Mice with a mutant ALK2 gene

Abstract

To provide a rodent that can be used as an animal model reflecting BMP signaling through ALK2 in a primate such as human.SOLUTION: A rodent has a rodent-mutant ALK2 gene having a mutation at a position encoding a 330-th amino acid of an ALK2 protein. In the rodent-mutant ALK2 gene, the 330-th serine in the rodent wild-type ALK2 protein is mutated to an amino acid selected from a group consisting of proline, asparagine, cysteine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, tyrosine, and valine.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to rodents having a mutant ALK2 gene.

Background Art

[0002] Bone Morphogenetic Protein (BMP) is a group of growth factors classified into the Transforming growth factor-β (TGF-β) family. Up to BMP15 has been identified, and they exhibit diverse physiological activities as homo- or hetero-dimers, such as the development and maintenance of locomotor organs such as bone, cartilage, and muscle, and iron metabolism in the liver.

[0003] The activity of the TGF-β family containing BMP is transmitted by seven types of transmembrane serine / threonine kinase receptors called Activin Like Kinase (ALK) 1 to ALK7 expressed on the cell membrane of target cells. However, the activity of the TGF-β family is modified by another transmembrane serine / threonine kinase, type II receptors, and various factors, and there are still many unclear points regarding its physiological effects in vivo.

[0004] ALK2 is a transmembrane serine / threonine kinase receptor that transmits the bone-inductive activity of BMP. ALK2 has been reported to be associated with intractable diseases caused by gene mutations. Examples of diseases caused by such gene mutations include, for example, Fibrodysplasia ossificans progressiva (FOP) in which heterotopic ossification occurs throughout the body, Diffuse idiopathic skeletal hyperostosis (DISH) in which tendons and ligaments ossify, Diffuse Intrinsic Pontine Glioma (DIPG), a pediatric brain tumor, and Congenital heart diseases (CHDs).

[0005] The physiological roles of BMP and TGF-β family activity, the pathogenesis of related diseases, and the development of therapeutic drugs are mainly studied using mice as a model. However, even when mutations from FOP cases are introduced into mouse ALK2, the mice die immediately after birth, making it impossible to establish a disease model as a clinical line (see, for example, Non-Patent Document 1).

[0006] Therefore, there is a strong desire to establish a mouse model that can reflect human ALK2-mediated BMP signaling. [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Chakkalakal SA, Zhang D, Culbert AL, Convente MR, Caron RJ, Wright AC, Maidment AD, Kaplan FS, Shore EM. An Acvr1 R206H knock-in mouse has fibrodysplasia ossificans progressiva. J Bone Miner Res. 2012 Aug;27(8):1746-56. [Overview of the Initiative] [Problems that the invention aims to solve]

[0008] The present invention aims to solve the aforementioned conventional problems and achieve the following objectives. Specifically, the present invention aims to provide a rodent that can be used as an animal model that reflects ALK2-mediated BMP signaling in primates such as humans. [Means for solving the problem]

[0009] As a result of diligent research to achieve the above objective, the present inventors discovered that among the seven types of transmembrane serine / threonine kinase receptors classified as type I, known as ALK1 to ALK7, only ALK2 exhibits a difference in activity between mice and humans, that mouse ALK2 is more active than human ALK2, and that the main reason for this difference is a single amino acid residue at position 330 located in the kinase domain within the cell.

[0010] The means to solve the aforementioned problem are as follows: <1> The rodent mutant ALK2 gene has a mutation at the position encoding the 330th amino acid of the ALK2 protein, The aforementioned rodent mutant ALK2 gene is a rodent characterized by a mutation in which the 330th serine in the rodent wild-type ALK2 protein becomes an amino acid selected from the group consisting of proline, asparagine, cysteine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, tyrosine, and valine. [Effects of the Invention]

[0011] According to the present invention, the aforementioned problems of the conventional era can be solved, and a rodent can be provided that can be used as an animal model that reflects ALK2-mediated BMP signaling in primates such as humans. [Brief explanation of the drawing]

