Ingestable sampling devices

Abstract

The present invention relates to a cell sampling device, and in particular to an ingestible cell sampling device for sampling cells in a subject and a method of using the same to detect abnormalities in a subject.

Description

Detailed Description of the Invention

[0001] 〔Technical Field〕 This application claims priority to U.S. Provisional Application No. 63 / 011,684, filed on April 17, 2020, which is incorporated herein by reference in its entirety.

[0002] Sequence Listing The text of the computer-readable sequence listing filed in this application, entitled "38145-601_SEQUENCE_LISTING_ST25", created on April 16, 2021 and having a file size of 7,473 bytes, is incorporated herein by reference in its entirety.

[0003] The present invention relates to a cell sampling device. In particular, the present invention relates to an ingestible cell sampling device for sampling cells of a subject, and a method of use for detecting an abnormality of the subject using the same.

[0004] 〔Background Art〕 For diagnosing certain diseases of the digestive tract, an ingestible cell sampling device can be used to collect cells from the surface of a patient's digestive tract. However, current cell sampling devices in use have various problems, including the difficulty or discomfort of swallowing and removing the device, the peeling of the sponge from the string during use, and / or laceration of the patient's esophagus when the device is withdrawn. Therefore, what is needed is an improved ingestible cell sampling device for use in a subject.

[0005] 〔Summary of the Invention〕 In some embodiments, provided herein are ingestible cell sampling devices. The device comprises an abrasive sponge housed in a soluble capsule, a molded cap, and a string attached to the molded cap. In some embodiments, the abrasive sponge comprises a mesh foam. In some embodiments, the abrasive sponge is compressible. The sponge can be held in a compressed state by the soluble capsule. In some embodiments, the abrasive sponge has a shape configured to maximize its external dimensions while minimizing the total amount of sponge contained in the capsule when uncompressed. For example, in some embodiments, the abrasive sponge is formed to have recesses or depressions and / or cavities, so that it can be provided, for example, by removing at least a portion of the abrasive sponge from the inside of the sponge and / or from the top, bottom, and / or sides of the abrasive sponge before compressing the sponge into the soluble capsule.

[0006] In some embodiments, the dissolving capsule has one or more openings such that a portion of the abrasive sponge is exposed to the external environment through one or more openings. In some embodiments, the dissolving capsule has a first closed end and a second closed end. In alternative embodiments, the dissolving capsule has a first closed end and a second open end.

[0007] In some embodiments, the molded cap comprises an inner surface in contact with the outer surface of one end of the capsule and an outer surface in contact with the external environment. In some embodiments, the molded cap comprises an inner surface in contact with the abrasive sponge and an outer surface in contact with the external environment. In some embodiments, the molded cap comprises an inner surface in contact with the abrasive sponge and an outer surface. The outer surface of the molded cap may be in contact with the inner surface of one end of the capsule. In some embodiments, the inner surface of the molded cap may be attached to the abrasive sponge by an adhesive, preferably a soluble adhesive.

[0008] In some embodiments, the string is attached to the molded cap by a knot. In some embodiments, the string is attached to the molded cap by adhesive. In some embodiments, the string is attached to the molded cap by a knot and adhesive. The string may include sutures. In some embodiments, the string passes through a portion of the abrasive sponge.

[0009] In some embodiments, what is provided herein is a method for obtaining a cell sample from a subject. In some embodiments, the method for obtaining a cell sample from a subject includes providing the ingestible cell sampling device described herein to the subject and removing all or part of the ingestible cell sampling device from the subject. The ingestible cell sampling device may be removed from the subject within 10 minutes of providing the ingestible cell sampling device to the subject.

[0010] In some embodiments, the Technology provides, for example, an ingestible cell sampling device and a system comprising such a device for carrying out a cell sampling method using the device described herein.

[0011] Embodiments of this technology include the following:

[0012] 1. A cell sampling device that can be ingested, i) An abrasive sponge contained within a soluble capsule, wherein the soluble capsule has an outer surface exposed to the external environment, and the abrasive sponge, ii) Molded cap and, iii) The ingestible cell sampling device comprising a string having a first end attached to the molded cap.

[0013] 2. The ingestible cell sampling device according to Embodiment 1, further comprising a handle attached to the string, preferably a non-swallowable handle.

[0014] 3. The ingestible cell sampling device according to Embodiment 1 or 2, wherein the abrasive sponge includes a mesh foam.

[0015] 4. An ingestible cell sampling device according to any one embodiment of the prior embodiments, wherein the polishing sponge is compressible.

[0016] 5. The ingestible cell sampling device according to Embodiment 4, wherein the abrasive sponge is held in a compressed state by the soluble capsule.

[0017] 6. An ingestible cell sampling device according to any one embodiment of the prior embodiments, wherein the abrasive sponge has at least one cavity in an uncompressed state.

[0018] 7. The ingestible cell sampling device according to Embodiment 6, wherein the string passes through at least one cavity, preferably at least one recess.

[0019] 8. An ingestible cell sampling device according to any one embodiment of the prior embodiments, wherein the soluble capsule has one or more openings, and a portion of the polishing sponge is exposed to the external environment through the one or more openings.

[0020] 9. The soluble capsule comprises a first end and a second end, a) The first end is closed, and the second end is closed, or b) An ingestible cell sampling device according to any one embodiment of the prior embodiments, wherein the first end is closed and the second end is open.

[0021] 10. The ingestible cell sampling device according to Embodiment 9, wherein the molded cap comprises an inner surface and an outer surface, the inner surface of the cap contacting the outer surface of the capsule at the first closing end, and the outer surface of the cap contacting the external environment.

[0022] 11. The ingestible cell sampling device according to Embodiment 9, wherein the formed cap has an inner surface of the cap and an outer surface of the cap, and the inner surface of the cap is in contact with the polishing sponge.

[0023] 12. The ingestible cell sampling device according to Embodiment 11, wherein the outer surface of the cap is in contact with the inner surface of the capsule at the first closed end.

[0024] 13. The ingestible cell sampling device according to Embodiment 11 or 12, wherein the inner surface of the cap is attached to the polishing sponge by an adhesive.

[0025] 14. The ingestible cell sampling device according to Embodiment 9, wherein the formed cap includes an inner surface of the cap in contact with the polishing sponge and an outer surface of the cap in contact with the external environment.

[0026] 15. The ingestible cell sampling device according to Embodiment 14, wherein the inner surface of the cap is attached to the polishing sponge.

[0027] 16. The ingestible cell sampling device according to Embodiment 15, wherein the inner surface of the cap is attached to the polishing sponge by an adhesive.

[0028] 17. The ingestible cell sampling device according to any one of the preceding embodiments, wherein the string is attached to the formed cap by a knot and / or an adhesive.

[0029] 18. The ingestible cell sampling device according to any one of the preceding embodiments, wherein the string has one or more calibration markings.

[0030] 19. The ingestible cell sampling device according to any one of the preceding embodiments, wherein the string includes a suture.

[0031] 20. An ingestible cell sampling device according to any one embodiment of the prior embodiments, wherein the string passes through a portion of the polishing sponge.

[0032] 21. An ingestible cell sampling device according to any one embodiment of the prior embodiments, wherein the molded cap includes a button.

[0033] 22. A system or kit for obtaining a cell sample from a subject, comprising an ingestible cell sampling device described in any one embodiment of the prior embodiments, i) A container for receiving a polishing sponge containing collected cells, ii) Cell preservation reagents, preferably buffering reagents, iii) Microscope slides, iv) Assay plate, v) Local anesthetic agent, preferably a local anesthetic spray, vi) Components of a drinkable solution, preferably a pre-mixed drinkable solution. and vii) The system or the kit further comprising one or more lubricants, preferably lubricating gels or liquids.

[0034] 23. A method for obtaining a cell sample from a subject, i) Orally administering to the subject an abrasive sponge contained within a soluble capsule of an ingestible cell sampling device described in any one embodiment of Embodiments 1 to 21, ii) The method comprising withdrawing the polishing sponge from the object, wherein the polishing sponge collects a cell sample from the object during the withdrawal.

[0035] 24. The method according to Embodiment 23, wherein the withdrawal occurs within 10 minutes of oral administration.

[0036] 25. The method according to Embodiment 23 or Embodiment 24, wherein, during the oral administration, the subject swallows the soluble capsule of the ingestible cell sampling device.

[0037] 26. A method for characterizing a cell sample collected according to any one embodiment of Embodiments 23 to 25, comprising assaying the cell sample for at least one biomarker.

[0038] 27. The method according to Embodiment 26, wherein the at least one biomarker comprises one or more proteins and nucleic acids.

[0039] 28. The method according to Embodiment 26 or Embodiment 27, wherein the at least one biomarker comprises DNA containing at least a portion of a gene selected from the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, FER1L4, ANKRD13B, CD1D, CDKN2A, CHST2, CNNM1, DIO3, DOCK2, DTX1, ELMO1, FERMT3, FLI1, GRIN2D, HUNK, JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEP9, SFMBT2, SLC12A8, TBX15, TSPYL5, ZNF304, and ZNF671.

[0040] 29. The method according to Embodiment 28, wherein assaying the at least one biomarker includes determining the DNA to determine the methylation status of the gene.

[0041] 30. Assaying at least one of the above biomarkers is possible for NDRG4, ZNF682, VAV3, BMP3, ZNF568, FER1L4, ANKRD13B, CD1D, CDKN2A, CHST2, CNNM1, DIO3, DOCK2, DTX1, ELMO1, FERMT3, FLI1, GRIN2D, HUNK, JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEP9, The method according to any one embodiment of Embodiments 26 to 29, comprising assaying 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 of the biomarkers from the group consisting of SFMBT2, SLC12A8, TBX15, TSPYL5, ZNF304, and ZNF671.

[0042] 31. Assaying for at least one of the above biomarkers is possible for NDRG4, ZNF682, VAV3, BMP3, ZNF568, FER1L4, ANKRD13B, CD1D, CDKN2A, CHST2, CNNM1, DIO3, DOCK2, DTX1, ELMO1, FERMT3, FLI1, GRIN2D, HUNK, JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, The method according to Embodiment 30, comprising assaying the methylation status of one, two, three, four, five, six, seven, eight, nine, ten, one, two, three

[0043] 31. The method according to any one embodiment of Embodiments 26 to 30, wherein assaying the at least one biomarker includes assaying the methylation status of at least one gene selected from the group consisting of ANKRD13B, CHST2, CNNM1, DOCK2, DTX1, FER1L4, FERMT3, FLI1, GRIN2D, JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEP9, SFMBT2, SLC12A8, TBX15, TSPYL5, VAV3, ZNF304, ZNF568, and ZNF671.

[0044] 32. The method according to any one embodiment of Embodiments 28 to 30, wherein assaying the at least one biomarker includes assaying the methylation status of at least one gene selected from the group consisting of BMP3, NDRG4, VAV3, SFMBT2, DIO3, HUNK, ELMO1, CD1D, CDKN2A, and OPLAH.

[0045] 33. The method according to any one embodiment of Embodiments 28 to 30, wherein assaying the at least one biomarker includes assaying the methylation status of at least one gene selected from the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, and FER1L4.

[0046] 34. The method according to Embodiment 33, comprising assaying the methylation status of the group of genes consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, and FER1L4.

[0047] definition To facilitate understanding of this technology, several terms and phrases are defined below. Additional definitions are provided throughout the detailed explanation.

[0048] Throughout this specification and the claims, the following terms have the meaning expressly as relating to this specification unless otherwise clearly indicated by the context. The phrase "in one embodiment" may, but not necessarily, refer to the same embodiment. Furthermore, the phrase "in another embodiment" may, but not necessarily, refer to a different embodiment. Thus, various embodiments of the Art can be readily combined without departing from the scope or spirit of the Art, as described below.

[0049] In addition, as used herein, the term “or” is an inclusive “or” operator and is equivalent to the term “and / or” unless otherwise explicitly indicated by the context. The term “based on” is not exclusive and allows for basing on additional factors not listed, unless otherwise explicitly indicated by the context. In addition, throughout this specification, the meanings of “a,” “an,” and “the” include multiple references. The meaning of “in” includes “in” and “on.”

