Pharmaceutical composition for the treatment of amyotrophic lateral sclerosis

Abstract

[Problem] To provide a novel pharmaceutical composition for the treatment of ALS, containing as an active ingredient an anti-EphA4 antibody capable of binding to EphA4 and promoting the cleavage of EphA4. [Solution] A pharmaceutical composition for the treatment of ALS that includes an anti-EphA4 antibody, the anti-EphA4 antibody including a heavy chain that includes a heavy chain CDR1 comprising the amino acid sequence shown in SEQ ID NO: 44, a heavy chain CDR2 comprising the amino acid sequence shown in SEQ ID NO: 27, and a heavy chain CDR3 comprising the amino acid sequence shown in SEQ ID NO: 28 and a light chain that includes a light chain CDR1 comprising the amino acid sequence shown in SEQ ID NO: 29, a light chain CDR2 comprising the amino acid sequence shown in SEQ ID NO: 30, and a light chain CDR3 comprising the amino acid sequence shown in SEQ ID NO: 31.

Description

[Technical Field]

[0001] This disclosure relates to a pharmaceutical composition for treating amyotrophic lateral sclerosis (ALS), comprising an antibody that binds to EphA4. [Background technology]

[0002] EphA4 is a member of the receptor tyrosine kinase family. Ephrin type A and type B are known ligands for EphA4, and when EphA4 binds to its ligand, ephrin, a disattachment signal is induced. EphA4 is expressed in motor neurons, and in the spinal cord during neural circuit formation, the expression of ephrin in the non-projection regions of motor neurons controls accurate axonal guidance. EphA4 is known to be cleaved in a neuronal activity-dependent manner by matrix metalloproteinases (MMPs), ADAM (a disintegrin and metalloproteinase), and γ-secretase.

[0003] Previous studies have suggested that inhibiting EphA4 function is an effective treatment for neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) and Alzheimer's disease, as well as spinal cord injury.

[0004] EphA4 has been reported to be a gene that regulates the phenotype of ALS (Patent Document 1, Non-Patent Document 1). Studies have shown that genetic deficiency of EphA4 or antagonistism by EphA4-Fc, etc., promotes axonal elongation and functional recovery in mice and rats after spinal cord injury (Non-Patent Document 2 and Non-Patent Document 3).

[0005] Existing EphA4 inhibitors include KYL peptide and compound 1 (Patent Document 1, Non-Patent Document 1, and Non-Patent Document 2). Antibodies that inhibit the binding of EphA4 to its ligand are also known (Patent Document 2 and Patent Document 3), but there have been no reports to date of antibodies that promote the cleavage of EphA4. [Prior art documents] [Patent Documents]

[0006] [Patent Document 1] WO2012 / 156351A1 [Patent Document 2] WO2016 / 019280A1 [Patent Document 3] WO2017 / 043466A1 [Non-patent literature]

[0007] [Non-Patent Document 1] Van Hoecke et al., Nature Medicine, vol18: 1418-1422,2012 [Non-Patent Document 2] Goldshmit et al., PLoS one, vol6:e24636,2011 [Non-Patent Document 3] Spanevello et al., Journal of Neurotrauma,vol30:1023-1034,2013 [Overview of the project] [Problems that the invention aims to solve]

[0008] This disclosure aims to provide a novel pharmaceutical composition for the treatment of ALS. [Means for solving the problem]

[0009] As a result of intensive research to solve the above problems, the present inventors have obtained an antibody effective for the treatment of ALS that binds to EphA4 and promotes the cleavage of EphA4.

[0010] This disclosure includes the following features. (1) A pharmaceutical composition for treating amyotrophic lateral sclerosis (ALS) containing an anti-EphA4 antibody, where the anti-EphA4 antibody (a) a heavy-chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 44; (b) a heavy-chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 27; and (c) a heavy chain containing a heavy-chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 28; and (d) a light-chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 29; (e) a light-chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 30; and (f) a light chain containing a light-chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 31 including a pharmaceutical composition.

[0011] (2) The pharmaceutical composition according to (1), where the anti-EphA4 antibody is humanized, a pharmaceutical composition.

[0012] (3) The pharmaceutical composition according to (1) or (2), where the anti-EphA4 antibody specifically binds to EphA4 and promotes the cleavage of EphA4, a pharmaceutical composition.

[0013] (4) The pharmaceutical composition according to any one of (1) to (3), where the anti-EphA4 antibody specifically binds to EphA4 and inhibits the binding of EphA4 and ephrin, a pharmaceutical composition.

[0014] (5) The pharmaceutical composition according to any one of (1) to (4), The heavy chain includes a variable region consisting of the amino acid sequence shown in SEQ ID NO: 45. The light chain includes a variable region consisting of the amino acid sequence shown in Sequence ID No. 46. Pharmaceutical composition.

[0015] (6) A pharmaceutical composition according to any of (1) to (5), The constant region of the heavy chain and the constant region of the light chain include an amino acid sequence derived from a human antibody. Pharmaceutical composition.

[0016] (7) A pharmaceutical composition as described in (6), The constant region of the heavy chain is the constant region of human IgG. Pharmaceutical composition.

[0017] (8) A pharmaceutical composition as described in (7), The constant region of human IgG is the constant region of human IgG2. Pharmaceutical composition.

[0018] (9) A pharmaceutical composition as described in (8), The constant region of the aforementioned human IgG2 includes the amino acid sequence shown in SEQ ID NO: 47. Pharmaceutical composition.

[0019] (10) A pharmaceutical composition according to any of (6) to (9), The constant region of the light chain is the constant region of human Igκ. Pharmaceutical composition.

[0020] (11) A pharmaceutical composition as described in (10), The constant region of the aforementioned human Igκ includes the amino acid sequence shown in SEQ ID NO: 48. Pharmaceutical composition.

[0021] (12) A pharmaceutical composition for treating amyotrophic lateral sclerosis (ALS), comprising an anti-EphA4 antibody, The anti-EphA4 antibody comprises a heavy chain and a light chain. The heavy chain comprises the amino acid sequence shown in Sequence ID No. 59, The light chain comprises the amino acid sequence shown in SEQ ID NO: 60, The C-terminal lysine of the heavy chain may be deleted. Pharmaceutical composition.

[0022] (13) A pharmaceutical composition as described in (12), The C-terminal lysine of the aforementioned heavy chain is deleted. Pharmaceutical composition.

[0023] (14) A pharmaceutical composition for treating amyotrophic lateral sclerosis (ALS), comprising an anti-EphA4 antibody, The anti-EphA4 antibody comprises a heavy chain and a light chain. The heavy chain comprises the amino acid sequence shown in Sequence ID No. 59, The light chain comprises the amino acid sequence shown in Sequence ID No. 60. Pharmaceutical composition.

[0024] (15) A pharmaceutical composition for treating amyotrophic lateral sclerosis (ALS), comprising an anti-EphA4 antibody, The anti-EphA4 antibody comprises a heavy chain and a light chain. The heavy chain comprises the amino acid sequence shown in Sequence ID No. 59, The light chain comprises the amino acid sequence shown in SEQ ID NO: 60, The C-terminal lysine of the aforementioned heavy chain is deleted. Pharmaceutical composition.

[0025] (16) A pharmaceutical composition according to any of (1) to (15), Further comprising at least one pharmaceutically acceptable carrier, Pharmaceutical composition.

[0026] (17) Anti-EphA4 antibody, The aforementioned anti-EphA4 antibody is (a) Heavy chain CDR1 consisting of the amino acid sequence shown in Sequence ID No. 44; (b) Heavy chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO. 27; and (c) A heavy chain containing the heavy chain CDR3 having the amino acid sequence shown in SEQ ID NO. 28; and (d) Light chain CDR1 consisting of the amino acid sequence shown in Sequence ID No. 29; (e) Light chain CDR2 consisting of the amino acid sequence shown in Sequence ID No. 30; and (f) Light chain containing CDR3, which has the amino acid sequence shown in Sequence ID No. 31 including, Anti-EphA4 antibody.

[0027] (18) The anti-EphA4 antibody described in (17), The aforementioned anti-EphA4 antibody is humanized. Anti-EphA4 antibody.

[0028] (19) An anti-EphA4 antibody as described in (17) or (18), The aforementioned anti-EphA4 antibody specifically binds to EphA4 and promotes the cleavage of EphA4. Anti-EphA4 antibody.

[0029] (20) An anti-EphA4 antibody as described in any of (17) to (19), The aforementioned anti-EphA4 antibody specifically binds to EphA4 and inhibits the binding of EphA4 to ephrin. Anti-EphA4 antibody.

[0030] (21) An anti-EphA4 antibody as described in any of (17) to (20), The heavy chain includes a variable region consisting of the amino acid sequence shown in SEQ ID NO: 45. The light chain includes a variable region consisting of the amino acid sequence shown in Sequence ID No. 46. Anti-EphA4 antibody.

[0031] (22) An anti-EphA4 antibody as described in any of (17) to (21), The constant region of the heavy chain and the constant region of the light chain include an amino acid sequence derived from a human antibody. Anti-EphA4 antibody.

[0032] (23) The anti-EphA4 antibody described in (22), The constant region of the heavy chain is the constant region of human IgG. Anti-EphA4 antibody.

[0033] (24) The anti-EphA4 antibody described in (23), The constant region of human IgG is the constant region of human IgG2. Anti-EphA4 antibody.

[0034] (25) The anti-EphA4 antibody described in (24), The constant region of the aforementioned human IgG2 includes the amino acid sequence shown in SEQ ID NO: 47. Anti-EphA4 antibody.

[0035] (26) An anti-EphA4 antibody as described in any of (22) to (25), The constant region of the light chain is the constant region of human Igκ. Anti-EphA4 antibody.

[0036] (27) The anti-EphA4 antibody described in (26), The constant region of the aforementioned human Igκ includes the amino acid sequence shown in SEQ ID NO: 48. Anti-EphA4 antibody.

[0037] (28) Anti-EphA4 antibody, The anti-EphA4 antibody comprises a heavy chain and a light chain. The heavy chain comprises the amino acid sequence shown in Sequence ID No. 59, The light chain comprises the amino acid sequence shown in SEQ ID NO: 60, The C-terminal lysine of the heavy chain may be deleted. Anti-EphA4 antibody.

[0038] (29) The anti-EphA4 antibody described in (28), The C-terminal lysine of the aforementioned heavy chain is deleted. Anti-EphA4 antibody.

[0039] (30) Anti-EphA4 antibody, The anti-EphA4 antibody comprises a heavy chain and a light chain. The heavy chain comprises the amino acid sequence shown in Sequence ID No. 59, The light chain comprises the amino acid sequence shown in Sequence ID No. 60. Anti-EphA4 antibody.

[0040] (31) Anti-EphA4 antibody, The anti-EphA4 antibody comprises a heavy chain and a light chain. The heavy chain comprises the amino acid sequence shown in Sequence ID No. 59, The light chain comprises the amino acid sequence shown in SEQ ID NO: 60, The C-terminal lysine of the aforementioned heavy chain is deleted. Anti-EphA4 antibody.

[0041] (32) An anti-EphA4 antibody as described in any of (17) to (31) for use in the treatment of amyotrophic lateral sclerosis (ALS).

[0042] (33) A method for treating amyotrophic lateral sclerosis (ALS), comprising administering a therapeutically effective amount of an anti-EphA4 antibody described in any of (17) to (31) to a patient in need thereof.

[0043] (34) Use of an anti-EphA4 antibody according to any of (17) to (31) for the manufacture of a pharmaceutical composition for the treatment of amyotrophic lateral sclerosis (ALS).

[0044] (35) Use of the anti-EphA4 antibody described in (34), The pharmaceutical composition comprises at least one pharmaceutically acceptable carrier. Use of anti-EphA4 antibody.

[0045] (36) A therapeutic agent for amyotrophic lateral sclerosis (ALS) comprising an anti-EphA4 antibody as described in any of (17) to (31). [Effects of the Invention]

[0046] The present disclosure provides a novel pharmaceutical composition for treating ALS. The pharmaceutical composition contains as an active ingredient an anti-EphA4 antibody that can bind to EphA4 and promote the cleavage of EphA4. [Brief explanation of the drawing]

[0047] [Figure 1] Figure 1 shows the binding affinity of the anti-EphA4 monoclonal antibody (Antibody A) to mouse and human EphA4. [Figure 2] Figure 2 shows the EphA4 cleavage-promoting activity of the anti-EphA4 monoclonal antibody (antibody A) using hippocampal neurons. [Figure 3] Figure 3 shows the mouse EphA4-mouse ligand binding inhibitory activity of the anti-EphA4 monoclonal antibody (Antibody A). [Figure 4] Figure 4 shows the human EphA4-human ligand binding inhibitory activity of the anti-EphA4 monoclonal antibody (Antibody A). [Figure 5] Figure 5 shows the selectivity of the anti-EphA4 monoclonal antibody (antibody A) for each human Eph receptor. [Figure 6] Figure 6 shows the selectivity of the anti-EphA4 monoclonal antibody (Antibody A) for each mouse Eph receptor. [Figure 7] Figure 7 shows the reactivity of the anti-EphA4 monoclonal antibody (Antibody A) against mouse, rat, monkey, and human EphA4. [Figure 8] Figure 8 shows the reactivity of the anti-EphA4 monoclonal antibody (Antibody A) to the human EphA4 extracellular domain (ECD), ligand-binding domain (LBD), fibronectin type III domain 1 (FN1), and fibronectin type III domain 2 (FN2). [Figure 9] Figure 9 shows the effect of anti-EphA4 monoclonal antibody (antibody A) on increasing the number of spines in hippocampal neurons. [Figure 10A]Figure 10A shows the amino acids of the EphA4-Ligand Binding Domain (EphA4-LBD) on the horizontal axis and the structural region of antibody A-Fab on the vertical axis. The black bits indicate the intersections of combinations where interactions exist. [Figure 10B] Figure 10B shows the surface structure of the EphA4-Ligand Binding Domain (EphA4-LBD). In Figure 10B, the amino acid names and residue numbers included in the binding region are shown at their corresponding positions, and the CDRs of the H chain and L chain of the binding antibody A-Fab are shown as ribbon models. [Figure 11] Figure 11 shows the affinity of the humanized anti-EphA4 monoclonal antibody (Antibody B) for human EphA4. [Figure 12] Figure 12 shows the EphA4 cleavage-promoting activity of the humanized anti-EphA4 monoclonal antibody (antibody B) in hippocampal neurons. [Figure 13] Figure 13 shows the human EphA4-human ligand binding inhibitory activity of the humanized anti-EphA4 monoclonal antibody (Antibody B). [Figure 14] Figure 14 shows the mouse EphA4-mouse ligand binding inhibitory activity of the humanized anti-EphA4 monoclonal antibody (antibody B). [Figure 15] Figure 15 shows the selectivity of the humanized anti-EphA4 monoclonal antibody (antibody B) for the human Eph receptor. [Figure 16] Figure 16 shows the selectivity of the humanized anti-EphA4 monoclonal antibody (antibody B) for the mouse Eph receptor. [Figure 17] Figure 17 shows the reactivity of the humanized anti-EphA4 monoclonal antibody (Antibody B) against mouse, rat, monkey, and human EphA4. [Figure 18] Figure 18 shows the reactivity of the humanized anti-EphA4 monoclonal antibody (Antibody B) to the human EphA4 extracellular domain (ECD), ligand-binding domain (LBD), fibronectin type III domain 1 (FN1), and fibronectin type III domain 2 (FN2). [Figure 19]Figure 19 shows the effect of humanized anti-EphA4 monoclonal antibody (antibody B) on increasing the number of spines in hippocampal neurons. [Figure 20] Figure 20 shows the human EphA4 cleavage-promoting activity of the humanized anti-EphA4 monoclonal antibody (antibody B) in hippocampal neurons. [Figure 21] Figure 21 shows the effect of humanized anti-EphA4 monoclonal antibody (antibody B) on increasing the number of spines in hippocampal neurons via MMP and ADAM. [Figure 22] Figure 22 shows a schematic diagram of the evaluation system implemented in Example 13. [Figure 23] Figure 23 shows the effect of a humanized anti-EphA4 monoclonal antibody (antibody B) on human iPS cell-derived motor neuron death induced by mutant human SOD1 (G93A) expressing astrocytes. [Modes for carrying out the invention]

[0048] The regions identified or coded by the sequence numbers used herein are as follows: JPEG0007839108000001.jpg177153

[0049] The anti-EphA4 antibody relating to this disclosure is an antibody capable of recognizing and binding to EphA4. As described below, the antibody may be an intact antibody or a synthetic antibody (e.g., recombinant antibody, chimeric antibody, humanized antibody, etc.) as long as it has binding affinity to EphA4. In this specification, EphA4 can be understood to refer to EphA4 derived from humans, mice, rats, and monkeys. EphA4 derived from humans, mice, rats, and monkeys can be obtained from public databases where sequence information is registered, such as Genbank provided by the National Center for Biotechnology Information. In addition, it is possible to obtain sequence information of the EphA4 gene by designing primers based on the nucleotide sequence information of EphA4 from closely related animal species and cloning from RNA extracted from the desired animal species. For example, the nucleotide sequence information for human, mouse, rat, and monkey EphA4 is registered in the database as Genbank Accession No. NM_004438.5, NM_007936.3, NM_001162411.1, and NM_001260870.1, respectively.

