Antibody Fc region with enhanced affinity for FcγRIIB

Abstract

The present invention provides engineered Fc regions that have at least one amino acid mutation compared to a parent Fc region, and the affinity of these engineered Fc regions for FcγRIIB is improved compared to the affinity of the parent Fc region for FcγRIIB. The present invention also provides antibodies, particularly agonistic antibodies, that comprise the engineered Fc regions. The engineered Fc region is important for optimizing the agonistic activity of an antibody.

Description

[Technical Field]

[0001] The present invention relates to the biopharmaceutical field, and more particularly to variants of the Fc region of a single-row human IgG2 antibody. Since these variants have enhanced FcγRIIB affinity, agonist antibodies containing these Fc region variants are expected to have superior agonist activity. [Background technology]

[0002] The development of biomolecular drugs brings new approaches and possibilities to the treatment of various diseases, and molecular targeted therapies based on antibodies and heavy chain constant regions (including Fc regions), including antibody-heavy chain constant region fusion proteins, continue to be a focus of the field, having achieved great success in the biopharmaceutical sector over the past 30 years.

[0003] Biomolecules are broadly classified into three categories based on their mechanism of action: effector molecules that clear targets (molecules or cells), blocking molecules that block signaling pathways involving targets, and agonist molecules that activate downstream signaling pathways of targets. In recent years, tumor immunotherapy has made significant progress. This is due to the use of antibodies that enhance the activity of immune cells and kill tumors by blocking nodes that suppress immunity. However, many cancer patients still do not respond to existing treatments. Therefore, there is an urgent need to optimize existing tumor immunotherapy methods and to research and develop new tumor immunotherapy drugs. In particular, tumor immunotherapy methods called "agonist antibodies" can indirectly kill tumor cells by binding to the surface of immune cells, transferring target molecules of immune activation signals, and activating important immune activation signaling pathways controlled by these molecules, thereby further enhancing the anti-tumor immune response. However, while the great potential of agonist tumor immunotherapy antibodies has already been proven in animal models and is widely accepted, it represents a promising tumor immunotherapy concept. Despite this, the research and development of these antibodies has not yet been successful, posing a significant challenge in the field of tumor immunotherapy. Furthermore, the activation of agonist antibodies is a valuable means of intervening in and regulating key signaling pathways in other biological processes, offering broad application prospects in disease prevention, control, and treatment. For example, activating immunosuppressive signaling pathways may help alleviate inflammation and autoimmune symptoms.

[0004] Antibodies primarily interact with FcγR via their constant region, and different antibodies exhibit different binding capacities to FcγR. This difference also affects antibody function in vivo. While antibody Fc engineering is a key means and trend for optimizing therapeutic antibodies, modifying the interaction ability of the antibody Fc region with key proteins such as FcγR is a highly effective method for optimizing antibody activity. [Overview of the project] [Problems that the invention aims to solve]

[0005] To address the above problems, the present invention provides amino acid mutations and combinations thereof that can enhance the affinity of FcγRIIB by mutating the Fc region based on IgG; Fc containing these amino acid mutations can be used to optimize antibody activity, and in particular to improve the agonist activity of agonist antibodies. [Means for solving the problem]

[0006] In a first aspect of the present invention, a mutant Fc polypeptide fragment is provided, the mutant Fc polypeptide fragment having the following characteristics: (i) The mutant Fc polypeptide fragment has mutations compared to the corresponding wild-type Fc fragment before the mutation; and (ii) The affinity of the mutant Fc region to FcγRIIB is improved compared to the wild-type Fc region; and the wild-type Fc is the Fc of wild-type IgG2.

[0007] In another preferred example, the mutant Fc polypeptide fragment has site mutations selected from the following, compared to the corresponding wild-type Fc fragment before mutation: L328, H268, S267, P271, G327, or a combination thereof; However, all amino acid numbers are based on IgG Eu numbers.

[0008] In another preferred example, the affinity can be reflected in the screening enrichment or binding analysis signal.

[0009] In another preferred example, the wild-type Fc fragment is located from position 233 to 332 in the amino acid sequence of IgG2 based on the IgG Eu number, and the amino acid sequence of the wild-type Fc fragment is shown as SEQ ID NO:20.

[0010] In another preferred example, the mutant Fc polypeptide fragment has enhanced FcγRIIB affinity compared to the wild-type Fc fragment.

[0011] In another preferred example, the affinity of the mutant Fc polypeptide fragment for FcγRIIB is at least 1-fold higher than the affinity of the wild-type Fc fragment for FcγRIIB, preferably 2, 3, 4, 5, 10, 20, 50 or 100-fold or more higher.

[0012] In another preferred example, the mutant Fc polypeptide fragment has a lower affinity for activating FcγRs than for FcγRIIB.

[0013] In another preferred example, compared to the wild-type Fc fragment, the mutant Fc polypeptide fragment has an improved affinity for FcγRIIB and a reduced affinity for activating FcγRs (the value of the I / A ratio is higher than that of the wild-type Fc fragment).

[0014] In another preferred example, FcγRIIB and FcγRIIA 131R The ratio (RIIB / RIIAR) of the affinity of the mutant Fc polypeptide fragment for is higher than that of wild-type IgG2.

[0015] In another preferred example, the activating FcγRs are FcγRI, FcγRIIA 131H , FcγRIIA 131R , FcγRIIIA 158F and FcγRIIIA 158V including.

[0016] In another preferred example, the mutant L328 is L328W, L328E, L328Y, L328F, L328M, L328A, L328G, L328N, L328P, L328R, L328V; preferably including L328W or L328E.

[0017] In another preferred example, the mutant H268 is H268D, H268S, H268E, H268K, H268N; preferably including H268D, H268S or H268E.

[0018] In another preferred example, the mutation S267 includes S267E, S267V, S267D, S267M, S267Q, S267A, S267G, S267R, S267N, S267W; preferably S267E, S267V, S267D, S267M; more preferably S267E.

[0019] In another preferred example, the P271 variant includes P271C, P271G, P271V, P271A, P271W, P271Y, P271Q, P271T, P271I, P271L, P271S; preferably P271C, P271G, P271V, P271A, P271W, P271Y, P271Q, P271T; more preferably P271C, P271G.

[0020] In another preferred example, the G327 variant includes G327A, G327L, and G327S; preferably G327A.

[0021] In another preferred example, the mutant Fc polypeptide fragment has mutations at a site selected from the following, L328W, L328E, H268D, H268S, H268E, S267E, A330S, P233G, P271G, P271C, P271V, P271A, P271W, P271Y, G327A, or a combination thereof, compared to the wild-type Fc fragment; however, all amino acid numbers are based on IgG Eu numbers.

[0022] In another preferred example, the mutant Fc polypeptide fragment has at least one mutation at two sites, L328 and H268, compared to the wild-type Fc fragment, and the mutation of the mutant Fc polypeptide fragment can be specifically selected from: L328W, L328E, H268D, H268S, H268E, H268D / S298L / L328W, S267V / S298L / L328W, V234M / S267E / S298L / L32 8W, A235W / V266L / S298L / L328W, V234Q / A235G / P238L / S239V / H268D / G327A / L328E / A330S / I332T, S239V / V266L / S298L / L328W, V266L / L328W, V266L / S267D / H268D / E269D / P271Q, S267E / H268S / E269D, P233F / V266L / S298L / L328W, V266L / S298L / L328W, V234 Q / A235G / P238L / S239V / G327A / L328E / A330S / I332T, V266L / S267E / H268S / E269V, V266L / S267E / H268S / E269V / P271C, V266L / S 267E / H268S / E269A / P271C, S267V / S298G / L328W, V266L / S267M / H268E / P271Q, V266L / S267E / H268S / E269G / P271T, V234Q / V266L / S267D / H268D / E269D / P271Q, V234Q / A235G / P238L / S239V / S267E / H268S / E269D, V266L / S267E / H268S / P271V, V234Q / A235G / P238L / S239V / S267E / S298L / G327A / L328E / A330S / I332T, V234Q / V266L / S267E / H268S / E269V, L328E / I332T; however, all amino acid numbers are based on IgG Eu numbers.

[0023] In another preferred example, the mutant Fc polypeptide fragment has a mutation at the S267 site compared to the wild-type Fc fragment, and the mutation of the mutant Fc polypeptide fragment can be specifically selected from: S267E / A330S, S267E / S298G, P233G / S267E, V234M / S267E / S298G / I332L, P233G / S267E / S298G, V266L / S2 67E / E269K / P271G, P238Q / S267E, S267A / P271C, S267A / P271G, S267E / D270H, S267E / P271C, S267E / P271V, S267E / P271W, S267E / P271Y, S267E / S298R, S267M / P271C, S267M / P271G, S267V / S298L, S267E / P329R; however, all amino acid numbers are based on IgG Eu numbers.

[0024] In another preferred example, the mutant Fc polypeptide fragment has a mutation at the S267 site compared to the wild-type Fc fragment, and the mutation of the mutant Fc polypeptide fragment can be specifically selected from: S267E / A330S, S267E / S298G, P233G / S267E, V234M / S267E / S298G / I332L, P233G / S267E / S298G, V266L / S267E / E269K / P271G, S267E / P271C; however, all amino acid numbers are based on IgG Eu numbers.

