 hours post-infection, and qPCR was performed using primers specific to the viral filament gene. Filament forward: 5'-AAGCTAGCCCTGCAAACATCA-3' (SEQ ID NO: 17); Filament reverse: 5'-CCCAAGCTACCAGTGGCAGTA-3' (SEQ ID NO: 18).

[0602] The results are shown in Figure 8.

[0603] As is clear from Figure 8, treatment of UMUC cells with the CDK4 / 6 inhibitor LEE011 (ribociclib) dramatically increased viral DNA replication of E1-negative adenovirus dl703 (almost 100-fold). This increase strongly suggests that specific induction G1 arrest by ribociclib, combined with suppression of E2F1 expression, promotes adenovirus replication unrelated to E1. As a result, not only viruses with a specific deletion in the E1A gene show increased adenovirus DNA replication under CDK4 / 6 treatment; even adenoviruses with a complete deletion of the E1A gene show increased viral DNA replication.

[0604] The Mek inhibitor GI-1040 showed similar properties in terms of E2F1 expression inhibition and G1 arrest, but its replication was significantly lower compared to ribociclib-treated cells. This is thought to be due to the simultaneous inhibition of other important cell cycle-related pathways necessary for viral replication, such as MEK / ERK. In addition, inhibition of the MEK / ERK pathway has been shown to reduce particle formation by more than 100-fold, making it clinically unsuitable for combination therapy with oncolytic adenovirus replication (Schumann and Doppelstein 2016, Cancer Research, 66, 1282-1288).

[0605] Example 12: Western blot analysis of UMUC cells treated with the indicated cell cycle inhibitors Western blot analysis of UMUC cells treated with CI-1040, roscovitine, Nutlin-3a, and LEE011 (ribociclib) at the indicated concentrations. 1 × 10⁶ cells were seeded in a 10 cm dish. 24 hours after treatment, proteins were isolated using 1% SDS buffer to achieve nuclear membrane disruption. All samples were aspirated several times into a syringe to disrupt DNA, followed by centrifugation at 30,000 rpm at 4°C for 30 minutes. The supernatant was transferred to a new reaction tube for direct use in further steps or stored at -80°C. Sodium dodecyl sulfate polyacrylamide gel electrophoresis was performed to separate proteins. 40 μg of total protein was loaded by electrophoresis at 100 V at 4°C for approximately 2 hours and probed against the indicated specific antibody.

[0606] The results are shown in Figures 9A, 9B, and 9C.

[0607] As is clear from Figure 9, roscovitine and Nutlin-3a did not have a significant effect on Rb, phRB, and E2F1 expression, but LEE-011 (ribociclib) at 10 μM and MI-1040 at 1 μM induced inhibition of E2F1, Rb, and phRb expression.

[0608] Example 13: Analysis of viral DNA replication of E1 deletion-deficient adenovirus dl703 by CDK4 / 6 inhibitors For cell cycle analysis, cells were seeded in 6-well plates (2.5 × 10⁴ E⁴c / well). Eight hours prior to infection with dl703, cells were treated with the indicated concentration of a cell cycle inhibitor. After infection with 10 MOI dl703, cells were treated again for 48 hours. Untreated cells and cells infected only with dl703 were used as controls. Forty-eight hours post-infection, cells were harvested by trypsin treatment and fixed with 80% ethanol while vortexing. To investigate the state of the cell cycle, fixed cells were centrifuged at RT and 300g for 5 minutes, and the ethanol was aspirated. The cells were resuspended, washed with 1% BSA-PBS (bovine serum albumin), and centrifuged again. Cells were stained with EDU, and cell cycle analysis was performed using the Thermo Fischer Click-iT® Plus EdU flow cytometry assay kit, catalog no. C10632. In addition, cells were washed three times with 1% BSA / PBS and then stained with PI (propidium iodide, 50 μg / ml). After staining using the FACScalibur flow cytometry system, measurements were performed directly. The data were analyzed using FlowJo software.

[0609] Characteristics of CDK4 / 6 inhibitors CI1040: MAP kinase kinase (MEK), a bispecific threonine / tyrosine kinase, is a key component of the RAS / RAF / MEK / ERK signaling pathway, which is often activated in human tumors. CI-1040 is a benzhydroxamate compound that potently inhibits MEK (Allen et al. 2003, Semin Oncol. (5 Suppl 16):105-16) and causes G1 arrest.

[0610] Nutlin-3a: Nutlin-3, a small molecule antagonist of MDM2, effectively restores p53 function in both normal MDM2-expressing cell lines and MDM2-overexpressing cell lines with wild-type p53, leading to cell cycle arrest and apoptosis (Wang et al 2012, Acta Biochimica et Biophysica Sinica, Volume 44, Issue 8, 1 August 2012, Pages 685-691).

[0611] Roscovitine (celiciclib or CYC202) is an experimental drug candidate in the family of pharmacological cyclin-dependent kinase (CDK) inhibitors that preferentially inhibits multiple enzyme targets, including CDK2, CDK7, and CDK9. This inhibition alters the proliferative phase or state within the cell cycle of treated cells (Whitaker et al. 2004, Cancer Research 64, 262-272).

[0612] LEE011 (ribociclib; trade name Kisqali) is a cyclin D1 / CDK4 and CDK6 inhibitor used to treat certain types of breast cancer. Inhibition of CDK4 / 6 arrests the cell cycle at G1 and inhibits E2F1 expression (Kim S. et al, Oncotarget. 2018 Oct 16;9(81):35226-35240; Yang C et al., Oncogene (2017)36,2255-2264).

[0613] The results are shown in Figure 10.

[0614] Clear G1 arrest was induced by the CDK4 / 6 inhibitors LEE011 (ribociclib) and CI-1040. Treatment with roscovitine showed a slight increase in G2 / m arrest cells. Nutlin-3a had little to no effect on the cell cycle at the concentrations used. Infection of UMUC cells with recombinant E1 deletion (lacking E1A protein) adenovirus dl703 did not significantly alter the cell cycle distribution.

[0615] Example 14: In vitro adenovirus hexon staining increased after treatment with palbociclib. Bladder cell lines RT112, T24, and UMUC were seeded in 6-well plates (2 × 10⁵ cells / well). On day 1 post-seeding, cells were treated with 500 nM palbociclib 24 hours prior to infection and again 1 hour post-infection. Infection with AD-WT cells of the indicated MOI was performed in 400 μl of serum-free DMEM medium. Hexon staining was performed on day 2 post-infection using the Agilent Adeasy virus titer kit (cat:972500) according to the manufacturer's instructions.

[0616] The results are shown in Figure 11.

[0617] As is evident from Figure 11, treatment with palbociclib (500 nM) as an exemplary CDK4 / 6 inhibitor resulted in a significant increase in hexon-positive cells 48 hours post-infection, as indicated by the brown / red areas. We concluded that under palbociclib treatment, cells were able to produce more viral particles and exhibited increased viral DNA replication. This is because adenovirus hexon expression is due to the exclusive initiation of viral replication.

[0618] The results from Examples 10-14 clearly showed that only CDK4 / 6 inhibitors could increase the replication and gene expression of replication-deficient adenovirus (dl703 lacking the E1 gene) and Ad-GFP, while other cell cycle inhibitors could not. Furthermore, in order to achieve such an increase in viral replication and gene expression, the CDK4 / 6 inhibitor must arrest the (infected) cells at G1 and inhibit F2F1 expression.

[0619] Example 15: Treatment of T24 cells using a triple combination therapy including XVir-N-31, palbociclib, and a PARP inhibitor. To demonstrate the efficacy of triple therapy for T24 cells using a combination therapy including XVir-N-31, palvocrib, and a PARP inhibitor (BMN673 (thalaszolarib)), an efficacy assay was performed.

[0620] 12,500 T24 cells per well were seeded in a 12-well plate and grown overnight at 37°C in RPMI medium containing 10% FCS. Cells were treated with inhibitors 24 hours after seeding and 1 hour after reinfection by adding the indicated concentrations to the medium. Cell infection was performed 24 hours after inhibitor treatment in 250 μl of serum-free medium. Fixation and SRB staining were performed on day 4 post-infection. PD, palbociclib; PARPi: BMN673.

[0621] For SRB staining, the culture medium was removed by aspiration. Cells were fixed with 1 ml of 10% cold TCA (per well) at 4°C for 1 hour. The TCA was removed by aspiration, and the cell layer was washed four times with tap water. Cells were stained with 1 ml of 0.5% SRB (sulfolhodamine B) in 1% acetic acid (per well) for 30 minutes. Unbound SRB was removed in five washing steps with 1 ml of 1% acetic acid per well. After each washing step, the acetic acid was removed by aspiration. The plate was air-dried for 2 hours. To solubilize the SRB-stained cells, 200 μl of 10 mM Tris base was added to each well. Then, 20 μl of each was dispensed into the wells of a 96-well plate. The 96-well plate was loaded into an Elisa plate reader, and the absorbance of the samples was measured at 560 nm. Mock-treated cells were set to 100% cell viability.

[0622] The results are shown in Figure 12.

[0623] The results shown in Figure 12 clearly demonstrate that the triple therapy consisting of palbociclib, BMN673, and XVir-N-31 showed superior performance in terms of cell killing compared to monotherapy or combination therapy. Nearly 90% cell killing was achieved using 10 MOI XVir-N-31 in combination with the PARP inhibitor PARPi (BMN673) and the CDK4 / 6 inhibitor palbociclib (PD). In combination with PARPi and palbociclib without XVir-N-31, only 65% ​​of cells were killed. T24 cells and UMUC cells are sensitive to CDK4 / 6 inhibitors (providing G1 arrest via E2F1 downregulation).

[0624] Example 16: Dynamics of triple combination therapy including XVir-N-31, palbociclib, and a PARP inhibitor To demonstrate the dynamics of triple therapy for T24 cells using a triple combination therapy including XVir-N-31, palvocrib, and a PARP inhibitor (BMN673 (thalazolarib)), efficacy assays were performed and efficacy was evaluated at various time points.

