Liver-specific regulatory nucleic acid sequences

Synthetic liver-specific cis-regulating modules and promoters enhance liver-specific gene expression, addressing off-target issues in gene therapy by providing high activity and specificity to the liver.

JP7860164B2Active Publication Date: 2026-05-15ASKBIO UK LTD
View PDF 9 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
ASKBIO UK LTD
Filing Date
2024-05-07
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing gene therapy methods struggle to achieve liver-specific gene expression without off-target effects, particularly when using adenovirus and AAV vectors, which can infect non-liver tissues.

Method used

Development of synthetic liver-specific cis-regulating modules (CRMs) and promoters comprising specific combinations of cis-regulating elements (CREs) that enhance liver-specific gene expression when combined with minimal or liver-specific proximal promoters.

Benefits of technology

The CRMs and promoters provide high levels of liver-specific enhancer activity, minimizing off-target expression and ensuring potent gene expression in the liver.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007860164000056
    Figure 0007860164000056
  • Figure 0007860164000057
    Figure 0007860164000057
  • Figure 0007860164000058
    Figure 0007860164000058
Patent Text Reader

Abstract

To provide regulatory nucleic acids capable of driving liver-specific gene expression.SOLUTION: The present invention relates to regulatory nucleic acid sequences, in particular, liver-specific cis-regulatory elements, cis-regulatory modules, promoters and other such nucleic acid sequences, that are capable of enhancing liver-specific expression of genes. The invention also relates to expression constructs, vectors and cells comprising such liver-specific regulatory nucleic acid sequences, and to methods of using them. The liver-specific regulatory nucleic acid sequences are of particular utility for gene therapy applications, but also find utility in other areas such as bioprocessing and biotechnology.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to regulatory nucleic acid sequences capable of enhancing the liver-specific expression of genes, particularly liver-specific cis-regulatory elements, cis-regulatory modules, promoters, and other such nucleic acid sequences. The invention also relates to expression constructs, vectors, and cells containing such liver-specific regulatory nucleic acid sequences, and methods for using them. Liver-specific regulatory nucleic acid sequences are particularly useful in gene therapy applications, but have also been found to be useful in other fields such as bioprocesses and biotechnology.

Background Art

[0002] The following considerations are provided to assist the reader's understanding of the present disclosure and do not constitute any admission as to the content or relevance of the prior art.

[0003] In numerous fields, including gene therapy, it is desirable to provide regulatory nucleic acid sequences capable of driving the expression of genes to produce protein or nucleic acid expression products in desired cells, tissues, or organs.

[0004] Expression in the liver is of particular interest because it is involved in a wide range of essential functions in the body, including the synthesis of numerous proteins involved in metabolism, hemostasis, and defense against infection. Considering that many diseases are associated with interference with gene expression in the liver, the development of gene therapy strategies in which the expression of transgenes in the liver enables the production of therapeutic expression products is of great interest. Examples of liver diseases associated with abnormal gene expression include hemophilia (including hemophilia A or hemophilia B), familial hypercholesterolemia, ornithine transcarbamylase deficiency, α-antitrypsin deficiency, hepatitis virus infection, non-viral hepatitis, liver cancer, and various other liver diseases (such as non-alcoholic fatty liver disease (NAFLD) and alcohol-related liver disease (ARLD)).

[0005] A major challenge in using gene therapy to treat liver disease is its ability to provide liver-specific (also known as liver-specific) therapeutic gene expression. It is known that mammalian hepatocytes can be targeted by injecting DNA or viral vectors into the liver parenchyma, hepatic artery, or portal vein. Adenovirus vectors have also been reported to primarily target the liver in mice. However, adenovirus vectors can infect other tissues, particularly the lungs and skeletal muscle, leading to "off-target" effects. Some forms of adeno-associated virus vectors (AAVs) or lentiviral vectors preferentially transduce hepatocytes, but this also results in off-target effects.

[0006] Therefore, it is desirable to provide a system for regulating gene expression in a liver-specific manner. Ideally, such a system would be highly specific to the liver (thereby avoiding or minimizing off-target expression in non-target tissues) and potent, i.e., such a system would drive high expression levels in the liver. The use of cis-acting regulatory elements has been proposed to provide both specificity and activity. Typically, this relates to cis-regulating enhancer sequences, i.e., nucleic acid sequences that act cis to increase promoter activity. Enhancers are typically active regardless of their orientation and can act at distances of up to several kilobases from the promoter in some cases, but typically they also act at much closer distances to the promoter.

[0007] Various enhancer sequences for liver-specific gene expression are described in the literature. International Publication Nos. 95 / 011308 and 01 / 098482 describe gene therapy vectors containing a promoter and a hepatocyte-specific apolipoprotein E-hepatocyte regulatory region enhancer linked to the transgene. Other liver-specific constructs are also proposed in the literature, such as an AAT promoter and an albumin enhancer or hepatitis B enhancer, or an alcohol dehydrogenase 6 (ADH6) basic promoter linked to two tandem copies of an apolipoprotein E enhancer element. International Publication No. 2009 / 130208 describes various liver-specific regulatory elements, which are described as advantageous due to their relatively short length. Short regulatory sequences are desirable to minimize the proportion of regulatory sequences in a gene therapy vector. This is especially important for gene therapy vectors with limited capacity (payload), such as AAV vectors.

[0008] In this field, there remains a need for regulatory nucleic acids that can drive liver-specific gene expression. In particular, there is a need for liver-specific regulatory sequences (e.g., cis-regulatory elements and minimal promoter elements or proximal promoter elements) containing such elements that can be incorporated into expression constructs and vectors to express a desired gene (e.g., a therapeutic transgene in the context of gene therapy) in a liver-specific manner, as well as for liver-specific cis-regulatory modules and promoters. [Prior art documents] [Patent Documents]

[0009] [Patent Document 1] International Publication No. 95 / 011308 [Patent Document 2] International Publication No. 01 / 098482 [Patent Document 3] International Publication No. 2009 / 130208

Patent document 4

Patent document 5

Non-licensed literature

[0010]

Non-licensed literature 1

Non-licensed Document 2

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Non-licensed Document 8

Non-licensed literature 9

Non-Patent Document 10

Non-Patent Document 11

Non-Patent Document 12

Non-Patent Document 13

Non-Patent Document 14

Non-Patent Document 15

Non-Patent Document 16

Non-Patent Document 17

Non-Patent Document 18

Non-Patent Document 19

Non-Patent Document 20

Non-Patent Document 21

Non-Patent Document 22

Non-Patent Document 23

Non-Patent Document 24

Non-Patent Document 25

Non-Patent Document 26

Non-Patent Document 27

Non-Patent Document 28

Non-Patent Document 29

Non-Patent Document 30

[0011] In a first aspect of the present invention, - CRE0018 (SEQ ID NO: 1) or its functional variant; - CRE0042 (SEQ ID NO: 2) or its functional variant; - CRE0051 (SEQ ID NO: 3) or its functional variant; - CRE0058 (SEQ ID NO: 4) or its functional variant; - CRE0065 (SEQ ID NO: 5) or its functional variant; - CRE0066 (SEQ ID NO: 7) or its functional variant; - CRE0068 (SEQ ID NO: 10) or its functional variant; and - CRE0074 (SEQ ID NO: 11) or its functional variant A synthetic liver-specific cis-regulating module (CRM) is provided, comprising two or more operably linked cis-regulating elements (CREs) selected from the group consisting of the following.

[0012] In some embodiments, the synthetic liver-specific CRM contains three or more, four or more, five or more, or six or more of the above-mentioned CREs. As will be discussed in more detail below, we have found that these CREs contribute to the activity of the CRM present in the synthetic liver-specific promoter.

[0013] In some embodiments, the synthetic liver-specific CRM of the present invention is - CRE0051 and CRE0058; - CRE0051 and CRE0042; - CRE0051, CRE0058, and CRE0065; - CRE0051, CRE0058, and CRE0066; - CRE0051, CRE0058, CRE0065, and CRE0066; - CRE0018, CRE0051, CRE0058, CRE0065, and CRE0066; - CRE0051, CRE0065, and CRE0066; - CRE0051, CRE0074, and CRE0058; - CRE0051, CRE0074, CRE0058, and CRE0065; - CRE0058 and CRE0065; - CRE0068 and CRE0042; - CRE0058, CRE0065, and CRE0066; - CRE0074, CRE0058, and CRE0065; - CRE0051, CRE0074, CRE0058, CRE0065, and CRE0066; and - CRE0074, CRE0058, CRE0065, and CRE0066 Includes CRE selected from the group consisting of or combinations of their functional variants.

[0014] In any of the CREs disclosed herein or combinations of their functional variants, the described CREs may be present in any order. In some preferred embodiments, the CREs are present in the order described (i.e., from upstream to downstream with respect to their positions on the operably linked promoter element or gene).

[0015] In any of the CREs disclosed herein or combinations of their functional variants, some or all of the described CREs may preferably be arranged adjacent to each other in the CRM (i.e., without any intervening CREs or other regulatory elements). The CREs may be adjacent or not adjacent (i.e., the CREs may be immediately adjacent to each other, or separated by spacers or other sequences). In some preferred embodiments, the CREs or their functional elements are provided in the order described and are adjacent to each other. For example, the synthetic liver-specific regulatory nucleic acid may contain CRE0051 immediately upstream of CRE0058. The CREs may or may not be adjacent. In some embodiments, it is preferable that some or all of the CREs are adjacent.

[0016] We found that CRMs containing the aforementioned combination of CREs, when combined with suitable promoter elements, provide significant liver-specific enhancer activity. Particularly high levels of activity were observed when the CREs were present in the described order and adjacent to each other. Therefore, they represent some preferred CRE "motifs" that typically correlate with high levels of liver-specific promoter activity.

[0017] In some embodiments, the synthetic liver-specific CRM of the present invention is - CRE0051 or its functional variant; - CRE0058 or its functional variant; - CRE0065 or its functional variant; - CRE0066 or its functional variant; and - CRE0074 or its functional variant It includes two, three, four, or more CREs selected from the group consisting of the following.

[0018] In some embodiments, the synthetic liver-specific CRM of the present invention is - CRE0001 (SEQ ID NO: 12) or its functional variant; - CRE0005 (SEQ ID NO: 13) or its functional variant; - CRE0012 (SEQ ID NO: 14) or its functional variant; - CRE0047 (SEQ ID NO: 15) or its functional variant; - CRE0048 (SEQ ID NO: 16) or its functional variant; - CRE0056 (SEQ ID NO: 17) or its functional variant; - CRE0062 (SEQ ID NO: 18) or its functional variant; - CRE0077 (SEQ ID NO: 19) or its functional variant; - CRE0078 (SEQ ID NO: 20) or its functional variant; - CRE0083.1 (SEQ ID NO: 21) or its functional variant; and - CRE0089 (SEQ ID NO: 22) or its functional variant It further includes one or more CREs selected from the group consisting of the following.

[0019] In some preferred embodiments of the present invention, synthetic liver-specific CRM is - CRE0051, CRE0058; - CRE0018, CRE0077, CRE0074, CRE0058, CRE0065; - CRE0068, CRE0042; - CRE0051, CRE0042; - CRE0065, CRE0051, CRE0083.1; - CRE0018, CRE0051, CRE0058, CRE0065, CRE0066; - CRE0012, CRE0051, CRE0058, CRE0065, CRE0066; - CRE0051, CRE0058, CRE0065, CRE0066; - CRE0051, CRE0058, CRE0018; - CRE0051, CRE0058, CRE0065, CRE0018; - CRE0051, CRE0058, CRE0065, CRE0012; - CRE0047, CRE0051, CRE0058, CRE0065, CRE0066; - CRE0051, CRE0074, CRE0058, CRE0065, CRE0066; - CRE0051, CRE0058, CRE0065, CRE0001; - CRE0051, CRE0058, CRE0065; - CRE0051, CRE0066.2; and - CRE0047, CRE0001 Includes CRE selected from the group consisting of or combinations of their functional variants.

[0020] Preferably, the above CREs are present in the synthetic liver-specific CRM in the order described. As described above, in such a synthetic liver-specific CRM, some or all of the described CREs or their functional elements may preferably be adjacent to each other. The CREs may be adjacent or not adjacent. We have found that CRMs containing such combinations of CREs, when combined with a suitable promoter element, provide high levels of liver-specific enhancer activity.

[0021] In some preferred embodiments of the present invention, synthetic liver-specific CRM is - CRE0018, CRE0051, CRE0058, CRE0065, CRE0066 (i.e., CRE derived from SP0239); - CRE0051, CRE0058, CRE0065, CRE0012 (i.e., CRE derived from SP0244); - CRE0051, CRE0058, CRE0065, CRE0066 (i.e., CRE derived from SP0265); and - CRE0051, CRE0042 (i.e., CRE derived from SP0412) Includes CRE selected from the group consisting of or combinations of their functional variants.

[0022] In this case as well, the CREs are preferably present in the order described and preferably arranged adjacent to each other. The CREs may also be adjacent. CRMs containing such combinations of CREs have been found to provide high levels of liver-specific enhancer activity when combined with suitable promoter elements, which is of particular interest.

[0023] In some embodiments of the present invention, the synthetic liver-specific CRM is CRM_SP0109, CRM_SP0112, CRM_SP0113, CRM_SP0121, CRM_SP0124, CRM_SP0127, CRM_SP0127A1, CRM_SP0127V1, CRM_SP0127V2, CRM_SP0128, CRM_SP0131, CRM_SP0132, CRM_SP0133, CRM_SP0239, CRM_SP0240, CRM_SP0241, CRM_SP02 42, CRM_SP0243, CRM_SP0244, CRM_SP0246, CRM_SP0247, CRM_SP0248, CRM_SP0249, CRM_SP0250, CRM_SP0251, CRM_SP0253, CRM_SP 0254, CRM_SP0255, CRM_SP0256, CRM_SP0257, CRM_SP0258, CRM_SP0265, CRM_SP0266, CRM_SP0267, CRM_SP0268, CRM_SP0269, CRM_ SP0270, CRM_SP0271, CRM_SP0272, CRM_SP0273, CRM_SP0368, CRM_SP0373, CRM_SP0378, CRM_SP0379, CRM_SP0380, CRM_SP0381, CR M_SP0384, CRM_SP0396, CRM_SP0397, CRM_SP0398, CRM_SP0403, CRM_SP0404, CRM_SP0405, CRM_SP0406, CRM_SP0407, CRM_SP0409, The CRM comprises a CRM selected from the group consisting of CRM_SP0411, CRM_SP0412, CRM_SP0413, CRM_SP0107, CRM_SP0111, CRM_SP0115, CRM_SP0116, CRM_SP0155, CRM_SP0158, CRM_SP0163, CRM_SP0236, CRM_SP0252, CRM_SP0259, CRM_SP0264, CRM_SP0388, and CRM_SP0399, or any functional variant thereof. Preferably, any functional variant of the above CRM contains a sequence that is at least 70% identical, more preferably at least 80%, 90%, 95%, or 99% identical, to the reference synthetic liver-specific CRM. Sequences and sequence numbers corresponding to such CRMs are shown in Example 1.

[0024] In some embodiments of the present invention, the synthetic liver-specific CRM is CRM_SP0399, CRM_SP0405, CRM_SP0379, CRM_SP0381, CRM_SP0384, CRM_SP0412, CRM_SP0112, CRM_SP0239, CRM_SP0243, CRM_SP0413, CRM_SP0163, CRM_SP0382, CRM_SP0383, CRM_SP0241, CRM_SP0255, CRM_SP0 The CRM comprises a CRM selected from the group consisting of 249, CRM_SP0247, CRM_SP0265, CRM_SP0406, CRM_SP0373, CRM_SP0155, CRM_SP0380, CRM_SP0244, CRM_SP0111, CRM_SP0258, CRM_SP0268, CRM_SP0250, CRM_SP0242, CRM_SP0109, and CRM_SP0259, or any functional variant thereof. Preferably, any functional variant of the above CRM contains a sequence that is at least 70% identical to the reference synthetic liver-specific CRM, more preferably at least 80%, 90%, 95%, or 99% identical to the reference synthetic liver-specific CRM. This group includes synthetic liver-specific CRMs that exhibit very high levels of activity.

[0025] In some embodiments of the present invention, the synthetic liver-specific CRM comprises a CRM selected from the group consisting of CRM_SP0239, CRM_SP0244, CRM_SP0259, CRM_SP0265, and CRM_SP0412, or any functional variant thereof. This group comprises a preferred subset of CRMs derived from synthetic liver-specific promoters exhibiting very high levels of activity. Preferably, any functional variant of the above CRM comprises a sequence that is at least 70% identical to, and more preferably at least 80%, 90%, 95%, or 99% identical to, the reference synthetic liver-specific CRM.

[0026] In a second aspect of the present invention, a) A CRM according to the first embodiment operably connected to a promoter element (preferably a minimal promoter or a liver-specific proximal promoter), or b) The following CREs or their functional variants: - CRE0018 or its functional variant; - CRE0042 or its functional variant; - CRE0051 or its functional variant; - CRE0058 or its functional variant; - CRE0065 or its functional variant; - CRE0066 or its functional variant; - CRE0068 or its functional variant; and - CRE0074 or its functional variant at least one of the following, wherein at least one of the CRE or functional variants thereof is operably connected to a promoter element selected from CRE0059 or a functional variant thereof, or CRE0006 or a functional variant thereof. A synthetic liver-specific promoter containing is provided.

[0027] Suitable promoter elements for use in the synthetic liver-specific promoter of group a) are discussed herein. In non-limiting examples, promoter elements can be selected from CRE0006, CRE0059, CRE0052, CRE0079, CRE0073, and CRE0073.1, or any functional variant thereof.

[0028] In some embodiments, the synthetic liver-specific promoter of b) includes at least two of the described cis-modulatory elements or their functional variants, operably coupled to a promoter element selected from CRE0059 or a functional variant thereof, or CRE0006 or a functional variant thereof. In other words, the synthetic liver-specific promoter of b) may include a CRM according to the first embodiment, operably coupled to a promoter element selected from CRE0059 or CRE0006 (or their functional variants).

[0029] In some embodiments, the synthetic liver-specific promoter of the present invention comprises one of the CREs shown in Table 1 or a combination of their functional variants, operably coupled to a promoter element.

[0030] [Table 1A]

[0031] [Table 1B]

[0032] In this case as well, the CREs are preferably present in the order described and preferably arranged adjacent to one another. The CREs may be adjacent to each other.

[0033] Table 1 shows combinations of two or more CREs selected from CRE0018, CRE0042, CRE0051, CRE0058, CRE0065, CRE0066, CRE0068, and CRE0074, which have been found to provide high levels of liver-specific activity when combined with a suitable promoter element (e.g., a minimal promoter or a liver-specific proximal promoter). These combinations of CREs or their functional variants also represent some preferred embodiments of CRM according to the first aspect of the present invention. The last seven rows show combinations of at least two CREs, including at least one CRE selected from CRE0018, CRE0042, CRE0051, CRE0058, CRE0065, CRE0066, CRE0068, and CRE0074, which have been found to provide high levels of liver-specific activity when combined with a promoter element CRE0059 or CRE0006. These represent additional preferred CRMs according to the present invention.

[0034] In some embodiments, the synthetic liver-specific promoter includes one of the individual CREs or their functional variants, or a combination of CREs or their functional elements, as shown in Table 2, operably coupled to a promoter element selected from CRE0006 or its functional variant, or CRE0059 or its functional variant.

[0035] [Table 2A]

[0036] [Table 2B]

[0037] In this case as well, the CREs are preferably in the order described and preferably adjacent to each other. The CREs may be adjacent. The promoter element is downstream of the CRE and is typically adjacent to the proximal CRE. The promoter element may be adjacent to an adjacent CRE or separated by a spacer.

[0038] Table 2 shows various individual CREs or combinations of CREs selected from CRE0018, CRE0051, CRE0058, CRE0065, CRE0066, CRE0042, CRE0068, and CRE0074 (or their functional variants), which can preferably be provided operably coupled with promoter elements CRE0006 or CRE0059 (or their functional variants) according to some embodiments of the present invention.

[0039] In some embodiments, the synthetic liver-specific promoter includes one of the CREs operably linked to the promoter elements or functional variants thereof as shown in Table 3 below, or a combination of those functional variants.

[0040] [Table 3A]

[0041] [Table 3B]

[0042] In this case as well, the CREs are preferably in the order described and preferably adjacent to each other. The CREs may be adjacent. The promoter element is downstream of the CRE and is typically adjacent to the proximal CRE. The promoter element may be adjacent to an adjacent CRE or separated by a spacer.

[0043] In a further embodiment, a synthetic liver-specific promoter is provided, comprising one of the following CREs or their functional variants, or a combination of CREs or their functional variants, operably coupled to a promoter element or a functional variant thereof as shown in Table 4.

[0044] [Table 4]

[0045] In this case as well, the CREs are preferably in the order described and preferably adjacent to each other. The CREs may be adjacent. The promoter element is downstream of the CRE and is typically adjacent to the proximal CRE. The promoter element may be adjacent to an adjacent CRE or separated by a spacer.

[0046] Table 4 provides further exemplary combinations of CRE and promoter elements that have been found to provide high levels of liver-specific activity. These therefore represent additional, desired synthetic liver-specific promoters.

[0047] In some embodiments of the present invention, the synthetic liver-specific promoter is SP0109, SP0112, SP0113, SP0121, SP0124, SP0127, SP0127A1, SP0127V1, SP0127V2, SP0128, SP0131, SP0132, SP0133, SP0239, SP0240, SP0241, SP0242, SP0243, SP0244, SP0246, SP0247, SP0248, SP0249, SP0250, SP0251, SP0253, SP0254, SP0255, SP0256, SP0257, SP0258, SP0265, SP0266, SP0267, SP0268, SP0269, SP0 The promoter includes a promoter selected from the group consisting of 270, SP0271, SP0272, SP0273, SP0368, SP0373, SP0378, SP0379, SP0380, SP0381, SP0384, SP0396, SP0397, SP0398, SP0403, SP0404, SP0405, SP0406, SP0407, SP0409, SP0411, SP0412, SP0413, SP0107, SP0111, SP0115, SP0116, SP0155, SP0158, SP0163, SP0236, SP0252, SP0259, SP0264, SP0388, and SP0399, or any functional variant thereof. Preferably, any functional variant of the promoter contains a sequence that is at least 70% identical to the reference synthetic liver-specific promoter, and more preferably 80%, 90%, 95%, or 99% identical to the reference synthetic liver-specific promoter. Sequences and sequence numbers corresponding to such promoters are shown in Example 1.

[0048] In some embodiments of the present invention, the synthetic liver-specific promoter is SP0109, SP0112, SP0113, SP0121, SP0124, SP0127, SP0127A1, SP0127V1, SP0127V2, SP0128, SP0131, SP0132, SP0133, SP0239, SP0240, SP0241, SP0242, SP0243, SP0244, SP0246, SP0247, SP0248, SP0249, SP0250, SP0251, SP0253, SP0254, SP0255, SP0256, SP0257, SP0258, SP0265, SP0266, SP0267, SP0268, SP0269, SP0 The promoter includes a promoter selected from the group consisting of 270, SP0271, SP0272, SP0273, SP0368, SP0373, SP0378, SP0379, SP0380, SP0381, SP0384, SP0396, SP0397, SP0398, SP0403, SP0404, SP0405, SP0406, SP0407, SP0409, SP0411, SP0412, SP0413, SP0107, SP0111, SP0115, SP0116, SP0155, SP0158, SP0163, SP0236, SP0252, SP0259, SP0264, SP0388, and SP0399, or any functional variant thereof. Preferably, any functional variant of the promoter contains a sequence that is at least 70% identical to the reference synthetic liver-specific promoter, and more preferably 80%, 90%, 95%, or 99% identical to the reference synthetic liver-specific promoter. Sequences and sequence numbers corresponding to such promoters are shown in Example 1.

[0049] In some embodiments of the present invention, the synthetic liver-specific promoter is SP0399, SP0405, SP0379, SP0381, SP0384, SP0412, SP0112, SP0239, SP0243, SP0413, SP0163, SP0382, SP0383, SP0241, SP0255, SP0249, SP0247, SP0265, SP0406, SP0373, SP0155, SP0380, SP0244, SP0111, SP0258, SP0268, SP0250, The promoter comprises a promoter selected from the group consisting of SP0242, SP0109, SP0259, SP0266, SP0158, SP0398, SP0253, SP0254, SP0257, SP0269, SP0409, SP0127A1, SP0270, SP0378, SP0403, SP0236, SP0248, SP0251, SP0411, SP0271, SP0132, SP0368, SP0246, SP0404, and SP0116, or any functional variant thereof. Preferably, any functional variant of the above promoter comprises a sequence that is at least 70% identical to the reference synthetic liver-specific promoter, more preferably at least 80%, 90%, 95%, or 99% identical to the reference synthetic liver-specific promoter. This group comprises synthetic liver-specific promoters having relatively high levels of activity.

[0050] In some embodiments of the present invention, the synthetic liver-specific promoter includes a promoter selected from the group consisting of SP0399, SP0405, SP0379, SP0381, SP0384, SP0412, SP0112, SP0239, SP0243, SP0413, SP0163, SP0382, SP0383, SP0241, SP0255, SP0249, SP0247, SP0265, SP0406, SP0373, SP0155, SP0380, SP0244, SP0111, SP0258, SP0268, SP0250, SP0242, SP0109, and SP0259, or any functional variant thereof. Preferably, any functional variant of the promoter contains a sequence that is at least 70% identical to the reference synthetic liver-specific promoter, and more preferably 80%, 90%, 95%, or 99% identical to the reference synthetic liver-specific promoter. This group includes synthetic liver-specific promoters having high levels of activity.

[0051] In some embodiments of the present invention, the synthetic liver-specific promoter comprises a promoter selected from the group consisting of SP0239, SP0244, SP0259, SP0265, and SP0412, or any functional variant thereof. This group comprises a particularly preferred subset of synthetic liver-specific promoters having high levels of activity. SP0412 and SP0265 (or any functional variant thereof) are of particular interest given their short lengths (283 and 381 nucleotides, respectively). Furthermore, the in vivo activity of SP0239 and SP0244 has been confirmed to be higher compared to the LP1 promoter.