[0050] In one embodiment, an anti-EphA4 antibody is an antibody that specifically binds to EphA4. The term “specific binding” is well known to those skilled in the art, and methods for determining the specific binding of an antibody or its antigen-binding fragment to an antigen or epitope are also well known. In one embodiment, “specific binding” is understood to mean that the anti-EphA4 antibody can bind to EphA4 by immunological reaction with greater binding affinity and binding activity, more rapidly, and / or for a longer duration than it would to bind to other target molecules. This does not mean that an antibody that specifically binds to EphA4 will not bind to other target molecules. In another embodiment, “specific binding” means that the antibody binds to EphA4 at least about 10 -7 M, or at least about 10 -8 M, or at least about 10 -9This can be demonstrated by antibodies with a KD of M or less. In yet another embodiment, “specific binding” is understood to be binding to EphA4 by immunological reaction but substantially not to other family molecules of the Eph receptor.

[0051] In one embodiment, the anti-EphA4 antibody is an antibody that binds to the extracellular domain of EphA4. In one embodiment, the anti-EphA4 antibody is an antibody that binds to the ligand-binding domain (LBD) of the extracellular domain of EphA4.

[0052] In one embodiment, an anti-EphA4 antibody can specifically bind to EphA4 and promote its cleavage. In a specific embodiment, an anti-EphA4 antibody can specifically bind to EphA4 and promote the cleavage of the extracellular domain of EphA4 by matrix metalloproteinases (MMPs) and ADAM (a disintegrin and metalloproteinase).

[0053] In one embodiment, an anti-EphA4 antibody can specifically bind to EphA4 and inhibit the binding of EphA4 to its ligand, ephrin.

[0054] In another embodiment, an anti-EphA4 antibody can specifically bind to EphA4 and increase the number of spines in hippocampal neurons or stabilize spines in hippocampal neurons.

[0055] In another embodiment, an anti-EphA4 antibody can protect motor neurons from cell death caused by SOD1 gene abnormalities.

[0056] This disclosure includes, in one embodiment, an anti-EphA4 antibody that can specifically bind to at least one of human EphA4, mouse EphA4, rat EphA4, and monkey EphA4 and inhibit its binding to its ligand. This disclosure includes, in another embodiment, an anti-EphA4 antibody that can specifically bind to two or more of human EphA4, mouse EphA4, rat EphA4, and monkey EphA4 and inhibit their binding to their ligand. This disclosure includes, yet another embodiment, an anti-EphA4 antibody that can specifically bind to all of human EphA4, mouse EphA4, rat EphA4, and monkey EphA4 and inhibit their binding to their ligand.

[0057] Methods for measuring the binding characteristics of anti-EphA4 antibodies to antigens (e.g., binding affinity and species cross-reactivity) may be those known to those skilled in the art. For example, binding affinity may be measured using, but is not limited to, Biacore® biosensors, KinExA biosensors, scintillation proximity assays, ELISA, ORIGEN immunoassay (IGEN), flow cytometry, fluorescence quenching, fluorescence transfer, yeast display, and / or immunostaining. The neutralizing activity of anti-EphA4 antibodies against the binding of EphA4 and its ligands may be measured using, but is not limited to, Biacore® biosensors, ELISA, and / or flow cytometry.

[0058] The anti-EphA4 antibody relating to this disclosure may be a monoclonal antibody, insofar as it binds to EphA4.

[0059] The anti-EphA4 antibody relating to this disclosure may be any class such as IgG, IgA, or IgM (or their subclasses), and is not limited to any particular class. Immunoglobulins are classified into different classes based on the antibody amino acid sequence of the constant region of the heavy chain (sometimes called the H chain). There are five main classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, some of which can be further subdivided into subclasses (isotypes) such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The corresponding constant regions of the heavy chains of different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively. In addition, there are λ chains and κ chains in the light chains (sometimes called the L chains) of antibodies. The anti-EphA4 antibody relating to this disclosure may be an IgG antibody, for example, an IgG1 antibody or an IgG2 antibody. Furthermore, the anti-EphA4 antibody relating to this disclosure may be in monomeric, dimeric, or polymeric form, depending on the circumstances.

[0060] The variable region of the antibody relating to this disclosure may mean the variable region of the antibody light chain and / or the variable region of the antibody heavy chain, and the constant region of the antibody may mean the constant region of the antibody light chain and / or the constant region of the antibody heavy chain. The variable regions of the heavy chain and light chain each consist of four framework regions (FRs) linked by three CDRs, also known as complementarity-determining regions. The CDRs in each chain are held in proximity by the FRs and, together with the CDRs in the other chain, contribute to the formation of the antigen-binding site of the antibody. Techniques for determining CDRs include, but are not limited to, (1) an approach based on interspecies sequence variability (e.g., Kabat et al, Sequences of Proteins of Immunological Interest, 5th ed., 1991, National Institutes of Health, Bethesda MD); and (2) an approach based on crystal structure studies of antigen-antibody complexes (Al-lazikani et al., 1997 J. Molec. Biol. 273:927-948). These approaches, or combinations of other approaches, may be used.

[0061] In this specification, a monoclonal antibody may mean an antibody obtained from a substantially homogeneous antibody population; that is, the individual antibodies in that population are identical except for a few possibly naturally occurring mutants. Monoclonal antibodies are highly specific, targeting a single antigen site. Furthermore, in contrast to typical polyclonal antibodies that target different antigens or different epitopes, each monoclonal antibody targets a single epitope of an antigen. The modifier "monoclonal" describes the characteristic of an antibody obtained from a substantially homogeneous antibody population and should not be interpreted restrictively as requiring antibody production by a specific method.

[0062] The anti-EphA4 antibody relating to this disclosure may be a mouse antibody, a chimeric antibody, or a humanized antibody. A chimeric antibody is, for example, an antibody in which the variable region of a non-human (e.g., mouse or rat) antibody is fused to the constant region of a human antibody, and may refer to an antibody in which, for example, the variable region is derived from a non-human antibody and the constant region is derived from a human antibody. A humanized antibody is, for example, an antibody in which the complementarity-determining region (CDR, sometimes called a hypervariable region) of a non-human antibody is introduced into a human antibody, and may refer to an antibody in which, for example, the CDR is derived from a non-human antibody and the rest of the antibody region is derived from a human antibody. However, the boundary between a chimeric antibody and a humanized antibody does not necessarily have to be clear, and it may be in a state that can be called both a chimeric antibody and a humanized antibody. Furthermore, in a chimeric antibody or a humanized antibody, the antibody region (FR, constant region) derived from a human antibody does not necessarily have to be composed entirely of amino acids derived from a human antibody, and may contain one or more amino acids derived from a non-human antibody as long as it can be used normally in human subjects. One embodiment of a humanized antibody is one in which the CDR is derived from a rodent antibody, and the rest of the antibody region is derived from a human antibody. A specific embodiment of a humanized antibody is one in which the CDR is derived from a mouse antibody, and the rest of the antibody region is derived from a human antibody. In these embodiments, the CDR may contain one or more amino acids derived from a non-rodent antibody, or one or more amino acids derived from a non-mouse antibody, and the antibody region other than the CDR may contain one or more amino acids derived from a non-human antibody. Here, "multiple" is not limited to these, but can be 2 to 20, or 2 to 15, for example, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2, or within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the total number of amino acids in the amino acid sequence.Humanization can be performed using the CDR transplantation method (Kontermann and Dubel, Antibody Engineering, Springer Lab Manual (2001) and Tsurushita et al., Methods 36:69-83 (2005)), or by substituting the CDR sequence for the corresponding sequence of a human antibody using methods known in the art (see, for example, Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); and Verhoeyen et al., Science 239:1534-1536 (1988)).

[0063] To reduce antigenicity, it may be important to select the use of human variable regions in both the light and heavy chains during the production of humanized antibodies. According to the "best fit" method, the variable region sequences of rodent antibodies are screened against the entire library of known human FR sequences. The human sequence most closely resembling the rodent sequence is then accepted as the human FR for the humanized antibody. See, for example, Sims et al., J. Immunol. 151:2296-2308 (1993) and Chothia et al., J. Mol. Biol. 196:901-917 (1987). Alternatively, a specific framework derived from common sequences of all human antibodies in a particular subgroup of the light or heavy chain is used. The same framework may be used for several different humanized antibodies. For example, see Carter et al., Proc. Natl. Acad. Set USA 89:4285-4289 (1992) and Presta et al., J. Immunol. 151:2623-2632 (1993).

[0064] Furthermore, it is generally desirable that humanized antibodies retain high binding affinity to antigens and other desirable biological properties. To achieve this goal, according to one method, humanized antibodies are prepared by an analytical step of the parent sequence and various conceptual humanized products using three-dimensional models of the parent sequence and the humanized sequence. Three-dimensional immunoglobulin models are generally available and known to those skilled in the art. Computer programs are available that schematic and display the promising three-dimensional structure of selected candidate immunoglobulin sequences. By examining these displays, it is possible to analyze the possible roles of residues in the function of the candidate immunoglobulin sequence, i.e., the residues that affect the ability of the candidate immunoglobulin to bind to its antigen. This method allows for the selection and combination of FR residues from the recipient sequence and import sequence so that desirable antibody properties, such as increased binding affinity to one or more target antigens (e.g., EphA4 or its fragments), are achieved.

[0065] Needless to say, antibodies obtained by appropriately modifying the chimeric antibodies or humanized antibodies exemplified above while retaining their function (or to add to or improve the function of the antibody) (e.g., modification of the antibody, or partial substitution, addition, and / or deletion of the amino acid sequence of the antibody) are also included in the anti-EphA4 antibodies of this disclosure. More specifically, antibodies in which the amino acid sequence of the constant region has been modified to modify the effector function of the antibody are also included in the scope of this disclosure. For example, antibodies in which the valine (Val) at position 234 of the Eu numbering of a human IgG2 antibody is replaced with alanine (Ala) and the glycine (Gly) at position 237 is replaced with alanine (Ala) are also included in the scope of this disclosure in order to reduce antibody-dependent cell-mediated cytotoxicity (ADCC) activity and / or antibody-dependent cell-mediated phagocytosis (ADCP) activity. Furthermore, bispecific antibodies (Kontermann (2012), mAbs 4, 182-97) that possess both an antibody-binding site having a CDR sequence of the anti-EphA4 antibody relating to this disclosure and an antigen-binding site that binds to a different antigen are also included in the scope of this disclosure.

[0066] The anti-EphA4 antibody relating to this disclosure may be modified as desired. The modification of the anti-EphA4 antibody may be a modification that changes (a) the three-dimensional structure of the amino acid sequence in the modified region, such as a sheet or helix conformation; (b) the charge or hydrophobic state of the molecule at the target site; or (c) the effect of the modification on maintaining the volume of the side chain, or it may be a modification in which these changes are not readily observable.

[0067] The modification of the anti-EphA4 antibody according to this disclosure may be achieved, for example, by substitution, deletion, or addition of constituent amino acid residues.

[0068] In this specification, the term "amino acid" is used in its broadest sense and includes not only natural amino acids such as serine (Ser), asparagine (Asn), valine (Val), leucine (Leu), isoleucine (Ile), alanine (Ala), tyrosine (Tyr), glycine (Gly), lysine (Lys), arginine (Arg), histidine (His), aspartic acid (Asp), glutamic acid (Glu), glutamine (Gln), threonine (Thr), cysteine ​​(Cys), methionine (Met), phenylalanine (Phe), tryptophan (Trp), and proline (Pro), but also unnatural amino acids such as amino acid variants and derivatives. Those skilled in the art will naturally understand, considering this broad definition, that the amino acids used herein include, for example, L-amino acids; D-amino acids; chemically modified amino acids such as amino acid mutants and amino acid derivatives; amino acids that do not form protein building blocks in living organisms, such as norleucine, β-alanine, and ornithine; and chemically synthesized compounds that possess the properties of amino acids known to those skilled in the art. Examples of unnatural amino acids include α-methyl amino acids (such as α-methylalanine), D-amino acids (such as D-aspartic acid and D-glutamic acid), histidine-like amino acids (such as 2-amino-histidine, β-hydroxyhistidine, homohistidine, α-fluoromethylhistidine, and α-methylhistidine), amino acids with an extra methylene group in their side chain ("homo" amino acids), and amino acids in which a carboxylic acid functional group amino acid in the side chain is replaced by a sulfonic acid group (such as cysteic acid).

[0069] Naturally occurring amino acid residues can be classified into the following groups, for example, based on their general side-chain properties: (1) Hydrophobic: Met, Ala, Val, Leu, Ile; (2) Neutral hydrophilic: Asn, Gln, Cys, Ser, Thr; (3) Acidic: Asp, Glu; (4) Basicity: His, Lys, Arg; (5) Residues that affect chain orientation: Gly, Pro; and (6) Aromatic: Trp, Tyr, Phe.

[0070] Non-conservative substitutions in the amino acid sequences constituting antibodies may be made by exchanging an amino acid belonging to one of these groups with an amino acid belonging to another group. More conservative substitutions may be made by exchanging an amino acid belonging to one of these groups with another amino acid of the same group. Similarly, deletions or substitutions of amino acid sequences may be made as appropriate.

