Pangenotypic drugs for respiratory viruses and methods for using them
Pangenotypic compositions targeting the PSL2 structure in viral RNA effectively inhibit influenza A and other respiratory viruses by disrupting their packaging, addressing resistance issues and providing broad-spectrum antiviral efficacy.
Patent Information
- Application Number
- JP2022548912
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-03-20
- Filing Date
- 2021-02-12
- Publication Date
- 2026-05-22
- Estimated Expiration
- 2041-02-12
AI Technical Summary
Current antiviral drugs for influenza A virus (IAV) are limited to specific subtypes and face issues with increasing antiviral resistance, and there is a need for therapies against other respiratory viruses like influenza B virus (IBV), respiratory syncytial virus (RSV), and coronaviruses, including strains causing severe conditions such as SARS, MERS, and the 2019 CoV pandemic.
Development of pangenotypic compositions that target the conserved packaging stem loop 2 (PSL2) structure in the genomic segment PB2 of viral RNA, using oligonucleotides and locked nucleic acids (LNAs) to specifically bind and disrupt this structure, inhibiting IAV, IBV, and coronaviruses.
The compositions effectively inhibit a wide range of influenza A subtypes and other respiratory viruses by targeting a conserved RNA structure, reducing viral packaging efficiency and providing broad-spectrum antiviral activity.
Smart Images

Figure 0007863883000018 
Figure 0007863883000019 
Figure 0007863883000020
Abstract
Description
Technical Field
[0001] Cross-reference This application is a continuation-in-part of U.S. Patent Application No. 16 / 792,103, filed on February 14, 2020, which is a continuation-in-part of U.S. Patent Application No. 16 / 081,818, filed on August 31, 2018, which is the national stage application of PCT / US2017 / 20241, filed on March 1, 2017, and claims the benefit of U.S. Provisional Patent Application No. 62 / 302,548, filed on March 2, 2016. All of these applications are hereby incorporated by reference in their entirety.
[0002] This application also claims the benefit of U.S. Provisional Patent Application No. 62 / 992,659, filed on March 20, 20, which is hereby incorporated by reference in its entirety.
Background Art
[0003] Introduction Influenza A virus (IAV) is a segmented RNA virus that causes significant morbidity and mortality worldwide. All currently approved IAV antiviral drugs are targeted against viral proteins, are limited to subtypes, and have the problem of increasing antiviral resistance against all drug class members.
[0004] The IAV genome consists of eight single-stranded negative-sense viral RNA (vRNA) segments that encode at least 14 known viral proteins. The vRNA forms a complete viral ribonucleoprotein (vRNP) together with a heterotrimeric polymerase complex consisting of the nucleoprotein (NP) and the PB2, PB1, and PA proteins. For complete infection, an IAV virion must incorporate at least one of the vRNPs of each segment. Each vRNP is likely to form a supramolecular complex that is maintained by segmental RNA-RNA and / or protein-RNA interactions that are hypothesized to interact with at least one other partner to induce the packaging process.
[0005] Individuals can be infected with influenza A virus alone and / or other respiratory viruses including, but not limited to, influenza B virus (IBV), coronavirus (Cov), respiratory syncytial virus (RSV), etc. IBV is a segmented RNA virus whose genome consists of eight segments of linear negative-sense single-stranded RNA
[0006] Respiratory syncytial virus (RSV), also known as human respiratory syncytial virus (hRSV), is a negative-sense single-stranded RNA virus. Patients infected with RSV are at high risk of respiratory failure. It is a very common human respiratory virus pathogen.
[0007] Coronavirus (CoV) is an enveloped RNA virus that typically causes self-limiting respiratory infections in humans. However, in the past 20 years, there have been life-threatening conditions caused by new CoV strains such as those found in the 2003 severe acute respiratory syndrome (SARS) pandemic, the 2012 Middle East respiratory syndrome (MERS), and more recently the 2019 CoV pandemic (SARS-CoV-2) that originated from Wuhan, China. New therapies are highly needed to contain the current pandemic and future pandemics. SUMMARY OF THE INVENTION
[0008] Aspects of this disclosure provide pangenotypic compositions designed to disrupt RNA structural elements of respiratory disease-associated viruses, such as IAV, IBV, RSV, and coronaviruses. Aspects of this disclosure provide pangenotypic compositions designed to disrupt an RNA structural element of IAV called packaging stem loop 2 (PSL2) within the 5' packaging signaling region of genomic segment PB2. Disruption of the PSL2 structure dramatically inhibits IAV. PSL2 is conserved across all influenza A subtypes tested.
[0009] A method for inhibiting influenza A virus in a sample is provided. An aspect of this method involves inhibiting influenza A virus by contacting a sample containing viral RNA (vRNA) having a PSL2 motif with an effective amount of a drug that specifically binds to the PSL2 motif. In some cases, the vRNA is isolated from virions or cells. In some cases, the vRNA is present in virions. In some cases, the vRNA is present in infected cells. Methods for treating or preventing influenza A virus infection in a subject are also provided. A method for screening candidate drugs for their ability to inhibit influenza A virus in cells is also provided, and this method involves contacting a sample with a candidate drug and determining whether the candidate drug specifically binds to the PSL2 motif of the vRNA. Compounds and pharmaceutical compositions are also provided, each containing an oligonucleotide sequence complementary to the PB2 vRNA (or its complementary strand) region used in the method of the subject.
[0010] A method for inhibiting influenza B virus in a sample is provided. An aspect of this method involves inhibiting influenza B virus by contacting a sample containing motif-containing viral RNA (vRNA) with an effective amount of a drug that specifically binds to the RNA motif. In some cases, the vRNA is isolated from virions or cells. In some cases, the vRNA is present in virions. In some cases, the vRNA is present in infected cells. Methods for treating or preventing influenza B virus infection in a subject are also provided. A method for screening candidate drugs for their ability to inhibit influenza B virus in cells is also provided, and this method involves contacting a sample with a candidate drug and determining whether the candidate drug specifically binds to the RNA motif of the vRNA. Compounds and pharmaceutical compositions containing oligonucleotide sequences complementary to the IBV vRNA region used in the method of the subject are also provided. [Brief explanation of the drawing]
[0011] Those skilled in the art will understand that the drawings shown below are for illustrative purposes only. The drawings are not intended to limit the scope of this instruction in any way.
[0012] [Figure 1A] Figures 1A to 1F show the RNA secondary structures of wild-type PB2 (SEQ ID NO: 1), packaging mutant vRNA, PB2m757 (SEQ ID NO: 2), m745 (SEQ ID NO: 3), 1918 pandemic (H1N1) (SEQ ID NO: 4), highly pathogenic birds (H5M=N1) (SEQ ID NO: 5), and 2009 pigs (H1N1) (SEQ ID NO: 6). [Figure 1B] Figures 1A to 1F show the RNA secondary structures of wild-type PB2 (SEQ ID NO: 1), packaging mutant vRNA, PB2m757 (SEQ ID NO: 2), m745 (SEQ ID NO: 3), 1918 pandemic (H1N1) (SEQ ID NO: 4), highly pathogenic birds (H5M=N1) (SEQ ID NO: 5), and 2009 pigs (H1N1) (SEQ ID NO: 6). [Figure 1C]Figures 1A to 1F show the RNA secondary structures of wild-type PB2 (SEQ ID NO: 1), packaging mutant vRNA, PB2m757 (SEQ ID NO: 2), m745 (SEQ ID NO: 3), 1918 pandemic (H1N1) (SEQ ID NO: 4), highly pathogenic birds (H5M=N1) (SEQ ID NO: 5), and 2009 pigs (H1N1) (SEQ ID NO: 6). [Figure 1D-1F] Figures 1A to 1F show the RNA secondary structures of wild-type PB2 (SEQ ID NO: 1), packaging mutant vRNA, PB2m757 (SEQ ID NO: 2), m745 (SEQ ID NO: 3), 1918 pandemic (H1N1) (SEQ ID NO: 4), highly pathogenic birds (H5M=N1) (SEQ ID NO: 5), and 2009 pigs (H1N1) (SEQ ID NO: 6). [Figure 1G] This shows the predicted RNA secondary structure that is conserved across coronavirus B viruses. [Figure 2] Panels A and B show the reactivity of full-length PB2 vRNA. [Figure 3A] Figures 3A to 3E show the breakdown of wild-type reactivity (SEQ ID NO: 7), PB2m744b (SEQ ID NO: 8), PB2m745 (SEQ ID NO: 9), PB2m55c (SEQ ID NO: 10), and PB2m757 (SEQ ID NO: 11) due to packaging deficiency mutations. [Figure 3B] Figures 3A to 3E show the breakdown of wild-type reactivity (SEQ ID NO: 7), PB2m744b (SEQ ID NO: 8), PB2m745 (SEQ ID NO: 9), PB2m55c (SEQ ID NO: 10), and PB2m757 (SEQ ID NO: 11) due to packaging deficiency mutations. [Figure 3C] Figures 3A to 3E show the breakdown of wild-type reactivity (SEQ ID NO: 7), PB2m744b (SEQ ID NO: 8), PB2m745 (SEQ ID NO: 9), PB2m55c (SEQ ID NO: 10), and PB2m757 (SEQ ID NO: 11) due to packaging deficiency mutations. [Figure 3D] Figures 3A to 3E show the breakdown of wild-type reactivity (SEQ ID NO: 7), PB2m744b (SEQ ID NO: 8), PB2m745 (SEQ ID NO: 9), PB2m55c (SEQ ID NO: 10), and PB2m757 (SEQ ID NO: 11) due to packaging deficiency mutations. [Figure 3E]Figures 3A to 3E show the breakdown of wild-type reactivity (SEQ ID NO: 7), PB2m744b (SEQ ID NO: 8), PB2m745 (SEQ ID NO: 9), PB2m55c (SEQ ID NO: 10), and PB2m757 (SEQ ID NO: 11) due to packaging deficiency mutations. [Figure 4] This demonstrates the conservation of nucleotide sequences containing the PSL2 structure. [Figure 5A] Figures 5A to 5D show two-dimensional mutations and map analysis of the PSL2 RNA secondary structure (Figure 5C, Sequence ID No. 12). [Figure 5B] Figures 5A to 5D show two-dimensional mutations and map analysis of the PSL2 RNA secondary structure (Figure 5C, Sequence ID No. 12). [Figure 5C] Figures 5A to 5D show two-dimensional mutations and map analysis of the PSL2 RNA secondary structure (Figure 5C, Sequence ID No. 12). [Figure 5D] Figures 5A to 5D show two-dimensional mutations and map analysis of the PSL2 RNA secondary structure (Figure 5C, Sequence ID No. 12). [Figure 6] Panels A and B show the design of compensatory mutations for the aforementioned PR8 PB2 mutant (Panel A, Sequence ID No. 13). [Figure 7] Panels A-D show synonymous variations of a single, highly conserved codon in PR8 PB2 vRNA (Panel A, SEQ ID NOs. 14-15; Panel B, SEQ ID NOs. 16-23, from top to bottom). [Figure 8] A table is provided showing the names of the PB2 packaging variants and the corresponding mutation sites. [Figure 9A] Figures 9A to 9C show the effects of synonymous mutations on the PSL2 structure, PB2m731 (sequence number 24), PB2m751 (sequence number 25), and PB2m748 (sequence number 26). [Figure 9B] Figures 9A to 9C show the effects of synonymous mutations on the PSL2 structure, PB2m731 (sequence number 24), PB2m751 (sequence number 25), and PB2m748 (sequence number 26). [Figure 9C]Figures 9A to 9C show the effects of synonymous mutations on the PSL2 structure, PB2m731 (sequence number 24), PB2m751 (sequence number 25), and PB2m748 (sequence number 26). [Figure 10] Panels A-I show the effects of compensatory mutations in PR8 PB2 packaging-deficient mutants on viral packaging and titer. [Figure 11] Panels A-D show multidimensional chemical mapping of PB2 packaging defects and compensatory mutant partners (Panel B, SEQ ID NO: 27). [Figure 12] Panels a-t show two-dimensional variant map rescue analysis. [Figure 13] The primer sequence design for the two-dimensional mutant map rescue mutant is shown. The sequences, from top to bottom, correspond to sequence numbers 28-43. [Figure 14] Panels A and B show that packaging-deficient viruses are attenuated in vivo. [Figure 15] Panels A-D demonstrate the antiviral activity of lock nucleic acids targeting the PSL2 RNA structure (Panel A, Sequence ID No. 44). [Figure 16A] Figures 16A and 16B show the analysis of LNA-RNA binding. [Figure 16B] Figures 16A and 16B show the analysis of LNA-RNA binding. [Figure 17] Panels A and B show the survival percentage and weight loss percentage of mice over time after a single intranasal administration of the exemplary compound LNA9. [Figure 18] Panels A-D show the susceptibility of influenza virus to oseltamivir after continuous passage under drug pressure. [Figure 19] Panels A-C show the susceptibility of influenza viruses to exemplary compound LNA9, including viruses after continuous passage under drug pressure and drug-resistant viruses. [Figure 20]Antiviral effects of miRNA-targeted LNA designed to disrupt respiratory viral infections. Huh7 cells were pretreated with 25 nM miRNA-targeted LNA 12–24 hours prior to infection with a 0.3 MOI fully replicating BSL3 SARS-CoV-2-nLuc reporter virus. Luciferase signals were read 48 hours after infection. Results are shown as log10 luciferase signals. Samples were doubled, N=2, and controls were quadrupled, N=4. Statistical analysis was performed using GraphPad Prism software and calculated using standard one-way ANOVA with Dunnett's multiple comparison test between sample and scrambled LNA (Scr.LNA) control means. A positive control nucleoside analog, EIDD-2801 (EIDD), was included as a positive control. [Figure 21] Huh7 cells were pretreated with a combination of 25 nM LNAs (12.5 nM each LNA = 25 nM total) 12–24 hours prior to infection with a 0.3 MOI fully replicating BSL3 SARS-CoV-2-nLuc reporter virus. Luciferase signals were read 48 hours after infection. Results are shown as log10 luciferase signals. Samples were performed in double, N=2, and controls in quadruple, N=4. Statistical analysis was performed using GraphPad Prism software and calculated using standard one-way ANOVA with Dunnett's multiple comparison test between sample and DMSO control means. A positive control, the positive control nucleoside analog EIDD-2801 (EIDD), was included. [Figure 22] In vivo efficacy of LNA combinations against respiratory viruses. Human ACE2 transgenic mice were treated with a single intranasal administration of a vehicle, low molecular weight A, or LNA combination 5 days prior to infection with lethal SARS-CoV-2 inoculation. After infection, animals were monitored daily using a clinical score, where 1 = asymptomatic and higher scores indicated worsening clinical condition. [Figure 23]ACE2-A549 cells were pretreated with either 50 nM, 25 nM, or 5 nM CoV-2 positive-strand targeted LNA, CoV-2 negative-strand targeted LNA, or miRNA-directed LNA 12–24 hours prior to infection with a 0.3 MOI fully replicated BSL3 SARS-CoV-2-nLuc reporter virus. Luciferase signals were read 48 hours after infection. Results are shown as log10 luciferase signals. Samples were run on 6 replicates, N=6. Statistical analysis was performed using GraphPad Prism software, and calculated using standard one-way ANOVA with Dunnett's multiple comparison test between the sample and the scrambled LNA (Scr.LNA) control mean. A positive control nucleoside analog, EIDD-2801 (EIDD), was included as a positive control. [Figure 24](a-b) Effect of intranasal LNA prophylactic treatment on the survival of virus-infected mice. Kaplan-Meier survival plot. Mice (n=7 mice / group) were intranasally administered a single dose of LNA9, scrambled LNA, or vehicle (simulated treatment), followed by lethal inoculation with wild-type PR8 virus. (a) 20 μg of LNA was administered 3 days (-3 days) or 1 day (-1 day) before infection, and (b) 1 week prior to treatment with a single dose of 30 μg of LNA9 or vehicle control. (c) Target sites of LNA9 and newly designed LNA14 mapped to the PSL2 structure. (d) Electrophoretic profiles of SHAPE analysis performed on untreated, scrambled LNA, LNA9, and LNA14 at a concentration of 100 nM in the presence of PR8 PB2 vRNA. Labeling with 1M7 SHAPE reagent is shown. (e) Kaplan-Meier survival plots of mice (n=7 mice / group) pre-treated intranasally with a single dose of 30 μg LNA14 or vehicle control one week prior to lethal PR8 infection (-7 days). (f-h) A single dose of 40 μg LNA14 or vehicle was administered intranasally two weeks prior to PR8 virus infection (-14 days). (f) Kaplan-Meier survival plots. (g) Percentage of mouse body weight relative to day 0. (h) Clinical score. (i-l) Mice (n=7) were administered a single intranasal dose of 40 μg LNA14 one week prior to primary lethal PR8 virus infection (e) with 1 LD100. 65 days after the initial infection, surviving mice from (e) were second-loaded with 10 LD100 along with age-matched naive controls (n=7 / group). (i) Loading study timeline. (j) Percentage of mouse body weight relative to day 0. (k) Clinical score. (l) Kaplan-Meier survival curve. (m) Mice (n=10 / group) were infected with a lethal dose of PR8 wild-type virus. Three days after infection, mice were administered a single dose of 40 μg of LNA14, LNA9, scrambled LNA, or vehicle control by intravenous injection. Kaplan-Meier survival plot. [Modes for carrying out the invention]
[0013] definition Before describing exemplary embodiments in more detail, the following definitions are provided to illustrate and define the meaning and scope of terms used in this description.
[0014] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale & Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide the general meanings of many terms used herein. Nevertheless, for clarity and ease of reference, certain terms are defined below.
[0015] It should be noted that, as used herein and in the appended claims, the singular forms “a,” “an,” and “the” refer to multiple subjects unless the context explicitly indicates otherwise. For example, the term “primer” refers to one or more primers, i.e., a single primer and multiple primers. It should be further noted that the claims may be drafted to exclude any optional element. Thus, this statement is intended to function as an antecedent for the use of exclusive terms such as “solely” and “only,” or for the use of “negative” restrictions, in relation to the enumeration of elements of the claims.
[0016] As used herein, the term “effective dose” refers to the amount of a substance (e.g., the drug of interest) that produces several desired topical or systemic effects. The effective dose of the active ingredient of interest varies depending on a variety of factors, including but not limited to the subject’s weight and age, the condition being treated, the severity of the condition, and the method of administration, and can be readily determined, or empirically determined, for example, using data such as the data provided in the experimental section below.
[0017] As used herein, the term "sample" typically, but not necessarily, relates to a fluid, i.e., an aqueous form, of a material or mixture of materials containing components for one or more purposes. A sample can be derived from a variety of sources such as a biological sample isolated from an individual or a solid or fluid such as tissue, and includes, for example, plasma, serum, cerebrospinal fluid, semen, lymph, an external section of skin, respiratory, intestinal, and urinary organs, tears, saliva, milk, blood cells, tumors, organs, and also samples of in vitro cell culture components (including, but not limited to, conditioned media resulting from the growth of cells in cell culture media, cells suspected of being infected with a virus, recombinant cells, and cell components). Components in a sample are referred to herein as "analytes". In many embodiments, the sample is a complex sample containing at least about 10 2 、5x10 2 、10 3 、5x10 3 、10 4 、5x10 4 、10 5 、5x10 5 、10 6 、5x10 6 、10 7 、5x10 7 、10 8 、10 9 、10 10 、10 11 、10 12 or more species of analytes.
[0018] Antibody fragments include portions of an intact antibody, such as the antigen-binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments, diabodies, linear antibodies (Zapata et al., Protein Eng. 8(10):1057-1062 (1995)), single-chain antibody molecules, nanobodies, and multispecific and multifunctional antibodies formed from antibody fragments. Papain digestion of antibodies produces two identical antigen-binding fragments, each having a single antigen-binding site, called "Fab" fragments, and the remaining "Fc" fragments, a name reflecting their ability to readily crystallize. Pepsin treatment produces an F(ab')2 fragment, which has two antigen-binding sites and can still crosslink to an antigen.
[0019] In this specification, the terms “polypeptide” and “protein” as used interchangeably refer to polymeric forms of amino acids of any length and may include coded and uncoded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having a modified peptide backbone. The term “fusion protein” or its grammatical equivalent means a protein consisting of multiple polypeptide components that are typically not joined in their native state but are typically joined by bonds, e.g., peptide bonds, at their respective amino and carboxyl ends, to form a single continuous polypeptide. A fusion protein may be a combination of two, three, or even four or more different proteins. The term polypeptide includes, but is not limited to, fusion proteins having heterologous amino acid sequences, fusions having heterologous and homologous leader sequences with or without an N-terminal methionine residue, immunotagged proteins, and fusion proteins having detectable fusion partners, e.g., fusion proteins containing fluorescent proteins, β-galactosidase, luciferase, etc., as fusion partners. In addition, the term "protein" may further encompass post-translational modifications, including but not limited to glycosylation, phosphorylation, methylation, and acetylation.
[0020] Generally, polypeptides can be of any length, for example, greater than 2 amino acids, greater than 4 amino acids, greater than about 10 amino acids, greater than about 20 amino acids, greater than about 50 amino acids, greater than about 100 amino acids, greater than about 300 amino acids, and typically up to about 500 or 1000 or more amino acids. "Peptides" are generally greater than 2 amino acids, greater than 4 amino acids, greater than about 10 amino acids, greater than about 20 amino acids, and typically up to about 50 amino acids. In some embodiments, peptides are 5 to 30 amino acid long.
[0021] The term "specific binding" refers to the ability of a drug to preferentially bind to a specific target (e.g., PSL2) present in a homogeneous mixture of various analytes. In some cases, specific binding interactions typically differentiate between desired and undesirable analytes in a sample by approximately 10 to 100 times or more (e.g., approximately 1000 times or more). Specific binding can include hybridization, polypeptide-nucleic acid interactions, or small molecule-nucleic acid interactions.
[0022] "Oligonucleotides" refer to ribose and / or deoxyribose nucleoside subunit polymers having approximately 2 to approximately 200 consecutive subunits. Nucleoside subunits can be joined by various intersubunit bonds, including but not limited to phosphodiesters, phosphotriesters, alkylphosphonates, e.g., methylphosphonates, P3'→N5' phosphoramidates, N3'→P5' phosphoramidates, N3'→P5' thiophosphoramidates, phosphorodiamidites, and phosphorothioate bonds. In certain cases, the intersubunit bonds have chiral atoms. Typical chiral intersubunit bonds include, but are not limited to, alkylphosphonates, phosphorodiamidites, and phosphorothioates. Furthermore, "oligonucleotides" include modifications known to those skilled in the art, e.g., sugars (e.g., 2' substitutions), bases (see the definition of "nucleoside" below), and / or chemical and biochemical modifications to the 3' and 5' ends. In embodiments in which the oligonucleotide portion includes multiple inter-subunit bonds, each bond may be formed using the same chemical or a mixture of the binding chemicals. In embodiments in which the oligonucleotide portion includes multiple inter-subunit bonds, one or more of the bonds may be chiral. Bonds having chiral atoms may be prepared as a racemic mixture or as separate enantiomers. The terms “oligonucleotide,” “nucleic acid,” “nucleic acid molecule,” “nucleic acid fragment,” “nucleic acid sequence or segment,” or “polynucleotide” are used interchangeably and may be used interchangeably with genes, cDNA, DNA, and RNA encoded by genes.
[0023] "Bicyclic nucleic acid" or "crosslinked nucleic acid" (BNA) refers to a modified RNA nucleotide in which the ribose moiety is modified with an extra crosslink connecting the 2' oxygen and 4' carbon atoms, thereby forming a bicyclic ring system. BNA monomers may contain 5-membered, 6-membered, or 7-membered crosslinked structures with a fixed 3' end structure. Crosslinked nucleic acids include, but are not limited to, locked nucleic acid (LNA), ethylene crosslinked nucleic acid (ENA), and restricted ethyl (cEt). "Crosslink" refers to a chain of atoms or valence bond connecting two crosslinking heads, and "crosslinking head" is any skeletal atom of a ring system (e.g., a ribose ring system) bonded to three or more skeletal atoms (excluding hydrogen). In some embodiments, the crosslink in BNA has 7 to 12 ring members and 1 to 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Unless otherwise specified, BNA is optionally substituted with one or more substituents, including, but not limited to, alkyl, substituted alkyl, alkoxy, substituted alkoxy, hydroxy, amino, and halogen.