[0052] According to some embodiments, the synthetic liver-specific promoter is as follows: - CRE0018, CRE0051, CRE0058, CRE0065, CRE0066, CRE0052 (i.e., CRE and promoter elements derived from SP0239); - CRE0051, CRE0058, CRE0065, CRE0012, CRE0006 (i.e., CRE and promoter element CRE derived from SP0244); - CRE0047, CRE0001, CRE0006 (i.e., CRE and promoter elements derived from SP0265); - CRE0051, CRE0058, CRE0065, CRE0066, CRE0052 (i.e., CRE and promoter elements derived from SP0265); and - CRE0051, CRE0042, CRE0059 (i.e., CRE and promoter elements derived from SP0412) Includes a combination of CRE (or any functional variant thereof) and promoter elements (or any functional variant thereof) selected from.

[0053] The synthetic liver-specific promoters SP0109, SP0121, SP0113, and SP0380 were found to exhibit somewhat higher expression in non-liver (HEK293) cells than other synthetic liver-specific promoters disclosed herein. Therefore, in some embodiments where low levels of expression in non-liver cells are particularly important, these promoters or their functional variants may be less desirable. In such cases, synthetic liver-specific promoters that exhibit very low expression in non-liver (HEK293) cells may be particularly preferred.

[0054] In some embodiments of the present invention, the synthetic liver-specific promoter has a nucleotide length of 700 or less, for example, 600, 500, 450, 400, 350, 300, 250, 200, 150, 100, 75, 70, 68, or fewer.

[0055] In a further embodiment, the present invention provides a synthetic liver-specific promoter comprising CRE0006 or a functional variant thereof. CRE0006 may be provided without any operably linked CREs (i.e., the synthetic liver-specific promoter consists essentially of CRE0006), or with operably linked CREs. Surprisingly, CRE0006 has been found to be an active liver-specific promoter by itself (i.e., without any operably linked regulatory sequences; see the results for SP0154 in Example 3), and to provide high levels of activity when combined with one or more liver-specific CREs (e.g., as discussed above). Thus, the present invention also provides a synthetic liver-specific promoter comprising CRE0006 or a functional variant thereof. The present invention also provides a promoter element comprising CRE0006 or a functional variant thereof, optionally having a nucleotide length of 400 or less, preferably 350 or less, more preferably 300 or less, and more preferably 280 or less. The present invention also provides a promoter element comprising CRE0006 or a functional variant thereof.

[0056] In a further embodiment, the present invention provides a synthetic liver-specific promoter comprising CRE0059 or a functional variant thereof. Surprisingly, CRE0059 has been found to provide high levels of activity when combined with one or more liver-specific CREs (e.g., as discussed above). The present invention also provides a promoter element comprising CRE0059 or a functional variant thereof, having a nucleotide length of 350 or less, more preferably 300 or less, more preferably 250 or less, and more preferably 230 or less. The present invention also provides a promoter element comprising CRE0059 or a functional variant thereof.

[0057] In a further embodiment, the present invention provides a synthetic liver-specific promoter comprising CRE0079 or a functional variant thereof. Surprisingly, CRE0079 has been found to provide high levels of activity when combined with one or more liver-specific CREs (e.g., as discussed above). The present invention also provides a promoter element comprising CRE0079 or a functional variant thereof, having a nucleotide length of 200 or less, preferably 150 or less, and more preferably 100 or less. The present invention also provides a promoter element comprising CRE0079 or a functional variant thereof.

[0058] In a further embodiment, the present invention provides a synthetic liver-specific promoter comprising CRE0073 or a functional variant thereof. Surprisingly, CRE0073 has been found to provide high levels of activity when combined with one or more liver-specific CREs (e.g., as discussed above). The present invention also provides a promoter element comprising CRE0073 or a functional variant thereof, having a nucleotide length of 300 or less, more preferably 250 or less, more preferably 200 or less, and more preferably 190 or less. The present invention also provides a promoter element comprising CRE0073 or a functional variant thereof.

[0059] In a further embodiment, the present invention provides a synthetic liver-specific promoter comprising CRE0073.1 or a functional variant thereof. Surprisingly, CRE0073.1 has been found to provide high levels of activity when combined with one or more liver-specific CREs (e.g., as discussed above). The present invention also provides a promoter element comprising CRE0073.1 or a functional variant thereof, having a nucleotide length of 180 or less, more preferably 170 or less. The present invention also provides a promoter element comprising CRE0073.1 or a functional variant thereof.

[0060] In a further embodiment, the present invention provides a synthetic liver-specific promoter comprising CRE0040 or a functional variant thereof. Surprisingly, CRE0040 has been found to provide high levels of activity when combined with one or more liver-specific CREs (e.g., as discussed above). The present invention also provides a promoter element comprising CRE0040 or a functional variant thereof, having a nucleotide length of 400 or less, more preferably 325 or less, more preferably 275 or less, and more preferably 250 or less. The present invention also provides a promoter element comprising CRE0040 or a functional variant thereof.

[0061] In some embodiments of the present invention, the synthetic liver-specific CRM and / or synthetic liver-specific promoter of the present invention does not include CR0077 or its functional variant, nor CR0078 or its functional variant.

[0062] In some embodiments of the present invention, the synthetic liver-specific CRM and / or synthetic liver-specific promoter of the present invention does not contain CRE0052 or its functional variant.

[0063] In further aspects of the present invention, CREs are provided selected from the group consisting of CRE0018, CRE0042, CRE0058, CRE0065, CRE0066, CRE0068, CRE0074, CRE0001, CRE0005, CRE0012, CRE0047, CRE0048, CRE0056, CRE0062, CRE0077, CRE0078, CRE0083.1, and CRE0089, or any functional variants thereof. In some preferred embodiments, CREs are provided selected from the group consisting of CRE0018, CRE0042, CRE0058, CRE0065, CRE0066, CRE0068, and CRE0074, or any functional variants thereof. In further aspects, a synthetic liver-specific CRM or synthetic liver-specific promoter is provided comprising any one or more of the above CREs or their functional variants.

[0064] In a further aspect of the present invention, an expression cassette is provided which comprises the synthetic liver-specific promoter of the present invention operably linked to a sequence encoding an expression product, preferably a gene, such as a transgene.

[0065] In further embodiments, vectors comprising a synthetic liver-specific CRM, a synthetic liver-specific promoter, or an expression cassette according to the present invention are provided. In some embodiments, the vector is an expression vector. In some embodiments, the vector is a viral vector. In some embodiments, the vector is a gene therapy vector, preferably an AAV vector, an adenovirus vector, a retrovirus vector, or a lentivirus vector. The AAV vector is of particular interest.

[0066] In a further embodiment, the present invention provides a vector, preferably a virion (viral particle) containing a viral vector.

[0067] In a further embodiment, a pharmaceutical composition comprising a synthetic liver-specific CRM, a synthetic liver-specific promoter, an expression cassette, a vector, or a virion according to the present invention is provided.

[0068] In further embodiments, synthetic liver-specific regulatory CRMs, synthetic liver-specific promoters, expression cassettes, vectors, virions, or pharmaceutical compositions according to the present invention are provided for use in therapy, i.e., for the prevention or treatment of medical conditions or diseases, preferably abnormal gene expression, optionally associated with abnormal gene expression in the liver. Preferably, this use is for gene therapy, and more preferably for the treatment of diseases involving abnormal gene expression. Preferably, gene therapy includes expressing a therapeutic expression product in the liver.

[0069] In further embodiments, cells comprising a synthetic liver-specific CRM, a synthetic liver-specific promoter, an expression cassette, a vector, or a virion as described herein are provided. In some embodiments, the cells are eukaryotic cells, optionally mammalian cells, and optionally human cells. Preferably, the cells are liver cells, but optionally, the cells are human liver cells. The synthetic liver-specific CRM, synthetic liver-specific promoter, and expression cassette may be present in the vector or in the cell genome.

[0070] In further embodiments, synthetic liver-specific CRMs, synthetic liver-specific promoters, expression cassettes, vectors, virions, or pharmaceutical compositions as described herein are provided for use in the manufacture of pharmaceutical compositions for treating medical conditions or diseases as discussed herein.

[0071] In a further embodiment, a method for producing an expression product is provided, comprising the steps of providing a synthetic liver-specific expression cassette of the present invention to liver cells, and expressing a gene present in the synthetic liver-specific expression cassette. This method may be in vitro, ex vivo, or in vivo. In some embodiments, this method is a bioprocess method.

[0072] In a further embodiment, a method for expressing a therapeutic transgene in liver cells is provided, comprising the step of introducing a synthetic liver-specific expression cassette, vector, or virion as described herein into liver cells.

[0073] In a further embodiment, a method for the treatment of an entity requiring it, preferably a human being, - A step of administering an expression cassette, vector, virion, or pharmaceutical composition as described herein, which includes a sequence encoding a therapeutic product operably linked to a promoter according to the present invention, and - A process of expressing a therapeutic amount of the therapeutic product in the liver of the above target. A method including this is provided.

[0074] In some embodiments, this method - The process of introducing an expression cassette, vector, virion, or pharmaceutical composition containing a gene encoding a therapeutic product, as described herein, into the target liver, and - A process of expressing a therapeutic amount of the therapeutic product in the liver of the above target. Includes.

[0075] Preferably, the method includes the step of administering a vector, virion, or pharmaceutical composition as described herein. In some preferred embodiments, the vector is a viral gene therapy vector, preferably an AAV vector. [Brief explanation of the drawing]

[0076] [Figure 1] This is a schematic diagram of the synthetic liver-specific promoter according to the present invention, and the CRE enhancer element is also shown. [Figure 2]The graph shows the expression levels of luciferase reporter proteins driven by various synthetic liver-specific promoters in the liver-derived cell line Huh7, compared to expression levels driven by the known liver-specific promoter LP1, as well as the ubiquitous CMV-IE promoter and CBA promoter. The CBA (chicken beta-actin) promoter used herein includes the CMV early enhancer + chicken beta-actin proximal promoter + intron. [Figure 3] This is a schematic diagram of a further synthetic promoter according to the present invention, with CRE enhancer elements also shown. These promoters correspond to the promoter in Figure 1, but with the addition of "V1" (LVR_CRE0077_V1), "V2" (or LVR_CRE0078_V2), and "A1" (or LVR_CRE0051_AMBP) CRE enhancers. [Figure 4a] This graph shows the expression levels of the luciferase reporter protein in Huh7 cells, driven by variants of the LVR_127 synthetic liver-specific promoter, namely LVR_127 alone, and LVR_127 with A1, V1, and V2 CRE enhancer elements added immediately upstream of the LVR_127 promoter. In this case, comparisons with the LP1, CMV-IE, and CBA promoters are also shown. [Figure 4b] This graph shows the expression levels of the luciferase reporter protein in Huh7 cells, driven by variants of the LVR_131 synthetic liver-specific promoter, namely LVR_131 alone, and LVR_131 with A1, V1, and V2 CRE enhancer elements added immediately upstream of the LVR_131 promoter. In this case, comparisons with the LP1, CMV-IE, and CBA promoters are also shown. [Figure 4c]This graph shows the expression levels of the luciferase reporter protein in Huh7 cells, driven by variants of the LVR_132 synthetic liver-specific promoter, namely LVR_132 alone, and LVR_132 with A1, V1, and V2 CRE enhancer elements added immediately upstream of the LVR_132 promoter. In this case, comparisons with the LP1, CMV-IE, and CBA promoters are also shown. [Figure 4d] This graph shows the expression levels of the luciferase reporter protein in Huh7 cells, driven by variants of the LVR_133 synthetic liver-specific promoter, namely LVR_133 alone, and LVR_133 with A1, V1, and V2 CRE enhancer elements added immediately upstream of the LVR_133 promoter. In this case, comparisons with the LP1, CMV-IE, and CBA promoters are also shown. [Figure 5] These graphs show the expression levels of luciferase reporter proteins in HEK-293 cells (i.e., non-liver-derived cells) driven by the LVR_127, LVR_131, LVR_132, and LVR_133 synthetic liver-specific promoters and their variants as shown in Figures 4a-4d. Comparisons with the LP1, CMV-IE, and CBA promoters are also shown. [Figure 6] These graphs show the expression levels of luciferase reporter proteins in HeLa cells (i.e., non-liver-derived cells) driven by the LVR_127, LVR_131, LVR_132, and LVR_133 synthetic liver-specific promoters, as well as their variants as shown in Figures 4a-4d. Comparisons with the LP1, CMV-IE, and CBA promoters are also shown. [Figure 7A] This is a schematic diagram of a synthetic liver-specific promoter according to an embodiment of the present invention, and the CRE enhancer element is also shown. [Figure 7B]This is a schematic diagram of a synthetic liver-specific promoter according to an embodiment of the present invention, and the CRE enhancer element is also shown. [Figure 7C] This is a schematic diagram of a synthetic liver-specific promoter according to an embodiment of the present invention, and the CRE enhancer element is also shown. [Figure 8] (Figure 8A) This figure shows the average activity of promoters according to embodiments of the present invention in Huh7 cells normalized to TBG activity. A relative activity of 100 is equal to the activity of TBG. Error bars are the standard error of the mean. If no error bars are present, the results are from a single experiment. Promoters are arranged in terms of relative activity, with the promoter with the highest relative activity shown first. The promoters are members of "Group 1" as defined in Example 3. (Figure 8B) This figure shows the average expression of the promoters presented in Figure 8A in HEK293. The average relative activity of each promoter from different experiments is shown. If no error bars are present, the results are from a single experiment. Specificity has been tested and confirmed for most, but not all, of the promoters presented in Figure 8A. [Figure 9] (Figure 9A) This figure shows the average activity of promoters according to embodiments of the present invention in Huh7 cells normalized to TBG activity. A relative activity of 100 is equal to the activity of TBG. Error bars are the standard error of the mean. If no error bars are present, the results are from a single experiment. Promoters are arranged in terms of relative activity, with the promoter with the highest relative activity shown first. The promoters are members of “Group 1” as defined in Example 3. (Figure 9B) This figure shows the average expression of the promoters presented in Figure 9A in HEK293. The average relative activity of each promoter from different experiments is shown. If no error bars are present, the results are from a single experiment. Specificity has been tested and confirmed for most, but not all, of the promoters presented in Figure 9A. [Figure 10](Figure 10A) This figure shows the average activity of promoters according to embodiments of the present invention in Huh7 cells normalized to TBG activity. A relative activity of 100 is equal to the activity of TBG. Error bars are the standard error of the mean. If no error bars are present, the results are from a single experiment. The promoters are arranged in terms of relative activity, with the promoter with the highest relative activity shown first. The promoters are members of "Group 2" as defined in Example 3. Some of the promoters are also members of "Group 1" as defined in Example 3. (Figure 10B) This figure shows the average expression of the promoters presented in Figure 10A in HEK293. The average relative activity of each promoter from different experiments is shown. If no error bars are present, the results are from a single experiment. Specificity has been tested and confirmed for most, but not all, of the promoters presented in Figure 10A. [Figure 11] (Figure 11A) This figure shows the average activity of promoters according to embodiments of the present invention in Huh7 cells normalized to TBG activity. A relative activity of 100 is equal to the activity of TBG. Error bars are the standard error of the mean. If no error bars are present, the results are from a single experiment. Promoters are arranged in terms of relative activity, with the promoter with the highest relative activity shown first. (Figure 11B) This figure shows the average activity of two promoters containing only promoter elements CRE0006 (SP0154) and CRE0040 (SP0235). (Figure 11C) This figure shows the average expression of the promoters presented in Figure 11A in HEK293. The average relative activity of each promoter from different experiments is shown. If no error bars are present, the results are from a single experiment. Specificity has been tested and confirmed for most, but not all, of the promoters presented in Figure 11A. [Figure 12](Figure 12A) This figure shows the mean relative activity of a large pool of liver-specific promoters (Group "All"), promoters containing at least two "core" CREs ("Group 1"), and promoters containing at least one "core" CRE operably linked to a promoter element selected from CRE0059 or CRE0006 ("Group 2"). The mean relative activity of "Group 1" (n=49) is approximately twice as high as the mean relative activity of Group "All" (n=217). In addition, the mean relative activity of "Group 2" (n=20) is approximately three times higher than the mean relative activity of Group "All" (n=217). Error bars are the standard error of the mean. (Figure 12B) This figure shows the mean relative activity of each promoter divided by its size (in base pairs) for each of Group "All", Group 1, and Group 2. The performance improvements of Group 1 and Group 2 compared to Group "All" persist even when promoter size is taken into account. This indicates that the superior performance of "Group 1" and "Group 2" compared to "all groups" is not due to differences in promoter size between the groups. [Figure 13](Figure 13A) This figure shows the average activity of a promoter with a specific number of core CREs compared to the average activity of a promoter with a specific number of CREs (any CREs). The presence of 1, 2, 3, or 4 core CRE elements is associated with increased activity compared to a promoter with 1, 2, 3, or 4 any CRE elements. The core CREs are the group consisting of CRE0018 (SEQ ID NO: 1), CRE0042 (SEQ ID NO: 2), CRE0051 (SEQ ID NO: 3), CRE0058 (SEQ ID NO: 4), CRE0065 (SEQ ID NO: 5), CRE0066 (SEQ ID NO: 7), CRE0068 (SEQ ID NO: 10), and CRE0074 (SEQ ID NO: 11). (Figure 13B) This figure shows the average activity of a promoter with a specific number of core CREs as a function of size (in base pairs) compared to the average activity of a promoter with a specific number of CREs (any CREs). The presence of 1, 2, 3, or 4 core CRE elements is associated with increased activity as a function of size (bp) compared to a promoter with 1, 2, 3, or 4 any CRE elements. This indicates that the higher activity of a promoter containing a specific number of core CREs compared to a promoter containing a specific number of arbitrary CREs is not due to differences in promoter size. [Figure 14] This figure shows the mean in vivo luciferase expression in mice driven by different promoters. Expression levels are shown as mean bioluminescence total flux (number of photons per second). Error bars are the standard error of the mean. When animals were injected with saline alone (n=10), luciferase bioluminescence was not detected. When animals were injected with a construct containing luciferase operably ligated to the LP1 promoter (n=9), luciferase bioluminescence was detected. To test the activity of some liver-specific promoters, animals were injected with equivalent constructs containing luciferase operably ligated to the SP0244 promoter (n=8) and the SP0239 promoter (n=10). Promoters SP0244 and SP0239 showed higher luciferase expression than the control LP1. [Figure 15](Figure 15A) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0051 and CRE0058 compared to promoters in the "all" group that have any two liver-specific cis-regulating elements. (Figure 15B) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0051 and CRE0058 against size (in base pairs) compared to promoters in the "all" group that have any two liver-specific cis-regulating elements. This indicates that the superior performance of promoters containing the CREs CRE0051 and CRE0058 compared to promoters containing any two liver-specific CREs is not due to differences in promoter size. [Figure 16] (Figure 16A) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0051, CRE0058, and CRE0065 compared to promoters in the group "all" that have any three liver-specific cis-regulating elements. (Figure 16B) This figure shows the average relative activity against size (in base pairs) of promoters containing the combination of cis-regulating elements CRE0051, CRE0058, and CRE0065 compared to promoters in the group "all" that have any three liver-specific cis-regulating elements. This indicates that the superior performance of promoters containing the CREs CRE0051, CRE0058, and CRE0065 compared to promoters containing any three liver-specific CREs is not due to differences in promoter size. [Figure 17](Figure 17A) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0051, CRE0058, and CRE0066 compared to promoters in the group "all" that have any three liver-specific cis-regulating elements. (Figure 17B) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0051, CRE0058, and CRE0066 against size (in base pairs) compared to promoters in the group "all" that have any three liver-specific cis-regulating elements. This indicates that the superior performance of promoters containing the CREs CRE0051, CRE0058, and CRE0066 compared to promoters containing any three liver-specific CREs is not due to differences in promoter size. [Figure 18] (Figure 18A) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0051, CRE0058, CRE0065, and CRE0066 compared to promoters in the group "all" that have any four liver-specific cis-regulating elements. (Figure 18B) This figure shows the average relative activity against size (in base pairs) of promoters containing the combination of cis-regulating elements CRE0051, CRE0058, CRE0065, and CRE0066 compared to promoters in the group "all" that have any four liver-specific cis-regulating elements. This indicates that the superior performance of promoters containing the CREs CRE0051, CRE0058, CRE0065, and CRE0066 compared to promoters containing any four liver-specific CREs is not due to differences in promoter size. [Figure 19](Figure 19A) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0051, CRE0065, and CRE0066 compared to promoters in the group "all" that have any three liver-specific cis-regulating elements. (Figure 19B) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0051, CRE0065, and CRE0066 against size (in base pairs) compared to promoters in the group "all" that have any three liver-specific cis-regulating elements. This indicates that the superior performance of promoters containing cis-regulating elements CRE0051, CRE0065, and CRE0066 compared to promoters containing any three liver-specific cis-regulating elements is not due to differences in promoter size. [Figure 20] (Figure 20A) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0051, CRE0058, and CRE0074 compared to promoters in the group "all" that contain any three liver-specific cis-regulating elements. (Figure 20B) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0051, CRE0058, and CRE0074 against size (in base pairs) compared to promoters in the group "all" that contain any three liver-specific cis-regulating elements. This indicates that the superior performance of promoters containing cis-regulating elements CRE0051, CRE0058, and CRE0074 compared to promoters containing any three liver-specific cis-regulating elements is not due to differences in promoter size. [Figure 21](Figure 21A) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0051, CRE0058, CRE0065, and CRE0074 compared to promoters in the group "all" that have any four liver-specific cis-regulating elements. (Figure 21B) This figure shows the average relative activity against the size (in base pairs) of promoters containing the combination of cis-regulating elements CRE0051, CRE0058, CRE0065, and CRE0074 compared to promoters in the group "all" that have any four liver-specific cis-regulating elements. This indicates that the superior performance of promoters containing cis-regulating elements CRE0051, CRE0058, CRE0065, and CRE0074 compared to promoters containing any four liver-specific cis-regulating elements is not due to differences in promoter size. [Figure 22] (Figure 22A) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0058, CRE0065, and CRE0066 compared to promoters in the group "all" that have any three liver-specific cis-regulating elements. (Figure 22B) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0058, CRE0065, and CRE0066 against size (in base pairs) compared to promoters in the group "all" that have any three liver-specific cis-regulating elements. This indicates that the superior performance of promoters containing cis-regulating elements CRE0058, CRE0065, and CRE0066 compared to promoters containing any three liver-specific cis-regulating elements is not due to differences in promoter size. [Figure 23](Figure 23A) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0058, CRE0065, and CRE0074 compared to promoters in the group "all" that have any three liver-specific cis-regulating elements. (Figure 23B) This figure shows the average relative activity of promoters containing the combination of cis-regulating elements CRE0058, CRE0065, and CRE0074 against size (in base pairs) compared to promoters in the group "all" that have any three liver-specific cis-regulating elements. This indicates that the superior performance of promoters containing cis-regulating elements CRE0058, CRE0065, and CRE0074 compared to promoters containing any three liver-specific cis-regulating elements is not due to differences in promoter size. [Figure 24] (Figure 24A) This figure shows the PWM of HNF1A. (Figure 24B) This figure shows the PWM of HNF1B. [Modes for carrying out the invention]

[0077] CRE and their functional variants: This specification discloses various CREs that can be used to construct liver-specific promoters. These CREs generally derive from genomic promoter and enhancer sequences, but are used herein in contexts quite different from their natural genomic environment. Generally, CREs constitute small portions of much larger genomic regulatory domains that control the expression of the genes they are typically associated with. Surprisingly, we have found that many of these CREs are very small, can be isolated from their natural environment, and retain their liver-specific regulatory activity when used to construct various synthetic promoters. This is surprising because, since extracting regulatory sequences from the complex, "three-dimensional" natural context of the genome often results in significant loss of activity, there is no reason to expect a given CRE to retain its observed activity level when extracted from its natural environment. We have tested numerous combinations of these CREs and found that, when combined with minimal and proximal promoters, they are highly effective in enhancing liver-specific promoter activity. It should be noted that the sequences of the CREs of this invention can be modified without causing substantial loss of activity. Therefore, the functional variants of CRE discussed below can be prepared by modifying the sequence of CRE, provided that modifications significantly detrimental to CRE activity are avoided. Given the information provided in this disclosure, modifying CRE to provide functional variants is not difficult. Furthermore, this disclosure provides a methodology for easily evaluating the functionality of any given CRE variant. Each functional variant of CRE is discussed below.

[0078] The relatively small size of certain CREs according to the present invention is advantageous because it allows for the provision of CREs, more specifically CRE-containing promoters, to a vector while occupying only the minimum payload size of the vector. This is particularly important when using CREs in vectors with limited capacity, such as AAV-based vectors.

[0079] CRE0018, CRE0051, CRE0042, CRE0058, CRE0065, CRE0066, CRE0068, and CRE0074 (or their functional variants) are of particular interest to the present invention because their presence in various combinations has been shown to consistently correlate with highly active liver-specific promoters. Therefore, combinations involving two of these elements are particularly significant. Furthermore, combinations of one of these CREs with promoter elements CRE0006 and CRE0059 have been shown to consistently correlate with highly active liver-specific promoters. While we do not wish to be bound by theory, these CREs are thought to be particularly effective in enhancing liver-specific promoter activity and, in many cases, can act synergistically when combined with CRM / promoters.

[0080] The presence of CRE0001, CRE0005, CRE0012, CRE0047, CRE0048, CRE0056, CRE0062, CRE0077, CRE0078, CRE0083.1, and CRE0089 (or their functional variants) was also found to correlate, albeit to a lower degree, with high liver-specific activity. Therefore, in some cases, the presence of one or more of these CREs is preferable. While we do not wish to be bound by theory, it is thought that these CREs are somewhat effective in enhancing liver-specific promoter activity and may act synergistically in CRM / promoters when combined with one or more of the CREs mentioned above.