[0625] 3,000 T24 cells per well were seeded in a 12-well plate and grown overnight at 37°C in RPMI medium containing 10% FCS. Cell inhibitor treatment was performed 24 hours after seeding and 1 hour after reinfection by adding the indicated concentrations to the medium. Cell infection was performed 24 hours after inhibitor treatment in 250 μl of serum-free medium. Fixation and SRB staining were performed 1 to 5 days after infection (dpi: days after infection). 15 nM PARPi corresponds to the IC80 value of T24 cells.

[0626] The results are shown in Figure 13.

[0627] As is clear from Figure 13, triple therapy using XVir-N-31, along with CDK4 / 6 inhibitors (palbociclib (PD) and PARP inhibitor PARPI (BMN673)), is far more effective from a dynamical standpoint than monotherapy using XVir-N-31 alone or combination therapy using XVir-N-31 with either a PARP inhibitor or a CDK4 / 6 inhibitor. Importantly, tumor cell regrowth was significantly reduced on days 4 and 5 (dpi: days after infection) in the CDK4 / 6-sensitive cell lines UMUC and T24.

[0628] Example 17: Dynamics of triple therapy including XVir-N-31, palbociclib, and a PARP inhibitor To demonstrate the dynamics of triple therapy for UMUC cells using a triple combination therapy including XVir-N-31, palvocrib, and a PARP inhibitor (BMN673 (thalazolarib)), efficacy assays were performed and efficacy was evaluated at various time points.

[0629] UMUC-3 seeding: 3,000 cells per well were seeded in a 12-well plate and grown overnight at 37°C in DMEM medium containing 10% FCS. Cell inhibitor treatment was performed 24 hours after seeding and 1 hour after reinfection by adding the indicated concentrations to the medium. Cell infection was performed 24 hours after inhibitor treatment. Fixation and SRB staining were performed 1 to 6 days after infection (dpi: days after infection). 160 nM PARPi corresponds to the IC80 value of UMUC3 cells.

[0630] The results are shown in Figure 14.

[0631] The results shown in Figure 14 clearly demonstrate that the triple therapy consisting of palbociclib, BMN673, and XVir-N-31 showed superior performance compared to monotherapy or combination therapy. Importantly, tumor cell regrowth was significantly reduced on days 4 and 5 (dpi: days after infection) in the CDK4 / 6-sensitive cell lines UMUC and T24.

[0632] Example 18: Triple combination therapy including XVir-N-31, a CDK4 / 6 inhibitor, and a bromodomain inhibitor 5000 T24 cells were seeded in a 12-well plate and grown in 1 ml of RPMI medium containing 10% FCS. The following day, the cells were treated with 500 nM palbociclib and 300 nM JQ-1. 24 hours after treatment, the cells were infected with XVir-N-31 at the indicated MOI in 200 μl of RPMI medium without FCS. One hour later, 800 μl of RPMI medium containing 10% FCS was added to each well. In addition, 500 nM palbociclib and 300 nM JQ-1 were added to the medium. SRB staining was performed 5 days after infection. Mock-treated cells were set to 100% cell viability.

[0633] The results are shown in Figure 15.

[0634] As is clear from Figure 15, the bromodomain inhibitor JQ-1 enhanced the cell-killing ability of XVir-N-31 in combination with the CDK4 / 6 inhibitor palbociclib at low MOI. Light microscopy analysis 48 hours post-infection revealed massive cell death in JQ-1 / palbociclib / XVir-N-31 treated cells. We concluded that JQ-1 increased viral replication in palbociclib-treated cells by increasing viral transcription. This is because monotherapy with 300nM JQ-1 alone did not increase XVir-N-31 cell-killing at 10 and 20 MOI.

[0635] The prerequisite for the enhancement of JQ-1 observed in adenovirus-infected cancer cells is the G1 arrest-inducing ability of palbociclib. In cells resistant to palbociclib (see Example 18, same treatment procedure), no increase in cell killing was observed. This observation is in stark contrast to Baojie Lv et al 2018, Scientific reports, 8, 11554, in which cells were treated with JQ-1 concentrations that did not induce G1 arrest and palbociclib was not used concomitantly.

[0636] Example 19: Triple combination therapy including XVir-N-31, a CDK4 / 6 inhibitor, and a bromodomain inhibitor 100,000 SK-N-MC cells / well were seeded into 12-well plates and grown in RPMI medium containing 10% FCS at 5% CO2 and 37°C. Cells were treated with 200 nM abemaciclib + 500 nM JQ-1 by adding appropriate amounts to the medium 24 hours before infection and 1 hour after reinfection. XVir-N-31 infection was performed in 500 μl of serum-free RPMI medium. SRB staining was performed 5 days post-infection. Mock-treated cells were set to 100% viability.

[0637] The results are shown in Figure 16.

[0638] SK-N-MC cells are resistant to CDK4 / 6 inhibitors and are therefore established not to undergo G1 arrest. Addition of JQ-1 did not increase cell killing in CDK4 / 6 (abemaciclib)-resistant SK-N-MC cells. This indicates that CDK4 / 6-mediated G1 arrest is a prerequisite for the JQ-1-mediated effect on cell killing.

[0639] Therefore, Figure 16 (and Figure 15) shows that, under the premise that CDK4 / 6 inhibitors induce G1 arrest in treated cells, bromodomain inhibitors targeting BRD2, BRD3, and BRD4 further enhance the cytotoxic effect of XVir-N-3.

[0640] Example 20: Western blot analysis of SK-N-MC cells treated with the CDK4 / 6 inhibitor LY-2835219 (abemaciclib) and the Wee inhibitor MK-1775 (adavocertib). 1 x 10 6Individual cells were seeded in a 10 cm dish. After 24 hours post-treatment, proteins were isolated using 1% SDS buffer to achieve nuclear membrane disruption. All samples were aspirated several times into a syringe to disrupt the DNA, followed by centrifugation at 30,000 rpm at 4°C for 30 minutes. The supernatant was transferred to a new reaction tube and used directly for further steps or stored at -80°C. Sodium dodecyl sulfate polyacrylamide gel electrophoresis was performed to separate the proteins. 40 μg of total protein was loaded by electrophoresis at 100 V at 4°C for approximately 2 hours and probed against the indicated specific antibody.

[0641] The results are shown in Figure 17.

[0642] SK-N-MC cells are known to be resistant to abemaciclib treatment (Dowless M et al., 2018, Clin Cancer Res: 24, 6028-6039). Wee1 is a key component of G2 / M cell cycle checkpoint control and mediates cell cycle arrest by regulating CDC2 phosphorylation. Inhibition of Wee1 by MK1775 has been reported to enhance the cytotoxic effects of DNA damaging agents in different types of cancer. Several studies have demonstrated that pharmacological inhibition of Wee1 by the small molecule kinase inhibitor MK-1775 removes CDC2 phosphorylation at Tyr15 in tumor cells (Kreahling et al 2013, PLoS One. 8(3), e 57523). Potent G1 arrest is observed with the combination treatment, but no changes are observed in Rb and E2F1 expression.

[0643] Example 21: Triple combination therapy including XVir-N-31, CDK4 / 6 inhibitor abemaciclib, and adavocertib (Wee inhibitor MK-1775) 100,000 SK-N-MC cells / well were seeded into 12-well plates and grown in RPMI medium containing 10% FCS at 5% CO2 and 37°C. Cells were treated with 200 nM abemaciclib by adding appropriate amounts to the medium 24 hours before infection and 1 hour after reinfection. XVir-N-31 infection was performed in 500 μl of serum-free RPMI medium. SRB staining was performed 5 days post-infection. Mock-treated cells were set to 100% viability.

[0644] The results are shown in Figure 18.

[0645] Figures 17 (and 18) demonstrate that the combination of the CDK4 / 6 inhibitor abemaciclib and the Wee inhibitor MK-1775 induced G1 arrest without inhibiting E2F1. Efficacy assays in Figure 18 show that this combination does not enhance the cytotoxic effect of the oncolytic adenovirus XVir-N-31. These results clearly demonstrate that G1 arrest induced by the combination of the CDK4 / 6 inhibitor abemaciclib and the Wee inhibitor MK-1775 did not enhance the cytotoxicity of XVir-N-31. Therefore, inhibition of E2F1 expression is a further necessary condition for enhancing viral oncolysis.

[0646] Example 22: G1 arrest in combination with E2F1 inhibition is a prerequisite for enhanced cell killing by XVir-N-31 in combination with CDK4 / 6 inhibitors. 48 hours after treatment, the cells were washed twice with PBS (containing RNase A, 100 U / ml). The cells were trypsinized and centrifuged at 1500 rpm at 4°C for 5 minutes. The cells were fixed by slowly adding 1 ml of ice-cold 80% ethanol dropwise to the pellet and incubating overnight. Staining was performed by adding 1 ml of staining solution (propidium iodide, 50 μg / ml) to the cells and incubating at RT for 30-60 minutes with gentle shaking. MK:MK-1775;LY:LY-2835219.

[0647] The results are shown in Figure 19.

[0648] As is clear from Figure 19, treatment of SK-M-NC cells with LY (abemaciclib) did not affect the cell cycle. Treatment with MK-1775 alone increased the number of cells in the G2 / M stage at 500 nM. The combination of the two resulted in strong G1 arrest.

[0649] Example 23: The role of E2F1 expression in viral DNA replication I. 2 x 10 per well 5 T24, A549, and HeLa cells were seeded in 6-well plates and grown in 1.5 ml of RPMI1640 medium (or DMEM medium) containing 10% FBS, penicillin / streptomycin, and non-essential amino acids. The following day, either 30 pmol siRNA-negative control siRNA (Qiagen #1022076) or siE2F1 (Sigma #NM_005225, siRNA ID SASI_Hs01_00162220) was diluted in 150 μL of Opti-MEM medium, and 9 μl of lipofectamine RNAiMAX was prepared in 150 μL of Opti-MEM medium. The siRNA solution and lipofectamine RNAiMAX solution were mixed and incubated for 5 minutes. This mixture was added dropwise to the cells. After 48 hours, RNA was isolated and performed by RT-qPCR.