[0050] The transitional phrase “essentially consisting of” is used in the claims of this application to limit the claims to specific substances or steps of the claimed invention that “do not substantially affect the basic and novel features” as stated in In re Herz, 537 F.2d 549, 551-52, 190 USPQ 461, 463 (CCPA 1976). For example, a composition “essentially consisting of” the enumerated elements may contain unenumerated impurities in levels that are present but do not alter the function of the enumerated composition compared to a pure composition, i.e., a composition “consisting of” the enumerated components.

[0051] As used herein, the term “abrasive” refers to a material that can remove cells from a surface, and preferably a material from which cells removed from the surface can be collected. For example, an abrasive may refer to a material that can remove cells from the esophagus in question. Preferably, the abrasive can remove cells from a surface (e.g., the esophagus) without damaging the esophagus.

[0052] As used herein, the term "solubility" refers to a material that can dissolve when exposed to the environment of the gastric cavity.

[0053] The term "esophageal disorder" refers to a type of disorder relating to the esophagus and / or esophageal tissue. Examples of esophageal disorders include, but are not limited to, Barrett's esophagus (BE), Barrett's esophageal dysplasia (BED), Barrett's low-grade esophageal dysplasia (BE-LGD), Barrett's high-grade esophageal dysplasia (BE-HGD), and esophageal adenocarcinoma (EAC).

[0054] The "ingestible cell sampling device" of this technology comprises an "ingestible assembly" comprising an ingestible portion, for example, an abrasive sponge housed in a soluble capsule and attached to a string, and a non-ingestible portion, for example, a part of the string that is not ingested during use, preferably attached to a handle.

[0055] As used herein, the term “handle” refers to a non-swallowable component of an ingestible sampling device suitable for a user or a third party to hold, for example, the oral administration of an ingestible assembly of an ingestible cell sampling device.

[0056] As used herein, the term “molding” means any suitable means for processing a component, such as a cap or capsule, including but not limited to various means of injection molding, compression molding, transfer molding, sintering, 3D additive printing, stereolithography, and machining.

[0057] As used herein, the term “capsule” preferably refers to any component or material that helps to enclose or case a sponge in a manner that makes the sponge swallowable. In some embodiments, the capsule is soluble. The capsule encompasses any material or device that encloses the sponge, preferably in a compressed state, and provides a surface suitable for swallowing, e.g., a surface that is smooth and / or supple enough to facilitate swallowing the sponge. The capsule may be formed separately, for example, as a molded empty container in which the sponge is later partially or completely enclosed, or the capsule may be formed as part of a process of enclosing the sponge, for example, as a coating, packaging, or other binding treatment applied during or after the compression of the sponge and having the effect of holding the sealed sponge in a compressed state.

[0058] As used herein with respect to an ingestible sampling device, the term “cap” refers to a rigid or semi-rigid component attached to or near the end of a string of an ingestible sampling device, preferably comprising one or more holes or openings for attaching the string, for example, by a loop or knot. The cap component of the ingestible assembly is molded to be suitable for swallowing, for example, by having a cup-like shape that conforms to the outer contour of the capsule, or by being molded to fit inside the capsule.

[0059] As used herein with respect to an ingestible sampling device, the term “button” refers to a rigid or semi-rigid component attached to or near the end of a string of the ingestible sampling device, preferably comprising one or more holes or openings for attaching the string, for example, by a loop or knot. The term “button” is an example of a molded cap having a disc-like shape. In some embodiments, the button is sized to fit into a soluble capsule of the ingestible sampling device.

[0060] As used herein with respect to cell samples, the term “assay” means to qualitatively evaluate or quantitatively measure aspects of a sample, for example, to evaluate or measure the presence, quantity, state, or functionality of a target entity, such as a biomarker.

[0061] As used herein, the term “string” broadly refers to any cord, thread, filament, cable, strand, fiber, ribbon, webbing, suture, lace, or other flexible tethering material, including a single filament material comprising one or more strands, for example, twisted, braided, woven, fused, or otherwise combined to form a string, or comprising multiple filaments, and may comprise strands or filaments of the same or different natural, synthetic, or hybrid materials, such as silk, cotton, polyester, nylon, polypropylene, or cellulose. The string or the individual filaments of the string may be solid, such as a single cord or filament of a flexible material such as nylon or polypropylene, or the string may comprise one or more hollow strands, such as a tube of nylon, polypropylene, or other flexible material. The string may comprise, for example, calibration markings indicating the distance between the markings and the ends of the string, for example, one or more information markings. A series of calibration markings may be provided along the string, evenly spaced or at intervals of different lengths.

[0062] As used herein, the term “reticulated” refers to porous, low-density materials, such as foams. Reticulated materials have open pores or cells, with few intact closed cells.

[0063] As used herein with respect to components of an ingestible sampling device, for example, an abrasive sponge, the term “compressible” refers to a material that can be reversibly forced or compressed into a smaller space or narrower compass in at least one dimension and can expand to an uncompressible dimension when the compressive force is removed.

[0064] As used herein, the terms “biomarker” and “marker” are interchangeable and refer to biological material (e.g., nucleic acids, or regions of nucleic acids, or proteins) that can be used to distinguish abnormal cells (e.g., cancer cells) from normal cells based on the presence, absence, or circumstances (e.g., methylation status or mutation) of a marker substance. Examples of biomaterials include, but are not limited to, nucleic acids, polypeptides, carbohydrates, fatty acids, cellular components (e.g., cell membranes and mitochondria), and whole cells. In some cases, a marker is a specific nucleic acid region (e.g., a gene, an intragenic region, a specific gene locus, etc.). A nucleic acid or protein region that serves as a biomarker may be called, for example, a “marker gene,” a “marker region,” a “marker sequence,” or a “marker locus.”

[0065] As used herein, the terms “patient” or “subject” refer to the organisms that are the subject of the various tests provided by this technology. The term “subject” includes animals, preferably mammals, including humans. In a preferred embodiment, the subject is a primate. In a more preferred embodiment, the subject is a human.

[0066] The term "sample" is used in its broadest sense. In one sense, it can refer to animal cells or tissues. In another sense, it can refer to specimens or cultures obtained from any source, as well as biological and environmental samples. Biological samples include fluids, solids, tissues, and gases. Environmental samples include environmental materials such as surface materials, soil, water, and industrial samples. These examples should not be construed as limiting the types of samples to which the present invention is applicable.

[0067] As used herein, the term “cell sample” refers to a sample containing cells (e.g., intact cells from the subject) or cellular material (e.g., material derived from cells of the subject that are not intact cells).

[0068] As used herein, the “methylation state,” “methylation profile,” and “methylation status” of a nucleic acid molecule refer to the presence or absence of one or more methylated nucleic acid bases in the nucleic acid molecule. For example, a nucleic acid molecule containing methylated cytosine is considered methylated (e.g., the methylation state of the nucleic acid molecule is methylated). A nucleic acid molecule that does not contain any methylated nucleotides is generally considered unmethylated. The methylation state of a particular nucleic acid sequence (e.g., a gene marker or region of a gene marker) can indicate the methylation state of all bases in this sequence, or the methylation state of a subset of these bases (e.g., one or more cytosines) in this sequence, or it can indicate information about the methylation density of a region in this sequence, with or without providing precise information about the location in the sequence where methylation occurs.

[0069] Therefore, methylation status describes the state of methylation of a nucleic acid (e.g., a genome sequence). In addition, methylation status refers to the characteristics of a nucleic acid segment at a specific genomic locus associated with methylation. Such characteristics include, but are not limited to, whether any of the cytosine (C) residues in this DNA sequence are methylated, the location of the methylated C residue(s), the frequency or percentage of methylated C across any particular region of the nucleic acid, and allele differences in methylation resulting from, for example, differences in allele origin.

[0070] As used herein, the term “nucleic acid detection assay” refers to any method for determining the nucleotide composition of a nucleic acid of interest. Nucleic acid detection assays include DNA sequencing methods, probe hybridization methods, and structure-specific cleavage assays (e.g., INVADER assay, (Hologic, Inc.)), each of which is incorporated herein by reference for any purpose, as exemplified by U.S. Patents No. 5,846,717, No. 5,985,557, No. 5,994,069, No. 6,001,567, No. 6,090,543, and No. 6,872,816, Lyamichev et al., Nat. Biotech.,17:292(1999), Hall et al., PNAS, USA, 97:8272(2000), and US2009 / 0253142); Enzyme mismatch cleavage (e.g., U.S. Patents 6,110,684, 5,958,692, and 5,851,770, which are incorporated herein by reference in whole); Polymerase chain reaction (PCR), as described above, (including real-time PCR such as Taqman® PCR); Branching hybridization (e.g., Chiron, U.S. Patents 5,849,481, 5,710,264, 5,124,246, and 5,624,802, which are incorporated herein by reference in whole); Rolling circle replication (e.g., which are incorporated herein by reference in whole); (Included herein by reference, U.S. Patents No. 6,210,884, 6,183,960 and 6,235,502); NASBA (e.g., U.S. Patent No. 5,409,818, which is incorporated herein by reference in its entirety); Molecular beacon technology (e.g., U.S. Patent No. 6,150,097, which is incorporated herein by reference in its entirety); E-sensor technology (Motorola, which is incorporated herein by reference in its entirety, U.S. Patents No. 6,248,229, 6,221,583, 6,013,170 and 6,063,573); Cycling probe technology (e.g., U.S. Patents No. 5,403,711, 5,011,769 and 5,660,988, which are incorporated herein by reference in their entirety); Dade This includes Behring signal amplification methods (e.g., U.S. Patents 6,121,001, 6,110,677, 5,914,230, 5,882,867, and 5,792,614, which are incorporated herein by reference in their entirety); ligase chain reactions (e.g., Baranay Proc. Natl. Acad. Sci USA 88,189-93 (1991)); and sandwich hybridization methods (e.g., U.S. Patent 5,288,609, which is incorporated herein by reference in its entirety). Additional methods are described in U.S. Patent Application 15 / 881,409 by Allawi et al., filed January 26, 2018, which is incorporated herein by reference in its entirety.

[0071] In some embodiments, the target nucleic acid is amplified (e.g., by polymerase chain reaction, as described by KBMullis in U.S. Patents No. 4,683,195, 4,683,202, and 4,965,188), and the amplified nucleic acid is simultaneously detected using an invasive cleavage assay. Assays configured to perform a detection assay (e.g., an invasive cleavage assay) in combination with the amplification assay are described in U.S. Patent No. 9,096,893, which is incorporated herein by reference in its entirety for all purposes. Additional amplification-plus-invasive cleavage detection configurations, known as the QuARTS method, are described in U.S. Patents No. 8,361,720, 8,715,937, 8,916,344, and 9,212,392, each of which is incorporated herein by reference for all purposes. Additional modified Quarts methods, known as LQAS and TELQAS, are described, for example, in U.S. Patent Publication No. 2020 / 0248233A1, U.S. Patent No. 10,648,025, International Patent Publication No. 2021 / 041726A1, and International Patent Publication No. 2020 / 206256A1.

[0072] As used herein, the term “invasive cleavage structure” refers to a cleavage structure comprising i) a target nucleic acid, ii) an upstream nucleic acid (e.g., an invasive or “INVADER” oligonucleotide), and iii) a downstream nucleic acid (e.g., a probe), wherein the upstream and downstream nucleic acids anneal to a continuous region of the target nucleic acid, and duplication is formed between the 3' portion of the upstream nucleic acid and the double strand formed between the downstream nucleic acid and the target nucleic acid. Duplication occurs when one or more bases from the upstream and downstream nucleic acids occupy the same position with respect to the target nucleic acid base, regardless of whether the duplicated base(s) of the upstream nucleic acid are complementary to the target nucleic acid and whether those bases are native or non-native bases. In some embodiments, the 3' portion of the upstream nucleic acid that duplicates with the downstream double strand is a non-basic chemical portion, such as an aromatic ring structure, as disclosed in U.S. Patent No. 6,090,543, which is entirely incorporated herein by reference. In some embodiments, one or more nucleic acids may be attached to each other, for example, through covalent bonds such as nucleic acid stem-loops, or through non-nucleic acid chemical bonds (e.g., multi-carbon chains). As used herein, the term “flap endonuclease assay” includes the “INVADER” entry cleavage assay, QuarTS assay, LQAS, and TELQAS assay, as described above.