[0024] Locked nucleic acids (LNAs) are modified RNA nucleotides in which the ribose portion is modified with an extra crosslink connecting the 2' oxygen and 4' carbon atoms, thereby forming a bicyclic ring system. The crosslink often "locks" the ribose at the 3' end structure found in type A double helix. Locked nucleic acids are also encompassed by the terms "bicyclic nucleic acids" or "crosslinked nucleic acids" (BNAs). LNA nucleotides can be mixed with any convenient nucleotide or nucleotide analog, such as DNA or RNA residues in oligonucleotides, if desired. LNAs hybridize with DNA or RNA according to the Watson-Crick base pairing rules. Such oligomers can be chemically synthesized. Generally, the locked ribose conformation enhances base stacking and backbone pre-organization, increasing the hybridization properties (melting temperature) of oligonucleotides. In some cases, the lock nucleic acid may be α-l-lock nucleic acid (α-l-LNA), which is a stereoisomer analog of lock nucleic acid (LNA) in inversion stereochemistry at the C2', C3', and C4' positions.
[0025] Ethylene-crosslinked nucleic acids (ENAs) refer to LNA-modified RNA nucleotides in which the ribose moiety is modified with an extra crosslink containing two carbon atoms between the 2' oxygen and 4' carbon atoms (see, for example, Morita et al., Bioorganic Medicinal Chemistry, 2003, 11(10), 2211-2226). Ethylene-crosslinked nucleic acids are also encompassed by the terms "bicyclic nucleic acids" or "crosslinked nucleic acids" (BNAs).
[0026] "Restricted ethyl (cEt)" refers to LNA-modified RNA nucleotides in which the ribose moiety is modified by an extra crosslink connecting the 2' oxygen and 4' carbon atoms, with the crosslink carbon atoms containing methyl groups. In some cases, cEt is (S) restricted ethyl. In other cases, cEt is (R) restricted ethyl (see, for example, Pallan et al., Chem. Commun. (Camb)., 2012, 48(66), 8195-8197). Restricted ethyl nucleic acids are also encompassed by the terms "bicyclic nucleic acid" or "crosslinked nucleic acid" (BNA).
[0027] As used herein, the terms “2' modified” or “2' substituted” mean a sugar containing a substituent at the 2' position other than H or OH. A 2' modified nucleotide comprises a moiety having a 2' substituent selected from alkyl, allyl, amino, azide, fluoro, thio, O-alkyl, e.g., O-methyl, O-allyl, OCF3, O-(CH2)2-O-CH3 (e.g., 2'-O-methoxyethyl (MOE)), O-(CH2)2SCH3,)-(CH2)2-ONR2, and O-CH2C(O)-NR2, where each R is independently selected from H, alkyl, and substituted alkyl.
[0028] This disclosure encompasses isolated or substantially purified nucleic acid molecules and compositions containing such molecules. In the context of this disclosure, an “isolated” or “purified” DNA or RNA molecule is a DNA or RNA molecule that exists away from its natural environment and is therefore not a product of nature. An isolated DNA or RNA molecule may exist in a purified form or in a non-natural environment, such as a transgenic host cell. For example, an “isolated” or “purified” nucleic acid molecule or its biologically active portion, if produced by recombinant techniques, substantially contains no other cell material or culture medium, or if chemically synthesized, substantially contains no chemical precursors or other chemicals. In one embodiment, an “isolated” nucleic acid does not contain sequences that are naturally adjacent to the nucleic acid in the genomic DNA of the organism from which the nucleic acid originates (i.e., sequences located at the 5' and 3' ends of the nucleic acid). For example, in various embodiments, an isolated nucleic acid molecule may contain nucleotide sequences of less than 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb that are naturally adjacent to the nucleic acid molecule in the genomic DNA of the cell from which the nucleic acid originates. Fragments and variants of the disclosed nucleotide sequences are also encompassed by this disclosure. "Fragment" or "part" means the full length or less than the full length of the nucleotide sequence. The siRNAs of this disclosure can be produced by any method known in the art, e.g., in vitro transcription, recombination, or synthesis. In one example, siRNA can be produced in vitro by using a recombinant enzyme such as T7 RNA polymerase and a DNA oligonucleotide template.
[0029] A "small interference" or "short interference RNA" or siRNA is an RNA double helix of nucleotides targeted to a target gene. An "RNA double helix" refers to a structure formed by complementary pairing between two regions of an RNA molecule. siRNA is "targeted" to a gene, and the nucleotide sequence of the siRNA double helix is complementary to the nucleotide sequence of the targeted gene. In some embodiments, the length of the siRNA double helix is less than 30 nucleotides. In some embodiments, the double helix may be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides long. In some embodiments, the length of the double helix is 19–25 nucleotides long. The RNA double helix portion of siRNA may be part of a hairpin structure. In addition to the double helix portion, the hairpin structure may include a loop portion located between the two sequences forming the double helix. The length of the loop may vary. In some embodiments, the loop is 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides long. The hairpin structure may also contain a 3' or 5' overhang portion. In some embodiments, the overhang is a 3' or 5' overhang of 0, 1, 2, 3, 4, or 5 nucleotides long.
[0030] The term “lipid” is used herein to broadly encompass substances that are soluble in organic solvents but are soluble in water, if not soluble, and are mostly soluble. The term lipid includes, but is not limited to, hydrocarbons, oils, fats (fatty acids, glycerides, etc.), sterols, steroids, and derivative forms of these compounds. Preferred lipids are fatty acids and their derivatives, hydrocarbons and their derivatives, and sterols such as cholesterol. As used herein, the term lipid also includes amphiphilic compounds containing both lipid and hydrophilic moieties. Fatty acids typically contain an even number of carbon atoms in a linear chain (generally 12 to 24 carbons), can be saturated or unsaturated, and may contain or be modified to contain various substituents. For brevity, the term “fatty acid” also includes fatty acid derivatives, such as fatty acid amides, produced by conjugation reactions with modified ends of oligonucleotides, for example.
[0031] Other definitions of terms may appear throughout this specification.
[0032] Detailed explanation Before describing the various embodiments, it should be understood that the teachings of this disclosure are not limited to the specific embodiments described and are, of course, subject to change. Furthermore, since the scope of these teachings is limited only by the appended claims, it should be understood that the terms used herein are solely for the purpose of describing specific embodiments and are not intended to be limiting.
[0033] Section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described in any way. While these instructions are described in conjunction with various embodiments, they are not intended to be limited to such embodiments. Conversely, these instructions include various substitutes, modifications, and equivalents, as will be understood by those skilled in the art.
[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which this disclosure belongs. Any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of this teaching, but some exemplary methods and materials are described herein.
[0035] Any citation of a publication is for disclosure prior to the filing date, and the claims should not be construed as acknowledging that such publication has no prior rights on the grounds of prior invention. Furthermore, the dates of the publications provided may differ from the actual publication dates that can be independently verified.
[0036] As will be apparent to those skilled in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has distinct components and features that can be readily separated from or combined with any of the other various embodiments without departing from the scope or spirit of this teaching. Any described method may be carried out in the order of the described events or in any other logically possible order.
[0037] All patents and publications referenced herein, including all sequences disclosed within such patents and publications, are expressly incorporated by reference.
[0038] Methods for regulating host microRNAs Host microRNAs can regulate a wide variety of physiological processes. In some cases, host microRNAs can regulate the compatibility of coronaviruses, including influenza A, B, SARS, SARS-CoV-2, MERS, and other respiratory viruses. In some cases, the miRNA is microRNA 191 (miR191). In some cases, the miRNAs are, among others, miR-602, miR-6759, miR-6769, miR-4802, miR-942, miR-4462, miR-4696, miR-376c, miR-4433, miR-663, miR-10396, miR-4749, miR-6787, miR-4706, miR-3675, miR-6810, mi The miRNA may be one of the following: R-6812, miR-663a, miR-381, miR-744, miR-4508, miR-4730, miR-6777, miR-10396, miR-4749, miR-6787, miR-4706, miR-3675, miR-6810, miR-3675, miR-6812, or miR-6796. In some cases, the miRNA may directly bind to influenza A virus RNA in virions or infected cells. In some cases, the miRNA may directly bind to influenza B virus RNA in virions or infected cells. In some cases, the miRNA may directly bind to coronavirus virus RNA, including SARS-CoV, SARS-CoV2, and MERS, in virions or infected cells. In some cases, miRNAs may directly bind to respiratory syncytial virus (RSV) RNA in virions or infected cells. In some cases, miRNAs may modulate host cell processes that otherwise regulate the levels of influenza A virus RNA in virions or infected cells. In some cases, miRNAs may modulate host cell processes that otherwise regulate the levels of influenza A virus RNA in virions or infected cells. In some cases, miRNAs may modulate host cell processes that otherwise regulate the levels of influenza B virus RNA in virions or infected cells.In some cases, miRNAs can modulate host cell processes that otherwise regulate levels of coronavirus virus RNA, including SARS-CoV, SARS-CoV2, and MERS virus RNA, in virions or infected cells. In some cases, miRNAs can modulate host cell processes that otherwise regulate levels of respiratory syncytial virus (RSV) RNA in virions or infected cells. In some cases, the conserved RNA secondary structure includes the presence of a miR191 binding site. In some cases, the drug or composition of the subject is designed to sequester miR191 in cells transfected with CoV.
[0039] Methods to inhibit influenza A virus As summarized above, aspects of this disclosure include pangenotypic compositions designed to disrupt an RNA structural element of IAV called the packaging stem loop 2 (PSL2) within the 5' packaging signal region of the genomic segment PB2. "Pangenotypic" means that the composition is effective across various different types of IAV in which the PSL2 structural element is conserved. In some cases, the compositions of the subject may be referred to as broad-spectrum. As used herein, the term "broad-spectrum" refers to the antiviral activity of a single portion that is active against two or more different viruses, such as three or more, four or more, five or more, six or more, eight or more, or ten or more different viruses. The two or more different viruses may be selected from different viral subgroups (e.g., influenza A group 1 or influenza A group 2) or from within the same group (e.g., two or more of H1, H2, H5, H6, H8 and H9 group 1 influenza A viruses, or two or more of H3, H4, H7 and H10 group 2 influenza A viruses).
[0040] Disintegration of the PSL2 structure dramatically inhibits IAV. PSL2 is conserved across all influenza A subtypes tested. Figure 1, panel a, shows an example of a targetable PSL2 structure in the method of the subject. Figure 4 shows the conservation of the target nucleotide sequence containing the PSL2 structure. In some cases, the composition of the subject has broad-spectrum activity against IAV, such as activity against two or more IAV selected from H1N1, H3N2, and H5N.
[0041] Aspects of this disclosure include methods for inhibiting influenza A virus (IAV) in a sample. In some embodiments, the method includes inhibiting influenza A virus by contacting a sample containing viral RNA (vRNA) having a PSL2 motif with an effective amount of a drug that specifically binds to the PSL2 motif. In some cases, the sample is in vitro. In certain cases, the sample is in vivo. The vRNA in the sample may be contained in virions. In some cases, the vRNA is contained in cells, such as cells infected with viral particles.
[0042] Aspects of this disclosure include methods for inhibiting influenza A virus (IAV) in cells. In some embodiments, the method includes inhibiting influenza A virus by contacting cells containing viral RNA (vRNA) having a PSL2 motif with an effective amount of a drug that specifically binds to the PSL2 motif. In some cases, the cells are in vitro. In certain cases, the cells are in vivo.
[0043] In some embodiments, the vRNA in a sample (e.g., cells) includes PB2 vRNA. As used herein, “PB2 vRNA” means viral RNA (e.g., IAV RNA) that contains a conserved RNA structural element called packaging stem-loop 2 (PSL2). Drugs can bind to specific sites on the PSL2 motif, disrupting the overall structure of the vRNA and thereby inhibiting the virus (see, for example, Figure 14). In some cases, drugs inhibit the packaging ability of the vRNA and thereby inhibit the virus. For example, Figure 1 shows the RNA secondary structures of wild-type PB2 and packaging mutant vRNA.
[0044] In some embodiments, by contacting a sample (e.g., cells) with a drug, the virus levels are reduced to 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, and 10 log. 10 Or even more significant loss of titer, such as a 1-log of the virus. 10 The above-mentioned loss of potency results.
[0045] In some embodiments, by contacting a sample (e.g., cells) with the drug, the virus levels are increased to 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, and 10 log. 10 Or even more significant loss of titer, such as a 2-log of the virus. 10 The above-mentioned loss of titer is achieved. In some embodiments, the drug is an oligonucleotide compound (e.g., as described herein) or a salt thereof, which contains a sequence complementary to the PSL2 motif of the vRNA.
[0046] In some cases of this method, binding of an oligonucleotide compound (e.g., one of the sequences described above) to the PB2 vRNA region (e.g., via hybridization) disrupts the overall secondary RNA structure of the PB2 vRNA. In some cases, binding of the oligonucleotide compound inhibits the packaging ability of the PB2 vRNA, thereby inhibiting the virus. In some cases, the compound of subject targets at least a portion of the region defined by nucleotides 34-87 in the (-) sense notation of the 5' coding region of the PB2 vRNA. In some cases, the compound targets at least a portion of the region defined by nucleotides 1-14 in the (-) sense notation of the 5' coding region of the PB2 vRNA. In some cases of this method, the method further includes recruiting an RNase to PSL2 to degrade the vRNA.
[0047] Aspects of this disclosure include methods for treating or preventing influenza A virus infection in subjects. In some embodiments, the method includes administering to a subject in need of administration a pharmaceutical composition comprising an effective amount of an activator that binds to the PSL2 motif of viral RNA (vRNA) (for example, as described herein). Thus, in some cases, the subject is a subject infected with the virus. In certain cases, the subject is a subject at risk of or suspected of being infected with the virus. In some embodiments, the vRNA is PB2 vRNA.
[0048] Any convenient protocol for administering the drug to the target may be used. The specific protocol used may vary, for example, depending on the administration site and whether the drug is, for example, an oligonucleotide, antibody, protein, peptide, or small molecule. For in vivo protocols, any convenient administration protocol may be used. Various protocols may be used depending on the identity and binding affinity of the drug, the desired response, the mode of administration, e.g., topical or systemic, intraocular, periocular, retrobulbar, intramuscular, intravenous, intraperitoneal, subcutaneous, subconjunctival, intranasal, topical, eye drops, IVSC, IP, oral, etc., half-life, cell number, or size of the graft bed or graft tissue. In some cases, cells are administered intranasally. In some cases, the drug is administered as an aerosol. In certain cases, the drug is administered by nebulizer. In certain cases, the drug is administered with the assistance of respiratory support devices, including but not limited to non-invasive positive pressure ventilation or mechanical ventilation. In certain cases, the drug is administered intravenously. In certain other cases, the drug is administered subcutaneously. In certain other cases, the drug is administered by intramuscular injection.
[0049] Pharmaceutical compositions containing the subject drug are also provided. Any convenient excipients, carriers, etc., can be used in the composition. Examples of pharmaceutically acceptable carriers used in the composition include non-aqueous sterile aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Water-soluble carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including physiological saline and buffering media. Parenteral vehicles include sodium chloride solutions, Ringer's dextrose, dextrose and sodium chloride, Ringer's lactate, or fixative oils. Intravenous vehicles include fluid and nutritional supplements, electrolyte supplements (such as those based on Ringer's dextrose), etc. Preservatives and other additives such as antimicrobial agents, antioxidants, chelating agents, and inert gases may also be present. Pharmaceutical compositions may also be lyophilized for subsequent reconstitution and use. Compositions may include carriers as described herein. Examples of carriers that may be used include, but are not limited to, alum, microparticles, liposomes, and nanoparticles. Any suitable additives may be included in the composition of the subject to enhance the delivery of the subject's activator. Potential additives include cell uptake enhancers, carrier proteins, lipids, dendrimer carriers, and carbohydrates.
[0050] In some cases, the pharmaceutical composition further comprises one or more additional activators. The activators of interest include additional oligonucleotide compounds of the Disclosure, and any favorable antiviral compounds or drugs of interest, including but not limited to amantadine, rimantadine, zanamivir, oseltamivir, and peramivir.
[0051] Methods for inhibiting influenza B virus Aspects of this disclosure include pangenotypic compositions designed to disrupt RNA structural elements of IBV, which may include regions of the genomic segment HA.
[0052] Aspects of this disclosure include methods for inhibiting influenza B virus (IBV) in a sample. In some embodiments, the method includes inhibiting influenza B virus by contacting a sample containing viral RNA (vRNA) having an IBV RNA motif with an effective amount of a drug that specifically binds to the IBV HA motif. In some cases, the sample is in vitro. In certain cases, the sample is in vivo. The vRNA in the sample may be contained in virions. In some cases, the vRNA is contained in cells, such as cells infected with viral particles.
[0053] Aspects of this disclosure include methods for inhibiting influenza B virus (IBV) in cells. In some embodiments, the method includes inhibiting influenza B virus by contacting cells containing viral RNA (vRNA) having an IBV RNA motif with an effective amount of a drug that specifically binds to the IBV RNA motif. In some cases, the cells are in vitro. In certain cases, the cells are in vivo.
[0054] In some embodiments, by contacting a sample (e.g., cells) with a drug, the virus levels are reduced to 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, and 10 log. 10 Or even more significant loss of titer, such as a 1-log of the virus. 10 The above-mentioned loss of potency results.
[0055] In some embodiments, by contacting a sample (e.g., cells) with the drug, the virus levels are increased to 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, and 10 log. 10 Or even more significant loss of titer, such as a 2-log of the virus. 10 The above-mentioned loss of titer is achieved. In some embodiments, the drug is an oligonucleotide compound (as described herein, for example) or a salt thereof, which contains a sequence complementary to the IBV RNA motif of the vRNA.
[0056] In some cases of this method, binding of an oligonucleotide compound (e.g., one of the sequences described above) to the IBV vRNA region (e.g., via hybridization) disrupts the overall secondary RNA structure of the IBV vRNA. In some cases, binding of the oligonucleotide compound inhibits the packaging ability of the HA vRNA, thereby inhibiting the virus. In some cases of this method, the method further includes recruiting an RNase to the IBV vRNA to degrade the vRNA.
[0057] Aspects of this disclosure include methods for treating or preventing influenza B virus infection in subjects. In some embodiments, the method includes administering to a subject in need of administration a pharmaceutical composition comprising an effective amount of an activator that binds to the IBV HA RNA motif of viral RNA. Thus, in some cases, the subject is a subject infected with the virus. In certain cases, the subject is a subject at risk of or suspected of being infected with the virus.
[0058] Any convenient protocol for administering the drug to the target may be used. The specific protocol used may vary, for example, depending on the administration site and whether the drug is, for example, an oligonucleotide, antibody, protein, peptide, or small molecule. For in vivo protocols, any convenient administration protocol may be used. Various protocols may be used depending on the identity and binding affinity of the drug, the desired response, the mode of administration, e.g., topical or systemic, intraocular, periocular, retrobulbar, intramuscular, intravenous, intraperitoneal, subcutaneous, subconjunctival, intranasal, topical, eye drops, IVSC, IP, oral, etc., half-life, cell number, or size of the graft bed or graft tissue. In some cases, cells are administered intranasally. In some cases, the drug is administered as an aerosol. In certain cases, the drug is administered by nebulizer. In certain cases, the drug is administered with the assistance of respiratory support devices, including but not limited to non-invasive positive pressure ventilation or mechanical ventilation. In certain cases, the drug is administered intravenously. In certain other cases, the drug is administered subcutaneously. In certain other cases, the drug is administered by intramuscular injection.
[0059] Pharmaceutical compositions containing the subject drug are also provided. Any convenient excipients, carriers, etc., can be used in the composition. Examples of pharmaceutically acceptable carriers used in the composition include non-aqueous sterile aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Water-soluble carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including physiological saline and buffering media. Parenteral vehicles include sodium chloride solutions, Ringer's dextrose, dextrose and sodium chloride, Ringer's lactate, or fixative oils. Intravenous vehicles include fluid and nutritional supplements, electrolyte supplements (such as those based on Ringer's dextrose), etc. Preservatives and other additives such as antimicrobial agents, antioxidants, chelating agents, and inert gases may also be present. Pharmaceutical compositions may also be lyophilized for subsequent reconstitution and use. Compositions may include carriers as described herein. Examples of carriers that may be used include, but are not limited to, alum, microparticles, liposomes, and nanoparticles. Any suitable additives may be included in the composition of the subject to enhance the delivery of the subject's activator. Potential additives include cell uptake enhancers, carrier proteins, lipids, dendrimer carriers, and carbohydrates.
[0060] In some cases, the pharmaceutical composition further comprises one or more additional activators. The activators of interest include additional oligonucleotide compounds of the Disclosure, and any favorable antiviral compounds or drugs of interest, including but not limited to amantadine, rimantadine, zanamivir, oseltamivir, and peramivir.
[0061] Methods to inhibit respiratory syncytial virus (RSV) As summarized above, aspects of this disclosure include agents and compositions designed to disrupt the RNA secondary structure of RSV. Disruption of the RNA secondary structure of RSV can inhibit the RSV virus.
[0062] Methods to inhibit coronavirus (CoV) As summarized above, aspects of this disclosure include agents and compositions designed to disrupt the RNA secondary structure of coronaviruses (CoV). Disruption of the RNA secondary structure of CoV can inhibit the CoV virus. The agents and compositions are effective across various different types of coronaviruses (CoV), and the RNA secondary structure is important in the viral life cycle. In some cases, the compositions of the subject may be referred to as broad-spectrum. As used herein, the term “broad-spectrum” refers to the antiviral activity of a single part that is active against two or more different viruses, such as three or more, four or more, five or more, six or more, eight or more, or ten or more different viruses. Two or more different viruses may be selected from different viral subgroups (e.g., human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), SARS-CoV (pathogen of severe acute respiratory syndrome (SARS)), human coronavirus NL63 (HCoV-NL63, New Haven coronavirus), human coronavirus HKU1, MERS-CoV ("Middle East Respiratory Syndrome Coronavirus" or MERS), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or COVID-19 (coronavirus disease 2019).
[0063] Disintegration of the RNA secondary structure of a CoV can dramatically inhibit the CoV. Figure 1G shows examples of conserved and predicted RNA secondary structures across coronavirus B viruses that can be targeted in the method of the subject. In some cases, the composition of the subject has broad-spectrum activity against CoVs, such as activity against one or more CoVs selected from HCoV-299E, HCoV-OC43, SARS-CoV, HCoV-NL63, HKU1, MERS-CoV, and SARS-CoV-2 or COVID-19. In some cases, the target CoV is SARS-CoV-2 or COVID-19. In some cases, the target CoV is SARS-CoV. In some cases, the target CoV is MERS-CoV. In some cases, the composition of the subject disintegrates the conserved RNA secondary structure of the target CoV without inducing caspases or interferons.
[0064] Aspects of this disclosure include methods for inhibiting coronavirus (CoV) in a sample. In some embodiments, the method includes inhibiting CoV by contacting a sample containing viral RNA (vRNA) having a conserved RNA secondary structure of CoV with an effective amount of a drug that specifically binds to the secondary structure. In some embodiments, the method includes contacting a sample containing viral RNA (vRNA) having a conserved RNA secondary structure of CoV with an effective amount of a drug that inhibits the interaction between host microRNA (miRNA) and CoV. In some cases, the miRNA is microRNA 191 (miR191). In some cases, the miRNA may be one of the following: miR663a, miR-381, miR-744, miR-4508, miR-4730, miR-6777, miR-10396, miR-4749, miR-6787, miR-4706, miR-3675, miR-6810, miR-3675, miR-6812, or miR-6796. In some cases, the conserved RNA secondary structure includes the presence of a microRNA binding site. In some cases, the microRNA is miR-191. In some cases, the microRNA may be any of the microRNAs listed above that have a predicted binding site on the viral RNA. In some cases, the drug or composition of the subject is designed to sequester miR191 in cells transfected with CoV. In some cases, cells are transfected with a CoV 5' terminal RNA segment bound to luciferase. In other cases, the CoV is either SARS-CoV-2 or COVID-19.