[0012] [Figure 1A] Figure 1A shows the results of measuring the activity of bone-inductive signals (Smad1 / 5 / 9) in Test Example 1. [Figure 1B] Figure 1B shows the results of measuring the activity of non-osteogenic signals (Smad2 / 3) in Test Example 1. [Figure 2A] Figure 2A shows the results of measuring the activity when BMP7 was used in Test Example 2. [Figure 2B]Figure 2B shows the results of measuring the activity when BMP9 was used in Test Example 2. [Figure 3] Figure 3 shows the results of the activity measurement in Test Example 3. [Figure 4] Figure 4 shows the results of analyzing heterotopic bone using micro-CT in Test Example 5. [Figure 5] Figure 5 shows the results of hematoxylin-eosin staining in Test Example 6. [Figure 6] Figure 6 shows the results of the activity measurement in Test Example 7. [Modes for carrying out the invention]

[0013] (rodent) The rodents of the present invention (hereinafter sometimes referred to as "ALK2 S330 substituted rodents," "ALK2 S330 mutant rodents," "ALK2 S330P rodents," or "ALK2 S330P mutant rodents") have a rodent mutant ALK2 gene having a mutation at the position encoding the 330th amino acid of the ALK2 protein, and the rodent mutant ALK2 gene includes at least a mutation in which the 330th serine in the rodent wild-type ALK2 protein becomes an amino acid selected from the group consisting of proline, asparagine, cysteine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, tyrosine, and valine, and may include other mutations as needed.

[0014] <alk2> The ALK2 is a transmembrane serine / threonine kinase receptor that transmits the bone inductive activity of BMP. The ALK2 has been reported to be associated with intractable diseases caused by gene mutations such as FOP, DISH, DIPG, and CHDs.

[0015] The amino acid sequence information of the ALK2 can be obtained from known databases. For example, in the database "National Center for Biotechnology Information (NCBI)", human ALK2 is NP_001096, monkey ALK2 is NP_001247690.1, mouse ALK2 is NP_001103675.1 (Sequence ID 3) and rat ALK2 can be obtained with the accession number of NP_077812.1.

[0016] The 330th amino acid in the amino acid sequence of the ALK2 is serine in rodents, while it is proline in primates, and the two are different. As shown in the items of [Examples] described later, among the seven types of type I receptors, ALK2 has higher activity in rodents such as mice than in primates such as humans.

[0017] The rodents of the present invention have a rodent mutant ALK2 gene having a mutation at the position encoding the 330th amino acid of the ALK2 protein. The rodent mutant ALK2 gene includes at least a mutation in which the 330th serine in the rodent wild-type ALK2 protein becomes an amino acid selected from the group consisting of proline, asparagine, cysteine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, tyrosine, and valine.

[0018] As described above, the amino acid located at the 330th position of the ALK2 protein is different between rodents and primates. Furthermore, as shown in the [Examples] section below, replacing the 330th proline in human ALK2 with serine from rodents (mouse) increases BMP activity, while replacing the 330th serine in mouse ALK2 with human proline, asparagine, cysteine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, tyrosine, or valine decreases BMP activity. Therefore, it is thought that the amino acid located at the 330th position of the ALK2 protein controls its activity. In the rodents of the present invention, the 330th serine in the rodent wild-type ALK2 protein is replaced by an amino acid selected from the group consisting of proline, asparagine, cysteine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, tyrosine, and valine, thereby reflecting ALK2-mediated BMP signaling in primates. Among these mutations, the mutation in which the 330th serine in the rodent wild-type ALK2 protein is replaced by proline is preferred.

[0019] The rodent may be heterozygous or homozygous for the rodent variant ALK2 gene, but it is preferable that it be homozygous.

[0020] The aforementioned rodents can be suitably used as a model that reflects ALK2-mediated BMP signaling in primates. Reflecting ALK2-mediated BMP signaling in primates means that rodents reflect the interaction between ALK2 and its ligand, BMP, as seen in primates. There are no particular restrictions on the type of BMP mentioned above; it can be selected as appropriate depending on the purpose.

[0021] There are no particular restrictions on the species of rodent mentioned above, and they can be appropriately selected depending on the purpose. Examples include mice, rats, gerbils, Okinawa mice, Sikkim mice, and Chinese hamsters. Among these, mice and rats are preferred because they are useful as experimental animals.