[0073] "Flap oligonucleotide" refers to an oligonucleotide that can be cleaved by a flap endonuclease in a detection assay such as an invasive cleavage assay. In a preferred embodiment, the flap oligonucleotide forms an invasive cleavage structure together with other nucleic acids, such as a target or template nucleic acid, and the invasive oligonucleotide. The flap assay reagent may optionally contain the invasive oligonucleotide and the target or template nucleic acid to which the flap oligonucleotide binds. In a particularly preferred embodiment, the flap assay reagent may contain Mg as discussed herein. ++ Includes flap assay buffer.

[0074] As used herein, the term “flap endonuclease” refers to a structure-specific nucleosomal enzyme that cleaves nucleic acid flap structures, such as invasive cleavage structures. Flap endonucleases include, for example, the 5' exonuclease domain of the bacterial DNA polymerase I protein, and the eukaryotic and archaeal FEN-1 protein (Kaiser et al. (above)). Flap endonucleases may cleave additional structures, such as pseudo-Y, 5' overhang, and gap structures. See, for example, Shen, B., BioEssays 27:717-729 (2005), Finger, LD., Subcell Biochem. 62:301-326 (2012), and U.S. Patent Application No. 62 / 901,085, filed on 16 September 2019, each of which is incorporated herein by reference in whole. As used herein, the term “flap endonuclease substrate” refers to a nucleic acid flap structure, such as an invasive cleavage structure, that is recognized and cleaved by a flap endonuclease, such as FEN-1 endonuclease.

[0075] As used herein with respect to the enzyme, the term “FEN-1” refers to a nonpolymerase flap endonuclease of eukaryotic or archaeal organism, encoded by the FEN-1 gene. See, for example, Kaiser et al., International Patent Application Publication No. 02 / 070755 and U.S. Patent No. 7,122,364, which are incorporated herein by reference in their entirety for all purposes. The term “FEN-1 activity” refers to any enzymatic activity of the FEN-1 enzyme. FEN-1 endonucleases also include modified FEN-1 proteins, such as chimeric proteins containing portions of FEN-1 enzymes from different organisms, and enzymes containing one or more mutations (e.g., substitutions, deletions, insertions, etc.), as described in International Patent Application Publication No. 02 / 070755 and U.S. Patent No. 7,122,364.

[0076] As used herein, the terms “flap endonuclease assay” and “flap assay” refer to a detection assay in which the formation and cleavage of a flap endonuclease substrate is used to assess a sample for the presence or amount of a target analyte, such as a target nucleic acid.

[0077] As used herein, the terms “flap assay reagent” or “invasive cleavage assay reagent” refer to the collection of all reagents necessary to perform a flap assay or invasive cleavage assay. As is known in the art, a flap assay generally comprises an invasive cleavage structure, a flap endonuclease, and optionally, an oligonucleotide for forming a FRET cassette or a 5' hairpin FRET reporter. The flap assay reagent may optionally contain an invasive oligonucleotide and a target to which the flap oligonucleotide binds.

[0078] As used herein, the term “FRET cassette” refers to a hairpin oligonucleotide containing a fluorophore moiety and a nearby quencher moiety that quenches the fluorophore. Hybridization of a cleaved flap (e.g., from cleavage of a target-specific probe in a PCR-flap assay) with a FRET cassette generates a secondary substrate for a flap endonuclease, such as the FEN-1 enzyme. Once this substrate is formed, the 5' fluorophore-containing base can be cleaved from the cassette by the flap endonuclease, thereby generating a fluorescent signal. In a preferred embodiment, the FRET cassette includes an unpaired 3' moiety, such as a portion of the cleavage product, e.g., a cleaved flap oligonucleotide, which can hybridize with an invasive cleavage structure that can be cleaved by the FEN-1 endonuclease.

[0079] As used herein, the term "PCR flap assay" is used synonymously with the term "PCR invasive cleavage assay" and refers to an assay configuration that combines PCR target amplification and detection of amplified DNA by forming a first double cleavage structure containing amplified target DNA, a cleaved 5' flap from the first double cleavage structure, and a second double cleavage structure containing a labeled reporter oligonucleotide, e.g., a "FRET cassette" or a 5' hairpin FRET reporter oligonucleotide. In the PCR-flap assay as used herein, the assay reagent comprises a mixture containing DNA polymerase, FEN-1 endonuclease, a primary probe containing a portion complementary to the target nucleic acid, and a FRET cassette or a 5' hairpin FRET reporter, the target nucleic acid being amplified by PCR, and the amplified nucleic acid being detected simultaneously (i.e., detection occurring during the process of target amplification). PCR-flap assays include the QuARTS assay described in U.S. Patents No. 8,361,720, No. 8,715,937, and No. 8,916,344, each of which is incorporated herein by reference in whole, and the amplification assay of U.S. Patent No. 9,096,893 (as illustrated, for example, in Figure 1 of that patent).

[0080] As used herein, the term "PCR-flap assay reagent" means one or more reagents for detecting a target nucleic acid in a PCR-flap assay, the reagent comprising nucleic acid molecules capable of amplifying the target nucleic acid and forming a flap endonuclease substrate in the presence of the target nucleic acid, preferably in a mixture containing DNA polymerase, FEN-1 endonuclease, and a FRET cassette or 5' hairpin FRET reporter.

[0081] As used herein, the term "FRET" refers to fluorescence resonance energy transfer, the process by which a portion (e.g., fluorophores) transfers energy between themselves or from a fluorophore to a non-fluorophore (e.g., a quencher molecule). In some situations, FRET involves an excited donor fluorophore transferring energy to a low-energy acceptor fluorophore via a short-range (e.g., less than about 10 nm) dipole-dipole interaction. In other situations, FRET involves a loss of fluorescence energy from the donor and an increase in fluorescence in the acceptor fluorophore. In yet another form of FRET, energy can be exchanged from an excited donor fluorophore to a non-fluorescent molecule (e.g., a quenching molecule). FRET is known to those skilled in the art and has been described (see, for example, Stryer et al., 1978, Ann. Rev. Biochem., 47:819; Selvin, 1995, Methods Enzymol., 246:300; Orpana, 2004 Biomol Eng 21, 45-50; Olivier, 2005 Mutant Res 573, 103-110, each of which is incorporated herein by reference in whole).

[0082] As used herein, the term “kit” refers to any delivery system for delivering a substance. In the context of cell sampling devices, such a delivery system includes a system that enables the storage, transport, delivery, or use of the device, and / or the processing of a sample obtained with the device and / or supporting materials (e.g., a sample processing or sample storage container, written instructions for performing the procedure, etc.) from one place to another (e.g., a drinkable solution, lubricant, or anesthetic for use with a swallowable device; sample processing reagents such as sample stabilizing reagents, particles, buffers, denaturants, oligonucleotides, filters, assay reaction components, etc., in a suitable container). For example, a kit includes the associated sampling device and one or more enclosed containers (e.g., a box) containing the reagents and / or supporting materials. As used herein, the term “fragmentation kit” refers to a delivery system comprising two or more separate containers, each containing a portion of the entire kit components. These containers may be delivered together or separately to the intended recipient. For example, the first container may contain materials and buffers for sample collection. For example, the first container may contain materials for sample collection and cell stabilization buffer. The second container may contain reagents for detecting one or more biomarkers. For example, the second container may contain capture oligonucleotides and denaturants. The term “fragmentation kit” is intended to encompass, but is not limited to, kits containing analyte-specific reagents (ASRs) regulated under Section 520(e) of the Federal Food, Drug, and Cosmetic Act. In fact, any delivery system comprising two or more separate containers, each containing a component of the entire kit, falls under the term “fragmentation kit.” For example, a fragmentation kit may contain analyte-specific reagents, DNA extraction reagents, and / or bisulfite conversion reagents. Alternatively, a fragmentation kit containing analyte-specific reagents may be used in combination with commercially available kits for DNA extraction.In such embodiments, the kit may include reagents for sample collection and cell stabilization buffer and may be used in combination with a suitable kit for DNA extraction to isolate DNA from the sample before detecting one or more biomarkers, such as the biomarkers described herein. In contrast, a “combined kit” refers to a delivery system that contains all the components for sample collection, processing, and assay in a single container (e.g., a single box containing each of the desired components). The term “kit” includes both subdivided kits and combined kits.

[0083] As used herein, the term “system” refers to a collection of articles for use for a particular purpose, e.g., for collecting samples (e.g., for preparing samples for analysis), or a collection of devices, reagents, and instruments for collecting, processing, and / or analyzing samples for a particular purpose. In some embodiments, the articles of the system include, for example, articles, instructions for use as information supplied on paper, or on a recordable medium (e.g., DVD, flash drive, etc.). In some embodiments, the instructions direct the user to an online location, e.g., a website for viewing, listening to, and / or downloading the instructions. In some embodiments, the instructions or other information are provided as an application (“app”) for a mobile device.

[0084] [Brief explanation of the drawing] These and other features, aspects, and advantages of this technology will be better understood with reference to the following drawings.

[0085] [Figure 1A] shows various embodiments of the soluble capsule described herein. Figure 1A shows a capsule having a first closed end and a second closed end.

[0086] [Figure 1B] shows various embodiments of the soluble capsule described herein. Figure 1B shows a capsule having a first closed end and a second open end.

[0087] [Figure 1C] shows various embodiments of the soluble capsule described herein. Figure 1C shows a capsule having a first closed end, a second closed end, and a plurality of openings.

[0088] [Figure 1D] shows various embodiments of the soluble capsule described herein. Figure 1D shows a capsule having a first closed end, a second open end, and a plurality of openings.

[0089] [Figure 2] shows an embodiment of the ingestible cell sampling device described herein. The device comprises an abrasive sponge contained in a compressed state within a soluble capsule having a first closed end and a second closed end, a spherical molded cap having an inner surface in contact with the outer surface of the second closed end, and a suture attached to the molded cap.

[0090] [Figure 3] shows an embodiment of the ingestible cell sampling device described herein. The device comprises an abrasive sponge contained in a compressed state within a soluble capsule having a first closed end and a second closed end; a spherical molded cap having an inner surface in contact with the outer surface of the second closed end; and sutures attached to the molded cap. The device further includes a plurality of openings along the cylindrical edge of the soluble capsule such that the abrasive sponge is exposed to the external environment at these openings.

[0091] [Figure 4] shows an embodiment of the ingestible cell sampling device described herein. The device comprises an abrasive sponge contained in a compressed state within a soluble capsule having a first closed end and a second closed end, a spherical molded cap having an inner surface in contact with the abrasive sponge, and a suture attached to the molded cap. The molded cap covers the second open end of the soluble capsule.

[0092] [Figure 5] shows an embodiment of the ingestible cell sampling device described herein. The device comprises an abrasive sponge contained in a compressed state within a soluble capsule having a first closed end and a second closed end; a spherical molded cap having an inner surface in contact with the abrasive sponge; and a suture attached to the molded cap. The molded cap covers the second open end of the soluble capsule. The device further comprises a plurality of openings along the cylindrical edge of the soluble capsule.

[0093] [Figure 6A] This shows various embodiments of the abrasive sponge described herein. Figure 6A shows a cylindrical abrasive sponge with some of the material removed from the center. Approximately 25% of the material has been removed from the center of the sponge.

[0094] [Figure 6B] shows various embodiments of the abrasive sponge described herein. Figure 6B shows a similar sponge from which a larger portion of the material has been removed from the center. Approximately 50% of the material has been removed from the center of the sponge.

[0095] [Figure 6C] shows various embodiments of the abrasive sponge described herein. Figure 6C shows a cylindrical sponge from which several portions have been removed from the edges of the sponge to create a pinwheel shape when viewed from above.

[0096] [Figure 6D] shows various embodiments of the abrasive sponge described herein. Figure 6D shows a cylindrical sponge from which several portions have been removed from the edges of the sponge to create a cross shape when viewed from above.