[0071] Modifications of the amino acids constituting an antibody may include post-translational modifications such as glycosylation, acetylation, or phosphorylation by sugars. Antibodies can be glycosylated at conserved positions within their constant region. Antibody glycosylation is usually either N-linked or O-linked. N-linked glycosylation means the attachment of a carbohydrate moiety to the side chain of an asparagine residue. The tripeptide sequences asparagine-X-serine, asparagine-X-threonine, and asparagine-X-cysteine ​​(where X is any amino acid other than proline) are recognition sequences for enzymatically attaching a carbohydrate moiety to the asparagine side chain. The presence of any of these tripeptide sequences in an antibody indicates the presence of a potential glycosylation site. O-linked glycosylation may involve attachment of N-acetylgalactosamine, galactose, or xylose to a hydroxyamino acid (e.g., serine or threonine), and may optionally be attachment to 5-hydroxyproline or 5-hydroxylysine. Those skilled in the art can appropriately select the conditions for glycosylation (for example, the type of host cell and cell culture medium, pH, etc., when glycosylation is performed using biological methods) according to their purpose.

[0072] The anti-EphA4 antibody relating to this disclosure may be further modified, alone or in combination, by other modification methods based on common technical knowledge known to those skilled in the art.

[0073] The anti-EphA4 antibody relating to this disclosure can be produced by methods well known to those skilled in the art. For example, the nucleic acid encoding the anti-EphA4 antibody relating to this disclosure may be incorporated into an expression vector, the expression vector may be introduced into a host cell, and the host cell may be cultured to produce the antibody. Therefore, this disclosure encompasses a nucleic acid encoding an anti-EphA4 antibody, a vector containing the nucleic acid, a host cell containing the vector, and a method for producing an anti-EphA4 antibody, comprising the steps of culturing the host cell.

[0074] The nucleic acid encoding the anti-EphA4 antibody according to this disclosure may have DNA encoding a signal sequence, DNA encoding a heavy chain variable region, and DNA encoding a signal sequence at the 5' end of the DNA encoding the light chain variable region. The signal sequence is an amino acid residue located at the N-terminus of a protein that is necessary for secreted proteins and membrane-bound proteins to pass through the lipid bilayer after being synthesized on ribosomes, and is not particularly limited in this disclosure as long as it has this function. Examples of signal sequences that the anti-EphA4 antibody according to this disclosure may contain include signal sequences derived from humans, mice, rats, rabbits, donkeys, goats, horses, birds, dogs, cats, yeast, etc. Specifically in this disclosure, a peptide containing the amino acid sequence represented by SEQ ID NO: 12 or 16 can be given as a signal sequence related to the heavy chain, and a peptide containing the amino acid sequence represented by SEQ ID NO: 14 or 18 can be given as a signal sequence related to the light chain. Furthermore, if functionally equivalent, the amino acid sequences represented by SEQ ID NO: 12 or 16, or SEQ ID NO: 14 or 18, may have one or more (e.g., two, three, four, or five) amino acid substitutions, additions, and / or deletions.

[0075] The anti-EphA4 antibody relating to this disclosure may be isolated or purified according to methods known to those skilled in the art.

[0076] In this specification, “isolated” or “purified” means that a molecule or composition has been artificially isolated or purified from its natural state. If a molecule or composition occurs naturally, it is “isolated” or “purified” when it has been altered, removed from its original environment, or both. Examples of isolation or purification methods include, but are not limited to, electrophoretic, molecular biological, immunological, or chromatographic methods, specifically, ion-exchange chromatography, hydrophobic chromatography, reverse-phase HPLC chromatography, isoelectric focusing, or alkaline extraction.

[0077] In one embodiment, the anti-EphA4 antibody comprises the following CDR: (a) Heavy chain CDR1 consisting of the amino acid sequence shown in Sequence ID No. 44; (b) Heavy chain CDR2 consisting of the amino acid sequence shown in Sequence ID No. 27; (c) Heavy chain CDR3 consisting of the amino acid sequence shown in Sequence ID No. 28; (d) Light chain CDR1 consisting of the amino acid sequence shown in Sequence ID No. 29; (e) Light chain CDR2 consisting of the amino acid sequence shown in Sequence ID No. 30; and (f) A light chain CDR3 consisting of the amino acid sequence shown in Sequence ID No. 31.

[0078] In one embodiment, the anti-EphA4 antibody is a humanized antibody or a chimeric antibody, and in a particular embodiment, it is a humanized antibody.

[0079] In another embodiment, the anti-EphA4 antibody comprises a heavy chain and a light chain, wherein the heavy chain includes a variable region consisting of the amino acid sequence shown in SEQ ID NO: 45, and the light chain includes a variable region consisting of the amino acid sequence shown in SEQ ID NO: 46. In this embodiment, the variable region of the heavy chain and / or the variable region of the light chain may include an amino acid sequence in which one or more amino acids are substituted, added, and / or deleted from the amino acid sequence shown in SEQ ID NO: 45 and / or the amino acid sequence shown in SEQ ID NO: 46. Here, "multiple" is not limited as long as it maintains binding affinity to EphA4 and promotes cleavage of EphA4, but can be 2 to 15, or 2 to 10, for example, 9, 8, 7, 6, 5, 4, 3, or 2, or within 10% of the total number of amino acids in the amino acid sequence, for example, within 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%.

[0080] In one embodiment, the heavy chain of the anti-EphA4 antibody includes the constant region of human IgG2.

[0081] In certain embodiments, the constant region of human IgG2 includes the amino acid sequence of SEQ ID NO: 47.

[0082] In one embodiment, the light chain of the anti-EphA4 antibody contains the constant region of human Igκ.

[0083] In certain embodiments, the constant region of human Igκ contains the amino acid sequence of SEQ ID NO: 48.

[0084] In one embodiment, the anti-EphA4 antibody comprises a heavy chain containing the amino acid sequence shown in SEQ ID NO: 59 and a light chain containing the amino acid sequence shown in SEQ ID NO: 60.

[0085] In another embodiment, for example, to reduce heterogeneity of antibodies produced by antibody-producing cells (see U.S. Patent Application Publication No. 2010 / 0297697 and Liu H et al., MAbs. 2014 Sep-Oct;6(5):1145-1154), anti-EphA4 antibodies have a deletion of lysine located at the C-terminus (carboxyl terminus) of the heavy chain. In this disclosure, anti-EphA4 antibodies with a deletion of the C-terminal lysine of the heavy chain include anti-EphA4 antibodies in which the C-terminal lysine of the heavy chain has been deleted by genetic modification, and anti-EphA4 antibodies in which the C-terminal lysine of the heavy chain has been cleaved after translation by carboxypeptidase, etc. Furthermore, in this disclosure, anti-EphA4 antibodies with a deletion of the C-terminal lysine of the heavy chain include not only anti-EphA4 antibodies in which the C-terminal lysine is deleted in both heavy chains, but also anti-EphA4 antibodies in which the C-terminal lysine is deleted in only one heavy chain.

[0086] In one embodiment, the disclosure relates to an isolated nucleic acid encoding an anti-EphA4 antibody. The isolated nucleic acid encoding an anti-EphA4 antibody refers to one or more nucleic acid molecules encoding the heavy chain and / or light chain of the anti-EphA4 antibody. In one embodiment, the nucleic acid according to the disclosure encodes the heavy chain of the anti-EphA4 antibody. In another embodiment, the nucleic acid according to the disclosure encodes the light chain of the anti-EphA4 antibody. In yet another embodiment, the nucleic acid according to the disclosure encodes both the heavy and light chains of the anti-EphA4 antibody. The nucleic acid according to the disclosure also includes a first nucleic acid molecule encoding the heavy chain of the anti-EphA4 antibody, and a second nucleic acid molecule encoding the light chain of the anti-EphA4 antibody.

[0087] In another embodiment, the disclosure relates to a vector comprising an isolated nucleic acid encoding an anti-EphA4 antibody. The vectors according to the disclosure refer to one or more vectors comprising an isolated nucleic acid encoding an anti-EphA4 antibody. In one embodiment, the vectors according to the disclosure are vectors comprising a nucleic acid encoding the heavy chain of an anti-EphA4 antibody and a nucleic acid encoding the light chain of an anti-EphA4 antibody. In another embodiment, the vectors according to the disclosure are vectors comprising nucleic acids encoding the heavy and light chains of an anti-EphA4 antibody. In yet another embodiment, the vectors according to the disclosure comprise a first vector comprising a nucleic acid encoding the heavy chain of an anti-EphA4 antibody and a second vector comprising a nucleic acid encoding the light chain of an anti-EphA4 antibody. The vectors according to the disclosure may be plasmids, cosmids, viruses, phages, etc., but are not limited to these. For example, viral vectors such as retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, or herpes simplex virus vectors are also included in the vectors according to the disclosure.

[0088] In yet another embodiment, the disclosure also includes a host cell containing the vector relating to the disclosure, and a method for producing an anti-EphA4 antibody, comprising the step of culturing the host cell. The host cell relating to the disclosure may be, but is not limited to, Escherichia coli cells, monkey COS cells, Chinese hamster ovary (CHO) cells, NS0 cells, etc. In one embodiment, the method for producing an anti-EphA4 antibody includes the steps of culturing the host cell and recovering the anti-EphA4 antibody secreted from the host cell (or the culture medium of the host cell).

[0089] The anti-EphA4 antibody relating to this disclosure is used to treat ALS. Accordingly, this disclosure relates to a pharmaceutical composition for treating ALS, comprising the anti-EphA4 antibody relating to this disclosure. In another embodiment, this disclosure also includes a method for treating ALS, comprising administering a therapeutically effective amount of anti-EphA4 antibody to a subject suffering from ALS.

[0090] This disclosure also, in yet another aspect, encompasses the use of anti-EphA4 antibodies for the manufacture of therapeutic drugs for ALS.

[0091] In yet another embodiment, this disclosure also includes an anti-EphA4 antibody for use in the treatment of ALS.

[0092] The anti-EphA4 antibody relating to this disclosure can be used alone or in combination with other agents or compositions in a therapeutic setting. For example, the anti-EphA4 antibody relating to this disclosure may be administered concurrently or at different times with another agent. Such combination therapies include concomitant administration (two or more agents in the same or separate formulations) and isolated administration (e.g., concurrently or sequentially). When two or more agents are administered separately, the administration of the anti-EphA4 antibody relating to this disclosure may precede or follow the accompanying therapeutic treatment.

[0093] The subjects to whom the anti-EphA4 antibody relating to this disclosure is administered are not limited, and the present invention can be used, for example, on humans or non-human mammals (such as monkeys, mice, rats, rabbits, cattle, horses, and goats).

[0094] The method of administering the anti-EphA4 antibody relating to this disclosure to the subject (route of administration, dosage, number of administrations per day, timing of administration, etc.) is not particularly limited and can be appropriately determined by a person skilled in the art (e.g., a physician) depending on the subject's health condition, the severity of the disease, the type of concomitant medication, etc.

[0095] The pharmaceutical composition relating to this disclosure comprises the anti-EphA4 antibody relating to this disclosure. The pharmaceutical composition relating to this disclosure can be manufactured in accordance with known methods, such as those described in the Japanese Pharmacopoeia (JP), the United States Pharmacopeia (USP), or the European Pharmacopoeia (EP).

[0096] Those skilled in the art will understand that, insofar as it does not conflict with the technical specifications, any one or more of the embodiments described herein may be combined as appropriate to implement the Disclosure. Furthermore, those skilled in the art will understand that, insofar as it does not conflict with the technical specifications, it would be preferable to combine as appropriate any preferred or advantageous embodiments described herein to implement the Disclosure.

[0097] Any documents cited herein should be deemed by reference to have all their disclosures expressly incorporated herein, and a person skilled in the art can understand, by means of the context herein, the relevant disclosures in those documents without departing from the spirit and scope of this disclosure.

[0098] The documents cited herein are provided solely for the purpose of disclosing relevant art prior to the filing date of this application and should not be construed as an admission by the inventors that they do not have prior rights to such disclosures, either for prior art or for any other reason. All descriptions in these documents are based on information available to the applicant and do not constitute an admission that the contents of these descriptions are accurate.

[0099] The terms used herein are for the purpose of describing specific embodiments and are not intended to limit the invention.

[0100] As used herein, the term "comprise" is intended to imply the existence of the described items (components, steps, elements, or numbers, etc.), unless the context clearly indicates otherwise, and does not exclude the existence of other items (components, steps, elements, or numbers, etc.). The term "consist of" encompasses the forms described by the terms "consist of" and / or "consist essentially of".

[0101] As used herein, the term "neutralizing activity" means activity that inhibits the binding of EphA4 to its ligand, and / or activity that inhibits signal transduction, cellular molecular expression responses, or functional changes induced in the human body by the binding of EphA4 to its ligand.

[0102] Unless otherwise defined, all terms used herein (including technical and scientific terms) have the same meaning as they are broadly understood by those skilled in the art to which this disclosure belongs. Unless otherwise explicitly defined, terms used herein should be construed to have a meaning consistent with that of this specification and the art relating to it, and should not be interpreted in an idealized or overly formal sense.

[0103] While terms such as "first," "second," etc., are used to describe various elements, it is understood that these elements should not be limited by these terms themselves. These terms are used solely to distinguish one element from another, and it is possible, without departing from the scope of this disclosure, to refer to the first element as the second element, and similarly, the second element as the first element.

[0104] In this specification, numerical values ​​used to indicate component content, numerical ranges, etc., should be understood to be modified by the term "approximately" unless otherwise specified. For example, "4°C" should be understood to mean "approximately 4°C" unless otherwise specified, and it is natural that a person skilled in the art can reasonably understand this degree in accordance with common technical knowledge and the intent of this specification.

[0105] Unless the context clearly indicates otherwise, it is understood that, as used herein and in the claims, each aspect expressed in the singular may also be in the plural, and vice versa, as long as it does not technically contradict the singular.

[0106] The present disclosure will be described in more detail below with reference to examples. However, the present disclosure can be embodied in various forms and should not be construed as being limited to the examples described herein. Those skilled in the art can implement the present disclosure with various modifications, additions, deletions, substitutions, etc., without altering the spirit or scope of the present disclosure. [Examples]

[0107] Reference Example 1: Production of anti-EphA4 monoclonal antibody (A) Production of mouse anti-EphA4 monoclonal antibody To produce a monoclonal antibody that binds to mouse EphA4 (Genbank Accession No. NP_031962.2, SEQ ID NO: 1), a protein (hereinafter referred to as "mouse EphA4 extracellular domain-SEAP-His protein," SEQ ID NO: 3) was prepared by fusing secreted alkaline phosphatase (SEAP) and a histidine tag to the extracellular domain (positions 20-547) of mouse EphA4 (SEQ ID NO: 2) using the following procedure.