[0022] There are no particular restrictions on the primates mentioned above, and they can be appropriately selected depending on the purpose. Examples include humans and monkeys. Among these, humans are preferred.

[0023] As shown in the [Examples] section below, the rodents of the present invention exhibit suppressed ectopic ossification compared to rodents possessing the wild-type ALK2 gene. Furthermore, unlike rodents possessing the wild-type ALK2 gene, lymphocyte infiltration is observed in the liver.

[0024] Other mutations in the aforementioned rodent variant ALK2 gene are not particularly limited and can be appropriately selected depending on the purpose. Examples include gene mutations in diseases caused by gene mutations such as FOP, DISH, DIPG, and CHDs. Since the rodents of the present invention can reflect ALK2-mediated BMP signaling in primates such as humans, by further introducing mutations of hereditary diseases in primates such as humans, they can be used as models that reflect said hereditary diseases.

[0025] The rodents of this invention have a primate-type 330th amino acid in ALK2, resulting in lower activity compared to wild-type rodent ALK2, and thus reflecting ALK2-mediated BMP signaling in primates. Therefore, it is possible to establish disease models of genetic diseases that could not be established in conventional mice.

[0026] There are no particular limitations on the method for producing rodents according to the present invention, and known methods can be appropriately selected. For example, one method is to produce rodents by introducing mutations using genome editing technology with Cas9 protein, guide RNA (rodent ALK2 gene sequence), and donor oligo DNA (derived from the rodent ALK2 gene sequence).

[0027] For example, when using mice as the rodents, one method is to use a guide RNA that targets the sequence represented by, for example, SEQ ID NO: 1, and a donor oligo DNA that uses the sequence represented by SEQ ID NO: 2. In this example, a total of four base mutations are introduced at the chr2: 58,462,951-58,462,959 locus (on the 8th exon of the ALK2 gene). The amino acid sequences at positions 331 and 332 remain Ala-Ile due to synonymous substitution, and Ser at position 330 is replaced with Pro. <Target sequence of guide RNA> 5'-CAGATCTCGATGGGCAATGGcgg-3'(Sequence ID 1: chr2: 58,462,936-58,462,958) The lowercase part (cgg) in sequence number 1 indicates the PAM sequence. <Donor oligoDNA (ssDNA)> 5'-GGTTAGCTGCCTTCGGATTGTACTGTCCATAGCCAGCGGCCTTGCCCATTTGCACATAGAGATATTTGGGACCCAAGGGAAG C C T GC T AT C GCCCATCGAGATCTGAAGAGCAAAAACATCCTGGTGAAGAAGA-3'(Sequence ID 2) The underlined portion in Sequence ID No. 2 indicates the location of the mutation.

[0028] The rodents of this invention enable the analysis of the physiological roles of ALK2-mediated BMP signaling in primates, such as in the musculoskeletal system and liver, and are expected to be applicable to elucidating the pathogenesis of various diseases caused by ALK2 gene mutations, as well as developing therapeutic and preventive drugs for these diseases and fractures. Furthermore, they can be used as experimental animals for pathological models of ectopic ossification caused by FOP, DISH, etc., and DIPG, which result from ALK2 genetic mutations, as well as for analyzing ALK2 signaling. [Examples]

[0029] The following describes some test examples of the present invention, but the present invention is not limited in any way to these test examples.