[0081] As discussed in some detail below, the CRE of the present invention includes a specific liver-specific TFBS. Generally, in functional variants of CRE, it is desirable that these liver-specific TFBS remain functional. Those skilled in the art will know that TFBS sequences can change while retaining their function. With this in mind, typically, the sequence of a TFBS is described by a consensus sequence, which typically has a certain degree of variation. Further information regarding the variation occurring in the TFBS can be described using a position-weight matrix (PWM) that represents the frequency with which a given nucleotide is typically found at a given position in the consensus sequence. Details of TF consensus sequences and associated position-weight matrices can be found, for example, in the Jaspar or Transfac databases (http: / / jaspargenereg.net / and http: / / gene-regulation.com / pub / databases.html). With this information, those skilled in the art will know that it is possible to modify the sequence of any given TFBS of CRE in a manner that retains, and in some cases enhances, the functionality of the CRE. For example, considering the TFBS of HNF1 found in CRE0079 as shown below, the TFBS of HNF1 in CRE0079 has the sequence GTTATTTATAAC (sequence number 98). The PWM of HNF1 is shown in Figure 24 (HNF1 has two subfamily members, HNF1A and HNF1B, and their TFBS PWMs are very similar. The PWMs of both the HNF1A and HNF1B isoforms are shown in Figures 24A and 24B, respectively). Given this, those skilled in the art will have sufficient guidance on how the TFBS of HNF1 can be modified while maintaining its ability to bind to the desired TF. For example, the Jaspar system would score the estimated TFBS based on its similarity to a given PWM. Furthermore, all TFBS can be identified / analyzed by scanning the CRE for all PWMs in the JASPAR database.Of course, those skilled in the art can find additional guidance in the literature and, furthermore, use routine experimental procedures to confirm TF binding to putative TFBS in any variant CRE. In this example, HNF1 was considered, but those skilled in the art can similarly consider other TFs and TFBS mentioned herein. It will be clear that significant sequence modifications to CRE can occur even within the TFBS of CRE while maintaining function.

[0082] CRE0018 and its functional variants: CRE0018 has the sequence shown in sequence number 1.

[0083] Functional variants of CRE0018 are regulatory elements that differ from CRE0018 but have a sequence that substantially retains its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not substantially render the CRE nonfunctional.

[0084] In some embodiments, a functional variant of CRE0018 can be considered a CRE that substantially retains its activity even when substituted for CRE0018 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0018 substituted for CRE0018 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0018). For example, considering promoter SP0239, CRE0018 in SP0239 can be replaced with a functional variant of CRE0018, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0085] In some embodiments, a functional variant of CRE0018 includes the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0018. The liver-specific TFBS present in CRE0018, listed in order of their presence, are IRF, NF1, HNF3, HBLF, RXRa, EF-C, NF1, and c / EBP. Therefore, a functional variant of CRE0018 preferably includes all of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0018, i.e., IRF, NF1, HNF3, HBLF, RXRa, EF-C, NF1, and then c / EBP. When CRE is associated with a promoter and a gene, this order is preferably considered to be in an upstream-to-downstream direction (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, the TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0086] In some embodiments, functional variants of CRE0018 include the following TFBS sequences: CTTTCACTTTC(IRF), TCGCAA(NF1), TGTGTAAACA(HNF3), TGTAAACAATA(HBLF), CTGAACCTTTACCC(RXRa), GTTGCCCGGCAAC(EF-C), CAGGTCTGTGCCAAG(NF1), TGCCAAGTGTTTG(c / EBP), complementary sequences thereto, or functional variants of such TFBS sequences that maintain the ability to bind to each TF (see Table 9 for TFBS sequence numbers). These may exist in the same order as CRE0018, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBS, and that a given TFBS typically has a consensus sequence, from which there is typically some degree of deviation.

[0087] In some embodiments of the present invention, a functional variant of CRE0018 is the following sequence: The sequence CTTTCACTTTCTCGCCAA-Na-TGTGTAAACAATA-Nb-CTGAACCTTTACCC-Nc-GTTGCCCGGCAAC-Nd-CAGGTCTGTGCCAAGTGTTTG (Sequence ID 268) or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto, In the sequence, Na, Nb, Nc, and Nd represent optional spacer sequences. If present, Na is optional and has a length of 10 to 20 nucleotides, preferably 13 to 17 nucleotides, more preferably 15 nucleotides. If present, Nb is optional and has a length of 1 to 10 nucleotides, preferably 1 to 5 nucleotides, more preferably 1 nucleotide. If present, Nc is optional and has a length of 1 to 10 nucleotides, preferably 1 to 5 nucleotides, more preferably 1 nucleotide. If present, Nd is optional and has a length of 1 to 10 nucleotides, preferably 2 to 8 nucleotides, more preferably 3 nucleotides.

[0088] In some embodiments, a functional variant of CRE0018 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 1, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 1. In addition to or instead of this, a functional variant of CRE0018 preferably includes a sequence that hybridizes with SEQ ID NO: 1 under stringent conditions.

[0089] In some embodiments of the present invention, the cis-adjustment enhancer element consists of SEQ ID NO: 1 or a functional variant thereof.

[0090] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, the complementary and reverse complementary sequences of SEQ ID NO: 1 or their functional variants fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 1 or its functional variants also fall within the scope of the present invention.

[0091] In some preferred embodiments, a CRE is provided that comprises or consists of CRE0018 or a functional variant thereof, having a nucleotide length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 103 or fewer nucleotides.

[0092] CRE0042 and its functional variants: CRE0042 has the sequence shown in sequence number 2.

[0093] Functional variants of CRE0042 are regulatory elements that differ from CRE0042 but have a sequence that substantially retains its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not substantially render the CRE nonfunctional.

[0094] In some embodiments, a functional variant of CRE0042 can be considered a CRE that substantially retains its activity even when substituted for CRE0042 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0042 substituted for CRE0042 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0042). For example, considering promoter SP0239 as an example, CRE0042 in SP0380 can be replaced with a functional variant of CRE0042, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0095] In some embodiments, a functional variant of CRE0042 includes the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0042. The liver-specific TFBS present in CRE0042, listed in order of their presence, are HNF-3, C / EBP, HNF-4, and C / EBP. Therefore, a functional variant of CRE0042 preferably includes all of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0042, i.e., HNF-3, C / EBP, HNF-4, and then C / EBP. When cis-regulatory elements are associated with promoters and genes, this order is preferably considered to be upstream-to-downstream (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0096] In some embodiments, functional variants of CRE0042 include the following TFBS sequences: GTTCAAACATG(HNF-3), CTAATACTCTG(C / EBP), TGCAAGGGTCAT(HNF-4), and TTACTCAACA(C / EBP), and sequences complementary to them, or functional variants of such TFBS sequences that maintain the ability to bind to each TF (see Table 10 for sequence numbers). These may exist in the same order as CRE0042, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBSs, and that a given TFBS typically has a consensus sequence, and typically there is some degree of deviation from there.

[0097] In some embodiments of the present invention, a functional variant of CRE0042 is the following sequence: The sequence includes GTTCAAACATG-Na-CTAATACTCTG-Nb-TGCAAGGGTCAT-Nc-TTACTCAACA (SEQ ID NO: 269) or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto. In the sequence, Na, Nb, and Nc represent optional spacer sequences. If present, Na is optional and has a length of 10 to 20 nucleotides, preferably 1 to 5 nucleotides, more preferably 2 nucleotides. If present, Nb is optional and has a length of 1 to 10 nucleotides, preferably 2 to 6 nucleotides, more preferably 4 nucleotides. If present, Nc is optional and has a length of 8 to 23 nucleotides, preferably 10 to 20 nucleotides, more preferably 15 nucleotides.

[0098] In some embodiments, a functional variant of CRE0042 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 2, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 2. In addition to or instead of this, a functional variant of CRE0042 preferably includes a sequence that hybridizes to SEQ ID NO: 2 under stringent conditions.

[0099] In some embodiments of the present invention, the cis-adjustment enhancer element consists of CRE0042 or a functional variant thereof.

[0100] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, the complementary and reverse complementary sequences of SEQ ID NO: 2 or their functional variants fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 2 or its functional variants also fall within the scope of the present invention.

[0101] In some preferred embodiments, a CRE is provided that comprises or consists of CRE0042 or a functional variant thereof, having a nucleotide length of 200 or less, 150 or less, 125 or less, 100 or less, or 80 or less.

[0102] CRE0051 and its functional variants: CRE0051 (also known as A1 or alpha-mic / bik) has the sequence shown in sequence number 3.

[0103] Functional variants of CRE0051 are regulatory elements that differ from CRE0051 but have a sequence that substantially retains its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not substantially render the CRE nonfunctional.

[0104] In some embodiments, a functional variant of CRE0051 can be considered a CRE that substantially retains its activity even when substituted for CRE0051 in a CRM or promoter. For example, a liver promoter containing a functional variant of CRE0051 substituted for CRE0051 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100%. For example, considering promoter SP0373 as an example, CRE0051 in SP0239 can be replaced with a functional variant of CRE0051, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0105] In some embodiments, a functional variant of CRE0051 includes the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0051. The liver-specific TFBS present in CRE0051, listed in order of their presence, are HNF1, HNF4, HNF3, HNF1, and HNF3. Therefore, a functional variant of CRE0051 preferably includes all of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0051, i.e., HNF1, HNF4, HNF3, HNF1, and then HNF3. When cis-regulatory elements are associated with promoters and genes, this order is preferably considered to be in an upstream-to-downstream direction (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0106] In some embodiments, functional variants of CRE0051 include the following TFBS sequences: GTTATTTTTAAA(HNF1), GTGGCCCTTGG(HNF4), TGTTTGC(HNF3), TGGTAATAATCTCA(HNF1), then ACAAACA(HNF3), complementary sequences thereto, or functional variants of such TFBS sequences that maintain the ability to bind to each TF (see Table 11 for TFBS sequence numbers). These may exist in the same order as CRE0051, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBS, and that a given TFBS typically has a consensus sequence, from which there is typically some degree of deviation.

[0107] In some embodiments of the present invention, a functional variant of CRE0051 is the following sequence: The sequence includes GTTAATTTTTAAA-Na-GTGGCCCTTGG-Nb-TGTTTGC-Nc-TGGTTAATAATCTCA-Nd-ACAAACA (SEQ ID NO: 270), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto. In the sequence, Na, Nb, Nc, and Nd represent optional spacer sequences. If present, Na is optional and has a length of 10 to 26 nucleotides, preferably 14 to 22 nucleotides, and more preferably 18 nucleotides. If present, Nb is optional and has a length of 8 to 22 nucleotides, preferably 12 to 20 nucleotides, and more preferably 16 nucleotides. If present, Nc is optional and has a length of 1 to 10 nucleotides, preferably 1 to 5 nucleotides, and more preferably 2 nucleotides. If present, Nd is optional and has a length of 1 to 13 nucleotides, preferably 2 to 9 nucleotides, and more preferably 5 nucleotides.

[0108] In some embodiments, a functional variant of CRE0051 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 3, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 3. In addition to or instead, a functional variant of SEQ ID NO: 3 preferably includes a sequence that hybridizes to SEQ ID NO: 3 under stringent conditions.

[0109] In some embodiments of the present invention, the cis-adjustment enhancer element consists of SEQ ID NO: 3 or a functional variant thereof.

[0110] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, the complementary and reverse complementary sequences of SEQ ID NO: 3 or their functional variants fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 3 or its functional variants also fall within the scope of the present invention.

[0111] In some preferred embodiments, a CRE is provided that includes or comprises CRE0051 or a functional variant thereof, having a nucleotide length of 200 or less, 150 or less, 125 or less, or 100 or less.

[0112] CRE0058 and its functional variants: CRE0058 has the sequence shown in sequence number 4.

[0113] Functional variants of CRE0058 are regulatory elements that differ from CRE0058 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0114] In some embodiments, a functional variant of CRE0058 can be considered a CRE that substantially retains its activity even when substituted for CRE0058 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0058 substituted for CRE0058 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0058). For example, considering promoter SP0373, CRE0058 in SP0373 can be replaced with a functional variant of CRE0058, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0115] In some embodiments, functional variants of CRE0058 (SEQ ID NO: 4) preferably contain the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0058. The liver-specific TFBS present in CRE0058 are, listed in order of their presence, HNF4 and c / EBP. Therefore, functional variants of CRE0058 preferably contain all of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0058, i.e., HNF4 followed by c / EBP. When cis regulatory elements are associated with promoters and genes, this order is preferably considered to be upstream-to-downstream (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0116] In some embodiments, functional variants of CRE0058 include the following TFBS sequences: CGCCCTTTGGACC(HNF4) and GACCTTTTGCAATCCTGG(c / EBP), complementary sequences thereto, or functional variants of such TFBS sequences that maintain the ability to bind to each TF (see Table 12 for TFBS sequence numbers). These may exist in the same order as CRE0058, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBS, and that a given TFBS typically has a consensus sequence, from which there is typically some degree of deviation.

[0117] In some embodiments of the present invention, a functional variant of CRE0058 is the following sequence: The sequence includes GCGCCCTTTGGACCTTTTGCAATCCTGG (sequence number 271), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto.

[0118] In some embodiments, a functional variant of CRE0058 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 4, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 4. In addition to or instead, a functional variant of CRE0058 preferably includes a sequence that hybridizes to SEQ ID NO: 4 under stringent conditions.

[0119] In some embodiments of the present invention, the cis-adjustment enhancer element consists of SEQ ID NO: 4 or a functional variant thereof.

[0120] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, the complementary and reverse complementary sequences of SEQ ID NO: 4 or their functional variants fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 4 or its functional variants also fall within the scope of the present invention.

[0121] In some preferred embodiments, a CRE is provided that includes or comprises CRE0058 or a functional variant thereof, having a nucleotide length of 120 or less, 80 or less, 60 or less, or 40 or less.

[0122] CRE0065 and its functional variants: CRE0065 (also known as LVR_CRE0065_APOA1) has the sequence shown in sequence number 5.

[0123] Functional variants of CRE0065 are regulatory elements that differ from CRE0065 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0124] In some embodiments, a functional variant of CRE0065 can be considered a CRE that substantially retains its activity even when substituted for CRE0065 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0065 substituted for CRE0065 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0065). For example, considering promoter SP0239 as an example, CRE0065 in SP0239 can be replaced with a functional variant of CRE0065, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0125] In some embodiments, functional variants of CRE0065 preferably include the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0065. The liver-specific TFBS present in CRE0065, listed in order of their presence, are RXR-alpha, HNF3, and HNF3. Therefore, functional variants of CRE0065 preferably include all of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0065, i.e., RXR-alpha, HNF3, and then HNF3. When cis-regulatory elements are associated with promoters and genes, this order is preferably considered to be in an upstream-to-downstream direction (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0126] In some embodiments, functional variants of CRE0065 include the following TFBS sequences: ACTGAACCCTTGACCCCTGCCCT(RXR alpha), CTGTTTGCCC(HNF3), and CTATTTGCCC(HNF3), complementary sequences, or functional variants of such TFBS sequences that maintain the ability to bind to each TF (see Table 13 for TFBS sequence numbers). These may exist in the same order as CRE0065, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBS, and that a given TFBS typically has a consensus sequence, from which there is typically some degree of deviation.

[0127] In some embodiments of the present invention, a functional variant of CRE0065 is the following sequence: The sequence includes ACTGAACCCTTGACCCCT-Na-CTGTTTGCCC-Nb-TATTTGCCC (Sequence ID 272), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto. In the sequence, Na and Nb represent optional spacer sequences. If present, Na is optional and has a length of 14 to 30 nucleotides, preferably 18 to 26 nucleotides, more preferably 22 nucleotides. If present, Nb is optional and has a length of 1 to 10 nucleotides, preferably 2 to 6 nucleotides, more preferably 4 nucleotides.

[0128] In some embodiments, a functional variant of CRE0065 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 5, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 5. In addition to or instead, a functional variant of CRE0065 preferably includes a sequence that hybridizes to SEQ ID NO: 5 under stringent conditions.

[0129] In some embodiments of the present invention, the cis-adjustment enhancer element consists of SEQ ID NO: 5 or a functional variant thereof.

[0130] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, the complementary and reverse complementary sequences of SEQ ID NO: 5 or their functional variants fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 5 or its functional variants also fall within the scope of the present invention.

[0131] In some preferred embodiments, a CRE is provided that comprises or consists of CRE0065 or a functional variant thereof, having a nucleotide length of 200 or less, 150 or less, 125 or less, 90 or less, or 72 or less.

[0132] CRE0065.1 and its functional variants: CRE0065.1 (also known as LVR_CRE0065_APOA1_v1) has the sequence as shown in Sequence ID No. 6. CRE0065.1 contains the entirety of CRE0065 plus 34 additional nucleotides at the 3' end. CRE0065.1 can be considered a longer functional equivalent of CRE0065.

[0133] Functional variants of CRE0065.1 are regulatory elements that differ from CRE0065.1 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0134] In some embodiments, a functional variant of CRE0065.1 can be considered a CRE that substantially retains its activity even when substituted for CRE0065.1 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0065.1 substituted for CRE0065.1 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0065.1). For example, considering promoter SP0127A1, CRE0065.1 in SP0127A1 can be replaced with a functional variant of CRE0065.1, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0135] In some embodiments, functional variants of CRE0065.1 preferably include the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0065.1. The liver-specific TFBS present in CRE0065.1, listed in order of their presence, are RXR-alpha, HNF3, HNF3, and HNF4 (i.e., CRE0065.1 includes an additional HNF4 TFBS compared to CRE0065). Therefore, functional variants of CRE0065.1 preferably include all of these TFBS. Preferably, the TFBS are present in the same order as in CRE0065.1, i.e., RXR-alpha, HNF3, HNF3, and then HNF4. When cis-regulatory elements are associated with promoters and genes, this order is preferably considered to be in an upstream-to-downstream direction (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, the TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0136] In some embodiments, functional variants of CRE0065.1 include the following TFBS sequences: ACTGAACCCTTGACCCCTGCCCT(RXR alpha), CTGTTTGCCC(HNF3), CTATTTGCCC(HNF3), and TGATCCTTGAACTCT(HNF4), complementary sequences thereto, or functional variants of these TFBS sequences that maintain the ability to bind to each TF (see Table 14 for TFBS sequence numbers). These may exist in the same order as CRE0065.1, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBS, and that a given TFBS typically has a consensus sequence, and typically there is some degree of deviation from there.

[0137] In some embodiments of the present invention, a functional variant of CRE0065.1 is the following sequence: The sequence includes ACTGAACCCTTGACCCCT-Na-CTGTTTGCCC-Nb-TATTTGCCC-Nc-TGATCCTTGAACTCT (Sequence ID 273), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto. In the sequence, Na, Nb, and Nc represent optional spacer sequences. If present, Na is optional and has a length of 14 to 30 nucleotides, preferably 18 to 26 nucleotides, more preferably 22 nucleotides. If present, Nb is optional and has a length of 1 to 10 nucleotides, preferably 2 to 6 nucleotides, more preferably 4 nucleotides. If present, Nc is optional and has a length of 9 to 25 nucleotides, preferably 13 to 21 nucleotides, more preferably 17 nucleotides.

[0138] In some embodiments, a functional variant of CRE0065.1 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 6, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 6. In addition to or instead of this, a functional variant of CRE0065.1 preferably includes a sequence that hybridizes to SEQ ID NO: 6 under stringent conditions.

[0139] In some embodiments of the present invention, the cis-adjustment enhancer element consists of CRE0065.1 or a functional variant thereof.

[0140] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 6 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 6 or its functional variant also fall within the scope of the present invention.

[0141] In some preferred embodiments, a CRE is provided that includes or comprises CRE0065.1 or a functional variant thereof, having a nucleotide length of 200 or less, 150 or less, 125 or less, or 106 or less.

[0142] CRE0066 and its functional variants: CRE0066 (also known as Enh_18XS) has the sequence shown in sequence number 7.

[0143] Functional variants of CRE0066 are regulatory elements that differ from CRE0066 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0144] In some embodiments, a functional variant of CRE0066 can be considered a CRE that substantially retains its activity even when substituted for CRE0066 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0066 substituted for CRE0066 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0066). For example, considering promoter SP0239 as an example, CRE0066 in SP0239 can be replaced with a functional variant of CRE0066, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0145] In some embodiments, functional variants of CRE0066 preferably include the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0066. The liver-specific TFBS present in CRE0066 are, listed in order of their presence, HNF4G and FOS::JUN. Therefore, functional variants of CRE0066 preferably include all of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0066, i.e., HNF4G followed by FOS::JUN. When cis regulatory elements are associated with promoters and genes, this order is preferably considered to be upstream-to-downstream (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0146] In some embodiments, functional variants of CRE0066 include the following TFBS sequences: GCAGGGCAAAGTGCA(HNF4G) and GATGACTCAG(FOS::JUN), complementary sequences, or functional variants of such TFBS sequences that maintain the ability to bind to each TF (see Table 15 for sequence numbers). These may exist in the same order as CRE0066, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBSs, and that a given TFBS typically has a consensus sequence, from which there is typically some degree of deviation.

[0147] In some embodiments of the present invention, the functional variant of CRE0066 (SEQ ID NO: 7) is the following sequence: GCAGGGCAAAGTGCA-Na-GATGACTCAG (SEQ ID NO: 274), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto, In the sequence, Na represents an optional spacer sequence. If present, Na is optional and has a length of 10 to 28 nucleotides, preferably 14 to 24 nucleotides, and more preferably 19 nucleotides.

[0148] In some embodiments, a functional variant of CRE0066 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 7, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 7. In addition to or instead, a functional variant of CRE0066 preferably includes a sequence that hybridizes to SEQ ID NO: 7 under stringent conditions.

[0149] In some embodiments of the present invention, the cis-adjustment enhancer element consists of CRE0066 or a functional variant thereof.

[0150] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 7 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 7 or its functional variant also fall within the scope of the present invention.

[0151] In some preferred embodiments, a CRE is provided that comprises or consists of CRE0066 or a functional variant thereof, having a nucleotide length of 200 or less, 150 or less, 125 or less, 100 or less, or 87 or less.

[0152] CRE0066.2 and its functional variants: CRE0066.2 (also known as LVR_CRE0066_v2 or Enh_18S) has the sequence as shown in Sequence ID No. 8. CRE0066.2 contains the entirety of CRE0066 and has an additional 81 nucleotides at the 3' end. CRE0066.2 can be considered a longer functional variant of CRE0066.

[0153] Functional variants of CRE0066.2 are regulatory elements that differ from CRE0066.2 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0154] In some embodiments, a functional variant of CRE0066.2 can be considered a CRE that substantially retains its activity even when substituted for CRE0066.2 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0066.2 substituted for CRE0066.2 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0066.2). For example, considering promoter SP0109 as an example, CRE0066.2 in SP0109 can be replaced with a functional variant of CRE0066.2, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0155] CRE0066.2 contains the same liver-specific TFBS as CRE0066, and therefore the same considerations apply regarding the preferred presence and location of the relevant TFBS.

[0156] In some embodiments, a functional variant of CRE0066.2 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 8, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 8. In addition to or instead of this, a functional variant of CRE0066.2 preferably includes a sequence that hybridizes to SEQ ID NO: 8 under stringent conditions.

[0157] In some embodiments of the present invention, the cis-adjustment enhancer element consists of SEQ ID NO: 8 or a functional variant thereof.

[0158] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 8 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 8 or its functional variant also fall within the scope of the present invention.

[0159] CRE0066.1 and its functional variants: CRE0066.1 (also known as LVR_CRE0066_v1 or Enh_18) has the sequence as shown in Sequence ID No. 9. CRE0066.1 contains the entirety of both CRE0066 and CRE0066.2, and has an additional 154 nucleotides at the 3' end compared to CRE0066. CRE0066.1 can be considered a longer functional variant of both CRE0066 and CRE0066.2.

[0160] Functional variants of CRE0066.1 are regulatory elements that differ from CRE0066.1 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0161] In some embodiments, a functional variant of CRE0066.1 can be considered a CRE that substantially retains its activity even when substituted for CRE0066.1 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0066.1 substituted for CRE0066.1 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0066.1). The retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing the substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0162] CRE0066.1 contains the same liver-specific TFBS as CRE0066, and therefore the same considerations apply regarding the preferred presence and location of the relevant TFBS.

[0163] In some embodiments, a functional variant of CRE0066.1 preferably includes a sequence that is at least 70% identical to sequence number 9, more preferably at least 80%, 90%, 95%, or 99% identical to sequence number 9. In addition to or instead of this, a functional variant of CRE0066.1 preferably includes a sequence that hybridizes to sequence number 9 under stringent conditions.

[0164] In some embodiments of the present invention, the cis-adjustment enhancer element consists of SEQ ID NO: 9 or a functional variant thereof.

[0165] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 9 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 9 or its functional variant also fall within the scope of the present invention.

[0166] CRE0068 and its functional variants: CRE0068 has the sequence shown in sequence number 10.

[0167] Functional variants of CRE0068 are regulatory elements that differ from CRE0068 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0168] In some embodiments, a functional variant of CRE0068 can be considered a CRE that substantially retains its activity even when substituted for CRE0068 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0068 substituted for CRE0068 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0068). For example, considering promoter SP0379, CRE0068 in SP0379 can be replaced with a functional variant of CRE0068, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0169] In some embodiments, functional variants of CRE0068 preferably include the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0068. The liver-specific TFBS present in CRE0068, listed in order of their presence, are HNF-4, HNF-1 / HNF-3, and SP1. Therefore, functional variants of CRE0068 preferably include all of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0068, i.e., in the order described above. When cis regulatory elements are associated with promoters and genes, this order is preferably considered to be in an upstream-to-downstream direction (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0170] In some embodiments, functional variants of CRE0068 include the following TFBS sequences: TTCCTGCTCTTTGTCCC(HNF4), AGACTAATATTTGCC(HNF-1 / HNF-3), and ATGGGGGAGGGACAG(SP1), complementary sequences, or functional variants of these TFBS sequences that maintain the ability to bind to each TF (see Table 16 for TFBS sequence numbers). These may exist in the same order as CRE0068, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBS, and that a given TFBS typically has a consensus sequence, from which there is typically some degree of deviation.