[0097] [Figure 7A] Various diagrams of the abrasive sponge with a portion (approximately 25%) of the material removed from the center. The suture material passes through the abrasive sponge and is attached to the molded cap. The uncompressed diameter of the abrasive sponge is approximately 30 mm (Figure 7A).

[0098] [Figure 7B] Various diagrams of the abrasive sponge with a portion of the material (approximately 25%) removed from the center. The portion of the material is removed from the center of the abrasive sponge, and the abrasive sponge is attached to the inner surface of the molded cap with adhesive (Figure 7B).

[0099] [Figure 8A] Various diagrams of the abrasive sponge with a portion (approximately 50%) of the material removed from the center. The suture material passes through the abrasive sponge and is attached to the molded cap. The uncompressed diameter of the abrasive sponge is approximately 30 mm (Figure 8A).

[0100] [Figure 8B] Various diagrams of the abrasive sponge with a portion (approximately 50%) of the material removed from the center. The portion of the material is removed from the center of the abrasive sponge, and the abrasive sponge is attached to the inner surface of the molded cap with adhesive (Figure 8B).

[0101] [Figure 9A] Various diagrams of the abrasive sponge with multiple pieces of material removed from the edges of the sponge. The uncompressed diameter of the abrasive sponge is approximately 30 mm (Figure 9A).

[0102] [Figure 9B] Various diagrams of abrasive sponges with multiple pieces of material removed from the edges of the sponge. Multiple pieces of material are removed from the edges of the sponge to produce a sponge that has a pinwheel shape when viewed from above (Figure 9B).

[0103] [Figure 10A] Various diagrams of the abrasive sponge with multiple pieces of material removed from the edges of the sponge. The uncompressed diameter of the abrasive sponge is approximately 30 mm (Figure 10A).

[0104] [Figure 10B] Various diagrams of abrasive sponges with multiple pieces of material removed from the edges of the sponge. Multiple pieces of material are removed from the edges of the sponge to produce a sponge that has a cross shape when viewed from above (Figure 10B).

[0105] [Figure 11A] shows various embodiments of a method for attaching the string to the molded cap. Figure 11A shows an embodiment in which the suture is attached to the molded cap by a knotting means. The molded cap is located outside the closed end of the capsule.

[0106] [Figure 11B] Various embodiments of a method for attaching the string to the molded cap are shown. Figure 11B shows an embodiment in which the molded cap covers the open end of the capsule. The string is attached to the molded cap by means of knotting, and the molded cap has an elongated cylindrical rim whose circumference fits into the circumference of the open end of the capsule.

[0107] [Figure 11C] Various embodiments of a method for attaching a string to a molded cap are shown. Figure 11C shows an embodiment in which the molded cap is a button. The button fits into the capsule, and the string is attached to the button by means of a knot.

[0108] [Figure 11D] shows various embodiments of a method for attaching a string to a molded cap. Figure 11D shows an embodiment in which the molded cap is a button. The button fits into the capsule, and the string is attached to the button by means of a knot.

[0109] [Figure 12] Shows multiple diagrams of an embodiment of the mounting shown in Figure 11A. The molded cap has two holes through which the string passes (left). A knot for securing the string to the cap is tied on the inside of the molded cap (center). The molded cap fits over the closed end of the soluble capsule such that the inner surface of the molded cap is in contact with the outer surface of the closed end of the capsule (right).

[0110] [Figure 13] Shows multiple diagrams of an embodiment of the mounting shown in Figure 11B. The molded cap has two holes through which the string passes (left). The knot for securing the string to the cap is tied inside the molded cap (center). The molded cap has an elongated cylindrical rim, the circumference of which fits into the circumference of the open end of the capsule (center, right). The outer surface of the molded cap is in contact with the external environment.

[0111] [Figure 14] Shows multiple diagrams of an embodiment of the mounting shown in Figure 11C. The molded cap is a button. The button has two holes through which the string passes (left). A knot for securing the string to the button is tied inside the molded cap (center). Alternatively or additionally, the string may be secured to the molded cap by the use of adhesive. The button fits into the capsule (right).

[0112] [Figure 15] Shows several diagrams of an embodiment of the mounting shown in Figure 11D. The molded cap is a button. The button has a bar shape molded inside the cap (left). The string is wrapped around the bar shape, and a knot for securing the string to the button is tied inside the molded cap (center). Alternatively or additionally, the string may be secured to the button (e.g., to the bar shape) by adhesive. The button fits into the capsule (right).

[0113] [Figure 16] Shows several figures of exemplary embodiments of an ingestible cell sampling device as described herein. The device comprises a soluble capsule having a first closed end and a second closed end. The device comprises a spherical molded cap having an outer surface in contact with the inner surface of the second closed end, and a suture attached to the molded cap. An abrasive sponge can be contained in a compressed state within the soluble capsule such that the inner surface of the spherical molded cap is in contact with the abrasive sponge. Exemplary side, top, and angled views of the molded cap are shown on the right. The molded cap has two holes for allowing the attachment of a suture, and the top is slightly recessed to accommodate the thickness of the suture.

[0114] [Figure 17] Shows several figures of exemplary embodiments of an ingestible cell sampling device as described herein. The device comprises a soluble capsule having a first closed end and a second closed end. The device comprises a spherical molded cap having an outer surface in contact with the inner surface of the second closed end, and a suture attached to the molded cap. An abrasive sponge may be contained in a compressed state within the soluble capsule such that the inner surface of the spherical molded cap is in contact with the abrasive sponge. Exemplary side, top, and angled views of the molded cap are shown on the right. The molded cap has two holes for allowing the attachment of a suture, and the top is slightly recessed to accommodate the thickness of the suture. The holes are slightly larger than those shown in the embodiment of Figure 16. The larger holes for this device compared to those shown in Figure 16 may allow different (e.g., larger) knots to be used to attach the suture to the molded cap.

[0115] [Figure 18] Shows several figures of exemplary embodiments of an ingestible cell sampling device as described herein. The device comprises a soluble capsule having a first closed end and a second open end. An abrasive sponge can be contained in a compressed state within the soluble capsule. The device comprises a spherical molded cap having an inner surface in contact with the abrasive sponge, and a suture attached to the molded cap. The outer surface of the spherical molded cap is exposed to the external environment. The molded cap covers the second open end of the soluble capsule. Exemplary side, top, and angled views of the molded cap are shown on the right. The molded cap has two holes for allowing the attachment of the suture, and the top is slightly recessed to accommodate the thickness of the suture.

[0116] [Figure 19] Shows several figures of exemplary embodiments of an ingestible cell sampling device as described herein. The device comprises a soluble capsule having a first closed end and a second open end. An abrasive sponge can be contained in a compressed state within the soluble capsule. The device comprises a spherical molded cap having an inner surface in contact with the abrasive sponge, and a suture attached to the molded cap. The outer surface of the molded cap is exposed to the external environment. The molded cap covers the second open end of the soluble capsule. Exemplary side, top, and angled views of the molded cap are shown on the right. The molded cap has two holes for allowing the attachment of the suture, and the top is slightly recessed to accommodate the thickness of the suture. The holes are slightly larger than those shown in the embodiment of Figure 18. The larger holes for this device compared to those shown in Figure 18 may allow different (e.g., larger) knots to be used to attach the suture to the molded cap.

[0117] [Figure 20] Shows several figures of an exemplary embodiment of the handle as described herein. The handle has a hook shape. The handle "grabs" the soluble capsule in a pair of grippers at one end of the handle. The other end of the handle is a hook. A suture can be wrapped around any suitable part of the handle. For use in a subject, the ingestible device can be removed and the suture can be unwound. The device can be ingested by the subject or a third party while the subject or a third party holds the hook end of the handle.

[0118] [Figure 21] shows an exemplary embodiment of a handle as described herein. The handle includes a cavity in which a soluble capsule may be placed. The suture may be wound around a separate portion of the handle, as shown. When wound, the suture may be held in place by a suitable amount of tension. The handle may include a tab that can be squeezed to release tension from the suture and allow for easy removal of the suture from the handle without having to unwind the entire length of the suture.

[0119] [Figure 22] shows another exemplary embodiment of a handle as described herein. The handle may be circular in shape. The handle includes a cavity in which a soluble capsule may be placed. The suture may be wound around the outer edge of the circular handle, such as along a slightly recessed channel extending along the outer edge of the handle. The suture may be tied in a location that can be facilitated by a single hole placed in the circular handle, such as. The suture may be unwound and wound back from the circular handle to allow an object to ingest the device.

[0120] [Figure 23] shows another exemplary embodiment of a handle as described herein. The handle is T-shaped. The handle includes a cavity in which a soluble capsule may be placed. The suture can be held in place by wrapping the suture around the handle.

[0121] [Figure 24] An exemplary embodiment of a handle as described herein is shown. The handle has a flat surface at one end and a hook shape at the opposite end. The flat surface includes a cavity in which a soluble capsule can be placed. The flat surface is further provided with a plurality of openings to provide various suitable attachment sites for sutures.

[0122] [Figure 25A] An exemplary assay design for detecting biomarkers of esophageal disorders in a sample is shown.

[0123] [Figure 25B] An exemplary assay design for detecting biomarkers of esophageal disorders in a sample is shown.

[0124] [Figure 25C] An exemplary assay design for detecting biomarkers of esophageal disorders in a sample is shown.

[0125] [Figure 25D] An exemplary assay design for detecting biomarkers of esophageal disorders in a sample is shown.

[0126] [Figure 25E] An exemplary assay design for detecting biomarkers of esophageal disorders in a sample is shown.

[0127] [Figure 25F] An exemplary assay design for detecting biomarkers of esophageal disorders in a sample is shown.

[0128] [Modes for carrying out the invention] This technology relates to cell sampling devices. Specifically, the present invention relates to ingestible cell sampling devices and their use in methods for detecting various abnormalities in a subject.

[0129] The ingestible cell sampling devices described herein are advantageous in that they provide improved safety for use in subjects. For example, the ingestible cell sampling devices described herein are equipped with a handle to facilitate use by the subject. The handle provides a surface suitable for the user or a third party to hold during ingestion of the device's soluble capsule component, thereby preventing loss within the subject and facilitating easy removal of the device after an appropriate period. As another example, the ingestible cell sampling devices described herein are designed to prevent the string from detaching from the molded cap, thus preventing loss of the device within the subject. As yet another example, the ingestible cell sampling devices described herein are designed to minimize the risk of the sponge detaching from the string during device removal, thus also preventing loss of the device within the subject. Furthermore, the devices described herein use materials that prevent tearing of the esophagus when the device is withdrawn. The device, along with the rapid dissolution of the capsule and expansion of the sponge, is easily swallowed by the subject, thus minimizing the total time required to collect an esophageal sample from the subject. Furthermore, the sponge is equipped with several features that allow the maximum surface area to capture sufficient tissue from the subject. Therefore, an ingestionable cell sampling device having maximum sampling capacity and enhanced safety and tolerability for use in the target area is described herein.

[0130] In some embodiments, provided herein are ingestible cell sampling devices. The device comprises an abrasive sponge housed in a soluble capsule, a molded cap, and a string attached to the molded cap.

[0131] The abrasive sponge may contain any suitable material. Preferably, the material can be compressed and held in a compressed state by a soluble capsule. For example, the abrasive sponge may contain a mesh material. In some embodiments, the mesh material has 10 to 35 pores per inch of material. For example, the mesh material may have about 10, about 15, about 20, about 25, about 30, or about 35 pores per inch of material. The material may be any suitable porous, low-density material capable of collecting esophageal cells from the subject. For example, the abrasive sponge may contain a mesh polyurethane. In some embodiments, the abrasive sponge contains a mesh polyester material. In some embodiments, the abrasive sponge contains a mesh polyether material.

[0132] The porosity of the abrasive sponge may be at least 80%. For example, the porosity may be at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.