[0030] (Example 1 of the study: Among the seven types of type I receptors, ALK2 shows higher activity in mice than in humans.) We measured the activity of intracellular signaling mediated by seven type I receptors using a BMP-specific luciferase reporter. Specifically, HEK293A cells were divided into 1 × 10⁶ cells. 4 Cells were seeded into 96-well white plates for luciferase assays (Greiner), and incubated overnight in DMEM medium containing 10% FBS at 37°C and 5% CO2. The following day, pcDEF3 / HitALK1(WT)-V5-His (human wild type, sometimes referred to as "ALK1"), pcDEF3 / HitALK2(WT)-V5-His (human wild type, sometimes referred to as "ALK2"), pcDEF3 / HitALK3(WT)-V5-His (human wild type, sometimes referred to as "ALK3"), pcDEF3 / HitALK4(WT)-V5-His (human wild type, sometimes referred to as "ALK4"), and pcDEF3 / HitALK5 (WT)-V5-His (human wild-type, sometimes referred to as "ALK5"), pcDEF3 / hitoALK6(WT)-V5-His (human wild-type, sometimes referred to as "ALK6"), pcDEF3 / hitoALK7(WT)-V5-His (human wild-type, sometimes referred to as "ALK7"), or pcDEF3 (used to adjust the total plasmid amount to a certain level; sometimes referred to as "mock"), along with pGL4.26 / IdlWT4F-luc (Genes Cells, 7,949 (2002); Biochem Biophys Res Commun, 407, 213 (2011)), and phRL-SV40 (Promega) were introduced using Lipofectamine 2000 (Thermo Fisher Scientific). After 2.5 hours, the following concentrations were obtained: 0.5 ng / mL of BMP9 (manufactured by Peprotech, sometimes referred to as "B9"), 10 ng / mL of BMP7 (manufactured by Miltenyi Biotec, sometimes referred to as "B7"), 10 ng / mL of BMP2 (manufactured by Corefront, sometimes referred to as "B2"), 10 ng / mL of Activin A (manufactured by Peprotech, sometimes referred to as "ActA"), 1 ng / mL of TGF-β1 (manufactured by Peprotech, sometimes referred to as "Tb1"), 10 ng / mL of GDF5 (manufactured by Peprotech, sometimes referred to as "GDF5"), or 10 ng / mL of Activin B (manufactured by Peprotech, sometimes referred to as "ActB").The cells were then replaced with OPTI-MEM I (Thermo Fisher Scientific) containing ) and incubated overnight. The following day, the luciferase activity of Firefly and Renilla was measured using a Dual-Glo Luciferase Assay System (Promega) and a GENios plate reader (TECAN).

[0031] Figure 1A shows the results of measuring the activity of bone-inducible signals (Smad1 / 5 / 9), and Figure 1B shows the results of measuring the activity of non-bone-inducible signals (Smad2 / 3). In Figures 1A and 1B, the items on the horizontal axis represent mocks or each type I receptor, and the bar graphs for each item show the results for mocks, humans, and mice, respectively, from left to right. As shown in Figures 1A and 1B, ALK2, which is involved in the transmission of bone-inducible signals, was found to be several times more active in mice than in humans.

[0032] (Example 2: Amino acid 330 of ALK2 regulates its activity) We measured the activity of intracellular signaling mediated by ALK2 using a BMP-specific luciferase reporter. Specifically, HEK293A cells were divided into 1 × 10⁶ cells. 4 Cells were seeded into 96-well white plates for luciferase assays (Greiner), and incubated overnight in DMEM medium containing 10% FBS at 37°C and 5% CO2. The following day, pcDEF3 / HitALK2(WT)-V5-His (human wild type, sometimes referred to as "human"), pcDEF3 / HitALK2(P330S)-V5-His (modified to mouse type by substituting proline at position 330 with serine in the human wild type, sometimes referred to as "hP330S"), pcDEF3 / mouseALK2(WT)-V5-His (mouse wild type, sometimes referred to as "mouse"), pcDEF3 / mouseALK2(S330P)-V5-His (modified to human type by substituting serine at position 330 with proline in the mouse wild type, sometimes referred to as "mS330P"), or pcDEF3 (used to adjust the total amount of plasmid to a certain level, sometimes referred to as "mock") and pGL4.26 / IdlWT4F-luc (Genes Cells, 7,949 (2002); Biochem Biophys Res Commun, 407, 213 (2011)) and phRL-SV40 (Promega) were introduced using Lipofectamine 2000 (Thermo Fisher Scientific). After 2.5 hours, the culture was changed to OPTI-MEM I (Thermo Fisher Scientific) containing either 10 ng / mL of BMP7 (Miltenyi Biotec) or 0.5 ng / mL of BMP9 (Peprotech), and incubated overnight. The following day, the luciferase activity of Firefly and Renilla was measured using a Dual-Glo Luciferase Assay System (Promega) and a plate reader GENios (TECAN).