[0650] The results are shown in Figure 20. As is clear from Figure 20, E2-initial expression is reduced.

[0651] II For each well of a 6-well plate, 2 × 10 5T24 cells were seeded in 1.5 ml of RPMI1640 medium containing 10% FBS, penicillin / streptomycin, and non-essential amino acids. The following day, either 30 pmol siRNA-negative control siRNA (Qiagen #1022076) or siE2F1 (Sigma #NM_005225, siRNA ID SASI_Hs01_00162220) was diluted in 150 μL of Opti-MEM medium, and 9 μl of lipofectamine RNAiMAX was prepared in 150 μL of Opti-MEM medium. The siRNA solution and lipofectamine RNAiMAX solution were mixed and incubated for 5 minutes. This mixture was added dropwise to the T24 cells. Infection was performed after 48 hours by incubating the cells with 10 MOI ADWTRGD in 400 μl of serum-free medium, shaking the plate every 10-15 minutes. After 1 hour, 1.6 ml of complete culture medium was added. RNA isolation was performed 24 hours after infection.

[0652] The results are shown in Figure 21.

[0653] III. Cells were rinsed with cold PBS and disrupted by adding 500 μl of lysis buffer from the MirVana kit (Thermo Fisher catalog number AM1560). The lysate was collected with a spatula and pipetted into a 1.5 ml tube. For organic extraction, 50 μl of homogenate additive was added, and the sample was incubated on ice for 10 minutes. Then, 500 μl of acid-phenol:chloroform was added, the sample was vortexed for 60 seconds, and incubated on ice for 2 minutes. The sample was centrifuged at 14000 × g at room temperature for 5 minutes to separate the aqueous and organic phases. The upper phase was carefully transferred to a new tube and an equal volume of isopropanol was added. After incubation at room temperature for 10 minutes, RNA was precipitated (14000 × g, 4°C, 30 minutes) and washed twice with 1 mL of 75% ethanol (centrifugation at 7500 × g, 4°C, 5 minutes). RNA was air-dried for 5-10 minutes, resuspended in 20-50 μl of RNase-free water, dissolved by shaking at 500 rpm and 55°C for 10 minutes, and measured using Nanodrop. DNA digestion (deoxyribonuclease II, Invitrogen Cat. No. 18068-015) was performed using 1 μg RNA sample, 1 μl of 10× DNAse I reaction buffer, 9 μl of nuclease-free water, and 1 μl of DNase I (1 U / μl). The samples were incubated at room temperature for 15 minutes, and 1 μl of 25 mM EDTA solution was added. DNAse I was inactivated by heating at 65°C for 10 minutes. Reverse transcription was performed using a high-performance cDNA reverse transcription kit (Thermo Fisher / Applied Biosystems®, catalog number: 4368814). Random hexamers were used for transcription for fiber PCR and actin PCR, and E2 initial primers were used for transcription for E2 initial PCR.

[0654] [Table 3]

[0655] To demonstrate the role of early E2 expression by RT-qPCR, selecting appropriate primers is absolutely essential. The primers should be positioned between the early and late E2 promoters. Otherwise, the late E2 promoter will strongly influence the results. The primer positions are shown in Figure 22.

[0656] As is evident from Figures 20 and 21, downregulation of E2F1 by siRNA leads to an increase in early E2 expression. This could only be explained by the repressive role of E2F1 in early E2 expression. If E2F1 were an activator, early E2 expression would decrease as a result. In addition, siRNA against E2F1 mimics the effect of CDK4 / 6 inhibitors, which also inhibits E2F1 expression (Yang C et al., Oncogene 2017, 36, 2255-2264).

[0657] Example 24: Recombinant adenoviruses with two E2F1 binding site mutations in the adenovirus E2 initial promoter show increased E2 initial expression. Mutant adenoviruses were created that had mutations in two E2F1 binding sites of the adenovirus E2 initial promoter. Both the wild-type E2 initial promoter and the mutant E2 initial promoter are shown in Figure 23 (Sequence IDs: 44, 45, 46, and 47).

[0658] RNA expression analysis was performed on AdWT-RGD and AdE2Fm (including the RGD motif) infected T24 cells, and results were obtained by RT-qPCR 24 hours after infection. AD-WT gene expression was set to 100%. This method was identical to that described in Section III of Example 23.

[0659] The results are shown in Figure 24.

[0660] As is evident from Figure 24, early E2 gene expression was higher in AdE2Fm-infected cells compared to AD-WT-infected cells. Therefore, it must be concluded that E2F-1 plays a repressive role in early E2 promoter activation. This is in stark contrast to the current understanding that E2F1 is an activator (DeCaprio JA, Virology. 2009 Feb 20;384(2):274-84).

[0661] It is well known that the structure of the E2 region in all currently known oncolytic adenoviruses is constructed as shown in Figure 22. Therefore, the mechanism of action of E2F1 is the same as that described herein. As a result, all of them, namely all oncolytic adenoviruses including ColoAd1 and delta-24-RGD, can be used in combination with CDK4 / 6 inhibitors.

[0662] ColoAd1 can be characterized as follows:

[0663] Enadenotucirev (formerly ColoAd1) is a tumor-selective chimeric adenovirus with demonstrated preclinical activity. The ColoAd1 capsid is derived from Ad11p, a serotype with limited seroprevalence in humans. EnAd infects cells by binding to both CD46 and / or desmoglein 2,6, which are widely expressed on many cancer cells. The majority of the EnAd genome is derived from Ad11p, which has a large deletion at E3 and a small deletion at E4. In addition, the E2B region consists of a chimeric sequence from Ad11p and Ad3. The E4 deletion in EnAd is located at E4ORF4, where Ad5 encodes a protein that inactivates protein phosphatase 2A, thereby activating the protein translation mechanism and regulating the activity of the E1A protein in a feedback inhibition loop. These deletions, likely combined with the chimeric E2B region, probably contribute to the remarkable cancer-selective replication of EnAd (Deyer et al., Mol Ther Oncolytics. 2017, 16; 5: 62-74).

[0664] The Delta-24-RGD (DNX-2401) can be characterized as follows:

[0665] Delta-24-RGD (DNX-2401) is a conditionally replicable oncolytic virus engineered to preferentially replicate and lyse in tumor cells with abnormalities in the p16 / RB / E2F1 pathway. Fueyo et al., Oncogene. 2000 Jan 6;19(1):2-12. Mutant oncolytic adenoviruses targeting the Rb pathway exhibit antiglioma effects in vivo. Dai B. et al. Mol Cancer Therapy. 2017 Apr;16(4):662-670.

[0666] Example 25: Triple combination therapy including XVir-N-31, the CDK4 / 6 inhibitor palbociclib, and the PARP inhibitor talazoparib, and FACS analysis of T24 cells and UMUC-3 cells. Efficacy assay / SRB staining The effects of killing virus-inducing cells alone, as well as the effects of combining it with the small molecule inhibitors palbociclib and talazoparib, were analyzed in 12-well plates. For this purpose, 12.5 × 10⁶ wells were used. 3 Individual T24 cells or 6.3 × 10⁶ 3 Individual UMUC-3 / 253J cells were seeded and infected with XVir-N-31 at increasing concentrations (multiple infection levels, MOI) after 24 hours. For co-treatment with the indicated small molecule inhibitors, cells were treated with talazoparib, palbociclib, or a combination of both at 24 hours pre-infection and 1 hour post-infection (hpi). Cells were infected with the indicated virus in triplicates in 200 μl of medium without fetal bovine serum (FBS). Complete medium with or without the small molecule inhibitor was added to the cells at 1 hpi. At 4 days post-infection (dpi) (T24) or 5 days post-infection (dpi) (UMUC-3 / 253J), cells were fixed with 10% trichloroacetic acid (TCA) at 4°C for 1 hour, stained with sulfohodamine B (SRB) at room temperature for 30 minutes, and subsequently washed with 1% acetic acid to remove excess SRB. Dried SRB was dissolved in 10 mM Tris base, and quantification was performed by photometric measurement at 562 nm using a multi-label plate reader (PerkinElmer Victor X3).

[0667] The results are shown in Figures 35, 36, and 37.

[0668] FACS analysis The effects of small molecule inhibitors applied at the indicated concentrations on bladder cancer cell lines, specifically T24 cells and UMUC-3 cell cycles, were analyzed by flow cytometry after DNA staining. 5 × 10 4Individual cells were seeded in 6-well plates and treated with appropriate inhibitors after 24 hours. Two days later, the cells were washed with PBS at approximately 80% confluence, triedpsinized, washed again, and fixed with ice-cold 80% ethanol. For cell cycle analysis, samples were incubated with the DNA insertion dye 7-aminoactinomycin D (7-AAD) and measured by FACS analysis. The measurement data were evaluated using FlowJo software.

[0669] The results are shown in Figure 38.

[0670] The results shown in Figures 35, 36, and 37 clearly demonstrate that the triple therapy consisting of palbociclib, talazoparib, and XVir-N-31 exhibits superior performance in terms of cell killing compared to monotherapy or combination therapy.

[0671] FACS analysis of treated bladder cells T24 and UMUC-3, shown in Figure 38, demonstrates that G1 arrest, which is necessary for increased viral replication, is not affected by the addition of the PARP inhibitor talazoparib.