[0065] In some cases, the sample is in vitro. In certain cases, the sample is in vivo. The vRNA in the sample may be contained within virions. In some cases, the vRNA is contained within cells, such as virus-infected cells.
[0066] Aspects of this disclosure include methods for inhibiting coronavirus (CoV) in cells. Aspects of this disclosure include methods for inhibiting coronavirus (CoV) in humans. In some embodiments, the method involves inhibiting CoV by contacting cells containing viral RNA (vRNA) having a conserved RNA secondary structure of CoV with an effective amount of a drug that specifically binds to the secondary structure. In some cases, the cells are in vitro. In certain cases, the cells are in vivo. In some embodiments, the drug (e.g., as described herein) may bind to a specific site of the conserved RNA secondary structure motif, disrupting the overall structure of the vRNA and thereby inhibiting the virus. In some cases, the drug inhibits the packaging ability of the vRNA and thereby inhibits the virus.
[0067] medication Any suitable agent may be used as an agent of the target of interest (e.g., PSL2) in the methods and compositions of the subject. The agent of interest includes, but is not limited to, PSL-2 ligands, PSL2-binding antibodies, PSL2 scaffold protein binders, oligonucleotides, small molecules, and peptides, or fragments, variants, or derivatives thereof, or any combination thereof.
[0068] Antibodies that may be used as agents in connection with this disclosure include monoclonal antibodies, polyclonal antibodies, bispecific antibodies, Fab antibody fragments, F(ab)2 antibody fragments, Fv antibody fragments (e.g., V H or V LThis may include, but is not limited to, single-chain Fv antibody fragments and dsFv antibody fragments. Furthermore, the antibody molecule may be a fully human antibody, a humanized antibody, or a chimeric antibody. Antibodies that may be used in connection with this disclosure may include any mature or untreated antibody variable region conjugated to any immunoglobulin constant region. Minor variations in the amino acid sequence of an antibody or immunoglobulin molecule are included in this disclosure provided that the variation in amino acid sequence maintains 75% or more of the sequence, e.g., 80%, 90%, 95%, or 99% or more. In particular, conservative amino acid substitutions are intended. Conservative substitutions are substitutions made within the amino acid family associated with their side chains. Whether an amino acid change results in a functional peptide can be determined by assaying the specific activity of the polypeptide derivative. In some embodiments, the drug is an antibody fragment (e.g., as described herein).
[0069] In some embodiments, the agent is a scaffold polypeptide conjugate. The scaffold refers to the underlying peptide framework (e.g., consensus sequence or structural motif) from which the polypeptide agent originates. The underlying scaffold sequence includes fixed residues and variant residues that can confer various functions to the polypeptide agent, such as specific binding to a target receptor. Such structural motifs can be structurally characterized and compared as a specific combination of secondary and tertiary structural elements, or alternatively, as equivalent primary sequences of amino acid residues. Any suitable scaffold and scaffold polypeptide can be used as an agent in the method of the subject. In some embodiments, such agents can be identified using recombinant screening methods, such as phage display screening. The scaffold polypeptide conjugates of interest include, but are not limited to, synthetic small proteins and recombinant small proteins such as affibodies.
[0070] In some cases, the drug is a small molecule that binds to PSL2. The small molecules of interest include, but are not limited to, small organic or inorganic compounds having molecular weights (MW) greater than 50 Da and less than about 1000 Da, or greater than 50 Da and less than about 500 Da, for example, greater than 50 Da and less than about 2,500 Da. “Small molecules” encompasses a large number of biological and chemical classes, including synthetic, semi-synthetic, or naturally occurring inorganic or organic molecules, and includes synthetic, recombinant, or naturally occurring polypeptides and nucleic acids. The small molecules of interest may contain functional groups necessary for structural interactions with proteins, particularly hydrogen bonding, and may contain at least amine, carbonyl, hydroxyl, or carboxyl groups, and may contain at least two of the functional chemical groups. The small molecules may contain cyclic carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Small molecules are also found among biomolecules, including peptides, sugars, fatty acids, steroids, purines, pyrimidines, their derivatives, structural analogs, or combinations.
[0071] Oligonucleotide compounds In some embodiments, the agent is an oligonucleotide or a derivative thereof, or a salt thereof (e.g., a pharmaceutically acceptable salt). In some cases, the oligonucleotide is complementary to a particular segment of a target motif (e.g., as described herein). In some cases, the complementary oligonucleotides used in the method of the subject are at least five, such as at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, about twelve, at least thirteen, at least fourteen, at least fifteen, or more. In some cases, the complementary oligonucleotides are 75 nucleotides or less in length, such as 50 nucleotides or less, 45 nucleotides or less, or 35 nucleotides or less, and the length is determined by the efficiency of inhibition, specificity including the absence of cross-reactivity, etc. In some cases, the complementary oligonucleotides are 30 nucleotides or less in length, such as 25 nucleotides or less, 20 nucleotides or less, or 15 nucleotides or less, and the length is determined by the efficiency of inhibition, specificity including the absence of cross-reactivity, etc. This disclosure provides short oligonucleotides, for example, 7, 8-15, or 15-16 nucleotides in length, which may be potent and selective inhibitors of targeted functions.
[0072] In some embodiments, the drug is an oligonucleotide compound or a salt thereof containing at least five nucleoside subunits complementary to the target motif of the vRNA (e.g., at least six, at least seven, at least eight, at least nine, at least ten, at least twelve, at least fourteen, at least sixteen, at least eighteen, or at least twenty). In certain cases, the oligonucleotide bond is, for example, a modified phosphate group in which one or more oxygen atoms of the phosphate are substituted with various substituents. While not bound by any particular theory, such modifications can increase the resistance of the oligonucleotide to nucleotide degradation. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidites, alkylphosphonates or arylphosphonates, and phosphotryesters. In some cases, the oligonucleotide bond is a modified phosphate group in which one or more of the non-crosslinked phosphonate oxygen atoms in the bond are S, Se, BR a 3, alkyl, substituted alkyl, aryl, substituted aryl, H, NR a 2, or OR b It is substituted with a group selected from R a These are H, alkyl, substituted alkyl, aryl, substituted aryl, and R bis H, alkyl, substituted alkyl, aryl, or substituted aryl. In certain cases, one or more of the phosphorus atoms of the oligonucleotide are chiral, for example, asymmetric centers. The asymmetric phosphorus atoms may have either an "R" configuration (referred to herein as Rp) or an "S" configuration (referred to herein as Sp). In certain embodiments, the oligonucleotide bond comprises one or more asymmetric phosphorus atoms having an enantiomer excess of at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more Sp configurations. In certain other embodiments, the oligonucleotide bond comprises one or more asymmetric phosphorus atoms having an enantiomer excess of at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more Rp configurations.
[0073] In certain embodiments, one or more of the oligonucleotide bonds are selected from methylphosphonate, P3'→N5' phosphoramidate, N3'→P5' phosphoramidate, N3'→P5' thiophosphoramidate, phosphorodithioate, and phosphorothioate bonds. In certain cases, one or more of the oligonucleotide bonds are phosphorothioate bonds. In certain cases, the phosphorus atoms in one or more of the phosphorothioate bonds are chiral. In some cases, the chiral phosphorus atoms in one or more phosphorothioate bonds have an Rp configuration. In some cases, the chiral phosphorus atoms in one or more phosphorothioate bonds have an Sp configuration. In certain embodiments, the oligonucleotide bonds include one or more phosphorothioate bonds having at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more enantiomer excess of Sp configurations. In certain other embodiments, the oligonucleotide binding comprises one or more phosphorothioates having an enantiomer excess of at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more Rp configurations.
[0074] In certain cases, the oligonucleotide sequence is a crosslinked nucleic acid (as described herein, for example). In certain cases, the oligonucleotide sequence comprises one or more crosslinked nucleic acid nucleotides, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more.
[0075] In certain cases, an oligonucleotide sequence is a lock nucleic acid. In certain cases, an oligonucleotide sequence contains one or more lock nucleic acid nucleotides, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more.
[0076] In certain cases, the oligonucleotide sequence is an ethylene-crosslinked nucleic acid (ENA). In certain cases, the oligonucleotide sequence contains one or more ENA nucleotides, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more.
[0077] In certain cases, the oligonucleotide sequence is a restricted ethyl (cEt) nucleic acid. In certain cases, the oligonucleotide sequence contains one or more cEt nucleotides, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more. In certain cases, the oligonucleotide sequence contains one or more (S) restricted ethyl nucleic acids, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more. In certain cases, the oligonucleotide sequence contains one or more (R) restricted ethyl nucleic acids, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more. In certain cases, the oligonucleotide sequence contains one or more ribose modifications. In some cases, the oligonucleotide sequence contains one or more 2'-modified ribose sugars (also referred to herein as 2'-modified nucleotides). In certain cases, the oligonucleotide sequence contains one or more 2'-modified nucleotides, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more. The 2'-modified nucleotides include, but are not limited to, moieties having 2' substituents selected from alkyl, allyl, amino, azide, fluoro, thio, O-alkyl, e.g., O-methyl, O-allyl, OCF3, O-(CH2)2-O-CH3 (e.g., 2'-O-methoxyethyl (MOE)), O-(CH2)2SCH3,)-(CH2)2-ONR2, and O-CH2C(O)-NR2, where each R is independently selected from H, alkyl, and substituted alkyl. In certain cases, the oligonucleotide sequence contains one or more 2'-O-methoxyethyl (MOE) modifications, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more.
[0078] In some embodiments, the drug is an oligonucleotide capable of recruiting an RNase, comprising at least five deoxyribonucleotide units (e.g., units complementary to the target motif, e.g., the PSL2 motif) (e.g., at least six, at least seven, at least eight, at least nine, at least ten, at least twelve, at least fourteen, at least sixteen, at least eighteen, at least twenty). In some cases, the oligonucleotide recruits an RNase to catalyze the degradation of the target vRNA into smaller components. Any convenient method and portion for recruiting an RNase can be incorporated into the drug of the subject (e.g., the oligonucleotide). In some cases, the oligonucleotide drug further comprises a sequence that recruits the RNase of interest. Unless otherwise indicated, oligonucleotide sequences shown herein include DNA sequences, RNA sequences (e.g., U may be optionally substituted with T), mixed RNA / DNA sequences, and analogs thereof, and it is understood that one or more nucleotides in a sequence are modified nucleotides such as BNA analogs, LNA analogs, ENA analogs, cEt analogs, 2' modified analogs, and / or analogs in which one or more nucleoside bonds are substituted with unnaturally occurring bonds such as phosphorothioates, phosphorodithioates, phosphoramidates, or thiophosphoramidate bonds. In embodiments in which one or more bonds of an oligonucleotide include a chiral phosphorus atom, for example, a chiral center, it will be understood that the chiral phosphorus atom may have either an "R" configuration (referred to herein as Rp) or an "S" configuration (referred to herein as Sp).
[0079] In some embodiments, the activator is a compound comprising an oligonucleotide sequence containing at least eight nucleoside subunits complementary to the PB2 vRNA region. In some embodiments, the activator is a compound comprising an oligonucleotide sequence containing at least eight and 20 or fewer (e.g., 15 or fewer) nucleoside subunits complementary to the PB2 vRNA region.
[0080] A specific region of the endogenous PSL2 sequence is selected to be complemented by an oligonucleotide agent. Specific sequence selection for the oligonucleotide may be performed using empirical methods, or several candidate sequences may be assayed for inhibition of the target IAV in vitro or in animal models based on structural analysis (e.g., as described herein). Combinations of oligonucleotides and sequences may also be used, and several regions of the target PSL2 are selected for antisense complementarity.
[0081] In some embodiments, the oligonucleotide is 5'ACCAAAAGAAT3' (Sequence ID 45), 5'TGGCCATCAAT3' (Sequence ID 46), 5'TAGCATACTTA3' (SEQ ID NO: 47), 5'CCAAAAGA3' (Sequence ID 48), 5'CATACTTA3' (SEQ ID NO: 49), 5'CAGACACGACCAAAA3' (Sequence ID 50), 5'TACTTACTGACAGCC3' (Sequence ID 51), 5'AGACACGACCAAAAG3' (Sequence ID 52), 5'ACCAAAAGAAT3' (Sequence ID 53), 5'TGGCCATCAAT3' (Sequence ID 54), 5'TAGCATACTTA3' (SEQ ID NO: 55), 5'CGACCAAAAGAATTC3' (Sequence ID 56), 5'CGACCAAAAGAATTC3' (Sequence ID 57), 5'GATGGCCATCAATTA3' (Sequence ID 58), 5'GATGGCCATCAATTA3' (Sequence ID 59), 5'TCTAGCATACTTACT3' (Sequence ID 60), 5'TCTAGCATACTTACT3' (Sequence ID 61), 5'GAATTCGGATGGCCA3' (Sequence ID 62), 5'GGCCATCAATTAGTG3' (Sequence ID 63), 5'TTCGGATGGCCATCA3' (Sequence ID 64), 5'AGCCAGACAGCGA3' (SEQ ID NO: 65), and Contains a sequence selected from 5'GACAGCCAGACAGCA3' (sequence number 66).
[0082] In certain embodiments, the oligonucleotide includes the sequence: 5'ACCAAAAGAAT3' (SEQ ID NO: 45). In certain embodiments, the oligonucleotide includes the sequence: 5'TGGCCATCAAT3' (SEQ ID NO: 46). In certain embodiments, the oligonucleotide includes the sequence: 5'TAGCATACTTA3' (SEQ ID NO: 47). In certain embodiments, the oligonucleotide includes the sequence: 5'CCAAAAGA3' (SEQ ID NO: 48). In certain embodiments, the oligonucleotide includes the sequence: 5'CATACTTA3' (SEQ ID NO: 49). In certain embodiments, the oligonucleotide includes the sequence: 5'CAGACACGACCAAAA3' (SEQ ID NO: 50). In certain embodiments, the oligonucleotide includes the sequence: 5'TACTTACTGACAGCC3' (SEQ ID NO: 51). In certain embodiments, the oligonucleotide includes the sequence: 5'AGACACGACCAAAAG3' (SEQ ID NO: 52). In certain embodiments, the oligonucleotide includes the sequence: 5'ACCAAAAGAAT3' (SEQ ID NO: 53). In certain embodiments, the oligonucleotide includes the sequence: 5'TGGCCATCAAT3' (SEQ ID NO: 54). In certain embodiments, the oligonucleotide includes the sequence: 5'TAGCATACTTA3' (SEQ ID NO: 55). In certain embodiments, the oligonucleotide includes the sequence: 5'CGACCAAAAGAATTC3' (SEQ ID NO: 56). In certain embodiments, the oligonucleotide includes the sequence: 5'CGACCAAAAGAATTC3' (SEQ ID NO: 57). In certain embodiments, the oligonucleotide includes the sequence: 5'GATGGCCATCAATTA3' (SEQ ID NO: 58). In certain embodiments, the oligonucleotide includes the sequence: 5'GATGGCCATCAATTA3' (SEQ ID NO: 59). In certain embodiments, the oligonucleotide includes the sequence: 5'TCTAGCATACTTACT3' (SEQ ID NO: 60). In certain embodiments, the oligonucleotide includes the sequence: 5'TCTAGCATACTTACT3' (SEQ ID NO: 61). In certain embodiments, the oligonucleotide includes the sequence: 5'GAATTCGGATGGCCA3' (SEQ ID NO: 62).In certain embodiments, the oligonucleotide comprises the sequence: 5'GGCCATCAATTAGTG3' (SEQ ID NO: 63). In certain embodiments, the oligonucleotide comprises the sequence: 5'TTCGGATGGCCATCA3' (SEQ ID NO: 64). In certain embodiments, the oligonucleotide comprises the sequence: 5'AGCCAGACAGCGA3' (SEQ ID NO: 65). In certain embodiments, the oligonucleotide comprises the sequence: 5'GACAGCCAGACAGCA3' (SEQ ID NO: 66).
[0083] In some embodiments, the oligonucleotide is 5'CGACCAAAAGAATT3' (SEQ ID NO: 98), and Contains a sequence selected from 5'GACCAAAAGAATTCGG3' (sequence number 99).
[0084] In certain embodiments, the oligonucleotide comprises the sequence: 5'CGACCAAAAGAATT3' (SEQ ID NO: 98). In certain embodiments, the oligonucleotide comprises the sequence: 5'GACCAAAAGAATTCGG3' (SEQ ID NO: 99).
[0085] In some embodiments, the oligonucleotide is 5'AGCATACTTACTGACA3' (Sequence ID 100), 5'CATACTTACTGACA3' (Sequence ID 101), 5'ATACTTACTGACAG3' (Sequence ID 102), 5'CATACTTACTGACAGC3' (Sequence ID 103), 5'AGACAGCGACCAAAAG3' (SEQ ID NO: 104), and Contains a sequence selected from 5'ACAGCGACCAAAAG (sequence number 105).
[0086] In certain embodiments, the oligonucleotide includes the sequence: 5'AGCATACTTACTGACA3' (SEQ ID NO: 100). In certain embodiments, the oligonucleotide includes the sequence: 5'CATACTTACTGACA3' (SEQ ID NO: 101). In certain embodiments, the oligonucleotide includes the sequence: 5'ATACTTACTGACAG3' (SEQ ID NO: 102). In certain embodiments, the oligonucleotide includes the sequence: 5'CATACTTACTGACAGC3' (SEQ ID NO: 103). In certain embodiments, the oligonucleotide includes the sequence: 5'AGACAGCGACCAAAAG3' (SEQ ID NO: 104). In certain embodiments, the oligonucleotide includes the sequence: 5'ACAGCGACCAAAAG' (SEQ ID NO: 105).
[0087] In some embodiments, the oligonucleotide is 5'CAGCCAGACAGCGAC3' (Sequence ID 106), 5'CAGCCAGACAGCGA3' (Sequence ID 107), 5'ACAGCCAGACAGCGA3' (SEQ ID NO: 108), and Contains a sequence selected from 5'GACAGCCAGACAGCG3' (sequence number 109).
[0088] In certain embodiments, the oligonucleotide comprises the sequence: 5'CAGCCAGACAGCGAC3' (SEQ ID NO: 106). In certain embodiments, the oligonucleotide comprises the sequence: 5'CAGCCAGACAGCGA3' (SEQ ID NO: 107). In certain embodiments, the oligonucleotide comprises the sequence: 5'ACAGCCAGACAGCGA3' (SEQ ID NO: 108). In certain embodiments, the oligonucleotide comprises the sequence: 5'GACAGCCAGACAGCG3' (SEQ ID NO: 109).
[0089] In some embodiments, the oligonucleotide is 5'GAATTCGGATGGCCA3' (Sequence ID 62), 5'AGCCAGACAGCGA3' (Sequence ID 65), 5'CATCAATTAGTGTCG3' (Sequence ID 110), 5'CCATCAATTAGTGTCG3' (Sequence ID 111), 5'GCCATCAATTAGTGTG3' (Sequence ID 112), 5'AAGAATTCGGATGGC3' (Sequence ID 113), 5'CAGACAGCGACCAA3' (SEQ ID NO: 114), and Includes sequences selected from 5'TGACAGCCAGACAGC3' (sequence number 115).
[0090] In certain embodiments, the oligonucleotide includes the sequence: 5'GAATTCGGATGGCCA3' (SEQ ID NO: 62). In certain embodiments, the oligonucleotide includes the sequence: 5'AGCCAGACAGCGA3' (SEQ ID NO: 65). In certain embodiments, the oligonucleotide includes the sequence: 5'CATCAATTAGTGTCG3' (SEQ ID NO: 110). In certain embodiments, the oligonucleotide includes the sequence: 5'CCATCAATTAGTGTCG3' (SEQ ID NO: 111). In certain embodiments, the oligonucleotide includes the sequence: 5'GCCATCAATTAGTGTG3' (SEQ ID NO: 112). In certain embodiments, the oligonucleotide includes the sequence: 5'AAGAATTCGGATGGC3' (SEQ ID NO: 113). In certain embodiments, the oligonucleotide includes the sequence: 5'CAGACAGCGACCAA3' (SEQ ID NO: 114). In certain embodiments, the oligonucleotide includes the sequence: 5'TGACAGCCAGACAGC3' (SEQ ID NO: 115). In some cases, binding of an oligonucleotide compound (e.g., one of the sequences mentioned above) to the PB2 vRNA region (e.g., via hybridization) disrupts the overall secondary RNA structure of the PB2 vRNA. In specific cases, binding of an oligonucleotide compound to the PB2 vRNA region inhibits the packaging ability of the PB2 vRNA, thereby inhibiting the virus.