[0108] First, the DNA sequences encoding the signal sequence (SEQ ID NO: 4) and extracellular region (SEQ ID NO: 2) of mouse EphA4 were amplified by RT-PCR using mouse brain-derived Total RNA and cloned into the SalI / NotI site of a pENTR1A vector (Invitrogen / LifeTechnologies) containing DNA sequences encoding SEAP and histidine tags. Next, the DNA sequences encoding the signal sequence and extracellular region of mouse EphA4, SEAP, and histidine tags were transferred to a pcDNA3.1_rfcB vector using the LR reaction in the Gateway System (Invitrogen / LifeTechnologies) to construct a pcDNA3.1-mouse EphA4 extracellular region-SEAP-His expression vector. The constructed pcDNA3.1-mouse EphA4 extracellular region-SEAP-His expression vector was transfused into HEK293EBNA cells (Invitrogen / LifeTechnologies) using TransIT-LT1 (TAKARA). After a 6-day incubation period (5% CO2, 37°C), the culture supernatant was collected. From the collected culture supernatant, the mouse EphA4 extracellular domain-SEAP-His protein (SEQ ID NO: 3) was purified using a Protino column (MACHEREY-NAGEL).

[0109] 20 μg of mouse EphA4 extracellular domain-SEAP-His protein was mixed with an equal amount of TiterMax Gold adjuvant (TiterMax USA) or GERBU adjuvant (GERBU Biotechnik GmbH) and subcutaneously injected into the soles of Balb / c mice. Subsequently, mouse EphA4 extracellular domain-SEAP-His protein was administered similarly on days 3, 7, and 10. TiterMax Gold adjuvant (TiterMax USA) was used only on day 10, while GERBU adjuvant (GERBU Biotechnik GmbH) was used on days 3, 7, and 10. On day 13, the mice were sacrificed, and peripheral lymph nodes were collected to prepare lymph node cells. In the presence of GenomeONE-CF (Ishihara Sangyo Kaisha, Ltd.), the prepared lymph node cells were fused with P3U1 myeloma cells (provided by Kyoto University) in a 5:1 ratio. The fused cells were cultured in a 96-well plastic plate. After 7 days of incubation (5% CO2, 37°C), the culture supernatant was collected.

[0110] Using the obtained culture supernatant, wells exhibiting reactivity to mouse, rat, and human EphA4 were selected.

[0111] The reactivity of mouse, rat, and human EphA4 to EphA4 was evaluated by ELISA using proteins fused with the Fc region of human IgG1 and a histidine tag to the extracellular region of mouse EphA4, the extracellular region (positions 20-547) of rat EphA4 (Genbank Accession No. NP_001155883.1), or the extracellular region (positions 20-547) (position 6) of human EphA4 (Genbank Accession No. NP_004429.1, SEQ ID NO: 5). (Hereafter referred to as "mouse EphA4 extracellular region-Fc-His protein," "rat EphA4 extracellular region-Fc-His protein," or "human EphA4 extracellular region-Fc-His protein," respectively.

[0112] The mouse, rat, or human EphA4 extracellular region-Fc-His protein was prepared by the following steps. First, a pcDNA3.1-mouse, rat, or human EphA4 extracellular region-Fc-His expression vector was constructed. First, the signal sequence and DNA sequence encoding the extracellular region of mouse, rat, or human EphA4 were amplified by RT-PCR using total RNA derived from mouse, rat, or human brain, and cloned into the SalI / NotI site of a pENTR1A vector (Invitrogen / LifeTechnologies) containing DNA sequences encoding Fc and histidine tags. Next, the signal sequence and extracellular region of mouse, rat, or human EphA4, and the DNA sequences encoding Fc and histidine tags were transferred to the pcDNA3.1_rfcB vector by an LR reaction in the Gateway System (Invitrogen / LifeTechnologies), and the pcDNA3.1-mouse, rat, or human EphA4 extracellular region-Fc-His expression vector was constructed. These constructed expression vectors were transfused into HEK293EBNA cells (Invitrogen / LifeTechnologies) using TransIT-LT1 (TAKARA). After 6 days of incubation (5% CO2, 37°C), the culture supernatant was collected.

[0113] ELISA using mouse, rat, or human EphA4 extracellular region-Fc-His protein was performed according to the following procedure: Anti-human IgG antibody (Jackson ImmunoResearch Laboratories) was coated onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked at room temperature for 1 hour with 1x Block Ace (Dainippon Pharmaceutical). After washing three times with 0.02% Tween20 / PBS (Nacalai Tesque), culture supernatant containing mouse, rat, or human EphA4 extracellular region-Fc-His protein was added to each well (final concentration 1 nM), and incubated at room temperature for 1 hour. After washing three times, culture supernatant of the fused cells was added to each well. After incubation at room temperature for 1 hour and washing three times, horseradish peroxidase-labeled anti-mouse IgG antibody (Jackson ImmunoResearch Laboratories) was added, and incubated at room temperature for 1 hour. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to each well and incubated at room temperature for 5-20 minutes. An equal volume of reaction stop solution (2N H2SO4, Wako Pure Chemical Industries) was added to each well, and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0114] Hybridomas were cloned from the wells selected through the above process using the limiting dilution method, and ultimately, hybridoma clones expressing mouse anti-EphA4 antibodies with binding activity to mouse, rat, and human EphA4 were obtained.

[0115] The obtained hybridoma clones were cultured, and mouse anti-EphA4 monoclonal antibodies were purified from the culture supernatant using Protein A (GE Healthcare).

[0116] (B) Evaluation of EphA4 cleavage-promoting activity Rat hippocampal neurons were prepared according to the following procedure: Fetuses were removed from rats (Charles River, Japan) on day 18 of gestation, and the brains were removed by dissecting the heads. After dissecting the hippocampal region under a stereomicroscope, it was placed in a digestion solution (137 mM NaCl (Wako Pure Chemical Industries), 5 mM KCl (Wako Pure Chemical Industries), 7 mM Na2HPO4 (Wako Pure Chemical Industries), 25 mM Hepes (DOJINDO), 0.5 mg / mL DNase (Sigma), 0.25% trypsin (Life Technologies)) and shaken at 37°C for 10 minutes. The solution was removed, and 20% fetal bovine serum / Hanks buffer (Sigma) was added. After removing the solution, the cells were washed twice with Hanks buffer, and then the hippocampal tissue was pipettered in Hanks buffer to prepare a cell suspension. Cells were seeded in a poly-L-lysine coated 96-well dish (Falcon) containing culture medium (Neurobasal medium (Life Technologies), 1×B-27 supplement (Life Technologies), 0.5 mM L-glutamine (Life Technologies)).

[0117] The EphA4 cleavage-promoting activity using hippocampal neurons was evaluated according to the following procedure. Rat hippocampal neurons seeded in 96-well dish (Falcon) were treated with an anti-EphA4 monoclonal antibody (67 nM) and the γ-secretase inhibitor Compound E (50 nM, Enzo Life Sciences). After 16 hours, the neurons were washed with PBS (Wako Pure Chemical Industries), and the cells were collected by adding SDS sample buffer (Laemmli sample buffer (Bio-Rad), 5% 2-mercaptoethanol (Bio-Rad)) and boiled for 5 minutes. SDS-PAGE was performed on these samples, and Western blotting was performed using an anti-EphA4 monoclonal antibody (Abnova). Band intensity was quantified, and the EphA4 C-terminal fragment / full-length EphA4 value was calculated.

[0118] A mouse anti-EphA4 monoclonal antibody (Antibody A) with activity to promote EphA4 cleavage was obtained. The isotype of antibody A was determined using a monoclonal antibody isotyping kit (Serotec), and it was IgG1 for the heavy chain and κ for the light chain.

[0119] (C) Sequence analysis of antibody A The signal sequences of the heavy and light chains of antibody A, and the DNA sequence encoding the variable region, were amplified by the 5'-RACE (5'-rapid amplification of cDNA ends) method. Total RNA was prepared from the hybridoma using RNeasy (QIAGEN) and treated with DNase (QIAGEN, RNase-free DNase set). Double-stranded cDNA was prepared from the total RNA using a cDNA synthesis kit (TAKARA). A 5' adapter obtained by annealing oligo-DNA ad29S (ACATCACTCCGT) (SEQ ID NO: 7) and oligo-DNA ad29AS (ACGGAGTGATGTCCGTCGACGTATCTCTGCGTTGATACTTCAGCGTAGCT) (SEQ ID NO: 8) was added to the cDNA. The obtained cDNA was amplified using a 5' forward primer (5'-PCR4 primer, AGCTACGCTGAAGTATCAACGCAGAG) (SEQ ID NO: 9) and a 3' reverse primer (GCCAGTGGATAGACTGATGG (SEQ ID NO: 10) was used for amplification of the mouse IgG heavy chain, and GATGGATACAGTTGGTGCAGC (SEQ ID NO: 11) was used for amplification of the mouse Igκ light chain). The amplified cDNA was inserted into a pCR2.1 vector (Invitrogen / LifeTechnologies). The gene sequence of antibody A was analyzed using ABI3130XL. The amino acid sequences encoded by the gene sequence of antibody A identified by this analysis are as follows: the heavy chain signal sequence is the sequence shown in SEQ ID NO: 12, the heavy chain variable region is the sequence shown in SEQ ID NO: 13, the light chain signal sequence is the sequence shown in SEQ ID NO: 14, and the light chain variable region is the sequence shown in SEQ ID NO: 15. The nucleotide sequences encoding the gene sequence of antibody A are as follows: the heavy chain signal sequence is the sequence shown in SEQ ID NO: 16, the heavy chain variable region is the sequence shown in SEQ ID NO: 17, the light chain signal sequence is the sequence shown in SEQ ID NO: 18, and the light chain variable region is the sequence shown in SEQ ID NO: 19.

[0120] The full-length sequences of the heavy and light chains of antibody A were obtained by the following procedure: Total RNA was prepared from the hybridoma using RNeasy (QIAGEN) and treated with DNase (QIAGEN, RNase-free DNase set). Reverse transcripts were prepared from the total RNA using an RNA PCR kit (TAKARA). Using the obtained reverse transcript as a template, the gene sequences encoding the heavy and light chains of antibody A were amplified by PCR using 5' forward primers (GCGAAGCTTGCCGCCACCATGGCTGTCCTGGTGCTGCTCC (primer ID 7455) (SEQ ID NO: 20) for heavy chain amplification and GCGAAGCTTGCCGCCACCATGGACATGAGGGTTCCTGCTCACG (primer ID 7453) (SEQ ID NO: 21) for light chain amplification) and 3' reverse primers (GCGGAATTCATCATTTACCAGGAGAGTGGGAGAGGC (primer ID 7257) (SEQ ID NO: 22) for heavy chain amplification and CGCGAATTCACTAACACTCATTCCTGTTGAAGCTCTTGAC (primer ID 7249) (SEQ ID NO: 23) for light chain amplification), and cloned into pEE6.4 and pEE12.4 vectors (Lonza), respectively. The gene sequences were analyzed using ABI3130XL. The amino acid sequences encoded by the gene sequence of antibody A identified by this analysis are as follows: the heavy chain constant region is the sequence shown in SEQ ID NO: 24, and the light chain constant region is the sequence shown in SEQ ID NO: 25.

[0121] The CDR of antibody A was determined by the following method: The amino acid sequence of antibody A was numbered using Abysis software (UCL) according to the Kabat numbering system. Based on this number, the CDR was determined according to the Kabat definition for CDR identification. The amino acid sequence of the CDR of antibody A is shown in Table 1. [Table 1]

[0122] Reference Example 2: Binding affinity of anti-EphA4 monoclonal antibodies to mouse and human EphA4 The binding affinity of antibody A to mouse and human EphA4 was determined by surface plasmon resonance (SPR) using Biacore T200 (GE Healthcare). First, the anti-His antibody (GE Healthcare, 28-9950-56) was immobilized onto the CM5 sensor chip. Immobilization was performed using an amine coupling method with N-hydroxysuccinimide (NHS) and N-ethyl-N'-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC), with ethanolamine used for blocking (all sensor chips and immobilization reagents were from GE Healthcare). The antibody was diluted to 3.5 μg / mL using immobilization buffer (10 mM sodium acetate, pH 4.5) and immobilized onto the sensor chip according to the protocol provided with the Biacore T200. Mouse or human EphA4 extracellular region-SEAP-His10 was diluted with running buffer HBS-EP (GE Healthcare, BR-1001-88) and delivered onto a flow cell for 120 seconds for capture (capture volume of approximately 10 RU). Subsequently, antibody A, diluted in series using HBS-EP in the range of 100, 50, 25, 12.5, 6.3, 3.2, 1.6, and 0 nM, was added to the sensor chip for 120 seconds, and the binding reaction curves were sequentially observed at the time of addition (conjugation phase, 120 seconds) and after the completion of addition (dissociation phase, 600 seconds). After each observation, the sensor chip was regenerated by adding 4 M MgCl2 (for 60 seconds, Wako Pure Chemical Industries). The obtained binding reaction curves were fitted using a 1:1 binding model with the system's accompanying software, BIA evaluation software, to calculate the binding affinity (KD = kd / ka) for mouse and human EphA4.

[0123] The binding affinity (KD value) of antibody A to mouse and human EphA4 was 1.32 × 10⁻¹⁴, respectively. -9 M, 1.19 × 10 -9 The result was M (Figure 1). Other binding parameters for mouse and human EphA4 were also nearly identical. Therefore, antibody A is considered to have similar binding affinity to mouse and human EphA4.

[0124] Reference Example 3: EphA4 cleavage-promoting activity of anti-EphA4 monoclonal antibody in hippocampal neurons The EphA4 cleavage-promoting activity of antibody A was evaluated using hippocampal neurons according to the following procedure. Rat hippocampal neurons seeded in 96-well dish (Falcon) were treated with antibody A (2.0, 6.7, 20 nM) and the γ-secretase inhibitor Compound E (50 nM, Enzo Life Sciences). After 24 hours, the cells were washed with PBS (Wako Pure Chemical Industries), and SDS sample buffer (Laemmli sample buffer (Bio-Rad), 5% 2-mercaptoethanol (Bio-Rad)) was added to collect the cells, which were then boiled for 5 minutes. SDS-PAGE was performed on these samples, and Western blotting was performed using the anti-EphA4 monoclonal antibody (Abnova). Band intensity was quantified, and the EphA4 C-terminal fragment / full-length EphA4 value was calculated.

[0125] Antibody A promoted EphA4 cleavage in hippocampal neurons in a concentration-dependent manner (Figure 2).

[0126] Reference Example 4: Inhibitory activity of anti-EphA4 monoclonal antibody in mouse EphA4-mouse ligand binding The inhibitory activity of antibody A in binding between mouse EphA4 and mouse ligand was evaluated according to the following procedure. Anti-alkaline phosphatase antibody (Thermo SCIENTIFIC) was coated onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked at room temperature for 1 hour with 1% Block Ace (DS Pharma Biomedical). After washing three times with 0.02% Tween20 / PBS (Thermo SCIENTIFIC), mouse EphA4 extracellular region-SEAP-His protein was added to the wells (final concentration 10 nM) and incubated at room temperature for 1 hour. After washing three times, ligand and antibody A (0, 0.003, 0.01, 0.03, 0.1, 0.3, 1, 3, 10, 30, 100, 300, 1000, 3000 nM) were added to the wells. Biotinylated mouse EphrinA1-Fc chimera (R&D Systems, final concentration 6 nM) and biotinylated mouse EphrinB2-Fc chimera (R&D Systems, final concentration 2.5 nM) were used as ligands. After incubation at room temperature for 1 hour and washing three times, horseradish peroxidase-labeled streptavidin (GE Healthcare) was added and incubated at room temperature for 1 hour. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to the wells and incubated at room temperature for 2 minutes. An equal volume of reaction stop solution (1N H2SO4, Wako Pure Chemical Industries) was added to the wells and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0127] Antibody A inhibits the binding of mouse EphA4 to mouse ligands in a concentration-dependent manner, and inhibits IC (implantation cell) binding of mouse EphrinA1 and EphrinB2. 50 The values ​​were approximately 5.9 nM and 3.1 nM, respectively (Figure 3). Therefore, it was shown that antibody A strongly inhibits the binding of mouse EphA4 to the mouse ligand.