[0133] The abrasive sponge can be of any suitable size and shape. The size and shape of the sponge may depend on the size of the capsule. In some embodiments, the abrasive sponge is of a suitable size and shape to allow for compression into a capsule suitable for oral administration (e.g., ingestion), as well as subsequent easy removal of the target from the esophagus and throat after the capsule has dissolved, and recovery of the sponge to its uncompressed size. For example, the sponge may be cylindrical in shape. For example, the sponge may be cylindrical in shape with a diameter of about 20 to 400 mm in its uncompressed form (e.g., the diameter of the circular portion forming the shaft of the cylinder). For example, the diameter may be about 20 mm, about 25 mm, about 30 mm, about 35 mm, or about 40 mm in its uncompressed state. For example, the sponge may be cylindrical in shape with a diameter of 20 mm, 21 mm, 22 mm, 23 mm, 24 mm, 25 mm, 26 mm, 27 mm, 28 mm, 29 mm, or 30 mm in its uncompressed state.

[0134] As another example, a sponge can be spherical in shape. For example, a sponge can be spherical in shape with a diameter of about 20-40 mm in an uncompressed state. For example, a sponge can be spherical in shape with a diameter of about 20 mm, about 25 mm, about 30 mm, about 35 mm, or about 40 mm in an uncompressed state. For example, a sponge can be spherical in shape with a diameter of 20 mm, 21 mm, 22 mm, 23 mm, 24 mm, 25 mm, 26 mm, 27 mm, 28 mm, 29 mm, or 30 mm in an uncompressed state.

[0135] The abrasive sponge can be compressed to an appropriate size and housed in a soluble capsule in its compressed state. For example, the compressed sponge may have a diameter of approximately 1 mm to approximately 15 mm. For example, the compressed sponge may have a diameter of 1 mm, 2 mm, 3 mm, 4 mm, 5 mm, 6 mm, 7 mm, 8 mm, 9 mm, 10 mm, 11 mm, 12 mm, 13 mm, 14 mm, or 15 mm in its compressed state.

[0136] In some embodiments, the dissolution of the soluble capsule releases the abrasive sponge from compression, allowing it to expand. In some embodiments, the abrasive sponge expands to its uncompressible size following the dissolution of the soluble capsule. In some embodiments, the abrasive sponge expands to substantially the same size as its original uncompressible size before being packaged in the capsule. As a non-limiting example, the abrasive sponge may expand to within 10% of its original uncompressible size following the dissolution of the soluble capsule. For example, the sponge may expand to within 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% of its original uncompressible size following the dissolution of the soluble capsule. For example, if the original uncompressible size is 30 mm, the sponge may expand to 27–30 mm following the dissolution of the capsule.

[0137] In some embodiments, the uncompressed sponge has a uniform shape. For example, the uncompressed sponge may have a uniform spherical shape. In some embodiments, the uncompressed sponge may have a uniform cylindrical shape. In some embodiments, the uncompressed sponge may have a spherical shape with a portion of the abrasive sponge material having projections extending within a soluble capsule. These projections are illustrated in Figure 8B.

[0138] In some embodiments, the abrasive sponge may be provided by removing at least one portion of the abrasive sponge, as it is formed to have recesses or indentations, or other external or internal spaces ("voids") that do not contain sponge material. Where used herein with respect to the shape of the abrasive sponge, the "removed" portion of the sponge refers to a void in a molded abrasive sponge, such as a portion removed from a simple solid form, e.g., a sphere or cylinder, to produce a final shape having one or more voids. It should be understood that the abrasive sponge may be manufactured in a final shape having such voids, such that the sponge material does not need to be physically "removed" during manufacturing. In some embodiments, at least a portion of the material may be removed from the center of the abrasive sponge. For example, the sponge may be cylindrical in shape, and a portion of the material may be removed from the center of the sponge. As another example, the sponge may be spherical in shape, and a portion of the material may be removed from the center of the abrasive sponge. For example, such embodiments are illustrated in Figures 6A and 6B. In some embodiments, at least one portion of the material may be removed from at least one outer edge of the abrasive sponge. For example, the sponge may be cylindrical in shape, and at least a portion of the material may be removed from the edge of the abrasive sponge. In another example, the sponge may be spherical in shape, and at least one portion of the material may be removed from the edge of the abrasive sponge. Various embodiments are illustrated in Figures 6C and 6D. For example, multiple portions of the material may be removed from the edge of the sponge to create a pinwheel shape (as shown in Figure 6C) or a cross shape (as shown in Figure 6D) when the sponge is viewed from above.

[0139] Any portion of an appropriate size can be removed from the sponge. For example, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or more of the material can be removed from the sponge. In some embodiments, the removal of a portion of the material facilitates the compression of the sponge into a capsule of an appropriate size for ingestion by the subject. In some embodiments, the removal of a portion of the material from the sponge facilitates the rapid expansion of the sponge following the dissolution of a soluble capsule. In some embodiments, the removal of a portion of the material from the sponge increases the surface area of ​​the sponge available for collecting esophageal cells in the subject.

[0140] The abrasive sponge is housed within a soluble capsule. Therefore, the abrasive sponge can be compressed into a cylindrical shape to fit within the soluble capsule. The soluble capsule may contain any suitable material. For example, the soluble capsule may contain gelatin, starch, or cellulose materials known in the art. In some embodiments, the soluble substance may be a vegan or vegetarian capsule (e.g., free of all animal products or free of certain types of animal-derived products, e.g., a gelatin-free capsule).

[0141] Dissolvable capsules can be made from suitable materials. In some embodiments, dissolvable capsules include suitable materials that dissolve within 10 minutes of entering the gastric cavity of the target. For example, a dissolvable capsule may dissolve within approximately 10 minutes, 9 minutes, 8 minutes, 7 minutes, 6 minutes, 5 minutes, 4 minutes, 3 minutes, 2 minutes, or 1 minute from exposure to the gastric cavity of the target. Preferably, the dissolvable capsule dissolves within 5 minutes from exposure to the gastric cavity of the target.

[0142] In some embodiments, the soluble capsule comprises a first closed end and a second closed end. For example, a soluble capsule comprising a first closed end and a second open end is shown in Figure 1A. In other embodiments, the soluble capsule comprises a first closed end and a second open end. For example, a soluble capsule comprising a first closed end and a second open end is shown in Figure 1B.

[0143] In some embodiments, the soluble capsule has one or more openings such that a portion of the abrasive sponge is exposed to the external environment through one or more openings. The presence of one or more openings can facilitate a faster dissolution time of the capsule upon ingestion by the subject. In some embodiments, the soluble capsule has one opening. In some embodiments, the soluble capsule has two or more openings. Representative images of capsules containing one or more openings are shown in Figure 1C (capsule with a first closed end and a second open end) and Figure 1D (capsule with a first closed end and a second open end).

[0144] One or more openings may be of any suitable size and shape that allows exposure of the abrasive sponge to the external environment without substantially reducing the capsule's ability to hold the sponge in a compressed state. One or more openings may be located at any suitable position on the dissolving capsule. For example, a dissolving capsule may have one or more openings at the closed end of the capsule. As another example, a dissolving capsule may have one or more openings at the cylindrical edge of the capsule.

[0145] The ingestible cell sampling device further comprises a molded cap. In some embodiments, the molded cap is hemispherical in shape. In some embodiments, the molded cap is cylindrical (e.g., button). In some embodiments, the molded cap is connected to a capsule. For example, the molded cap may be connected to the capsule by adhesive. In some embodiments, the molded cap is connected to an abrasive sponge. For example, the molded cap may be connected to an abrasive sponge by adhesive. In some embodiments, the molded cap is fitted inside the capsule.

[0146] In some embodiments, the cell sampling device may comprise a capsule having a first closed end and a second closed end, and a hemispherical molded cap may cover one of the closed ends of the capsule. For example, the molded cap may comprise an inner surface in contact with the outer surface of one end of the capsule and an outer surface in contact with the external environment (as illustrated in Figures 2 and 3). In some embodiments, the molded cap comprises an inner surface in contact with an abrasive sponge and an outer surface. In some embodiments, the outer surface may be in contact with the external environment. For example, the capsule may comprise a first closed end and a second open end, and the molded cap may cover the second open end of the capsule. For example, the molded cap may comprise an elongated cylindrical rim whose circumference fits into the circumference of the capsule (as illustrated in Figure 4).

[0147] In some embodiments, the molded cap comprises an inner surface in contact with the abrasive sponge and an outer surface in contact with the inner surface of one end of the capsule. For example, the capsule may have a first closed end and a second closed end, and the hemispherical molded cap may have an inner surface in contact with the abrasive sponge and an outer surface in contact with the inner surface of one closed end of the capsule (e.g., the molded cap is fitted inside the capsule). In some embodiments, the capsule may have a first closed end and a second closed end, and a cylindrical molded cap (e.g., a button) may be fitted inside the capsule. In such embodiments, the button may be fitted inside the capsule such that the rim of the molded cap is in contact with the capsule, the bottom surface of the molded cap is in contact with the abrasive sponge, and the top surface of the molded cap is not in direct contact with the inner surface of the capsule (as illustrated in Figures 14 and 15). In some embodiments, the cell sampling device comprises a capsule having a first closed end and a second closed end, and a hemispherical molded cap may be fitted inside the capsule. For example, a cell sampling device may comprise a hemispherical molded cap having an outer surface in contact with the inner surface of a second closed end, and a suture attached to the molded cap. An abrasive sponge may be housed in a compressed state within a soluble capsule such that the inner surface of the spherical molded cap is in contact with the abrasive sponge. Such embodiments are shown, for example, in Figures 16 and 17.

[0148] In embodiments where the inner surface of the molded cap is in contact with the abrasive sponge, the inner surface of the molded cap can be attached to the abrasive sponge. For example, the inner surface of the molded cap can be attached to the abrasive sponge by an adhesive.

[0149] In embodiments where the surface of the molded cap is in contact with the capsule, the molded cap can be attached to the capsule (for example, by adhesive).

[0150] The ingestible cell sampling device further comprises a string attached to a molded cap. The string may be attached to the molded cap by any suitable means, including but not limited to crimping, overmolding, adhesive, melting, packaging, or taping. In some embodiments, the string is attached to the molded cap by adhesive. In some embodiments, the string is attached to the molded cap by knots. Any suitable type of knot may be used. For example, the knot may be a hitch knot. The term "hitch knot" refers to a type of knot used to tie a string to an object or another string. This term refers to alternative ring hitches, anchor bend variants, bale ring hitches, barrel hitches, beckett hitches, blackwall hitches, Blakes hitches, boom hitches, bottom load release hitches, buntline hitches, cat's paws, chain hitches, clathering hitches, clove hitches, continuous ring hitches, cow hitch variants, toggle and cow hitches, cow hitches, double half hitches, Farrimond friction hitches, Garda hitches, groundline hitches, half hitches, halter hitches, high point hitches, highwayman hitches, hitching ties, icicle hitches, killk hitches, noot hitches, lighter hitches, This encompasses many different types of hitch knots, including Magnus hitch, Marlin hitch, Marlin spike hitch, masthead knot, midshipman's hitch, Münter hitch, Münter friction hitch, Ossel hitch, Paloma knot, pile hitch, Prusik knot, reverse half hitch, round hitch, round turn and 2 half hitch, sailor's grip hitch, sailor's hitch, Siberian hitch, single hitch, Sriperry hitch, Snell knot, Snuggle hitch, Tautline hitch, Timber hitch, Trilen knot, Trucker's hitch, Tugboat hitch, Uni knot, or Wagoner's hitch. In some embodiments, the hitch knot is a double overhand knot.

[0151] In some embodiments, the knot may be a binding knot. The term “binding knot” refers to a type of knot used to hold together one or more objects using a string that passes around them at least once. Suitable binding knots include, for example, bore knots, bottle slings, bowline knots, contraction knots, horned beef knots, granny knots, ground knots, mirror knots, packer knots, leaf knots, constriction knots, surgeon knots, thief knots, obstruction knots, sheet bends, or general whip knots. The type of knot may be selected to provide a stable means of connecting the string to a molded cap while allowing for ease of manufacture.

[0152] The molded cap may have any suitable features to allow the string to be attached to the cap. For example, the molded cap may have two holes through which a string can be threaded and tied to a suitable knot. The string can be threaded through the first hole, pass through the external environment, and then re-enter the capsule by passing through the second hole, before the knot can be tied inside the capsule. As another example, the molded cap may have a bar to which the string can be secured (as shown in Figure 11D).