[0091] In some embodiments, the oligonucleotide comprises a sequence selected from (COV2) below. 5'GGTGACATGGTACCACATATATCACGTC3'(Sequence ID 192) 5'GACGTGATATATGTGGTACCATGTCACC3'(Sequence ID 193) 5'GACGTGATATATGTGG3' (Sequence ID 194) 5'CGTGATATATGTGGTA3' (Sequence ID 195) 5'GATATGTGGTACCAT3' (Sequence ID 196) 5'TGGTACCATGTCAC3'(Sequence ID 197) 5'GTCACTAAGAAATCTGCTGCTGAGG3' (Sequence ID 198) 5'CCTCAGCAGCAGATTTCTTAGTGAC3' (Sequence ID 199) 5'CCTCAGCAGCAGATTT3' (Sequence ID 200) 5'TCAGCAGCAGATTTC3' (Sequence ID 201) 5'CAGCAGCAGATTTC3' (Sequence ID 202) 5'CAGATTTCTTAGTGAC3' (Sequence ID 203) 5'TGCTTACGGTTTCGTCCGTGTTGCA3' (Sequence ID 204) 5'TGCAACACGGACGAAACCGTAAGCA3' (Sequence ID 205) 5'TGCAACACGGACGAAA3'(Sequence ID 206) 5'GCAACACGGACGAAAC3' (Sequence ID 207) 5'ACACGGACGAAACCG3' (Sequence ID 208) 5'GGACGAAACCCGTAA3' (Sequence ID 209) 5'ACGAAACCGTAAGCA3' (Sequence ID 210) 5'ACGAAACCGTAAGCA3' (Sequence ID 211) 5'GCAACACGGACGAAAC3' (Sequence ID 212) 5'GCAACACGGACGAAA3' (Sequence ID 213) 5'GCAACACGGACGAAAC3' (Sequence ID 214) 5'GCAACACGGACGAAAC3' (Sequence ID 215) 5'GCAACACGGACGAAAC3' (Sequence ID 216) 5'GCAACACGGACGAA3' (Sequence ID 217) 5'ACACGGACGAAACCG3' (Sequence ID 218) 5'ACACGGACGAAACCG3' (Sequence ID 219) 5'AACACGGACGAAACCG3' (Sequence ID 220) 5'AACACGGACGAAACCG3' (Sequence ID 221) 5'ACGAAACCGTAAGCA3' (Sequence ID 222) 5'ACGAAACCGTAAGCA3' (Sequence ID 223) 5'ATAGGTCCAGACATGTTCC3' (Sequence ID 224) 5'GGAACATGTCTGGACCTAT3'(Sequence ID 225) 5'AACATGTCTGGACCTA3' (Sequence ID 226) 5'ACATGTCTGGACCTAT3'(Sequence ID 227) 5'TATGACTATGTCATATTCA3' (Sequence ID 228) 5'AGTGAATATGACATAGTCATATT3'(Sequence ID 229) 5'TGAATATGACATAGT3' (Sequence ID 230) 5'AATATGACATAGTC3' (Sequence ID 231) 5'GATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTG3'(Sequence ID 232) 5'CACAGATTTTAAAGTTCGTTTAGAGAACAGATCTACAAGAGATC3' (Sequence ID 233) 5'CACAGATTTTAAAGTT3' (Sequence ID 234) 5'CACAGATTTTAAAGTT3' (Sequence ID 235) 5'CAGATTTTAAAGTTCG3' (Sequence ID 236) 5'GATTTTAAAGTTCGT3'(Sequence ID 237) 5'TAAAGTTCGTTTAGA3' (Sequence ID 238) 5'AAAGTTCGTTTAGA3' (Sequence ID 239) 5'TCGTTTAGAGAACAGAT3' (Sequence ID 240) 5'AGAGAACAGATCTACA3' (Sequence ID 241) 5'AGATCTACAAGAGA3' (Sequence ID 242) 5'ATCTACAAGAGATC3' (Sequence ID 243) 5'AGATTTTAAAGTTCGT3'(Sequence ID 244) 5'GATTTTAAAGTTCGT3'(Sequence ID 245) 5'GATTTTAAAGTTCGT3'(Sequence ID 246) 5'AGATTTTAAAGTTCG3' (Sequence ID 247) 5'TCGTTTAGAGAACAGAT3' (Sequence ID 248) 5'TTCGTTTAGAGAACAG3' (Sequence ID 249) 5'TTCGTTTAGAGAACAG3' (Sequence ID 250) 5'GAGAAAACACACGTCCAACTCAGTTTGCCTG3'(Sequence ID 251) 5'CAGGCAAACTGAGTTGGACGTGTGTTTTCTC3'(Sequence ID 252) 5'CAGGCAAACTGAGTTG3'(Sequence ID 253) 5'CAGGCAAACTGAGTTG3'(Sequence ID 254) 5'CAGGCAAACTGAGT3' (Sequence ID 255) 5'CAAACTGAGTTGGACG3'(Sequence ID 256) 5'AAACTGAGTTGGAC3' (Sequence ID 257) 5'AAACTGAGTTGGACGT3' (Sequence ID 258) 5'GAGTTGGACGTGTGT3'(Sequence ID 259) 5'TTGGACGTGTGTTTTC3'(Sequence ID 260) 5'GGACGTGTGTTTTCTC3' (Sequence ID 261) 5'GGTTTCGTCCGGGTGTGACCG3'(Sequence ID 262) 5'TTTCGGTCACACCCGGACGAAACCTAGAT3'(Sequence ID 263) 5'TTTCGGTCACACCCGG3' (Sequence ID 264) 5'CGGTCACACCCGGACG3' (Sequence ID 265) 5'TCACACCCGGACGAAA3'(Sequence ID 266) 5'CACCCGGACGAAAC3' (Sequence ID 267) 5'CACCCGGACGAAACC3' (Sequence ID 268) 5'CACCCGGACGAAACCT3' (Sequence ID 269) 5'CCGGACGAAACCTA3' (Sequence ID 270) 5'CGGTCACACCCGGACGA3' (Sequence ID 21) 5'CGGTCACACCCGGACG3' (Sequence ID 272) 5'CGGTCACACCCGGACG3' (Sequence ID 273) 5'CGGTCACACCCGGACG3' (Sequence ID 274) 5'GTCACACCCGGACG3' (Sequence ID 275) 5'GTCACACCCGGACG3' (Sequence ID 276) 5'CACCCGGACGAAACC3' (Sequence ID 277) 5'CACCCGGACGAAACC3' (Sequence ID 278) 5'CACCCGGACGAAAC3' (Sequence ID 279) 5'CACACCCGGACGAAAC3' (Sequence ID 280) 5'CACACCCGGACGAAA3' (Sequence ID 281) 5'CACACCCGGACGAA3' (Sequence ID 282) 5'CGAGGCCACGCGGAGTACGATCGA3' (Sequence ID 283) 5'ACTCGATCGTACTCCGCGTGGCCTCGGTGAA3' (Sequence ID 284) 5'TCGATCGTACTCCGC3' (Sequence ID 285) 5'TCGATCGTACTCCG3' (Sequence ID 286) 5'ATCGTACTCCGCGTG3' (Sequence ID 287) 5'ACTCGATCGTACTC3' (Sequence ID 288) 5'CGTGGCCTCGGTGAA3' (Sequence ID 289) 5'GTGGCCTCGGTGAA3' (Sequence ID 290) 5'TAGTTAACTTTAATCTCACATAGCAATCTTTAATC3'(Sequence ID 291) 5'GATTAAAGATTGCTATGTGAGATTAAAGTTAACTA3'(Sequence ID 292) 5'GATTAAAGATTGCTAT3' (Sequence ID 293) 5'TAAAGATTGCTATGTG3'(Sequence ID 294) 5'AAGATTGCTATGTGAG3' (Sequence ID 295) 5'GCTATGTGAGTTAAAG3' (Sequence ID 296) 5'TATGTGAGTTAAAGTT3' (Sequence ID 297) 5'TGTGAGTTAAAGTTAA3' (Sequence ID 298) 5'CGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAG3'(Sequence ID 299) 5'CTGCGTAGAAGCCTTTTGGCAATGTTGTTCCTTGAGGAAGTTGTAGCACG3'(Sequence ID 300) 5'TCGTAGAAGCCTTTTG3' (Sequence ID 301) 5'CGTAGAAGCCTTTTGGC3' (Sequence ID 302) 5'TAGAAGCCTTTTGGCA3' (Sequence ID 303) 5'AAGCCTTTTGGCAATG3' (Sequence ID 304) 5'TTGGCAATGTTGTTCC3' (Sequence ID 305) 5'GCAATGTTGTTCCT3' (Sequence ID 306) 5'CTTGAGGAAGTTGT3' (Sequence ID 307) 5'AGGAAGTTGTAGCACG3' (Sequence ID 308) 5'GCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAG3'(Sequence ID 309) 5'CTACTAAAATTAATTTTACACATTAGGGCTCTTCCATATAGGC3'(Sequence ID 310) 5'CTACTAAAATTAATT3'(Sequence ID 311) 5'TACTAAAATTAATTT3'(Sequence ID 312) 5'ACTAAAATTAATTT3' (Sequence ID 313) 5'AATTAATTTTACACAT3' (Sequence ID 314) 5'ATTTTACACATTAGGG3' (Sequence ID 315) 5'TACACATTAGGGCTC3' (Sequence ID 316) 5'ACATTAGGGCTCTTC3' (Sequence ID 317) 5'TAGGGCTCTTCCATA3' (Sequence ID 318) 5'GCTCTTCCATATAGG3' (Sequence ID 319) 5'AGGTAAGATGGAGAGCCTT3' (Sequence ID 320) 5'AAGGCTCTCCATCTTACCTTTCGG3' (Sequence ID 321) 5'AAGGCTCTCCATCTTA3' (Sequence ID 322) 5'AAGGCTCTCCATCT3' (Sequence ID 323) 5'GCTCTCCATCTTACCT3' (Sequence ID 324) 5'TCCATCTTACCTTTCG3' (Sequence ID 325) 5'TGTGTAACATTAGGGAGG3'(Sequence ID 326) 5'CCTCCCTAATGTTACACA3'(Sequence ID 327) 5'CCTCCCTAATGTTACA3' (Sequence ID 328) 5'CTCCCTAATGTTACAG3' (Sequence ID 329) 5'CTCCCTAATGTTACAG3' (Sequence ID 330) 5'TCATGTGGTAGTGTTGGTTTTA3'(Sequence ID 331) 5'TAAAACCAACACTACCACATGA3'(Sequence ID 332) 5'TAAAACCAACACTACC3' (Sequence ID 333) 5'AAACCAACACTACCAC3' (Sequence ID 334) 5'AAACCAACACTACCAC3' (Sequence ID 335) 5'ACCAACACTACCACAT3' (Sequence ID 336) 5'CAACACTACCACATGA3' (Sequence ID 336)
[0092] In some embodiments, the oligonucleotide includes a sequence selected from the following: (IAV PSL2(+) 5'TGTCAGTAAGTATG3' (Sequence ID 337) 5'CTGGCTGTCAGTAAGT3'(Sequence ID 338) 5'TCGCTGTCTGGCTGT3' (Sequence ID 339) 5'CTTTTGGTCGCTGTCT3' (Sequence ID 340) 5'CTTTTGGTCGCTGT3' (Sequence ID 341) 5'TTGGTCGCTGTCTGGC3' (Sequence ID 342) 5'TTGGTCGCTGTCTG3' (Sequence ID 343) 5'GAATTCTTTTGGTCGC3' (Sequence ID 344) 5'GAATTCTTTTGGTCG3' (Sequence ID 345) 5'AATTCTTTTGGTCGC3' (Sequence ID 346) 5'CGAATTCTTTTGGTCG3' (Sequence ID 347) 5'ACACTAATTGATGGC3' (Sequence ID 348) 5'AATTGATGGCCAT3' (Sequence ID 349)
[0093] In some embodiments, the oligonucleotide comprises a sequence selected from the following: (IBV(-) 5'CCACAAAATGAAGGCA3' (Sequence ID 350) 5'CACAAAATGAAGGCA3' (Sequence ID 351) 5'CACAAAATGAAGGC3' (Sequence ID 352) 5'CAATAATTGTACTA3' (Sequence ID 353) 5'CAATAATTGTACTA3' (Sequence ID 354) 5'CAATAATTGTACTA3' (Sequence ID 355) 5'CAATAATTGTACTAC3' (Sequence ID 356) 5'CAATAATTGTACTAC3' (Sequence ID 357) 5'TGTACTACTCATGGTA3'(Sequence ID 358) 5'TGTACTACTCATGGTA3' (Sequence ID 359) 5'TGTACTACTCATGGTA3'(Sequence ID 360) 5'GTACTACTCATGGT3'(Sequence ID 361) 5'TTGTACTACTCATGG3'(Sequence ID 362) 5'CATGGTAGTAACATC3' (Sequence ID 363) 5'CTCATGGTAGTAACATC3' (Sequence ID 364) 5'CTCATGGTAGTAACAT3' (Sequence ID 365) 5'CTCATGGTAGTAACAT3' (Sequence ID 366) 5'ACTCATGGTAGTAACA3' (Sequence ID 367) 5'ACTCATGGTAGTAACA3' (Sequence ID 368) 5'ACTCATGGTAGTAAC3' (Sequence ID 369) 5'ACTCATGGTAGTAA3' (Sequence ID 370) 5'CAATGCAGATCGAAT3' (Sequence ID 371) 5'CAATGCAGATCGAAT3' (Sequence ID 372) 5'GATTGCCTTCACGAAA3' (Sequence ID 373) 5GATTGCCTTCACGAAA3'(Sequence ID 374)
[0094] In some embodiments, the oligonucleotide comprises a sequence selected from the following: (IBV(+) 5'GCCTTCATTTTGTG3' (Sequence ID 375) 5'ATTGCCTTCATTTTGT3' (Sequence ID 376) 5'ATTGCCTTCATTTTGT3' (Sequence ID 377) 5'TAGTACAATTATTGCC3' (Sequence ID 378) 5'AGTACAATTATTGCC3' (Sequence ID 379) 5'GTACAATTATTGCCTT3' (Sequence ID 380) 5'ACCATGAGTAGTACA3' (Sequence ID 381) 5'CATGAGTAGTACAAT3' (Sequence ID 382) 5'GATGTTACTACCATGAG3' (Sequence ID 383) 5'ATGTTACTACCATGAG3' (Sequence ID 384) 5'CATTGGATGTTACTAC3' (Sequence ID 385) 5'ATTGGATGTTACTACC3' (Sequence ID 386) 5'ATTGGATGTTACTAC3' (Sequence ID 387) 5'TTTCGTGAAGGCAATC3' (Sequence ID 388) 5'TCGTGAAGGCAATC3' (Sequence ID 389)
[0095] In some embodiments, the oligonucleotide includes a sequence selected from the following (miRNA targeting sequences). 5'GGTTTCGTCCGTGTT3' (Sequence ID 390) 5'GTTTCGTCCGTGTT3' (Sequence ID 391) 5'GCTGTCGCCCGTGTC3' (Sequence ID 392) 5'GCTGTCGCCCGTGTC3' (Sequence ID 393) 5'GCTGTCGCCCGTGTC3' (Sequence ID 394) 5'GCTGTCGCCCGTGT3' (Sequence ID 395) 5'TTCGTCCGTG3' (Sequence ID 396) 5'TTCGTCCGTG3' (Sequence ID 397) 5'TTCGTCCGTG3' (Sequence ID 398) 5'CCCACCCAC3' (Sequence ID 399) 5'CCCACCCAC3' (Sequence ID 400) 5'CCCACCCAC3' (Sequence ID 401) 5'TTTCGTCCGT3' (Sequence ID 402) 5'TTTCGTCCGT3' (Sequence ID 403) 5'TTTCGTCCGT3'(Sequence ID 404) 5'CCCCACCCAC3' (Sequence ID 405) 5'CCCCACCCAC3' (Sequence ID 406) 5'CCCCACCCAC3' (Sequence ID 407) 5'TTTCGTCCGTGT3' (Sequence ID 408) 5'TTTCGTCCGTGT3' (Sequence ID 409) 5'TTTCGTCCGTGT3' (Sequence ID 410) 5'TTCCATCCATGT3' (Sequence ID 411) 5'TTCCATCCATGT3' (Sequence ID 412) 5'TTCCATCCATGT3' (Sequence ID 413) 5'TTCCATCCATGT3' (Sequence ID 414) 5'GTTTCGTCCGTGTT3' (Sequence ID 415) 5'GTTTCGTCCGTGTT3' (Sequence ID 416) 5'GTTTCGTCCGTGTT3' (Sequence ID 417) 5'GTTTCGGCCATGTG3' (Sequence ID 418) 5'CGTCCGTGTT3' (Sequence ID 419) 5'CGTCCGTGTT3' (Sequence ID 420) 5'CGTCCGTGTT3' (Sequence ID 421) 5'CGTCCGTGTT3' (Sequence ID 422) 5'CCTCCGTGTC3' (Sequence ID 423) 5'CCTCCGTGTC3' (Sequence ID 424) 5'CCTCCGTGTC3' (Sequence ID 425) 5'TCCGTGTTGC3' (Sequence ID 426) 5'TCCGTGTTGC3' (Sequence ID 427) 5'TCCGTGTTGC3' (Sequence ID 428) 5'TCCGTCTTGC3' (Sequence ID 429) 5'TCCGTCTTGC3 (Sequence ID 430) 5'TCCGTTTGC3' (Sequence ID 431) 5'TTTCGTCCGTGTT3' (Sequence ID 432) 5'TTTCGTCCGTGTT3'(Sequence ID 433) 5'TTTCCTCTATGTT3' (Sequence ID 434) 5'TTTCCTCTATGTT3' (Sequence ID 435) 5'GTTTCGTCCGTGT3' (Sequence ID 436) 5'GGTTTCGTCCGTGTT3' (Sequence ID 437) 5'GGTTTCGTCCGTGTT3' (Sequence ID 438) 5'AAGTACGTCCTACTT3' (Sequence ID 439) 5'GGTTTCGTCC3' (Sequence ID 440) 5'GGTTTCGTCC3' (Sequence ID 441) 5'TGGGTTTCGTCCGTT3' (Sequence ID 442) 5'TTTTGGGATTCCGT3'(Sequence ID 443) 5'GCTTTTGGGATTCCGT3'(Sequence ID 444) 5'GCTTTTGGGATTCCGT3' (Sequence ID 445) 5'AGCTGCTTTTGGGATT3' (Sequence ID 446) 5'GAGCTGCTTTTGGGAT3' (Sequence ID 447) 5'CTGCTTTTGGGATTCC3' (Sequence ID 448) 5'TGCTTTTGGGATTC3' (Sequence ID 449) 5'AGCTGCTTTTGGGATT3' (Sequence ID 450) 5'AGCTGCTTTTGGGA3' (Sequence ID 451) 5'CAGCTGCTTTTGGGAT3' (Sequence ID 452) 5'AGCTGCTTTTGGGATT3' (Sequence ID 453) 5'AGCTGCTTTTGGGA3'(Sequence ID 454) 5'AGCTGCTTTTGGGA3' (Sequence ID 455) 5'AGCTGCTTTTGGGATT3' (Sequence ID 456) 5'TGCTTTTGGGATTC3' (Sequence ID 457) 5'GCGGCGCCCCGCCT3' (Sequence ID 458) 5'GCGGCGCCCCGCCT3' (Sequence ID 459) 5'CGGTCCCGCGGCGCCCCGCCT3' (Sequence ID 460) 5'TTTGGGCTTCCTCGCT3' (Sequence ID 461) 5'TTTGGGCTTCCTCG3' (Sequence ID 462) 5'TTTGGGCTTCCTCG3' (Sequence ID 463) 5'TGGGCTTCCTCGCT3' (Sequence ID 464) 5'ATATACTTTGGGCTTC3' (Sequence ID 465) 5'ATATACTTTGGGCTTC3' (Sequence ID 466) 5'ATATACTTTGGGCT3' (Sequence ID 467) 5'ATATACTTTGGGCTT3' (Sequence ID 468) 5'TAGCCCTAGCCCCGCA3' (Sequence ID 469) 5'TAGCCCTAGCCCCGCA3' (Sequence ID 470) 5'TAGCCCTAGCCCCG3' (Sequence ID 471) 5'TGCTGTTAGCCCTA3' (Sequence ID 472) 5'TGCTGTTAGCCCTA3' (Sequence ID 473) 5'GTGTTAGCCCTAGCC3' (Sequence ID 474) 5'GCGCCCAGCCCCGC3' (Sequence ID 475) 5'GCGCCCAGCCCCGC3' (Sequence ID 476) 5'CGCGCGCCCAGCCC3' (Sequence ID 477) 5'CGCGCGCCCAGCCCCGC3' (Sequence ID 478) 5'TGGCATGGAATGGG3' (Sequence ID 479) 5'ATGGAATGGGCTCCGC3' (Sequence ID 480) 5'ATGGAATGGGCTCC3' (Sequence ID 481) 5'AATGGGCTCCGCCAG3' (Sequence ID 482) 5'AATGGGCTCCGCCAG3' (Sequence ID 483) 5'AATGGGCTCCGCCA3' (Sequence ID 484) 5'AATGGGCTCCGCCA3' (Sequence ID 485) 5'CTTACCCGAGGCGGTC3' (Sequence ID 486) 5'TTACCCGAGGCGGT3' (Sequence ID 487) 5'ACCGTACCTTACCCGA3' (Sequence ID 488) 5'CGTACCTTACCCGA3' (Sequence ID 489) 5'CTCCGAGCCCCGCC3' (Sequence ID 490) 5'CCCGGCTCCGAGCCCCGCC3' (Sequence ID 491) 5'TGGCCTGTCCCCGCA3' (Sequence ID 492) 5'TGGCCTGTCCCCGCA3' (Sequence ID 493) 5'GATGCCCTGGCCTG3' (Sequence ID 494) 5'GATGCCCTGGCCTG3' (Sequence ID 495) 5'GCAGCCAGCTCTAC3' (Sequence ID 496) 5'GCAGCCAGCTCTAC3' (Sequence ID 497) 5'AGCCAGCTCTACCC3' (Sequence ID 498) 5'AGCTCTACCCCCGCCA3' (Sequence ID 499) 5'AGCTCTACCCCCGCCA3' (Sequence ID 500) 5'AAAGCAGCGCCCACTT3' (Sequence ID 501) 5'ACTTCCTCCCCGCT3' (Sequence ID 502) 5'CTACAGAAGCCCCATA3' (Sequence ID 503) 5'CTACAGAAGCCCCATA3' (Sequence ID 504) 5'GAAATCTCTACAGAAG3' (Sequence ID 505) 5'GAAATCTCTACAGAAG3' (Sequence ID 506) 5'TGATCCCTGTCCCCAT3' (Sequence ID 507) 5'ATGCTGATCCCTGTC3' (Sequence ID 508) 5'GCCATGCTGATCCCTGTCCCCAT3' (Sequence ID 509) 5'CCATCTCACCCCAT3' (Sequence ID 510) 5'GCTGCTCCTCCCCAT3' (Sequence ID 511) 5'TCTCCAACCCCACAA3' (Sequence ID 512) 5'CTCCAACCCCACAA3' (Sequence ID 513) 5'CAGCCAGCTCTCCAA3' (Sequence ID 514) 5'AGCCAGCTCTCCAA3' (Sequence ID 515)
[0096] In some embodiments, the oligonucleotide comprises a sequence selected from the following (minus-chain targeted LNAs). 5'ATCTGTTCTCTAAACGA3' (Sequence ID 516) 5'ATCTGTTCTCTAAACG3'(Sequence ID 517) 5'AGATCTGTTCTCTAAA3'(Sequence ID 518) 5'TCTCTAAACGAACTTT3' (Sequence ID 519) 5'TCTCTAAACGAACTTT3' (Sequence ID 520) 5'CTCTAAACGAACTTTA3' (Sequence ID 521) 5'ACTTTAAAATCTGT3' (Sequence ID 522) 5'GGTTTCGTCCGTGTT3' (Sequence ID 523) 5'GGTTTCGTCCGTGTT3' (Sequence ID 524) 5'GGTTTCGTCCGTGTT3' (Sequence ID 525) 5'TGCTTACGGTTTCGTCC3' (Sequence ID 526) 5'GTTTCGTCCGTGTTGC3' (Sequence ID 527) 5'TAGGTTTCGTCCGG3' (Sequence ID 528) 5'TCGTCCGGGTGTGA3' (Sequence ID 529) 5'TTCGTCCGGGTGTGA3' (Sequence ID 530) 5'TTTCGTCCGGGTGTGA3'(Sequence ID 531) 5'AGGTTTCGTCCGGGT3' (Sequence ID 532) 5'AGGTTTCGTCCGGG3' (Sequence ID 533) 5'AGGTTTCGTCCGGGT3' (Sequence ID 534) 5'TTTCGTCCGGGTGTG3' (Sequence ID 535) 5'AGGCCACGCGGAGTA3' (Sequence ID 536) 5'CACGCGGAGTACGATC3' (Sequence ID 537)
[0097] Oligonucleotide sequences may contain any convenient number of DNA, RNA, BNA, LNA, ENA, cEt, 2'-modified nucleotides, or other chemically modified nucleotides. In some cases of the oligonucleotide sequences described herein, the sequence is a mixed RNA / DNA sequence. In some cases of the oligonucleotide sequences described herein, the sequence is a mixed BNA / DNA sequence. In some cases of the oligonucleotide sequences described herein, the sequence is a mixed BNA / RNA sequence. In some cases of the oligonucleotide sequences described herein, the sequence contains only BNA nucleotides. In some cases of the oligonucleotide sequences described herein, the sequence is a mixed LNA / DNA sequence. In some cases of the oligonucleotide sequences described herein, the sequence is a mixed LNA / RNA sequence. In some cases of the oligonucleotide sequences described herein, the sequence contains only LNA nucleotides. In some cases of the oligonucleotide sequences described herein, the sequence is a mixed ENA / DNA sequence. In some cases of the oligonucleotide sequences described herein, the sequence is a mixed ENA / RNA sequence. In some cases of the oligonucleotide sequences described herein, the sequence contains only ENA nucleotides. In some cases of the oligonucleotide sequences described herein, the sequence is a mixed cEt / DNA sequence. In some cases of the oligonucleotide sequences described herein, the sequence is a mixed cEt / RNA sequence. In some cases of the oligonucleotide sequences described herein, the sequence contains only cEt nucleotides. In some cases of the oligonucleotide sequences described herein, the sequence is a mixed 2' modified nucleotide / DNA sequence. In some cases of the oligonucleotide sequences described herein, the sequence is a mixed 2' modified nucleotide / RNA sequence. In some cases of the oligonucleotide sequences described herein, the sequence contains only 2' modified nucleotides. In some cases of the oligonucleotide sequences described herein, the sequence contains only DNA nucleotides. In some cases of the oligonucleotide sequences described herein, the sequence contains only RNA nucleotides.