[0171] In some embodiments of the present invention, a functional variant of CRE0068 is the following sequence: The sequence includes TTCCTGCTCTTTGTCCC-Na-AGACTAATATTTGCC-Nb-ATGGGGGAGGGACAG (SEQ ID NO: 275), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto. In the sequence, Na and Nb represent optional spacer sequences. If present, Na is optional and has a length of 4 to 20 nucleotides, preferably 8 to 16 nucleotides, more preferably 12 nucleotides. If present, Nb is optional and has a length of 10 to 30 nucleotides, preferably 15 to 25 nucleotides, more preferably 20 nucleotides.

[0172] In some embodiments, a functional variant of CRE0068 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 10, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 10. In addition to or instead of this, a functional variant of CRE0068 preferably includes a sequence that hybridizes to SEQ ID NO: 10 under stringent conditions.

[0173] In some embodiments of the present invention, the cis-adjustment enhancer element consists of CRE0068 or a functional variant thereof.

[0174] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 10 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 10 or its functional variant also fall within the scope of the present invention.

[0175] In some preferred embodiments, a CRE is provided that includes or comprises CRE0068 or a functional variant thereof, having a nucleotide length of 200 or less, 150 or less, 125 or less, or 100 or less.

[0176] CRE0074 and its functional variants: CRE0074 (also known as SEPP1) has the sequence shown in sequence number 11.

[0177] Functional variants of CRE0074 are regulatory elements that differ from CRE0074 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0178] In some embodiments, a functional variant of CRE0068 can be considered a CRE that substantially retains its activity even when substituted for CRE0074 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0074 substituted for CRE0074 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0074). For example, considering promoter SP0379 as an example, CRE0074 in SP0268 can be replaced with a functional variant of CRE0074, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0179] In some embodiments, functional variants of CRE0074 preferably include the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0074. The liver-specific TFBS present in CRE0074 are, listed in order of their presence, HNF4 and FoxO1a. Therefore, functional variants of CRE0074 preferably include all of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0074, i.e., HNF4 followed by FoxO1a. When cis-regulatory elements are associated with promoters and genes, this order is preferably considered to be in an upstream-to-downstream direction (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0180] In some embodiments, functional variants of CRE0074 include the following TFBS sequences: AACATTGAACTTTGGACTA(HNF4) and GTAAACAA(FoxO1a), complementary sequences thereto, or functional variants of such TFBS sequences that maintain the ability to bind to each TF (see Table 17 for TFBS sequence numbers). These may exist in the same order as CRE0074, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBS, and that a given TFBS typically has a consensus sequence, from which there is typically some degree of deviation.

[0181] In some embodiments of the present invention, a functional variant of CRE0074 is the following sequence: The sequence includes AACATTGAACTTTGGACTA-Na-GTAAACAA (SEQ ID NO: 276), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto. In the sequence, Na represents an optional spacer sequence. If present, Na is optional and has a length of 7 to 23 nucleotides, preferably 11 to 19 nucleotides, and more preferably 15 nucleotides.

[0182] In some embodiments, a functional variant of CRE0074 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 11, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 11. In addition to or instead of this, a functional variant of SEQ ID NO: 11 preferably includes a sequence that hybridizes to SEQ ID NO: 11 under stringent conditions.

[0183] In some embodiments of the present invention, the cis-adjustment enhancer element consists of SEQ ID NO: 11 or a functional variant thereof.

[0184] It should be noted that CRE0074 or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 11 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 11 or its functional variant also fall within the scope of the present invention.

[0185] In some preferred embodiments, a CRE is provided that comprises or consists of CRE0074 or a functional variant thereof, having a nucleotide length of 200 or less, 150 or less, 100 or less, 80 or less, or 61 or less.

[0186] CRE0001 and its functional variants: CRE0001 has the sequence shown in sequence number 12.

[0187] A functional variant of CRE0001 is a regulatory element that differs from CRE0001 but substantially retains its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0188] In some embodiments, a functional variant of CRE0001 can be considered a CRE that substantially retains its activity even when substituted for CRE0001 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0001 substituted for CRE0001 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0001). For example, considering promoter SP0250, CRE0001 in SP0250 can be replaced with a functional variant of CRE0001, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0189] In some embodiments, a functional variant of CRE0001 preferably contains the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0001. The liver-specific TFBS present in CRE0001 are, listed in order of their presence, HNF-4, HNF-1, HNF-3, and HNF-4. Therefore, a functional variant of CRE0018 preferably contains all of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0018, i.e., in the order shown above. When CRE is associated with a promoter and a gene, this order is preferably considered to be upstream to downstream (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0190] In some embodiments, functional variants of CRE0001 include the following TFBS sequences: TCCAAAGTCCAAA(HNF-4), TGTTAATTAATA(HNF-1), CAATAAACATCA(HNF-3), TTCCCTTTGAACCTT(HNF-4), complementary sequences, or functional variants of these TFBS sequences that maintain the ability to bind to each TF (see Table 18 for TFBS sequence numbers). These may exist in the same order as CRE0018, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBS, and that a given TFBS typically has a consensus sequence, and typically there is some degree of deviation from it.

[0191] In some embodiments of the present invention, a functional variant of CRE0001 is the following sequence: The sequence includes TCCAAAGTCCAAA-Na-TGTTAATAATTAATA-Nb-CAATAAACATCA-Nc-TTCCCTTTGAACCTT (Sequence ID 277), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto. In the sequence, Na, Nb, and Nc represent optional spacer sequences. If present, Na is optional and has a length of 1 to 10 nucleotides, preferably 2 to 6 nucleotides, more preferably 3 nucleotides. If present, Nb is optional and has a length of 1 to 10 nucleotides, preferably 2 to 6 nucleotides, more preferably 3 nucleotides. If present, Nc is optional and has a length of 11 to 31 nucleotides, preferably 16 to 26 nucleotides, more preferably 21 nucleotides.

[0192] In some embodiments, a functional variant of CRE0001 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 12, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 12. In addition to or instead of this, a functional variant of CRE0001 preferably includes a sequence that hybridizes to SEQ ID NO: 12 under stringent conditions.

[0193] In some embodiments of the present invention, the cis-adjustment enhancer element consists of SEQ ID NO: 12 or a functional variant thereof.

[0194] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 12 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 12 or its functional variant also fall within the scope of the present invention.

[0195] In some preferred embodiments, a CRE is provided that includes or comprises CRE0001 or a functional variant thereof, having 400 or fewer nucleotides, 300 or fewer nucleotides, 250 or fewer nucleotides, or a nucleotide length of 201 or less.

[0196] CRE0005 and its functional variants: CRE0005 has the sequence as shown in sequence number 13.

[0197] Functional variants of CRE0005 are regulatory elements that differ from CRE0005 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0198] In some embodiments, a functional variant of CRE0005 can be considered a CRE that, when substituted for CRE0005 in a CRM or promoter, substantially retains its activity. For example, a promoter containing a functional variant of CRE0005 substituted for CRE0005 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0005). For example, considering the promoter SP0256 as an example, the CRE0005 of SP0256 can be replaced with a functional variant of CRE0005, and the promoter substantially retains its activity. The retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of an otherwise identical promoter containing the substituted CRE under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0199] Bioinformatics analysis of CRE0005 revealed that CRE0005 is thought to contain no known liver-specific TFBS. Nevertheless, the inventors determined that CRE0005 nevertheless contributes to the liver-specific activity of the promoter. Without wishing to be bound by theory, this may be because it cooperatively interacts with other CREs containing liver-specific TFBS to enhance their activity.

[0200] In some embodiments, a functional variant of CRE0005 comprises a sequence that is at least 70% identical to SEQ ID NO: 13, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 13. In addition or alternatively, a functional variant of CRE0005 preferably comprises a sequence that hybridizes to SEQ ID NO: 13 under stringent conditions.

[0201] In some embodiments of the invention, the CRE consists of SEQ ID NO: 13 or a functional variant thereof.

[0202] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 13 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 13 or its functional variant also fall within the scope of the present invention.

[0203] In some preferred embodiments, a CRE is provided that includes or comprises CRE0005 or a functional variant thereof, having a nucleotide length of 400 or less, 325 or less, 275 or less, or 232 or less.

[0204] CRE0012 and its functional variants: CRE0012 has the sequence shown in sequence number 14.

[0205] Functional variants of CRE0012 are regulatory elements that differ from CRE0012 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0206] In some embodiments, a functional variant of CRE0012 can be considered a CRE that substantially retains its activity even when substituted for CRE0012 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0012 substituted for CRE0012 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0012). For example, considering promoter SP0243, CRE0012 in SP0243 can be replaced with a functional variant of CRE0012, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0207] In some embodiments, functional variants of CRE0012 preferably include the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0012. The liver-specific TFBS present in CRE0012, listed in order of their presence, are HNF-4, HNF-3, HNF-3, and C / EBP. Therefore, functional variants of CRE0012 preferably include all of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0012, i.e., HNF-4, HNF-3, HNF-3, and then C / EBP. When CRE is associated with a promoter and a gene, this order is preferably considered to be upstream-to-downstream (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0208] In some embodiments, functional variants of CRE0012 include the following TFBS sequences: AAGTCCAAAGGTAGA(HNF-4), GAGTCAACATGA(HNF-3), AAATGTTGACTG(HNF-3), and GGGTTGCTTAAT(C / EBP), complementary sequences thereto, or functional variants of these TFBS sequences that maintain the ability to bind to each TF (see Table 19 for TFBS sequence numbers). These may exist in the same order as CRE0012, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBS, and that a given TFBS typically has a consensus sequence, from which there is typically some degree of deviation.

[0209] In some embodiments of the present invention, a functional variant of CRE0012 is the following sequence: The sequence includes AAGTCCAAAGGTAGA-Na-GAGTCAACATGA-Nb-AAATGTTGACTG-Nc-GGTTGCTTAAT (SEQ ID NO: 278), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto. In the sequence, Na, Nb, and Nc represent optional spacer sequences. If present, Na is optional and has a length of 23 to 43 nucleotides, preferably 28 to 38 nucleotides, more preferably 33 nucleotides. If present, Nb is optional and has a length of 38 to 58 nucleotides, preferably 42 to 53 nucleotides, more preferably 48 nucleotides. If present, Nc is optional and has a length of 8 to 28 nucleotides, preferably 13 to 23 nucleotides, more preferably 18 nucleotides.

[0210] In some embodiments, a functional variant of CRE0012 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 14, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 14. In addition to or instead of this, a functional variant of CRE0012 preferably includes a sequence that hybridizes to SEQ ID NO: 14 under stringent conditions.

[0211] In some embodiments of the present invention, CRE consists of SEQ ID NO: 14 or a functional variant thereof.

[0212] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 14 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 14 or its functional variant also fall within the scope of the present invention.

[0213] In some preferred embodiments, a CRE is provided that comprises or consists of CRE0012 or a functional variant thereof, having a nucleotide length of 400 or less, 300 or less, 250 or less, or 200 or less.

[0214] CRE0047 and its functional variants: CRE0047 has the sequence shown in sequence number 15.

[0215] Functional variants of CRE0047 are regulatory elements that differ from CRE0047 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0216] In some embodiments, a functional variant of CRE0047 can be considered a CRE that substantially retains its activity even when substituted for CRE0047 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0047 substituted for CRE0047 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0047). For example, considering promoter SP0258, CRE0047 in SP0258 can be replaced with a functional variant of CRE0047, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0217] In some embodiments, functional variants of CRE0047 preferably contain the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0047. The liver-specific TFBS present in CRE0047 are, listed in order of their presence, HNF-3 and C / EBP. Therefore, functional variants of CRE0047 preferably contain both of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0047, i.e., HNF-3 and then C / EBP. When CRE is associated with a promoter and a gene, this order is preferably considered to be upstream-to-downstream (i.e., distal to the transcription start site (TSS) and proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0218] In some embodiments, functional variants of CRE0047 include the following TFBS sequences: GCAATGTTTGCCCAT (HNF-3), TGTTTGCCCAT (C / EBP), sequences complementary thereto, or functional variants of such TFBS sequences that maintain the ability to bind to each TF (see Table 20 for TFBS sequence numbers). These may be present in the same order as CRE0047, i.e., in the order shown above. It is well known in the art that there is sequence variability associated with TFBS, and that a given TFBS typically has a consensus sequence and typically some degree of deviation therefrom.

[0219] In some embodiments of the invention, functional variants of CRE0047 include the following sequences: GCAATGTTTGCCCAT (SEQ ID NO: 279), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto.

[0220] In some embodiments, functional variants of CRE0047 preferably include a sequence that is at least 70% identical to SEQ ID NO: 15, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 15. In addition or alternatively, functional variants of CRE0047 preferably include a sequence that hybridizes to SEQ ID NO: 15 under stringent conditions.

[0221] In some embodiments of the invention, the CRE consists of SEQ ID NO: 15 or a functional variant thereof.

[0222] It will be noted that CRE or its functional variant may be provided on either strand of the double-stranded polynucleotide and in either orientation. Therefore, the complementary and reverse-complementary sequences of SEQ ID NO: 15 or its functional variant are within the scope of the invention. Single-stranded nucleic acids containing a sequence by SEQ ID NO: 15 or its functional variant are also within the scope of the invention.

[0223] In some preferred embodiments, a CRE is provided that comprises or consists of CRE0047 or a functional variant thereof, having a nucleotide length of 200 or less, 150 or less, 100 or less, 50 or less, or 35 or less.

[0224] CRE0048 and its functional variants: CRE0048 has the sequence shown in sequence number 16.

[0225] Functional variants of CRE0048 are regulatory elements that differ from CRE0048 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0226] In some embodiments, a functional variant of CRE0048 can be considered a CRE that substantially retains its activity even when substituted for CRE0048 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0048 substituted for CRE0048 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0048). For example, considering promoter SP0378, CRE0048 in SP0378 can be replaced with a functional variant of CRE0048, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0227] Bioinformatics analysis of CRE0048 revealed that CRE0048 appears to contain no known liver-specific TFBS. Nevertheless, the inventors determined that CRE0005 contributes to the liver-specific activity of the promoter. While we do not wish to be bound by theory, this may be because it synergistically interacts with other CREs containing liver-specific TFBS, thereby enhancing their activity.

[0228] In some embodiments of the present invention, a functional variant of CRE0048 includes a sequence that is at least 70% identical to SEQ ID NO: 16, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 16. In addition to or instead of this, a functional variant of CRE0048 preferably includes a sequence that hybridizes to SEQ ID NO: 16 under stringent conditions.

[0229] In some embodiments of the present invention, CRE consists of SEQ ID NO: 16 or a functional variant thereof.

[0230] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 16 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 16 or its functional variant also fall within the scope of the present invention.

[0231] In some preferred embodiments, a CRE is provided that includes or comprises CRE0048 or a functional variant thereof, having 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or a nucleotide length of 92 or less.

[0232] CRE0056 and its functional variants: CRE0056 has the sequence shown in sequence number 17.

[0233] Functional variants of CRE0056 are regulatory elements that differ from CRE0056 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0234] In some embodiments, a functional variant of CRE0056 can be considered a CRE that substantially retains its activity even when substituted for CRE0056 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0056 substituted for CRE0056 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0056). For example, considering promoter SP0380 as an example, CRE0056 in SP0380 can be replaced with a functional variant of CRE0056, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0235] In some embodiments, functional variants of CRE0056 preferably contain the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0056. The liver-specific TFBS present in CRE0056 are, listed in order of their presence, HNF-4 and HNF-3. Therefore, functional variants of CRE0056 preferably contain both of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0056, i.e., HNF-4 and then HNF-3. When CRE is associated with a promoter and a gene, this order is preferably considered to be upstream-to-downstream (i.e., distal to the transcription start site (TSS) and proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0236] In some embodiments, functional variants of CRE0056 include the following TFBS sequences:ACTGAACCCTTGACCCCTGCCCT(HNF-4) and TGCCCACTCTATTTGCCCAGCC(HNF-3), complementary sequences thereto, or functional variants of these TFBS sequences that maintain the ability to bind to their respective TFs (see Table 21 for TFBS sequence numbers). These may exist in the same order as CRE0056, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBSs, and that a given TFBS typically has a consensus sequence, from which there is typically some degree of deviation.

[0237] In some embodiments of the present invention, a functional variant of CRE0056 is the following sequence: ACTGAACCCTTGACCCCTGCCCT-Na-TGCCCACTCTATTTGCCCAGCC (Sequence ID 280), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto, In the sequence, Na represents an optional spacer sequence. If present, Na is optional and has a length of 12 to 32 nucleotides, preferably 17 to 27 nucleotides, and more preferably 22 nucleotides.

[0238] In some embodiments, a functional variant of CRE0056 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 17, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 17. In addition to or instead of this, a functional variant of CRE0056 preferably includes a sequence that hybridizes to SEQ ID NO: 17 under stringent conditions.

[0239] In some embodiments of the present invention, CRE consists of SEQ ID NO: 17 or a functional variant thereof.

[0240] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 17 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 17 or its functional variant also fall within the scope of the present invention.

[0241] In some preferred embodiments, a CRE is provided that comprises or consists of CRE0056 or a functional variant thereof, having 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 100 or fewer nucleotides, or a nucleotide length of 79 or less.

[0242] CRE0062 and its functional variants: CRE0062 has the sequence shown in sequence number 18.

[0243] Functional variants of CRE0062 are regulatory elements that differ from CRE0062 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0244] In some embodiments, a functional variant of CRE0062 can be considered a CRE that substantially retains its activity even when substituted for CRE0062 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0062 substituted for CRE0062 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0062). For example, considering promoter SP0381 as an example, CRE0062 in SP0381 can be replaced with a functional variant of CRE0062, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0245] In some embodiments, functional variants of CRE0062 preferably include the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0062. The liver-specific TFBS present in CRE0062 are, in order of their presence, HNF-4, HNF-4, and HNF-3. Therefore, functional variants of CRE0062 preferably include all of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0062, i.e., HNF-4, HNF-4, and then HNF-3. When CRE is associated with a promoter and a gene, this order is preferably considered to be upstream-to-downstream (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0246] In some embodiments, functional variants of CRE0062 include the following TFBS sequences: AGATTCCAAAGTTCA(HNF-4), ACCAAAGTTCAGA(HNF-4), GTTATTACAA(HNF-3), complementary sequences thereto, or functional variants of such TFBS sequences that maintain the ability to bind to each TF (see Table 22 for TFBS sequence numbers). These may exist in the same order as CRE0062, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBS, and that a given TFBS typically has a consensus sequence, and typically there is some degree of deviation from there.

[0247] In some embodiments of the present invention, a functional variant of CRE0062 is the following sequence: AGAGATTCCAAAGTTCA-Na-ACCAAAGTTCAGA-Nb-GTTATTTACAA (SEQ ID NO: 281), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto, In the sequence, Na and Nb represent optional spacer sequences. If present, Na is optionally 1 to 13 nucleotides long, preferably 2 to 8 nucleotides, and more preferably 3 nucleotides long. If present, Nb is optionally 1 to 18 nucleotides long, preferably 3 to 13 nucleotides, and more preferably 8 nucleotides long.

[0248] In some embodiments, a functional variant of CRE0062 preferably includes a sequence that is at least 70% identical to SEQ ID NO: 18, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 18. In addition to or instead of this, a functional variant of CRE0062 preferably includes a sequence that hybridizes to SEQ ID NO: 18 under stringent conditions.

[0249] In some embodiments of the present invention, CRE consists of SEQ ID NO: 18 or a functional variant thereof.

[0250] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 18 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 18 or its functional variant also fall within the scope of the present invention.

[0251] In some preferred embodiments, a CRE is provided that comprises or consists of CRE0062 or a functional variant thereof, having a nucleotide length of 200 or less, 150 or less, 125 or less, 100 or less, or 85 or less.

[0252] CRE0077 and its functional variants: CRE0077 has the sequence shown in sequence number 19.

[0253] Functional variants of CRE0077 are regulatory elements that differ from CRE0077 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0254] In some embodiments, a functional variant of CRE0077 can be considered a CRE that substantially retains its activity even when substituted for CRE0077 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0077 substituted for CRE0077 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0077). For example, considering promoter SP0405 as an example, CRE0077 in SP0405 can be replaced with a functional variant of CRE0077, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0255] In some embodiments, functional variants of CRE0077 (SEQ ID NO: 19) preferably contain the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0077. The liver-specific TFBS present in CRE0077 are, in order (from 5' to 3'), HNF3, HNF3, HNF1, HNF3, and HNF3. Therefore, functional variants of CRE0077 preferably contain all of these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0077, i.e., HNF3, HNF3, HNF1, HNF3, and then HNF3. When cis-regulatory elements are associated with promoters and genes, this order is preferably considered to be in an upstream-to-downstream direction (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, the TFBS may preferably overlap, as long as they remain functional, i.e., as long as both overlapping sequences can bind to their respective TFs.

[0256] In some embodiments, functional variants of CRE0077 include the following TFBS sequences: AGCAAATATTT(HNF3), AAATATTTGTGG(HNF3), GGTTATGGATTAACT(HNF1), CTGTTTGCCC(HNF3), CTATTTGCCC(HNF3), sequences complementary to them, or functional variants of such TFBS sequences that maintain the ability to bind to each TF (see Table 23 for TFBS sequence numbers). These may exist in the same order as CRE0077, i.e., in the order shown above. It is well known in the Art that sequence variability exists associated with TFBS, and that a given TFBS typically has a consensus sequence, and typically there is some degree of deviation from there.

[0257] In some embodiments of the present invention, a functional variant of CRE0077 is the following sequence: AGCAAATATTTGTGGTTATGGATTAACT-Na-CTGTTTGCCC-Nb-CTATTTGCCC (SEQ ID NO: 282), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto, In the sequence, Na and Nb represent optional spacer sequences. If present, the spacer sequences Na and Nb are preferably 0 to 10 nucleotides long. Optionally, Na is 2 to 8 nucleotides long, preferably 3 to 6 nucleotides long, and more preferably 4 nucleotides long. Optionally, Nb is 2 to 8 nucleotides long, preferably 2 to 6 nucleotides long, and more preferably 3 nucleotides long.

[0258] In some embodiments of the present invention, a functional variant of CRE0077 includes a sequence that is at least 70% identical to SEQ ID NO: 19, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 19. In addition to or instead of this, a functional variant of CRE0077 preferably includes a sequence that hybridizes to SEQ ID NO: 19 under stringent conditions.

[0259] In some embodiments of the present invention, CRE consists of SEQ ID NO: 19 or a functional variant thereof.

[0260] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 19 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 19 or its functional variant also fall within the scope of the present invention.

[0261] In some preferred embodiments, a CRE is provided that comprises or consists of CRE0077 or a functional variant thereof, having a nucleotide length of 150 or less, 125 or less, 100 or less, 75 or less, or 56 or less.

[0262] CRE0078 and its functional variants: CRE0078 has the sequence shown in sequence number 20.

[0263] Functional variants of CRE0078 are regulatory elements that differ from CRE0078 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0264] In some embodiments, a functional variant of CRE0078 can be considered a CRE that substantially retains its activity even when substituted for CRE0078 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0078 substituted for CRE0078 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0078). For example, considering promoter SP0270, CRE0078 in SP0270 can be replaced with a functional variant of CRE0078, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0265] In some embodiments, functional variants of CRE0078 (SEQ ID NO: 20) preferably contain the same liver-specific transcription factor (TF) binding sites (TFBS) as CRE0078. The liver-specific TFBS present in CRE0078 are, in order, HNF-4, c / EBP, HNF3, and HNF3. Therefore, functional variants of CRE0078 preferably contain these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0078, i.e., HNF4, c / EBP, HNF3, and HNF3. When cis regulatory elements are associated with promoters and genes, this order is preferably considered to be upstream-to-downstream (i.e., distal to the transcription start site (TSS) to proximal to the TSS). In some embodiments, the TFBS are duplicated but still functional, i.e., both duplicated sequences can bind to their respective TFs.

[0266] In some embodiments, functional variants of CRE0078 include the following TFBS sequences: CGCCCTTTGGACC(HNF4), GACCTTTTGCAATCCTGG(c / EBP), CTGTTTTGCT(HNF3), GTGTTTGCTG(HNF3), complementary sequences thereto, or functional variants of such TFBS sequences that maintain the ability to bind to each TF (see Table 24 for TFBS sequence numbers). It is well known in the Art that sequence variability exists associated with TFBS, and that a given TFBS typically has a consensus sequence defined based on multiple sequence alignment, and typically there is some degree of deviation from the consensus sequence therefrom.

[0267] In some embodiments of the present invention, a functional variant of CRE0078 includes the following sequence:CGCCCTTTGGACCTTTTGCAATCCTGGAGCAAACAGCAAACAC (SEQ ID NO: 283), or a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical thereto.

[0268] In some embodiments of the present invention, a functional variant of CRE0078 includes a sequence that is at least 70% identical to SEQ ID NO: 20, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 20. In addition to or instead of this, a functional variant of CRE0078 preferably includes a sequence that hybridizes to SEQ ID NO: 20 under stringent conditions.

[0269] In some embodiments of the present invention, CRE consists of SEQ ID NO: 20 or a functional variant thereof.

[0270] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 20 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 20 or its functional variant also fall within the scope of the present invention.

[0271] In some preferred embodiments, a CRE is provided that comprises or consists of CRE0078 or a functional variant thereof, having a nucleotide length of 150 or less, 125 or less, 100 or less, 75 or less, or 45 or less.

[0272] CRE0083.1 and its functional variants: CRE0083.1 has the sequence as shown in sequence number 21.

[0273] Functional variants of CRE0083.1 are regulatory elements that differ from CRE0083.1 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0274] In some embodiments, a functional variant of CRE0083.1 can be considered a CRE that substantially retains its activity even when substituted for CRE0083.1 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0083.1 substituted for CRE0083.1 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0083.1). For example, considering promoter SP0112 as an example, CRE0083.1 in SP0112 can be replaced with a functional variant of CRE0083.1, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0275] Bioinformatics analysis of CRE0083.1 revealed that CRE0083.1 appears to contain no known liver-specific TFBS. Nevertheless, the inventors determined that CRE0005 contributes to the liver-specific activity of the promoter. While we do not wish to be bound by theory, this may be due to cooperative interaction with other CREs containing liver-specific TFBS, thereby enhancing their activity.