[0033] Figure 2A shows the results when using BMP7, and Figure 2B shows the results when using BMP9. In Figures 2A and 2B, the horizontal axis items represent the expression vectors used, and the bar graphs for each item show the results when using control, BMP7, or BMP9, from left to right. As shown in Figures 2A and 2B, it was confirmed that replacing the 330th proline in human ALK2 with a mouse-type serine increased BMP activity, while replacing the 330th serine in mouse ALK2 with a human-type proline decreased BMP activity.

[0034] (Test example 3: Amino acid 330 of ALK2 regulates ligand-dependent activity) We measured ligand-dependent activity mediated by ALK2 using a BMP-specific luciferase reporter. Specifically, HEK293A cells were divided into 1 × 10⁶ cells. 4 Cells were seeded into 96-well white plates for luciferase assays (Greiner), and incubated overnight in DMEM medium containing 10% FBS at 37°C and 5% CO2. The following day, pcDEF3 / hitoALK2(WT)-V5-His (human wild type, sometimes referred to as "hA2WT"), pcDEF3 / hitoALK2(P330S)-V5-His (modified to the mouse type by substituting proline at position 330 with serine in the human wild type, sometimes referred to as "hA2(P330S)"), or pcDEF3 (used to adjust the total plasmid amount to a certain level, sometimes referred to as a "mock"), along with pGL4.26 / IdlWT4F-luc (Genes Cells, 7,949 (2002); Biochem Biophys Res Commun, 407, 213 (2011)), and phRL-SV40 (Promega) were introduced using Lipofectamine 2000 (Thermo Fisher Scientific). After 2.5 hours, the cells were replaced with OPTI-MEM I (Thermo Fisher Scientific) containing 1 ng / mL, 10 ng / mL, or 100 ng / mL of BMP2 (Corefront), BMP4 (R&D), BMP5 (Peprotech), BMP6 (Peprotech), BMP7 (Mi1tenyi Biotec), BMP9 (Peprotech), BMP10 (Mi1tenyi Biotec), GDF5 (Peprotech), or Activin B (Peprotech), and incubated overnight. The following day, the luciferase activity of Firefly and Renilla was measured using a Dual-Glo Luciferase Assay System (Promega) and a GENios plate reader (TECAN).

[0035] The results are shown in Figure 3. In Figure 3, the horizontal axis items represent the various BMPs, GDF5s, and Activin B (Act B) used. The values ​​"1, 10, 100" within each item represent the amount of each BMP, GDF5, and Activin B (Act B) used. The bar graphs for each usage amount show the results when using mock, hA2WT, and hA2 (P330S), respectively, from left to right. As shown in Figure 3, BMP2, 4, and 10 showed decreased activity when both the wild-type (hA2WT) and mutant (hA2(P330S)) were expressed. On the other hand, BMP5, 6, 7, and 9 showed increased activity when the mutant was expressed. Activin B did not respond when expressed in its wild-type form, but it did respond when expressed in its mutant form. These results suggest that mouse ALK2 does not accurately reflect the activity of human ALK2. Therefore, conventional mouse models that introduce mutations for human genetic diseases are likely not accurate models of human genetic diseases.

[0036] BMP7, discovered as an osteoinducing factor and whose clinical application is being developed, is thought to be one of the BMPs that exerts its biological activity using ALK2 as a receptor. It has long been known that BMPs exhibit strong osteoinducing activity in rodents, while their osteoinducing activity is weak in primates, including humans, but the mechanism has not been elucidated. From the above results, it was considered possible that a difference in residue 330 of ALK2 may be influencing the osteoinducing activity of BMPs such as BMP7.