[0025] In another preferred example, the mutant Fc polypeptide fragment has a mutation at the P271 site compared to the wild-type Fc fragment, and the mutation of the mutant Fc polypeptide fragment can be selected from the following: V266L / S267E / E269K / P271G, V266A / P271C, V266A / P271G, S267A / P271C, S267A / P271G, S267E / P271C, S267E / P271V, S267E / P271W, S267E / P271Y, S267M / P271C, S267M / P 271G, V266G / P271C, P271A / S298R, P271G / G236V, P271G / P329S, P271G / P331C, P271G / P331T, P271G / S298D, P271G / S298E, P271G / S298G, P271G / S298K, P271G / S298L, P271G / S298N, P271G / S298R, P271G / T299A, P271G / T299M, P271G / T299S, P271G / T299W, P271G / I332L; however, all amino acid numbers are based on IgG Eu numbers.

[0026] In another preferred example, the mutant Fc polypeptide fragment has a mutation at the G327 site compared to the wild-type Fc fragment, and the mutation of the mutant Fc polypeptide fragment can be specifically selected from: G327A / A330R, G327A / A330V, G327A / I332A, G327A / I332C, G327A / I332E.

[0027] In another preferred example, the mutations in the aforementioned mutant Fc polypeptide fragments, compared to the wild-type Fc fragment, can be specifically selected from the following: H268D / S298L / L328W, S267V / S298L / L328W, V234M / S267E / S298L / L328W, A235W / V266L / S298L / L328W, V234Q / A235G / P238L / S239V / H268D / G327A / L328E / A330S / I332T; however, all amino acid numbers are based on IgG Eu numbers.

[0028] In a second aspect of the present invention, a mutant immunoglobulin Fc region is provided, wherein the mutant immunoglobulin Fc region comprises the mutant Fc polypeptide fragment described in the first aspect of the present invention.

[0029] In another preferred example, the immunoglobulin is human IgG2.

[0030] In another preferred example, the mutant immunoglobulin Fc region has enhanced FcγRIIB affinity compared to the wild-type IgG2 Fc region.

[0031] In another preferred example, the affinity of the mutant immunoglobulin Fc region to FcγRIIB is at least 1-fold higher than the affinity of the wild-type IgG2 Fc region to FcγRIIB, and is preferably 2, 3, 4, 5, 10, 20, 50, or 100-fold higher.

[0032] In another preferred example, the affinity can be reflected in the screening enrichment or binding analysis signal.

[0033] In another preferred example, the mutant immunoglobulin Fc region has a lower affinity for activating FcγR than FcγRIIB.

[0034] In another preferred example, compared to the wild-type IgG2 Fc region, the mutant immunoglobulin Fc region exhibits improved affinity for FcγRIIB and decreased affinity for activating FcγR (the I / A ratio is higher than that of the wild-type IgG2 Fc region).

[0035] In another preferred example, the affinity ratio of the mutant immunoglobulin Fc region to FcγRIIB and FcγRIIA131R (RIIB / RIIAR) is higher than that of wild-type IgG2.

[0036] In a third aspect of the present invention, an antibody is provided, the antibody comprising a mutant Fc polypeptide fragment described in the first aspect of the present invention or a mutant immunoglobulin Fc region described in the second aspect of the present invention.

[0037] In another preferred example, the antibody is an antibody based on the human IgG2 skeleton.

[0038] In another preferred example, the antibody is an agonist antibody.

[0039] In another preferred example, the antibody specifically targets the tumor necrosis factor receptor superfamily.

[0040] In another preferred example, the antibody can specifically bind to a target selected from: CD40, DR5, OX40, CD137, CD27, CD30, GITR, HVEM, TACI, DR4, FAS, or a combination thereof.

[0041] In another preferred example, the antibody can specifically bind to OX40.

[0042] In another preferred example, the antigen targeted by the antibody is an immunoreceptor molecule or a combination thereof.

[0043] In another preferred example, the antigen targeted by the antibody is an immunosuppressive receptor molecule, and the immunosuppressive receptor molecule can be selected from PD-1, CTLA-4, VISTA, TIM-3, BTLA, LAG-3, or a combination thereof.

[0044] In another preferred example, the antibody is a human antibody, a humanized antibody, or a chimeric antibody.

[0045] In another preferred example, the antibody is a monoclonal antibody or a polyclonal antibody, preferably a monoclonal antibody.

[0046] A fourth aspect of the present invention provides a fusion protein comprising a mutant Fc polypeptide fragment described in the first aspect of the present invention, a mutant immunoglobulin Fc region described in the second aspect of the present invention, or an antibody described in the third aspect of the present invention.

[0047] In another preferred example, the fusion protein also includes other protein sequences or fragments thereof that have receptor agonist function.

[0048] In another preferred example, other proteins with the aforementioned receptor agonist function are cytokines in the TNF gene family.

[0049] In another preferred example, the other protein having the aforementioned receptor agonist function includes the ligand molecule of the immune receptor.

[0050] In another preferred example, the other protein having receptor agonist function comprises an immunoreceptor ligand molecule, which is one or a combination of CD80, CD86, ICOSL, OX40L, CD137L, CD40L, CD30L, CD27L, CD244, CD150, CD48, CD84, CD319, Ly118, or CD229.

[0051] In another preferred example, the other protein having receptor agonist function includes an immunoreceptor ligand molecule, which can be selected from PD-L1, PD-L2, B7-H3, B7-H4, CD47, VISTA, HVEM, GAL9, or a combination thereof.

[0052] In another preferred example, the fusion protein includes a tag sequence that contributes to expression and / or purification; preferably, the tag sequence includes a 6His tag, an HA tag, and / or a FLAG tag.

[0053] In a fifth aspect of the present invention, an isolated polynucleotide is provided, the polynucleotide encoding a mutant Fc polypeptide fragment described in the first aspect of the present invention, a mutant immunoglobulin Fc region described in the second aspect of the present invention, an antibody described in the third aspect of the present invention, or a recombinant protein described in the fourth aspect of the present invention.

[0054] In a sixth embodiment of the present invention, a vector is provided, the vector comprising an isolated polynucleotide described in a fifth embodiment of the present invention.

[0055] In another preferred example, the vector can be selected from DNA, RNA, viral vectors, plasmids, transposons, other gene transfer systems, or a combination thereof.

[0056] In another preferred example, the vector includes a viral vector, such as a lentivirus, adenovirus, AAV virus, reverse transcription virus, or a combination thereof.

[0057] In a seventh aspect of the present invention, a host cell is provided, the host cell comprising the vector described in the sixth aspect of the present invention, or incorporating the polynucleotide described in the fifth aspect of the present invention into its genome; Alternatively, the host cell expresses a mutant Fc polypeptide fragment described in the first aspect of the present invention, a mutant immunoglobulin Fc region described in the second aspect of the present invention, an antibody described in the third aspect of the present invention, or a recombinant protein described in the fourth aspect of the present invention.

[0058] In another preferred example, the host cells include prokaryotic or eukaryotic cells.

[0059] In another preferred example, the host cells can be selected from E. coli, yeast cells, insect cells, avian cells, and mammalian cells.

[0060] In an eighth aspect of the present invention, a drug composition is provided, the drug composition comprising the following: (a) a mutant Fc polypeptide fragment as described in the first aspect of the present invention, a mutant immunoglobulin Fc region as described in the second aspect of the present invention, an antibody as described in the third aspect of the present invention, or a recombinant protein as described in the fourth aspect of the present invention; and (b) A pharmaceutically acceptable carrier.

[0061] In another preferred example, the drug composition includes other drugs that treat tumors, such as cytotoxic drugs.

[0062] In another preferred example, the drug composition comprises other active substances having receptor agonist function.

[0063] In another preferred example, the drug composition is in the form of an injectable dosage.

[0064] A ninth aspect of the present invention provides a method for producing a mutant Fc polypeptide fragment described in the first aspect of the present invention, a mutant immunoglobulin Fc region described in the second aspect of the present invention, an antibody described in the third aspect of the present invention, or a recombinant protein described in the fourth aspect of the present invention, comprising the following steps: (i) Under appropriate conditions, a host cell according to the seventh aspect of the present invention is cultured to obtain a culture containing the mutant Fc polypeptide fragment, the mutant immunoglobulin Fc region, the antibody, or the recombinant protein; and (ii) The culture obtained in step (i) is purified and / or isolated to obtain the mutant Fc polypeptide fragment, mutant immunoglobulin Fc region, antibody, or recombinant protein.

[0065] In another preferred example, the purification is performed by obtaining the target antibody through purification and isolation using a protein A affinity column.

[0066] In another preferred example, the purification is performed to obtain the target antibody by purification and isolation using a protein G affinity column.

[0067] In another preferred example, the purity of the purified and isolated target antibody is higher than 95%, higher than 96%, higher than 97%, higher than 98%, higher than 99%, and preferably 100%.

[0068] In a tenth aspect of the present invention, the invention provides the application of a mutant Fc polypeptide fragment described in the first aspect of the invention, a mutant immunoglobulin Fc region described in the second aspect of the invention, an antibody described in the third aspect of the invention, or a recombinant protein described in the fourth aspect of the invention, a polynucleotide described in the fifth aspect of the invention, a vector described in the sixth aspect of the invention, and / or a host cell described in the seventh aspect of the invention, in the preparation of a drug composition for use in tumor immunotherapy to alleviate inflammation and / or autoimmune symptoms.