[0276] In some embodiments of the present invention, a functional variant of CRE0083.1 includes a sequence that is at least 70% identical to SEQ ID NO: 21, more preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 21. In addition to or instead of this, a functional variant of CRE0083.1 preferably includes a sequence that hybridizes to SEQ ID NO: 21 under stringent conditions.

[0277] In some embodiments of the present invention, CRE consists of SEQ ID NO: 21 or a functional variant thereof.

[0278] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 21 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 21 or its functional variant also fall within the scope of the present invention.

[0279] In some preferred embodiments, a CRE is provided that includes or comprises CRE0083.1 or a functional variant thereof, having a nucleotide length of 250 or less, 200 or less, 150 or less, 125 or less, or 112 or less.

[0280] CRE0089 and its functional variants: CRE0089 has the sequence shown in sequence number 22.

[0281] Functional variants of CRE0089 are regulatory elements that differ from CRE0089 but substantially retain its activity as a liver-specific CRE. Those skilled in the art will understand that it is possible to alter the sequence of CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not render the CRE nonfunctional.

[0282] In some embodiments, a functional variant of CRE0089 can be considered a CRE that substantially retains its activity even when substituted for CRE0089 in a CRM or promoter. For example, a promoter containing a functional variant of CRE0089 substituted for CRE0089 preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing CRE0089). For example, considering promoter SP0139, CRE0089 in SP0139 can be replaced with a functional variant of CRE0089, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0283] Bioinformatics analysis of CRE0083 revealed that CRE0083 appears to contain no known liver-specific TFBS. Nevertheless, the inventors determined that CRE0005 contributes to the liver-specific activity of the promoter. While we do not wish to be bound by theory, this may be because it synergistically interacts with other CREs containing liver-specific TFBS, thereby enhancing their activity.

[0284] In some embodiments of the present invention, a functional variant of CRE0089 includes a sequence that is at least 70% identical to, more preferably at least 80%, 90%, 95%, or 99% identical to, sequence number 22. In addition to or instead of this, a functional variant of CRE0089 preferably includes a sequence that hybridizes to sequence number 22 under stringent conditions.

[0285] In some embodiments of the present invention, CRE consists of SEQ ID NO: 22 or a functional variant thereof.

[0286] It should be noted that CRE or its functional variant may be provided on either strand of a double-stranded polynucleotide and may be provided in either direction. Therefore, complementary and reverse complementary sequences of SEQ ID NO: 22 or its functional variant fall within the scope of the present invention. Single-stranded nucleic acids containing sequences of SEQ ID NO: 22 or its functional variant also fall within the scope of the present invention.

[0287] In some preferred embodiments, a CRE is provided that comprises or consists of CRE0089 or a functional variant thereof, having a nucleotide length of 250 or less, 200 or less, 150 or less, 125 or less, or 102 or less.

[0288] Promoter elements and their functional variants: This specification discloses various promoter elements that can be used to construct synthetic liver-specific promoters. These promoter elements are either minimal promoters or liver-specific proximal promoters. The CREs and CRMs of the present invention can be used in combination with a wide range of suitable minimal promoters or liver-specific proximal promoters, and it has been found that some proximal promoters act synergistically with CREs or CRMs to significantly contribute to the activity of liver-specific promoters. In addition, it has been found that some liver-specific proximal promoters disclosed herein exhibit remarkable levels of activity even in the absence of additional CRE or CRM sequences (most notably proximal promoters CRE0006 and CRE0059).

[0289] Functional variants of the promoter element include sequences that differ from the reference promoter element but substantially retain its activity as a liver-specific promoter element. Those skilled in the art will understand that it is possible to alter the sequence of the promoter element while retaining its ability to recruit RNA polymerase II and, where applicable, bind to liver-specific transcription factors (TFs) to enhance their expression. Functional variants of the promoter element may include substitutions, deletions, and / or insertions compared to the reference promoter element, as long as the promoter element is not rendered non-functional.

[0290] In some embodiments, a functional variant of a promoter element can be considered a promoter element that effectively retains its activity even when substituted for a reference promoter element in the promoter. For example, a liver-specific promoter containing a functional variant of a given promoter element preferably retains at least 80% of its activity, more preferably at least 90%, more preferably at least 95%, and even more preferably 100% of its activity (compared to a reference promoter containing an unmodified promoter element). Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0291] Preferably, the functional variant of the promoter element maintains a significant level of sequence identity with the reference promoter element. Preferably, the functional variant includes a sequence that is at least 70% identical to the reference promoter element, and more preferably 80%, 90%, 95%, or 99% identical to the reference promoter element.

[0292] In the case of a proximal promoter element, the functional variant preferably retains the TFBS of liver-specific TFs that bind to the reference promoter element (the same considerations as above for PWM apply here as well). Preferably, the TFBS are retained in substantially the same order and position as the reference promoter element. Furthermore, it is generally preferable that the sequence of the transcription start site (TSS) of the functional variant of the promoter element is substantially unchanged.

[0293] The retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0294] The promoter elements used in this invention may be natural (i.e., obtained from or derived from naturally occurring gene promoters) or synthetic (i.e., not naturally occurring).

[0295] CRE0006 and its functional variants: CRE0006 has the sequence shown in sequence number 25.

[0296] As discussed above, functional variants of CRE0006 substantially retain the ability of CRE0006 to act as a liver-specific promoter element. For example, when a functional variant of CRE0006 is substituted in the liver-specific promoter SP0241 or SP0244, the modified organism retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and even more preferably 100% of the activity of SP0241 or SP0244. Preferably, the functional variant of CRE0006 contains a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical to SEQ ID NO: 25.

[0297] CRE0006 is a proximal promoter containing liver-specific TFs (TFBSs) upstream of the TSS. The liver-specific TFBSs present in CRE0006 are, in order, HNF4, RXRa, HNF4, c / EBP, and HNF3 (see Table 25 for details). Therefore, functional variants of CRE0006 preferably include these TFBS. Preferably, the TFBS are present in the order they are present in CRE0006, i.e., HNF4, c / EBP, HNF3, and HNF3. In some embodiments, the TFBS are duplicated but still functional, meaning both duplicated sequences can bind to their respective TFs.

[0298] In some embodiments, the functional variant of CRE0006 is at least 70% identical to SEQ ID NO: 25 (preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 25), contains a TFBS of HNF4, RXRa, HNF4, c / EBP, and HNF3, and preferably contains a TSS sequence downstream of the TFBS that is at least 80%, 90%, 95%, or completely identical to those shown in Table 25.

[0299] In some embodiments, a functional variant of CRE0006 has at least 70%, 80%, 90%, 95%, or 99% identity with SEQ ID NO: 25 and further includes the following TFBS: HNF4 at or near positions 25-37; RXRa at or near positions 73-83; HNF4 at or near positions 74-86; c / EBP at or near positions 123-136; and HNF3 at or near positions 129-137, and includes a TSS sequence at or near positions 166-196 that is at least 80%, 90%, 95%, or completely identical to those shown in Table 25, with the positions numbered with reference to SEQ ID NO: 25. In this context, "position or near" preferably means within 10, 5, 4, 3, 2, or 1 nucleotide of the position described with reference to SEQ ID NO: 25. Suitable TFBS sequences are shown in Table 25, but alternative TFBS sequences may be used.

[0300] In some preferred embodiments, the promoter comprising or consisting of CRE0006 or a functional variant thereof has a nucleotide length of 400 or less, 350 or less, 325 or less, 300 or less, or 279 or less.

[0301] CRE0059 and its functional variants: CRE0059 has the sequence shown in sequence number 26.

[0302] As discussed above, functional variants of CRE0059 substantially retain the ability of CRE00059 to act as a liver-specific promoter element. For example, when a functional variant of CRE0059 is substituted in the liver-specific promoter SP0412 or SP0380, the modified organism retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and even more preferably 100% of the activity of SP0412 or SP0380. Preferably, the functional variant of CRE0059 contains a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical to SEQ ID NO: 26.

[0303] CRE0059 is a proximal promoter that contains a liver-specific TF, namely HNF1 TFBS, upstream of the TSS. Therefore, functional variants of CRE0059 preferably contain HNF1 TFBS upstream of the TSS.

[0304] In some embodiments, the functional variant of CRE0059 is at least 70% identical to SEQ ID NO: 26 (preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 26), contains a TFBS of HNF1, and preferably includes a TSS sequence downstream of the TFBS that is at least 80%, 90%, 95%, or completely identical to those shown in Table 27.

[0305] In some embodiments, a functional variant of CRE0059 has at least 70%, 80%, 90%, 95%, or 99% identity with SEQ ID NO: 26, further containing a TFBS of HNF3 at or near positions 24–36, and containing a TSS sequence at or near positions 73–93 that is at least 80%, 90%, 95%, or completely identical to those shown in Table 27, with the positions numbered with reference to SEQ ID NO: 26. In this context, “position or near” preferably means within 10, 5, 4, 3, 2, or 1 nucleotide of the position described with reference to SEQ ID NO: 26. Preferred TFBS sequences are shown in Table 27, but alternative TFBS sequences may be used.

[0306] In some preferred embodiments, the promoter comprising or consisting of CRE0059 or a functional variant thereof has 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 110 or fewer nucleotides, or a nucleotide length of 95 or less.

[0307] CRE0073 and its functional variants: CRE0073 has the sequence shown in sequence number 27.

[0308] As discussed above, functional variants of CRE0073 substantially retain the ability of CRE0073 to act as a liver-specific promoter element. For example, when a functional variant of CRE0073 is substituted in the liver-specific promoter SP0249 or SP0116, the modified organism retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and even more preferably 100% of the activity of SP0249 or SP0116. Preferably, the functional variant of CRE0073 contains a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical to SEQ ID NO: 27.

[0309] CRE0073 is a proximal promoter containing liver-specific TFs (TFBSs) upstream of the TSS. The liver-specific TFBS present in CRE0073 are, in order, HNF3, C / EBP, HNF1, and C / EBP (see Table 28 for details). Therefore, functional variants of CRE0073 preferably include these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0073, i.e., HNF3, C / EBP, HNF1, and then C / EBP. In some embodiments, the TFBS are duplicated but still functional, meaning both duplicate sequences can bind to their respective TFs.

[0310] In some embodiments, the functional variant of CRE0073 is at least 70% identical to SEQ ID NO: 27 (preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 27), contains a TFBS of HNF3, C / EBP, HNF1, and C / EBP, and preferably includes a TSS sequence downstream of the TFBS that is at least 80%, 90%, 95%, or completely identical to those shown in Table 28.

[0311] In some embodiments, a functional variant of CRE0073 has at least 70%, 80%, 90%, 95%, or 99% identity with SEQ ID NO: 27 and further includes the following TFBS: HNF3 at or near positions 36-42; C / EBP at or near positions 38-49; HNF1 at or near positions 66-83; C / EBP at or near positions 75-86; and HNF3 at or near positions 129-137, and includes a TSS sequence at or near positions 138-156 that is at least 80%, 90%, 95%, or completely identical to those shown in Table 28, with the positions numbered with reference to SEQ ID NO: 27. In this context, “position or near” preferably means within 10, 5, 4, 3, 2, or 1 nucleotide of the position described with reference to SEQ ID NO: 27. Suitable TFBS sequences are shown in Table 28, but alternative TFBS sequences may be used.

[0312] CRE0073.1 is an exemplary functional variant of CRE0073. Compared to CRE0073, CRE0073.1 has 22 nucleotides deleted from the 5' end. Otherwise, CRE0073.1 is identical and contains the same TFBS at the same relative positions as CRE0073.

[0313] In some preferred embodiments, the promoter comprising or consisting of CRE0073 or a functional variant thereof has a nucleotide length of 300 or less, 250 or less, 200 or less, 175 or less, or 164 or less.

[0314] CRE0040 and its functional variants: CRE0040 has the sequence shown in sequence number 29.

[0315] As discussed above, functional variants of CRE0040 substantially retain the ability of CRE0040 to act as a liver-specific promoter element. For example, when a functional variant of CRE0040 is substituted in the liver-specific promoter SP0254 or SP0252, the modified organism retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and even more preferably 100% of the activity of SP0254 or SP0252. Preferably, the functional variant of CRE0040 contains a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical to SEQ ID NO: 29.

[0316] CRE0040 is a proximal promoter that includes liver-specific TFs (TFBSs) upstream of the TSS. The liver-specific TFBSs present in CRE0040 are, in order, C / EBP and HNF1 (see Table 30 for details). Therefore, functional variants of CRE0040 preferably include these TFBSs. Preferably, the TFBSs are present in the same order as they are present in CRE0040, i.e., C / EBP followed by HNF1.

[0317] In some embodiments, the functional variant of CRE0040 is at least 70% identical to SEQ ID NO: 29 (preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 29), contains a TFBS of C / EBP and HNF1, and preferably includes a TSS sequence downstream of the TFBS that is at least 80%, 90%, 95%, or completely identical to those shown in Table 30.

[0318] In some embodiments, a functional variant of CRE0040 has at least 70%, 80%, 90%, 95%, or 99% identity with SEQ ID NO: 29 and further includes the following TFBS: C / EBP at or near positions 39-52; HNF1 at or near positions 120-140; and a TSS sequence at or near positions 172-201 that is at least 80%, 90%, 95%, or completely identical to those shown in Table 30, with the positions numbered with reference to SEQ ID NO: 29. In this context, "position or near" preferably means within 10, 5, 4, 3, 2, or 1 nucleotide of the position described with reference to SEQ ID NO: 29. Preferred TFBS sequences are shown in Table 30, but alternative TFBS sequences may be used.

[0319] In some preferred embodiments, the promoter comprising or consisting of CRE0006 or a functional variant thereof has a nucleotide length of 400 or less, 350 or less, 300 or less, 275 or less, or 240 or less.

[0320] CRE0079 and its functional variants: CRE0079 has the sequence shown in sequence number 24.

[0321] As discussed above, functional variants of CRE0079 substantially retain the ability of CRE0079 to act as a liver-specific promoter element. For example, when a functional variant of CRE0079 is substituted in the liver-specific promoter SP0271 or SP0272, the modified organism retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and even more preferably 100% of the activity of SP0271 or SP0272. Preferably, the functional variant of CRE0079 contains a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical to SEQ ID NO: 24.

[0322] CRE0079 is a proximal promoter that includes liver-specific TFs (TFBSs) upstream of the TSS. The liver-specific TFBSs present in CRE0079 are, in order, HNF4, HNF1, and C / EBP (see Table 26 for details). Therefore, functional variants of CRE0079 preferably include these TFBS. Preferably, the TFBS are present in the same order as they are present in CRE0079, i.e., HNF4, HNF1, and then C / EBP.

[0323] In some embodiments, the functional variant of CRE0079 is at least 70% identical to SEQ ID NO: 24 (preferably at least 80%, 90%, 95%, or 99% identical to SEQ ID NO: 24), contains a TFBS of HNF4, HNF1, and C / EBP, and preferably includes a TSS sequence downstream of the TFBS that is at least 80%, 90%, 95%, or completely identical to those shown in Table 24.

[0324] In some embodiments, a functional variant of CRE0079 has at least 70%, 80%, 90%, 95%, or 99% identity with SEQ ID NO: 24 and further includes the following TFBS: HNF4 at or near positions 43–55; HNF1 at or near positions 138–150; and C / EBP at or near positions 162–175, and includes a TSS sequence at or near positions 206–219 that is at least 80%, 90%, 95%, or completely identical to those shown in Table 26, with the positions numbered with reference to SEQ ID NO: 24. In this context, “position or near” preferably means within 10, 5, 4, 3, 2, or 1 nucleotides of the position described with reference to SEQ ID NO: 24. Preferred TFBS sequences are shown in Table 26, but alternative TFBS sequences may be used.

[0325] In some preferred embodiments, the promoter comprising or consisting of CRE0079 or a functional variant thereof has a nucleotide length of 400 or less, 325 or less, 275 or less, 250 or less, or 226 or less.

[0326] CRE0052 and its functional variants: CRE0052 has the sequence shown in sequence number 23.

[0327] As discussed above, functional variants of CRE0052 substantially retain the ability of CRE0052 to act as a liver-specific promoter element. For example, when a functional variant of CRE0052 is substituted in the liver-specific promoter SP0239 or SP0265, the modified organism retains at least 80% of its activity, more preferably at least 90%, more preferably at least 95%, and even more preferably 100% of the activity of SP0239 or SP0265.

[0328] Preferably, the functional variant of CRE0052 includes a sequence that is at least 70%, 80%, 90%, 95%, or 99% identical to sequence number 23.

[0329] In some preferred embodiments, the promoter comprising or consisting of CRE0052 or a functional variant thereof has a nucleotide length of 200 or less, 150 or less, 125 or less, 100 or less, or 76 or less.

[0330] Other promoter elements: Other non-limiting examples of liver-specific proximal promoters that can be used in the present invention include, but are not limited to, the following: ApoA-I promoter, ApoA-II promoter, ApoA-IV promoter, ApoB promoter, ApoC-1 promoter, ApoC-II promoter, ApoC-III promoter, ApoE promoter, albumin promoter, α-fetoprotein promoter, phosphoenolpyruvate carboxykinase (PCK1) promoter, phosphoenolpyruvate carboxykinase 2 (PCK2) promoter, transthyretin (TTR) promoter, α-antitrypsin (AAT or SERPINA1) promoter, TK (thymidine kinase) promoter, hemopexin promoter, alcohol dehydrogenase 6 promoter, cholesterol 7 alpha-25 hydroxylase promoter, factor IX promoter, α-microglobulin promoter, SV40 promoter, CMV promoter, Roussarcoma virus-L TR promoter, and HBV promoter. Of course, minimal promoters derived from these promoters can also be used.

[0331] Synthetic liver-specific CRM and its functional variants: This specification discloses various synthetic liver-specific CRMs that can be used to construct synthetic liver-specific promoters. The CRMs of the present invention can be used in combination with a wide range of suitable minimal promoters or liver-specific proximal promoters, as discussed above.

[0332] Functional variants of the CRM include sequences that differ from the reference CRM element but substantially retain its activity as a liver-specific CRM. Those skilled in the art will understand that it is possible to alter the CRM sequence while retaining its ability to recruit suitable liver-specific transcription factors (TFs) and thereby enhance their expression. Functional variants of the CRM may include substitutions, deletions, and / or insertions compared to the reference CRM, as long as they do not substantially render the CRM non-functional.

[0333] In some embodiments, a functional variant of a CRM can be considered a CRM that substantially retains its activity even when substituted for a reference CRM in a promoter. For example, a liver-specific promoter containing a given functional variant of a CRM preferably retains at least 80%, more preferably at least 90%, more preferably at least 95%, and even more preferably 100% of its activity (compared to a reference promoter containing an unmodified CRM).

[0334] Preferably, the functional variant of the CRM maintains a significant level of sequence identity with the reference CRM. Preferably, the functional variant includes a sequence that is at least 70% identical to the reference CRM, and more preferably 80%, 90%, 95%, or 99% identical to the reference CRM.

[0335] The retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of a promoter containing a substituted CRE but otherwise identical, under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0336] A given functional variant of a CRM may, in some embodiments, include one or more functional variants of CRE present in a reference CRM. For example, a given functional variant of a CRM may include 1, 2, 3, 4, 5, or 6 functional variants of CRE present in a reference CRM. Functional variants of CRE are discussed above.

[0337] A given functional variant of a CRM may, in some embodiments, contain the same combination of CREs as a reference CRM, although the CREs may be in a different order than those in the reference CRM. Typically, it is preferable that the CREs are in the same order as those in the reference CRM (and therefore, a functional variant of a CRM preferably contains the same permutations of CREs as shown in the reference CRM).

[0338] A given functional variant of a CRM may, in some embodiments, include one or more additional CREs compared to those present in a reference CRM. These additional CREs may be provided upstream of, downstream of, and / or between the CREs present in the reference CRM. The additional CREs may be any of the CREs disclosed herein, or other CREs. Generally, it is preferable that a given functional variant of a CRM includes the same CREs (or their functional variants) and does not include additional CREs.

[0339] A given functional variant of a CRM may include one or more additional regulatory elements compared to a reference CRM. For example, the additional regulatory elements may include inducible or repressive elements, boundary control elements, insulators, locus control regions, response elements, binding sites, terminal repeat segments, response sites, stabilizing elements, destabilizing elements, and splicing elements, as long as they do not substantially render the CRM non-functional.

[0340] A given functional variant of a CRM may include additional spacers between adjacent CREs, or, if one or more spacers exist in a reference CRM, the one or more spacers may be longer or shorter than the reference CRM.

[0341] It will be apparent that, in order to provide the synthetic liver-specific promoter according to the present invention, the CRM or its functional variant as disclosed herein can be combined with any suitable promoter element.

[0342] In many cases, shorter promoter sequences are preferred, especially when the volume of the vector (e.g., viral vectors such as AAV) is limited. Therefore, in some embodiments, the synthetic liver-specific CRM has a nucleotide length of 500 or less, for example, 450, 400, 350, 300, 250, 200, 150, 100, 75, 60, 50, or fewer.

[0343] Synthetic liver-specific promoters and their functional variants: Various synthetic liver-specific promoters are disclosed herein.

[0344] A functional variant of the reference synthetic liver-specific promoter is a promoter that contains a different sequence from the reference synthetic liver-specific promoter but substantially retains liver-specific promoter activity. Those skilled in the art will understand that it is possible to alter the sequence of the synthetic liver-specific promoter while retaining its ability to recruit a suitable liver-specific transcription factor (TF) and to recruit RNA polymerase II to provide liver-specific expression of an operablely linked sequence (e.g., an open reading frame). A functional variant of the synthetic liver-specific promoter may contain substitutions, deletions, and / or insertions compared to the reference promoter, as long as the substitutions, deletions, and / or insertions do not substantially render the synthetic liver-specific promoter non-functional compared to the reference promoter.

[0345] Therefore, in some embodiments, a functional variant of a synthetic liver-specific promoter can be considered a variant that substantially retains the liver-specific promoter activity of the reference promoter. For example, a functional variant of a synthetic liver-specific promoter preferably retains at least 70% of the activity of the reference promoter, preferably at least 80%, more preferably at least 90%, more preferably at least 95%, and even more preferably at least 100%.

[0346] Functional variants of synthetic liver-specific promoters often retain a significant level of sequence similarity to a reference synthetic liver-specific promoter. In some embodiments, the functional variant includes a sequence that is at least 70% identical, and more preferably at least 80%, 90%, 95%, or 99% identical to the reference synthetic liver-specific promoter.

[0347] The activity of a functional variant can be evaluated by comparing the expression of a suitable reporter under the control of a reference synthetic liver-specific promoter with that of a putative functional variant under equivalent conditions. Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2 and 3.

[0348] A given functional variant of a synthetic liver-specific promoter may contain one or more functional variants of CRE present in a reference synthetic liver-specific promoter. For example, a given functional variant of CRM may contain 1, 2, 3, 4, 5, or 6 CRE present in the reference CRM. Functional variants of CRE are discussed above.

[0349] A given functional variant of a synthetic liver-specific promoter may include a functional variant of its promoter element, or it may include a different promoter element compared to the reference synthetic liver-specific promoter.

[0350] A given functional variant of a synthetic liver-specific promoter may contain the same CRE as the reference synthetic liver-specific promoter, but the CRE may be in a different order than that of the reference synthetic liver-specific promoter.

[0351] A given functional variant of a synthetic liver-specific promoter may include one or more additional CREs compared to those present in a reference synthetic liver-specific promoter. These additional CREs may be provided upstream of the CREs present in the reference CRM, downstream of the CREs present in the reference synthetic liver-specific promoter, and / or between the CREs present in the reference synthetic liver-specific promoter. These additional CREs may be any of the CREs disclosed herein, or other CREs.

[0352] A given functional variant of a CRM may include one or more additional regulatory elements compared to a reference CRM. For example, the additional regulatory elements may include inductive elements, intron elements, boundary control elements, insulators, locus control regions, response elements, binding sites, terminal repeat segments, response sites, stabilizing elements, destabilizing elements, and splicing elements, as long as they do not substantially render the promoter non-functional.

[0353] A given functional variant of a synthetic liver-specific promoter may include additional spacers between adjacent CREs and promoter elements, or, if one or more spacers are present in the reference liver-specific promoter, the one or more spacers may be longer or shorter than those of the reference liver-specific promoter.

[0354] It will be apparent that the synthetic liver-specific promoter of the present invention may include the CRM and additional regulatory sequences of the present invention. For example, they may include one or more additional CRMs, inducible or repressive elements, boundary regulatory elements, insulators, locus regulatory regions, response elements, binding sites, segments of terminal repeats, response sites, stabilizing elements, destabilizing elements, and splicing elements, etc., as long as they do not substantially render the promoter non-functional.

[0355] The preferred synthetic liver-specific promoters of the present invention exhibit liver-specific promoter activity at least 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, or 400% of the activity of the TBG promoter. In some embodiments, the synthetic liver-specific promoters of the present invention are suitable for promoting liver-specific transgene expression at at least 100% of the activity of the LP1 promoter, preferably at 150%, 200%, 300%, or 500% of the activity of the LP1 promoter. While higher levels of promoter activity are often preferred, this is not always the case, and therefore, in some instances, more moderate levels of expression may be preferred. The activity of a given synthetic liver-specific promoter of the present invention compared to TBG can be evaluated by comparing the liver-specific expression of a reporter gene under the control of the synthetic liver-specific promoter with the expression of the same reporter gene under the control of the TBG promoter, provided that the two promoters are provided under otherwise equivalent expression constructs and conditions.

[0356] In some embodiments, the synthetic liver-specific promoter of the present invention can increase the expression of a gene (e.g., a therapeutic gene or target gene) in the target liver or hepatocytes by at least 20%, at least 40%, at least 60%, at least 80%, at least 100%, at least 200%, at least 300%, at least 500%, at least 1000%, or more, compared to a known liver-specific promoter, preferably the LP-1 promoter.