[0128] Reference Example 5: Human EphA4-Human Ligand Binding Inhibitory Activity of Anti-EphA4 Monoclonal Antibody The inhibitory activity of antibody A in binding between human EphA4 and human ligands was evaluated according to the following procedure. Anti-alkaline phosphatase antibody (Thermo SCIENTIFIC) was coated onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked at room temperature for 1 hour with 1% Block Ace (DS Pharma Biomedical). After washing three times with 0.05% Tween20 / PBS (Thermo SCIENTIFIC), human EphA4 extracellular region-SEAP-His protein was added to the wells (final concentration 10 nM), and incubated at room temperature for 1 hour. After washing three times, ligands and serially diluted antibody A (0, 0.003, 0.01, 0.03, 0.1, 0.3, 1, 3, 10, 30, 100, 300, 1000, 3000 nM) were added to the wells. Biotinylated human Ephrin A5-Fc chimera (R&D Systems, final concentration 0.7 nM) and biotinylated human Ephrin B3-Fc chimera (R&D Systems, final concentration 2.3 nM) were used as ligands. After incubation at room temperature for 1 hour and washing three times, horseradish peroxidase-labeled streptavidin (GE Healthcare) was added and incubated at room temperature for 1 hour. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to the wells and incubated at room temperature for 2-5 minutes. An equal volume of reaction stop solution (1N H2SO4, Wako Pure Chemical Industries) was added to the wells, and the absorbance at 450 nm was read using a microplate reader (Molecular Devices or PerkinElmer).

[0129] Antibody A inhibits the binding of human EphA4 to human ligands in a concentration-dependent manner, and inhibits IC (implantation cell) binding to human EphrinA5 and EphrinB3. 50 The values ​​were approximately 2.8 nM and 1.4 nM, respectively (Figure 4). Therefore, it was shown that antibody A strongly inhibits the binding of human EphA4 to human ligands.

[0130] Reference Example 6: Selectivity of anti-EphA4 monoclonal antibodies against human Eph receptors Following the preparation method for mouse EphA4 extracellular domain-SEAP-His protein described in Reference Example 1, the signal sequences and DNA sequences encoding the extracellular domains of each human Eph receptor (EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB6) were amplified by RT-PCR using tissue-derived Total RNA and cloned into a pENTR1A vector (Invitrogen / LifeTechnologies) containing DNA sequences encoding SEAP and histidine tags. Next, the signal sequences and extracellular regions of each human Eph receptor, as well as the DNA sequences encoding SEAP and histidine tags, were transferred to the pcDNA3.1_rfcB vector using the Gateway System (Invitrogen / LifeTechnologies) LR reaction. A vector expressing a protein fused with SEAP and the His tag to the extracellular region of each human Eph receptor (referred to as the "Eph receptor extracellular region-SEAP-His protein") was then constructed (referred to as the "Eph receptor extracellular region-SEAP-His protein expression vector").

[0131] Next, human Eph receptor extracellular region-SEAP-His protein expression vectors were introduced into Expi293F cells (Gibco / ThermoFisher) using the Expi293 expression system (Gibco / ThermoFisher). After 5 days of culture (5% CO2, 37°C, 120 rpm), the culture supernatant was collected and centrifuged at room temperature at 1500 rpm for 5 minutes. The supernatant was filtered through a 0.45 μm filter (Millipore).

[0132] The binding activity of antibody A to the human Eph receptor was evaluated according to the following procedure. Rabbit anti-6-His antibody (Bethyl Laboratories) was coated onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked at room temperature for 1 hour with 1% Block Ace (DS Pharma Biomedical). After washing three times with 0.05% Tween20 / PBS (Thermo SCIENTIFIC), human extracellular region-SEAP-His protein (final concentration 1 nM) of each Eph receptor was seeded into each well and incubated at room temperature for 1 hour. After washing three times, human IgG solution (100 μg / mL, Mitsubishi Welpharma) and antibody A (10 μg / mL) were added to the wells and incubated at room temperature for 1 hour. Horseradish peroxidase-labeled donkey anti-mouse IgG antibody (Jackson ImmunoResearch Laboratories) was added and incubated at room temperature for 1 hour. After washing three times, add TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution to the wells. Once a suitable color development is confirmed, add an equal volume of reaction stop solution (1N H2SO4) to the wells. 4、 Wako Pure Chemical Industries (Wako) was added, and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0133] Antibody A exhibited specific binding activity only to human EphA4 among the human Eph receptor family (Figure 5).

[0134] Reference Example 7: Selectivity of anti-EphA4 monoclonal antibody against mouse Eph receptors Following the preparation method for the EphA4 extracellular domain-Fc-His protein described in Reference Example 1, the signal sequences and DNA sequences encoding the extracellular domains of each mouse Eph receptor (EphA1, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB6) were amplified by RT-PCR using tissue-derived Total RNA and cloned into a pENTR1A vector (Invitrogen / LifeTechnologies) containing the Fc region and histidine tag-encoding DNA sequences of human IgG1. Next, the signal sequences and extracellular domains of each mouse Eph receptor (EphA1, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB6), along with the DNA sequences encoding the Fc and histidine tags, were transferred to the pcDNA3.1_rfcB vector using the LR reaction in the Gateway System (Invitrogen / LifeTechnologies) to construct extracellular domain-Fc-His protein expression vectors for each mouse Eph receptor. In constructing the mouse EphA2 extracellular region-Fc-His protein expression vector, the signal sequence and DNA sequence encoding the extracellular region of mouse EphA2 were amplified by RT-PCR using tissue-derived total RNA. These sequences were then cloned into a pcDNA3.1 vector containing DNA sequences encoding Fc and histidine tags to construct the mouse EphA2 extracellular region-Fc-His protein expression vector.

[0135] Next, using the Expi293 expression system (Gibco / ThermoFisher), mouse Eph receptor extracellular region-Fc-His protein expression vectors were introduced into Expi293F cells (Gibco / ThermoFisher). After 5 days of culture (5% CO2, 37°C, 120 rpm), the culture supernatant was collected and centrifuged at room temperature at 1500 rpm for 5 minutes. The supernatant was filtered through a 0.45 μm filter (Millipore).

[0136] Regarding antibody A, the binding activity to mouse Eph receptors was evaluated according to the following procedure. Rabbit anti-6-His antibody (Bethyl Laboratories) was coated onto the wells of a 96-well plate (Nunc). After incubating overnight at 4°C, the wells were blocked with 1% Block Ace (DS Pharma Biomedical) for 1 hour at room temperature. After washing three times with 0.05% Tween20 / PBS (Thermo SCIENTIFIC), each well was seeded with mouse extracellular domain-Fc-His protein of each Eph receptor (final concentration 1 nM) and incubated for 1 hour at room temperature. After washing three times, human IgG solution (100 μg / mL, Sigma) and antibody A (10 μg / mL) were added to the wells and incubated for 1 hour at room temperature. Horseradish peroxidase-labeled donkey anti-mouse IgG antibody (Jackson ImmunoResearch Laboratories) was added and incubated for 1 hour at room temperature. After washing three times, TMBZ (3,3’,5,5’-tetramethylbenzidine, Sigma) solution was added to the wells. After confirming appropriate color development, an equal volume of reaction stop solution (1N H2SO 4、 Wako Pure Chemical Industries) was added, and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0137] Antibody A had specific binding activity only to mouse EphA4 among the mouse Eph receptor family (Figure 6).

[0138] Reference Example 8: Reactivity of anti-EphA4 monoclonal antibodies against mouse, rat, monkey, and human EphA4 The mouse, rat, monkey, and human EphA4 extracellular region-Fc-His proteins were prepared according to the following procedure. First, a monkey EphA4 extracellular region-Fc-His protein expression vector was constructed according to the preparation method for the EphA4 extracellular region-Fc-His protein described in Reference Example 1. The amino acid sequence of monkey EphA4 used in vector construction is shown as SEQ ID NO: 32, and its extracellular region as SEQ ID NO: 33. Various EphA4 extracellular region-Fc-His proteins were prepared using the monkey EphA4 extracellular region-Fc-His protein expression vector and the mouse, rat, and human EphA4 extracellular region-Fc-His protein expression vectors described in Reference Example 1.

[0139] The binding activity of antibody A to various EphA4 extracellular domains was evaluated according to the following procedure. Donkey anti-human IgG antibody (Jackson ImmunoResearch Laboratories) was coated onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked at room temperature for 1 hour with 1% Block Ace (DS Pharma Biomedical). After washing three times with 0.05% Tween20 / PBS (Thermo SCIENTIFIC), mouse, rat, monkey, and human EphA4 extracellular region-Fc-His protein (final concentration 1 nM) was seeded into the wells and incubated at room temperature for 1 hour. After washing three times, human IgG solution (100 μg / mL, Mitsubishi Welpharma) and antibody A (0, 0.00013, 0.00064, 0.0032, 0.016, 0.08, 0.4, 2, 10 μg / mL) were added to the wells and incubated at room temperature for 1 hour. Horseradish peroxidase-labeled donkey anti-mouse IgG antibody (Jackson ImmunoResearch Laboratories) was added and incubated at room temperature for 1 hour. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to the wells. Once a suitable color development was confirmed, an equal volume of stop solution (1N H2SO4, Wako Pure Chemical Industries) was added to the wells, and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0140] Antibody A exhibited comparable binding activity in mice, rats, monkeys, and human EphA4 (Figure 7).

[0141] Reference Example 9: Reactivity of anti-EphA4 monoclonal antibody to the extracellular domain, ligand-binding domain, fibronectin type III domain 1, and fibronectin type III domain 2 of human EphA4. The production of proteins fused with the extracellular domain (ECD), ligand-binding domain (LBD), fibronectin type III domain 1 (FN1), or fibronectin type III domain 2 (FN2) of human EphA4, along with maltose-binding protein (MBP) and a histidine tag (hereinafter referred to as "human EphA4 extracellular domain-MBP-His protein," "human EphA4 ligand-binding domain-MBP-His protein," "human EphA4 fibronectin type III domain 1-MBP-His protein," and "human EphA4 fibronectin type III domain 2-MBP-His protein") was carried out according to the following steps. First, a pcDNA3.4-human EphA4 extracellular domain, ligand-binding domain, fibronectin type III domain 1, or fibronectin type III domain 2-MBP-His expression vector was constructed. First, the signal sequence of human EphA4 (SEQ ID NO: 34) or the signal sequence of preprotrypsin (SEQ ID NO: 35) and the DNA sequences encoding each domain of human EphA4 were amplified by PCR and cloned into a pcDNA3.4 vector (Invitrogen / LifeTechnologies) containing DNA sequences encoding MBP and histidine tags. Expression vectors for human EphA4 extracellular domain-MBP-His protein, human EphA4 ligand-binding domain-MBP-His protein, human EphA4 fibronectin type III domain 1-MBP-His protein, and human EphA4 fibronectin type III domain 2-MBP-His protein were constructed. The amino acid sequence of human EphA4 used in vector construction is shown as SEQ ID NO: 5, its extracellular domain as SEQ ID NO: 36, its ligand-binding domain as SEQ ID NO: 37, its fibronectin type III domain 1 as SEQ ID NO: 38, and its fibronectin type III domain 2 as SEQ ID NO: 39. The expression vector was transfused into Expi293F cells (Thermo SCIENTIFIC) using the Expi293 expression system (Thermo SCIENTIFIC). After 4 days, the culture supernatant was collected and filtered through a 0.45 μm filter (Millipore).Crude purification was performed using amylose resin (NEB), and buffer replacement was performed with PBS (Wako Pure Chemical Industries) using a Zeba Spin Desalting column (Thermo SCIENTIFIC). The monomer fraction was fractionated and purified using a Superdex200 10 / 300 (GE Healthcare).

[0142] The binding activity of antibody A to various human EphA4 intradomains was evaluated according to the following procedure. Rabbit anti-6-His antibody (Bethyl Laboratories) was coated onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked at room temperature for 1 hour with 1% Block Ace (DS Pharma Biomedical). After washing twice with 0.02% Tween20 / PBS (Nacalai Tesque), human EphA4 extracellular domain-MBP-His protein, human EphA4 ligand-binding domain-MBP-His protein, human EphA4 fibronectin type III domain 1-MBP-His protein, and human EphA4 fibronectin type III domain 2-MBP-His protein (final concentration 10 nM) were seeded into the wells and incubated at room temperature for 1 hour. After washing three times, antibody A (final concentration 10 nM) was added to the wells and incubated at room temperature for 1 hour. Horseradish peroxidase-labeled goat anti-mouse IgG Fcγ fragment antibody (Jackson ImmunoResearch Laboratories) was added and incubated at room temperature for 1 hour. After washing 5 times, TMB solution (KPL) was added to the wells, and after confirming adequate color development, an equal volume of reaction stop solution (2N H2SO4, Wako Pure Chemical Industries) was added to the wells, and the absorbance at 450 nm and 650 nm was read using a microplate reader (PerkinElmer).

[0143] Antibody A exhibited binding activity to the extracellular domain (ECD) and ligand-binding domain (LBD) of human EphA4 (Figure 8). It did not react with fibronectin type III domain 1 (FN1) or fibronectin type III domain 2 (FN2). Therefore, it was found that antibody A specifically binds to the ligand-binding domain of the extracellular domain of human EphA4.

[0144] Reference Example 10: Effect of anti-EphA4 monoclonal antibody on increasing spine count in hippocampal neurons Rat hippocampal neurons were prepared as described in Reference Example 1 (B) above. The EGFP gene was introduced into rat hippocampal neurons using Nucleofector (Lonza), and these were mixed with rat hippocampal neurons that had not undergone gene introduction. The mixture was then seeded into a 24-well plate (Falcon) containing a poly-L-lysine coated coverslip (Matsunami Glass Industry).