[0069] In an eleventh aspect of the present invention, a method for treating a disease is provided, comprising the following steps: using, to the subject as needed, a mutant Fc polypeptide fragment as described in the first aspect of the present invention, a mutant immunoglobulin Fc region as described in the second aspect of the present invention, an antibody as described in the third aspect of the present invention, or a recombinant protein as described in the fourth aspect of the present invention, a polynucleotide as described in the fifth aspect of the present invention, a vector as described in the sixth aspect of the present invention, a host cell as described in the seventh aspect of the present invention, and / or a drug composition as described in the eighth aspect of the present invention.

[0070] In another preferred example, the subject includes mammals, preferably humans.

[0071] In another preferred example, the aforementioned disease may be selected from tumors, inflammatory diseases, autoimmune diseases, or a combination thereof.

[0072] In another preferred example, the aforementioned cancers include, but are not limited to, breast cancer, prostate cancer, lung cancer, ovarian cancer, cervical cancer, skin cancer, melanoma, colon cancer, stomach cancer, liver cancer, esophageal cancer, kidney cancer, throat cancer, thyroid cancer, pancreatic cancer, testicular cancer, brain cancer, bone cancer, and blood cancers (e.g., leukemia, chronic lymphocytic leukemia).

[0073] In another preferred example, the cancers mentioned above include, but are not limited to, basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain and central nervous system (CNS) cancer, cervical cancer, choriocarcinoma, colorectal cancer, connective tissue cancer, gastrointestinal cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, stomach cancer, epithelial tumors, kidney cancer, throat cancer, liver cancer, (small cell, large cell) lung cancer, lymphoma (including Hodgkin lymphoma and non-Hodgkin lymphoma); melanoma; neuroblastoma; oral cancer (e.g., lip, tongue, mouth, and throat); ovarian cancer; pancreatic cancer; retinoblastoma; rhabdomyosarcoma; rectal cancer; respiratory cancer; sarcoma; skin cancer; stomach cancer; testicular cancer; thyroid cancer; uterine cancer; urinary tract cancer; and other cancers and sarcomas.

[0074] In another preferred example, the method is used to stimulate an immune response to treat the tumor by inhibiting or delaying tumor growth or by reducing the size of the tumor.

[0075] Another aspect of the present invention provides a method for screening amino acid mutations that enhance protein-molecule binding ability, comprising the following steps: 1) Provide the parent protein sequence and introduce amino acid mutations into the parent protein sequence by PCR; 2) Construct expression vectors with the parent protein and the mutated protein to create a mutation library; 3) Transfect the expression vector into mammalian cells and express the parent protein and the mutated protein on the cell surface; 4) Incubate the marker-tagged interacting molecules with the mammalian cells, and sort the marked mammalian cells by flow cytometry or magnetic beads; 5) Extract DNA from marked mammalian cells, perform sequencing, and analyze and compare the changes in sequence ratios before and after sorting; However, amino acid mutations whose ratio after sorting is significantly higher than the ratio before sorting are amino acid mutations that can enhance the binding ability between the protein and the interacting molecule.

[0076] This screening method is very convenient and effective, as it can efficiently screen for various amino acid mutations, and may be used to screen for amino acid mutations that enhance various protein-protein interactions or protein-other molecular interactions.

[0077] A favorable effect of the present invention is that the engineered Fc regions or Fc fragments provided herein have enhanced FcγRIIB affinity, and some of them also have reduced activating FcγR affinity while possessing enhanced FcγRIIB affinity. These proteins can be used to design, engineer, or optimize the agonist activity of antibodies or fusion proteins. In particular, they may be used to design the agonist activity of antibodies or fusion proteins based on the human IgG2 backbone. This provides protein molecules with significantly enhanced agonist activity, which have significant application prospects for the treatment of tumors, inflammatory diseases, autoimmune diseases, or combinations thereof. [Brief explanation of the drawing]

[0078] [Figure 1] This shows the construction map of mammalian surface display antibody plasmids. [Figure 2] A schematic diagram of the mutation screening flow is shown. Specifically, a mutation library is constructed, introduced into cells using reverse transcription virus, the Fc mutation library is expressed on the cell surface, cells with high affinity for FcγRIIB are sorted, DNA is extracted, high-throughput sequencing (NSG) is performed, and the enrichment status of various mutations is analyzed before and after sorting to select mutations with relatively high enrichment ratios compared to the wild type. [Figure 3] The Eu number corresponding to the CH2-coded amino acid is shown for human IgG2 Fc. [Figure 4] This shows that sorting using a flow cytometry sorter can gradually enrich cells with higher binding affinity to FcγRIIB. This figure shows the flow cytometry analysis results of wild-type human IgG2 cells and human IgG2 library LibraryMix cells after one and two FcγRIIB sorting steps, respectively. [Figure 5] This shows that cells screened by the library significantly improved their binding ability to FcγRIIB. This figure shows the flow cytometry results of wild-type human IgG2 cells and cells after two FcγRIIB sortings. [Figure 6] Schematic diagrams of two types of combinatorial mutation libraries are shown. Type 1: Single-point combinatorial mutations between four regions, i.e., 0-1 mutations in each of the four regions P233-V240, V266-P271, S298-T299, and G327-I332, resulting in a total of 0-4 combinatorial mutations; Type 2: Combinatorial mutations of multiple amino acids within a single region, i.e., combinatorial mutations of amino acids within each of the four regions P233-V240, V266-P271, S298-T299, and G327-I332 (0-7, 0-6, 0-2, and 0-6 combinatorial mutations, respectively). [Figure 7] The flow cytometry analysis results for wild-type IgG2 and library IgG2_C01 and library IgG2_C02, sorted by flow cytometry, are shown. Library IgG2_C01 and library IgG2_C02 showed an increased proportion of cells binding to FcγRIIB. [Figure 8]The binding ability of library Cmix and library C2 cells to FcγRIIB was shown before ("_before") and after ("_1st" and "_2nd") sorting by flow cytometry. As a result, the proportion of cells binding to FcγRIIB gradually increased in the library after sorting (2nd > 1st > before). [Figure 9] This shows the binding ability of different IgG2 antibody Fc variants to FcγRI (ELISA signal: expressed as absorbance (A650) at 650 nm). [Figure 10] This shows the binding ability of different IgG2 antibody Fc variants to FcγRIIA131H (ELISA signal: expressed as absorbance (A650) at 650 nm). [Figure 11] This shows the binding ability of different IgG2 antibody Fc variants to FcγRIIA131R (ELISA signal: expressed as absorbance (A650) at 650 nm). [Figure 12] This shows the binding ability of different IgG2 antibody Fc variants to FcγRIIB (ELISA signal: expressed as absorbance (A650) at 650 nm). [Figure 13] This shows the binding ability of different IgG2 antibody Fc variants to FcγRIIIA158F (ELISA signal: expressed as absorbance (A650) at 650 nm). [Figure 14] This shows the binding ability of different IgG2 antibody Fc variants to FcγRIIIA158V (ELISA signal: expressed as absorbance (A650) at 650 nm). [Figure 15] ELISA was used to analyze the binding affinity of mutants corresponding to IgG2 on IgG1V11 (hIgG1V11) to FcγRIIA131H and FcγRIIB (ELISA signal: expressed as absorbance at 650 nm (A650)). [Figure 16] The results of the analysis of the immunoactivating activity of various antibody Fc variants of anti-human OX40 antibodies are shown, represented as a bar graph of the average fluorescence intensity of CFSE in CD4-positive cells (lower CFSE signal indicates higher activity). [Figure 17]The results of the analysis of the immunoactivating activity of various antibody Fc variants of anti-human OX40 antibodies are shown, represented as a histogram of CFSE fluorescence intensity in CD4-positive cells (lower CFSE signal indicates higher activity). [Modes for carrying out the invention]

[0079] Unless otherwise specified, scientific and technical terms used herein have meanings that are generally understood by those skilled in the art. Furthermore, unless specifically limited herein, singular terms include plural terms, and plural terms include singular terms. Generally, the nomenclature and techniques relating to cell and tissue culture, molecular biology, immunology, and protein and nucleic acid chemistry described herein are well known and commonly used in the art.

[0080] The methods and techniques of the present invention are generally carried out in accordance with conventional methods known in the art and, unless otherwise specified, are described in the general and specialized references listed herein. For example, reference is made to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)), Ausubel et al., Current Protocols in Molecular Biology (Greene Publishing Associates (1992)), and Harlow and Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1990)), the contents of which are incorporated herein by reference. Enzyme reactions and purification techniques are carried out according to the manufacturer's instructions and can generally be carried out according to methods known in the art or methods described herein. The analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical nomenclature, as well as experimental methods and techniques described herein, are publicly known and commonly used in the art. Standard techniques are used for chemical synthesis methods, chemical analysis methods, pharmaceutical manufacturing methods, preparation methods and drug delivery methods, and patient treatment methods.

[0081] Unless otherwise specified, the following terms have the following definitions.