[0357] The preferred synthetic liver-specific promoter of the present invention exhibits activity in non-hepatic cells (e.g., HEK293 cells) that is 50% or less of that of CMV-IE, preferably 25% or less of that of CMV-IE, more preferably 10% or less of that of CMV-IE, and in some cases 5% or less of that of CMV-IE, or 1% or less of that of CMV-IE.

[0358] In many cases, shorter promoter sequences are preferred, especially when the volume of the vector (e.g., viral vectors such as AAV) is limited. Therefore, in some embodiments, the synthetic liver-specific promoter has a nucleotide length of 700 or less, for example, 600, 500, 450, 400, 350, 300, 250, 200, 150, 100, 75, 70, 68, or fewer.

[0359] Particularly preferred synthetic liver-specific promoters are those that are both short and exhibit high levels of activity.

[0360] Synthetic liver-specific expression cassette: Furthermore, the present invention provides a synthetic liver-specific expression cassette comprising the synthetic liver-specific promoter of the present invention, which is operably linked to a sequence encoding an expression product, preferably a gene (e.g., a transgene).

[0361] A gene typically encodes a desired gene expression product, such as a polypeptide (protein) or RNA. A gene may be a full-length cDNA or genomic DNA sequence, or any fragment, subunit, or variant thereof that possesses at least some degree of desired biological activity.

[0362] If a gene codes for a protein, it may be essentially any type of protein. In non-limiting examples, the protein may be an enzyme, antibody, or antibody fragment (e.g., a monoclonal antibody), a viral protein (e.g., REP-CAP, REV, VSV-G, or RD114), a therapeutic protein, or a toxic protein (e.g., caspase 3, caspase 8, or caspase 9).

[0363] In some preferred embodiments of the present invention, the gene encodes a therapeutic expression product, preferably a therapeutic polypeptide suitable for use in treating a disease or condition associated with abnormal gene expression, preferably in the liver, optionally. The therapeutic expression product may be a secreted protein, such as a coagulation factor (e.g., factor IX or factor VIII), cytokine, growth factor, antibody or nanobody, chemokine, plasma factor, insulin, erythropoietin, lipoprotein lipase, or toxic protein. Alternatively, the therapeutic expression product may be RNA, such as siRNA or miRNA. A non-exclusive list of therapeutic expression products (and encoding sequences) expected to be used in the present invention includes: Factor VIII, Factor IX, Factor VII, Factor X, von Willebrand factor, erythropoietin (EPO), interferon-a, interferon-B, interferon-y, interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-8 (IL-8), interleukin-9 (IL-9), interleukin-10 (IL-10), interleukin-11 (IL-11), inter Leukin-12 (IL-12), chemokine (CXC motif) ligand 5 (CXCL5), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), macrophage colony-stimulating factor (M-CSF), stem cell factor (SCF), keratinocyte growth factor (KGF), monocyte chemotactic protein-1 (MCP-1), tumor necrosis factor (TNF), afamine (AFM), α1-antitrypsin, α-galactosidase A, α-L-idronidase, ATP7b, ornithine transcarbamoylase, phenylalanine hydroxylase, lipoprotein lipase, aromatic amino acid decarboxylase (AADC), ATPase sarcoplasmic / endoplasmic reticulum Ca2+ transport 2 (ATP2A2).2) Cystic fibrosis membrane conductance regulator (CTFR), glutamate decarboxylase 65kDa protein (GAD65), glutamate decarboxylase 67kDa protein (GAD67), lipoprotein lipase (LPL), nerve growth factor (NGF), neurturin (NTN), porphobilinogen deaminase (PBGD), sarcoglycan alpha (SGCA), soluble fms-like tyrosine kinase-1 (sFLT-1), apoliprotein, low-density lipoprotein receptor (LDL-R), albumin, glucose-6-phosphatase, antibodies, nanobodies, aptamers, antiviral dominant-negative proteins, and functional fragments, subunits, or variants thereof. Preferably, the proteins are primate proteins, more preferably human proteins.

[0364] In some embodiments of the present invention, the synthetic liver-specific expression cassette includes a gene encoding a site-specific clease useful for gene editing, such as a meganuclease, zinc finger nuclease (ZFN), transcription activator-like effector-based nuclease (TALEN), or clustered regularly interspaced short palindromic repeats (CRISPR-Cas). Preferably, the site-specific nuclease is configured to edit a desired target genomic locus by performing a cleavage (typically a site-specific double-strand break) and then repairing it by non-homologous end joining (NHEJ) or homology-dependent repair (HDR) to result in the desired editing. The editing may be partial or complete repair of a dysfunctional gene, or it may be knockdown or knockout of a functional gene.

[0365] Preferably, the synthetic liver-specific expression cassette includes a sequence that provides or codes for one or more, preferably all, ribosome-binding sites, start codons, stop codons, and transcription termination sequences. Preferably, the expression cassette includes a nucleic acid encoding a post-transcriptional regulatory element. Preferably, the expression cassette includes a nucleic acid encoding a poly(A) element.

[0366] Vectors and viral particles: The present invention further provides a vector comprising a synthetic liver-specific CRM, a synthetic liver-specific promoter, or an expression cassette according to the present invention.

[0367] In some embodiments of the present invention, the vector is a plasmid. Such a plasmid may contain various other functional nucleic acid sequences, such as one or more selectable markers, one or more origins of replication, and multiple cloning sites. In some embodiments of the present invention, the vector is a viral vector.

[0368] In some embodiments of the present invention, the vector is an expression vector for expression in eukaryotic cells. Examples of eukaryotic expression vectors include, but are not limited to, pW-LNEO, pSV2CAT, pOG44, pXT1, and pSG, available from Stratagene; pSVK3, pBPV, pMSG, and pSVL, available from Amersham Pharmacia Biotech; and pCMVDsRed2-express, pIRES2-DsRed2, pDsRed2-Mito, and pCMV-EGFP, available from Clontech. Numerous other vectors are known and commercially available. For mammalian cells, adenovirus vectors, pSV, and pCMV series vectors are particularly well known but non-limiting examples. There are also many well known yeast expression vectors, including, but are not limited to, yeast integration plasmids (YIp) and yeast replication plasmids (YRp). In the case of plants, the Ti plasmid of the genus Agrobacterium is an exemplary expression vector, and plant viruses provide suitable expression vectors, such as tobacco mosaic virus (TMV), potato virus X, and cowpea mosaic virus.

[0369] In some preferred embodiments, the vector is a gene therapy vector. Various gene therapy vectors are known in the art and can be said to be AAV vectors, adenovirus vectors, retrovirus vectors, and lentivirus vectors. When the vector is a gene therapy vector, the vector preferably comprises a nucleic acid sequence operably linked to the synthetic liver-specific promoter of the present invention, which encodes a therapeutic product, preferably a therapeutic protein. The therapeutic protein may be a secreted protein. Non-limiting examples of secreted proteins have been discussed above, and exemplary secreted therapeutic proteins include coagulation factors such as factor VIII or factor IX, insulin, erythropoietin, lipoprotein lipase, antibodies or nanobodies, growth factors, cytokines, chemokines, plasma factors, and toxic proteins.

[0370] In some embodiments of the present invention, the vector is a viral vector such as a retroviral vector, lentiviral vector, adenovirus vector, or adeno-associated virus (AAV) vector. In some preferred embodiments, the vector is an AAV vector. In some preferred embodiments, the AAV has a serotype suitable for hepatic transduction. In some embodiments, the AAV is selected from the group consisting of AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, or derivatives thereof. The AAV vector is preferably used as a self-complementary double-stranded AAV vector (scAAV) to overcome one of the limiting steps of AAV transduction (i.e., conversion from single-stranded AAV to double-stranded AAV), although the use of a single-stranded AAV vector (ssAAV) is also encompassed herein. In some embodiments of the present invention, the AAV vector is a chimeric vector, meaning that it contains components derived from at least two AAV serotypes, such as the ITR of AAV2 and the capsid protein of AAV5.

[0371] The present invention further provides recombinant virions (viral particles) containing the vector described above.

[0372] Pharmaceutical composition: The vector or virion of the present invention can be formulated into a pharmaceutical composition having pharmaceutically acceptable excipients, i.e., one or more pharmaceutically acceptable carrier substances and / or additives, such as buffers, carriers, excipients, stabilizers, etc. The pharmaceutical composition can be provided in the form of a kit.

[0373] Therefore, a further aspect of the present invention provides a pharmaceutical composition comprising a vector or virion as described herein.

[0374] Therapeutic and other methods and uses: Furthermore, the present invention provides synthetic liver-specific CRMs, synthetic liver-specific promoters, expression cassettes, vectors, virions, or pharmaceutical compositions according to various embodiments of the present invention for use in the treatment of diseases, preferably optionally in the liver, associated with abnormal gene expression (e.g., hereditary liver diseases). Various diseases associated with abnormal gene expression in the liver have been discussed above, but are not limited to, hemophilia (including hemophilia A or hemophilia B), familial hypercholesterolemia, ornithine transcarbamylase deficiency, phenylketonuria, ornithine transcarbamylase deficiency, glycogen storage disease, α1-antitrypsin deficiency, hereditary hemochromatosis, tyrosinemia type 1, argininosuccinateuria, hepatitis virus infection, nonviral hepatitis, liver cancer, hereditary cholestasis, Wilson's disease, and various other liver diseases (such as non-alcoholic fatty liver disease (NAFLD), alcohol-related liver disease (ARLD), and lysosomal storage disorders). The use of this invention to treat hemophilia A or hemophilia B is a preferred embodiment.

[0375] Furthermore, the present invention provides synthetic liver-specific CRMs, synthetic liver-specific promoters, expression cassettes, vectors, and virions according to various embodiments of the present invention for use in the manufacture of pharmaceutical compositions for treating any condition or disease mentioned herein.

[0376] The present invention further provides cells comprising synthetic liver-specific CRM, synthetic liver-specific promoter, expression cassette, vector, and virion according to various embodiments of the present invention. Preferably, the cells are eukaryotic cells. The eukaryotic cells may preferably be fungal cells (e.g., yeast cells), animal (metazoan) cells (e.g., mammalian cells), or plant cells. Alternatively, the cells may be prokaryotic cells.

[0377] In some embodiments of the present invention, the cells are present ex vivo, for example, in cell culture. In other embodiments of the present invention, the cells may be part of a tissue or a multicellular organism.

[0378] In preferred embodiments, the cells are liver cells and may be present ex vivo or in vivo. The liver cells may be primary liver cells or cells from a liver-derived cell line, such as an immortalized cell line. The cells may be present in a liver tissue environment (e.g., in the liver of an animal) or isolated from liver tissue, for example, in a cell culture. Preferably, the cells are human cells.

[0379] The liver-specific CRM, synthetic liver-specific promoter, expression cassette, or vector according to the present invention may be inserted into the cell genome or may be episomal (for example, present in an episomal vector).

[0380] In a further embodiment, the present invention provides a method for producing an expression product, comprising the steps of providing a synthetic liver-specific expression cassette according to the present invention (preferably contained in a vector as described above) to cells, preferably liver cells, and expressing a gene present in the synthetic liver-specific expression cassette. The method preferably includes the step of maintaining the liver cells under conditions suitable for gene expression. This may include, during culture, the step of incubating the cells or tissue containing cells under suitable culture conditions. Of course, the expression may also occur in vivo, for example, in one or more cells of the liver in question.

[0381] Preferably, the method includes the step of introducing a synthetic liver-specific expression cassette into liver cells. A wide range of methods for transfecting liver cells are well known in the art. A preferred method for transfecting liver cells is the step of transfecting cells with a viral vector containing a synthetic liver-specific expression cassette, such as an AAV vector.

[0382] Those skilled in the art will see that synthetic liver-specific CRMs, synthetic liver-specific promoters, expression cassettes, vectors, or virions according to various embodiments of the present invention can be used in gene therapy. Therefore, the use of such nucleic acid constructs in gene therapy forms part of the present invention.

[0383] Accordingly, the present invention provides, in some embodiments, expression cassettes, vectors, or virions according to the present disclosure for use in gene therapy, preferably gene therapy by liver-specific expression of a therapeutic gene. The therapy may include the treatment of a disease, preferably a disease involving abnormal gene expression in the liver (e.g., hemophilia A or hemophilia B), by causing liver cells to secrete a therapeutic product.

[0384] Furthermore, the present invention provides a method for expressing a therapeutic transgene in liver cells, comprising the step of introducing an expression cassette or vector according to the present invention into liver cells. The liver cells may be in vivo or ex vivo.

[0385] Furthermore, the present invention relates to a method for gene therapy for subjects requiring it, preferably human, - The process of administering (preferably introducing into the target liver) the synthetic liver-specific expression cassette, vector, virion, or pharmaceutical composition of the present invention, which contains a gene encoding a therapeutic product. This provides a method that includes this.

[0386] Preferably, this method includes the step of expressing a therapeutic amount of therapeutic product from a gene in the liver of the target organism.

[0387] Genes encoding suitable therapeutic products have been discussed above. However, therapeutic proteins such as factor VIII and factor IX, for the treatment of hemophilia, can be mentioned in particular.

[0388] This method preferably includes the step of administering the vector or virion according to the present invention to a target. Preferably, the vector is a viral gene therapy vector, such as an AAV vector.

[0389] In some embodiments, the method includes the step of systemically administering a viral gene therapy vector. Systemic administration may be enteral (e.g., oral, sublingual, and rectal) or parenteral (e.g., injection). Preferred injection routes include intravenous, intramuscular, subcutaneous, intra-arterial, intra-articular, intrathecal, and intradermal injections.

[0390] In some embodiments, the viral gene therapy vector may be administered simultaneously or sequentially with one or more additional therapeutic agents, or with one or more saturators designed to prevent vector clearance by the reticuloendothelial system.

[0391] If the vector is an AAV vector, the dose of the vector is 1 × 10⁻⁶ 10 gc / kg ~ 1 × 10 15 gc / kg or more, preferably 1 × 10 12 gc / kg ~ 1 × 10 14 gc / kg, preferably 5 × 10 12 gc / kg ~ 5 × 10 13 gc / kg is also acceptable.

[0392] Generally, the subjects requiring this are mammals, preferably primates, and more preferably humans. Typically, the subjects requiring this will present symptoms characteristic of a disease. This method typically includes the step of improving the symptoms presented by the subjects requiring it by expressing a therapeutic dose of the therapeutic product.

[0393] Gene therapy protocols for expressing therapeutic genes in target cells in vitro and in vivo are well known in the art and will not be discussed in detail herein. Briefly, gene therapy protocols include intramuscular injection, interstitial injection, drip infusion into the airway, topical application to the endothelium, intrahepatic administration, and intravenous or intra-arterial administration (e.g., intrahepatic artery, intrahepatic vein) of plasmid DNA vectors (naked or in liposomes) or viral vectors. Various devices have been developed to enhance the availability of DNA to target cells. Simple methods involve physically contacting target cells with a catheter or implantable material containing the relevant vector, while more complex methods utilize jet infusion devices, etc. Gene transfer into mammalian liver cells is performed using both ex vivo and in vivo procedures. Ex vivo methods typically require harvesting liver cells, transduction in vitro with a suitable expression vector, and subsequent reintroduction of the transduced liver cells into the liver. In vivo gene transfer is achieved by injecting DNA or viral vectors into the liver parenchyma, hepatic artery, or portal vein.

[0394] According to some preferred embodiments, the methods described above can be used to treat subjects having hemophilia, for example, hemophilia A or hemophilia B. Therefore, the present invention is a method for treating subjects having hemophilia A or hemophilia B, - A step of administering (preferably introducing into the target liver) the synthetic liver-specific expression cassette, vector, virion, or pharmaceutical composition of the present invention, which contains a gene encoding a suitable coagulation factor (particularly factor VIII in the case of hemophilia A or factor IX in the case of hemophilia B), and - A process of expressing therapeutic doses of coagulation factors in the liver of the above-mentioned target. This provides a method that includes this.

[0395] In some cases, synthetic liver-specific expression cassettes are provided in gene therapy vectors, preferably in AAV vectors.

[0396] Preferably, the method includes the step of expressing a suitable amount of relevant coagulation factors in the target liver in order to alleviate or improve the symptoms of hemophilia A or hemophilia B.

[0397] Additional substances: In some embodiments of the present invention, the CRM or synthetic liver-specific promoter does not contain both CR0077 (or its functional variant) and CR0078 (or its functional variant). In some embodiments of the present invention, if the CRE, CRM, or synthetic liver-specific promoter contains either CR0077 or CR0078 (or their functional variants), it does not contain any further CRE selected from the group consisting of CR0077 (or its functional variant) and CR0078 (or its functional variant). In some embodiments of the present invention, the CRM or synthetic liver-specific promoter does not contain more than one CRE selected from the group consisting of CR0077 (or its functional variant) or CR0078 (or its functional variant).

[0398] In some embodiments of the present invention, the CRE, CRM, or synthetic liver-specific promoter does not include CR0077 or its functional variant, nor CR0078 or its functional variant.

[0399] In some embodiments of the present invention, the CRM or synthetic liver-specific promoter does not contain the sequence GGACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCA (SEQ ID NO: 284), GCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCA (SEQ ID NO: 285), or any functional variant thereof. Such sequences are portions of the SEPRINA1 promoter.

[0400] In some embodiments of the present invention, if the CRM or synthetic liver-specific promoter contains either CR0077 or CR0078 (or a functional variant thereof), it does not contain SEQ ID NO: 284 or SEQ ID NO: 285 (or any functional variant thereof). Therefore, in some embodiments, the CRM or synthetic liver-specific promoter contains one or less of sequences V1, V2, SEQ ID NO: 284, and SEQ ID NO: 285.

[0401] In some embodiments of the present invention, the CRM or synthetic liver-specific promoter includes two or fewer of the following elements: LVR_CRE0080_PROC, LVR_CRE0081_APOA1, LVR_CRE0061_APOB, LVR_CRE0082_APOC4, SEQ ID NO: 284, and SEQ ID NO: 285, or any functional variants thereof. In some embodiments of the present invention, the CRM or synthetic liver-specific promoter includes one or fewer of the above elements or any functional variants thereof. In some embodiments of the present invention, the CRM or synthetic liver-specific promoter does not include any of the above elements or any functional variants thereof. LVR_CRE0080_PROC and LVR_CRE0081_APOA1 are components of CR0077, and LVR_CRE0061_APOB and LVR_CRE0082_APOC4 are components of CR0078 (see Tables 7 and 8 for further details).

[0402] In some embodiments of the present invention, the synthetic liver-specific promoter does not include the CRE0052 minimal promoter or its functional variant.

[0403] In some embodiments of the present invention, the CRM or synthetic liver-specific promoter does not include the sequence disclosed in European Patent Application No. 18207027.6.

[0404] Any functional variant of the sequences of these abandonments and embodiments discussed above may have sequences that are, for example, 60%, 70%, 80%, 90%, 95%, or 99% identical to any of the reference sequences.

[0405] Definitions and basic information: While the fabrication and use of various embodiments of the present invention will be discussed in detail below, it should be understood that the present invention provides a number of applicable inventive concepts that can be embodied in a wide range of specific contexts. The specific embodiments discussed herein are merely illustrative of specific ways of fabricating and using the present invention and do not limit the scope of the invention.

[0406] The background discussions of the invention described herein are included to illustrate the context of the invention. This should not be construed as acknowledging that any of the referenced substances were published, publicly known, or part of the general knowledge in any country as of the priority date of the claims.

[0407] Throughout this disclosure, various publications, patents, and published patent specifications are referenced by identifying reference. All documents referenced herein are incorporated herein by reference in their entirety. In particular, teachings or portions of such documents specifically referenced herein are incorporated by reference.

[0408] Unless otherwise indicated, the implementation of this invention will involve the use of prior art in cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the scope of the art. Such art is well described in the literature. For example, see the following references: Current Protocols in Molecular Biology (Ausubel, 2000, Wiley and Son Inc., Library of Congress); Molecular Cloning: A Laboratory Manual, Third Edition (Sambrook et al., 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (MJ Gait, ed., 1984); U.S. Patent No. 4,683,195; Nucleic Acid Hybridization (Harries and Higgins, eds., 1984); Transcription and Translation (Hames and Higgins, eds., 1984); Culture of Animal Cells (Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells and Enzymes (IRL Press, 1986); Perbal, A Practical Guide to Molecular Cloning (1984); Methods in Enzymology series (edited by Abelson and Simon, Academic Press, Inc.)(Cold Spring Harbor Laboratory, New York), particularly volumes 154 and 155 (edited by Wu et al.) and volume 185, "Gene Expression Technology" (edited by Goeddel); Gene Transfer Vectors For Mammalian Cells (edited by Miller and Calos, 1987, Cold Spring Harbor Laboratory); Immunochemical Methods in Cell and Molecular Biology (edited by Mayer and Walker, Academic Press, London, 1987); Handbook of Experimental Immunology, volumes I-IV (edited by Weir and Blackwell, 1986); and Manipulating the Mouse Embryo (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1986).

[0409] To facilitate understanding of the present invention, several terms are defined or explained below. Terms used herein have meanings generally understood by those skilled in the art relating to the present invention. Terms such as “a,” “an,” and “the” are not intended to refer only to singular entities, but also include basic classes for which specific examples may be used for illustrative purposes. While the terms herein are used to describe specific embodiments of the present invention, their use is not intended to limit the invention except as defined in the claims.

[0410] The terms “cis-regulatory element” or “CRE” are well known to those skilled in the art and refer to nucleic acid sequences, such as enhancers, promoters, insulators, or silencers, that can regulate or modulate the transcription of adjacent (i.e., cis) genes. CREs are found near the genes they regulate. Typically, CREs regulate gene transcription by binding to TFs. That is, CREs include TFBSs. A single TF can bind to multiple CREs and thus regulate the expression of multiple genes (pleomorphism). CREs are usually, though not always, located upstream of the transcription start site (TSS) of the gene they regulate. “Enhancers” are CREs that enhance (i.e., upregulate) the transcription of the gene to which they are operably associated and can be found upstream, downstream, and even within introns of the gene they regulate. Multiple enhancers may act cooperatively to regulate the transcription of a single gene. In this context, “silencers” refer to TF-binding CREs called repressors that act to prevent or downregulate the transcription of a gene. The term "silencer" can also refer to a region in the 3' untranslated area of ​​messenger RNA that binds to a protein that suppresses the translation of that mRNA molecule, but this usage differs from its use in the description of CRE. Generally, the CRE of the present invention is a liver-specific enhancer element (often called liver-specific CRE or liver-specific CRE enhancer, etc.). In this context, the CRE is preferably located 1500 or fewer nucleotides away from the transcription start site (TSS), more preferably 1000 or fewer nucleotides away from the TSS, more preferably 500 or fewer nucleotides away from the TSS, and preferably 250, 200, 150, or 100 or fewer nucleotides away from the TSS. The CRE of the present invention is preferably relatively short in length, preferably with a nucleotide length of 250 or fewer nucleotides, for example, the CRE of the present invention may have a nucleotide length of 200, 175, 150, 90, 80, 70, 60, or 50 or fewer nucleotides.The CRE of the present invention is typically provided in combination with an operably coupled promoter element, which may be a minimal promoter or a proximal promoter. The CRE of the present invention enhances the liver-specific activity of the promoter element.

[0411] The term “cis-regulatory module” or “CRM” typically refers to a functional regulatory nucleic acid module containing two or more CREs, where CREs are typically liver-specific enhancers in this invention, and therefore CRMs are synthetic liver-specific regulatory nucleic acids. Thus, in this application, CRMs typically contain multiple liver-specific CREs. Typically, multiple CREs within a CRM act together (e.g., additively or synergistically) to enhance the transcription of a gene operably associated with a promoter containing the CRM. There is a considerable range of shuffling (i.e., rearranging), inversion (i.e., reversing directionality), and alteration of spacing of CREs within a CRM. Accordingly, functional variants of CRMs of this invention include, among other things, variants of the reference CRM in which the CREs within them are shuffled and / or inverted, and / or the spacing between CREs is altered.

[0412] As used herein, the term “promoter” generally refers to a region of DNA located upstream of the nucleic acid sequence to be transcribed that is necessary for transcription to occur, i.e., initiates transcription. Promoters enable the appropriate activation or repression of transcription of the coding sequences under their control. Promoters typically contain specific sequences that are recognized and bound to multiple TFs. TFs bind to promoter sequences, resulting in the recruitment of RNA polymerase, the enzyme that synthesizes RNA from the coding region of a gene. A large variety of promoters are known in the art.

[0413] As used herein, the term “synthetic promoter” refers to a promoter that does not exist in nature. In this context, the term typically includes the CRE and / or CRM of the present invention operably ligated to a minimal (or core) promoter or a liver-specific proximal promoter (promoter element). The CRE and / or CRM of the present invention serve to enhance liver-specific transcription of the gene operably ligated to the synthetic promoter. While some synthetic promoters may exist in nature (e.g., a minimal promoter or one or more CREs of a promoter), a synthetic promoter as a complete entity does not exist in nature.

[0414] As used herein, a “minimal promoter” (also known as a “core promoter”) refers to a short DNA segment that is inactive or nearly inactive on its own but can mediate transcription when combined with other transcriptional regulatory elements. Minimal promoter sequences may originate from a variety of different sources, including prokaryotic and eukaryotic genes. Examples of minimal promoters discussed above include the dopamine beta-hydroxylase gene minimal promoter, the cytomegalovirus (CMV) early gene minimal promoter (CMV-MP), and the herpesthymidine kinase minimal promoter (MinTK). Minimal promoters typically include a transcription start site (TSS) and elements immediately upstream, an RNA polymerase II binding site, and a basic transcription factor binding site (often a TATA box). Minimal promoters may also include several elements downstream of the TSS, which typically have additional regulatory elements with little or no functionality.

[0415] As used herein, “proximal promoter” refers to a minimal promoter with a proximal sequence upstream of a gene that tends to contain the main regulatory element. Often, the proximal promoter extends approximately 250 base pairs upstream of the TSS and contains a specific TFBS. The proximal promoter may also contain one or more regulatory elements downstream of the TSS, such as an UTR or intron. In this case, the proximal promoter may preferably be a naturally occurring liver-specific proximal promoter that can be combined with one or more CREs or CRMs of the present invention. However, the proximal promoter may also be synthetic.