[0037] (Example 4: Establishment of ALK2 S330P mice through genetic modification) We established the ALK2 S330P mutant mouse (a mouse in which the 330th Ser in mouse ALK2 is replaced with human-type Pro) by introducing mutations using genome editing technology (CRISPAR / Cas9) with Cas9 protein, guide RNA (mouse ALK2 gene sequence), and donor oligo DNA (derived from the mouse ALK2 gene sequence). In the ALK2 S330P mouse, a total of 4 nucleotide mutations were introduced at the chr2: 58,462,951-58,462,959 locus (on exon 8 of the ALK2 gene). As a result, the 330th Ser in the ALK2 protein was replaced with Pro (the amino acid sequences at positions 331 and 332 remained Ala-Ile due to synonymous substitution). The established mice showed no macroscopic abnormalities and were able to maintain normal breeding practices. <Target sequence of guide RNA> 5'-CAGATCTCGATGGGCAATGGcgg-3'(Sequence ID 1: chr2: 58,462,936-58,462,958) The lowercase part (cgg) in sequence number 1 indicates the PAM sequence. <Donor oligoDNA (ssDNA)> 5'-GGTTAGCTGCCTTCGGATTGTACTGTCCATAGCCAGCGGCCTTGCCCATTTGCACATAGAGATATTTGGGACCCAAGGGAAG C C T GC T AT C GCCCATCGAGATCTGAAGAGCAAAAACATCCTGGTGAAGAAGA-3'(Sequence ID 2) The underlined portion in Sequence ID No. 2 indicates the location of the mutation.

[0038] (Test example 5: Ectopic ossification is suppressed in ALK2 S330P mice) The effect of ALK2 S330P on ectopic ossification was analyzed using an ectopic ossification model induced by BMP transplantation. BMP7 pellets were prepared by impregnating 2.5 μg of BMP7 (Milteney) into a 4 mm diameter circular piece of CollaTape (Zimmer Dental) and freeze-drying it. ALK2 WT / WT mice (wild-type), ALK2 S330P / WT mice (heterozygous), and ALK2 S330P / S330P mice (homozygous) were subjected to 2% isoflurane inhalation anesthesia, and the thigh was incised, with the BMP7 pellets transplanted into the skeletal muscle. Three weeks after transplantation, ectopic bone was analyzed using micro-CT (CosmoScanGX).

[0039] The results are shown in Figure 4. In Figure 4, the top row (WT / WT) shows the results for three wild-type individuals, the middle row (S330P / WT) shows the results for three heterozygous individuals, and the bottom row shows the results for three homozygous individuals. In Figure 4, the white arrows indicate ectopic bone. As shown in Figure 4, heterozygotes and homozygotes were found to have smaller ectopic bone size compared to the wild type. This result is thought to reflect the decrease in activity observed in the in vitro study described above when serine 330 in mouse ALK2 was replaced with proline.

[0040] (Test Example 6: Phenotypes in the liver of ALK2 S330P mice) Liver tissue samples were collected from ALK2 WT / WT mice (wild-type), ALK2 S330P / WT mice (heterozygous), and ALK2 S330P / S330P mice (homozygous). These samples were fixed in 4% paraformaldehyde-phosphate buffer (Nacalai Tesque) for two days, dehydrated with ethanol, replaced with xylene, and embedded in paraffin. Paraffin sections were prepared using a rotary microtome (Leica), stained with hematoxylin and eosin according to standard procedures, and mounted with coverslips to create tissue specimens. The tissue specimens were observed using a BZ-9000 (Keyence).

[0041] The results are shown in Figure 5. In Figure 5, the top panel (WT / WT) shows the results for three wild-type individuals, the middle panel (S330P / WT) shows the results for three heterozygous individuals, and the bottom panel shows the results for three homozygous individuals. As shown in Figure 5, lymphocyte infiltration was observed in the liver in both heterozygous and homozygous individuals.

[0042] The results of Test Examples 5 and 6 suggest that ALK2 is an important receptor for BMP7-mediated bone induction activity, and also suggest that ALK2 may have unknown physiological effects in tissues such as the liver.