[0098] In certain cases, the oligonucleotide of the subject has one of the following arrangements of nucleotide types in its sequence (e.g., one of sequence numbers 45-66 or 98-115). A, ABA, ABABA, ABABABA, ABABABABA, B, BAB, BABAB, BABABAB, or BABABABPA6 In the formula, each A is independently a sequence of modified nucleotides, and each B is a sequence of DNA nucleotides. In a particular case, A is a sequence of modified nucleotides, where the ribose moiety is modified to include modifications selected from BNA, LNA, ENA, cEt, and 2' modified nucleotides. In a particular case, each A is a sequence of 1 to 50 nucleotides, such as 1-40, 1-30, 1-20, 1-10, or 1-5. In a particular case, each B is a sequence of 1 to 50 nucleotides, such as 1-40, 1-30, 1-20, 1-10, or 1-5.
[0099] In certain cases, the oligonucleotide of the subject has one of the following arrangements of nucleotide types in its sequence (e.g., one of sequence numbers 45-66 or 98-115). (A) n1 , (A) n2 -(B) n3 -(A) n2 , (A)n4-(B) n5 -(A) n4 -(B) n5 -(A) n4 -(B) n5 -(A) n4 , or (A) n4 -(B) n5 -(A) n4 -(B)n5 -(A) n4 -(B) n5 -(A) n4 -(B) n5 -(A) n4 , In the formula, A is a modified nucleotide, B is a DNA nucleotide, n1 is 8 or more, n2 is 3 to 4, n3 is 6 to 8, n4 is 1 to 2, and n5 is 1 to 3. In a specific case, A is a modified nucleotide, and the ribose moiety is modified to include modifications selected from BNA, LNA, ENA, cEt, and 2' modified nucleotides.
[0100] In certain cases, the oligonucleotide of the subject has one of the following arrangements of nucleotide types in its sequence (e.g., one of sequence numbers 45-66 or 98-115). In the formula, A is a sequence of eight or more LNA nucleotides. In the formula ABA, B is a sequence of 6-8 DNA nucleotides, and each A is a sequence of 3-4 LNA nucleotides. In the formula ABA, B is a sequence of 7-8 DNA nucleotides, and each A is a sequence of 4 LNA nucleotides. In the formula LDLDLDL, each L represents a sequence of 1-2 LNA nucleotides, and each D represents a sequence of 2 DNA nucleotides. In the formula LDLDLDL, each L represents a sequence of 1-2 LNA nucleotides, and each D represents a sequence of 1-2 DNA nucleotides. In the formula LDLDLDL, each L represents a sequence of 1-2 LNA nucleotides, and each D represents a sequence of 1-3 DNA nucleotides. LDLDLDLDL, where each L is a sequence of 1-2 LNA nucleotides, each D is a sequence of 1-3 DNA nucleotides, and In the formula LDLDLDLDL, each L is a sequence of 1-2 LNA nucleotides, and each D is a sequence of 1-2 DNA nucleotides.
[0101] The oligonucleotide sequence of the subject matter may further include one or more modified internucleoside linkages such as phosphorothioate, phosphorodithioate, phosphoramidate, and / or thiophosphoramidate linkages. The non-naturally occurring internucleoside linkages can be included at any convenient position of the sequence of the oligonucleotide of the subject matter. In embodiments where the internucleoside linkage includes a chiral phosphorus atom, e.g., an asymmetric center, the asymmetric phosphorus atom can have either an "R" configuration (referred to herein as Rp) or an "S" configuration (referred to herein as Sp). The oligonucleotide sequence of the subject matter containing a chiral phosphorus atom can be prepared as a racemic mixture or as separate enantiomers.
[0102] In certain embodiments, the oligonucleotide has one of the following sequences, where uppercase letters indicate LNA nucleotides and lowercase letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). LNA1: 5’AccAaaAGaaT3’ (SEQ ID NO: 67), LNA2: 5’TggCcATcaaT3’ (SEQ ID NO: 68), LNA3: 5’TagCAtActtA3’ (SEQ ID NO: 69), LNA4: 5’CCAAAAGA3’ (SEQ ID NO: 70), LNA5: 5’CATACTTA3’ (SEQ ID NO: 71), LNA6: 5’CagaCaCGaCCaaAA3’ (SEQ ID NO: 72), LNA7: 5’TAcTtaCTgaCagCC3’ (SEQ ID NO: 73), LNA8: 5’AGACacgaccaAAAG3’ (SEQ ID NO: 74), LNA9: 5’TACTtactgacaGCC3’ (SEQ ID NO: 75), LNA9.2: 5’TACttactgacAGCC3’ (SEQ ID NO: 76), LNA10: 5’ACCaaaagAAT3’ (SEQ ID NO: 77), LNA11: 5’TGGccatcAAT3’ (SEQ ID NO: 78), LNA12: 5’TAGcatacTTA3’ (SEQ ID NO: 79), LNA13: 5’CgacCAaaAGaattC3’ (SEQ ID NO: 80), LNA14: 5’CGACcaaaagaATTC3’ (SEQ ID NO: 81), LNA15: 5’GaTGgCcATcaAttA3’ (SEQ ID NO: 82), LNA16: 5’GATGgccatcaATTA3’ (SEQ ID NO: 83), LNA17: 5’TcTAgCaTActTacT3’ (SEQ ID NO: 84), LNA18: 5’TCTAgcatactTACT3’ (SEQ ID NO: 85), LNA19: 5’GAAttcggatgGCCA3’ (SEQ ID NO: 86), LNA20: 5’GGCCatcaattaGTG3’ (SEQ ID NO: 87), LNA21: 5’TTCGgatggccaTCA3’ (SEQ ID NO: 88), LNA22: 5’AGCCagacagCGA3’ (SEQ ID NO: 89), and LNA23: 5’GACAgccagacaGCA3’ (SEQ ID NO: 90).
[0103] It will be understood that for any of the sequences LNA1 to LNA23 (SEQ ID NOs: 67) to (SEQ ID NOs: 90), one or more of the LNA nucleotides can be replaced with a modified nucleotide selected from BNA nucleotides, ENA nucleotides, cEt nucleotides, and 2'-modified nucleotides. In certain cases, 1, 2, 3, 4 or more of the LNA nucleotides can be replaced with BNA nucleotides. In certain cases, 1, 2, 3, 4 or more of the LNA nucleotides can be replaced with ENA nucleotides. In certain cases, 1, 2, 3, 4 or more of the LNA nucleotides can be replaced with cEt nucleotides. In certain cases, 1, 2, 3, 4 or more of the LNA nucleotides can be replaced with 2'-modified nucleotides (e.g., replaced with MOE and other substituents described herein).
[0104] In certain embodiments, the oligonucleotide has one of the following sequences, where uppercase letters indicate an LNA nucleotide and lowercase letters indicate a DNA nucleotide (i.e., a deoxyribonucleotide unit). LNA19:5'GAAttcggatgGCCA3' (SEQ ID NO: 86) LNA22:5'AGCCagacagCGA3' (Sequence ID 89), LNA22.2:5'CAGCcagacagCGAC3' (SEQ ID NO: 116) LNA22.3:5'CAGccagacagCGAC3' (SEQ ID NO: 117) LNA22.5:5'CAGccagacaGCGA3' (SEQ ID NO: 118) LNA22.6:5'CAGccagacagCGA3' (SEQ ID NO: 119) LNA22.7:5'CAGCcagacagCGA3' (SEQ ID NO: 120) LNA22.8:5'ACAgccagacagCGA3' (SEQ ID NO: 121) LNA22.9:5'ACAGccagacaGCGA3' (SEQ ID NO: 122) LNA22.10:5'ACAgccagacaGCGA3' (SEQ ID NO: 123) LNA22.11:5'GACAgccagacaGCG3' (SEQ ID NO: 124) LNA22.13:5'GACagccagacaGCG3' (SEQ ID NO: 125), and LNA22.14:5'GACAgccagacAGCG(Sequence ID 126).
[0105] It will be understood that in any of the sequences LNA19 or LNA22-LNA22.14 ((SEQ ID NO: 86), (SEQ ID NO: 89), and (SEQ ID NO: 116) to (SEQ ID NO: 126)), one or more LNA nucleotides may be substituted with modified nucleotides selected from BNA nucleotides, ENA nucleotides, cEt nucleotides, and 2' modified nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with BNA nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with ENA nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with cEt nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with 2' modified nucleotides (e.g., substituted with MOE and other substituents described herein).
[0106] In certain embodiments, the oligonucleotide has one of the following sequences, where uppercase letters indicate an LNA nucleotide and lowercase letters indicate a DNA nucleotide (i.e., a deoxyribonucleotide unit). LNA24:5'CATcaattagtgTCG3'(Sequence ID 127), LNA25:5'CCAtcaattagtgTCG3'(Sequence ID 128), LNA26:5'GCCatcaattagtGTG3' (SEQ ID NO: 129) LNA27:5'AAGAattcggaTGGC3' (SEQ ID NO: 130) LNA28:5'CAGacagcgacCAA3' (SEQ ID NO: 131), and LNA29:5'TGAcagccagacAGC3' (Sequence ID 132).
[0107] It will be understood that in any of the sequences LNA24 or LNA29 (SEQ ID NO: 127) to (SEQ ID NO: 132), one or more LNA nucleotides may be substituted with modified nucleotides selected from BNA nucleotides, ENA nucleotides, cEt nucleotides, and 2'-modified nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with BNA nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with ENA nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with cEt nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with 2'-modified nucleotides (e.g., substituted with MOE and other substituents described herein).
[0108] In certain embodiments, the oligonucleotide has the sequence LNA14 or a derivative thereof, as shown in Table 1, where the "+" before the letter indicates an LNA nucleotide or another chemically modified nucleotide (as described herein, for example), and the other letter indicates a DNA nucleotide (i.e., a deoxyribonucleotide unit). [Table 1]
[0109] In certain embodiments, the oligonucleotide has the sequence LNA9 or a derivative thereof, as shown in Table 2, where the "+" before the letter indicates an LNA nucleotide or another chemically modified nucleotide (as described herein, for example), and the other letter indicates a DNA nucleotide (i.e., a deoxyribonucleotide unit). [Table 2]
[0110] In certain embodiments, the oligonucleotide has the sequence LNA8a, or a derivative thereof, as shown in Table 3, where a “+” preceding a letter indicates an LNA nucleotide, or another chemically modified nucleotide (e.g., as described herein), and other letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). [Table 3]
[0111] In certain embodiments, the oligonucleotide has the sequence IAV-Pos, or a derivative thereof, as shown in Table 4, where a “+” preceding a letter indicates an LNA nucleotide, or another chemically modified nucleotide (e.g., as described herein), and other letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). [Table 4]
[0112] In certain embodiments, the oligonucleotide has the sequence IBV, or a derivative thereof, as shown in Table 5, where a “+” preceding a letter indicates an LNA nucleotide, or another chemically modified nucleotide (e.g., as described herein), and other letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). [Table 5]
[0113] In certain embodiments, the oligonucleotide has the sequence IBV-Pos, or a derivative thereof, as shown in Table 6, where a “+” preceding a letter indicates an LNA nucleotide, or another chemically modified nucleotide (e.g., as described herein), and other letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). [Table 6]
[0114] In certain embodiments, the oligonucleotide has the sequence Neg, or a derivative thereof, as shown in Table 7, where the "+" before the letter indicates an LNA nucleotide or another chemically modified nucleotide (as described herein, for example), and the other letter indicates a DNA nucleotide (i.e., a deoxyribonucleotide unit). [Table 7-1] [Table 7-2]
[0115] In certain embodiments, the oligonucleotide has the sequence miR, or a derivative thereof, as shown in Table 8, where the "+" before the letter indicates an LNA nucleotide or another chemically modified nucleotide (as described herein, for example), and the other letter indicates a DNA nucleotide (i.e., a deoxyribonucleotide unit). [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5]
[0116] In certain embodiments, the oligonucleotide has the sequence Cov, or a derivative thereof, as shown in Table 8, where the "+" before the letter indicates an LNA nucleotide or another chemically modified nucleotide (as described herein, for example), and the other letter indicates a DNA nucleotide (i.e., a deoxyribonucleotide unit). [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4]
[0117] In certain embodiments, the oligonucleotide has one of the following sequences, where uppercase letters indicate an LNA nucleotide and lowercase letters indicate a DNA nucleotide (i.e., a deoxyribonucleotide unit). a) LNA14:5'CGACcaaaagaATTC3' (SEQ ID NO: 81), b) LNA14.5:5'CGACcaaaagaATT3' (SEQ ID NO: 135), c) LNA14.8:5'CGACcaaaagaaTTC3' (Sequence ID 137), d) LNA14.28:5'GACcaaaagaatTCGG3' (Sequence ID 148), e) LNA14.30:5'GACCaaaagaattCGG3' (SEQ ID NO: 149) f) LNA9:5'TACTtactgacaGCC3' (SEQ ID NO: 75) g) LNA9.1:5'AGCAtacttactGACA3' (SEQ ID NO: 159), h) LNA9.2a:5'CATacttactgACA3' (SEQ ID NO: 160) i) LNA9.8:5'ATActtactgACAG(SEQ ID NO: 164), j) LNA9.12:5'CATActtactgacAGC (Sequence ID 167), k)LNA8a:5'AGAcagcgaccaaAAG (Sequence ID 188) l) LNA8a.1:5'AGACagcgaccaAAAG (SEQ ID NO: 189), and m)LNA8a.2:5'ACAGcgaccaAAAG(Sequence ID 190).
[0118] In certain embodiments, the oligonucleotide has a sequence selected from (a) to (e). In certain cases, the oligonucleotide has a sequence selected from (f) to (j). In certain other cases, the oligonucleotide has a sequence selected from (k) to (m).
[0119] It will be understood that for any sequence (a) to (m), or any sequence selected from any one of Tables 1 to 9, one or more LNA nucleotides may be substituted with modified nucleotides selected from BNA nucleotides, ENA nucleotides, cEt nucleotides, and 2'-modified nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with BNA nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with ENA nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with cEt nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with 2'-modified nucleotides (e.g., substituted with MOE and other substituents described herein).
[0120] It will also be understood that one or more DNA nucleotides may be modified in any of the above oligonucleotide sequences to provide the corresponding BNA, LNA, ENA, cEt, or 2'-modified nucleotide. In certain cases, one, two, three, four or more DNA nucleotides may be substituted with BNA nucleotides. In certain cases, one, two, three, four or more DNA nucleotides may be modified to provide the corresponding LNA nucleotide. In certain cases, one, two, three, four or more DNA nucleotides may be modified to provide the corresponding ENA nucleotide. In certain cases, one, two, three, four or more DNA nucleotides may be modified to provide the corresponding cEt nucleotide. In certain cases, one, two, three, four or more DNA nucleotides may be modified to provide the corresponding 2'-modified nucleotide (as described herein, for example).
[0121] Sequence variants of the above oligonucleotide sequences are also included in this disclosure. It is understood that mutations of one, two, three, four or more nucleotides in any of the sequences described herein may provide desirable properties such as enhanced inhibitory activity or conjugation to modifiers.
[0122] In some cases, one of the sequences described herein (for example, one of sequence numbers 45-907) is included in a longer sequence, for example, containing additional 5' and / or 3' nucleotides. In certain cases, the oligonucleotide of the subject is 75 nucleotides or less in length, such as 50 nucleotides or less, 40 nucleotides or less, or 35 nucleotides or less. In certain cases, the oligonucleotide of the subject is 30 nucleotides or less in length, such as 25 nucleotides or less, 20 nucleotides or less, 19 nucleotides or less, 18 nucleotides or less, 17 nucleotides or less, 16 nucleotides or less, 15 nucleotides or less, 14 nucleotides or less, 13 nucleotides or less, 12 nucleotides or less, 11 nucleotides or less, or 10 nucleotides or less.
[0123] In some cases, the oligonucleotide compound of the subject comprises a sequence having a deletion in relation to one of the sequences described herein (e.g., one of sequence numbers 45-907). For example, a sequence in which one, two, or three nucleotides are deleted from the 5' and / or 3' ends of one of sequence numbers 45-96. In some cases, the deletion sequence is missing one nucleotide from the 5' end of one of sequence numbers 45-907. In some cases, the deletion sequence is missing one nucleotide from the 3' end of one of sequence numbers 45-191. In some cases, the deletion sequence is missing two nucleotides from the 5' end of one of sequence numbers 45-907. In some cases, the deletion sequence is missing two nucleotides from the 3' end of one of sequence numbers 45-907.
[0124] In certain cases, the oligonucleotide contains a sequence having at least 70% homology to any one of the sequences (SEQ ID NO: 45) to (SEQ ID NO: 907) (as defined herein). In certain cases, the oligonucleotide contains a sequence having 70% or more homology to any one of the sequences (SEQ ID NO: 45) to (SEQ ID NO: 907), such as 75% or more, 80% or more, 85% or more, 90% or more, or more. In certain cases, the oligonucleotide contains a sequence having 70 to 80% homology to any one of the sequences (SEQ ID NO: 45) to (SEQ ID NO: 907). In certain cases, the oligonucleotide contains a sequence having 80% to 90% homology to any one of the sequences (SEQ ID NO: 45) to (SEQ ID NO: 907). In certain cases, the oligonucleotide contains a sequence having 90% to 99% homology to any one of the sequences (SEQ ID NO: 45) to (SEQ ID NO: 907).
[0125] In certain cases, oligonucleotide sequences may contain mutations designed to cover single nucleotide polymorphisms (SNPs) in the target PSL2 sequence. In some cases, the oligonucleotide is a modified version of LNA9 having a single mutant site that protects the PSL2 target sequence from a nucleotide change containing the LNA9 target sequence. It is understood that the desired SNP mutation may be applied to any of the sequences described herein. The desired mutant sequences are as follows: 5'TACTTACTGACAGTC3' (Sequence ID 91), 5'TACTTACCGACAGCC3' (SEQ ID NO: 92), and This includes, but is not limited to, 5'GGATTTCGGATGGCCA3' (SEQ ID NO: 93).
[0126] In certain embodiments, the oligonucleotide has one of the following sequences, where uppercase letters indicate LNA nucleotides and lowercase letters indicate DNA nucleotides. LNA9.G74C:5'TACTtactgacaGTC3'(SEQ ID NO: 94) LNA9.T80C:5'TACTtaccgacaGCC3' (SEQ ID NO: 95), and LNA19.U56C:5'GGATttcggatggCCA3' (Sequence ID 96).
[0127] It will be understood that any of the sequences (SEQ ID NOs. 94) to (SEQ ID NOs. 96), or one or more LNA nucleotides, may be substituted with modified nucleotides selected from ENA nucleotides, cEt nucleotides, and 2'-modified nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with ENA nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with cEt nucleotides. In certain cases, one, two, three, four or more LNA nucleotides may be substituted with 2'-modified nucleotides (e.g., substituted with MOE and other substituents described herein).
[0128] In certain cases, the oligonucleotide has a maximum length corresponding to a specific region of the PSL2 structure (e.g., a subregion corresponding to nucleotides 34-87). In certain cases, the oligonucleotide length is 20 nucleotides or less, such as 15 nucleotides or less, 14 nucleotides or less, 13 nucleotides or less, 12 nucleotides or less, 11 nucleotides or less, 10 nucleotides or less, 9 nucleotides or less, 8 nucleotides or less, 7 nucleotides or less, or less.
[0129] Oligonucleotides can be chemically synthesized by methods known in the art (see Wagner et al. (1993), above, and Milligan et al., above). Oligonucleotides can be chemically modified from their natural phosphodiester structures to increase intracellular stability and binding affinity. Several such modifications altering the chemical properties of the backbone, sugar, or heterocyclic base have been described in the literature.
[0130] Among the useful modifications in skeletal chemistry are phosphorothioates, phosphorodithioates in which both the non-crosslinked oxygen and phosphorus are substituted with sulfur, phosphoramidites, alkylphosphotriesters, and boranophosphates. Achiral phosphate derivatives include 3'-O'-5'-S-phosphorothioates, 3'-S-5'-O-phosphorothioates, 3'-CH2-5'-O-phosphonates, 3'-NH-5'-O-phosphoramides, and thiophosphoramides. Peptide nucleic acids replace the entire ribose phosphodiester skeleton with peptide bonds. Sugar modifications are also used to enhance stability and affinity. The α-anomer of deoxyribose may be used, with the bases inverted relative to the natural β-anomer. In certain cases, the 2'-OH of the ribose sugar may be altered, for example, as described herein. The 2'-OH group of ribose sugar may be modified to form a 2'-O-methyl or 2'-O-allyl sugar, which provides resistance to degradation without affecting affinity. In certain cases, modification of the 2'-OH group of ribose sugar can improve toxicity. Modification of heterocyclic bases must maintain appropriate base pairing. Some useful substitutions include deoxyuridine for deoxythymidine, and 5-methyl-2'-deoxycytidine and 5-bromo-2'-deoxycytidine for deoxycytidine. 5-propynyl-2'-deoxyuridine and 5-propynyl-2'-deoxycytidine have been shown to increase affinity and biological activity when substituted for deoxythymidine and deoxycytidine, respectively.
[0131] Oligonucleotide drugs can be derivatized with any suitable modifier, for example, by conjugation of the modifier to the 5' and / or 3' ends of the oligonucleotide sequence. In some cases, the modifier is a moiety that enhances cellular uptake (e.g., a lipid). Any suitable lipid can be conjugated to the oligonucleotide of the subject. In some cases, the modifier is a fatty acid attached to the 5' or 3' end via any linker. The lipid group can be an aliphatic hydrocarbon or fatty acid, including but not limited to hydrocarbons and fatty acid derivatives, examples of which are saturated linear compounds having 14 to 20 carbon atoms, such as myristic acid (tetradecanoic acid), palmitic acid (hexadecanoic acid), and stearic acid (octadecanoic acid), and their corresponding aliphatic hydrocarbon forms, tetradecane, hexadecane, and octadecane. Other suitable lipid groups that can be used include sterols such as cholesterol, as well as substituted fatty acids and hydrocarbons, particularly polyfluorinated forms of these groups. The range of lipid groups includes derivatives such as amines, amides, esters, and carbamate derivatives.
[0132] In some cases, the modifier is a further nucleic acid sequence having the desired activity (e.g., recruitment of RNases as described herein). In specific cases, the modifier has specific binding activity that provides delivery of oligonucleotides to specific targets, such as cell-specific proteins. In some cases, the modifier is an antibody of interest that specifically binds to the cell-specific target of interest. In specific cases, the antibody modifier specifically binds to a hemagglutinin (HA) target.
[0133] Oligonucleotide activators can be used in any convenient form. In some cases, the oligonucleotide activator is single-stranded. In some cases, the oligonucleotide activator is double-stranded. In some cases, the oligonucleotide activator is siRNA. In some cases, the oligonucleotide activator is shRNA. In some cases, the oligonucleotide activator is ssRNA. In some cases, one or more nucleotides of the ssRNA may be substituted with LNA nucleotides. In some cases, the oligonucleotide activator is ssDNA. In some cases, one or more nucleotides of the ssDNA may be substituted with LNA nucleotides.
[0134] Treatment method Individuals can be infected with influenza A virus alone, and / or other respiratory viruses, including but not limited to influenza B virus (IBV), coronavirus (CoV), and respiratory syncytial virus (RSV).
[0135] The present invention is particularly well suited to functioning as a just-in-time vaccine for the prevention and / or treatment of respiratory infections. In addition, the present invention can be administered co-administered with other vaccines to provide immediate protection during the period required for other vaccines to become effective. In addition, the present invention can be administered to vaccinated individuals at risk of exposure to vaccine-resistant variants. In addition, the present invention can be administered to vaccinated individuals who are asymptomatic but still capable of transmitting the virus.
[0136] The oligonucleotides described in this invention may be used alone or in combination with other oligonucleotides to prevent and / or treat the respiratory viruses described herein.