[0416] As used herein, “promoter element” refers to either the minimal promoter or the proximal promoter as defined above. In the context of the present invention, the promoter element is typically combined with one or more CREs to provide the synthetic liver-specific promoter of the present invention.

[0417] In the context of the present invention, a “functional variant” of a CRE, CRM, promoter element, promoter, or other nucleic acid construct is a variant of a reference sequence that retains the ability to function in the same way as the reference sequence, for example, as a liver-specific CRE, liver-specific CRM, or liver-specific promoter. Alternative terms for such a functional variant include “biological equivalent” or “equivalent.”

[0418] It will be understood that the ability of a given CRE to function as a liver-specific enhancer is, in principle, determined by the ability of the sequence to bind to the same liver-specific TF that binds to the reference sequence. Therefore, in most cases, a functional variant of a CRE or CRM will contain most or all of the TFBSs of the same TF as the reference CRE or CRM. It is preferable, but not required, for the TFBS of a functional variant to be in the same relative position (i.e., order and base position) as the reference CRE or CRM. It is also preferable, but not required, for the TFBS of a functional variant to have the same orientation as the reference sequence (it should be noted that in some cases, the TFBS may exist with the orientation reversed compared to the sequence of the reference sequence, for example, as an inverse complement). Furthermore, it is preferable, but not required, for the TFBS of a functional variant to be on the same chain as the reference sequence. Therefore, in a preferred embodiment, the functional variant contains the TFBS of the same TF in the same order, position, orientation, and on the same chain as the reference sequence. It will be understood that sequences between TFBSs (sometimes called spacer sequences, etc.) do not significantly affect the function of the CRE or CRM. Such sequences may typically vary considerably, and their lengths can be altered. However, in preferred embodiments, the spacing of functional variants (i.e., the distance between adjacent TFBSs) is substantially the same as the spacing in the reference sequence (e.g., no greater variation than 20%, preferably no greater variation than 10%, and more preferably nearly the same). It will be apparent that in some cases, functional variants of the CRE may exist in the opposite direction, for example, as the inverse complement of the CRE or its variant described above.

[0419] The level of sequence identity between a functional variant and its reference sequence can also be an indicator of functionality preservation. A high level of sequence identity in a CRE TFBS is generally more important than sequence identity in a spacer sequence (which has little or no need for sequence preservation). However, considering that the sequences in functional TFBSs do not need to exactly match the consensus sequence, it is understandable that a considerable degree of sequence variability may be tolerated, even within the TFBS.

[0420] The ability of one or more TFs to bind to the TFBS of a given functional variant can be determined by any relevant means known in the art, including, but not limited to, electrical mobility shift assays (EMSA), binding assays, chromatin immunoprecipitation (ChIP), and ChIP-sequencing (ChIP-seq). In a preferred embodiment, the ability of one or more TFs to bind to a given functional variant is determined by EMSA. Methods for performing EMSA are well known in the art. A preferred method is described by Sambrook et al., cited above. Numerous related papers describing this procedure are available, for example, Hellman and Fried, Nat Protoc., 2007; Vol. 2 (No. 8): pp. 1849–1861.

[0421] "Liver-specific" or "liver-specific expression" refers to the ability of a cis-regulatory element, cis-regulatory module, or promoter to selectively or dominantly enhance or drive gene expression in the liver (or liver-derived cells) compared to other tissues (e.g., spleen, muscle, heart, lung, and brain). Gene expression may be in the form of mRNA or protein. In preferred embodiments, liver-specific expression means that expression in other (i.e., non-liver) tissues or cells is negligible, i.e., the expression is highly liver-specific.

[0422] The ability of a CRE, CRM, or promoter to function as a liver-specific CRE, CRM, or promoter can be readily assessed by those skilled in the art. Therefore, those skilled in the art can easily determine which variant of a particular CRE, CRM, or promoter described above is still functional (i.e., a functional variant as defined above). For example, any given CRM to be evaluated may be operably linked to a minimal promoter (e.g., located upstream of a CMV-MP), and the ability of the cis-regulatory element to drive liver-specific expression of a gene (typically a reporter gene) is measured. Alternatively, a variant of the CRE may be substituted in place of a reference CRE with a synthetic liver-specific promoter, and the effect on liver-specific expression driven by the modified promoter can be determined and compared to the unmodified form. Similarly, the ability of a CRM or promoter to drive liver-specific expression can be readily assessed by those skilled in the art (e.g., as described in the examples below). The expression level of a gene driven by a variant of a reference promoter can be compared to the expression level driven by a reference sequence. In some embodiments, a variant can be said to be functional if the liver-specific expression level driven by the variant promoter is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% of the expression level driven by the reference promoter. Suitable nucleic acid constructs and reporter assays for evaluating liver-specific enhancement can be easily constructed, and suitable methodologies are given in the examples shown below.

[0423] Liver specificity can be identified, where the expression of a gene (e.g., a therapeutic gene or a reporter gene) occurs selectively or predominantly in liver-derived cells. For example, if the level of expression is significantly higher in liver-derived cells than in other types of cells (i.e., non-liver-derived cells), then the expression can be defined as selective or dominant. For example, expression in liver-derived cells is preferably at least 5 times higher than in non-liver cells, preferably at least 10 times higher, and in some cases, 50 times or more higher. For convenience, liver-specific expression can preferably be demonstrated by comparing the expression level in hepatocyte lines (e.g., liver-derived cell lines such as Huh7 cells and / or HepG2 cells) or primary liver cells with the expression level in kidney-derived cell lines (e.g., HEK-293), cervical tissue-derived cell lines (e.g., HeLa), and / or lung-derived cell lines (e.g., A549).

[0424] The synthetic liver-specific promoter of the present invention preferably exhibits reduced expression in non-liver-derived cells, preferably HEK-293, HeLa, and / or A549 cells, compared to non-tissue-specific promoters such as CMV-IE. The synthetic liver-specific promoter of the present invention preferably has an activity of 50% or less, preferably 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 1% or less, of the CMV-IE promoter in non-liver-derived cells (preferably HEK-293, HeLa, and / or A549 cells). Generally, it is preferable to minimize expression in non-liver-derived cells, but in some cases this may not be necessary. In some embodiments, the synthetic liver-specific promoter of the present invention is suitable for promoting gene expression at 50% or less of the LP1 promoter level in non-liver-derived cells (e.g., HEK-293, HeLa, and / or A549 cells).

[0425] The synthetic liver-specific promoters of the present invention are preferably suitable for promoting expression in the liver of a target, for example, to drive liver-specific expression of a transgene, preferably a therapeutic transgene. Preferred synthetic liver-specific promoters of the present invention are suitable for promoting liver-specific transgene expression and have activity in liver cells at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, or 400% of the activity of the TBG promoter. In some embodiments, the synthetic liver-specific promoters of the present invention are suitable for promoting liver-specific transgene expression at at least 100% of the activity of the LP1 promoter, preferably at 150%, 200%, 300%, or 500% of the activity of the LP1 promoter. Such liver-specific expression is preferably determined in liver-derived cells, such as Huh7 cells and / or HepG2 cells, or primary hepatocytes (preferably primary human hepatocytes).

[0426] Furthermore, the synthetic liver-specific promoter of the present invention may be able to promote liver-specific gene expression at a level of at least 150% compared to CMV-IE in liver-derived cells (e.g., Huh7 cells and / or HepG2 cells), and preferably at a level of at least 200% compared to the CMV-IE promoter in liver-derived cells.

[0427] As used herein, the term “nucleic acid” typically refers to oligomers or polymers of any length (preferably linear polymers) that are essentially composed of nucleotides. A nucleotide unit generally comprises a heterocyclic base, a sugar group, and at least one, e.g., one, two, or three phosphate groups, including modified or substituted phosphate groups. Examples of heterocyclic bases include, among others, purine and pyrimidine bases such as adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), which are widely present in naturally occurring nucleic acids, in other naturally occurring bases (e.g., xanthine, inosine, hypoxanthine), and in chemically or biochemically modified (e.g., methylated) unnatural or derivatized bases. Examples of sugar groups include, particularly preferably, ribose and / or 2-deoxyribose, which are common to naturally occurring nucleic acids, or pentose (pentofuranose) groups such as arabinose, 2-deoxyarabinose, threose, or hexose sugar groups, as well as modified or substituted sugar groups. Nucleic acids as intended herein may include naturally occurring nucleotides, modified nucleotides, or mixtures thereof. Modified nucleotides may include modified heterocyclic bases, modified sugar moieties, modified phosphate groups, or combinations thereof. The introduction of phosphate groups or sugar modifications can improve stability, resistance to enzymatic degradation, or several other useful properties. The term “nucleic acid” more preferably encompasses DNA, RNA, and DNA-RNA hybrid molecules, particularly hnRNA, pre-mRNA, mRNA, cDNA, genomic DNA, amplification products, oligonucleotides, and synthetic (e.g., chemically synthesized) DNA, RNA, or DNA-RNA hybrids. Nucleic acids may be naturally occurring, for example, they may be present in nature or isolated from nature, or they may not be naturally occurring, for example, they may be recombinant, i.e., produced by recombinant DNA technology, and / or partially or entirely synthesized chemically or biochemically. "Nucleic acids" may be double-stranded, partially double-stranded, or single-stranded. If single-stranded, the nucleic acid may be a sense strand or an antisense strand.In addition, nucleic acids may be circular or linear.

[0428] Terms such as "identity" and "identical" refer to the sequence similarity between two polymer molecules, or between two nucleic acid molecules, such as two DNA molecules. Sequence alignment and sequence identity can be determined using the Basic Local Alignment Search Tool (BLAST), first described by Altschul et al. in 1990 (J Mol Biol, Vol. 215, pp. 403-401), such as the "Blast 2 sequences" algorithm described by Tatusova and Madden in 1999 (FEMS Microbiol Lett, Vol. 174: pp. 247-250).

[0429] Methods for aligning sequences for comparison are well known in the art. Various programs and alignment algorithms are described in the following literature: for example, Smith and Waterman (1981) Adv. Appl. Math., Vol. 2: p. 482; Needleman and Wunsch (1970) J. Mol. Biol., Vol. 48: p. 443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA, Vol. 85: p. 2444; Higgins and Sharp (1988) Gene, Vol. 73: pp. 237-234; Higgins and Sharp (1989) CABIOS, Vol. 5: pp. 151-153; Corpet et al. (1988) Nucleic Acids Res., Vol. 16: pp. 10881-1090; Huang et al. (1992) Comp. Appl. Biosci., Vol. 8: pp. 155-165; Pearson et al. (1994) Methods Mol. Biol., Vol. 24: pp. 307-331; Tatiana et al. (1999) FEMS Microbiol. Lett., Vol. 174: pp. 247-245. Detailed discussions of sequence alignment methods and homology calculations can be found in Altschul et al. (1990) J. Mol. Biol., Vol. 215: pp. 403-4010.

[0430] The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST®; Altschul et al. (1990)) is available from several suppliers, including the NCBI (Bethesda, Maryland), and via the Internet for use in conjunction with several sequence analysis programs. Instructions on how to determine sequence identity using this program are available online from the BLAST® "Help" section. To compare nucleic acid sequences, the BLAST® (Blastn) program's "Blast 2 sequences" function can be used with default parameters. Nucleic acid sequences with greater similarity to a reference sequence will show a higher identity percentage when evaluated in this way. Typically, the sequence identity percentage is calculated over the entire length of the sequence.

[0431] For example, the globally optimized alignment is preferably found by the Needleman-Wunsch algorithm using the following scoring parameters: match score: +2, mismatch score: -3; gap penalty: gap open 5, gap extension 2. The identity percentage of the obtained optimal global alignment is preferably calculated by multiplying the ratio of the number of aligned bases to the full length of the alignment by 100, where the alignment length includes both match and mismatch.

[0432] The term "hybridize" refers to the annealing of two at least partially complementary nucleotide sequences in a hybridization process. To enable hybridization, complementary nucleic acid molecules are generally denatured thermally or chemically to melt the double strands into two single strands and / or remove hairpins or other secondary structures from the single-stranded nucleic acids. The stringency of hybridization is influenced by conditions such as temperature, salt concentration, and hybridization buffer composition. Conventional hybridization conditions are described, for example, in Sambrook (2001) Molecular Cloning: Laboratory Manual, Third Edition, Cold Spring Harbour Laboratory Press, CSH, New York; however, those skilled in the art can design numerous different hybridization conditions as a function of known or expected homology and / or length of the nucleic acid sequences. High-stringency conditions for hybridization include high temperature and / or low sodium / salt concentration (salts include, for example, sodium in NaCl and sodium citrate), and / or inclusion of formamide in the hybridization buffer, and / or reduced concentration of compounds such as SDS (sodium dodecyl sulfate surfactant) in the hybridization buffer, and / or exclusion of compounds such as dextran sulfate or polyethylene glycol (which promote molecular clustering) from the hybridization buffer. As a non-limiting example, typical salt and temperature conditions for stringent hybridization are 1×SSC, 0.5% SDS at 65°C. The abbreviation SSC refers to the buffer used in nucleic acid hybridization solutions. One liter of 20× (20-fold concentrate) stock SSC buffer solution (pH 7.0) contains 175.3 g of sodium chloride and 88.2 g of sodium citrate. A typical period for achieving hybridization is 12 hours.

[0433] The term “transcription factor binding site” (TFBS) is well known in the art. Various specific TFBS sequences are disclosed herein. It will be apparent to those skilled in the art that alternative TFBS sequences can be used, provided they bind to the intended TF. The consensus sequences for the various TFBS disclosed herein are known in the art, and those skilled in the art can readily use this information to determine alternative TFBS. Furthermore, the ability of a TF to bind to a given putative sequence can be readily determined experimentally by those skilled in the art (e.g., by EMSA and other methods well known in the art and discussed herein).

[0434] The meaning of "consensus sequence" is well known in the art. In this application, unless the context indicates otherwise, the following notation is used for consensus sequences: The following is an example of a DNA sequence: A[CT]N{A}YR Considering this, A means that A is always found in that position, [CT] represents either C or T in that position, N represents any base in that position, and {A} means that any base other than A is found in that position. Y represents any pyrimidine, and R represents any purine.

[0435] In this application, "synthetic" means a nucleic acid molecule that does not occur in nature. The synthetic nucleic acid expression constructs of the present invention are typically produced artificially by recombinant technology. Such synthetic nucleic acids may contain naturally occurring sequences (e.g., promoters, enhancers, introns, and other such regulatory sequences), but they exist in a context in which they do not occur in nature. For example, a synthetic gene (or portion of a gene) typically contains one or more nucleic acid sequences (chimeric sequences) that do not occur in nature, and / or may include substitutions, insertions, deletions, and combinations thereof.

[0436] As used herein, "complementary" or "complementarity" refers to the Watson-Crick base pairing of two nucleic acid sequences. For example, sequence 5'-AGT-3' binds to the complementary sequence 3'-TCA-5'. The complementarity between two nucleic acid sequences may be "partial," where only some of the bases bind to their complements, or it may be complete, where all the bases in the sequence bind to their complementary bases. The degree of complementarity between nucleic acid strands significantly affects the efficiency and strength of hybridization between nucleic acid strands.

[0437] In this application, "transfection" broadly refers to any process of intentionally introducing nucleic acids into cells, encompassing the introduction of viral and non-viral vectors, and including transformation, transduction, and similar terms and processes. Examples, though not limited to these, include: transfection with viral vectors; transformation with plasmid vectors; electroporation (Fromm et al. (1986), Nature Vol. 319: pp. 791-793); lipofection (Feigner et al. (1987), Proc. Natl. Acad. Sci. USA Vol. 84: pp. 7413-747); microinjection (Mueller et al. (1978), Cell Vol. 15: pp. 579-85); Agrobacterium-mediated transfer (Fraley et al. (1983), Proc. Natl. Acad. Sci. USA Vol. 80: pp. 4803-4877); direct DNA uptake; whisker-mediated transformation; and particulate guns (Klein et al. (1987), Nature Vol. 327: p. 70).

[0438] As used herein, the term “transgene” refers to an exogenous nucleic acid sequence. In one example, the transgene is a gene that codes for an industrially or pharmaceutically useful compound, or a gene that codes for a desirable trait. In yet another example, the transgene codes for an antisense nucleic acid sequence, and the expression of the antisense nucleic acid sequence inhibits the expression of the target nucleic acid sequence. The transgene preferably codes for a therapeutic product, such as a protein.

[0439] The term "vector," as is well known in the art and as used herein, refers to a nucleic acid molecule, such as double-stranded DNA, into which a nucleic acid sequence according to the present invention can be inserted. The vector is preferably used to transport the inserted nucleic acid molecule to a suitable host cell. The vector typically contains all the necessary elements to enable the transcription of the inserted nucleic acid molecule, and preferably, the translation of the transcript into a polypeptide. Because the vector typically contains all the necessary elements, once present in a host cell, the vector can replicate independently of or simultaneously with host chromosomal DNA, producing several copies of the vector and its inserted nucleic acid molecule. The vector of the present invention may be an episomal vector (i.e., not integrated into the host cell genome) or a vector integrated into the host cell genome. This definition includes both non-viral and viral vectors. Non-viral vectors include, but are not limited to, plasmid vectors (e.g., pMA-RQ, pUC vectors, bluescript vectors (pBS), and pBR322, or their derivatives lacking bacterial sequences (minicircles)) and transposon-based vectors (e.g., PiggyBac (PB) vector or Sleeping Beauty (SB) vector). Larger vectors, such as artificial chromosomes (bacteria (BAC), yeast (YAC), or human (HAC)), can accommodate larger inserts. Viral vectors are derived from viruses and are not limited to, but include retroviral vectors, lentiviral vectors, adeno-associated virus vectors, adenovirus vectors, herpesvirus vectors, or hepatitis virus vectors. Typically, though not always, viral vectors are replication-deficient because the viral genes essential for replication have been removed from the viral vector, thus losing the ability to proliferate in a given cell. However, some viral vectors can be configured to replicate specifically in a given cell, such as cancer cells, and are typically used to induce (cancer) cell-specific (tumor) lysis.Virosoms are a non-limiting example of vectors containing both viral and non-viral elements, particularly the combination of liposomes with inactivated HIV or influenza virus (Yamada et al., 2003). Another example includes viral vectors mixed with cationic lipids.

[0440] The terms “operatably linked,” “operatably connected,” or equivalent expressions, as used herein, refer to the arrangement of various nucleic acid elements relative to each other such that the elements are functionally connected and can interact with each other in an intended manner. Such elements include, but are not limited to, promoters, CREs (e.g., enhancers or other regulatory elements), polyadenylated sequences, one or more introns and / or exons, and coding sequences of genes to be expressed. When nucleic acid sequence elements are properly oriented or operationally linked, they can act together to modulate each other’s activity and ultimately affect the expression level of the expression product. Modulation means increasing, decreasing, or maintaining the activity level of a particular element. The position of each element relative to other elements can be expressed at the 5' and 3' ends of each element, or at the point where their positions are upstream or downstream of another element or position (such as a TSS or promoter element), and the distance between any particular elements can be referred to by the number of intervening nucleotides or base pairs between the elements. As those skilled in the art will understand, "operably linked" implies functional activity and does not necessarily refer to innate positional linkage. In fact, when used in nucleic acid expression cassettes, CREs are typically located immediately upstream of the promoter element (this is generally true, but should not be interpreted as a limitation or exclusion of position within the nucleic acid expression cassette), but this may not be true in vivo. For example, a regulatory element sequence that in nature is located downstream of a gene that affects transcription can function just as well if it were located upstream of the promoter. Therefore, according to certain embodiments, the regulatory or enhancing effect of a regulatory element may be position-independent.

[0441] A “spacer sequence” or “spacer,” as used herein, is a nucleic acid sequence that separates two functional nucleic acid sequences (e.g., TFBS, CRE, CRM, promoter element, etc.). It can have essentially any sequence, as long as it does not prevent the functional nucleic acid sequences (e.g., cis-regulatory elements) from functioning as desired (for example, this can occur if the “spacer sequence” or “spacer” includes a silencer sequence that prevents the binding of a desired transcription factor, etc.). Typically, a “spacer sequence” or “spacer” is non-functional, as it exists solely to separate adjacent functional nucleic acid sequences from each other. In some embodiments, the spacer may have a length of 75, 50, 40, 30, 30, or 10 nucleotides, or fewer.

[0442] When used herein, the term "pharmaceutically acceptable" means consistent with the art, compatible with other components of a pharmaceutical composition, and not harmful to its recipient.

[0443] "Therapeutic dose" and similar terms mean, for example, the dose or plasma concentration in a subject that causes a therapeutic gene to be expressed in the liver, thereby providing a specific pharmacological effect. A therapeutic dose is not always effective in treating the conditions described herein, even if such a dose is considered therapeutic by those skilled in the art. Therapeutic doses may vary depending on the route of administration and dosage form, the age and weight of the subject, and / or the disease or condition to be treated.

[0444] The terms “treatment” or “to treat” refer to reducing, improving, or eliminating one or more signs, symptoms, or effects of a disease or condition.

[0445] "Administration" of a substance to a subject includes any route for introducing or delivering the substance to the subject to perform its intended function. Administration may be carried out by any preferred route, including oral, intranasal, intraocular, ophthalmic, parenteral (intravenous, intramuscular, intraperitoneal, or subcutaneous), or topical. Administration includes self-administration and administration by another person.

[0446] The terms “individual,” “subject,” and “patient” are used interchangeably and refer to any individual subject having a disease or condition requiring treatment. For the purposes of this disclosure, the subject may be a primate, preferably a human, or another mammal such as a dog, cat, horse, pig, goat, or cattle. [Examples]

[0447] (Example 1) array The following sequence is relevant to this disclosure.

[0448] [Table 5A]

[0449] [Table 5B]

[0450] [Table 6]

[0451] [Table 7]

[0452] [Table 8]

[0453] [Table 9]

[0454] [Table 10]

[0455] Table 11

[0456] Table 12

[0457] Table 13

[0458] Table 14

[0459] Table 15

[0460] Table 16

[0461] Table 17

[0462] Table 18

[0463] Table 19

[0464] Table 20

[0465] Table 21

[0466] Table 22

[0467] Table 23

[0468] Table 24

[0469] Table 25

[0470] Table 26

[0471] Table 27

[0472] Table 28

[0473] Table 29

[0474] Table 30

[0475] Table 31A

[0476] Table 31B

[0477] Table 31C

[0478] Table 31D

[0479] Table 31E

[0480] Table 31F

[0481]

Table 31G

[0482] Table 32A

[0483] Table 32B

[0484] Table 32C

[0485] Table 32D

[0486] Table 32E

[0487] [Table 32F]

[0488] [Table 32G]

[0489] [Table 32H]

[0490] [Table 32I]

[0491] [Table 32J]

[0492] [Table 32K]

[0493] [Table 32L]

[0494] [Table 33A]

[0495] [Table 33B]

[0496] (Example 2) Substances and methods Promoters were designed using Synpromics' proprietary platform PROMPT® and synthesized using GeneArt®. This involved analyzing liver gene expression datasets, including microarrays and NGS datasets, to identify candidate genes, and reviewing scientific literature to identify genes expressed at very high levels in liver cells. Cis-regulatory elements were selected and analyzed. TFBS within CRE were identified.

[0497] Synthetic promoters containing CRMs linked to minimal / proximal promoters, as discussed herein, were cloned upstream of the luciferase reporter gene and the subsequent SV40 late polyA signaling pathway into vectors having a scaffold essentially identical to that of pUC19. The DNA preparations were transfected into either Huh7 (hepatocellular carcinoma cell line), HeLa (immortalized cervical cancer cell line), or HEK293 (human fetal kidney cells), and transcriptional activity was evaluated. Huh-7 cells were obtained from the JCRB cell bank (JCRB0403), and HeLa and HEK293 cells were obtained from the ECACC cell bank. All cell lines were grown and maintained according to the recommendations of the cell banks.

[0498] Transfection was performed in triple duplication in a 48-well plate using FuGene HD transfection reagent (Promega #E2311) at a DNA:FuGene HD ratio of 1:1.1. Luciferase activity was measured 24 hours after transfection. Cells were washed with phosphate-buffered saline (PBS), lysed in 100 μl of Passive Lysis buffer (Promega #E194A), and stored overnight at -80°C. Luciferase activity was quantified in 10 μl of lysate using the Luciferase Reporter 1000 assay system (Promega #E4550) according to the manufacturer's guidelines, using a 96-well flat-bottom white solid microplate, FluoroNunc plate (Thermo Fisher #236105), and luminescence was quantified using a FLUOstar Omega plate reader (BMG Labtech).

[0499] The luciferase method described above is a conventional method in this field, and similar techniques are extensively described in the literature, for example, Alam and Cook, "Reporter Genes: Application to the Study of Mammalian Gene Transcription," Analytical Biochemistry, Vol. 188, pp. 245-254 (1990).

[0500] Discussion and Results Bioinformatics analysis of large genome datasets led to the discovery of cis-regulatory elements (CREs) that are expected to be useful for enhancing liver-specific gene expression. The top 12 CREs were selected to design four synthetic liver-specific promoters. These promoters were named LVR_127, LVR_131, LVR_132, and LVR_133, respectively. The structures of these promoters, including the CREs and minimal / proximal promoter elements present in each promoter, are shown in Figure 1.

[0501] The sequences of these promoters are shown in Table 32, and the CRMs included in these promoters are shown in Table 31. The sequences of the components (CREs) of these CRMs / promoters are shown in Table 5, and the minimal / proximal promoters operably linked to these CRMs are shown in Table 6. For promoters LVR_127, LVR_131, and LVR_132, CRMs containing various combinations of CREs (Table 31) were placed upstream of the minimal promoter LVR_CRE0052_G6PC (see Table 6). For LVR_133, the CRM was placed upstream of the SERPINA7 proximal promoter (LVR_CRE0079_SERPINA7, see Table 6).