[0082] An antibody (Ab) includes, but is not limited to, a glycoprotein immunoglobulin or its antigen-binding portion, which specifically binds to an antigen and comprises at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each H chain includes a heavy chain variable region (hereinafter simply referred to as VH) and a heavy chain constant region. The heavy chain constant region of the antibody, also called CDs, includes three domains CH1, CH2, and CH3, and a hinge region located between the CH1 and CH2 domains. Each light chain includes a light chain variable region (hereinafter simply referred to as VL) and a light chain constant region. The light chain constant region consists of a single domain CL. The VH and VL regions are further subdivided into highly variable regions called complementarity-determining regions (CDRs), interspersed between them are relatively conserved regions called frame regions (FRs). Each VH and VL consists of three CDRs and four FRs, arranged in the order FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4 from the amino terminus to the carboxyl terminus. The variable regions of the heavy and light chains contain binding domains that interact with the antigen.

[0083] The "Fc region" (crystallizable region), "Fc domain," or "Fc" refers to the C-terminal region of the antibody heavy chain, which mediates the binding of immunoglobulins to host tissues or factors, including binding to Fc receptors located on various cells of the immune system (e.g., effector cells) or to the first component (C1q) of the classical complement system. Therefore, the Fc region is a polypeptide that constitutes the portion of the antibody heavy chain constant region other than the first constant domain immunoglobulin domain (CH1 domain). In the isotypes of IgG, IgA, and IgD antibodies, the Fc region consists of two identical protein fragments: the second (CH2 domain) and the third (CH3 domain) constant domain of the two antibody heavy chains; the Fc region of IgM and IgE contains three heavy chain constant domains (CH2-CH3-CH4 domains) in each polypeptide chain. In the case of IgG, the Fc region includes the immunoglobulin domains CH2 and CH3, and the hinge region between CH1 and CH2. While the limits of the Fc region of the immunoglobulin heavy chain can vary, in this invention, the Fc region of the human IgG heavy chain is defined as the sequence fragment from the amino residue at position P231 to the carboxyl terminus of the heavy chain, where the number is based on the EU number, as in Kabat. The CH2 domain of the human IgG Fc region extends from approximately amino acid 231 to approximately amino acid 340, while the CH3 domain is located on the C-terminal side of the CH2 domain of the Fc region, i.e., extends from approximately amino acid 341 to approximately amino acid 447 of IgG.

[0084] "Fc polypeptide fragment" refers to a fragment contained within an Fc region, and as used in this invention, an Fc polypeptide fragment refers to a fragment extending from amino acid 233 to amino acid 332 in an Fc region, or a fragment within another Fc region containing said fragment, such as an Fc CH2 domain or an Fc region.

[0085] As used herein, “Fc region” or “Fc polypeptide fragment” may be natural Fc or engineered Fc. Furthermore, “Fc region” or “Fc polypeptide fragment” refers to this region in a state of further isolation, or to this region in a protein polypeptide containing Fc, such polypeptides are also called “Fc fusion proteins” (e.g., antibodies or immunoadhesins).

[0086] An "Fc receptor" or "FcR" is a receptor that binds to the Fc region of immunoglobulins. FcRs that bind to IgG antibodies include the FcγR family of receptors, and also include allele variants and alternative splicing forms of these receptors. The human Fcγ receptor family includes several members: FcγRI(CD64), FcγRIIA(CD32a), FcγRIIB(CD32b), FcγRIIIA(CD16a), and FcγRIIIB(CD16b). Of these, FcγRIIB is the only inhibitory Fcγ receptor, while the others are all activating Fcγ receptors. Most native effector cell types co-express one or more activating FcγR receptors and inhibitory FcγRIIB receptors, while natural killer (NK) cells selectively express one activating Fcγ receptor (FcγRIII in mice and FcγRIIIA in humans), but do not express inhibitory FcγRIIB receptors in mice or humans. Because these Fcγ receptors have different molecular structures, they have different affinities to each IgG antibody subclass. Among these Fcγ receptors, FcγRI is a high-affinity receptor, while FcγRIIA, FcγRIIB, and FcγRIIIA are low-affinity receptors. Genetic polymorphisms also exist in these different Fcγ receptors and affect their binding affinities. The most common genetic polymorphisms are R131 / H131 in FcγRIIA and V158 / F158 in FcγRIIIA. Among these polymorphisms, some have been found to be associated with a variety of diseases, and the effectiveness of some specific therapeutic antibodies also depends on whether or not a patient has a particular Fcγ receptor gene polymorphism.

[0087] The “sequences” described in the present invention are understood to include sequences substantially identical to those of the present invention, where “substantially identical sequences” means that, after optimized alignment, when measured using, for example, a GAP or BESTFIT program and the default gap value, the two peptide sequences have at least 70, 75, or 80% sequence identity, preferably at least 90 or 95%, and more preferably at least 97, 98, or 99% sequence identity. Preferably, differences in the positions of different residues are conserved amino acid substitutions. A “conservative amino acid substitution” is one in which an amino acid residue is replaced by another amino acid residue having an R group in its side chain with similar chemical properties (e.g., charge or hydrophilicity). Generally, conservative amino acid substitutions do not substantially alter the function and properties of the protein. If two or more amino acid sequences differ by a conservative substitution, the sequence identity percentage or similarity can be improved to correct the conservative nature of the substitution. See, for example, Pearson, Methods Mol. Biol. 243:307-31 (1994). Examples of amino acid groups with side chains of similar chemical properties include: 1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; 2) aliphatic-hydroxyl side chains: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) alkali side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartic acid and glutamic acid; and 7) sulfur-containing side chains: including cysteine-methionine. A preferred group of conserved amino acid substitutions is valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamic acid-aspartic acid, and asparagine-glutamine. As noted above, the Fc region, antibody, Fc fragment, or fusion protein according to the present invention may further include other possible modifications not disclosed in the present invention, provided that they satisfy substantially the same sequence requirements as described above, except for having the amino acid mutations provided in the present invention.

[0088] The serial numbers of the amino acids of the antibodies, fragments or domains of the present invention are based on the IgG EU numbers. Table 1 shows the types and names of the corresponding mutations of some mutants involved in the present invention.

[0089] Antibodies generally bind specifically to their associated antigens with high affinity (similarly, the proteins of the present invention can also specifically bind to their epitope recognition molecules), which is represented by a dissociation constant (KD) of 10 -5 -10 -11 M or less. Any KD greater than about 10 -4 M -1 generally indicates non-specific binding. As used herein, an antibody that "specifically binds" to an antigen is an antibody that binds to the antigen and substantially the same antigen with high affinity, and its KD is 10 -7 M or less, preferably 10 -8 M or less, more preferably 5 × 10 -9 M or less, most preferably 10 -8 -10 -10 M or less, but it does not bind to antigens that are not related with high affinity. When an antigen exhibits a high sequence identity with the designated antigen, for example, at least 80%, at least 90%, preferably at least 95%, more preferably at least 97%, or more preferably at least 99% sequence identity with the sequence of the designated antigen, the antigen is "substantially the same" as the designated antigen.

[0090] Immunoglobulins can originate from any commonly known isotype. IgG isotypes can be classified into subclasses in some species: in humans, they can be classified into IgG1, IgG2, IgG3, and IgG4 subclasses; and in mice, into IgG1, IgG2a, IgG2b, and IgG3 subclasses. "Isotype" refers to the class of antibody encoded by a heavy chain constant region gene (e.g., IgM or IgG1). "Antibody" includes, for example, naturally occurring or non-natural antibodies; monoclonal and polyclonal antibodies; chimeric and humanized antibodies; human or non-human antibodies; fully synthetic antibodies; and single-chain antibodies.

[0091] In this invention, "natural IgG" refers to IgG that can naturally exist in nature, and the sequences of these IgGs are not artificially modified. It should be noted that even natural IgG can have different variants due to genetic polymorphisms, but regardless of whether or not it mutates, any IgG that is not artificially modified in its natural state is called natural IgG.

[0092] An "agonist antibody" is an antibody that binds to and activates a receptor. An example of agonist antibody function is binding to receptors of the tumor necrosis factor receptor (TNFR) superfamily and inducing apoptosis in cells expressing the TNF receptor. Assays for measuring apoptosis-inducing function are described in WO98 / 51793 and WO99 / 37684, both of which are expressly incorporated herein by reference. In specific embodiments of the present invention, anti-CD40 agonist antibodies can enhance the anti-tumor immune response and indirectly kill tumor cells by binding to target molecules that transmit immune activation signals on the surface of immune cells and activating key immune activation signaling pathways regulated by them. Examples of some agonist antibodies that have entered clinical research are referred to in PCT / CN2017 / 087620.

[0093] "Agonist activity" refers to the activity of an antibody that binds to an antigen molecule, stimulating the antigen molecule to generate a signal and thereby inducing a specific change in its physiological activity. Antigen molecules include receptor molecules and other molecules that have signal transduction or physiological functions. The specific physiological activities mentioned above include, but are not limited to, proliferation activity, survival activity, differentiation activity, transcription activity, membrane transport activity, affinity, proteolytic activity, phosphorylation / dephosphorylation activity, redox activity, transfer activity, nucleolytic activity, dehydration activity, cell death induction activity, and apoptosis induction activity.

[0094] "Parent" refers to the engineered subject in the process of protein engineering. The parent may be a naturally occurring polypeptide, or a variant or engineered version of a naturally occurring polypeptide. In some examples, the parent Fc region described in the present invention is the Fc region of natural IgG.