[0043] (Test example 7: Substitution of amino acid 330 in mouse ALK2) The 330th amino acid (serine) in mouse wild-type ALK2 was substituted with the following amino acid, and the activity of intracellular signaling mediated by ALK2 was measured using a BMP-specific luciferase reporter, in the same manner as in Test Example 2. The same test was also performed for mouse wild-type ALK2 without the substitution of the 330th amino acid. <Substituted amino acids> (1) Pro (2) Ala (3) Arg (4) Asn (5) Asp (6) Cys (7) Gln (8) Glu (9) Gly (10) His (11) Ile (12) Leu (13) Lys (14) Met (15) Phe (16) Thr (17) Trp (18) Tyr (19) Val

[0044] Specifically, HEK293A cells were divided into 1 × 10⁶ cells. 4 Cells were seeded into 96-well white plates for luciferase assays (Greiner), and incubated overnight in DMEM medium containing 10% FBS at 37°C and 5% CO2. The following day, pcDEF3 / mouse ALK2(S330 substitution)-V5-His (mouse wild-type with serine at position 330 substituted with the above amino acid), pcDEF3 / mouse ALK2(WT)-V5-His (mouse wild-type with serine at position 330), or pcDEF3 (used to adjust the total plasmid amount to a certain level; sometimes referred to as a "mock"), along with pGL4.26 / IdlWT4F-luc (Genes Cells, 7,949 (2002); Biochem Biophys Res Commun, 407, 213 (2011)), and phRL-SV40 (Promega) were introduced using Lipofectamine 2000 (Thermo Fisher Scientific). After 2.5 hours, the culture was replaced with OPTI-MEM I (Thermo Fisher Scientific) containing 10 ng / mL of BMP7 (Miltenyi Biotec), and incubated overnight. The following day, the luciferase activity of Firefly and Renilla was measured using a Dual-Glo Luciferase Assay System (Promega) and a GENios plate reader (TECAN).

[0045] The results are shown in Figure 6. In Figure 6, the horizontal axis represents the expression vector used. Except for the mock expression, the values ​​are represented by the 330th amino acid in mouse ALK2. As shown in Figure 6, it was confirmed that BMP activity decreased when the 330th serine in mouse ALK2 was replaced with proline, asparagine, cysteine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, tyrosine, and valine.

[0046] The results above suggest that the rodent of the present invention, which contains a mutation in which the 330th serine in the wild-type rodent ALK2 protein becomes an amino acid selected from the group consisting of proline, asparagine, cysteine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, tyrosine, and valine, has the potential to be used as an in vivo model that reflects primate ALK2 with weak BMP activity. A rodent model that reflects BMP signaling in primates such as humans will enable the analysis of the physiological roles of ALK2-mediated BMP signaling in the musculoskeletal system and liver in rodents, and is expected to have applications in elucidating the pathogenesis of various diseases caused by ALK2 gene mutations, as well as in the development of therapeutic and preventive drugs for such diseases and fractures.

[0047] Examples of embodiments of the present invention include the following: <1> The rodent mutant ALK2 gene has a mutation at the position encoding the 330th amino acid of the ALK2 protein, The aforementioned rodent mutant ALK2 gene is a rodent characterized by a mutation in which the 330th serine in the rodent wild-type ALK2 protein becomes an amino acid selected from the group consisting of proline, asparagine, cysteine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, tyrosine, and valine. <2> The aforementioned model reflects ALK2-mediated BMP signaling in primates. <1> It is a rodent as described in [reference]. <3> The above is either a mouse or a rat. <1> from <2> It is a rodent described in one of the following lists. <4> The above-mentioned that heterotopic ossification is suppressed. <1> from <3> It is a rodent described in one of the following lists. <5> Lymphocytes are infiltrating the liver as described above. <1> from <4> It is a rodent described in one of the following lists.

Claims

1. A mouse having a mutant ALK2 gene having a mutation at the position encoding the 330th amino acid of the wild-type ALK2 protein represented by Sequence ID No. 3, The mutant ALK2 gene is characterized by a mouse in which the 330th serine in the wild-type ALK2 protein represented by Sequence ID No. 3 is replaced with an amino acid selected from the group consisting of proline, asparagine, cysteine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, tyrosine, and valine.

2. The mouse according to claim 1, which is a model that reflects ALK2-mediated BMP signaling in primates.

3. The mouse according to claim 1 or 2, wherein ectopic ossification is suppressed.

4. A mouse according to any one of claims 1 to 3, wherein lymphocytes are infiltrated in the liver.

Images