[0153] The string may contain any suitable material. For example, the string may be suture material (e.g., surgical suture material). Suture material can be made from a variety of materials, including biological or synthetic materials. For example, suture material may contain synthetic materials such as nylon, polyester, PVDF, polypropylene, or combinations thereof.

[0154] The string should be of an appropriate thickness so that the subject can easily swallow it without causing lacerations to the throat. In some embodiments, the string has a thickness of 0.3 mm to 0.7 mm. For example, the string may have a thickness of 0.3 mm, 0.35 mm, 0.4 mm, 0.45 mm, 0.5 mm, 0.55 mm, 0.6 mm, 0.65 mm, or 0.7 mm.

[0155] The string should be of an appropriate length to allow the device to be removed after the dissolvable capsule has dissolved in the subject. Therefore, the string should be long enough to allow the abrasive sponge contained within the dissolvable capsule to reach the gastric cavity of the subject, while holding enough string so that the subject or physician can grasp the string and begin to remove the device. For example, the string may be at least 60 cm long. In some embodiments, the string may be 60 cm to 80 cm long. For example, the string may be 60 cm, 61 cm, 62 cm, 63 cm, 64 cm, 65 cm, 66 cm, 67 cm, 68 cm, 69 cm, 70 cm, 71 cm, 72 cm, 73 cm, 74 cm, 75 cm, 76 cm, 77 cm, 78 cm, 79 cm, or 80 cm long.

[0156] In some embodiments, the string may be provided with markings on the string to determine the amount of string swallowed. Such markings would help determine that the soluble capsule has moved to a desired area (e.g., the target gastric cavity). The markings can be spaced at any appropriate distance apart. For example, the markings can be spaced 1 to 80 cm apart. For example, the markings may be placed about 1 cm, about 5 cm, about 10 cm, about 15 cm, about 20 cm, about 25 cm, about 30 cm, about 35 cm, or about 40 cm apart.

[0157] The string should have adequate tensile strength to minimize the risk of the string breaking during ingestion and / or removal of the device. For example, the string should have adequate tensile strength to allow the string to be pulled to remove the device from the object after the dissolvable capsule has dissolved. In some embodiments, the ingestible device may be equipped with a handle or grip to facilitate removal of the device and / or prevent swallowing of the entire string. For example, the ingestible device may be equipped with a handle attached to the end of the string that is not attached to a moldable cap or button. For example, the ingestible device may be equipped with a handle or grip at the end of the string that does not contain a capsule. The handle or grip may be of any appropriate size and shape to facilitate removal and prevent swallowing of the string. The handle or grip may be open (e.g., bar shape, T-shape, X-shape, hook shape, etc.) or closed (e.g., circular or semicircular shape, rectangular shape, triangular shape, etc.) and may be formed from the same material as the string (e.g., loops or knots in the string) or from a different material (e.g., plastic, metal, etc.). A suitable handle is demonstrated herein, particularly in Figures 21, 22, 23, and 24.

[0158] In some embodiments, the handle also serves as a means for storing a device that can be ingested before use in the subject. For example, the handle may have a cavity that may contain a soluble capsule. The handle may also have means for wrapping a string (e.g., suture) around the handle during storage.

[0159] In some embodiments, the handle grips a soluble capsule ingestion device within a pair of grippers at one end of the handle. The handle may include a mechanism for loosening or unlocking the grippers, thereby releasing the soluble capsule before use in the subject. In some embodiments, the other end of the handle (e.g., the end facing the grippers) is a hook. Such embodiments are shown in Figure 20.

[0160] In some embodiments, the handle comprises a flat surface containing a cavity in which a soluble capsule may be placed and a segment around which the suture can be wound. The handle may further comprise means for releasing tension on the suture, thereby facilitating the removal of the length of suture without the need to unwind it. Such embodiments are shown, for example, in Figure 21. In this particular figure, the handle comprises a tab that can be squeezed to release tension from the suture and allow for easy removal of the suture from the handle.

[0161] In some embodiments, the handle is circular in shape. The handle has a flat surface containing a cavity in which a soluble capsule can be placed. The suture may be wound around the outer edge of the circular handle, such as along a slightly recessed channel extending along the outer edge of the handle. The suture may be tied in a location that can be facilitated by a single hole located in the circular handle, etc. The suture may be unwound and wound back from the circular handle to allow the subject to ingest the device. Such embodiments are shown in Figure 22.

[0162] In some embodiments, the handle is T-shaped. The upper section of the T may have a cavity in which a dissolvable capsule can be placed, while the vertical section may be used to wrap sutures around the handle. Such embodiments are shown, for example, in Figure 23.

[0163] In some embodiments, the handle comprises a modified hook shape having multiple attachment points to which sutures can be secured. Figure 24 shows an exemplary embodiment of the handle described herein. The handle comprises a flat surface at one end and a hook shape at the opposite end. The flat surface includes a cavity in which a soluble capsule can be placed. The flat surface further comprises multiple openings to provide a variety of suitable attachment points for sutures.

[0164] In some embodiments, the string passes through a portion of the abrasive sponge. Therefore, passing the string through the sponge would help secure the sponge to the molded cap so that it is not lost within the object after the dissolution of the dissolving capsule. In some embodiments, the string passes through at least one surface of the dissolving capsule. For example, the string may pass through a first closed end of the dissolving capsule, through the abrasive sponge, and then to the molded cap. In some embodiments, the string may pass through a first closed end of the dissolving capsule, through the abrasive sponge, through a second closed end of the dissolving capsule, and then to the molded cap. The end of the string not attached to the molded cap may be attached to the handle, as described above.

[0165] Methods for collecting cells from a subject are further described herein. These methods include providing a subject with an ingestible cell sampling device as described herein. Suitable methods for providing a subject with an ingestible cell sampling device are described in U.S. Patents 4,735,214, 10,327,742, and 10,292,687, each of which is incorporated herein by reference in whole. For example, a subject may swallow the ingestible cell sampling device as described herein, and a suitable time may elapse before the device is removed from the subject. For example, a subject may swallow the ingestible cell sampling device, and it may be possible for it to pass through for 10 minutes or less before removal. For example, 10 minutes, 9 minutes, 8 minutes, 7 minutes, 6 minutes, 5 minutes, 4 minutes, 3 minutes, 2 minutes, or 1 minute may elapse before removal. Removal may include having the subject, a physician, or other suitable person grasp and pull the string at a suitable speed that allows for comfortable removal of the device from the subject. Esophageal cells may be collected from an abrasive sponge by any suitable means and subsequently analyzed to determine whether one or more abnormalities are present in the subject. In some embodiments, esophageal cells may be collected and placed in a suitable stabilizing buffer before analysis. For example, the stabilizing buffer may contain any suitable agent or combination of agents that prevent undesirable damage to the cells (e.g., cell lysis) or damage / degradation of nucleic acids (e.g., DNA or RNA) contained in the cell sample.

[0166] In some embodiments, esophageal cells are collected from a polishing sponge and analyzed to determine whether esophageal disorder is present in the subject. The analysis may be performed by any suitable method, including protein-based tests, tissue / cytological examinations (e.g., microscopy or other visual examinations), and / or nucleic acid detection assays. For example, the analysis may be performed by protein-based techniques to analyze one or more biomarkers of interest. Protein-based techniques include, for example, immunohistochemistry, ELISA, Western blotting, flow cytometry, fluorescence insights hybridization (FISH), fluorescence analysis of cell sorting (FACS), and mass spectrometry. For example, the protein-based technique may be performed using one or more antibodies against at least one biomarker protein of interest. The biomarker protein(s) may be detected using antibodies capable of reacting with the protein(s) and subsequent visualization of the antibodies. The antibodies may be polyclonal or monoclonal antibodies. The use of secondary, tertiary, or further antibodies may be advantageous to amplify the signal and facilitate detection.

[0167] In some embodiments, esophageal cells are collected from an abrasive sponge and examined to determine whether an esophageal disorder is present in the subject. For example, cells may be collected from the sponge, plated on a suitable culture medium, and examined by microscopy or other visual inspection to determine whether features indicating an esophageal disorder are present within the cells. In some embodiments, cells may be collected from the sponge, plated, and examined using a microscope to determine whether one or more cancer cells are present. In some embodiments, the diagnosis of an esophageal disorder may be made by visualization of a specific cell type, such as columnar cells, which may indicate gastroesophageal reflux disease or its complications, including Barrett's esophagus or esophageal adenocarcinoma.

[0168] In some embodiments, esophageal cells are collected from a polishing sponge, and one or more nucleic acid detection assays are performed to determine whether esophageal disorders are present in the subject. For example, esophageal cells may be collected from a polishing sponge after use in the subject, and the cells may be analyzed by one or more nucleic acid detection assays to detect levels of one or more biomarkers of esophageal disorders. Suitable methods for detecting esophageal disorders (e.g., nucleic acid detection assays) and biomarkers are both incorporated herein by reference in their entirety by U.S. Patent Application No. 15 / 881,409 (e.g., ANKRD13B, CHST2, CNNM1, DOCK2, DTX1, FER1L4, FERMT3, FLI1, GRIN2D, JAM3, LRRC4) filed on January 26, 2018. These include OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEP9, SFMBT2, SLC12A8, TBX15, TSPYL5, VAV3, ZNF304, ZNF568, and ZNF671, as well as those described in U.S. Patent No. 10,435,755 (e.g., including BMP3, NDRG4, VAV3, SFMBT2, DIO3, HUNK, ELMO1, CD1D, CDKN2A, and OPLAH). Exemplary assay designs for suitable biomarkers ZNF682, NDRG4, and VAV3 are discussed in more detail below.

[0169] Exemplary nucleic acid assay designs are shown in Figures 16A–16F. For example, esophageal cells may be collected from a polishing sponge, and the levels of one or more biomarkers selected from ZNF682, NDRG4, and VAV3 may be determined. In some embodiments, the levels of ZNF682, NDRG4, and VAV3 may be determined. In some embodiments, the detection of esophageal disorders may involve measuring the DNA methylation levels of one or more biomarkers.

[0170] In some embodiments, the biomarker may be ZNF682. Exemplary primers and probes for ZNF682 are shown in Figure 16A. In some embodiments, the ZNF682 forward primer may include 5'AGTTTATTTTGGGAAGAGTCGCG3' (SEQ ID NO: 3), the reverse primer may include 5'CCATTATCCCCGCAATCGAA3' (SEQ ID NO: 4), and the probe may include 5'CGCGCCGAGGGCGCGTTTTTGCGTT / 3C6 / 3' (SEQ ID NO: 5).

[0171] In some embodiments, the biomarker may be VAV3. Exemplary primers and probes for VAV3 are shown in Figure 16B. In some embodiments, the VAV3 forward primer may include 5'TCGGAGTCGAGTTTAGCGC3' (SEQ ID NO: 8), and the reverse primer may include 5'CGAAATCGAAAAAACAAAAACCGC3' (SEQ ID NO: 9). In some embodiments, VAV3 may be detected by one or two probes. For example, VAV3 may be detected by probe (arm 1) 5'CGCCGAGGCGGCGTTCGCGA / 3C6 / 3' (SEQ ID NO: 10) and / or probe (arm 5) 5'CCACGGACGCGGCGTTCGCGA / 3C6 / 3' (SEQ ID NO: 11).

[0172] In some embodiments, the biomarker may be NDRG4. Exemplary primers and probes for NDRG4 are shown in Figure 16C. In some embodiments, the NDRG4 forward primer may include 5'CGGTTTTCGTTCGTTTTTTCG3' (SEQ ID NO: 14), the reverse primer may include 5'CCGCCTTCTACGCGACTA3' (SEQ ID NO: 15), and the probe may include 5'CCACGGACGGTTCGTTTATCG / 3C6 / 3' (SEQ ID NO: 16).

[0173] In some embodiments, the biomarker may be bone morphogenesis protein 3 (BMP3). In some embodiments, the biomarker may be ZNF568. In some embodiments, the biomarkers may be BMP3 and ZNF568.