[0095] In the context of protein engineering, a "variant" refers to a protein obtained by modifying a parent. Specifically, it may be a protein induced by mutation, deletion, and / or addition of parent amino acids, and which retains some or all of the functions inherent to the parent. The variant sequences herein preferably have at least about 80% identity with the parent sequence, most preferably at least about 90% identity, and more preferably at least about 95% identity. Thus, as used herein, an "Fc variant" refers to an Fc sequence that differs from a parent Fc sequence due to modification of at least one amino acid. An Fc variant may consist only of an Fc region, or it may exist in association with an antibody, an Fc fusion, isolated Fc, an Fc region, or other polypeptides substantially encoded by Fc. An Fc variant may refer to the Fc polypeptide itself, a composition containing an Fc variant polypeptide, or the amino acid sequence encoding it.

[0096] As used herein, the “tumor necrosis factor receptor superfamily” or “TNF receptor superfamily” refers to receptor polypeptides capable of binding to TNF family cytokines. Generally, these receptors are type I transmembrane receptors having one or more cysteine-rich duplicate sequences in their extracellular domain. Examples of cytokines within the TNF gene family include tumor necrosis factor-α (TNF-α), tumor necrosis factor-β (TNF-β or lymphotoxin), CD30 ligand, CD27 ligand, CD40 ligand, OX-40 ligand, 4-1BB ligand, Apo-1 ligand (also known as Fas ligand or CD95 ligand), Apo-2 ligand (also known as TRAIL), Apo-3 ligand (also known as TWEAK), osteoprotegerin (OPG), APRIL, RANK ligand (also known as TRANCE), and TALL-1 (also known as BlyS, BAFF, or THANK). Examples of receptors within the TNF receptor superfamily include type 1 tumor necrosis factor receptor (TNFR1), type 2 tumor necrosis factor receptor (TNFR2), p75 nerve growth factor receptor (NGFR), B cell surface antigen CD40, T cell antigen OX-40, Apo-1 receptor (Fas or CD95), Apo-3 receptor (DR3, sw1-1, also called TRAMP and LARD), receptors called "transmembrane activators and CAML interactors" or "TACI", BCMA proteins, DR4, DR5 (or, This includes Apo-2 (also known as TRAIL-R2, TR6, Tango-63, hAPO8, TRICK2, or KILLER), DR6, DcR1 (also known as TRID, LIT, or TRAIL-R3), DcR2 (also known as TRAIL-R4 or TRUNDD), OPG, DcR3 (also known as TR6 or M68), CAR1, HVEM (also known as ATAR or TR2), GITR, ZTNFR-5, NTR-1, TNFL1, CD30, lymphotoxin β receptor (LTBr), 4-1BB receptor, and TR9 (EP988, 371A1).

[0097] The "affinity ratio for inhibitory Fcγ receptors and activating Fcγ receptors" or "I / A ratio" described in the present invention is equal to the affinity value of the constant region of the antibody heavy chain for an inhibitory Fcγ receptor (e.g., human FcγRIIB) divided by the highest affinity value of the constant region of the antibody heavy chain for activating Fcγ receptors of the same species (e.g., including human FcγRI, FcγRIIA, FcγRIIIA, and FcγRIIIB).

[0098] The above-mentioned "affinity" refers to the strength of the binding ability between two molecules, which is usually measured by KD, and in this invention, it can also be measured by the enrichment ratio (as shown in Table 7) or the binding analysis signal (as shown in Figure 12). "KD" is the equilibrium dissociation constant at which two molecules (for example: a specific antibody and antigen, or a ligand and receptor) interact with each other. "Enrichment ratio" refers to the percentage of cells expressing an antibody containing a specific Fc mutation after sorting by the flow cytometry sorting method or magnetic bead sorting method provided in this invention, divided by the percentage of cells before sorting (analyzed by next-generation sequencing, shown in Table 7). "Binding analysis signal" is the absorbance value in the ELISA assay provided in this invention (shown in Figure 12).

[0099] A "human" antibody is an antibody whose variable region contains a frame region and a CDR region derived from a human germline immunoglobulin sequence. If the antibody contains a constant region, that region is also derived from a human germline immunoglobulin sequence. The human antibodies of this invention may contain amino acid residues not encoded by the human germline immunoglobulin sequence (for example, mutations introduced by in vitro random mutations or site-directed mutations, or in vivo somatic mutations). However, as used herein, the term "human antibody" is not intended to include antibodies obtained by grafting a CDR sequence derived from the germline of another mammalian species (such as a mouse) onto a human frame sequence. The terms "human" antibody and "fully human" antibody are used interchangeably.

[0100] The "antibodies" of this invention include, for example, antibodies that exist or do not exist in nature; monoclonal and polyclonal antibodies; chimeric and humanized antibodies; human or non-human antibodies; and fully synthetic antibodies.

[0101] A "humanized" antibody is an antibody in which some, most, or all of the amino acids, excluding the non-human antibody CDR domain, are replaced with corresponding amino acids derived from human immunoglobulin. In one embodiment of a humanized antibody, some, most, or all of the amino acids, excluding the CDR domain, are replaced with amino acids derived from human immunoglobulin, but some, most, or all of the amino acids in one or more CDR regions remain unchanged. Small additions, deletions, insertions, substitutions, or modifications to amino acids are acceptable as long as the antibody does not lose its ability to bind to a specific antigen. A "humanized" antibody retains antigen specificity similar to that of the original antibody.

[0102] A "chimeric antibody" is an antibody in which the variable region and the constant region originate from different species. For example, the variable region may originate from a mouse antibody, while the constant region originates from a human antibody.

[0103] The present invention will be further described below with reference to specific examples. It should be understood that these examples are not intended to limit the scope of the present invention, but are merely illustrative. Experimental methods in the following examples that do not specify particular conditions are usually carried out according to the usual conditions described in J. Sambrook et al., "Molecular Cloning: An Experimental Manual (New York: Cold Spring Harbor Laboratory Press, 1989)," or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts refer to weight percentages and parts by mass.

[0104] [Table 1] [Materials and Methods] [Construction of surface display vectors for mammals] The full-length light and heavy chain sequences of the human IgG2 anti-mouse CD40 antibody were constructed on the retroviral vector MIGRI (Addgene, Pear et al., Blood. 1998 Nov 15. 92(10):3780-92.) using the Multi One Step Pcr Cloning Kit (Shanghai EYSE Biotechnology Co., Ltd., China). The primers used are shown in Table 2, and the construction map is shown in Figure 1. After single digestion with restriction endonuclease BglII, the light and heavy chain DNA of the complete antibody were inserted and the middle was joined with a self-cleaving Linker P2A. However, the ends of the heavy chain DNA contained transmembrane domain DNA (the DNA sequences of each fragment are shown in Table 3). The plasmid expressed both the human IgG2 antibody and the GFP protein simultaneously. The amino acid sequences of the surface-display antibody and its associated Fc region are shown in Table 4. Successful construction was confirmed by sequencing.

[0105] [Table 2]

[0106] [Table 3]

[0107] [Table 4] [Construction of an Fc mutation library] In point mutation libraries, mutations are introduced via degenerate primers, and multiple degenerate primers are designed. For example, the degenerate primer used for the P233 site mutation is CCACCGTGCCCAGCACCANNSGTGGCAGGACCGTCAGTC (SEQ ID NO: 21). Mutation library fragments and the required ligation vectors were obtained by PCR, ligated using a One Step Pcr Cloning Kit (Shanghai EYSE Biotechnology Co., Ltd., China), transformed into DH5α, and obtained mutation libraries. Twenty colonies were selected from each library, sequenced, and confirmed whether the mutations were introduced at the target site.

[0108] The combinatorial mutation library method is similar, where primers are designed according to enriched mutation types obtained by screening the point mutation library, and intermediate degenerate primers are modified to primer sequences consisting of codons encoding specific amino acids, or degenerate codons encoding several amino acids, for example, L328W(TGCAAGGTCTCCAACAAAGGCTGGCCAGCCCCCATCGAGAAAAC,SEQ ID NO:22), Combine2_1(ACGTGCGTGGTGGTGGACKNGWBGVASRWSSACCHGGAGGTCCAGTTCAACTGG,SEQ ID NO:23).

[0109] The symbols other than the normal bases in the above primer sequences are degenerate bases: R is A / G, Y is C / T, M is A / C, K is G / T, S is G / C, W is A / T, H is A / T / C, B is G / T / C, V is G / A / C, D is G / A / T, and N is A / T / C / G.

[0110] [Construction of stable expression cell lines] The above library plasmid was mixed with the helper plasmid Phoenix-Eco (molar ratio 2:1) and the transfection reagent PEI (mass ratio 1:5). This mixture was added to pre-plated Phoenix cells (80% density), and after 6 hours, the medium was replaced with fresh medium. After 48 hours, the supernatant containing the retrovirus was collected. Using 50% of the above retrovirus supernatant and 50% fresh medium, 3T3 cells that had been pre-plated to 80% density were infected. After 24 hours, the medium was replaced, and after 48 hours, a stable cell line expressing the antibody was obtained.

[0111] [Analyze stable expression cell lines that express antibodies using flow cytometry] 3T3 cells were collected by trypsin treatment, and a single-cell suspension was prepared. Approximately 1-5 × 10⁶ cells were added to 50 μl of FACS buffer (1x PBS containing 0.5% FBS and 2 mM EDTA) containing PE-F(ab')2 fragment goat anti-human IgG (1:500, Jackson ImmunoResearch Laboratories) or Biotin-FcγRIIB (1 μg / ml, Yiqiao Shenzhou Co.) and Streptavidin-APC (1:500, BD Biosciences). 6 The cells were resuspended, incubated on ice for 15 minutes, washed twice with FACS buffer, resuspended in 200 μl of FACS buffer, and analyzed by flow cytometry.