[0137] Aspects of this disclosure include methods for treating or preventing influenza A virus infection, influenza B, coronavirus, and respiratory syncytial virus (RSV) in subjects. The oligonucleotide compounds of the subject are used as a novel class of antiviral therapeutic agents that can efficiently disrupt the packaging and completely prevent otherwise fatal diseases in vivo. As demonstrated in the Examples section, intranasal administration of exemplary oligonucleotide compounds in vivo resulted in a potent antiviral effect and prevented fatal IAV infection in mice.
[0138] Embodiments of this method include administering a therapeutically effective dose of a compound of the subject to a subject in need of administration to treat an infection in the subject or to prevent an infection in the subject. “Therapeutic dose” means a concentration of the compound sufficient to induce a desired biological effect (e.g., treatment or prevention of a condition or disease, influenza A virus infection). “Treatment” means that at least improvement of the symptoms associated with the condition afflicting the host is achieved, and improvement is used more broadly to refer to at least a reduction in a parameter associated with the treated condition, e.g., the severity of the symptoms. Therefore, treatment also includes situations in which a pathological condition, or at least its associated symptoms, are completely inhibited, e.g., prevented from occurring or stopped, e.g., terminated, so that the host no longer suffers from the condition or at least the symptoms characterizing the condition. Therefore, treatment includes (i) prevention, i.e., reducing the risk of developing clinical symptoms, including preventing the development of clinical symptoms, e.g., preventing the progression of the disease to an adverse condition; (ii) inhibition, i.e., preventing the development or further development of clinical symptoms, e.g., reducing or completely inhibiting an active disease (e.g., an infection); and / or (iii) mitigation, i.e., causing regression of clinical symptoms. In the context of influenza A virus infection, the term “treating” includes any or all of the following: reducing the number of viral cells in a patient sample, inhibiting viral cell replication, and improving one or more symptoms associated with the infection.
[0139] The subject to be treated may be one in need of treatment, and the host to be treated is a host suitable for treatment with the compound of the subject. In some embodiments, the subject is one suspected of having influenza A virus infection. In certain embodiments, the subject is diagnosed with influenza A virus infection. Thus, in some cases, the subject is one infected with the virus.
[0140] In certain cases, the subject is one who is at risk of or suspected of being infected with the virus. In some embodiments, the vRNA is PB2 vRNA. The method of the subject may be used to prevent infection of a subject with the influenza A virus. "Prevention" means that a subject at risk of influenza A virus infection does not become infected despite being exposed to the virus under conditions that would normally lead to infection. In some cases, administration of the activator of the subject (e.g., an oligonucleotide compound) protects the subject from infection for more than one week, such as more than two weeks, more than three weeks, more than one month, more than two months, or more than three months. Multiple doses of the compound of the subject may be administered according to the method of the subject to provide long-term protection against the form of infection of the subject. Timing and dosage can be easily determined using conventional methods.
[0141] In some cases, the treatment method for the subject includes a step of determining or diagnosing whether the subject has an influenza A virus infection. The determination step may be performed using any convenient method. In some cases, the determination step includes obtaining a biological sample from the subject and assaying the sample for the presence of viral cells. The sample may be a cellular sample. The determination step may include identifying viral cells containing a particular mutation.
[0142] Therefore, a variety of subjects may be suitable for treatment using the subject compounds and pharmaceutical compositions disclosed herein. As used herein, the terms “subject” and “host” are interchangeable. Generally, such subjects are “mammals,” and humans are the subject of interest. Other subjects include domesticated pets (e.g., dogs and cats), livestock (e.g., cattle, pigs, goats, horses, etc.), rodents (e.g., mice, guinea pigs, and rats, e.g., animal models of diseases), and non-human primates (e.g., chimpanzees and monkeys).
[0143] The amount of the subject compound administered can be determined by any convenient method so as to be sufficient to produce the desired effect in conjunction with a pharmaceutically acceptable diluent, carrier, or vehicle. The specifications of the unit dosage forms of the present invention depend on the specific compound used and the effect to be achieved, as well as the pharmacodynamics associated with each compound in the host.
[0144] Aspects of this disclosure include methods for treating or preventing coronavirus (CoV) infection. The oligonucleotide compounds of subject matter efficiently disrupt the RNA secondary structure of CoV and are therefore used as a novel class of antiviral therapeutic agents capable of treating or preventing CoV infection in a subject. In some cases, the oligonucleotide compounds of subject matter can inhibit host miRNA interactions with CoV. In some cases, the oligonucleotide compounds of subject matter are used as novel antiviral therapeutic agents capable of efficiently disrupting the RNA secondary structure of CoV, disrupting its packaging, and completely preventing otherwise fatal disease in vivo. In specific cases, CoV is selected from HCoV-229E, HCoV-OC43, SARS-CoV, HCoV-NL63, HKU1, MERS-CoV, and SARS-CoV-2. In specific cases, CoV is SARS-CoV-2.
[0145] Embodiments of this method include administering a therapeutically effective dose of a compound of the subject to a subject in need of administration to treat an infection in the subject or to prevent an infection in the subject. “Therapeutally effective dose” means a concentration of the compound sufficient to induce a desired biological effect (e.g., treatment or prevention of a condition or disease, influenza A, influenza B, coronavirus infection, RSV infection). “Treatment” means that at least improvement of the symptoms associated with the condition afflicting the host is achieved, and improvement is used more broadly to refer to at least a reduction in a parameter associated with the treated condition, e.g., the severity of the symptoms. Therefore, treatment also includes situations in which a pathological condition, or at least its associated symptoms, are partially or completely inhibited, e.g., prevented from occurring or stopped, e.g., terminated, so that the host no longer suffers from the condition, or at least the symptoms characterizing the condition. Therefore, treatment includes (i) prevention, i.e., reducing the risk of developing clinical symptoms, including preventing the development of clinical symptoms, e.g., preventing the progression of the disease to an adverse condition; (ii) inhibition, i.e., preventing the development or further development of clinical symptoms, e.g., reducing or completely inhibiting active disease (e.g., infection); (iii) palliative treatment, i.e., causing regression of clinical symptoms; (iv) preventing the need for a serious condition requiring hospitalization or intensive care unit (ICU); (v) shortening the length of hospitalization or ICU stay; (vi) preventing or reducing the need for assisted ventilation, including but not limited to supplemental oxygen, non-invasive positive pressure ventilation (CPAP and / or BPAP), and mechanical ventilation; (vi) preventing or reducing the need for assisted cardiopulmonary bypass, such as an extracorporeal membrane oxygenation (ECMO) device; (vii) preventing the development of multiple bacterial infections; and (viii) preventing death.In the context of influenza A, influenza B, and coronavirus (CoV) infections, the term “to treat” includes any or all of the following: reducing the number of viruses in the body; reducing the number of virus-infected cells in a patient; inhibiting the replication of viruses and virus-infected cells inside and / or outside cells; and improving one or more symptoms associated with the infection.
[0146] The subject to be treated may be one in need of treatment, and the host to be treated is a host suitable for treatment with the compound of the subject. In some embodiments, the subject is one suspected of having a coronavirus infection. In certain embodiments, the subject is diagnosed with having a coronavirus infection. Therefore, in some cases, the subject is one infected with the virus.
[0147] In certain cases, the subject is one who is at risk of or suspected of being infected with the virus. The method of the subject may be used to prevent infection of the subject with coronavirus. "Prevention" means that a subject at risk of coronavirus infection does not become infected, or the severity of infection is reduced, despite being exposed to the virus under conditions that would normally lead to infection. In some cases, administration of the subject's activator (e.g., an oligonucleotide compound) provides immediate protection of the subject from infection for more than one week, such as more than two weeks, more than three weeks, more than one month, more than two months, or more than three months. Multiple doses of the subject's compound can be administered according to the method of the subject to provide long-term protection against the form of infection of the subject. Timing and dosage can be easily determined using conventional methods.
[0148] In some cases, the treatment method for the subject includes a step of determining or diagnosing whether the subject has coronavirus infection. The determination step may be performed using any convenient method. In some cases, the determination step includes obtaining a biological sample from the subject and assaying the sample for the presence of intracellular and / or extracellular viruses and virus-infected cells. The sample may be a cell sample. The determination step may include the identification of intracellular and / or extracellular viruses and virus-infected cells containing specific mutations.
[0149] In some embodiments, the effective dosage of the compound in question is approximately 50 ng / ml to approximately 50 μg / ml (for example, approximately 50 ng / ml to approximately 40 μg / ml, approximately 30 ng / ml to approximately 20 μg / ml, approximately 50 ng / ml to approximately 10 μg / ml, approximately 50 ng / ml to approximately 1 μg / ml, approximately 50 ng / ml to approximately 800 ng / ml, approximately 50 ng / ml to approximately 700 ng / ml, approximately 50 ng / ml to approximately 600 ng / ml, approximately 50 ng / ml to approximately 500 ng / ml, approximately 50 ng / ml to approximately 400 ng / ml, approximately 60 ng / ml to approximately 400 ng / ml). This refers to the effective volume of mass concentrations in the following ranges: approximately 70 ng / ml to approximately 300 ng / ml, approximately 60 ng / ml to approximately 100 ng / ml, approximately 65 ng / ml to approximately 85 ng / ml, approximately 70 ng / ml to approximately 90 ng / ml, approximately 200 ng / ml to approximately 900 ng / ml, approximately 200 ng / ml to approximately 800 ng / ml, approximately 200 ng / ml to approximately 700 ng / ml, approximately 200 ng / ml to approximately 600 ng / ml, approximately 200 ng / ml to approximately 500 ng / ml, approximately 200 ng / ml to approximately 400 ng / ml, or approximately 200 ng / ml to approximately 300 ng / ml.
[0150] In some embodiments, the effective amount of the compound in question is about 10 pg to about 100 mg, for example, about 10 pg to about 50 pg, about 50 pg to about 150 pg, about 150 pg to about 250 pg, about 250 pg to about 500 pg, about 500 pg to about 750 pg, about 750 pg to about 1 ng, about 1 ng to about 10 ng, about 10 ng to about 50 ng, about 50 ng to about 150 ng, about 150 ng to about 250 ng, about 25 The amounts range from 0 ng to approximately 500 ng, approximately 500 ng to approximately 750 ng, approximately 750 ng to approximately 1 μg, approximately 1 μg to approximately 10 μg, approximately 10 μg to approximately 50 μg, approximately 50 μg to approximately 150 μg, approximately 150 μg to approximately 250 μg, approximately 250 μg to approximately 500 μg, approximately 500 μg to approximately 750 μg, approximately 750 μg to approximately 1 mg, approximately 1 mg to approximately 50 mg, approximately 1 mg to approximately 100 mg, or approximately 50 mg to approximately 100 mg. The amount may be a single dose or the total daily dose. The total daily dose may be in the range of 10 pg to 100 mg, or in the range of 100 mg to approximately 500 mg, or in the range of 500 mg to approximately 1000 mg.
[0151] In some embodiments, a single dose of the subject compound is administered. In other embodiments, multiple doses of the subject compound are administered. When multiple doses are administered over a period of time, the subject compound may be administered twice daily (qid), daily (qd), every other day (qod), every three days, three times a week (tiw), or twice a week (biw) over that period. For example, the compound may be administered at qid, qd, qod, tiw, or biw intervals over a period of time ranging from one day to approximately two years or more. For example, the compound may be administered at any of the above frequencies for a period of one week, two weeks, one month, two months, six months, one year, or two years or longer, depending on various factors.
[0152] The effectiveness of a treatment method can be determined using one of several methods. For example, a biological sample obtained from an individual treated with the method of the subject may be assayed for the presence and / or levels of viral cells. Evaluation of the effectiveness of a treatment method for a subject may include evaluation of the subject before, during, and / or after treatment using any convenient method. Embodiments of the method of the subject further include a step of evaluating the subject's therapeutic response to the treatment.
[0153] In some embodiments, the method includes evaluating the condition of a subject, including diagnosing or evaluating one or more symptoms of the subject related to the disease or condition of interest to be treated (e.g., as described herein). In some embodiments, the method includes obtaining a biological sample from the subject and assaying the sample for the presence of viral cells or components related to the disease or condition of interest (e.g., as described herein). The sample may be a cellular sample. The evaluation step of the subject method may be performed one or more times before, during, and / or after administration of the compound of subject using any convenient method. In certain cases, the evaluation step includes identification and / or quantification of viral cells. In certain cases, evaluating the subject includes diagnosing whether the subject has a viral infection or has symptoms thereof.
[0154] Screening method Aspects of the present disclosure also include, for example, screening assays configured to identify agents to be used in the methods of the present invention, as outlined above. Aspects of the present disclosure include methods for screening candidate agents for their ability to inhibit influenza A virus in cells. In some cases, the method includes contacting a sample containing viral RNA (vRNA) containing a PSL2 motif with a candidate agent and determining whether the candidate agent specifically binds to the PSL2 motif. In some cases, the agent that specifically binds to the PSL2 motif treats subjects having influenza A virus infection. In some cases, the method includes contacting a sample containing viral RNA (vRNA) containing a segment of influenza B genomic RNA with a candidate agent and determining whether the candidate agent specifically binds to the vRNA. In some cases, the agent that specifically binds to the HA motif treats subjects having influenza B virus infection. To evaluate or determine means to at least predict that a given test compound has desirable activity such that further testing of the compound in additional assays, such as animal models and / or clinical assays, is desired.
[0155] Candidate drugs are selected from small molecules, oligonucleotides, antibodies, and polypeptides. In some cases, the determination step involves detecting cellular parameters, and changes in intracellular parameters compared to cells not in contact with the candidate drug indicate that the candidate drug specifically binds to the PSL2 motif. In some cases, the subject screening method is an RNA structure mapping method such as SHAPE analysis (selective 2'-hydroxyacylation analyzed by primer extension). In specific cases, the candidate drug is an oligonucleotide.
[0156] Drug screening can be performed using in vitro models, genetically modified cells or animals, or purified PSL2 protein. Drug screening can identify ligands that compete with, modulate, or mimic the action of lead drugs. Drug screening identifies drugs that bind to specific sites on the PSL2 motif. For this purpose, a wide variety of assays can be used, including labeled in vitro binding assays, electrophoretic mobility shift assays, and protein binding immunoassays. Knowledge of the three-dimensional structure of PSL2 derived from the structural studies described herein can also lead to the rational design of small drugs that specifically inhibit IAV activity.
[0157] As used herein, the term “drug” refers to any molecule, e.g., oligonucleotide, protein, or pharmaceutical, that has the ability to bind to PSL2 and inhibit IAV. Generally, multiple assay mixtures are run in parallel at different drug concentrations to obtain differential responses to various concentrations. Typically, one of these concentrations serves as a negative control, i.e., at zero concentration or below detection level.
[0158] Aspects of the present disclosure also include, for example, screening assays configured to identify agents to be used in the methods of the present invention, as outlined above. Aspects of the present disclosure include methods for screening candidate agents for their ability to inhibit coronavirus in cells. In some cases, the method includes contacting a sample containing viral RNA (vRNA) containing a conserved RNA secondary structure of CoV with a candidate agent and determining whether the candidate agent specifically binds to the conserved RNA secondary structure motif. In some cases, an agent that specifically binds to a conserved RNA secondary structure motif treats a subject having a coronavirus infection. To evaluate or determine means to at least predict that a given test compound has desirable activity such that further testing of the compound in additional assays, such as animal models and / or clinical assays, is desired.
[0159] Candidate drugs encompass a wide range of chemical classes, including oligonucleotides, antibodies, polypeptides, and organic molecules, such as small organic compounds with molecular weights greater than 50 daltons and less than approximately 2,500 daltons. Candidate drugs contain functional groups necessary for structural interactions with proteins, particularly hydrogen bonding, and typically include at least two of the following: amine, carbonyl, hydroxyl, or carboxyl groups, preferably functional chemical groups. Candidate drugs often include cyclic carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate drugs are also found in biomolecules, including peptides, sugars, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs, or combinations thereof.
[0160] Candidate drugs can be obtained from a wide variety of sources, including libraries of synthetic or natural compounds. For example, numerous means are available for the random and targeted synthesis of a wide variety of organic compounds and biomolecules, including the expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are available or readily produced. Additionally, libraries and compounds produced naturally or synthetically can be readily modified through conventional chemical, physical, and biochemical means and used to produce combination libraries. Known pharmacological agents can undergo direct or random chemical modifications, such as acylation, alkylation, esterification, and amidation, to produce structural analogues. In certain embodiments, the target is a compound that crosses the blood-brain barrier.
[0161] If the screening assay is a binding assay, one or more molecules may be bound to a member of a signal-producing system, such as a label, which can directly or indirectly provide a detectable signal. Various labels include, but are not limited to, radioisotopes, fluorescent substances, chemiluminescent substances, enzymes, specific binding molecules, and particles, such as magnetic particles. Examples of specific binding molecules include pairs such as biotin and streptavidin, and digoxin and anti-digoxin. For specific binding members, the complementary member is usually labeled with a molecule that provides detection according to a known procedure.
[0162] Various other reagents may be included in the screening assay. These include reagents such as salts, neutral proteins, e.g., albumin, detergents, used to promote optimal protein-protein binding and / or reduce nonspecific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, and antimicrobial agents, may be used. The mixture of components is added in any order that provides the desired binding. Incubation is performed at any suitable temperature, typically 4–40°C. The incubation period is selected for optimal activity but can also be optimized to facilitate rapid, high-throughput screening. Typically, 0.1–1 hour is sufficient. [Examples]
[0163] The following examples are provided to those skilled in the art to provide a complete disclosure and description of the methods of preparation and use of the present invention, and are not intended to limit the scope of what the inventors consider to be the invention, nor are they intended to represent that the following experiments are all or only experiments that can be performed. While efforts have been made to ensure accuracy to the figures used (e.g., quantity, temperature, etc.), some degree of experimental error and deviation should be taken into consideration. Unless otherwise indicated, parts are by weight, molecular weight is weight-average molecular weight, temperature is in degrees Celsius, and pressure is atmospheric pressure or approximate atmospheric pressure. Standard abbreviations, e.g., bp, base pair; kb, kilobase; pl, picoliters; s or sec, seconds; min, minutes; h or hr, hours; aa, amino acid; kb, kilobase; bp, base pair; nt, nucleotide; im, intramuscular; ip, intraperitoneal; sc, subcutaneous, etc. may be used.
[0164] Materials and methods Cells and viruses: HEK293T and MDCK cells were obtained from the American Type Culture Collection (Manasass, VA) and maintained in Dulbecco's Modified Eagle Medium containing 10% fetal bovine serum and penicillin-streptomycin (Gibco). Influenza A / PR / 8 / 34 (PR8)H1N1 virus was generated using an 8-plasmid reverse gene system. Tissue culture-adapted influenza A / Hong Kong / 8 / 68 (HK68)H3N2 virus was obtained from ATCC (ATCC-VR-1679). The viruses were grown and amplified at 35°C in 10-day-old chicken embryos free of specific pathogens (Charles River Laboratories, SPAEAS).
[0165] Plasmid constructs and cloning: Plasmids containing wild-type PB2 segments derived from influenza viruses A / Puerto Rico / 8 / 34(H1N1)[PR8], A / New York / 470 / 2004(H3N2)[NY470], A / New York / 312 / 2001(H1N1)[NY312], A / Brevig Mission / 1 / 1918(H1N1)
[1918] , A / California / 04 / 2009(H1N1)[CA09], A / Vietnam / 03 / 2004(H5N1)[VN1203], and A / Anhui / 1 / 2013(H7N9) were used. For the generation of PR8 packaging mutant vRNA, the Stratagene QuickChange XL site-directed mutagenesis kit (Stratagene) was used to induce mutagenesis in the pDZ plasmid containing the PR8 PB2 gene. The sequences of each mutant construct were confirmed by automated sequencing.
[0166] Reverse genetics and viral titration: Influenza A / Puerto Rico / 8 / 34 (PR8) virus was generated using an 8-plasmid reverse gene system (Hoffman et al., 2000). Briefly, to produce recombinant PR8 virus, 10 6293T / MDCK cell co-cultures were transfected with 1 µg of Lipofectamine 3000 (Invitrogen) with one of each of the eight segments contained in a plasmid utilizing a bidirectional dual POL I / II promoter system for simultaneous synthesis of genomic vRNA and mRNA. Cells were collected 24 hours after transfection and inoculated into the allantois space of 10-day-old chicken embryos (Charles River, research-grade, pathogen-free eggs). Rescue of recombinant viruses was assessed by hemagglutination activity. Each newly rescued virus was further subjected to plaque titer measurement, and mutations were confirmed by sequencing of the mutated gene. Plaque assays were performed on confluent MDCK cells as previously described (Szretter et al., 2006). Hemagglutination (HA) assays were performed in 96-well round-bottom plates at room temperature using 50 µg of virus diluent and 0.5% turkey erythrocyte suspension in 50 µg of phosphate-buffered saline (PBS).
[0167] Viral replication kinetics: The replication kinetics of the PR8 virus were determined by inoculating 10-day-old chicken eggs with 100 plaque-forming units (PFUs) of the virus. 72 hours after inoculation, the viral titer in the allanantium fluid was determined by titration of plaques on MDCK cells.
[0168] Isolation of packaged vRNA: To analyze packaged vRNA for the PR8 mutant virus, approximately 1000 PFU of recombinant virus was inoculated into 10-day-old eggs and incubated for 72 hours. Allaneal fluid was collected, and the supernatant was clarified by slow centrifugation. The clarified supernatant was then placed on a 30% sucrose cushion and ultracentrifuged at 30,000 RPM for 2.5 hours (Beckman Rotor SW41). The pelletized virus was resuspended in PBS and extracted with TRIzol (Invitrogen). The precipitated vRNA was resuspended in 20 μl of 10 mM Tris-HCl (pH 8.0) and stored at -80°C.
[0169] qPCR analysis of packaged vRNA: Approximately 200 ng of extracted vRNA was reverse transcribed using a universal 3' primer (5'-AGGGCTCTTCGGCCAGCRAAAGCAGG) (SEQ ID NO: 97) and Superscript III reverse transcriptase (RT) (Invitrogen). The RT product was diluted 10,000-fold and used as a template for quantitative PCR (qPCR). Separate PCRs were then performed with segment-specific primers as previously described (Marsh et al., 2007). 10 μl of the reaction mixture contained 1 μl of diluted RT product, a primer concentration of 0.5 μM, and SYBR Select Master Mix (Applied Biosystems) containing SYBR GreenER dye, 200 μM deoxynucleoside triphosphate, heat-unstable UDG, optimized SYBR Green Select Buffer, and AmpliTaq DNA polymerase UP enzyme. Relative vRNA concentrations were determined by cycle threshold analysis, total vRNA amounts were normalized by equalizing HA vRNA levels, and then the integration percentage was calculated relative to the wt vRNA packaging level. The viral packaging results represent the mean level ± standard deviation of vRNA integration derived from two independent viral purifications, and vRNA levels were quantified in triple, n=6.
[0170] Mouse infection: A group of 6-8 week old female BALB / C mice (Jackson Laboratory) were lightly anesthetized with isoflurane and intranasal-infected with 50 µl of 1000 PFU of wild-type mouse-adapted PR8 (H1N1) virus (ATCC), PB2-mutated PR8 recombinant virus, or sterile PBS. Body weight was measured daily, and animals were humanely euthanized by day 10 or when weight loss exceeded 20%. All animal care and experimental procedures followed the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and were approved by the Stanford University Administrative Panel on Laboratory Animal Care.