[0672] Example 26: Triple therapy including XVir-N-31, the CDK4 / 6 inhibitor palbociclib, and the bromodomain inhibitor JQ-1 Efficacy assay The effects of killing virus-attracting cells with the virus alone and in combination with small molecule inhibitors were analyzed in 12-well plates. For this purpose, 2 × 10⁶ 4Cells (Cal-33) were seeded and, 24 hours later, infected with XVir-N-31 at a rate of 5 infectious virus particles per cell (multiple degrees of infection, MOI). For combined treatment with the indicated small molecule inhibitors, cells were treated with 100 nM palbociclib, 100 nM JQ-1, or a combination of both drugs 24 hours prior to infection and 1 hour post-infection (hpi). Cells were tripletically infected with the indicated virus in 200 μl of FBS-free medium. Complete medium with or without the small molecule inhibitor was added to the cells at 1 hpi. Four days post-infection (dpi), cells were fixed with 10% trichloroacetic acid (TCA) at 4°C for 1 hour, stained with sulfohodamine B (SRB) at room temperature for 30 minutes, and subsequently washed with 1% acetic acid to remove excess SRB. Dried SRB was dissolved in 10 mM Tris base, and quantification was performed by photometric measurement at 562 nm using a multi-label plate reader (PerkinElmer Victor X3).

[0673] Adenovirus replication assay Fiber qPCR DNA isolation For DNA purification, the culture medium was aspirated and 200 μl of lysis buffer was added to the wells. Proteinase K was added to this solution, and the mixture was incubated at 56°C for 10 minutes. 200 μl of phenol-chloroform-isoamyl alcohol was added to the viral cell lysate. After vortexing and subsequent incubation on ice for 5 minutes, phase separation was achieved by centrifugation at 16430 g at 4°C for 3 minutes. For better visualization of the phases, the upper aqueous phase was transferred to a new snap cap containing 200 μl of chloroform in 10 mM TrisCl and 20 μl of cresol red. After vortexing and incubation on ice for 5 minutes, centrifugation was performed at 16430 g at 4°C for 3 minutes. Again, the upper aqueous phase was combined with 800 μl of ethanol and 50 μl of 3M sodium acetate solution. To achieve better precipitation, 2 μl of glycogen solution was added. After briefly inverting the tube, the solution was centrifuged at 16430 g at 4°C for 30 minutes. Subsequently, the DNA pellet was covered with 400 μl of 70% ethanol and incubated at room temperature for 10 minutes. After centrifuging at 4760 g at room temperature for 7 minutes, the DNA pellet was dried at 37°C for approximately 5-10 minutes. Subsequently, the pellet was dissolved in 100 μl of 0.1×TE buffer and shaken at 40°C at 400 rpm for approximately 3 hours. Once the DNA was completely dissolved, the DNA concentration was measured using a spectrophotometer with 2 μl of DNA solution for measurement and 0.1×TE buffer as a blank solution. The DNA was then stored at 4°C.

[0674] Real-time PCR Viral replication was analyzed by adenovirus-specific fiber quantitative PCR (qPCR). Using the ΔΔCT method, XVir-N-31 replication was calculated from the number of viral DNA copies per cell (normalized to cellular β-actin) in relation to the level of viral entry into cells (4hpi value). Cal-33 cells were seeded in a 6-well plate (1.5 × 10⁶ per well). 5Cells were pretreated with the indicated inhibitor for 24 hours. The following day, cells were infected with 10 MOI XVir-N-31 in 400 μl of FBS-free medium. Complete medium with or without the small molecule inhibitor was added to the cells at 1 hpi. Cells were harvested at 4, 24, and 48 hpi for DNA extraction. DNA was then isolated using phenol-chloroform extraction. The doubling of values ​​determined by qPCR of the control sample (10 MOI XVir-N-31 without additional small molecule inhibitors) was set to 1.0, and the doubling of further samples was plotted against them. Quantitative PCR was performed in a 96-well plate using SYBR Green Mastermix (Eurogentec) under the following cycle conditions: 2 minutes at 95°C, 15 seconds at 94°C, 15 seconds at 60°C, and 15 seconds at 72°C for 45 cycles. Gene expression was calculated using the ΔΔCT method.

[0675] The following specific primers were used to detect viral DNA. [Table 4]

[0676] A673 cells (ATCC CRL 1598): The Ewing sarcoma cell line was established in 1973. Martinez-Ramirez et al. 2003. Characterization of the A673 cell line (Ewing tumor) by molecular cytogenetic techniques. Cancer Genet Cytogenet. Mar;141(2):138-42.

[0677] Cal-33 cells: These are squamous cell carcinoma cells of the tongue. CAL33 is a head and neck squamous cell carcinoma (HNSCC) cell line widely used for testing therapeutic agents.

[0678] result Figure 39 shows the results of efficacy assays for Ewing sarcoma cell line A673 using Xvir-N-31 alone, in combination with the CDK4 / 6 inhibitor abemaciclib, in combination with the bromodomain inhibitor JQ-1, or in combination with the CDK4 / 6 inhibitor abemaciclib and the bromodomain inhibitor JQ-1 at MOIs of 5, 10, and 20.

[0679] The results of the efficacy assay for Cal33, a head and neck squamous cell carcinoma (HNSCC) cell, are shown in Figures 40 and 41.

[0680] QPCR was performed to analyze viral replication under the following treatment conditions: XVir-N-31 MOI: 10; 100nM palbociclib, 100nM JQ-1; cell line: Cal-33; analysis at 24 hours and 48 hours post-infection. Infection was treated with JQ-1, palbociclib, or both (in combination) 24 hours prior to infection with 10 MOI XVir-N-31. DNA was isolated at 4, 24, and 48 hours post-infection, and real-time PCR was performed to measure viral replication. The results were normalized to β-actin and 4-hour values.

[0681] The results are shown in Figures 42A and 42B. In all cell lines, triple therapy was superior to monotherapy or any of the two-agent therapies, namely XVir-N-31 + CDK4 / 6 inhibitor; XVir-N-31 + bromodomain inhibitor; and CDK4 / 6 inhibitor + bromodomain inhibitor.

[0682] Example 27: Triple combination therapy including XVir-N-31, the CDK4 / 6 inhibitor palbociclib, and nutrin and nutrin derivatives. Example 27.1 Method and Materials Efficacy assay / SRB staining Cytotoxicity using XVir-N-31 alone and in combination with small molecule inhibitors was analyzed in 12-well plates. For this, 20,000 T24 cells or 25,000 UMUC-3 cells were seeded and after 24 hours, infected while increasing the concentration of XVir-N-31 (multiplicity of infection, MOI). For co-treatment with the indicated small molecule inhibitors, cells were treated 24 hours prior to infection with each concentration of nutlin-3a or idasanutlin, palbociclib, and the combination of both drugs. Cells were infected in triplicate with the indicated virus in 250 μl of FBS-free medium. At 1 hpi, complete medium containing palbociclib was added to cells pretreated with palbociclib. To control and nutlin-treated cells, complete medium without inhibitor was added. At 4 days post-infection (dpi), cells were fixed with 10% trichloroacetic acid (TCA) for 1 hour at 4 °C and stained with 0.05% sulforhodamine B (SRB) in 1% acetic acid for at least 30 minutes at room temperature, followed by washing with 1% acetic acid to remove excess SRB. After taking a picture of the plate, the dried SRB was dissolved in 10 mM Tris base and quantification was performed by photometric measurement at 562 nm using a multi-label plate reader (PerkinElmer Victor X3).

[0683] FACS analysis The effect of small molecule inhibitors applied at the indicated concentrations on the cell cycle of bladder cancer cell lines T24, T24shRb, UMUC-3, and RT112 was analyzed by flow cytometry analysis after DNA staining. For this, 5 × 10 4 cells were seeded in 6-well plates and after 24 hours, treated with the appropriate inhibitor. After 2 days, at approximately 80% confluence, cells were washed with PBS, trypsinized, washed again, and fixed with ice-cold 80% ethanol. For cell cycle analysis, samples were incubated with propidium iodide (PI) and measured by FACS analysis. Evaluation of the measurement data was performed by software FlowJo.

[0684] Adenovirus replication Fiber qPCR DNA isolation For DNA purification, the culture medium was aspirated and 200 μl of lysis buffer was added to the wells. Proteinase K was added to this solution, and the mixture was incubated at 56°C for 10 minutes. 200 μl of phenol-chloroform-isoamyl alcohol was added to the viral cell lysate. After vortexing and subsequent incubation on ice for 5 minutes, phase separation was achieved by centrifugation at 16430 g at 4°C for 3 minutes. For better visualization of the phases, the upper aqueous phase was transferred to a new snap cap containing 200 μl of chloroform in 10 mM TrisCl and 20 μl of cresol red. After vortexing and incubation on ice for 5 minutes, centrifugation was performed at 16430 g at 4°C for 3 minutes. Again, the upper aqueous phase was combined with 800 μl of ethanol and 50 μl of 3M sodium acetate solution. To achieve better precipitation, 2 μl of glycogen solution was added. After briefly inverting the tube, the solution was centrifuged at 16430 g at 4°C for 30 minutes. Subsequently, the DNA pellet was covered with 400 μl of 70% ethanol and incubated at room temperature for 10 minutes. After centrifuging at 4760 g at room temperature for 7 minutes, the DNA pellet was dried at 37°C for approximately 5-10 minutes. Subsequently, the pellet was dissolved in 100 μl of 0.1×TE buffer and shaken at 40°C at 400 rpm for approximately 3 hours. Once the DNA was completely dissolved, the DNA concentration was measured using a spectrophotometer with 2 μl of DNA solution for measurement and 0.1×TE buffer as a blank solution. The DNA was then stored at 4°C.