[0174] In some embodiments, one or a group of biomarkers for analyzing a sample collected from the esophagus, for example, for detecting esophageal disorders, may be selected from the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, FER1L4, ANKRD13B, CD1D, CDKN2A, CHST2, CNNM1, DIO3, DOCK2, DTX1, ELMO1, FERMT3, FLI1, GRIN2D, HUNK, JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEP9, SFMBT2, SLC12A8, TBX15, TSPYL5, ZNF304, and ZNF671. The biomarkers selected from this group may include, without limitation, one biomarker, or two, three, four, five, six, seven, eight, nine, ten, one, two, three, four, three, six, seven, eight, nine, ten, one, three For example, in a particular embodiment, the biomarker or group of biomarkers is selected from the group consisting of ANKRD13B, CHST2, CNNM1, DOCK2, DTX1, FER1L4, FERMT3, FLI1, GRIN2D, JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEP9, SFMBT2, SLC12A8, TBX15, TSPYL5, VAV3, ZNF304, ZNF568, and ZNF671, and in some embodiments, the biomarker or group of biomarkers is selected from the group consisting of BMP3, NDRG4, VAV3, SFMBT2, DIO3, HUNK, ELMO1, CD1D, CDKN2A, and OPLAH. In some embodiments, the biomarker or group of biomarkers is selected from the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, and FER1L4, and in a particular embodiment, the group of biomarkers includes the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, and FER1L4.

[0175] In some embodiments, one or more biomarkers are normalized against a reference marker. Suitable methods and reference markers are described in U.S. Patent No. 10,465,248 and U.S. Patent Application No. 16 / 318,580, the entire contents of which are incorporated herein by reference. In some embodiments, the reference marker is selected from β-actin, ZDHHC1, and B3GALT6.

[0176] In some embodiments, the reference marker may be ZDHHC1. Exemplary primers and probes for ZDHHC1 are shown in Figure 16D. In some embodiments, the ZDHHC1 forward primer comprises 5'GTCGGGGTCGATAGTTTACG3' (SEQ ID NO: 19), the reverse primer comprises 5'ACTCGAACTCACGAAAACG3' (SEQ ID NO: 20), and the probe comprises 5'CCACGGACGGACGAACGCACG / 3C6 / 3' (SEQ ID NO: 21).

[0177] In some embodiments, the reference marker may be B3GALT6. Exemplary primers and probes for B3GALT6 are shown in Figure 16E. In some embodiments, the B3GALT6 forward primer comprises 5'GGTTTATTTTGGTTTTTTGAGTTTTCGG3' (SEQ ID NO: 24), the reverse primer comprises 5'TCCAACCTACTATATTTACGCGAA3' (SEQ ID NO: 25), and the probe comprises 5'CCACGGACGGCGGATTTAGGG / 3C6 / 3' (SEQ ID NO: 26).

[0178] In some embodiments, the reference marker may be β-actin. Exemplary β-actin primers and probes are shown in Figure 16F. In some embodiments, the β-actin forward primer comprises 5'GTGTTTGTTTTTTTGATTAGGTGTTTAAGA3' (SEQ ID NO: 32), the reverse primer comprises 5'CTTTACACCAACCTCATAACCTTATC3' (SEQ ID NO: 33), and the probe comprises 5'GACGCGGAGATAGTGTTGTGG / 3C6 / 3' (SEQ ID NO: 34).

[0179] All documents and similar materials cited herein, including but not limited to patents, patent applications, articles, books, papers, and internet web pages, are expressly incorporated by reference in their entirety for all purposes. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to whom the various embodiments described herein belong. Where, when the definitions of these terms appear to differ from those provided in the teachings of the invention, the definitions provided in the teachings of the invention shall prevail.

[0180] Various modifications and variations of the compositions, methods, and uses of the scientific and technological invention described herein will be obvious to those skilled in the art without departing from the scope and spirit of the scientific and technological invention as described herein. Although the scientific and technological invention has been described in relation to specific exemplary embodiments, it should be understood that the invention as described in the claims should not be excessively limited to such specific embodiments. In fact, various modifications of the methods described for carrying out the invention which are obvious to those skilled in the art in pharmacology, biochemistry, medicine, or related fields are intended to be within the scope of the appended claims. [Brief explanation of the drawing]

[0181] These and other features, aspects, and advantages of this technology will be better understood with reference to the following drawings. [Figure 1A]Various embodiments of the soluble capsule described herein are shown. Figure 1A shows a capsule having a first closed end and a second closed end. [Figure 1B] Various embodiments of the soluble capsule described herein are shown. Figure 1B shows a capsule having a first closed end and a second open end. [Figure 1C] Various embodiments of the soluble capsule described herein are shown. Figure 1C shows a capsule having a first closed end, a second closed end, and a plurality of openings. [Figure 1D] Various embodiments of the soluble capsule described herein are shown. Figure 1D shows a capsule having a first closed end, a second open end, and a plurality of openings. [Figure 2] An embodiment of the ingestible cell sampling device described herein is shown. The device comprises an abrasive sponge contained in a compressed state within a soluble capsule having a first closed end and a second closed end, a spherical molded cap having an inner surface in contact with the outer surface of the second closed end, and a suture attached to the molded cap. [Figure 3] Embodiments of an ingestible cell sampling device described herein are shown. The device comprises an abrasive sponge contained in a compressed state within a soluble capsule having a first closed end and a second closed end; a spherical molded cap having an inner surface in contact with the outer surface of the second closed end; and a suture attached to the molded cap. The device further includes a plurality of openings along the cylindrical edge of the soluble capsule such that the abrasive sponge is exposed to the external environment at these openings. [Figure 4] This specification describes an embodiment of an ingestible cell sampling device. The device comprises an abrasive sponge contained in a compressed state within a soluble capsule having a first closed end and a second closed end; a spherical molded cap having an inner surface in contact with the abrasive sponge; and a suture attached to the molded cap. The molded cap covers the second open end of the soluble capsule. [Figure 5]Embodiments of an ingestible cell sampling device described herein are shown. The device comprises an abrasive sponge contained in a compressed state within a soluble capsule having a first closed end and a second closed end; a spherical molded cap having an inner surface in contact with the abrasive sponge; and a suture attached to the molded cap. The molded cap covers the second open end of the soluble capsule. The device further comprises a plurality of openings along the cylindrical edge of the soluble capsule. [Figure 6A] Various embodiments of the abrasive sponge described herein are shown. Figure 6A shows a cylindrical abrasive sponge with some of the material removed from the center. Approximately 25% of the material has been removed from the center of the sponge. [Figure 6B] Various embodiments of the abrasive sponge described herein are shown. Figure 6B shows a similar sponge from which a larger portion of the material has been removed from the center. Approximately 50% of the material has been removed from the center of the sponge. [Figure 6C] Various embodiments of the abrasive sponge described herein are shown. Figure 6C shows a cylindrical sponge from which several portions have been removed from the edge of the sponge to create a pinwheel shape when viewed from above. [Figure 6D] Various embodiments of the abrasive sponge described herein are shown. Figure 6D shows a cylindrical sponge from which several portions have been removed from the edges to create a cross shape when viewed from above. [Figure 7A] Various diagrams of the abrasive sponge with a portion of the material (approximately 25%) removed from the center are shown. The suture material passes through the abrasive sponge and is attached to the molded cap. The uncompressed diameter of the abrasive sponge is approximately 30 mm (Figure 7A). [Figure 7B] Various diagrams of abrasive sponges are shown with a portion of the material (approximately 25%) removed from the center. The portion of the material is removed from the center of the abrasive sponge, and the abrasive sponge is attached to the inner surface of a molded cap with adhesive (Figure 7B). [Figure 8A]Various diagrams of the abrasive sponge with a portion (approximately 50%) of the material removed from the center are shown. The suture material passes through the abrasive sponge and is attached to the molded cap. The uncompressed diameter of the abrasive sponge is approximately 30 mm (Figure 8A). [Figure 8B] Various diagrams of abrasive sponges are shown with a portion of the material (approximately 50%) removed from the center. The portion of the material is removed from the center of the abrasive sponge, and the abrasive sponge is attached to the inner surface of a molded cap with adhesive (Figure 8B). [Figure 9A] Various diagrams of the abrasive sponge with multiple pieces of material removed from the edges are shown. The uncompressed diameter of the abrasive sponge is approximately 30 mm (Figure 9A). [Figure 9B] Various diagrams of abrasive sponges are shown with multiple pieces of material removed from the edges of the sponge. Multiple pieces of material are removed from the edges of the sponge to produce a sponge that has a pinwheel shape when viewed from above (Figure 9B). [Figure 10A] Various diagrams of abrasive sponges with multiple pieces of material removed from the edges are shown. The uncompressed diameter of the abrasive sponge is approximately 30 mm (Figure 10A). [Figure 10B] Various diagrams of abrasive sponges are shown with multiple pieces of material removed from the edges of the sponge. Multiple pieces of material are removed from the edges of the sponge to produce a sponge that has a cross shape when viewed from above (Figure 10B). [Figure 11A] Various embodiments of methods for attaching the string to the molded cap are shown. Figure 11A shows an embodiment in which the suture is attached to the molded cap by a knotting means. The molded cap is located outside the closed end of the capsule. [Figure 11B] Various embodiments of methods for attaching the string to the molded cap are shown. Figure 11B shows an embodiment in which the molded cap covers the open end of the capsule. The string is attached to the molded cap by means of knotting, and the molded cap has an elongated cylindrical rim whose circumference fits into the circumference of the open end of the capsule. [Figure 11C]Various embodiments of methods for attaching a string to a molded cap are shown. Figure 11C shows an embodiment in which the molded cap is a button. The button fits into the capsule, and the string is attached to the button by means of a knot. [Figure 11D] Various embodiments of methods for attaching a string to a molded cap are shown. Figure 11D shows an embodiment in which the molded cap is a button. The button fits into the capsule, and the string is attached to the button by means of a knot. [Figure 12] Figure 11A shows several diagrams of an embodiment of the mounting shown. The molded cap has two holes through which the string passes (left). A knot for securing the string to the cap is tied on the inside of the molded cap (center). The molded cap fits over the closed end of the soluble capsule such that the inner surface of the molded cap is in contact with the outer surface of the closed end of the capsule (right). [Figure 13] Figure 11B shows several diagrams of an embodiment of the mounting shown. The molded cap has two holes through which the string passes (left). The knot for securing the string to the cap is tied inside the molded cap (center). The molded cap has an elongated cylindrical rim, the circumference of which fits into the circumference of the open end of the capsule (center, right). The outer surface of the molded cap is in contact with the external environment. [Figure 14] Figure 11C shows several diagrams of an embodiment of the mounting shown. The molded cap is a button. The button has two holes through which a string is passed (left). A knot for securing the string to the button is tied inside the molded cap (center). Alternatively or additionally, the string may be secured to the molded cap by the use of adhesive. The button fits into the capsule (right). [Figure 15]Figure 11D shows several diagrams of an embodiment of the mounting shown. The molded cap is a button. The button has a bar shape molded inside the cap (left). The string is wrapped around the bar shape, and a knot for securing the string to the button is tied inside the molded cap (center). Alternatively or additionally, the string may be secured to the button (e.g., to the bar shape) by adhesive. The button fits into the capsule (right). [Figure 16] The following are figures illustrating exemplary embodiments of an ingestible cell sampling device as described herein. The device comprises a soluble capsule having a first closed end and a second closed end. The device comprises a spherical molded cap having an outer surface in contact with the inner surface of the second closed end, and a suture attached to the molded cap. An abrasive sponge can be contained in a compressed state within the soluble capsule such that the inner surface of the spherical molded cap is in contact with the abrasive sponge. Exemplary side, top, and angled views of the molded cap are shown on the right. The molded cap has two holes for allowing the attachment of a suture, and the top is slightly recessed to accommodate the thickness of the suture. [Figure 17] The following are figures illustrating exemplary embodiments of an ingestible cell sampling device as described herein. The device comprises a soluble capsule having a first closed end and a second closed end. The device comprises a spherical molded cap having an outer surface in contact with the inner surface of the second closed end, and a suture attached to the molded cap. An abrasive sponge may be housed in a compressed state within the soluble capsule such that the inner surface of the spherical molded cap is in contact with the abrasive sponge. Exemplary side, top, and angled views of the molded cap are shown on the right. The molded cap has two holes for allowing the attachment of a suture, and the top is slightly recessed to accommodate the thickness of the suture. The holes are slightly larger than those shown in the embodiment of Figure 16. The larger holes for this device compared to those shown in Figure 16 may allow different (e.g., larger) knots to be used to attach the suture to the molded cap. [Figure 18]This specification shows several figures of exemplary embodiments of an ingestible cell sampling device as described herein. The device comprises a soluble capsule having a first closed end and a second open end. An abrasive sponge can be contained in a compressed state within the soluble capsule. The device comprises a spherical molded cap having an inner surface in contact with the abrasive sponge, and a suture attached to the molded cap. The outer surface of the spherical molded cap is exposed to the external environment. The molded cap covers the second open end of the soluble capsule. Exemplary side, top, and angled views of the molded cap are shown on the right. The molded cap has two holes for allowing the attachment of the suture, and the top is slightly recessed to accommodate the thickness of the suture. [Figure 19] This specification shows several figures of exemplary embodiments of an ingestible cell sampling device as described herein. The device comprises a soluble capsule having a first closed end and a second open end. An abrasive sponge may be contained in a compressed state within the soluble capsule. The device comprises a spherical molded cap having an inner surface in contact with the abrasive sponge, and a suture attached to the molded cap. The outer surface of the molded cap is exposed to the external environment. The molded cap covers the second open end of the soluble capsule. Exemplary side, top, and angled views of the molded cap are shown on the right. The molded cap has two holes for allowing the attachment of the suture, and the top is slightly recessed to accommodate the thickness of the suture. The holes are slightly larger than those shown in the embodiment of Figure 18. The larger holes for this device compared to those shown in Figure 18 may allow different (e.g., larger) knots to be used to attach the suture to the molded cap. [Figure 20]Several figures illustrating exemplary embodiments of the handle as described herein are shown. The handle has a hook shape. The handle "grabs" the soluble capsule in a pair of grippers at one end of the handle. The other end of the handle is a hook. A suture can be wrapped around any suitable part of the handle. For use in a subject, the ingestible device can be removed and the suture can be unwound. The device can be ingested by the subject or a third party while the subject or a third party holds the hook end of the handle. [Figure 21] An exemplary embodiment of a handle as described herein is shown. The handle includes a cavity in which a soluble capsule may be placed. A suture can be wound around a separate portion of the handle, as shown. When wound, the suture can be held in place by a suitable amount of tension. The handle may include a tab that can be squeezed to release tension from the suture and allow for easy removal of the suture from the handle without having to unwind the entire length of the suture. [Figure 22] Another exemplary embodiment of a handle as described herein is shown. The handle may be circular in shape. The handle includes a cavity in which a soluble capsule may be placed. The suture may be wound around the outer edge of the circular handle, such as along a slightly recessed channel extending along the outer edge of the handle. The suture may be tied in a location that can be facilitated by a single hole placed in the circular handle, such as. The suture may be unwound and wound back from the circular handle to allow an object to ingest the device. [Figure 23] Another exemplary embodiment of a handle as described herein is shown. The handle is T-shaped. The handle includes a cavity in which a soluble capsule may be placed. The suture can be held in place by wrapping the suture around the handle. [Figure 24]An exemplary embodiment of a handle as described herein is shown. The handle has a flat surface at one end and a hook shape at the opposite end. The flat surface includes a cavity in which a soluble capsule can be placed. The flat surface is further provided with a plurality of openings to provide various suitable attachment sites for sutures. [Figure 25A] This document presents an exemplary assay design for detecting biomarkers of esophageal disorders in a sample. [Figure 25B] This document presents an exemplary assay design for detecting biomarkers of esophageal disorders in a sample. [Figure 25C] This document presents an exemplary assay design for detecting biomarkers of esophageal disorders in a sample. [Figure 25D] This document presents an exemplary assay design for detecting biomarkers of esophageal disorders in a sample. [Figure 25E] This document presents an exemplary assay design for detecting biomarkers of esophageal disorders in a sample. [Figure 25F] This document presents an exemplary assay design for detecting biomarkers of esophageal disorders in a sample.