[0171] Design and Preparation of Locked Nucleic Acids (LNAs): Oligonucleotides containing locked nucleic acids (LNAs) were custom synthesized from Exiqon. Uppercase letters indicate LNAs. Lowercase letters indicate typical (unlocked) DNA nucleotides. All oligonucleotides contained phosphorothioate nucleoside bonds. The LNAs were designed to be complementary to various sequences contained in the PSL2 structure of segment PB2. LNA8a and 9 were designed to contain a stretch of 6-8 DNA nucleotides for RNAse-H recruitment. The sequences of all LNAs are shown below. LNA1:5'AccAaaAGaaT3'(Sequence ID 67) LNA2:5'TggCcATcaaT3'(Sequence ID 68) LNA3:5'TagCAtActtA3' (SEQ ID NO: 69) LNA4:5'CCAAAAGA3'(Sequence ID 70) LNA5:5'CATACTTA3'(SEQ ID NO: 71) LNA6:5'CagaCaCGaCCaaAA3' (Sequence ID 72) LNA7:5'TAcTtaCTgaCagCC3'(SEQ ID NO: 73) LNA8a:5'AGAcagcgaccaaAAG3'- Possesses RNase-H activity (SEQ ID NO: 188) LNA9:5'TACTtactgacaGCC3'-RNase-H activity is present (SEQ ID NO: 75) LNA9.2:5'TACttactgacAGCC3'(SEQ ID NO: 76) LNA10:5'ACCaaaagAAT3'(Sequence ID 77) LNA11:5'TGGccatcAAT3'(SEQ ID NO: 78) LNA12:5'TAGcatacTTA3'(SEQ ID NO: 79) LNA13:5'CgacCAaaAGaattC3' (Sequence ID 80) LNA14:5'CGACcaaaagaATTC3' (SEQ ID NO: 81) LNA15:5'GaTGgCcATcaAttA3'(SEQ ID NO: 82) LNA16:5'GATGgccatcaATTA3'(Sequence ID 83) LNA17:5'TcTAgCaTActTacT3'(SEQ ID NO: 84) LNA18:5'TCTAgcatactTACT3'(SEQ ID NO: 85) LNA19:5'GAAttcggatgGCCA3'(Sequence ID 86) LNA20:5'GGCCatcaattaGTG3'(Sequence ID 87) LNA21:5'TTCGgatggccaTCA3'(Sequence ID 88) LNA22:5'AGCCagacagCGA3' (Sequence ID 89) LNA23:5'GACAgccagacaGCA3' (Sequence ID 90)
[0172] The following oligonucleotides were designed to cover single nucleotide polymorphisms (SNPs) in the PSL2 sequence. The following exemplary sequences are modified versions of LNA9 with a single mutation site that protects the PSL2 sequence from several bird and bat strains containing nucleotide changes with the LNA9 target sequence. It should be understood that similar designs can be applied to any of the sequences described herein. LNA9.G74C:5'TACTtactgacaGTC3'(SEQ ID NO: 94) LNA9.T80C:5'TACTtaccgacaGCC3'(SEQ ID NO: 95) LNA19.U56C:5'GGATttcggatggCCA3'(Sequence ID 96)
[0173] Antiviral assay: LNA was reconstituted at 100 μM in RNAse-free water, aliquoted, and stored at -20°C before single use. Using Lipofectamine 3000 (Life Technology), LNA was transfected into cells at final concentrations of 1 μM, 100 nM, 10 nM, and 1 nM according to the manufacturer's protocol. For prophylactic antiviral assays, 10 24 hours before transfection with the indicated LNA 6 Individual MDCK cells were seeded in 6-well plates. The cells were then infected with 0.01 MOI PR8(H1N1) or HK68(H3N2) virus 4 hours, 2 hours, or 1 hour after transfection. Post-infection, MDCK cells were infected with PR8 or HK68 as described for therapeutic antiviral evaluation. LNA was then transfected 4 hours, 2 hours, or 1 hour after infection. 48 hours after infection, the supernatant was collected and viral titers were determined by plaque assay.
[0174] Cellular SARS-CoV-2 Replication Assay: For the cell replication assay, LNA ASO was reconstituted in RNase-free water with a 100 μM stock solution, aliquoted, and stored at -20°C before single use. One day prior to transfection, Huh-7, Vero E6, or ACE-A549 cells were seeded in 96-well clear-bottom plates to a culture density of 60–70% upon treatment with LNA ASO or scrambled LNA. Using Lipofectamine 3000® (Life Technologies), LNA ASO was transfected to cells at a final concentration of 25 nM or 100 nM according to the manufacturer's protocol. Cells were then infected with a SARS-CoV-2 reporter virus expressing nanoluciferase (SARS-CoV-2 nLUC) at a MOI of 0.3 for 1 hour, after which the virus was removed and fresh medium was added. Recombinant SARS-CoV-2 nLUC is a true, fully replicating virus in which ORF7 is deleted and replaced with nLUC. Therefore, measuring nLUC expression is a surrogate marker of viral replication that enables the screening of antiviral compounds.
[0175] In vitro transcription of vRNA: For each wild-type isolate (PR8, 1918, VN1203, NY470, NY312, CA09, and A / Anhoy / 1 / 2013 H7N9) and the PR8 packaging mutant clone, PB2 cDNA was amplified from plasmids using segment-specific primers under the T7 promoter. The amplified cDNA was gel-purified using the Invitrogen DNA gel kit. Then, vRNA was generated by in vitro transcription using T7-MEGAscript. The vRNA for shaping was purified using MEGAclear (Thermofisher, catalog number AM1908), and its purity and length were verified by capillary electrophoresis.
[0176] vRNA sf-SHAPE analysis: PB2 vRNA was folded in 100 mM HEPES (pH=8) (100 mM NaCl, 2.5 mM MgCl, 65°C for 1 minute, cooled at room temperature for 5 minutes, and then 37°C for 20–30 minutes). As previously described (Mortimer and Weeks, 2009), 2 minutes of acylation in NMIA (Wilkinson et al., 2006) and reverse transcription (RT) primer extension were performed at 45°C for 1 minute, 52°C for 25 minutes, and 65°C for 5 minutes. 6FAM was used for all labeled primers. Exceptions to these protocols were as follows: (i) RNA purification after acylation was performed using an RNA C&C column (Zymo Research) instead of ethanol precipitation, (ii) the mixture was left at room temperature for 2-5 minutes before and after adding SHAPE primer buffer to significantly enhance the RT transcription yield, (iii) DNA purification was performed using a Sephadex G-50 size exclusion resin in a 96-well format, then concentrated by vacuum centrifugation to more significantly remove primers, and (iv) 2 pmol of RNA was used in the ddGTP RNA sequencing reaction.
[0177] An ABI 3100 Genetic Analyzer (50 cm capillary packed with POP6 matrix) was set to the following parameters: voltage 15 kV, T=60°C, injection time=15 seconds. Using the GeneScan program, data was acquired for each sample consisting of purified DNA resuspended in 9.75 μl of Hi-Di formamide with the addition of 0.25 μl of ROX500 internal size standard (ABI catalog 602912). PeakScanner parameters were set to the following: smoothing=none, window size=25, size call=local southern, baseline window=51, peak threshold=15. Fragments 250 and 340 were computationally excluded from the ROX500 standard (Akbari et al., 2008). The data from PeakScanner was then processed into SHAPE data using a custom program (Pang et al., 2011) called FAST (fast analysis of SHAPE traces). FAST automatically corrects for signal differences due to handling errors, adjusts for signal attenuation, and converts fragment lengths to nucleotide positions using the ddGTP ladder as an external sizing standard and local Southern sizing (Pang et al., 2011 and Pang et al., 2012).
[0178] RNAstructure parameters: The gradient and intercept parameters of 2.6 and -0.8 kcal / mol were initially tried as suggested (Deigan et al., 2009), and it was found that smaller intercepts, closer to 0.0 kcal / mol (e.g., about -0.3), produced fewer optimal structures (within a 10% maximum energy difference). This slight difference in parameters may be due to the precise fitting achieved between the experimental and reference datasets by the automated FAST algorithm. In the current implementation, FAST is integrated into RNAstructure, requiring MFC (Microsoft Foundation Classes). RNA structures were plotted and colored using RNAViz2 (De Rijk et al., 2003) and finalized in Adobe Illustrator.
[0179] Construct design, RNA synthesis, and chemical modification for mutation and mapping experiments: As previously described, double-stranded DNA templates were prepared by PCR assembly of DNA oligomers designed by automated MATLAB® (NA_Thermo, available at "https: / / github.com / DasLab / NA_thermo") (Kladwang and Cordero et al., 2011). Constructs for mutation and mapping (M 2 ) includes all single variants for the corresponding Watson-Crick region. Compensatory variants for mutation / rescue were designed based on base pairing in the proposed secondary structure (Tian et al., 2014). In vitro transcription, RNA purification, and quantification steps are as previously described (Kladwang and Cordero et al., 2011). One-dimensional chemical mapping, mutation, and mapping (M 2Modification and mutation / rescue were performed in a 96-well format as previously described (Kladwang and VanLang et al., 2011; Kladwang and Cordero et al., 2011; Cordero et al., 2013). Briefly, RNA was heated and cooled to remove secondary structure heterogeneity, then properly folded and incubated with SHAPE reagent (5 mg / mL of 1-methyl-7-nitroisatoic anhydride (1M7)) (Mortimer and Weeks, 2007). The modification reaction was quenched, and RNA was recovered using poly(dT) magnetic beads (Ambion) and FAM-labeled Tail2-A20 primers. RNA was washed twice with 70% ethanol (EtOH) and resuspended in ddH2O. Subsequently, it was reverse transcribed to cDNA, heated with NaOH, and RNA was removed. The final cDNA library was recovered by magnetic bead separation, rinsed, eluted in Hi-Di formamide (Applied Biosystems) using a ROX-350 ladder, and loaded into a capillary electrophoresis sequencer (ABI3100). Data processing, structural modeling, and data deposition: CE data were analyzed using version 2.0 of the HiTRACE software package (both MATLAB® toolbox and web server are available (Yoon et al., 2011; Kim et al., 2013)). Trace alignment, baseline subtraction, sequence assignment, profile fitting, decay correction, and normalization were achieved as previously described (Kim et al., 2009; Kladwang et al., 2014). Sequence assignment was performed manually with validation from the sequencing ladder. Data-driven secondary structure models were obtained using the RNAstructure package version 5.4 folding program (Mathews et al., 2004) with pseudo-energy gradients of 2.6 kcal / mol and -0.8 kcal / mol, and intercept parameters. 2The two-dimensional Z-score matrix and helix-wise bootstrapping confidence values for the dataset were calculated as previously described (Tian et al., 2014; Kladwang and VanLang et al., 2011). The Z-score matrix was used as base-pair-wise pseudo-free energy with slopes and intercepts of 1.0 kcal / mol and 0 kcal / mol. Secondary structure images were generated by VARNA (Darty et al., 2009). All chemical mapping datasets, including one-dimensional mapping, mutations and maps, and mutation / rescue, are deposited in the RNA mapping database ("http:" followed by " / / rmdb.stanford." followed by "edu") (Cordero et al., 2012).
[0180] SHAPE analysis of LNA-targeted vRNA: A DNA template of PR8 segment PB2 was prepared by PCR assembly of DNA oligomers, and the in vitro transcription reaction, RNA purification, and quantification steps were as previously described (Kladwang and VanLang et al., 2011). One-dimensional SHAPE chemical mapping was performed in 96-well plate format as described above, except as follows: The RNA was denatured and refolded as described, and 100 nM of each prepared LNA was added to the folded RNA, which was incubated with 5 mg / mL of SHAPE reagent 1M7 (1-methyl-7-nitroisatoic anhydride). Modification quench, RNA recovery, resuspension, reverse transcription, cDNA sequencing, and data processing were performed as described; see Kladwang and VanLang et al., 2011.
[0181] Example 1: SHAPE characterization of the IAV segment PB2 packaging signal identifies conserved structures. Selective 2'-hydroxyacylation (SHAPE) and computational modeling, analyzed by primer extension, were applied to IAV segment PB2 genomic vRNA to search for structured RNA domains. Full-length (-) sense PB2 vRNA transcribed in vitro from strain A / Puerto Rico / 8 / 1934 (H1N1) "PR8" was folded in solution (Pang, 2011) and examined using an electrophilic SHAPE reagent that preferentially reacts with nucleotides present in a flexible single-stranded state (Wilkinson et al., 2006) (Figure 1). This analysis revealed that many of the 2341nt vRNAs were largely unstructured (Figure 2). This is consistent with recent bioinformatics studies that have found that (+) sense RNA secondary structure conservation is more likely than (-) sense RNA for all segments including PB2 (Priore et al., 2012; Moss et al., 2011). These previous studies did not analyze the terminal coding region (TCR), but instead stopped 80 nucleotides before the end of the PB2 5'TCR. SHAPE-inducible modeling suggested several regions of this area containing a stable RNA secondary structure, most notably a stem-loop motif (Figure 1A) containing nucleotides 34–87 (in sense notation), which we have herein named packaging stem-loop 2 (PSL2). This segment had previously contained a set of nucleotides involved in PB2 packaging through mutational analysis via an unidentified mechanism (Figure 1A–1B, see nucleotides circled) (Gao et al., 2012; Marsh et al., 2008; Liang et al., 2008; Gog et al., 2007). Supporting the hypothesis that these previous mutations act via the disruption of the PSL2 structure, SHAPE analysis of the mutants resulted in different conformations, all of which invalidated the wild-type PSL2 structure (Figure 1C, Figure 3). The 60-nucleotide region encompassing PSL2 exhibits nearly 100% sequence conservation at the single-nucleotide level between seasonal and pandemic strains of different subtypes and species origins (Figure 4), suggesting the existence of strict biological requirements for maintaining an intact PSL2 structure.Because different downstream sequences within PB2 vRNA can alter the secondary structure of PSL2, we explored the structural conservation of PSL2 by performing SHAPE analysis on full-length wild-type PB2 vRNAs isolated from various IAV strains and subtypes, including highly pathogenic bird H5N1 and pandemic 1918H1N1 strains. Despite the presence of two differing nucleotides within the stem-loop and significant differences in adjacent sequences, the PSL2 stem-loop structure was recovered in SHAPE-induced modeling of PB2 RNA across these diverse species and subtypes (Figures 1D-1F).
[0182] Figures 1A–1F show SHAPE chemical mapping performed on full-length (-) sense wild-type PB2 vRNA. Color indicates SHAPE reactivity, proportional to the probability that nucleotides are single-stranded. All structures are cleaved to highlight the 5' end sequence structure. Energy = ΔG free energy value of the determined structure generated by the RNA structure modeling algorithm using the SHAPE pseudo-free energy parameter. (Figure 1A) Secondary structure of wild-type PB2 RNA from strain A / Puerto Rico / 8 / 1934 "PR8" (H1N1). Color-coded circles correspond to nucleotide sites where synonymous mutations have been reported to affect PB2 packaging (Gao et al., 2012; Marsh et al., 2011). (Figure 1B) Packaging efficiency of synonymous variants in (Figure 1a), as determined by qPCR. Results were performed in triple. Error bars = ±SD. The box below shows the variant name and corresponding mutation. Nucleotide numbering is shown in the genome (-) sense direction. (Figure 1C) SHAPE-determined structures of PB2 packaging-deficient mutant vRNAs, m757(G44C) and m745(A80U). Black box = site of synonymous mutation. (Figures 1D-1F) SHAPE-determined structures of wild-type PB2 from pandemic and highly pathogenic strains, including different subtypes: (Figure 1D) 1918 pandemic (A / Brevig Mission / 1 / 1918(H1N1)), (Figure 1E) highly pathogenic birds (A / Vietnam / 1203 / 2004(H5N1)), (Figure 1F) 2009 pandemic "pigs" (A / California / 04 / 2009(H1N1)).
[0183] Figure 2, panels A and B show the SHAPE reactivity of full-length PB2 vRNA. (Figure 2, panel A) Average SHAPE reactivity as a function of nucleotide position (window bin size = 100 nt) of full-length (-) sense PB2 vRNA from IAV strain A / Puerto Rico / 8 / 1934(H1N1). The PSL2 region (highlighted in blue, nt 34-86) contains a 5' packaging signal domain, which has a high density of codons with a conserved third position and exhibits one of the lowest SHAPE reactivity within the vRNA. The region after PSL2 is relatively unstructured but still contains another potential site for the presence of RNA structure at nucleotides 1400-1500. Interestingly, this second internal region was also predicted to contain structural elements by a 2011 bioinformatics study (reference 19). (Figure 2, panel B) Enlarged view of the PSL2 region from (Figure 2a). Window bin size = 10 nt.
[0184] Figures 3A–3E show that packaging-deficient mutations disrupt wild-type SHAPE reactivity. Left: Mutant SHAPE reactivity plotted as change relative to WT. Nucleotide numbering starts from the 5' end of the (-) sense vRNA. Orange bars indicate the site of mutation. Energy values represent the ΔG free energy of the predicted structure generated by the RNA structure modeling algorithm using the SHAPE pseudo-free energy parameter. Right: SHAPE-determined structure of full-length (-) sense mutant PB2 vRNA from PR8 strain (H1N1). Images are cleaved and the 5' terminal region highlighted. (Figure 3A) Wild-type. Packaging-deficient mutants: (Figure 3B) m744b (AG83, 85UA). (Figure 3C) m745 (A80U). (Figure 3D) m55c (CU35, 36UC). (Figure 3E) m757 (G44C).
[0185] Figure 4 shows the conservation of nucleotide sequences containing the PSL2 structure. A graph of nucleic acid sequence alignments across various influenza A virus subtypes and strains ("weblogo." followed by "berkeley" followed by ".edu"). The overall height represents sequence conservation at that nucleotide position, and the height of the symbols within each position indicates the relative frequency of each nucleotide at that site. Black box = PSL2 region. Sequences included in the alignment: High pathogenicity A / Brevig Mission / 1 / 1918 (H1N1), Pandemic "Swine Flu" A / California / 04 / 2009 (H1N1), Modern Human A / New York / 470 / 2004 (H3N2), Human A / Puerto Rico / 8 / 1934 (H1N1), High pathogenic Bird A / Vietnam / 03 / 2004 (H5N1), Human A / Hong Kong / 8 / 1968 (H3N2), and Human A / New York / 312 / 2001 (H1N1). (-) RNA nucleotides numbered in the sense direction. Sequence alignment of the terminal 5' region of PB2 corresponding to the above sequences. Shaded blue boxes contain PSL2 RNA secondary structure elements. Black dots indicate differing nucleotide sites.
[0186] Mutation and mapping strategies validate the PSL2 structure and predict novel packaging variants. To further investigate SHAPE analysis of PSL2 RNA structure and identify additional useful mutations necessary for in vivo testing, we applied multidimensional chemical mapping (Kladwang and Das, 2010) to PSL2 segments. Firstly, mutations and mapping (M 2 Measurements revealed a disruption of the chemoreactivity pattern during phylogenetic mutations of each stem residue, including changes in nucleotides previously found to be important for PB2 packaging (see Figure 5A, noted region) (Marsh et al., 2008; Gog et al., 2007). These M 2Automated computational analysis based on data reliably restored the SHAPE-induced PSL2 structure (Figures 1C, 3, 5B-5D), further validating the structural model. Secondly, as a predictive test, compensatory mutations were designed to restore the base pairs of the wild-type stem-loop structure disrupted by the initial packaging deletion mutation (Figure 6, panels A-B). These mutant rescuers actually restored the PSL2 SHAPE pattern, provided base-pair resolution in in vitro validation of the modeled structure, and suggested sequence variants for testing the role of PSL2 structure in vivo.
[0187] Figures 5A-5D show two-dimensional mutations and M2 (M2) analysis of the PSL2 RNA secondary structure. (Figure 5A) Systematic single nucleotide mutations and the resulting mapping of chemical accessibility reveal interactions in the three-dimensional structure of the RNA. Chemical accessibility plotted in grayscale (black = best SHAPE reactivity) across 88 single mutations of PSL2 elements from PR8 strain PB2 at single nucleotide resolution. Reactivity peaks (from left to right) correspond to nucleotides from the 5' end to the 3' end of the PB2 RNA. Nucleotide sites corresponding to known packaging mutations (reported by Marsh et al., 2008) are shown in blue on the right. Red arrows indicate prominent packaging loss mutation sites predicted by M2 analysis. (Figure 5B) Strong features of the mutations and M2 data isolated by Z-score analysis (numerical values of the standard deviation from the mean for each residue). The Z-score for each nucleotide reactivity was calculated by subtracting the mean reactivity of this nucleotide across all mutants and dividing by the standard deviation (output in HiTRACE: _Zscore_from_rdat). Squares represent secondary structure models induced by mutation and mapping data. Dark signals highlight evidence of structured nucleotide pairing. (Figure 5C) RNA secondary structure of the 5' packaging signal region (nt30~93) derived from incorporating Z-scores into the RNA structure modeling algorithm: Bootstrap confidence estimates are given as green present values. Bootstrap values provide a numerically accurate indicator of structural reliability. Low bootstrap confidence values suggest the presence of alternative structural models. (Figure 5D) Bootstrap support values for each base pair, shown as grayscale shading.
[0188] Figure 6 shows the design of compensatory mutations for the aforementioned PR8 PB2 variants. (Figure 6, Panel A) The aforementioned synonymous variants (m757, m745, m55c) are mapped to the PSL2 structure. (Figure 6, Panel B) Compensatory mutations (m55c-comp, m745-comp, and m757-comp) were designed at sites predicted to restore the wild-type PSL2 structure based on SHAPE and mutation and map chemistry analysis. Nucleotides enclosed in black indicate the site of the compensatory mutation. (-) indicates sense vRNA direction. For mutations requiring non-synonymous changes to restore the structure, changes in the encoded protein sequence are indicated.
[0189] To test whether the PSL2 stem-loop structure observed in solution is related to viral packaging in the cellular environment, the same nine synonymous mutations reported by Gog et al., 2007 and Marsh et al., 2008 (Figures 1A-1B, Figure 7 Panel A), as well as M 2 Four novel synonymous variants characterized by the analysis (Figure 7, Panel B) were cloned into pDZ plasmids containing the PR8 PB2 gene (Marsh et al., 2008; Liang et al., 2008; Gog et al., 2007) (Figure 8). The packaging efficiency of the nine known variants currently underlying PR8 is comparable to that of the WSN33 virus. 15 These were equivalent to those initially described in (Figure 7, Panel C). Of these, mutants m55c, m757, m745, and m744b were predicted to show the most significant impairment based on their location within the stem region of PSL2 (Figure 1C, Figures 3A-3F, Figure 7). In contrast, published mutations that did not affect PB2 packaging, such as those that mapped to the unstructured tip loop or fell outside of PSL2 and did not alter its structural integrity (e.g., m731) (Figure 9A) (Marsh et al., 2008). 2Analysis revealed that three novel synonymous variants (m74-1, m74-2, and m68) (Figure 5A) that had a significant effect on the in vitro PSL2 structure showed a significant loss in PB2 packaging. On the other hand, mutant sites that resulted in negligible changes in SHAPE reactivity compared to the wild-type PSL2 structure yielded wild-type-like packaging efficiency levels (e.g., m56) (Figure 7, Panel D).
[0190] Figure 7 shows highly conserved single-codon synonymous variants of PR8 PB2 vRNA. (Figure 7, Panel A) Previously published synonymous variants involved in PB2 packaging. The top row is the parent PR8 vRNA sequence ((+)-sense direction), and the mutated single nucleotide is shown in bold red in the bottom row. The numbering and naming of introduced variants are based on reports by Marsh et al., 2008 and Gog et al., 2007. Regions highlighted in yellow indicate sequences containing the PSL2 structure. (Figure 7, Panel B) Design of primer sequences for cloning synonymous variants identified from M2 analysis (see Supplementary Figure 4a) into pDZ plasmids. Sequences are in the (+)-sense direction. Highlighted nucleotides = mutation sites. (Figure 7, Panels C-D) (Figure 7, Panel C) Packaging efficiency representing the percentage of mutant PB2 packaging of previously published synonymous variants compared to parental wild-type PB2, and (Figure 7, Panel D) M2 analysis identified synonymous variants. Based on results from two independent experiments, the assay was performed in triple replication (n=6). Error bars indicate the mean ± SD.