[0685] Real-time PCR Viral replication was analyzed by adenovirus-specific fiber quantitative PCR (qPCR). Using the ΔΔCT method, XVir-N-31 replication was calculated from the number of viral DNA copies per cell (normalized to cellular β-actin) in relation to the level of viral entry into cells (4hpi value). T24 cells and T24shRb cells were seeded in 6-well plates (5 × 10⁶ per well). 5Cells were pretreated with the indicated inhibitor for 24 hours. The following day, cells were infected with 20 MOI XVir-N-31 in 400 μl of FBS-free medium. Complete medium containing palbociclib was added to the palbociclib-pre-treated cells at 1 hpi. Complete medium without inhibitors was added to the control and nutrin-treated cells. Cells were harvested at 4 and 48 hpi for DNA extraction. DNA was then isolated using phenol-chloroform extraction. The doubling of the values ​​determined by qPCR of the control sample (20 MOI XVir-N-31 without additional small molecule inhibitors) was set to 1.0, and the doubling of further samples was plotted against them. Quantitative PCR was performed in a 96-well plate using SYBR Green Mastermix (Eurogentec) under the following cycle conditions: 2 minutes at 95°C, 15 seconds at 94°C, 15 seconds at 60°C, and 15 seconds at 72°C for 45 cycles. Gene expression was calculated using the ΔΔCT method.

[0686] The following specific primers were used to detect the virus copy. [Table 5]

[0687] Example 27.2 Triple combination therapy for T24 cells including XVir-N-31, Nutrin-3a, and Palbociclib Efficacy assays using T24 cells were performed to determine the cytotoxic effects of XVir-N-31 alone, XVir-N-31 with Nutrin-3a, XVir-N-31 with Palbociclib, and XVir-N-31 with Nutrin-3a and Palbociclib together.

[0688] The results are shown in Figures 44 and 45.

[0689] As is evident from Figures 44 and 45, pretreatment of T24 cells with palbociclib increased cell killing by XVir-N-31. This effect was enhanced by combination therapy with palbociclib and nutrin-3a. Furthermore, nutrin-3a treatment enhanced the cell killing observed with the combination therapy of XVir-N-31 and palbociclib.

[0690] Example 27.3 Triple combination therapy including XVir-N-31, Nutrin-3a, and Palbociclib for T24shRB cells The same efficacy assay as in Example 27.2 was performed using T24shRB cells. T24shRB cells are T24 cells that do not express Rb. This Rb expression deficiency was induced by lentiviral transfection. Here, the lentivirus encoded shRNA targeting Rb. The lentiviral vector used was pLKO-RB1-shRNA19 (obtained from Addgene, Watertown, MA 02472, USA), and the shRNA sequence was CAGAGATCGTGTATTGAGATTCTCGAGAATCTCAATACACGATCTCTG (Sequence ID: 39). The procedure is also described in Michaud K et al. (Cancer Res. 2010 Apr 15. 70(8):3228-38).

[0691] The results are shown in Figures 46 and 47.

[0692] As is evident from Figures 46 and 47, treatment with nutrin-3a or palbociclib alone was ineffective in killing Rb-negative cells (T24shRb) with XVir-N-31. Only the combination of palbociclib and nutrin-3a showed increased XVir-N-31-mediated cell killing. Therefore, nutrin-3a enhanced the tumor-lytic effect of the two-agent combination therapy using XVir-N-31 and palbociclib treated with nutrin-3a against Rb-negative cells.

[0693] Example 27.4 Triple combination therapy including XVir-N-31, idasanutrin, and palbociclib for T24 cells and T24shRb cells Efficacy assays using T24 cells were performed to determine the cytotoxic effects of XVir-N-31, XVir-N-31 with idasanutrin, XVir-N-31 with palbociclib, and XVir-N-31 with idasanutrin and palbociclib.

[0694] The results are shown in Figures 48 and 49.

[0695] Similar efficacy assays using T24shRb cells were performed to determine the cytotoxic effects of XVir-N-31, XVir-N-31 with idasanutrin, XVir-N-31 with palbociclib, and XVir-N-31 with idasanutrin and palbociclib.

[0696] The results are shown in Figures 50 and 51.

[0697] As is clear from Figures 48 to 51, idasanutrin had the same effect as nutrin-3a in triple combination therapy using XVir-N-31 and CDK4 / 6 inhibitors.

[0698] Example 27.5 Evaluation of XVir-N-31 replication under conditions according to Examples 27.2-27.4 XVir-N-31 replication in T24shRb cells and T24 cells was evaluated by measuring viral DNA using the ΔΔCT method.

[0699] The experimental setup was as follows:

[0700] Viral replication was measured at 24 and 48 hours. Infection was treated with Nutrin-3a, palbociclib, or both (in combination) 24 hours prior to XVir-N-31 at 20 MOI. DNA was isolated at 4 and 48 hours, and real-time PCR was performed to measure viral replication. The results were normalized to β-actin and 4-hour values ​​according to the ΔΔCT method.

[0701] The results are shown in Figure 52.

[0702] As is evident from Figure 52, Nutrin-3a, when used in combination with palbociclib, showed an increase in viral DNA. Relative fibrous DNA was already high in palbociclib-treated T24 cells, but the combination with Nutrin-3a showed values ​​nearly 10 times higher than the untreated control. In Rb-negative T24shRb cells, the effect was observed only when Nutrin-3a, palbociclib, and XVir-N-31 were used in combination. Here, palbociclib alone did not have a significant effect on viral DNA compared to the control.

[0703] Western blot analysis was performed on T24shRb cells treated with Nutrin-3a (5 μM, 10 μM, or 30 μM), palbociclib (500 μM), or both (in combination). The results are shown in Figure 53.

[0704] Figure 54 shows the E2F1 protein levels shown in Figure 53 after treatment with palbociclib and / or Nutrin-3a (5 μM, 10 μM, or 30 μM), palbociclib (500 μM), or both (in combination). The E2F1 protein level in untreated cells was set to "1".

[0705] As is clear from Figures 53 and 54, combination therapy with 30 μM Nutrin-3a and 500 nM Palbociclib reduced the relative amount of E2F1 compared to monotherapy.

[0706] Example 27.6 FACS analysis of cells obtained by the treatment in Example 27.5 Cells treated as outlined in Example 27.5 were subjected to FACS analysis. Furthermore, UMUC cells and RT112 cells were subjected to the same treatment plan as described in Example 27.5.

[0707] The results for T24 cells are shown in Figure 55(A), for T24shRb cells in Figure 55(B), for UMUC-3 cells in Figure 55(C), and for RT112 cells in Figure 55(D).

[0708] Further analysis of the results shown in Figures 55(A)-(D), which focus on the percentage of cells in G1, is presented in Figure 56(A) for T24 cells, Figure 56(B) for T24shRb cells, Figure 56(C) for UNUC-3 cells, and Figure 56(D) for RT112 cells.

[0709] As is clear from Figures 55(A)-(D) and 56(A)-(D), the effect on G0 / G1 arrest in all cell lines was most pronounced when treated with nutrin-3a and palbociclib in combination.

[0710] Example 28: Combination therapy including the bromodomain inhibitors JQ1 and XVir-N-31 in treated glioblastoma 2 x 10 4 Individual cells (U87 cells, LN229 cells, or T98G cells) were seeded in DMEM medium in 12-well plates and treated with an inhibitor the following day. 48 hours after seeding, the cells were infected with XVir-N-31. Four days later, the cells were fixed using 10% TCA. The plates were stained with 0.1% SRB solution. After removing excess, the plates were washed with 1% acetic acid. After removing the acetic acid, the plates were air-dried overnight. SRB was dissolved in 1 ml of 10 mM Tris base solution, and a 1:10 dilution was measured using a photometer at 560 nm.

[0711] The results are shown in Figures 57, 58, and 59.

[0712] As is evident from Figures 57, 58, and 59, the combined use of JQ1 and XVir-N-31 results in strongly enhanced cell killing. The use of the CDK4 / 6 inhibitor LEE011 further increased cell killing in all three glioblastoma cell lines.

[0713] Example 29: Replication of XVir-N-31 by combined exposure with JQ1 and ribociclib. 1 x 10 5 Cells were seeded in DMEM medium in a 6-well plate. The following day, cells were treated with 500 nM LEE011 and 50 nM JQ1. The next morning, cells were infected with 20 MOI for U87 and LN229, and 50 MOI for T98G. One hour after infection, DMEM medium containing the inhibitor was added to the cells. After each time point (4, 24, 48 hours), cells were washed once with PBS and 200 μl of SDS DNA lysis buffer was added. Cells were incubated with proteinase K for 1 hour, followed by phenol-chloroform-isoamyl alcohol purification. DNA was diluted with 1×TE buffer, and the DNA concentration was determined using Nanodrop. For each sample, a 10 ng / μl solution was prepared, and RT-qPCR was performed using 50 ng DNA and GoTaq Master mix. Specific filamentous forward and reverse primers were used, and specific actin primers were also used for Δct value calculation. For each sample, three fiber values ​​and two actin values ​​were measured. Calculations were performed in Excel, and the 24-hour and 48-hour values ​​were calculated based on the 4-hour values ​​(initial viral entry before replication).

[0714] The results are shown in Figures 60, 61, and 62.

[0715] As is evident from Figures 60, 61, and 62, XVir-N-31 showed a significant increase in replication when exposed to JQ1. In two cell lines, this effect was much greater compared to the use of the CDK4 / 6 inhibitor LEE011(LEE). In all three cell lines, the increase in viral replication was highest when both JQ1 and LEE011(LEE) were used in combination.