[0145] Spine counting using hippocampal neurons was performed according to the following procedure: EGFP-transformed rat hippocampal neurons cultured 13 days prior, seeded in a 24-well plate (Falcon) containing poly-L-lysine coated coverslips (Matsunami Glass Co., Ltd.), were treated with either a control antibody (mouse IgG1; BioLegend) or antibody A (6.7, 20 nM) for 24 hours. Subsequently, the coverslips were transferred to 2% PFA (Wako Pure Chemical Industries) / 4% Sucrose (Wako Pure Chemical Industries) / PBS and allowed to stand for 20 minutes to fix the cells. After removing the fixative, the cells were washed three times with PBS, and then 0.25% TritonX-100 (Wako Pure Chemical Industries) / PBS was added for cell permeabilization for 15 minutes. After removing the liquid, the coverslip was transferred to 2% BSA (Sigma) / 0.25% Triton X-100 / Opti-MEM (GIBCO), blocked for 1 hour, and then reacted with anti-GFP antibody (Nacalai Tesque) for 1 hour and 30 minutes. After removing the primary antibody solution, the coverslip was washed three times with PBS, and then reacted with the secondary antibody for 1 hour. After removing the secondary antibody solution, the coverslip was washed three times with PBS, Prolong Gold antifade reagent (Molecular probes) was added and the coverslip was mounted and observed with LSM800 (ZEISS). The above experiment was performed three times, and for each experiment, neurons were extracted from two coverslips, and the spines on the dendrites of each neuron were counted using the image analysis software Imaris® (Bitplane), and the number of spines per 10 μm in each neuron was calculated.

[0146] Antibody A increased the number of spines in hippocampal neurons (Figure 9). This result indicates that antibody A has the activity to stabilize spines in hippocampal neurons.

[0147] Reference Example 11: Epitope mapping of the EphA4-ligand-binding domain (EphA4-LBD) by X-ray crystal structure analysis The preparation of antibody A-Fab was carried out according to the following procedure. 101.1 mg of antibody A was dissolved in 0.1 M sodium phosphate buffer (pH 7.0) containing 30 mM L-cysteine ​​and 2 mM EDTA at a concentration of 15 mg / mL. Papain (Sigma) was added to this antibody solution at a ratio of 1 / 200 relative to the antibody, and enzymatic digestion was carried out at 37°C for 18 hours. The enzymatic digest of antibody A was dialyzed against PBS, and the precipitate was removed by centrifugation (the resulting precipitate was redissolved in PBS and mixed with the supernatant). Next, the following steps were performed to remove impurities other than antibody A-Fab. 1) Purification using Protein A column This enzyme digestion solution was applied to 2 mL of ProSep vA High Capacity (Millipore) equilibrated with PBS, and the pass-through fraction and the PBS wash fraction were collected. 2) Affinity purification using anti-human IgG Fcγ antibody An affinity column was prepared by covalently binding an anti-human IgG Fcγ antibody (Jackson ImmunoResearch Laboratories) to NHS-Activated Sepharose 4FF (GE Healthcare) according to the Sepharose manual. The solution recovered in step 1) above was charged to this affinity column, and the pass-through solution and the PBS washing solution were collected. 3) Purification by gel filtration The pass-through fraction obtained in step 2) above was concentrated using an ultrafiltration membrane. Superose 12 (GE Healthcare) was equilibrated with PBS, and the concentrated sample was applied and separated and purified. A portion of the separated and purified fraction was analyzed by SDS-PAGE, and the fraction containing antibody A-Fab with high purity was recovered and pooled. The sample purified in this way was designated as antibody A-Fab.

[0148] To create a conjugate of antibody A-Fab and the antigen EphA4-LBD, EphA4-LBD was prepared (Qin H. et al., J. Biol. Chem., 283: 29473-29484 (2008)). 0.68 μmol (200 μM, 3.4 mL) of EphA4-LBD and 0.45 μmol (300 μM, 1.5 mL) of antibody A-Fab were mixed so that EphA4-LBD was approximately 1.5 times the molar ratio of antibody A-Fab. The mixture was then applied to HILOAD 26 / 60 Superdex 75 prep grade (GE Healthcare) and eluted with chromatographic buffer (25 mM Tris / HCl (pH 7.5), 100 mM NaCl). The fraction containing the complex was analyzed by SDS-PAGE, and the high-purity fraction was collected and concentrated to approximately 40.8 mg / mL, which was then used for crystallization.

[0149] The complex was crystallized using the sitting drop vapor diffusion method with the automated crystallization system Hydra II Plus One (Matrix Technologies Corp., Ltd.). MRC-2 (Molecular Dimensions) plates were used. The reservoir solution consisted of 100 mM HEPES (pH 7.5), 10% Polyethylene Glycol 8000, and 8% Ethylene Glycol. Crystallization droplets were prepared by mixing this reservoir solution with the complex solution in a 1:1 volume ratio. The prepared crystallization plates were left standing at 20°C.

[0150] Crystallization was performed under the above conditions, yielding crystals with space group P212121 and lattice constants a=71.0 Å, b=84.5 Å, and c=116.1 Å. Synchrotron X-rays (1.0 Å) were incident on the obtained crystals, and diffraction data at 1.79 Å was acquired. The diffraction data was processed using HKL2000 (HKL Research Inc.), and the phase was determined by molecular substitution. For molecular substitution, the program PHASER (version 2.5.0, McCoy AJ et al., J. Appl. Cryst. 40:658-674 (2007)), included in the CCP4 Software Suite (Collaborative computational project number 4, [CCP4] version 6.5.0, Acta Cryst. D 67:235-242 (2011)), was used. For the molecular substitution search model, we used the crystal structure of EphA4-LBD (PDBID:3CKH) and the crystal structure of the Fab region of IgG (PDBID:2VXT (L chain) and 1FGN (H chain)). Molecular models were constructed using the COOT program (Emsley P. et al., Acta Cryst. D 60: 2126-2132n (2004)) to match the electron density obtained from the determined phase, and structural refinement was performed using the REFMAC program (Murshudov GN, Acta Cryst. D 53:240-255 (1997)). The above structural calculations yielded a composite crystal structure with a resolution of 2.0 Å (R=0.212, Rfree=0.258).

[0151] The crystal structure of the obtained antibody A-Fab / EphA4-LBD complex was analyzed using an interaction detection tool installed in the computational chemistry system MOE 2018.0101 (Chemical Computing Group Inc.), and the amino acid residues on EphA4-LBD that are in direct contact with antibody A-Fab were identified (Figure 10A). The identified amino acid residues are Glu51, Gly52, Ile59, Gln71, Cys73, Asn74, Val75, Met76, Glu77, Thr104, Arg106, Leu111, Pro112, Met115, Arg162, Met164, Cys191, Ala193, and Val195. Figure 10B shows the surface structure of EphA4-LBD created with Maestro (version 11.0, Schrodinger, LLC). As a result, the inventors concluded that the region containing these amino acid residues is the antibody A-Fab binding region in EphA4-LBD.

[0152] Example 1: Preparation of humanized antibody of antibody A Preparation of humanized anti-EphA4 antibodies Variable regions for humanized antibodies were designed. Based on high homology to the framework region (FR) of antibody A, IGHV3-33*03 (SEQ ID NO: 42) and JH6 (SEQ ID NO: 43) were selected from the FRs of human antibodies for the heavy chain, and IGKV1-17*01 (SEQ ID NO: 40) and JK4 (SEQ ID NO: 41) were selected for the light chain as the FRs for humanized antibodies. Subsequently, using a 3D structural prediction model of mouse antibody A, the amino acids in the FRs that interact with the amino acids of the CDR were predicted. These were transplanted along with the CDRs of antibody A (SEQ ID NOs: 44, 27, 28, and 29-31) that have the Y32F mutation in the heavy chain CDR1. HK2-42 (SEQ ID NO: 45) was designed as the heavy chain variable region of the humanized antibody, and L1-8 (SEQ ID NO: 46) was designed as the light chain variable region of the humanized antibody. The amino acid sequences of the transplanted CDRs are shown in Table 2, and the nucleic acid sequences are shown in Table 3.

[0153] The constant region of human IgG2 (SEQ ID NO: 47) was used as the heavy chain constant region. Human Igκ (SEQ ID NO: 48) was used as the light chain constant region. An expression vector (pcDNA3.4) containing the gene sequence encoding the amino acid sequence of the humanized antibody was transfused into Expi293F cells (Gibco / ThermoFisher) using the Expi293 expression system (Gibco / ThermoFisher). The nucleic acid sequence encoding the amino acid sequence of the humanized antibody was as follows: for the heavy chain variable region, the nucleic acid sequence shown in SEQ ID NO: 55 was used; for the light chain variable region, the nucleic acid sequence shown in SEQ ID NO: 56 was used; for the heavy chain constant region, the nucleic acid sequence shown in SEQ ID NO: 57 was used; and for the light chain constant region, the nucleic acid sequence shown in SEQ ID NO: 58 was used. The amino acid sequence of the full-length heavy chain (excluding the signal sequence) of the humanized antibody is the amino acid sequence shown in SEQ ID NO: 59, and the amino acid sequence of the full-length light chain (excluding the signal sequence) is the amino acid sequence shown in SEQ ID NO: 60. The nucleic acid sequence encoding the full-length heavy chain of the humanized antibody is the sequence shown in SEQ ID NO: 61, and the nucleic acid sequence encoding the full-length light chain is the sequence shown in SEQ ID NO: 62. The supernatant was collected, and the humanized antibody (antibody B) of antibody A was purified using MabSelectSuRe (GE Healthcare).

[0154] [Table 2] [Table 3]

[0155] Example 2: Affinity of humanized anti-EphA4 monoclonal antibody against human EphA4 The binding affinity of antibody B obtained in Example 1 to human EphA4 was determined by surface plasmon resonance (SPR) using Biacore T200 (GE Healthcare). First, the anti-His antibody (GE Healthcare, 28-9950-56) was immobilized onto the sensor chip CM5. Immobilization was performed by an amine coupling method using N-hydroxysuccinimide (NHS) and N-ethyl-N'-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC), with ethanolamine used for blocking (all sensor chips and immobilization reagents were manufactured by GE Healthcare). The antibody was diluted to 3.5 μg / mL using immobilization buffer (10 mM sodium acetate, pH 4.5) and immobilized onto the sensor chip according to the protocol provided with the Biacore T200. Human EphA4 extracellular region-SEAP-His10 was diluted with running buffer HBS-EP (GE Healthcare, BR-1001-88) and captured by infusion on a flow cell for 120 seconds (capture volume of approximately 10 RU). Subsequently, antibody B, which had been sequentially diluted using HBS-EP in the range of 100, 50, 25, 12.5, 6.3, 3.2, 1.6, and 0 nM, was added to the sensor chip for 120 seconds, and the binding reaction curves were sequentially observed at the time of addition (conjugation phase, 120 seconds) and after the completion of addition (dissociation phase, 600 seconds). After each observation, the sensor chip was regenerated by adding 4 M MgCl2 (for 60 seconds, Wako Pure Chemical Industries). The obtained binding reaction curves were fitted using a 1:1 binding model with the system's accompanying software, BIA evaluation software, to calculate the affinity for human EphA4 (KD = kd / ka).

[0156] The binding affinity (KD value) of antibody B to human EphA4 is 1.34 × 10⁻⁶. -9 The result was M (Figure 11). Antibody B was found to exhibit almost the same affinity as antibody A before humanization.

[0157] Example 3: EphA4 cleavage-promoting activity of humanized anti-EphA4 monoclonal antibody in hippocampal neurons The EphA4 cleavage-promoting activity of antibody B obtained in Example 1 was evaluated using hippocampal neurons according to the following procedure. Rat hippocampal neurons seeded in 96-welldish (Falcon) were treated with antibody B (2.0, 6.7, 20 nM) and the γ-secretase inhibitor Compound E (50 nM, Enzo Life Sciences). After 24 hours, the cells were washed with PBS (Wako Pure Chemical Industries), and the cells were collected in SDS sample buffer (Laemmli sample buffer (Bio-Rad), 5% 2-mercaptoethanol (Bio-Rad)). The cells were boiled for 5 minutes. SDS-PAGE was performed on these samples, and Western blotting was performed using an anti-EphA4 monoclonal antibody (Abnova). Band intensity was quantified, and the EphA4 C-terminal fragment / full-length EphA4 values ​​were calculated.

[0158] Antibody B promoted EphA4 cleavage in hippocampal neurons in a concentration-dependent manner (Figure 12).

[0159] Example 4: Human EphA4-human ligand binding inhibitory activity of humanized anti-EphA4 monoclonal antibody The inhibitory activity of antibody B obtained in Example 1 on the binding of human EphA4 to human ligands was evaluated according to the following procedure. Anti-alkaline phosphatase antibody (Thermo SCIENTIFIC) was coated onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked at room temperature for 1 hour with 1% Block Ace (DS Pharma Biomedical). After washing three times with 0.05% Tween20 / PBS (Thermo SCIENTIFIC), human EphA4 extracellular region-SEAP-His protein (final concentration 10 nM) was seeded into the wells and incubated at room temperature for 1 hour. After washing three times, ligands and serially diluted antibody B (0, 0.003, 0.01, 0.03, 0.1, 0.3, 1, 3, 10, 30, 100, 300, 1000, 3000 nM) were added to the wells. Biotinylated human Ephrin A5-Fc chimera (R&D Systems, final concentration 0.7 nM) and biotinylated human Ephrin B3-Fc chimera (R&D Systems, final concentration 2.3 nM) were used as ligands. After incubation at room temperature for 1 hour and washing three times, horseradish peroxidase-labeled streptavidin (GE Healthcare) was added and incubated at room temperature for 1 hour. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to the wells and incubated at room temperature for 2-5 minutes. An equal volume of reaction stop solution (1N H2SO4, Wako Pure Chemical Industries) was added to the wells, and the absorbance at 450 nm was read using a microplate reader (Molecular Devices or PerkinElmer).

[0160] Antibody B inhibits the binding of human EphA4 to human ligands in a concentration-dependent manner, and inhibits IC (implantation cell) binding to human EphrinA5 and EphrinB3. 50 The values ​​were approximately 4.9 nM and 1.6 nM, respectively. Therefore, it was found that antibody B strongly inhibits the binding of human EphA4 to human ligands and exhibits inhibitory activity almost equivalent to that of antibody A before humanization (Figure 13).

[0161] Example 5: Inhibitory activity of humanized anti-EphA4 monoclonal antibody on mouse EphA4-mouse ligand binding The inhibitory activity of antibody B obtained in Example 1 on the binding of mouse EphA4 to mouse ligands was evaluated according to the following procedure. Anti-alkaline phosphatase antibody (Thermo SCIENTIFIC) was coated onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked at room temperature for 1 hour with 1% Block Ace (DS Pharma Biomedical). After washing three times with 0.02% Tween20 / PBS (Thermo SCIENTIFIC), mouse EphA4 extracellular region-SEAP-His protein was added to the wells (final concentration 10 nM), and incubated at room temperature for 1 hour. After washing three times, ligands and serially diluted antibody B (0, 0.003, 0.01, 0.03, 0.1, 0.3, 1, 3, 10, 30, 100, 300, 1000, 3000 nM) were added to the wells. Biotinylated mouse EphrinA1-Fc chimera (R&D Systems, final concentration 6 nM) and biotinylated mouse EphrinB2-Fc chimera (R&D Systems, final concentration 2.5 nM) were used as ligands. After incubation at room temperature for 1 hour and washing three times, horseradish peroxidase-labeled streptavidin (GE Healthcare) was added and incubated at room temperature for 1 hour. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to the wells and incubated at room temperature for 2 minutes. An equal volume of reaction stop solution (1N H2SO4, Wako Pure Chemical Industries) was added to the wells, and the absorbance at 450 nm was read using a microplate reader (Molecular Devices or PerkinElmer).