Claims

1. A cell sampling device that can be ingested, i) An abrasive sponge contained within a soluble capsule, wherein the soluble capsule has a closed end, an open end, and an outer surface exposed to the external environment, the soluble capsule has one or more openings, and a portion of the abrasive sponge is exposed to the external environment through the one or more openings, and the abrasive sponge and ii) A molded cap covering the open end of the dissolvable capsule, comprising an inner surface of the cap attached to the abrasive sponge by adhesive, and an outer surface of the cap in contact with the external environment, iii) The ingestible cell sampling device comprising: a string having a first end attached to the molded cap and a second end, wherein the string passes the abrasive sponge and the soluble capsule between the first end and the second end.

2. The ingestible cell sampling device according to claim 1, further comprising a handle attached to the string.

3. An ingestible cell sampling device according to claim 1, having one or more features selected from the following: a) The abrasive sponge includes a mesh-like material; b) The abrasive sponge includes a mesh foam; c) The abrasive sponge comprises a mesh material having 10 to 35 pores per inch of material; d) The abrasive sponge comprises at least one of a mesh polyurethane, a mesh polyester, and a mesh polyether; e) The abrasive sponge comprises a mesh material having at least 80% to 99% porosity; f) The abrasive sponge is compressible; g) The abrasive sponge is held in a compressed state by the soluble capsule; h) The abrasive sponge, in an uncompressed state, has a shape selected from cylindrical, partially cylindrical, spherical, and partially spherical; i) The shape of the abrasive sponge, in an uncompressed state, has a maximum diameter perpendicular to the portion of the string passing through the abrasive sponge, and this maximum diameter is 20 to 40 mm; j) The abrasive sponge, in its uncompressed state, has at least one cavity; k) The string passes through at least one cavity in the abrasive sponge in an uncompressed state; and l) The shape of the abrasive sponge has volume in an uncompressed state, and the volume of the at least one cavity includes at least 5% to 50% of the volume of the shape of the abrasive sponge.

4. An ingestible cell sampling device according to claim 2, having one or more features selected from the following: a) The handle is a handle that cannot be swallowed; b) The handle is attached to the second end of the string; c) The handle includes a cavity in which the soluble capsule may be placed; d) The handle includes a set of grippers that hold the dissolvable capsule by pinching it; e) The handle includes a mechanism for loosening or unlocking the set of grippers to release the soluble capsule; and f) The handle includes a hook.

5. The ingestible cell sampling device according to claim 1, comprising one or more features selected from the following: a) The molded cap includes a disc-shaped button; b) The molded cap includes one or more holes; c) The molded cap or a part of the molded cap includes a shape selected from a spherical part, a hemisphere or a part thereof, and a cylindrical shape or a part thereof.

6. An ingestible cell sampling device according to claim 1, comprising one or more features selected from the following: a) The soluble capsule contains gelatin; b) The soluble capsule is gelatin-free; c) The soluble capsules do not contain animal products; d) The soluble capsule contains starch and / or cellulose material; and e) The soluble capsule can be dissolved within 1 to 10 minutes after being exposed to the gastric cavity of the subject.

7. An ingestible cell sampling device according to claim 1, comprising one or more features selected from the following: a) The string is attached to the molded cap by loops, knots and / or adhesive; b) The string has one or more calibration markings; c) The string includes one or more elements selected from the group consisting of cords, threads, filaments, cables, strands, fibers, ribbons, webbing, sutures, and lace; d) The string includes one strand; e) The string includes multiple strands of one material or multiple strands of different materials; f) The string includes a plurality of strands that are twisted, braided, woven or fused together to form the string; g) The string may include natural, synthetic, or hybrid materials; h) The string comprises one or more materials selected from silk, cotton, polyester, nylon, polypropylene, and cellulose; i) The string includes one or more hollow strands; j) The thickness of the swallowable portion of the string is 0.3 mm to 0.7 mm; and k) The length of the string is at least 60 cm.

8. A system or kit for obtaining cell samples from a subject, wherein the system or kit comprises an ingestible cell sampling device, and the ingestible cell sampling device is i) An abrasive sponge contained within a soluble capsule, wherein the soluble capsule has a closed end, an open end, and an outer surface exposed to the external environment, ii) A molded cap covering the open end of the dissolvable capsule, the molded cap comprising an inner surface attached to the abrasive sponge by adhesive and an outer surface of the cap in contact with the external environment, and iii) A string having a first end and a second end attached to the molded cap, wherein the string passes the abrasive sponge and the dissolvable capsule between the first end and the second end; Equipped with, The aforementioned system or kit further includes: a) A container for receiving the polishing sponge containing the collected cells; b) Cell preservation reagents; c) Buffering reagent; d) Microscope slides; e) Assay plate; f) Local anesthetic agents; g) Local anesthetic spray; h) Components of a drinkable solution; i) A pre-mixed, potable solution; j) Lubricants; and k) Lubricant gel or liquid; A system or kit comprising one or more of the following.

9. An ingestible cell sampling device for use in a method of collecting cell samples from a subject, The aforementioned method, a) Oral administration to an ingestible cell sampling device, wherein the ingestible cell sampling device is i) An abrasive sponge contained within a soluble capsule, wherein the soluble capsule has a closed end, an open end, and an outer surface exposed to the external environment, ii) A molded cap covering the open end of the dissolvable capsule, the molded cap comprising an inner surface attached to the abrasive sponge by adhesive and an outer surface of the cap in contact with the external environment, and iii) A string having a first end and a second end attached to the molded cap, wherein the string passes the abrasive sponge and the dissolvable capsule between the first end and the second end; Equipped with, b) The ingestible cell sampling device, comprising withdrawing the cell sampling device from the object, wherein the polishing sponge collects a cell sample from the object during the withdrawal.

10. The ingestible cell sampling device according to claim 9, wherein the extraction occurs within 10 minutes of oral administration.

11. The ingestible cell sampling device according to claim 9, wherein during the oral administration, the subject swallows the soluble capsule of the ingestible cell sampling device.

12. The ingestible cell sampling device according to any one of claims 9 to 11, further comprising assaying the cell sample for at least one biomarker.

13. The ingestible cell sampling device according to claim 12, wherein the at least one biomarker comprises one or more proteins and nucleic acids.

14. The ingestible cell sampling device according to claim 13, wherein the at least one biomarker comprises DNA containing at least a portion of a gene selected from the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, FER1L4, ANKRD13B, CD1D, CDKN2A, CHST2, CNNM1, DIO3, DOCK2, DTX1, ELMO1, FERMT3, FLI1, GRIN2D, HUNK, JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEPT9, SFMBT2, SLC12A8, TBX15, TSPYL5, ZNF304, and ZNF671.

15. Assaying for at least one of the above biomarkers is possible for NDRG4, ZNF682, VAV3, BMP3, ZNF568, FER1L4, ANKRD13B, CD1D, CDKN2A, CHST2, CNNM1, DIO3, DOCK2, DTX1, ELMO1, FERMT3, FLI1, GRIN2D, HUNK, JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEPT9, S An ingestible cell sampling device according to claim 12, comprising assaying 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 of the biomarkers from the group consisting of FMBT2, SLC12A8, TBX15, TSPYL5, ZNF304, and ZNF671.

16. The ingestible cell sampling device according to claim 13, wherein assaying at least one biomarker includes determining the methylation status of a gene.

17. The ingestible cell sampling device according to claim 16, wherein assaying the at least one biomarker includes assaying the methylation status of at least one gene selected from the group consisting of ANKRD13B, CHST2, CNNM1, DOCK2, DTX1, FER1L4, FERMT3, FLI1, GRIN2D, JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEPT9, SFMBT2, SLC12A8, TBX15, TSPYL5, VAV3, ZNF304, ZNF568, and ZNF671.

18. The ingestible cell sampling device according to claim 17, wherein assaying the at least one biomarker includes assaying the methylation status of at least one gene selected from the group consisting of BMP3, NDRG4, VAV3, SFMBT2, DIO3, HUNK, ELMO1, CD1D, CDKN2A, and OPLAH.

19. The ingestible cell sampling device according to claim 17, wherein assaying the at least one biomarker includes assaying the methylation status of at least one gene selected from the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, and FER1L4.

Images