[0716] Example 30: Western blot analysis of XVir-N-31 infected cancer cells 2.5 × 10 5LN229 cells were seeded in DMEM medium on a 10 cm plate. The following day, the cells were treated with 500 nM LEE011 and 200 nM JQ1 or a combination of both. The next morning, the cells were infected with XVir-N-31 at 20 MOI. One hour post-infection, DMEM medium containing the inhibitor was added to the cells. After each time point (24, 48, 72 hours), the cells were placed on ice, washed twice with ice-cold PBS, and 300 μl of SDS protein lysis buffer was added. The cells were transferred to a reaction tube, DNA was sheared with a syringe and needle, and the supernatant was transferred for further use after centrifugation. Protein concentration was measured by BCA assay, and samples with a concentration of 4 × Lammli:DTT 6:1 and 20 μg were prepared and transferred to a 10% SDS gel. Gel electrophoresis was started at 90 V and increased to 150 V after the ladder began to separate. Proteins on the gel were blotted onto a membrane at 100V for 2 hours and blocked at RT for 1 hour in 5% milk in TBS-T. After washing in TBS-T, primary antibodies were added overnight at 4°C according to the manufacturer's instructions. The antibodies used at all time points targeted GAPDH, E1A, DBP, E2F1, Rb, pRb, and for the 72-hour sample, further caspase 3 and full-length and cleaved PARP. The following day, washing was repeated and secondary antibodies were added at RT for 1 hour. After washing, chemiluminescence was imaged using the ChemiDoc™ MP imaging system with ECL.

[0717] The results are shown in Figures 63, 64, 65, and 66.

[0718] As shown in Figure 63, the viral proteins E1A and DBP were increased by combined treatment with XVir-N-31 and 500 nM LEE011 and / or 200 nM JQ-1. The cellular proteins Rb and pRb remained inhibited in these samples (lanes 5, 6, and 7).

[0719] As shown in Figure 64, the viral proteins E1A and DBP were increased by combined treatment with XVir-N-31 and LEE011 or / and JQ-1. The cellular proteins Rb and pRb remained inhibited in these samples, while E2F-1 was stabilized in these samples (lanes 5, 6, and 7).

[0720] As shown in Figure 65, the viral proteins E1A and DBP were increased by combined treatment with XVir-N-31 and LEE011 or / and JQ-1, while the cellular protein Rb decreased, and E2F1 increased in these samples. Furthermore, there were Rb cleavage products visible at 48 kDa, indicating apoptosis (Fattman, Cheryl L.; Delach, Scott M.; Dou, Qing Ping; Johnson, Daniel E. (2001): Sequential two-step cleavage of retinoblastoma protein by caspase-3 / -7 during etoposide-induced apoptosis. In: Oncogene 20 (23), S. 2918-2926.).

[0721] As shown in Figure 66, caspase-3 and PARP were present in all cell lysates, even in the control group. Cleavaged PARP was detected not only by cleavage-type PARP antibody but also by full-length PARP antibody. Cleavaged PARP was only observed in infected cells, and its presence increased upon treatment with LEE011 and JQ1. This cleavage was a sign of apoptosis (Chaitanya et al.: PARP-1 cleavage fragments: signatures of cell-death proteases in neurodegeneration. Cell Communication and Signaling 2010 8:31).

[0722] Example 31: Effect of JQ1 on various adenoviruses in glioblastoma Adenovirus E1A consists of various conserved regions (CRs) that bind to various cellular proteins and interfere with their function. CR1 binds to p300 / CBP, which can also bind to CR3. Other regions of CR3 can bind to various mediator complex subunits, such as MED23, thus playing a role in the transactivation of other viral early genes by E1A. Adenovirus regions CR1 and CR2 can also bind to RB. This interaction leads to the release of E2F, which then progresses to the next cell cycle. Furthermore, E2F binds to the early promoter of adenovirus E2, activating its transcription.

[0723] Figure 67 shows the locations of E1A's interaction partners and the conserved regions CR1-CR4.

[0724] To determine which conserved region of E1A is essential for the effect of JQ1 in enhancing viral replication, adenoviruses with various deletions and mutations were used. Wild-type adenoviruses containing the RGD motif for better infectivity and the E3 deletion for an unimpaired antiviral response were used as controls. Other viruses included dl119, which has deletions at the N-terminus and CR1 and CR2, and Addelta 24, which is under the control of the CMV promoter and has a CR2 deletion. As a CR3 deletion virus, XVir-N-31, which also contains the RGD motif, E3 deletion, and E1B-19k deletion to enhance apoptosis, was used. Another virus used was ADWT / E2Fm. This virus contains a mutation in the E2F binding site in the initial E2 promoter, which blocks E2F binding. Again, these characteristics are summarized below.

[0725] [Table 6]

[0726] 1 x 10 5LN229 cells were seeded in DMEM medium in a 6-well plate. The following day, the cells were infected with various viruses (AdWt, dl119, AdDelta24, XVir-N-31, AdWt / E2Fm) at a dose of 20 MOI. To differentiate between infection with and without JQ1 treatment, DMEM medium or DMEM medium containing 200 nM JQ1 was added to the cells 1 hour after infection. After each time point (4, 24, 48 hours), the cells were washed once with PBS and 200 μl of SDS DNA lysis buffer was added. The cells were incubated with proteinase K at 56°C for 15 minutes, followed by phenol-chloroform-isoamyl alcohol purification. The DNA was diluted in AE buffer, and the DNA concentration was determined using Nanodrop. For each sample, a 10 ng / μl solution was prepared, and qPCR was performed using 50 ng DNA and GoTaq Master mix. Specific filament forward and reverse primers were used, and specific actin primers were also used for calculating Δct values. Three filament values ​​and three actin values ​​were measured for each sample. Calculations were performed in Excel, with each 24-hour and 48-hour period calculated based on the 4-hour value (initial viral entry before replication) and the increase in replication via JQ1 for untreated infected samples.

[0727] The nucleotide sequences of various primers were as follows. [Table 7]

[0728] The results are shown in Figures 68 and 69.

[0729] Among various viruses, XVir-N-31 showed the highest increase in viral replication under the influence of JQ1 after 48 hours. This indicates that viruses with CR3 deletions benefit most strongly from treatment with JQ1.

[0730] Example 32: Dual therapy with XVir-N-31 and JQ-1 in bladder cancer In the first aspect, we evaluated the replication of XVir-N-31.

[0731] 2.5 × 10 4 Individual UMUC-3 cells were seeded in DMEM medium in a 12-well plate. The following day, the cells were treated with JQ-1 (priming) or DMEM medium. The next morning, the cells were infected with 10 MOI XVir-N-31. One hour after infection, DMEM medium containing JQ-1 was added to the cells (simultaneous treatment). After 4 hours and 24 hours, the cells were washed once with PBS and 200 μl of SDS DNA lysis buffer was added. The cells were incubated with proteinase K for at least 1 hour, followed by phenol-chloroform-isoamyl alcohol purification. The DNA was diluted with 1×TE buffer, and the DNA concentration was determined using Nanodrop. For each sample, a 15 ng / μl solution was prepared, and RT-qPCR was performed using 75 ng of DNA and GoTaq Master mix. Specific filament forward and reverse primers were used, and specific actin primers were also used for Δct value calculation. For each sample, three filament values ​​and three actin values ​​were measured. The calculations were performed in Excel, and each 24-hour value was calculated based on its 4-hour value (initial virus infection before replication).

[0732] The results are shown in Figure 70.

[0733] As is clear from Figure 70, priming itself did not have a beneficial effect on XVir-N-31 replication. The slight positive effect of priming shown in the figure was due to insufficient washing in the experimental setup. Co-treatment with JQ-1 was crucial for the success of the two-drug combination therapy, but pre-addition of JQ-1 (priming) was less efficient compared to co-treatment.

[0734] In a second aspect, the particle formation of XVir-N-31 was evaluated.

[0735] The production of viral particles was analyzed by immunohistochemical staining of hexone protein (hexone titer test). For this purpose, 2 × 10⁶ samples were taken per well. 5 Adherent HEK293 cells were seeded in 24-well plates. Cell culture samples collected after the indicated post-infection time points and after the indicated co-treatment with JQ-1 were pre-treated by 3 cycles of thaw-freeze to release viral particles from the cells, and then serially diluted. HEK293 cells were infected with either 50 μl or 10 μl of cells per sample. The plates were then incubated at 37°C and 10% CO2 for 40 hours, and then checked for detectable cytopathic effects. The culture medium was aspirated, the plates were dried for 5–10 minutes, and then the cells were fixed by adding ice-cold methanol at -20°C for 10 minutes. The wells were washed twice with PBS + 1% BSA. Primary antibody (goat anti-hexone, 1:500) was added, the plates were incubated at 37°C for 1 hour, and then washed twice with PBS + 1% BSA. Next, a secondary antibody (rabbit anti-goat HRP conjugate, 1:1000) was added and incubated at 37°C for 1 hour. The wells were washed twice again with PBS containing 1% BSA, and then DAB solution was added. After 30 minutes of incubation, 10 different random fields of view (fov) per well were counted under a 20× objective lens of a microscope. The counting repeats were averaged, and the number of infectious particles per 1 ml was calculated according to this formula.

[0736]

number

[0737] The results are shown in Figures 71 and 72.

[0738] As is evident from Figure 71, XVir-N-31 particle formation was significantly increased in UMUC-3 cells upon the addition of 500 nM JQ-1. Furthermore, the dynamics of XVir-N-31 particle formation were greatly accelerated by simultaneous treatment with 500 nM JQ-1.

[0739] As a third approach, Western blot analysis was performed.

[0740] 1 x 10 6 Individual UMUC-3 cells were seeded in DMEM medium on a 10 cm plate and infected with 10 MOI XVir-N-31 24 hours after seeding. One hour after infection, the culture medium was repacked with either DMEM or DMEM spiked with 500 nM JQ-1. Total protein lysates were obtained using SDS buffer at 12, 24, 36, and 48 h.pi. BCA assays were applied to adjust to equivalent protein concentrations. Then, the protein samples were supplemented with Lammli buffer and separated by SDS-PA gel electrophoresis on a 10% PA gel. The samples were blotted onto PVDF membranes using the BioRAD Wet Tank System. These membranes were blocked with TBS-Tween buffer containing 5% skim milk powder at room temperature for 1 hour. Incubation with primary antibody was performed overnight at 4°C, and incubation with HRP-conjugated secondary antibody was performed at room temperature for 1 hour. Chemiluminescence was detected using the ChemiDoc imaging system (BioRad) with ECL prime (Pierce). Figures were created using Adobe® Illustrator and evaluated using ImageLab.