[0162] Antibody B inhibits the binding of mouse EphA4 to mouse ligands in a concentration-dependent manner, and inhibits IC (implantation cell) binding of mouse EphrinA1 and EphrinB2. 50 The values ​​were approximately 8.7 nM and 4.2 nM, respectively. Therefore, it was found that antibody B strongly inhibited the binding of mouse EphA4 to the mouse ligand and exhibited inhibitory activity almost equivalent to that of antibody A before humanization (Figure 14).

[0163] Example 6: Selectivity of humanized anti-EphA4 monoclonal antibody for human Eph receptors Similar to the preparation method for the mouse EphA4 extracellular domain-SEAP-His protein described in Reference Example 1, the signal sequences and DNA sequences encoding the extracellular domains of each human Eph receptor (EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB6) were amplified by RT-PCR using tissue-derived Total RNA and cloned into a pENTR1A vector (Invitrogen / LifeTechnologies) containing the SEAP protein and the DNA sequence encoding the histidine tag. Next, the signal sequences and extracellular regions of each human Eph receptor, along with the DNA sequences encoding the SEAP protein and histidine tag, were transferred to the pcDNA3.1_rfcB vector using the Gateway System (Invitrogen / LifeTechnologies) LR reaction. A vector expressing a protein fused with the SEAP protein and His tag to the extracellular region of each human Eph receptor (referred to as the "Eph receptor extracellular region-SEAP-His protein") was then constructed (referred to as the "Eph receptor extracellular region-SEAP-His protein expression vector").

[0164] Next, human Eph receptor extracellular region-SEAP-His protein expression vectors were introduced into Expi293F cells (Gibco / ThermoFisher) using the Expi293 expression system (Gibco / ThermoFisher). After 5 days of incubation (5% CO2, 37°C), the culture supernatant was collected and centrifuged at 1500 rpm for 5 minutes at room temperature. The supernatant was filtered through a 0.45 μm filter (Millipore).

[0165] The binding activity of antibody B obtained in Example 1 to the human Eph receptor was evaluated according to the following procedure. Rabbit anti-6-His antibody (Bethyl Laboratories) was coated onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked at room temperature for 1 hour with 1% Block Ace (DS Pharma Biomedical). After washing three times with 0.05% Tween20 / PBS (Thermo SCIENTIFIC), human extracellular region-SEAP-His protein (final concentration 1 nM) of each Eph receptor was seeded into each well and incubated at room temperature for 1 hour. After washing three times, human IgG solution (100 μg / mL, Mitsubishi Welpharma) and antibody B (10 μg / mL) were added to the wells and incubated at room temperature for 1 hour. Horseradish peroxidase-labeled donkey anti-human IgG antibody (Jackson ImmunoResearch Laboratories) was added and incubated at room temperature for 1 hour. After washing three times, add TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution to the wells. Once a suitable color development is confirmed, add an equal volume of reaction stop solution (1N H2SO4) to the wells. 4、 Wako Pure Chemical Industries (Wako) was added, and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0166] Antibody B, like antibody A before humanization, was found to specifically bind to human EphA4 within the human Eph receptor family (Figure 15).

[0167] Example 7: Selectivity of humanized anti-EphA4 monoclonal antibody against mouse Eph receptors Following the preparation method for the EphA4 extracellular domain-Fc-His protein described in Reference Example 1, the signal sequences and DNA sequences encoding the extracellular domains of each mouse Eph receptor (EphA1, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB6) were amplified by RT-PCR using tissue-derived Total RNA and cloned into a pENTR1A vector (Invitrogen / LifeTechnologies) containing the Fc region and histidine tag-encoding DNA sequences of human IgG1. Next, the signal sequences and extracellular domains of each mouse Eph receptor (EphA1, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB6), along with the DNA sequences encoding the Fc and histidine tags, were transferred to the pcDNA3.1_rfcB vector using the LR reaction in the Gateway System (Invitrogen / LifeTechnologies) to construct extracellular domain-Fc-His protein expression vectors for each mouse Eph receptor. In constructing the mouse EphA2 extracellular region-Fc-His protein expression vector, the signal sequence and DNA sequence encoding the extracellular region of mouse EphA2 were amplified by RT-PCR using tissue-derived total RNA. These sequences were then cloned into a pcDNA3.1 vector containing DNA sequences encoding Fc and histidine tags to construct the mouse EphA2 extracellular region-Fc-His protein expression vector.

[0168] Next, using the Expi293 expression system (Gibco / ThermoFisher), expression vectors for each mouse Eph receptor extracellular region-Fc-His protein were introduced into Expi293F cells (Gibco / ThermoFisher). After 5 days of culture (5% CO2, 37°C, 120 rpm), the culture supernatant was collected and centrifuged at room temperature at 1500 rpm for 5 minutes. The supernatant was filtered through a 0.45 μm filter (Millipore).

[0169] The binding activity of antibody B to the mouse Eph receptor was evaluated according to the following procedure. Rabbit anti-6-His antibody (Bethyl Laboratories) was coated onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked at room temperature for 1 hour with 1% Block Ace (DS Pharma Biomedical). After washing three times with 0.05% Tween20 / PBS (Thermo SCIENTIFIC), each well was seeded with mouse Eph receptor extracellular region-Fc-His protein (final concentration 1 nM) and incubated at room temperature for 1 hour. After washing three times, human IgG solution (100 μg / mL, Sigma) and antibody B (10 μg / mL) were added to the wells and incubated at room temperature for 1 hour. Horseradish peroxidase-labeled goat anti-human Kappa Light Chain antibody (IBL) was added and incubated at room temperature for 1 hour. After washing three times, add TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution to the wells. Once a suitable color development is confirmed, add an equal volume of reaction stop solution (1N H2SO4) to the wells. 4、 Wako Pure Chemical Industries (Wako) was added, and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0170] Antibody B exhibited specific binding activity only to mouse EphA4 among the mouse Eph receptor family (Figure 16).

[0171] Example 8: Reactivity of humanized anti-EphA4 monoclonal antibody against mouse, rat, monkey, and human EphA4

[0172] The binding activity of antibody B with various EphA4 compounds was evaluated according to the following procedure. Anti-alkaline phosphatase antibody (Thermo SCIENTIFIC) was coated onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked with 1% Block Ace (DS Pharma Biomedical) at room temperature for 1 hour. After washing three times with 0.05% Tween20 / PBS (Thermo SCIENTIFIC), mouse, rat, monkey, and human EphA4 extracellular region-SEAP-His protein (final concentration 1 nM) was seeded into the wells and incubated at room temperature for 1 hour. After washing three times, human IgG solution (100 μg / mL, Mitsubishi Welpharma) and antibody B (0, 0.00013, 0.00064, 0.0032, 0.016, 0.08, 0.4, 2, 10 μg / mL) were added to the wells and incubated at room temperature for 1 hour. Horseradish peroxidase-labeled donkey anti-human IgG antibody (Jackson ImmunoResearch Laboratories) was added and incubated at room temperature for 1 hour. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to the wells. Once a suitable color development was confirmed, an equal volume of stop solution (1N H2SO4, Wako Pure Chemical Industries) was added to the wells, and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0173] Antibody B exhibited comparable binding activity in mice, rats, monkeys, and human EphA4 (Figure 17).

[0174] Example 9: Reactivity of humanized anti-EphA4 monoclonal antibody to the extracellular domain, ligand-binding domain, fibronectin type III domain 1, and fibronectin type III domain 2 of human EphA4. The binding activity of antibody B obtained in Example 1 with various human EphA4 intradomains was evaluated according to the following procedure. Rabbit anti-6-His antibody (Bethyl Laboratories) was coated onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked at room temperature for 1 hour with 1% Block Ace (DS Pharma Biomedical). After washing twice with 0.02% Tween20 / PBS (Nacalai Tesque), human EphA4 extracellular domain-MBP-His protein, human EphA4 ligand-binding domain-MBP-His protein, human EphA4 fibronectin type III domain 1-MBP-His protein, and human EphA4 fibronectin type III domain 2-MBP-His protein (final concentration 10 nM) were seeded into the wells and incubated at room temperature for 1 hour. After washing three times, antibody B (final concentration 10 nM) was added to the wells and incubated at room temperature for 1 hour. Horseradish peroxidase-labeled rabbit anti-human IgG Fcγ fragment antibody (Jackson ImmunoResearch Laboratories) was added and incubated at room temperature for 1 hour. After washing 5 times, TMB (KPL) solution was added to the wells, and after confirming adequate color development, an equal volume of reaction stop solution (2N H2SO4, Wako Pure Chemical Industries) was added to the wells, and the absorbance at 450 nm and 650 nm was read using a microplate reader (PerkinElmer).

[0175] Antibody B exhibited binding activity to the extracellular domain (ECD) and ligand-binding domain (LBD) of human EphA4 (Figure 18). It did not react with fibronectin type III domain 1 (FN1) or fibronectin type III domain 2 (FN2). Therefore, it was found that antibody B specifically binds to the ligand-binding domain of the extracellular domain of human EphA4.

[0176] Example 10: Effect of humanized anti-EphA4 monoclonal antibody on increasing spine number in hippocampal neurons Rat hippocampal neurons were prepared as described in Reference Example 1 (B). The EGFP gene was introduced into rat hippocampal neurons using Nucleofector (Lonza), and the neurons were seeded in 24-well plates (Falcon) containing poly-L-lysine coated coverslips (Matsunami Glass Industry).

[0177] Spine counting using hippocampal neurons was performed according to the following procedure: EGFP-transformed rat hippocampal neurons cultured 13 days prior, seeded in a 24-well plate (Falcon) containing poly-L-lysine coated coverslips (Matsunami Glass Co., Ltd.), were treated with either a control antibody (human IgG2; Sigma) or antibody B (6.7, 20 nM) for 24 hours. Subsequently, the coverslips were transferred to 2% PFA (Wako Pure Chemical Industries) / 4% Sucrose (Wako Pure Chemical Industries) / PBS and allowed to stand for 20 minutes to fix the cells. After removing the fixative, the cells were washed three times with PBS, and then 0.25% TritonX-100 (Wako Pure Chemical Industries) / PBS was added for cell permeabilization for 15 minutes. After removing the liquid, the coverslip was transferred to 2% BSA (Sigma) / 0.25% Triton X-100 / OPTI-MEM (GIBCO), blocked for 1 hour, and then reacted with anti-GFP antibody (Nacalai Tesque) for 1 hour and 30 minutes. After removing the primary antibody solution, the coverslip was washed three times with PBS, and then reacted with the secondary antibody for 1 hour. After removing the secondary antibody solution, the coverslip was washed three times with PBS, Prolong Gold antifade reagent (Molecular probes) was added and the coverslip was mounted and observed with LSM800 (ZEISS). The above experiment was performed three times, and for each experiment, neurons were extracted from two coverslips, and the spines on the dendrites of each neuron were counted using the image analysis software Imaris® (Bitplane), and the number of spines per 10 μm in each neuron was calculated.

[0178] Antibody B increased the number of spines in hippocampal neurons (Figure 19). This result indicates that antibody B has the activity to stabilize spines in hippocampal neurons.

[0179] Example 11: Human EphA4 cleavage-promoting activity of humanized anti-EphA4 monoclonal antibody The cleavage-promoting activity of antibody B obtained in Example 1 against human EphA4 was evaluated according to the following procedure. Rat hippocampal neurons were prepared as described in Reference Example 1 (B). Human EphA4-HA protein expression vectors were introduced into rat hippocampal neurons using Nucleofector (Lonza) and seeded on poly-L-lysine coated 96-well dish (Falcon). The seeded rat hippocampal neurons were treated with antibody B (6.7, 20, 67 nM) and the γ-secretase inhibitor Compound E (50 nM, Enzo Life Sciences) for approximately 24 hours, washed with PBS (Wako Pure Chemical Industries), and the cells were collected by adding SDS sample buffer (Laemmli sample buffer (Bio-Rad), 5% 2-mercaptoethanol (Bio-Rad)) and boiled for 5 minutes. SDS-PAGE was performed on these samples, and Western blotting was performed using rat anti-HA monoclonal antibody (Roche). Band intensity was quantified, and the EphA4 C-terminal fragment / full-length EphA4 values ​​were calculated.

[0180] Antibody B promoted the human EphA4 cleavage reaction in hippocampal neurons (Figure 20).

[0181] Example 12: Involvement of MMP and ADAM in the effect of humanized anti-EphA4 monoclonal antibody on increasing spine number in hippocampal neurons Rat hippocampal neurons were prepared as described in Reference Example 1 (B). The EGFP gene was introduced into some rat hippocampal neurons using Nucleofector (Lonza), and then seeded in 24-well plates (Falcon) containing poly-L-lysine coated coverslips (Matsunami Glass Industry).

[0182] Spine counting using hippocampal neurons was performed according to the following procedure: EGFP-transformed rat hippocampal neurons cultured 13 days prior, seeded in a 24-well plate (Falcon) containing poly-L-lysine coated coverslips (Matsunami Glass Co., Ltd.), were treated for 24 hours with either a control antibody (human IgG2; Sigma) or antibody B (20 nM) and DMSO (Sigma) or GM6001 (2.5 μM, MedChemExpress), an inhibitor of MMP and ADAM. The coverslips were then transferred to 2% PFA (Wako Pure Chemical Industries) / 4% Sucrose (Wako Pure Chemical Industries) / PBS and allowed to stand for 20 minutes to fix the cells. After removing the fixative, the cells were washed three times with PBS, and then 0.25% TritonX-100 (Wako Pure Chemical Industries) / PBS was added for 15 minutes of cell permeabilization. After removing the 0.25% TritonX-100 / PBS, the coverslips were transferred to 2% BSA (Sigma) / 0.25% TritonX-100 / OPTI-MEM (GIBCO), blocked for 1 hour, and then reacted with anti-GFP antibody (Nacalai Tesque) for 1 hour and 30 minutes. After removing the primary antibody solution, the coverslips were washed three times with PBS, and then reacted with the secondary antibody for 1 hour. After removing the secondary antibody solution and washing three times with PBS, Prolong Gold antifade reagent (Molecular probes) was added and the coverslips were mounted and observed with LSM800 (ZEISS). The above experiment was performed three times, and for each experiment, neurons were extracted from two coverslips. The spines on the dendrites of each neuron were counted using the image analysis software Imaris® (Bitplane), and the number of spines per 10 μm in each neuron was calculated.

[0183] The increase in spine number in hippocampal neurons induced by antibody B was inhibited by simultaneous treatment with GM6001 (Figure 21). This result indicates that antibody B has spine-stabilizing activity in hippocampal neurons via MMP and ADAM.