[0502] The ability of these synthetic promoters to drive expression in liver cells was benchmarked against the ubiquitous CMV_IE and CBA promoters, as well as the known liver-specific promoter LP1. The sequences of these promoters are shown in Table 14. The results of this experiment, which represent the average of three replicas, are shown in Figure 2. The bars indicate the standard deviation.

[0503] All synthetic promoters according to the present invention showed higher activity than the LP1 promoter in Huh7 cells (Figure 2). When these promoters were screened against non-liver-derived HEK293 cells and HeLa cells, they showed negligible activity compared to the ubiquitously active promoters CMV_IE and CBA (see Figures 5 and 6). This indicates that the LVR_127, LVR_131, LVR_132, and LVR_133 promoters are highly specific in terms of activity in liver cell lines.

[0504] Subsequently, two candidate enhancers were designed based on bioinformatics predictions using the following CREs: LVR_CRE0080_PROC, LVR_CRE0081_APOA1, LVR_CRE0061_APOB, and LVR_CRE0082_APOC4. These synthetic enhancers were named "V1" (or LVR_CRE0077_V1, SEQ ID NO: 19) and "V2" (or LVR_CRE0078_V2, SEQ ID NO: 20), respectively (Figure 3). The effects of these candidate enhancers were tested by adding them to the previously described LVR_127, LVR_131, LVR_132, and LVR_133 liver-specific promoters. Furthermore, a known human alpha(1)-microglobulin / bikunin precursor (AMBP) enhancer, named "A1" (or LVR_CRE0051_AMBP, SEQ ID NO: 3) in this specification (Rouet et al., 1992), was added to the LVR_127, LVR_131, LVR_132, and LVR_133 liver-specific promoters. These novel promoters with the additional enhancer element were tested in Huh7 cells as previously described for the LVR_127, LVR_131, LVR_132, and LVR_133 liver-specific promoters.

[0505] As shown in Figures 4a to 4d, the addition of either the V1 or V2 enhancer significantly enhanced the promoter activity of LVR_127, LVR_132, and LVR_133. The only exception observed was the combination of LVR_131 and V2. Furthermore, the liver specificity of the promoters was preserved even after the addition of V1 and V2 enhancer sequences. This was confirmed by counter-screening of the promoters in HEK293 and HeLa cells (Figure 5).

[0506] The promoters of the SYNP_LVR_131 family (SEQ ID NOs. 202 and 230-232), particularly SYNP_LVR_131_A1 (SEQ ID NOs. 230), are considered to be especially potent. Therefore, these promoters, as well as the CRMs they contain (SEQ ID NOs. 130 and 158-160, particularly SEQ ID NOs. 158), and their functional variants are of particular interest. However, all synthetic promoters according to the present invention are considered to be potent and liver-specific.

[0507] The CREs used in the CRMs and promoters specifically exemplified herein may be rearranged (e.g., shuffled or inverted) and it is expected that liver-specific promoter activity will be preserved. Furthermore, the sequences of the CREs, CRMs, and promoters are expected to be significantly altered while preserving liver-specific promoter activity. Generally, the TFBSs within the CRE should be preserved, preferably in the same order and at approximate intervals as the reference CRE, to the extent that the CRE can still bind to the same TF, in order to maintain function. Generally, the CREs (i.e., enhancers) of this disclosure themselves are self-contained regulatory units that can be moved and / or reoriented without loss of function. Those skilled in the art can easily determine the effect of any modification to the CRE, CRM, or promoter using the methods described herein (e.g., in absolute terms or in comparison to the reference CRE, CRM, or promoter). Furthermore, the CREs can be incorporated into other promoters to drive liver-specific expression (in particular, other CREs disclosed herein, as well as V1 and V2, which are considered to have broad utility).

[0508] In summary, these novel synthetic promoters and enhancers are valuable tools for gene therapy using liver-specific gene expression, and for designing liver-specific gene therapies.

[0509] (Example 3) Bioinformatics and literature analyses of large-scale genomic datasets led to the identification of additional cis-regulatory elements (CREs) that are expected to be useful in enhancing liver-specific gene expression. These CREs were used to design further liver-specific promoters.

[0510] The activity of the obtained liver-specific promoters (i.e., all promoters shown in Table 32) was tested in Huh7 cells using essentially the same substances and methods as described in Example 2. However, since TBG was found to show higher and more consistent in vitro expression than LP1, in this case the activity of the liver-specific promoter was compared to the activity of promoter TBG.

[0511] Furthermore, the specificity of liver-specific promoters to hepatocytes was tested using non-hepatic HEK293 cells with the substances and methods described in Example 2. The activity of liver-specific promoters is shown in comparison to the activity of CMV-IE (TBG and LP1 are liver-specific and therefore not particularly active in HEK293 cells). In the graph showing the specificity of liver-specific promoters tested in HEK293 cells, "relative activity" represents the activity of the notated promoter as a ratio to the activity of CMV-IE, where 1 is the same activity as CMV-IE, a value greater than 1 indicates higher activity compared to CMV-IE, and a value less than 1 indicates lower activity compared to CMV-IE.

[0512] Activation The average activity of the promoters according to the present invention is shown in Figures 8A, 9A, 10A, and 11A. The average relative activity from different experiments is shown for each promoter, and each experiment is itself the average of technical replicates. Error bars are the standard error of the mean. Where no error bars are present, the data is from a single experiment. The “relative activity” in these graphs showing the activity of liver-specific promoters tested in Huh7 cells is the activity of the nominal promoter expressed as a percentage of TBG activity (i.e., 100 is the same activity as TBG, higher than 100 is higher activity compared to TBG, and lower than 100 is lower activity compared to TBG). It should be noted that TBG is an extremely potent liver-specific promoter, and therefore promoters showing lower expression than TBG can still be extremely useful. In particular, promoters that are shorter than TBG but still show high levels of activity (e.g., 15%, more preferably 25%, 50%, or 75%, or higher than TBG activity) are of particular interest.

[0513] All of the synthetic liver-specific promoters of the present invention can be observed to be highly active in liver cells.

[0514] The average activity of two promoters containing only promoter elements CRE0006 (SP0154) and CRE0040 (SP0235) is shown in Figure 11B for comparison.

[0515] Figure 11B shows the activity of SP0154 containing only promoter element CRE0006. SP0154 has relatively low activity compared to TBG, but this is actually surprisingly high considering the complete lack of additional CRE. However, when additional CRE is combined with promoter element CRE0006, such as promoters SP0155 (CRE0006 and CRE0001), SP0158 (CRE0006 and CRE0005), and SP0163 (CRE0006 and CRE0012), the activity of the resulting synthetic liver-specific promoter increases 5-fold, 3-fold, and 6-fold, respectively, as shown in Figure 11A. Similarly, when promoter element CRE0006 is combined with a combination of CRE, such as promoter SP259 (a combination of CRE0006 with CRE0001 and CRE0047), the activity of the resulting synthetic promoter increases 4-fold, as shown in Figure 11A. This indicates that individual CREs, such as CRE0001, CRE0005, CRE0012, and combinations of CRE0001 and CRE0047, can provide significantly enhanced activity when added to promoter elements such as CRE0006.

[0516] Furthermore, Figure 11B shows the activity of SP0235 containing only the promoter element CRE0040. SP0235 has minimal relative activity. However, when additional CREs are combined with the promoter element CRE0040, such as promoters SP0236 and SP264 (both containing CRE0040 and CRE0018), the activity of the resulting synthetic promoter increases by approximately 50 times, as shown in Figure 11A. Similarly, when the promoter element CRE0040 is combined with a combination of multiple CREs, such as promoter SP0252 (a combination of CRE0040, CRE0018, and CRE0077), the activity of the resulting synthetic promoter increases by approximately 40 times, as shown in Figure 11A. This indicates that individual CREs, such as CRE0018, and combinations of CRE0018 and CRE0077, can provide significant enhancement when added to promoter elements such as CRE0040.

[0517] In Figure 11A, promoters SP0236 and SP0264 contain the same CRE and promoter elements, but SP0236 lacks a consensus Kozak sequence, while SP0264 does. The presence of the consensus Kozak sequence is not thought to affect promoter activity.

[0518] Liver Promoter activity in HEK293 cells compared to CMV-IE is shown in Figures 8B, 9B, 10B, and 11C. The mean relative activity from different experiments is shown for each promoter. Where no error bars are present, the results are from a single experiment. The specificity of most, though not all, promoters was experimentally tested. Many of the promoters according to the present invention are expressed at a low level in HEK293 cells, as indicated by their activity in HEK293 cells being less than 50% of their activity in CMV-IE. The majority of promoters show activity in HEK293 cells being less than 10% of their activity in CMV-IE, indicating that their activity is highly liver-specific.

[0519] Identification of high-performance CRE and promoter elements A large group of more than 200 promoters was created, containing various combinations of CREs and / or promoter elements expected to be useful for enhancing liver-specific gene expression (this included all of the synthetic promoters used in Example 3, as well as additional liver-specific promoters and liver-specific CREs). These promoters represent a large group of liver-specific promoters useful for evaluating the contributions made to expression by various CREs. This large group of promoters is referred to as "all" in Figures 12A and 12B.

[0520] By analyzing this group, we identified individual CREs and groups of CREs that correlated particularly strongly with high levels of liver-specific expression.

[0521] Of all the groups of promoters tested, a specific subset of liver-specific promoters containing two or more operablely linked “core” CREs, selected from the group consisting of CRE0018, CRE0042, CRE0051, CRE0058, CRE0065, CRE0066, CRE0068, and CRE0074, was found to correlate particularly well with high levels of activity. This preferred group of promoters is referred to as “Group 1” in Figures 12A and 12B.

[0522] In addition, a further subset of liver-specific promoters, including at least one of the aforementioned core CREs operably linked to one of the promoter elements CRE0059 and CRE0006, was found to correlate particularly well with high activity. This preferred group of promoters is referred to as "Group 2" in Figures 12A and 12B. It should be noted that some promoters fall into both "Group 1" and "Group 2" (i.e., they contain two or more core CREs and either CRE0059 or CRE0006).

[0523] To demonstrate the particularly high activity of the promoters in "Group 1" and "Group 2," the average relative activity of "All" (n=217), "Group 1" (n=49), and "Group 2" (n=20) is shown in Figure 12A (note that "All" includes additional promoters in addition to those in "Group 1" and "Group 2"). As can be seen from this figure, the average relative activity of "Group 1" is approximately twice as high as the average relative activity of "All." In addition, the average relative activity of "Group 2" is approximately three times higher than the average relative activity of "All." Even when the relative activity of each promoter is divided by its size (in base pairs), "Group 1" and "Group 2" still perform better than "All," suggesting that this is not due to differences in length between the groups. The average of these values ​​for each group is shown in Figure 12B.

[0524] While we do not wish to be constrained by theory, the superior performance of "Group 1" and "Group 2" may be due to the presence of one or more core CREs and preferred promoter elements. In all groups of promoters tested (group "all"), the number of CREs present in each promoter was counted. In addition, the number of core CREs present in each promoter was counted. In this case, the core CREs are CRE0018, CRE0042, CRE0051, CRE0058, CRE0065, CRE0066, CRE0068, and CRE0074. The average activity of promoters with a specific number of core CREs for any given CRE was calculated. This is shown in Figure 13A. This figure shows that the presence of a specified number of core CREs in a promoter is associated with an increase in activity compared to promoters with a specified number of CREs where the CREs are any given CRE. This is not due to the size difference between the group of promoters containing a specified number of core CREs and the group of promoters with a specified number of arbitrary CREs, as the comparison of activity against size shows a similar trend, as shown in Figure 13B.

[0525] As can be seen from the fact that the average relative activity of "Group 2" (promoter comprising at least one core CRE and a preferred promoter element) is higher than that of "Group 1" (promoter comprising at least two core CREs), the activity of the resulting synthetic promoter is even higher when one or more core CREs are combined with a preferred promoter element such as CRE0059 or CRE0006.

[0526] The presence of various subsets of CREs within the core CRE group of a promoter is also associated with higher levels of activity. For example, as can be seen in Figures 15A and 15B, the average activity and average activity relative to size (in base pairs) of a promoter containing both CRE0051 and CRE0058 (n=25) is higher than the average activity of a promoter (n=50) derived from the "all" group with two CREs. Similarly, as can be seen in Figures 16A and 16B, the average activity and average activity relative to size (in base pairs) of a promoter (n=15) containing CRE0051, CRE0058, and CRE0065 is higher than the average activity of a promoter (n=19) derived from the "all" group with three CREs. As can be seen in Figures 17A and 17B, the average activity and average activity relative to size (in base pairs) of a promoter (n=8) containing CRE0051, CRE0058, and CRE0066 is higher than the average activity of a promoter (n=19) derived from the "all" group with three CREs. As can be seen in Figures 18A and 18B, the average activity and average activity relative to size (in base pairs) of promoters containing CRE0051, CRE0058, CRE0065, and CRE0066 (n=7) are higher than the average activity of promoters (n=15) derived from "all" groups with four CREs. As can be seen in Figures 19A and 19B, the average activity and average activity relative to size (in base pairs) of promoters containing CRE0051, CRE0065, and CRE0066 (n=19) are higher than the average activity of promoters (n=19) derived from "all" groups with three CREs. As can be seen in Figures 20A and 20B, the average activity and average activity relative to size (in base pairs) of promoters containing CRE0051, CRE0058, and CRE0074 (n=6) are higher than the average activity of promoters (n=19) derived from "all" groups with three CREs.As can be seen in Figures 21A and 21B, the average activity and average activity relative to size (in base pairs) of the promoter containing CRE0051, CRE0058, CRE0065, and CRE0074 (n=4) is higher than the average activity of the promoter (n=15) derived from "all" groups with four CREs. As can be seen in Figures 22A and 22B, the average activity and average activity relative to size (in base pairs) of the promoter containing CRE0058, CRE0065, and CRE0066 (n=19) is higher than the average activity of the promoter (n=50) derived from "all" groups with three CREs. Finally, as can be seen in Figures 23A and 23B, the average activity and average activity relative to size (in base pairs) of the promoter containing CRE0058, CRE0065, and CRE0074 (n=14) is higher than the average activity of the promoter (n=19) derived from "all" groups with two CREs. Overall, the presence of the aforementioned combinations of CRE is associated with higher activity. This is not due to differences in size between groups, as normalizing activity against size (in base pairs) reveals that promoter performance including the aforementioned combinations of CRE is equally superior.

[0527] (Example 4) AAV production The activity of a subset of promoters according to the present invention was tested in vivo. The synthetic promoters included in this study were LVR-239 (SP0239), LVR-244 (SP0244), and the positive control LP1. The reporter gene used was fLUC-T2A-EGFP, i.e., fLUC (firefly luciferase) fused to mEGFP (mutant green fluorescent protein) via a T2A signal (bidirectional self-cleaving peptide). The pAAV_SYNP_Luc-T2A-GFP destination vector was derived from pAAV ZsGreen1 (purchased from Clontech), with the ZsGreen1 reporter replaced by the Luc-T2A-GFP dual reporter. All DNA plasmids were prepared using the QIAGEN Plasmid Mega Kit (Qiagen #12181, Germany) according to the manufacturer's instructions.

[0528] HEK293T cells were cultured in tissue-culture-treated 145mm culture dishes (Greiner Bio-One Ltd, #639160, UK) on Dulbecco's Modified Eagle Medium supplemented with 10% (v / v) fetal bovine serum (Sigma, #F7524, UK), high glucose, and GlutaMAX supplement (Gibco (Life Technologies), #61965-059, UK), and incubated at 37°C and 5% CO2. Other reagents for cell culture were purchased from Invitrogen, UK, and plastic products were purchased from Life Technologies.

[0529] All AAV vectors used in this study were pseudotyped to the AAV9 capsid. HEK293T cells were used as producer cells, co-transfected with plasmids in which the reporter gene was regulated by different promoters, along with a plasmid (pDG9) that encoded a helper function enabling viral replication. HEK293T cells were transfected with polyethyleneimine (PEI) (Sigma-Aldrich #764604, UK) at a stock concentration of 1 ug / ul in a molar ratio of 1:3 (DNA:PEI).

[0530] AAV purification and titration 72 hours after transfection, the cells were lysed, the crude lysate was filtered, and then purified using an AKTAprime plus high-performance liquid chromatography HPLC system (GE Healthcares, #11001313) with an HPLC column containing POROS® CaptureSelect® AAV resin (Thermo Scientific, #A36739).

[0531] The number of vector genomes was determined by qPCR titration targeting a LUC cassette with forward primer (ACGCTGGGCTACTTGATC-SEQ ID NO: 265), reverse primer (CGAGGAGGAGCTATTCTTG-SEQ ID NO: 266), and probe (TTTCGGGTCGTGCTCATG-SEQ ID NO: 267) using a QuantStudio® 3 system real-time PCR (Thermo Fisher Scientific, UK) according to the manufacturer's instructions for use of Luna® Universal qPCR Master Mix (NEB, UK #M3003). The data was analyzed using QuantStudio design and analysis software V1.4.1.

[0532] Animal Procedures Six-week-old, uninbred CD1 male mice were purchased from Charles River, UK. The mice were kept in isolation for one week, then transferred to closed, ventilated cages and maintained in a minimal-disease facility. The mice were placed in cages of five per cage, normalized to body weight, and given free access to food and water. Newly housed mice were given an additional one-week acclimatization period before the experiment. This study was conducted in accordance with University College London's internal guidelines, based on statutory Home Office recommendations; regulatory, ethics, and licensing procedures; and the Animals (Scientific Procedures) Act 1986.

[0533] animal injection AAV was administered to 8-week-old young adult male CD1 mice anesthetized with 2%-4% isoflurane supplied to a heated chamber (Thermo Fisher Scientific, UK) in medical air (21% oxygen) (Abbotts Laboratories, UK). Intravenous injection was administered into the lateral tail vein of the mice using a 27G 1 / 2 inch, 1.0 ml insulin syringe (Fisher Scientific, UK). Each mouse was injected with an AAV vector dose of 8E+10 AAV viral genomes per mouse in a final volume of 200 μl of physiological saline solution. The mice were then allowed to return to normal body temperature before being returned to their cages.

[0534] Bioluminescence imaging Mice were subjected to whole-body bioluminescence imaging weekly. If necessary, mice were anesthetized with 2%–4% isoflurane supplied in medical air (21% oxygen), and 300 μl of 15 mg / mL D-luciferin potassium salt (Syd Labs #MB000102, USA) was intraperitoneally injected using an insulin syringe (Fisher Scientific, UK). D-luciferin stock was prepared in physiological saline (Gibco #14190-094, UK). After 5 minutes, mice were imaged for 1–10 seconds using a cooled charge-coupled device camera (IVIS Lumina II, Perkin Elmer, UK). The region of interest (ROI) was measured using IVIS Lumina Living image 4.5.5 (Perkin Elmer), with photons per steradian per square centimeter per second (photons / sec / cm²). 2 It was represented as / sr).

[0535] data The results of this study are shown in Figure 13B. The results are expressed as the average total flux (number of photons per second) of luciferase bioluminescence intensity for all tested animals in each group. Error bars represent the standard error of the mean.

[0536] In the "physiological saline" group (n=10), animals were injected with physiological saline alone. Luciferase bioluminescence was not detected. This group served as a negative control, demonstrating that luciferase bioluminescence is not detectable unless luciferase operably linked to a promoter is injected.

[0537] In the "LP1" group (n=9), animals were injected with luciferase operably linked to the LP1 promoter. Luciferase bioluminescence was detected. This group served as a positive control, demonstrating that luciferase can be expressed and detected under the control of the LP1 promoter.

[0538] To test the activity of the liver-specific promoter according to the present invention, animals were injected with a construct containing luciferase operably ligated to two promoters. In group "SP0244" (n=8), the luciferase was operably ligated to the SP0244 promoter. In group "SP0239" (n=10), the luciferase was operably ligated to the SP0239 promoter.

[0539] As can be seen in Figure 13B, groups "SP0244" and "SP0239" exhibit higher bioluminescence intensity than group "LP1". Promoters SP0244 and SP0239 show high activity in vivo, and their activity is higher than that of LP1.

[0540] This experiment demonstrates that the in vitro results obtained in Example 3 correlate with the results obtained in vivo. Furthermore, consistent with the data presented in Example 3, which shows a relationship between the presence of core CREs and preferred promoter elements (CRE0006 and CRE0059), promoter SP0239, which shows high expression in vivo, is a member of "Group 1" discussed above and contains five core CREs. Promoter SP0244, which also shows high expression, is a member of both "Group 1" and "Group 2" and contains three core CREs and a preferred promoter element, namely CRE0006. This data indicates that the presence of core CREs, and the combination of core CREs and preferred promoter elements, is associated not only with high expression in vitro but also with high expression in vivo.

[0541] The present invention provides a range of liver-specific promoters exhibiting varying intensities, which can be highly useful in providing desired levels of liver-specific expression in therapeutic settings.

[0542] While the present invention is described and illustrated in conjunction with several specific embodiments, those skilled in the art will understand that modifications and alterations can be made without departing from the principles of the invention as illustrated, described and claimed herein. The present invention can be embodied in other specific forms without departing from their spirit or essential features. The embodiments described are in all respects illustrative and not limiting.

[0543] pAAV_SYNP_Luc_2A_GFP

Claims

1. - CRE0066.2 (SEQ ID NO: 8), CRE0083.1 (SEQ ID NO: 21), CRE0052 (SEQ ID NO: 23); - CRE0051 (SEQ ID NO: 3), CRE0083.1, CRE0052; - CRE0066.1 (SEQ ID NO: 9), CRE0073.1 (SEQ ID NO: 28); - CRE0066.2, CRE0073.1; - CRE0001 (SEQ ID NO: 12), CRE0006 (SEQ ID NO: 25); - CRE0005 (SEQ ID NO: 13), CRE0006; - CRE0012 (SEQ ID NO: 14), CRE0006; - CRE0018 (SEQ ID NO: 1), CRE0040 (SEQ ID NO: 29); - CRE0077 (SEQ ID NO: 19), CRE0018, CRE0040; - CRE0047 (SEQ ID NO: 15), CRE0001, CRE0006; - CRE0018, CRE0040; - CRE0051, CRE0052; and - CRE0074 (Sequence ID 11), CRE0052 A synthetic liver-specific promoter comprising a combination of CRE and an operablely linked promoter element or a functional variant thereof, selected from the group consisting of the following: The functional variant is a synthetic liver-specific promoter comprising a sequence that is at least 90% identical to the reference sequence.

2. The synthetic liver-specific promoter according to claim 1, wherein the CRE and operably linked promoter elements or functional variants thereof are present in the order described and adjacent to one another.

3. A synthetic liver-specific promoter according to claim 1 or 2, selected from the group comprising SP0107 (SEQ ID NO: 188), SP0111 (SEQ ID NO: 190), SP0115 (SEQ ID NO: 193), SP0116 (SEQ ID NO: 194), SP0155 (SEQ ID NO: 205), SP0158 (SEQ ID NO: 206), SP0163 (SEQ ID NO: 207), SP0236 (SEQ ID NO: 208), SP0252 (SEQ ID NO: 211), SP0259 (SEQ ID NO: 228), SP0264 (SEQ ID NO: 229), SP0388 (SEQ ID NO: 246), and SP0399 (SEQ ID NO: 250), or any functional variant thereof.

4. A synthetic liver-specific promoter according to any one of claims 1 to 3, having a length of 700 or fewer nucleotides.

5. A synthetic liver-specific promoter according to any one of claims 1 to 4, exhibiting liver-specific promoter activity that is at least 25%, 50%, 75%, or 100% of the activity of the TBG promoter.

6. A synthetic liver-specific promoter according to any one of claims 1 to 5, which exhibits 50%, 10%, or 1% or less of the activity of CMV-IE in non-hepatic cells.

7. An expression cassette comprising a synthetic liver-specific promoter according to any one of claims 1 to 6, operably linked to a sequence encoding an expression product.

8. The expression cassette according to claim 7, wherein the sequence encoding the expression product is a transgene encoding a therapeutic protein.

9. A vector comprising a synthetic liver-specific promoter according to any one of claims 1 to 6 or an expression cassette according to claim 7 or 8.

10. The vector according to claim 9, which is a viral vector.

11. The vector according to claim 9 or 10, which is a gene therapy vector.

12. The vector according to claim 10 or 11, which is an AAV vector.

13. A bilion comprising the vector according to any one of claims 9 to 12.

14. A pharmaceutical composition comprising a synthetic liver-specific promoter according to any one of claims 1 to 6, an expression cassette according to claim 7 or 8, a vector according to any one of claims 9 to 12, or a virion according to claim 13.

15. A cell comprising a synthetic liver-specific promoter according to any one of claims 1 to 6, an expression cassette according to claim 7 or 8, a vector according to any one of claims 9 to 12, or a virion according to claim 13.

16. The cells according to claim 15, which are liver cells.

17. A synthetic liver-specific promoter according to any one of claims 1 to 6, an expression cassette according to claim 7 or 8, a vector according to any one of claims 9 to 12, a virion according to claim 13, a pharmaceutical composition according to claim 14, or cells according to claim 15 or 16, for use in therapeutic purposes.

18. An ex vivo method for producing an expression product, comprising the steps of providing an expression cassette according to claim 7 or 8 to liver cells, and expressing the expression product from a sequence encoding the expression product, wherein the liver cells are present in ex vivo.

19. An ex vivo method for expressing a therapeutic gene in liver cells, comprising the step of introducing an expression cassette according to claim 7 or 8, a vector according to any one of claims 9 to 12, or a virion according to claim 13 into the liver cells, wherein the liver-specific expression cassette, vector, or virion comprises a therapeutic gene operably linked to a promoter according to any one of claims 1 to 6, and the liver cells are present in ex vivo.

20. An expression cassette according to claim 7 or 8, a vector according to any one of claims 9 to 12, a virion according to claim 13, or a pharmaceutical composition according to claim 14, comprising a sequence encoding a therapeutic product linked to a promoter according to any one of claims 1 to 6, for use in a method of treating a subject by administering the expression cassette, vector, virion, or pharmaceutical composition to a subject in need thereof.