[0741] The results are shown in Figure 73.

[0742] As is evident from Figure 73, the absolute viral protein expression and major dynamics of XVir-N-31 viral proteins (E1A, E1B55k, DBP, and E40rf6) were greatly accelerated by co-treatment with JQ-1. JQ-1 treatment resulted in high levels of expression of late viral proteins, particularly hexone, in the early post-XVir-N-31 timeframe.

[0743] Example 33: Triple combination therapy for bladder cancer using XVir-N-31, palbociclib, and JQ-1 In the first embodiment, the effects of small molecule inhibitors applied at the indicated concentrations during the cell cycle of bladder cancer cell lines UMUC-3 and RT112 were analyzed by flow cytometry analysis after DNA staining.

[0744] For this purpose, 5 × 10 4 Individual UMUC-3 and RT112 cells were seeded in 6-well plates and treated with appropriate inhibitors after 24 hours. After 1 day, the cells were washed with PBS at approximately 80% confluence, triedpsinized, washed again, and fixed with 80% ice-cold ethanol. For cell cycle analysis, samples were incubated with the DNA insertion dye 7-aminoactinomycin D (7-AAD) and measured by FACS analysis. The measurement data were evaluated using FlowJo software.

[0745] The results are shown in Figure 74.

[0746] As is evident from Figure 74, palbociclib induced potent arrest in the G1 phase of the cell cycle. JQ-1, whether used alone or in combination with palbociclib, did not show any significant effect on the cell cycle. In particular, JQ-1 was applied at relatively low concentrations that were still sufficient to potently enhance the oncolytic activity of XVir-N-31. Uncertain data on higher doses of JQ-1 inducing either G1- or G2-arrest were found in the published scientific literature. On the other hand, low doses of JQ-1 did not affect the cell cycle.

[0747] In a second aspect, the expression levels of specific cell target proteins were quantified after treatment with both JQ-1 and palbociclib.

[0748] 1-2 x 10 6Individual UMUC-3 or RT-112 cells were seeded in DMEM medium in a 10 cm plate and treated with each small molecule inhibitor 24 hours after seeding. 24 hours after treatment, total protein lysates were obtained using SDS buffer. The proteins were adjusted to equivalent concentrations using a BCA assay. Then, the protein samples were supplemented with Lammli buffer and separated by SDS-PA gel electrophoresis on a 10% PA gel. The samples were blotted onto PVDF membranes using the BioRAD Wet Tank System. These membranes were blocked with TBS-Tween buffer containing 5% skim milk powder at room temperature for 1 hour. Incubation with primary antibody was performed overnight at 4°C, followed by incubation with HRP-conjugated secondary antibody at room temperature for 1 hour. Chemiluminescence was detected using the ChemiDoc imaging system (BioRad) with ECL prime (Pierce). The diagrams were created using Adobe Illustrator (registered trademark), and the evaluation was performed using ImageLab.

[0749] The results are shown in Figure 75.

[0750] As is clear from Figure 75, JQ-1 did not affect the levels of the cell cycle regulators RB, phospho-RB, or E2F-1 proteins at the indicated concentrations, whether used as monotherapy or in combination with palbociclib. The RNA polymerase II repressor Hexim1 was downregulated after JQ-1 treatment but was rescued in combination with palbociclib. Thus, the cell cycle proteins RB and E2F-1 do not contribute to the enhancement of XVir-N-31 replication capacity under JQ-1 treatment.

[0751] In a third aspect, the cytotoxic efficacy of the triple therapy was determined using an efficacy assay.

[0752] 1-3 x 10 4Individual cells were seeded in DMEM or RPMI medium in 12-well plates and treated with an inhibitor the following day. 48 hours after seeding, the cells were infected with XVir-N-31. Four days later, the cells were fixed using 10% TCA. The plates were stained with 0.1% SRB solution. After removing excess, the plates were washed with 1% acetic acid. After removing the acetic acid, the plates were air-dried overnight. SRB was dissolved in 1 ml of 10 mM Tris base solution, and a 1:10 dilution was measured using a photometer at 560 nm.

[0753] The results are shown in Figures 76, 77, and 78.

[0754] As is evident from Figures 76, 77, and 78, when treated with low doses of palbociclib and JQ-1, XVir-N-31 can completely eliminate the survival of bladder cancer cells in vitro, even at low MOI, as demonstrated by the effects observed in each and all of the bladder cancer cells UMUC-3, RT112, and T24.

[0755] In a fourth aspect, we evaluated the effect of this triple therapy on viral replication.

[0756] 2.5 × 10 4Individual UMUC-3, T24, or RT112 cells were seeded in 12-well plates in DMEM or RPMI medium. The following day, the cells were treated with JQ-1, palbociclib (priming), or culture medium. The next day, the cells were infected with 10, 20, or 50 MOI of XVir-N-31. One hour after infection, the cells were added to a medium containing JQ-1 or palbociclib. After 4 and 24 hours, the cells were washed once with PBS and 200 μl of SDS DNA lysis buffer was added. The cells were incubated with proteinase K for at least 1 hour, followed by phenol-chloroform-isoamyl alcohol purification. The DNA was diluted in 1×TE buffer, and the DNA concentration was determined using Nanodrop. For each sample, a 15 ng / μl solution was prepared, and RT-qPCR was performed using 75 ng of DNA and GoTaq Master mix. Specific filament forward and reverse primers were used, and specific actin primers were also used for calculating Δct values. Three filament values ​​and three actin values ​​were measured for each sample. Calculations were performed in Excel, and each 24-hour value was calculated based on its 4-hour value (initial viral entry before replication).

[0757] The results are shown in Figures 79, 80, and 81.

[0758] As is clear from Figures 79, 80, and 81, additional treatment with low doses of palbociclib and JQ-1 significantly accelerates XVir-N-31 replication by up to 200-fold.

[0759] In a fifth aspect, the effect of this triple therapy on tumor cells that were proliferatively infected was evaluated.

[0760] The number of proliferatively infected tumor cells was analyzed by direct immunohistochemical staining of hexone proteins in infected UMUC-3 cells (pseudohexone titer test). For this purpose, 5 × 10⁶ cells were used per well. 5Individual UMUC-3 cells were seeded in a 12-well plate. The following day, the cells were primed with low doses of JQ-1 and palbociclib. Then, 48 hours after seeding, the cells were infected with XVir-N-31 (9 MOI), and 1 hour later, they were simultaneously treated with each inhibitor. The plates were then incubated at 37°C and 10% CO2 for 40 hours, after which the detectable cytopathic effect was checked. The culture medium was aspirated, the plates were dried for 5-10 minutes, and then the cells were fixed by adding ice-cold methanol at -20°C for 10 minutes. The wells were washed twice with PBS + 1% BSA. Primary antibody (goat anti-hexone, 1:500) was added, the plates were incubated at 37°C for 1 hour, and then washed twice with PBS + 1% BSA. Next, a secondary antibody (rabbit anti-goat HRP conjugate, 1:1000) was added and incubated at 37°C for 1 hour. The wells were washed twice again with PBS containing 1% BSA, and then DAB solution was added. After 30 minutes of incubation, 10 different random fields of view (fov) per well were counted under a 20× objective lens of a microscope.

[0761] The results are shown in Figures 82 and 83.

[0762] As is evident from Figures 82 and 83, additional treatment with low doses of palbociclib and JQ-1 significantly accelerates the number of tumor cells infected with XVir-N-31.

[0763] Example 34: Effects of various BET inhibitors and BET degraders used in combination with XVir-N-31 in UMUC3 and RT112 cell lines

[0764] The purpose of this study was to determine the efficacy of XVir-N-31 in combination with various BET (bromodomain and extraterminal motif) inhibitors, including degradation agents. BET inhibitors (BETi): OTX015 (monovalent), AZD5153 (divalent) competitively inhibit BET, while BET degraders (BETd): dBet6, ARV55 induce BET degradation (e.g., Rhyasen GW, et al. AZD5153: A Novel Bivalent BET Bromodomain Inhibitor Highly Active against Hematologic Malignancies. Mol Cancer Ther. 2016 Nov;15(11):2563-2574; J. Kay Noel, et al. Abstract C244: Development of the BET bromodomain inhibitor OTX015. Mol Cancer Ther. November 2013 12; C244; Winter GE, et al.: BET Bromodomain Proteins Function as Master Transcription Elongation Factors Independent of CDK9 Recruitment. Mol Cell. 2017 Jul See Raina K, et al.: PROTAC-induced BET protein degradation as a therapy for castration-resistant prostate cancer. Proc Natl Acad Sci US A. 2016 Jun 28;113(26):7124-9. These disclosures are incorporated herein by reference.

[0765] In the first embodiment, the cell survival of UMUC3 cells and RT112 cells after XVir-N-31 infection in combination with BETi and BETd treatment was analyzed by efficacy assay.

[0766] 1.3 × 10 4 Individual UMUC-3 cells and 3 × 104 Individual RT112 cells were seeded in 12-well plates in DMEM medium and RT112 medium. The following day, the cells were pretreated with BETi and BETd at the indicated concentrations. 48 hours after seeding, the cells were infected with the oncolytic adenovirus XVir-N-31 and treated with BETi and BETd. Five days later, the cells were fixed using 10% TCA. The plates were stained with 0.05% SRB solution. After removing excess, the plates were washed with 1% acetic acid. After removing the acetic acid, the plates were air-dried overnight. SRB was dissolved in 500 μl of 10 mM Tris base solution, and a 1:10 dilution was measured using a photometer at 562 nm.

[0767] The results are shown in Figures 84 and 85.

[0768] As is evident from Figures 84 and 85, the combined use of BETi and BETd with XVir-N-31 virus was synergistic in both cell lines, resulting in a potent reduction in cell survival.