[0184] Example 13: Protective effect of humanized anti-EphA4 monoclonal antibody on human iPS cell-derived motor neurons in an in vitro ALS model. (A) Maintenance culture of human iPS cells The maintenance culture of human iPS cells was performed according to the following procedure: Human iPS cells (201B7) cryopreserved in a stem cell banker (Takara) in liquid nitrogen were removed from the liquid nitrogen layer and suspended in 5 mL of human iPS cell culture medium (Essential 8, Thermofisher Scientific) that had been preheated to 37°C, and then thawed. The cell suspension was collected in a 15 mL conical tube (Thermofisher Scientific), centrifuged at 1000 rpm for 5 minutes at room temperature, the supernatant was removed, and the cells were suspended in fresh medium and preheated to 0.3 μg / cm³. 2 Human iPS cells were seeded in φ60 mm cell culture dishes (Corning) coated with iMatrix-511 (Nippi), and after adding 10 μM Y-27632 (WAKO), they were cultured in a CO2 incubator (37°C, 5% CO2). The culture medium was changed daily, and maintenance culture of human iPS cells was performed by subculturing when subconfluence was reached. Subculturing was performed as follows: The culture medium of subconfluent human iPS cells was aspirated, washed with 2 mL of PBS (WAKO), and then 1 mL of Accutase (Nacalai Tesque) was added and incubated in a CO2 incubator (37°C, 5% CO2) for 5 minutes. Human iPS cells were dissociated into single cells by suspension in 4 mL of human iPS cell culture medium containing 10 μM Y-27632, and then collected in a 15 mL conical tube. The cells were centrifuged at 1000 rpm for 5 minutes at room temperature, and after aspirating the supernatant, human iPS cells were suspended in 1 mL of human iPS cell culture medium containing 10 μM Y-27632. The number of cells was counted, and 2 × 10⁶ cells were obtained. 5 After suspending individual human iPS cells in 4 mL of human iPS cell culture medium, 0.3 μg / cm³ 2 Human iPS cells were seeded in φ60 mm cell culture dishes coated with iMatrix-511 and cultured in a CO2 incubator (37°C, 5% CO2). Human iPS cells that had undergone at least one subculture were used in the experiment.

[0185] (B) Establishment and maintenance of astrocytes The establishment and maintenance culture of astrocytes from neonatal mouse pups was performed according to the following procedure. Two-day-old wild-type mouse pups (C57BL / 6JJmsSlc (Nippon SLC)) and pups of wild-type mice crossed with mutant human SOD1(G93A)Tg-(B6.Cg-Tg(SOD1 G93A)1Gur / J (Jackson Laboratories)) mice were euthanized by decapitation under isoflurane (Intervet) inhalation anesthesia. The cerebral cortex was then isolated and dispersed by treatment with 0.25% trypsin-EDTA (Thermofisher Scientific) at 37°C for 15 minutes. After enzymatic treatment, the cells were diluted with 4 mL of Dulbecco's Modified Eagle Medium (Thermofisher Scientific) (10% FBS-DMEM) containing 10% FBS (Thermofisher Scientific) and 1% penicillin streptomycin (Nacalai Tesque) to stop enzymatic digestion. Then, impurities other than single cells were filtered using a cell strainer (Corning), and the cells were centrifuged at 1500 rpm for 5 minutes. The supernatant was aspirated, and the cells were diluted in 4 mL of fresh 10% FBS-DMEM. Each cell was seeded in a φ60 mm cell culture dish and cultured at 37°C. Two days after seeding, the medium was aspirated, and 4 mL of fresh 10% FBS-DMEM was added to the cells for a medium change. After reaching confluence, subculturing was performed. Subculturing of neonatal mouse astrocytes was carried out as follows. After aspirating 10% FBS-DMEM from confluent astrocytes on a φ60mm cell culture dish, the cells were washed with 2mL of PBS (WAKO), 1mL of 0.25% trypsin-EDTA was added, and the cells were incubated in a CO2 incubator (37°C, 5% CO2) for 3 minutes. The astrocytes were dissociated into single cells by suspension with 3mL of 10% FBS-DMEM and then collected in a 15mL conical tube. The cells were centrifuged at 1500rpm for 3 minutes at room temperature, and the supernatant was aspirated. After adding 8mL of fresh 10% FBS-DMEM to the cells, they were seeded in a φ100mm cell culture dish (passage 1). Passaging was performed in the same manner as above when the cells reached confluence.For subculturing astrocytes cultured in φ100mm cell culture dishes, 4 mL of PBS and 2 mL of 0.25% trypsin-EDTA were used. A portion of the cell suspension was also collected during subculturing and used for genotyping of mutant human SOD1 (G93A). Astrocytes that underwent a total of three subculturings were diluted in Cell Banker (Nippon Zenyaku Kogyo) and frozen at -80°C until test use. For test use, the frozen cell suspensions were thawed in a constant temperature bath and then diluted in 10% FBS-DMEM preheated to 37°C. Each cell suspension was centrifuged (1500 rpm, 3 minutes, room temperature), the supernatant was removed, and the cells were resuspended in fresh medium. They were then seeded in an 8-well chamber (ibidi) and maintained in a CO2 incubator (37°C, 5% CO2).

[0186] Genotyping of mutant human SOD1 (G93A) is performed using REDExtract-N-Amp TM The procedure was performed using a Tissue PCR kit (Sigma). Cell suspensions collected during astrocyte subculture were transferred to 1.5 mL tubes and centrifuged at 1500 rpm for 3 minutes. After centrifugation, the supernatant was aspirated, washed with 1 mL of PBS, centrifuged again, and then aspirated. 50 μL of extraction solution and 12.5 μL of tissue preparation solution were mixed and added to the sample. After mixing, the sample was transferred to a polymerase chain reaction (PCR) tube and subjected to GeneAmp®. The reaction was carried out using PCR system 9700 (Applied biosystems®) at 55°C for 10 minutes and then at 95°C for 3 minutes. After that, 50 μL of the neutralization solution provided with the kit was added to prepare the genomic DNA.

[0187] Genomic PCR was performed using the extracted genomic DNA with the composition shown in Table 4. The primer sequences used for PCR are shown in Table 5. Post-PCR electrophoresis was performed on a 1% agarose gel at 100V for 20 minutes. Cells that showed two bands—an internal standard of 324 bp and a mutant human SOD1 (G93A) of 236 bp—were identified as mutant human SOD1 (G93A) expressing astrocytes.

[0188] [Table 4] Red mix = REDExtract-N-Amp PCR reaction mix.

[0189] [Table 5]

[0190] (C) Evaluation of the protective effect of human iPS cell-derived motor neurons in an in vitro ALS model. The protective effect of human iPS cells on motor neurons in an in vitro ALS model was evaluated according to the following procedure. After obtaining a single-cell suspension of human iPS cells using the same method as in the subculture described in (A) above, the suspension was centrifuged at 1000 rpm for 5 minutes at room temperature, and the supernatant was aspirated. Human iPS cells were suspended in DFK20 medium (DMEM / F12 (Thermofisher Scientific) containing 20% ​​Knockout serum replacement (KSR, Thermofisher Scientific), 1% Non-essential amino acid (NEAA, Thermofisher Scientific), 1% GlutaMAX-I Supplement (Thermofisher Scientific), 100 units / mL penicillin-100 μg / mL streptomycin (Nacalai Tesque), and 100 μM β-mercaptoethanol (Thermofisher Scientific)), and the cell count was measured. 3 × 10 5Human iPS cells were suspended in 2 mL of DFK20 medium containing 10 μM SB431542 (Sigma), 100 nM LDN193189 (Sigma), 3 μM CHIR99021 (Cayman Chemical), and 10 μM Y-27632. The cells were seeded into one well of a low-adhesion 6-well cell culture plate (Corning) and cultured in a CO2 incubator (37°C, 5% CO2). On day 3 of culture, the human iPS cell differentiated cell aggregates (SFEBs) were collected along with the culture medium in a 15 mL conical tube and the cell aggregates were precipitated by centrifugation at 300 rpm for 2 minutes at room temperature. The supernatant was aspirated, and the SFEBs were gently suspended in DFK20 medium containing 10 μM SB431542, 100 nM LDN193189, 3 μM CHIR99021 (Cayman), 5 μM Y-27632, and 1 μM Retinoic Acid (Sigma). The medium was then returned to the original well to perform a medium change. The same method was used for medium change on day 5 of culture. However, the concentration of Y-27632 was increased to 2.5 μM for the medium change (the other compounds were the same as on day 3 of culture). On day 7 of culture, the SFEBs were collected in a 15 mL conical tube along with the medium and allowed to stand at room temperature for 10 minutes to precipitate. The supernatant was aspirated, and the SFEBs were suspended in 3 mL of DFK5 medium (DMEM / F12 containing 5% KSR, 1% NEAA, 1% GlutaMAX-I Supplement, 100 units / mL penicillin-100 μg / mL streptomycin, and 100 μM β-mercaptoethanol) containing 1 μM Retinoic Acid and 1 μM Purmorphamine (Myltenyi Biotech). The suspended SFEBs were returned to the original well and cultured in a CO2 incubator (37°C, 5% CO2). Subsequently, the medium was changed every 2-3 days using the same procedure as on day 7 of culture, and human iPS cells were induced to differentiate into motor neurons. On day 33 of culture, the SFEBs were collected in a 15 mL conical tube along with the medium, and allowed to stand at room temperature for 5 minutes to precipitate. The supernatant was aspirated, 2 mL of Accutase containing 10 μM Y-27632 was added, and the mixture was incubated in a 37°C water bath for 10 minutes.Subsequently, the cell aggregate was dispersed by pipetting 30 times using a P1000 pipette, and the enzymatic reaction was stopped with 10 mL of DFK5 medium containing 10 μM Y-27632. The cell suspension was collected in a new 15 mL conical tube and centrifuged at 1000 rpm for 5 minutes at room temperature, and the supernatant was aspirated. After resuspending the cells in DFK5 medium containing 10 μM Y-27632, filtration was performed using a cell strainer (Corning), and then the cell count was measured. Cells were cultured in Neurobasal medium (Thermofisher Scientific) containing 2% B27 Supplement (Thermofisher Scientific), 10 μM Y-27632, 1% GlutaMax-I Supplement, 100 units / mL penicillin-100 μg / mL streptomycin, totaling 5 × 10⁶ cells. 5 The cells / mL suspension was prepared and divided into a control group, a vehicle-added group, and a drug-treated group. Drug dilution was performed using co-culture medium. After adding the vehicle (co-culture medium) and the drug antibody B to each group, 8 × 10⁶ mouse-derived wild-type astrocytes or mutant human SOD1 (G93A)-expressing astrocytes were added. 4 Cells were seeded at a rate of 200 μL / well in an 8-well chamber, and co-cultured astrocytes and motor neurons were used for evaluation. The number of motor neurons observed in co-culture of wild-type astrocytes and motor neurons was used as a control. In the vehicle-added group and the drug-treated group, mutant human SOD1 (G93A) expressing astrocytes were co-cultured with motor neurons, under the conditions of vehicle addition (1% co-culture medium) and antibody B (10, 30, 100 nmol / L). After culturing for 2 days in a CO2 incubator (37°C, 5% CO2) under each condition, motor neurons were immunocytochemically stained using anti-ISL1 antibody (Abcam) and anti-Human Nuclear Antigen (HNA) antibody (Millipore). ISL1 / HNA co-positive cells per well were counted as viable motor neurons, and motor neuron survival rate was calculated as a percentage of the control. A simple schematic diagram of the evaluation system is shown in Figure 22.

[0191] In a co-culture of mutant human SOD1(G93A)-expressing astrocytes and human iPS cell-derived motor neurons (in vitro ALS model), motor neuron survival was significantly reduced. Antibody B suppressed human iPS cell-derived motor neuron death induced by mutant human SOD1(G93A)-expressing astrocytes in a concentration-dependent manner (Figure 23). These results indicate that antibody B promotes motor neuron survival in the in vitro ALS model.

Claims

1. A pharmaceutical composition for treating amyotrophic lateral sclerosis (ALS), comprising an anti-EphA4 antibody, The aforementioned anti-EphA4 antibody is (a) Heavy chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 44; (b) Heavy chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 27; and (c) A heavy chain containing the heavy chain CDR3 having the amino acid sequence shown in Sequence ID No. 28; and (d) Light chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 29; (e) Light chain CDR2 consisting of the amino acid sequence shown in Sequence ID No. 30; and (f) Light chain containing CDR3, which has the amino acid sequence shown in Sequence ID No. 31 including, Pharmaceutical composition.

2. A pharmaceutical composition according to claim 1, The aforementioned anti-EphA4 antibody is humanized. Pharmaceutical composition.

3. A pharmaceutical composition according to claim 1 or 2, The anti-EphA4 antibody specifically binds to EphA4 and promotes the cleavage of EphA4. Pharmaceutical composition.

4. A pharmaceutical composition according to any one of claims 1 to 3, The anti-EphA4 antibody specifically binds to EphA4 and inhibits the binding of EphA4 to ephrin. Pharmaceutical composition.

5. A pharmaceutical composition according to any one of claims 1 to 4, The heavy chain includes a variable region consisting of the amino acid sequence shown in Sequence ID No.

45. The light chain includes a variable region consisting of the amino acid sequence shown in Sequence ID No.

46. Pharmaceutical composition.

6. A pharmaceutical composition according to any one of claims 1 to 5, The constant region of the heavy chain and the constant region of the light chain include an amino acid sequence derived from a human antibody. Pharmaceutical composition.

7. A pharmaceutical composition according to claim 6, The steady-state region of the heavy chain is the steady-state region of human IgG. Pharmaceutical composition.

8. A pharmaceutical composition according to claim 7, The steady-state region of human IgG is human IgG ２ This is the steady-state region of Pharmaceutical composition.

9. A pharmaceutical composition according to claim 8, The aforementioned human IgG ２ The constant region includes the amino acid sequence shown in SEQ ID NO:

47. Pharmaceutical composition.

10. A pharmaceutical composition according to any one of claims 6 to 9, The constant region of the light chain is the constant region of human Igκ. Pharmaceutical composition.

11. A pharmaceutical composition according to claim 10, The constant region of human Igκ includes the amino acid sequence shown in SEQ ID NO:

48. Pharmaceutical composition.

12. A pharmaceutical composition for treating amyotrophic lateral sclerosis (ALS), comprising an anti-EphA4 antibody, The anti-EphA4 antibody comprises a heavy chain and a light chain. The heavy chain comprises the amino acid sequence shown in Sequence ID No. 59, The light chain comprises the amino acid sequence shown in Sequence ID No. 60, The C-terminal lysine of the heavy chain may be deleted. Pharmaceutical composition.

13. A pharmaceutical composition according to claim 12, The C-terminal lysine of the aforementioned heavy chain is deleted. Pharmaceutical composition.

14. The use of an anti-EphA4 antibody for manufacturing a pharmaceutical composition for the treatment of amyotrophic lateral sclerosis (ALS), The aforementioned anti-EphA4 antibody is (a) Heavy chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 44; (b) Heavy chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 27; and (c) A heavy chain containing the heavy chain CDR3 having the amino acid sequence shown in Sequence ID No. 28; and (d) Light chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 29; (e) Light chain CDR2 consisting of the amino acid sequence shown in Sequence ID No. 30; and (f) Light chain containing CDR3, which has the amino acid sequence shown in Sequence ID No. 31 including, Use of anti-EphA4 antibody.

15. The use of the anti-EphA4 antibody according to claim 14, The heavy chain includes a variable region consisting of the amino acid sequence shown in Sequence ID No.

45. The light chain includes a variable region consisting of the amino acid sequence shown in Sequence ID No.

46. Use of anti-EphA4 antibody.

Images