[0112] [Flow cytometry sorting of cells with high affinity for FcγRIIB] Following the flow cytometry staining method described above, the staining system was amplified proportionally, and finally, cells were approximately 1-5 × 10⁶ 7 The cells were resuspended in cells / ml, transferred to a machine, and cells expressing IgG (strong PE fluorescence signal) and having high affinity for FcγRIIB (strong APC fluorescence signal) were selected, with their proportion controlled to less than 1% of the total IgG-positive cell count.

[0113] [Cells that have high affinity for FcγRIIB but low affinity for activated FcγR (high I / A ratio) are sorted using magnetic beads.] 3T3 cells were collected by trypsin treatment, and a single-cell suspension was prepared. Biotin-FcγRIIB (1 μg / ml, Yiqiao Shenzhou Co.) and activated FcγR (FcγRI, FcγRIIA) were added. 131H , FcγRIIA 131R FcγRIIIA 158V FcγRIIIA 158F Each of these is 1 μg / ml and contains approximately 1 x 10 units in 50 μl of MACS buffer (1 x PBS containing 0.5% BSA and 2 mMEDTA) including Shanghai Jin'an Technology Co., Ltd. 7 The cells were resuspended, incubated on ice for 15 minutes, washed twice with MACS buffer, resuspended in 100 μl of MACS buffer, 25 μl of anti-Biotin beads were added, incubated on ice for 15 minutes, washed once with MACS buffer, resuspended in 500 μl, added to an LS column placed in a magnetic field, the drained effluent was collected, washed with 3 ml of MACS buffer and collected, and finally the LS column was removed from the magnetic field. The cells retained on the sorting column were rapidly eluted using 5 ml of MACS buffer, and positive cells, i.e., cells with a high I / A ratio, were collected.

[0114] [High-throughput sequencing analysis] Approximately 0.1–5 × 10 of the target cell population 6 Individual cells are collected, lysed, genomic DNA is extracted, PCR is performed, a library is prepared for high-throughput sequencing (PE150 or PE250), approximately 60,000 to 300,000 sequences are obtained from each sample, nucleotide sequences of the mutant regions are extracted, and batch translation is performed to the corresponding amino acid sequences (http: / / www.cbs.dtu.dk / services / VirtualRibosome / ,Rasmus Wernersson.Nucl.Acids Res.2006 34:W385-W388), and the proportion of each mutant sequence in each sample is calculated: proportion of mutant sequences = number of mutant sequences / total number of sequences.

[0115] [Antibody Expression and Purification] Desired Fc variants or novel combinatorial variants were constructed in the heavy chain of anti-human OX40 antibodies using next-generation sequencing. These were transiently transfected into HEK293S cells along with the corresponding antibody light chains, the proteins were expressed, and different Fc variant antibodies were obtained by purification with Protein G. The antibodies were structurally intact, as detected by SDS-PAGE. The DNA and protein sequences of the anti-human OX40 antibodies are shown in Tables 5 and 6.

[0116] [Table 5]

[0117] [Table 6] The binding characteristics of mutant antibodies to FcγR are analyzed using enzyme-linked immunosorbent assay (ELISA). 100 μL of antibody or its variant at 2 μg / mL was added to an enzyme-conjugated plate, coated overnight, the supernatant was discarded, blocked with PBS containing 1% BSA for 2 hours, washed with PBST (PBS containing 0.05% Tween 20), and then FcγR extracellular domain protein (Beijing Yiqiao Shenzhou Biotechnology Co., Ltd.) marked with biotin at an appropriate concentration was added, incubated at room temperature for 1 hour, the supernatant was discarded, and washed with PBST. Streptavidin-HRP (BD Biotechnology) was added, incubated at room temperature for 1 hour, biotin protein was detected, the supernatant was discarded, chromogenic solution was added, and after 20-40 minutes of color development, the absorbance at 650 nm (A650) was measured.

[0118] [In vitro immunoactivation activity analysis of different antibody Fc variants of anti-human OX40 antibodies (promotion of T cell proliferation)] Humanized FCγR / OX40 mouse spleens were isolated, and a single-cell suspension of lysed red blood cells was prepared, marked with CFSE, and cells were measured in 5 × 10⁶ cells. 6Resuspend the cells in PBS containing 5 μM MCFSE at a concentration of 3 × 10⁻¹ / mL, incubate at 37°C for 15 minutes, wash twice with 600 g of PBS containing 5% FBS for 5 minutes each, then resuspend in primary cell culture medium (RPMI + 10% FBS + 1% Pen / Strep + 1% HEPES + 1% sodium pyruvate + 0.1% 2ME (final concentration 50 μM) + 1% L-glutamine + 1% non-essential amino acids) and adjust the cell concentration to 3 × 10⁻¹ / mL. 6 Prepare the solution by adding 100 μl of cell solution to each well, that is, 3 × 10⁶ cells per well. 5 The sample contained 100 μL of cells. The antibodies were diluted to concentrations of 2 μg / ml, 0.2 μg / ml, and 0.02 μg / ml, respectively, in primary cell culture medium containing 0.2 μg / ml anti-CD3. 100 μL of the antibody mixture prepared above was transferred to wells already containing CFSE-marked humanized FCγR / OX40 splenocytes. There were two control groups: the CD3-only group had CFSE-marked cells and anti-mouse CD3 added, but no other antibodies were added; the CD3+CD28 group had CFSE-marked cells and anti-mouse CD3 added, along with anti-mouse CD28 antibody (clone 37.51 (RUO), BD Pharmaceuticals) at a concentration of 2 μg / ml (final concentrations of anti-mouse CD3 and CD28 were 0.1 μg / ml and 1 μg / ml, respectively). The cells were incubated for 3 days in a 37°C, 5% CO2 constant temperature cell incubator. After the end of the culture, the cells were collected and analyzed for CD4 by flow cytometry. + and CD8 +Cell number and proliferation were detected. Flow cytometry to detect T cell proliferation: Cells cultured above were transferred to a 96-well U-bottom plate, washed twice with PBS, centrifuged at 500g for 5 minutes, the supernatant was discarded, and the cells were resuspended in 50 μl of FACS buffer (0.5% FBS, PBS containing 2 mM EDTA) containing PE anti-mouse CD4 (clone: ​​GK1.5, 1:500, BD) and APC anti-mouse CD8a (clone: ​​53-6.7, 1:500, BioLegend). After incubation on ice in the dark for 15 minutes, the cells were washed twice with PBS buffer, resuspended in 200 μl of FACS buffer containing DAPI (0.5 μg / ml, Invitrogen) and CountBrightAbsoluteCountingBeads (Life Technologies, 2 μl / sample), and analyzed by flow cytometry.

[0119] The present invention primarily provides antibody Fc variant sequences that enhance the interaction between human IgG2 and FcγRIIB. Simultaneously, the present invention also provides a method for screening and obtaining these variants, and as shown in Figure 2, Fc variants having specific affinity characteristics can be screened according to the method described above.

[0120] Furthermore, according to the screening methods provided in the present invention, those skilled in the art can screen for amino acid mutations that enhance various protein-protein interactions or protein-other molecular interactions; common screening methods include: 1) Provide the parent protein sequence, and introduce amino acid mutations into the parent protein sequence by PCR.

[0121] 2) Construct expression vectors with the parent protein and the mutated protein to create a mutation library.

[0122] 3) Transfect mammalian cells with the expression vector to express the parent protein and the mutated protein on the cell surface.

[0123] 4) The marker-tagged interacting protein is incubated with the mammalian cells, and the marked mammalian cells are sorted by flow cytometry or magnetic beads.

[0124] 5) Extract DNA from marked mammalian cells, perform sequencing, and analyze and compare the changes in sequence ratios before and after sorting; however, amino acid mutations in which the ratio after sorting is significantly higher than the ratio before sorting are amino acid mutations that can enhance the binding ability between the protein and interacting molecules.

[0125] Example 1: Construction of a human antibody IgG2_Fc point mutation library.

[0126] This invention involves selecting several sites on human IgG2_Fc_CH2, including P233-S239, V266-P271, S298-T299, and G327-I332 (Eu numbers, shown in Figure 3 and Table 4). The amino acids at these sites are subjected to single-site random mutations, resulting in a total of 20 amino acids at each site, including the wild type (A, R, D, C, Q, E, H, I, G, N, L, K, M, F, P, S, T, W, Y, V). Plasmid libraries of single-site random mutations corresponding to the four regions of human IgG2_Fc described above (Library1, Library2, Library3, Library4), and a mixed library of these four libraries (LibraryMix) were created.

[0127] Example 2: Analyze the cell enrichment status before and after sorting using flow cytometry.