[0769] In the second aspect, the effects of BETi and BETd on viral replication of fibrous DNA in UMUC-3 and RT112 cell lines were analyzed by qPCR.

[0770] 3 x 10 4 Individual UMUC-3 cells and 4 × 10 4Individual RT112 cells were seeded in 12-well plates in DMEM and PRMI medium. The following day, the cells were pretreated with BETi and BETd. 48 hours after seeding, the cells were infected with UMUC-3 at 10 MOI and RT112 at 50 MOI, and treated with BETi and BETd at the indicated concentrations. After each time point (4 and 24 hours), the cells were washed once with PBS and 200 μl of SDS DNA lysis buffer was added. The cells were incubated with proteinase K, followed by phenol-chloroform-isoamyl alcohol purification. The DNA was diluted in DNase-free water, and the DNA concentration was determined using Nanodrop. For each sample, a 15 ng / μl solution was prepared, and RT-qPCR was performed using 75 ng of DNA and GoTaq Master mix. Specific filament forward and reverse primers were used, and specific actin primers were also used for Δct value calculation. For each sample, three filament values ​​and three actin values ​​were measured. The calculations were performed in Excel, and each 24-hour value was calculated based on its 4-hour value (initial virus infection before replication).

[0771] The results are shown in Figures 86 and 87.

[0772] As is evident from Figures 86 and 87, treatment with BETi and BETd significantly increased XVir-N-31 replication within 24 hours post-infection. In both cell lines, the increase in viral replication was highest with the use of the bivalent BETi, AZD5153. This indicates that bivalent inhibitors are generally more suitable for use with XVir-N-31.

[0773] Example 35: Combination therapy of the CDK4 / 6 inhibitor ribociclib and XVir-N-31 in a sarcoma xenograft nude mouse model. method animal research For the human sarcoma xenograft model, 3 × 10 6Individual A673 tumor cells were injected subcutaneously (sc). Tumor size was measured every 2-3 days, and tumor volume was calculated using the formula: Volume = 0.5 × Length × Width 2 The calculation was performed based on the tumor volume being 100-150 mm². 3 After exceeding a certain threshold, mice were randomized to the indicated treatment / control groups: PBS (i.e., 0.5% methylcellulose containing PBS but without LEE011, intratumor [it]), LEE (i.e., 0.5% methylcellulose containing LEE011 and PBS, it), XVir alone (i.e., 0.5% methylcellulose containing XVir-N-31 but without LEE011, it), and combination (i.e., 0.5% methylcellulose containing LEE011 and XVir-N-31, it). Then, each animal was orally administered 200 mg / kg body weight of ribocilib succinate (LEE011) (dissolved in 0.5% methylcellulose) from day X (DX) to day X+4 (DX+4), or a mock control (0.5% methylcellulose without LEE011). 1 × 10 11 VP XVir-N-31 or PBS (50 μl each) was injected on day X+1 (DX+1) and day X+3 (DX+3). On day X+5, three representative animals from the XVir-alone and XVir-combined treatment groups were euthanized for histopathological evaluation and quantification of viral replication in explanted tumors. The tumor size of the remaining mice was measured when the tumor volume reached 1000 mm². 3 The mice were euthanized after being measured until the reading exceeded a certain threshold.

[0774] The experimental design for animal research is shown in Figure 88.

[0775] statistical analysis In vivo tumor growth was analyzed using the open-access web tool TumGrowth (https: / / kroemerlab.shinyapps.io / TumGrowth). In short, tumor volume measurement data were subjected to linear mixed-effects modeling, enabling longitudinal tumor growth gradient comparison and treatment response evaluation (cross-sectional analysis) at desired time points. P-values ​​were calculated using software employing Type II ANOVA and selected pairwise comparisons for longitudinal and cross-sectional analysis (with Holm adjustments, where indicated). Tumor growth curves were generated using Prism 5 (GraphPad Software, San Diego, CA, USA). Tumor growth curves were plotted using mean tumor volume and mean standard error (SEM). A P-value < 0.05 was considered statistically significant. * p<0.05; ** p<0.005; *** p<0.0005).

[0776] Results - Efficacy of combination therapy and monotherapy in xenograft nude mouse models To investigate whether the biologically relevant benefits of the proposed combination strategy could translate into potential therapeutic benefits, tumor suppression of xenografted A673 sarcoma cells was evaluated in immunodeficient nude mice. Applying TumGrowth, an open-access web tool, significantly improved tumor growth suppression in animals treated with the combination compared to animals treated with monotherapy (LEE or XVir alone) or control (PBS). The maximum difference in treatment response between groups was observed 12–21 days after the start of treatment. (Notably, viral replication was significantly increased in explanted tumors of representative animals treated with the combination compared to XVir-N-31.)

[0777] The results are shown in Figures 89, 90, and 91. The selected pairwise comparisons for the longitudinal analysis are shown in the table below.

[0778] [Table 8]

[0779] The results shown in Figures 29, 30, and 31 clearly demonstrate that combination therapy including XVir-N-31 and ribociclib is more effective than XVir-N-31 or ribociclib alone.

[0780] The features of the present invention disclosed in the prior specification, claims, and drawings may be important, both individually and in any combination, for the realization of the invention in various embodiments.

Claims

1. A pharmaceutical composition for the treatment of tumors or cancer, Oncolytic adenovirus, CDK4 / 6 inhibitors, and It comprises a nutrin derivative selected from the group consisting of nutrin-3a and idasanutrin, The adenovirus described above lacks the expression of E1A13S and replicates in a YB-1-dependent manner. The CDK4 / 6 inhibitors are selected from the group consisting of palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, and ribociclib, also known as LEE011. and The aforementioned tumor or cancer has YB-1 in its nucleus, The aforementioned tumor or cancer expresses Rb or is Rb-positive. A pharmaceutical composition for the treatment of tumors or cancer.

2. The pharmaceutical composition according to claim 1, wherein the adenovirus, the CDK4 / 6 inhibitor, and the nutrin derivative are to be administered separately.

3. The pharmaceutical composition according to claim 1, wherein the adenovirus, the CDK4 / 6 inhibitor, and the nutrin derivative are for concomitant administration.

4. A pharmaceutical composition containing an oncolytic adenovirus for use in the treatment of tumors or cancer, The measure is, The pharmaceutical composition is administered to a subject in combination with, or before or after, a CDK4 / 6 inhibitor and a nutrin derivative selected from the group consisting of nutrin-3a and idasanutrin. The adenovirus described above lacks the expression of E1A13S and replicates in a YB-1-dependent manner. The CDK4 / 6 inhibitors are selected from the group consisting of palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, and ribociclib, also known as LEE011. and The aforementioned tumor or cancer has YB-1 in its nucleus, The aforementioned tumor or cancer expresses Rb or is Rb-positive. Pharmaceutical composition.

5. A pharmaceutical composition containing a CDK4 / 6 inhibitor for use in the treatment of tumors or cancer, The measure is, The pharmaceutical composition is administered to a subject in combination with, or before or after, a nutrin derivative selected from the group consisting of oncolytic adenovirus, nutrin-3a, and idasanutrin. The adenovirus described above lacks the expression of E1A13S and replicates in a YB-1-dependent manner. The CDK4 / 6 inhibitors are selected from the group consisting of palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, and ribociclib, also known as LEE011. and The aforementioned tumor or cancer has YB-1 in its nucleus, The aforementioned tumor or cancer expresses Rb or is Rb-positive. Pharmaceutical composition.

6. A pharmaceutical composition for use in the treatment of tumors or cancer, comprising a nutrin derivative selected from the group consisting of nutrin-3a and idasanutrin, The procedure includes administering the pharmaceutical composition to a subject in combination with or before / after a tumor-lytic adenovirus and a CDK4 / 6 inhibitor. The adenovirus described above lacks the expression of E1A13S and replicates in a YB-1-dependent manner. The CDK4 / 6 inhibitors are selected from the group consisting of palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, and ribociclib, also known as LEE011. and The aforementioned tumor or cancer has YB-1 in its nucleus, The aforementioned tumor or cancer expresses Rb or is Rb-positive. Pharmaceutical composition.

7. The pharmaceutical composition according to any one of claims 1 to 6, wherein the oncolytic adenovirus is replication-deficient in cells lacking YB-1 in the nucleus, but replicates in cells having YB-1 in the nucleus.

8. The pharmaceutical composition according to any one of claims 1 to 7, wherein the adenovirus lacks the expression of the E1B 19kDa protein.

9. The pharmaceutical composition according to any one of claims 1 to 8, wherein the adenovirus is an adenovirus that expresses an RGD motif in the fiber.

10. The pharmaceutical composition according to any one of claims 1 to 9, wherein the adenovirus is XVir-N-31.

11. The pharmaceutical composition according to any one of claims 1 to 10, wherein the tumor or cancer cells are resistant to or insensitive to one or more pharmaceutically active agents and / or radiation.

12. The pharmaceutical composition according to any one of claims 1 to 11, wherein the tumor or cancer contains YB-1 in the cell nucleus regardless of the cell cycle.

13. The pharmaceutical composition according to any one of claims 1 to 12, wherein the tumor or cancer has YB-1 in its nucleus after induction.

14. The pharmaceutical composition according to claim 13, wherein the inducement is radiation, administration of a cell division inhibitor, or hyperthermia.

15. The pharmaceutical composition according to any one of claims 1 to 14, wherein the tumor or cancer is selected from the group including bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer, and leukemia.

Citation Information

Patent Citations

  • Oncolytic adenovirus composition

    JP2016516407A

  • Kinase inhibitors and their uses

    JP2017501187A

  • Androgen receptor regulators and methods of using the same

    JP2017516862A

  • Treatment of tumors with a combination of oncolytic adenovirus and CDK4 / 6 inhibitors

    JP2021517119A

  • Oncolytic adenoviruses with mutations in immunodominant adenovirus epitopes and their use in cancer treatment

    WO2016178167A1