[0128] After successfully constructing the plasmid libraries described above, retroviruses were prepared and used to infect 3T3 cells to obtain stable expression cell lines expressing these libraries. This invention utilizes flow cytometry sorting technology to sort cells that express human IgG2 (detectable by anti-human IgG F(ab')2) and bind to human FcγRIIB. As shown in Figure 4, flow cytometry sorting allows for the enrichment of cells with progressively higher binding affinity to FcγRIIB. When the human IgG2 library LibraryMix was sorted using a flow cytometry sorter and cells obtained from different rounds were analyzed separately, the percentage of FcγRIIB-bound cells detectable by flow cytometry increased after each round of sorting, reaching 0.90% in the first round and 22.2% in the second round, which are 2.65-fold and 65.29-fold increases, respectively, compared to 0.34% for wild-type human IgG2.

[0129] As shown in Figure 5, after two rounds of sorting, the percentage of FcγRIIB-bound cells in Library1, Library2, Library3, Library4, and LibraryMix, detectable by flow cytometry, all increased: reaching 1.85%, 16.3%, 0.57%, 2.19%, and 22.2%, respectively. Compared to 0.34% for wild-type human IgG2, these percentages increased 5.44 times, 47.94 times, 1.69 times, 6.44 times, and 65.29 times, respectively.

[0130] Example 3: Next-generation sequencing after flow cytometry sorting analyzes IgG2 Fc mutation types that show improved binding ability to FcγRIIB.

[0131] This invention selects mutations that increase the proportion of sequences before and after sorting by more than twice that of wild-type human IgG2 (enrichment factor / wild-type enrichment factor > 2), that is, mutation types of human IgG2 that are advantageous for improving binding ability to FcγRIIB (enrichment factor increased by at least 1 compared to the wild type), as shown in Table 7. For example, the proportion of L328W before sorting was 0.39%, the proportion after sorting was 12.84%, and the enrichment factor was 33.20, which is 22.21 times that of the wild type (1.49).

[0132] [Table 7] TIFF0007836088000008.tif197160 #1-3: The data in question is obtained from experiments in Library2 (#1), Library4 (#2), and LibraryMix (#3).

[0133] In addition to point mutations, the present invention also screened for several double mutation types, and the proportion of these amino acid mutations more than doubled compared to wild-type human IgG2 before and after flow cytometry sorting. Among these, the double mutation combinations (V266A / P271C or G, S267A / P271C or G, S267E / D270H, S267E / P271C or V or W or Y, S267E / S298R, S267M / P271C or G, P271A / S298R, P271G / G236V, P271G / G329S, P271G / P331C or T, P2 The increased ratio of mutations (e.g., 71G / S298D or E or G or K or L or N or R, P271G / T299A or M or S or W, G327A / A330R or V, G327A / I332A or C or E, L328E / I332T) was higher than that of any other point mutation, indicating that both amino acids in the mutation combination contribute to the improved binding ability of FcγRIIB. Furthermore, there was also a mutation combination such as S267V / S298L, and the multiplier of improvement in this combinatorial mutation was approximately equal to that of the S298L mutation, which showed a higher multiplier of improvement. This suggests that the improvement in this mutation combination is due solely to the contribution of this single site mutation, and that other point mutations have essentially no effect (see Table 8). Therefore, the Fc region, antibody, Fc fragment, or fusion protein of the present invention may include other possible combinations or modifications in addition to the amino acid mutations provided in the present invention.

[0134] [Table 8] a. The ratio of the concentration ratio of the mutant after sorting to the concentration ratio of the wild type. b. The ratio of the concentration ratio of the original point mutation-sorted mutant to the concentration ratio of the wild type. c. The ratio of the increase in combinatorial mutations to the increase in one of the point mutations within them. Example 4: Analyze favorable mutant types by next-generation sequencing after magnetic bead sorting.

[0135] In this invention, using magnetic bead sorting technology, high-affinity FcγRIIB cells obtained from the above-mentioned flow cytometry sorting are subsequently sorted, biotin-marked FcγRIIB and unmarked activated FcγR are mixed and incubated with the cells, then anti-biotin magnetic beads are used to sort the marked cells, and the enrichment ratio before and after sorting is analyzed by next-generation sequencing to screen for mutations with a high I / A ratio, as shown in Table 9. Method for selecting mutations: Mutations were selected in which the ratio before and after sorting increased to more than twice that of wild-type human IgG2, while the proportion of unbound magnetic bead portion (i.e., the effluent when passing through the LS column) in the sorting decreased.

[0136] [Table 9] TIFF0007836088000011.tif76168 NA indicates that no variant type corresponding to this row was detected in the samples in this column.

[0137] #1-#4: The data in question was obtained from two experiments (#3, #4) using Library2 (#1), Library4 (#2), and LibraryMix (#3).

[0138] Mutations in G236D, S239D (reported by Seung Y. Chu et al. (Molecular Immunology 45(2008)3926-3933)), and S298A (reported in patent US20090042291A1) can improve the affinity of human IgG1 to FcγRIIB. However, the results of next-generation sequencing analysis of the present invention showed that the proportion of IgG2 variants containing G236D or S298A mutations did not increase after sorting, but rather decreased (Table 10); the proportion of human IgG2 variants containing the S239D mutation was 0.026% before sorting and was not detected in the sequencing results after sorting. These results indicate that mutations in G236D, S239D, and S298A do not increase the FcγRIIB binding ability of human IgG2; see Table 10.

[0139] [Table 10] NA indicates that the variant type in this row was not detected in the experiment in this column, and therefore the percentage and magnification cannot be calculated.

[0140] Example 5: Amino acid mutations that can enhance FcγRIIB affinity in human IgG2 Fc polypeptide fragments.

[0141] Table 11 summarizes the amino acid mutations that can enhance FcγRIIB affinity, screened according to the point mutation library screening method of the present invention. As can be seen in comparison with previous patents, both sites S267G and P271C of the present invention are novel types of mutations in human IgG2 that can improve FcγRIIB binding ability. Sites H268S, L328A, and G327A are novel types of mutations in human IgG2 that can improve FcγRIIB binding ability while simultaneously having weaker affinity for other activating FcγRs than FcγRIIB.

[0142] [Table 11] Example 6: Construction of a human antibody IgG2_Fc combinatorial mutation library. Based on the Fc mutation types that can improve FcγRIIB affinity (mutations with enrichment ratios at least 1x higher than wild-type) screened using the aforementioned point mutation library and high-throughput sequencing results, two types of combinatorial mutation libraries were designed: Type 1: Single-point combinatorial mutations between four regions, i.e., 0-1 mutations in each of the four regions P233-V240, V266-P271, S298-T299, and G327-I332, resulting in a total of 0-4 combinatorial mutations; Type 2: Combinatorial mutations of multiple amino acids within a single region, i.e., combinatorial mutations of amino acids within each of the four regions P233-V240, V266-P271, S298-T299, and G327-I332 (0-7, 0-6, 0-2, and 0-6 combinatorial mutations, respectively), as shown in Figure 6. Plasmid library size is up to 4.67 × 10⁶ 5 That was the case.

[0143] Example 7: Cell enrichment status of combinatorial mutation library before and after flow cytometry sorting. Based on point mutation libraries and high-throughput sequencing results, combinatorial mutation libraries of type 1 and type 2 were constructed (Example 6), and cell libraries expressing combinatorial mutations were obtained. Cells with high affinity for FcγRIIB were then sorted sequentially in 2-3 rounds. As shown in Figure 7, after 2 rounds of sorting, the percentage of cells bound to FcγRIIB in libraries IgG2_C01 and IgG2_C02 increased, reaching 9.53% and 26.9%, respectively, as detected by flow cytometry. Compared to 0.23% for wild-type human IgG2, the ratios increased 41.43 times and 116.96 times, respectively. However, IgG2_C01 is a combinatorial mutation (Type I) library with a maximum of one mutation in each of the four regions: P233-V240, V266-P271, S298-T299, and G327-I332; IgG2_C02 is a cell library obtained by combining a combinatorial mutation (Type II) library with consecutive mutations in the same four regions: P233-V240, V266-P271, S298-T299, and G327-I332, and introducing them together into 3T3 cells.

[0144] As shown in Figure 8, after two rounds of sorting, the binding ability of library Cmix and library C2 cells to FcγRIIB increased significantly, as detected by flow cytometry, and the percentage of cells bound to FcγRIIB increased substantially after each round of sorting: after round 1 and round 2 sorting, the percentage of cells bound to FcγRIIB in Cmix reached 1.86% and 28.9%, respectively, an increase of 246.03 times and 3822.75 times, compared to 0.00756% before sorting; in Cmix, it reached 6.46% and 28.9%, respectively, an increase of 718.58 times and 3214.68 times, compared to 0.00899% before sorting. Library Cmix is ​​a combinatorial mutation (type 1) library with a maximum of one mutation in each of the four regions; library C2 is a combinatorial mutation (type 2) library in the V266-P271 region.

[0145] Example 8: Next-generation sequencing after flow cytometry sorting analyzes IgG2 Fc combinatorial mutation types that show improved binding ability to FcγRIIB.

[0146] To screen for IgG2Fc combinatorial mutation types with improved binding to FcγRIIB, the combinatorial mutation library constructed in this invention was flow-cytometry-sorted to obtain cells with high binding affinity to FcγRIIB. Next-generation sequencing was then used to analyze the enrichment ratio of each mutation type before and after sorting, and the results are shown in Table 12. All selected mutations were either enriched at a high ratio (after / before the final round of sorting), significantly enriched in at least one round of sorting (after / before the current round of sorting), or detected only after the final round. For example, the enrichment ratio of V266L / S298L / L328W is 21920.33 times that of the wild type (after sorting in the final round / before sorting); the enrichment ratio of point variant L328W is 8.78 times that of the wild type (after sorting in the final round / before sorting); the enrichment ratios of H268D / S298L / L328W are 43.98 (after sorting in round 2 / before sorting in round 2) and 5.95 (after sorting in round 3 / before sorting in round 3), respectively; the enrichment ratio of V234M / S267E / S298L / L328W is 5.13 (after sorting in round 3 / before sorting in round 3); V234Q / A235G / P238L / S239V / G327A / L328E / A330S / I332T were detected only after the final round.

[0147] [Table 12] TIFF0007836088000015.tif218165 #1-4: The data is obtained from experiments with libraries IgG2_C01 (#1), IgG2_C02 (#2), Cmix (#3), and C2 (#4). NA indicates that the variant type corresponding to this row was not detected in the samples in this column.

[0148] Example 9: The binding characteristics of mutant antibodies to FcγR are analyzed by enzyme-linked immunosorbent assay (ELISA). Based on favorable Fc single-point mutations and mutation combinations screened by next-generation sequencing, novel combinations of Fc mutations were constructed. Anti-human OX40 antibodies containing these novel combinations of Fc mutations were expressed, and the binding characteristics of the mutant antibodies to FcγR were analyzed by enzyme-linked immunosorbent assay (ELISA). Figure 9-14 shows FcyRI and FcyRIIA of different Fc variants. 131H , FcyRIIA 131R FcyRIIB, FcyRIIIA 158F , and FcyRIIIA 158V The binding ability to FcγRIIB was demonstrated. The binding ability of IgG1 to each FcγR was set to 1, and the relative binding ability of each mutant to these FcγRs (ELISA absorbance of the variant bound to the FcγR divided by the ELISA absorbance of IgG1 bound to the FcγR) and the increase in the FcγRIIB binding ability of each mutant compared to wild-type IgG2 (ELISA absorbance of the variant bound to FcγRIIB divided by the ELISA absorbance of wild-type IgG2 bound to FcγRIIB) were calculated. As shown in Table 13, the increase in FcγRIIB binding ability of each mutant compared to wild-type IgG2 ranged from 4.23 to 25.55 times. Furthermore, the FcγRIIB and FcγRIIA of each mutant were also analyzed. 131R The ratio of binding ability to IgG2 (RIIB / RIIAR) was calculated (Table 13), and the RIIB / RIIAR ratios of all these mutants were higher than those of wild-type IgG2 (wild-type IgG2: 0.34; mutants: 0.46-3.67).

[0149] [Table 13] TIFF0007836088000017.tif120168 Note: In the table, RI, RIAH, RIIAR, RIIB, RIIIAF, and RIIIAV are FcγRI and FcγRIIA, respectively. 131H , FcγRIIA 131R , FcγRIIB, FcγRIIIA 158F FcγRIIIA 158V It represents.

[0150] Example 10: Favorable mutations support stronger immune activation activity. The immunoactivating activity of anti-human OX40 antibodies containing the above-mentioned advantageous mutations (Example 9) in FCγR / OX40 humanized mouse spleen cells was analyzed. Figures 16 and 17 show the CFSE fluorescence intensity of CD4+ cells and corresponding histograms at an antibody concentration of 1 μg / ml. Lower values ​​indicate stronger activity, and the activity of all selected antibodies was superior to that of wild-type IgG2. The activity values ​​at different antibody concentrations in the two experiments were analyzed together. The activity when only αCD3 antibody was added was set to 0, and the activity when αCD3 antibody and αCD28 antibody were added as positive controls was set to 1. The relative activity of each mutant antibody was calculated, and the average value was calculated. Table 14 shows that the activity of all 30 selected mutant antibodies was superior to that of wild-type IgG2, with activity increasing 9.17 to 16.51 times compared to the wild type.

[0151] [Table 14] TIFF0007836088000019.tif63166 NA indicates that the mutant antibody in this row did not perform the experiment in this column.

[0152] Example 11: Based on the effects of known mutations on the FcγR binding ability of IgG1, it is not possible to directly predict their effects on the FcγR binding ability of IgG2.

[0153] Mutations in G236D, S239D (reported by Seung Y. Chu et al. (Molecular Immunology 45(2008)3926-3933)), and S298A (reported in patent US20090042291A1) can improve the affinity of human IgG1 to FcγRIIB. However, the results of next-generation sequencing analysis of the present invention showed that the proportion of IgG2 variants containing G236D or S298A mutations did not increase after sorting, but rather decreased (Table 10); the proportion of human IgG2 variants containing the S239D mutation was 0.026% before sorting and was not detected in the sequencing results after sorting. These results indicate that mutations in G236D, S239D, and S298A do not increase the FcγRIIB binding ability of human IgG2; see Table 10.

[0154] Furthermore, by introducing the V11 mutation site into IgG2, which can significantly improve the FcγRIIB binding ability of IgG1 (G237D / P238D / H268D / P271G / A330R) (F. Mimoto et al., Protein Engineering, Design & Selection vol.26 no.10 pp.589-598, 2013), IgG2_M2 (H268D / P271G), IgG2_M3 (H268D / P271G / A330R), IgG2_M4 (G236D / P238D / H268D / P271G), and IgG2_M5 (G236D / P238D / H268D / P271G / A330R) were obtained, where the M5 mutation in IgG2 corresponds to the mutation in IgG1V11. The ELISA results in Figure 15 showed that these mutants did not confer FcγRIIB binding ability to IgG2, similar to IgG1V11. Therefore, based on the effects of known mutations on IgG1's FcγR binding ability, it is not possible to directly predict their effects on IgG2's FcγR binding ability.

[0155] All references cited in this application are cited and referred to in this application so as to be cited alone by reference. It should be understood that, based on the above disclosure of the present invention, those skilled in the art may make various changes or modifications to the invention, and these equivalent forms are also included within the scope defined in the claims attached to this application.

Claims

1. A mutant Fc polypeptide fragment, (i) The mutant Fc polypeptide fragment has a mutation at L328 compared to the wild-type IgG2 Fc polypeptide fragment of SEQ ID NO: 20, and the mutant Fc polypeptide fragments are L328W, L328Y, L328M, L328P, L328N, L328G, L328V, L328A, L328E / I332T, V266L / L328W, V266L / S298L / L328W, H268D / S298L / L328W, S267V / S298L / L328W, S239V / V26 The mutant has mutations selected from the group consisting of 6L / S298L / L328W, A235W / V266L / S298L / L328W, P233F / V266L / S298L / L328W, S267V / S298G / L328W, V234M / S267E / S298L / L328W, V234Q / A235G / P238L / S239V / G327A / L328E / A330S / I332T, and all amino acid numbers are based on IgG Eu numbers; and (ii) A mutant Fc polypeptide fragment characterized by improved affinity for FcγRIIB compared to the wild-type IgG2 Fc polypeptide fragment of SEQ ID NO:

20.

2. A mutant immunoglobulin Fc region characterized by comprising the mutant Fc polypeptide fragment described in claim 1.

3. The mutant immunoglobulin Fc region according to claim 2, characterized in that the mutant immunoglobulin Fc region enhances the agonist activity of the antibody.

4. An antibody characterized by comprising a mutant Fc polypeptide fragment as described in claim 1, or a mutant immunoglobulin Fc region as described in claim 2 or 3.

5. A fusion protein characterized by comprising a mutant Fc polypeptide fragment as described in claim 1, a mutant immunoglobulin Fc region as described in claim 2 or 3, or an antibody as described in claim 4.

6. An isolated polynucleotide characterized by encoding a mutant Fc polypeptide fragment as described in claim 1, a mutant immunoglobulin Fc region as described in claim 2 or 3, an antibody as described in claim 4, or a fusion protein as described in claim 5.

7. A vector characterized by comprising the isolated polynucleotide described in claim 6.

8. A vector comprising the vector described in claim 7, or incorporating the polynucleotide described in claim 6 into its genome; Alternatively, an isolated host cell characterized by expressing a mutant Fc polypeptide fragment as described in claim 1, a mutant immunoglobulin Fc region as described in claim 2 or 3, an antibody as described in claim 4, or a fusion protein as described in claim 5.

9. (a) the antibody described in claim 4, or the fusion protein described in claim 5; and (b) A drug composition comprising a pharmaceutically acceptable carrier.

10. A method for producing a mutant Fc polypeptide fragment according to claim 1, a mutant immunoglobulin Fc region according to claim 2 or 3, an antibody according to claim 4, or a fusion protein according to claim 5, (i) Culturing the host cells described in claim 8 under appropriate conditions to obtain a culture containing the mutant Fc polypeptide fragment, the mutant immunoglobulin Fc region, the antibody, or the fusion protein; and (ii) A method comprising the step of purifying and / or isolating the culture obtained in step (i) to obtain the mutant Fc polypeptide fragment, mutant immunoglobulin Fc region, antibody, or fusion protein.

11. For the preparation of drug compositions to alleviate tumors, inflammation and / or autoimmune symptoms, The antibody according to claim 4, The fusion protein according to claim 5, Polynucleotides encoding the antibody or the fusion protein, A vector containing the aforementioned polynucleotide, or Use of host cells that express the aforementioned antibody, express the aforementioned fusion protein, contain the aforementioned vector, or incorporate the aforementioned polynucleotide into the cell genome.

Images