[0191] Figure 8 shows the naming of PB2 packaging variants and the corresponding mutation sites. 1) A mutation naming chart showing the names and sites of mutations from previously published synonymous variants involved in PB2 packaging (shown in blue), based on reports by Marsh et al., 2008 and Gog et al., 2007, and 2) from PSL2 structural design single variants (shown in black) and double-compensated variants (shown in red). The numbering and naming of introduced mutations are based on the genome and (-) sense vRNA. Examples of mutations resulting in protein-coding changes are indicated by synonymous (SYN) or non-synonymous (non-SYN) regions.
[0192] Figures 9A-9C show the effect of synonymous mutations on the PSL2 structure. Left: Predicted RNA secondary structures of PB2 packaging mutants determined by sf-SHAPE analysis of full-length (-) sense PB2 vRNA from the PR8 strain. For clarity, the wild-type structure is shown in the box in the upper right corner. Right: SHAPE reactivity graphs are shown as changes in mutant reactivity compared to the wild type. Energy values and packaging efficiency percentages are shown in the headings of the following figures. Mutants: (Figure 9A) m731. (Figure 9B) m751. (Figure 9C) m748. The packaging efficiency percentage of PB2 incorporation for each of the aforementioned mutants is highlighted in blue.
[0193] Compensatory mutations rescued not only the viral packaging of segment PB2 (Figure 10, panels A-C; Figure 6, panels A-B), consistent with the proposed hierarchical role of PB2 in IAV packaging, but also other segments previously reported to be affected by harmful mutations (Muramoto et al., 2006; Gao et al., 2012; Marsh et al., 2008) (Figure 10, panels D-F). In addition to restoring PB2 packaging, compensatory mutations resulted in complete or near-complete rescue of viral titer loss caused by deletion mutations (Figure 10, panels G-I). Some non-synonymous compensatory mutations were able to restore PB2 packaging better than others (m745-comp and m55c-comp compared to m757-comp) (Figure 10, panels A-C), likely reflecting an incomplete restoration of PB2 protein function via exogenous addition. Some non-synonymous mutations affected both PSL2 structure and protein sequence, thus requiring such exogenous addition. The most incisive test of the PSL2 structure was obtained from packaging experiments that did not require the addition of supplemental wild-type PB2 protein. Based on computational enumeration and multidimensional mutant rescue experiments (Tian et al., 2014), both were found to be synonymous, and a single mutant rescue pair was discovered that eliminated the need for wild-type PB2 protein addition (m52 / m65, Figure 11, Panels A-B, Figure 12, Panel s, Figure 13). Generating each mutant individually (m52 and m65) resulted in a PB2 integration packaging efficiency of less than 4% and 4log 10 Previous reports have described titer loss exceeding 2log, and packaging-deficient viruses (i.e., 2log). 10 This resulted in extreme damage exceeding that level (Figure 11, Panels C-D, Figure 7, Panel C, Figure 10). When introduced together with the double mutant m52 / 65-comp strain that restored the PSL2 structure, the compensatory mutation restored both packaging efficiency and viral titer to wild-type levels, although the sequence was altered.
[0194] Figure 10, panels A-I, shows the effects of compensatory mutations in PR8 PB2 packaging-deficient mutants on viral packaging and titer. (Figure 10, panels A-C) Packaging efficiency of packaging-deficient and compensatory mutant PB2 vRNA. For compensatory mutations requiring non-synonymous changes, co-transfection with wild-type PB2 protein expression plasmids was performed during viral rescue. pWT = expression plasmid encoding wild-type PR8 PB2 protein. wt = value given as percentage of PB2 vRNA packaging compared to parental PR8 virus. Results from two independent experiments were used, and the assay was performed in triple replication (n=6). (Figures, panels D-F) Packaging efficiency of packaging-deficient and compensatory mutant viruses, as well as their effects on the packaging of other interaction segments, PB1, PA, NP, and MX. The assay was performed in triple replication (n=6). (Figure 10, panels G-I) Viral titer by plaque assay. Results are in PFU / mL, and the assay was performed in triple replication.
[0195] Figure 11 shows that multidimensional chemical mapping reveals novel PB2 packaging deficiencies and compensatory mutation partners. (Figure 11, Panel A) Electropherogram results from systematic single-nucleotide mutation mapping with individual and compensatory double mutation rescue (mutation map rescue) analysis to test base pairings from a 1D data-driven model and identify predicted successful synonymous PSL2 deficiency and compensatory mutant pairs. Chemical accessibility plotted in grayscale (black = highest SHAPE reactivity) across 88 single mutations of the PSL2 element from PR8 strain PB2 at single-nucleotide resolution. Reactivity peaks (from left to right) correspond to nucleotides from the 5' end to the 3' end of the PB2 RNA. See Figure 12 for a complete list of mutation rescue pairs. (Figure 11, Panel B) Mutation designs for single mutants m52 (G52U) and m65 (C65A) on the PSL2 structure, as well as the double m52 / 65 rescue pair. (Figure 11, Panel C) Packaging efficiency of synonymous single and double mutants and rescue pairs. Values are given as percentages of PB2 vRNA packaging compared to wt parental PR8 virus. Results from two independent experiments, the assay was performed in triplicate (n=6). (Figure 11, Panel D) Viral titer at PFU / mL, triplicate results. Error bars indicate mean ± SD.
[0196] Panels a-t of Figure 12 show two-dimensional mutant map rescue (M2R) analysis. Mutation / rescue results validate the PSL2 RNA secondary structure. Electrophoresis of SHAPE analysis using compensated double mutations to identify successful PSL2 deletion and compensated mutant pairs, testing base pairings from a 1D data-inducible model. Chemical accessibility plotted in grayscale (black = highest SHAPE reactivity) across 88 single mutations at single-nucleotide resolution of PSL2 elements from PR8 strain PB2. For each tested pair, wild-type, single mutant 1, single mutant 2, and the "quadruplet" of the compensated double mutant are grouped for comparison. (Figure 12, panels a-r) Non-synonymous mutations and rescue pairs. All unboxed electrophoresis are pairs in which no collapse and / or rescue was observed. Blue boxes indicate normal deletion and rescue mutations. (Figure 12, panel) Double synonymous mutations and rescue pairs. Green boxes = successful synonymous deletion and rescue pairs. (Figure 12, panel t) Packaging efficiency of non-synonymous mutations and rescue pairs. Values are given as percentages of PB2 vRNA packaging compared to wt parental PR8 virus. Results from two independent experiments were obtained, and the assay was performed in triple replication (n=6). Error bars represent ±SD.
[0197] Figure 13 shows the primer sequence design for the two-dimensional mutant map rescue (M2R) mutant. Sequence numbers (28-43) are listed from top to bottom. Primer sequences used for QuickChange mutant cloning of M2R mutants into pDZ plasmids. Sequences are in the (+) sense direction. The left region indicates synonymous (Syn.) or non-synonymous (Non-syn.) changes. Highlighted nucleotides = mutation sites. The enclosed mutant primer set shows the double-synonymous mutant partners, m52 and m65.
[0198] To test the relevance of PSL2 structure in an in vivo model, 6-8 week old BALB / C mice were intranasally inoculated with 1000 PFU of wild-type PR8 virus or strains carrying mutations predicted to disrupt or restore PSL2 structure. Mice infected with the PSL2 disruption mutation m745 (20% packaging efficiency) or the severe packaging-deficient single-mutant virus, m52 (<4% packaging efficiency), showed reduced or absent clinical signs of disease in either weight loss or survival, respectively, compared to PBS controls (Figure 14, Panels A-B). Notably, including compensatory mutations that restore PSL2 structure rescued viral pathogenicity. Animals infected with m52 / 65-comp and m745-comp showed comparable mortality profiles and survival curves to mice infected with wild-type PR8 (Figure 14, Panels A-B). In line with APLAC guidelines, all mice were humanely euthanized when they reached a weight loss of more than 20%.
[0199] Figure 14, panels A and B, show that the packaging-deficient virus decays in vivo. Percentage of weight loss and survival in mice infected with single PSL2 collapsed and compensatory PSL2-recovered double mutant viruses. Six- to eight-week-old BALB / C female mice were intranasally infected with 1000 PFU of PR8 wild-type (wt) virus, packaging-deficient single mutant viruses, m52 and m745, compensatory double mutant viruses, m52 / 65 and m745-comp, or PBS control. Mice were monitored daily for percentage of weight loss and survival relative to day 0. Results are obtained as the mean of two independent experiments with six mice per condition. (Figure 14, panel A) Percentage of weight loss. (Figure 14, panel B) Kaplan-Meir survival plots of the individual cohort shown in (Figure 14, panel A).
[0200] Example 2: Therapeutic design and targeting of the PSL2 structure inhibits IAV infection in vitro and in vivo. To explore the therapeutic potential of targeting PSL2-mediated viral packaging, nine locking nucleic acids (LNAs) containing phosphorothioate nucleoside bonds (Vester and Wengel, 2004) were designed for key residues predicted to disrupt the overall RNA secondary structure of the element and thereby inhibit viral production (Figure 15, Panel A). Two of the designed LNAs, LNA8a and LNA9, are sequence-identical to LNA6 and LNA7, respectively, but possess 6-7 unmodified (unlocked) DNA nucleotides optimized for RNase-H activation (see, e.g., LNA6 / 8-RNaseH and LNA7 / 9-RNaseH, respectively). First, to evaluate the effect of LNA binding on the PSL2 RNA secondary structure, topprinting and SHAPE chemical mapping were performed on PB2 vRNA in the presence of LNA. Supported by antiviral assay results, the sequences encoded by LNA6-9 showed the greatest ability to bind to and disrupt the wild-type PSL2 structure (Figure 16).
[0201] Figure 15, panels A-D, shows that lock nucleic acids targeting the PSL2 RNA structure exhibit potent antiviral activity in vitro and in vivo. (Figure 15, panel A) Positions of complementary lock nucleic acids (LNAs) designed for various regions of the PSL2 structure. (Figure 15, panel B) To screen LNAs for antiviral activity, MDCK cells were pretreated for 1 hour with 100 nM of each designated LNA by lipofectamine transfection before infection with either PR8(H1N1) virus or A / Hong Kong / 8 / 68(H3N2) virus at 0.01 MOI. 48 hours after infection, the supernatant was collected and viral titers were determined by plaque assay. Based on results from two independent experiments, the assay was performed in triple replication (n=6). (Figure 15, panel C) Time course of pretreatment (RX) versus post-infection treatment with LNA9 at titration concentrations (100 nM, 10 nM, 1 nM). Infection under WT+Lipo=Lipofectamine control. Pretreatment: Confluent MDCK cells in a 6-well plate were treated with LNA9 either 2 hours or 4 hours before infection. The treated supernatant was removed at the indicated time, and the cells were infected with 0.01 MOI wtPR8 virus for 1 hour. Post-infection treatment: MDCK cells were infected with 0.01 MOI PR8 virus for 1 hour, then the supernatant was replaced, and the cells were treated with LNA9 either 2 or 4 hours after infection. The supernatant was collected after 48 hours, and viral titers were determined by triple plaque assay. Figure 15, panel d, shows the effect of intranasal LNA treatment on the survival of virus-infected mice. Mice were intranasally administered 20 ug of LNA9, scrambled LNA, or PBS (non-infection control) 12 hours before infection with PR8 virus. All mice underwent two additional treatments at 8 hpi and 36 hpi (n=7 mice per state).
[0202] As shown in Figure 15, panels A-D, the sequence label "LNA8" refers, for example, to sequence LNA8a (sequence number 188) as described herein. Furthermore, in Figure 15, panels A-D, Figure 16A, and Figure 16B, LNA6 / 8 refers, for example, to sequences LNA6 (sequence number 72) and LNA8a (sequence number 155) as described herein.
[0203] Figures 16A and 16B show SHAPE analysis for LNA-RNA binding. (Figure 16A) Electrophoretic profiles of SHAPE analysis performed on LNA1, 2, 4, 5, 6 / 8a, and 7 / 9 (100 nM) in the presence of PR8 PB2 vRNA. S1, a small molecule that interacts with hepatitis C virus IRES RNA, was added as a control for RNA binding. Left column: unlabeled reaction without SHAPE reagent 1M7. Right: with labeling reagent. (Figure 16B) Electrophoretic profiles of SHAPE performed on LNA-vRNA combinations at titration concentrations of LNA. For each LNA, the left set of columns is without labeling reagent.
[0204] Next, in a first pilot experiment to determine the antiviral potential of LNA-mediated targeting of PSL2 across two different IAV subtypes, MDCK cells were pretreated with 100 nM of each LNA before infection with either 0.01 MOI wild-type PR8(H1N1) virus or tissue culture-compatible A / Hong Kong / 8 / 68(HK68)(H3N2) virus, and delivered by Lipofectamine® transfection for 1 hour. 48 hours after infection, the supernatant was collected and viral production was measured by plaque assay (Figure 15, Panel B). LNAs directed only to the upper loop of PSL2 (LNA1, LNA4) had little or no effect on viral titer. Similarly, LNA3 and LNA5, targeting the 3' base of PSL2, also did not inhibit viral production. In contrast, nucleotide coverage of both the upper loop and the intermediate bulge by LNA6 was 2 log for PR8. 10This resulted in a significant loss of titer (Figure 15, panels A-B). LNA8a, the RNase-H activated copy of LNA6, produced even greater antiviral activity against both viruses, up to 3 log. Most notably, LNA9, the RNase-H activated copy of LNA7, had the most potent antiviral capacity, reducing viral production against PR8 and HK68 by nearly 5 log and 4 log, respectively.
[0205] After identifying the optimal candidate LNA, the antiviral activity of LNA9 was further investigated over time and concentration parameters. MDCK cells were treated with a 10-fold dilution of one dose of LNA9 either 2 hours or 4 hours before infection, or alternatively, 2 or 4 hours after infection with 0.01 MOI wild-type PR8 virus. Cells pretreated with LNA showed the most potent antiviral response (≥4log) and potent viral inhibition (≥2log) even at the lowest dilution (1nM) (Figure 15, Panel C). Antiviral activity tended to decrease with increasing post-infection treatment time, but suppression of viral titers greater than 3log was achieved even at the most recent test.
[0206] Example 3: In vivo efficacy trial: Extended single-dose prophylaxis Balb / C female mice (5 mice / group) were pre-treated intranasally with a single dose of 20 ug of LNA9 either 3 days (-3 days) before infection with a lethal dose of wild-type PR8 virus or 1 day (-1 day) before infection. Mice were monitored daily for weight loss, clinical score, and survival. Figure 17, Panel A shows the survival percentage of mice over time. Figure 17, Panel B shows the percentage of weight loss over time after administration.
[0207] A single dose of 20 ug of LNA9 three days prior to infection completely protected mice from fatal influenza disease. Untreated control mice were humanely sacrificed when they lost more than 25% body weight over an average of 5.5 days. In contrast, the pre-treated group showed minimal weight loss, few clinical signs of the disease, and complete recovery to pre-infection body weight.
[0208] These results demonstrate that a single inhalable dose of LNA9 administered several days prior to infection can provide sustained protection against the fatal disease, suggesting that the compound in question may be used in preventative measures during influenza outbreaks and pandemics.
[0209] Example 4: Susceptibility of influenza virus to oseltamivir and LNA9 after continuous passage in the presence of drugs: Drug selection experiment Oseltamivir (Tamiflu) is the most widely used and stockpiled neuraminidase inhibitor (NAI) on the market. Like all NAIs, oseltamivir requires a conformational rearrangement of the viral neuraminidase (NA) protein to be compatible with the drug. Any mutation in the NA protein that affects this rearrangement reduces the binding affinity of oseltamivir and, therefore, reduces drug efficacy. In particular, the H274Y variant (also known as the H275Y variant depending on the nomenclature) is most commonly associated with oseltamivir resistance. The rapid selection of the H274Y variant in immunocompromised patients can lead to clinical failure of the last-resort NAI drug peramivir, suggesting that the selection of multidrug-resistant viruses in immunocompromised hosts may be more common than previously believed. This, along with the recent circulating spread of oseltamivir-resistant and NAI-resistant viruses, highlights the need to re-evaluate the general use of NAIs. The development of a new class of antiviral drugs is essential to mitigate the potential adverse effects that current and future influenza pandemics may have on human health.
[0210] The sequence region in segment PB2 containing the PSL2 stem-loop is highly conserved across a wide range of IAV subtypes, strains, and isolates from various host species, potentially reflecting stringent biological requirements for its conservation. SHAPE analysis of this region confirmed the maintenance of the PSL2 structure across various subtypes and seasonal and pandemic viruses of host origin, strongly suggesting that this structural element may be a novel pan-genotypic therapeutic target (hence LNA9 has broad-spectrum potential against IAV isolates). In addition, since subjective LNAs are directed towards highly conserved viral genomic RNA targets with clearly strong constraints on their mutagenicity, subjective LNAs targeting PSL2 are expected to have a higher barrier to resistance development compared to NAIs.
[0211] The susceptibility of influenza virus LNA9 to oseltamivir after serial passage under drug pressure was investigated. Oseltamivir initiated at passage 1 of drug-treated serotonin (PR8) at 41 nM IC50, as determined by a plaque reduction assay. 50 The drug dosage was increased, and after only 6 viral passages, oseltamivir IC was administered. 50 It jumped to 50 μM and 1000 ×. See Figure 18, panels A-D. In contrast, after 10 viral passages in the presence of LNA9, IC 50 The level was stably maintained at 18–16 pM. Figure 19, panels A and B.
[0212] LNA9 can also be used to treat drug-resistant viruses. Drug-resistant variants of the A / WSN / 33(H1N1) virus were generated using a reverse gene virus rescue system, and the NA gene was mutated to contain the H274Y resistance mutation. Against this virus, oseltamivir produced an IC53uM 50It possesses [the following characteristics]. Importantly, LNA9 maintained its potency and efficacy against the WSN H274Y virus in picomolar activity. Figure 19, Panel C. This result provides strong evidence for the therapeutic treatment of NAI-resistant viruses with PSL2-targeted LNA. This result also highlights the activity of LNA9 against various IAV isolates.
[0213] Example 5: Antiviral activity of miR-targeted LNAs: We determined the in vitro antiviral efficacy of LNAs designed against microRNAs hypothesized to mediate respiratory viral replication. Individual LNAs designed to target microRNAs were transfected into Huh7 cells, and subsequently, ORF7 cells were infected with fully replicated SARS-CoV-2-nLuc virus containing a nanoluciferase reporter. 48 hours after infection, the effect on replication was measured by luciferase activity compared to control cells treated with negative control scrambled LNAs (Scr.LNAs) or positive control nucleoside analog EIDDs (Figure 20). LNAs targeting the frameshift element (FSE) region of the SARS-CoV-2 RNA genome had minimal effect on viral replication, while our anti-miR LNAs designed to isolate miR-191 showed multiple log 10A reduction was observed. The degree of inhibition with anti-miRLNA was greater than that with EIDD-positive controls. Furthermore, this degree of inhibition was observed with LNA at a concentration of 25 nanomoles, while EIDD-positive controls were used at a concentration of 5 micromoles. Other microRNA-targeted LNAs with anti-respiratory virus activity have also been identified, including the following: LNA-602.1, LNA-602.6, LNA-6769-5P.3, LNA-6769-5P.6, LNA-942.3P.4, LNA -376c.3, LNA-4433b.1, LNA-191.1, LNA-191.2, LNA-191.3, LNA-191.4, LNA-1 91.8, LNA-191.8, LNA-19110, LNA-191.11, LNA-191.12, LNA-191.13, LNA-66 3.1, LNA-663.3, LNA-381.2, LNA-744.2, LNA-744.4, LNA-744.7, LNA-4508.1, LNA-4508.4, LNA-4730.2, LNA-4730.6, LNA-6777.4, LNA-10396.1, LNA-10396.2, LNA-4749.2, LNA-4749.4, LNA-4706.3, LNA-4706.4, LNA-3675.2, LNA-3675.3, LNA6810.1, LNA-6810.2, LNA-6810.3, LNA-6812.1, LNA-6796.1, LNA-6796.3, all of these LNAs exhibit potent antiviral activity against SARS-CoV-2, and all inhibit viral replication by approximately 1 log 10 or more. These LNAs are listed in Table 8 above.
[0214] Example 6: Determining the in vitro antiviral effects of LNA combinations against respiratory viruses: Combining an LNA targeting a conserved SARS-CoV-2 RNA secondary structure with an LNA designed to sequester miR-191 leads to significant inhibition of viral replication. Using the assay described in Example 5 above, individual LNA combinations demonstrated antirespiratory viral activity (Figure 21).
[0215] Example 7: In vivo effects of LNA combinations against respiratory viruses. Human ACE2 transgenic mice were treated with a single intranasal administration of a vehicle, low molecular weight A, or LNA combination 5 days prior to infection with lethal SARS-CoV-2 inoculation. After infection, animals were monitored daily using a clinical score, where 1 = asymptomatic and higher scores indicated worsening clinical condition (Figure 21). LNA combinations inhibit respiratory viral infection in vivo.
[0216] Example 8: Antiviral activity of single microRNA-targeting LNAs, or LNAs that target either the minus or plus strand of a respiratory virus. Using the assay described in Example 5, individual LNAs were shown to possess anti-respiratory virus activity (Figure 22). Other LNAs possessing anti-respiratory virus activity have also been identified, including, but are not limited to, Neg3.1, Neg8.2, Neg8.4, Neg10.1, Neg10.1, Neg12.2, Neg18.2, Neg18.3, Neg18.4, Cov8.5, Cov10.1, Cov11.3, Cov12.8, Cov13.9, Cov14.3, Cov16.3, Cov18.1, Cov1.1, Cov1.2, Cov1.4, Cov2.1, Cov2.2, Cov3.2, Cov3.2-2, Cov3.2-3, Cov3.2-4, Cov3.2-5, Cov3.2-6, Cov3.2-7, Cov4.1, Cov4.2, Cov6.4, Cov6.5, Cov6. 6, Cov6.7, Cov6.8, Cov6.9, Cov6.7-1, Cov6.7-2, Cov6.8, Cov6.9, Cov6.7-1, Cov6.7-2, Cov7.2, Cov7.7, C ov7.9, Cov8.1, Cov8.2, Cov8.3, Cov8.4, Cov8.5, Cov8.6, Cov8.2-1, Cov10.1, Cov10.4, Cov11.1, Cov11. 2, Cov11.3, Cov12.4, Cov12.5, Cov12.7, Cov12.8, Cov13.1, Cov13.4, Cov13.5, Cov13.6, Cov13.8, Cov13 .9, Cov14.1, Cov14.2, Cov14.3, Cov14.4, Cov16.1, Cov16.2, Cov16.3, Cov18.1, Cov18.5, IBV-LNA0.2, IBV-LNA4.4, IBV-LNA3.4, IBV-LNA2.5, IBV-LNA1.5, all possess potent antiviral activity, and all inhibit viral replication by approximately 1 log 10 or more. These LNAs are listed in Tables 7 and 9 above.
[0217] Example 9: LNA, which inhibits respiratory viruses, can be used as a just-in-time vaccine, as shown in Figure 23. (a-b) Effect of intranasal LNA prophylactic treatment on the survival of virus-infected mice. Kaplan-Meier survival plot. Mice (n=7 mice / group) were intranasally administered a single dose of LNA9, scrambled LNA, or vehicle (simulated treatment), followed by lethal inoculation with wild-type PR8 virus. (a) Mice were treated with 20 μg of LNA 3 days (-3 days) or 1 day (-1 day) before infection, and (b) Mice were treated 1 week before with a single dose of 30 μg of LNA9 or vehicle control. (c) Target sites of LNA9 and the newly designed LNA14 mapped to the PSL2 structure. (d) Electrophoretic profiles of SHAPE analysis performed on untreated, scrambled LNA, LNA9, and LNA14 at a concentration of 100 nM in the presence of PR8 PB2 vRNA. Labeling with 1M7 SHAPE reagent is shown. (e) Kaplan-Meier survival plots of mice (n=7 mice / group) intranasally pretreated with a single dose of 30 μg of LNA14 or vehicle control one week prior to lethal PR8 infection (-7 days). (f-h) Single dose of 40 μg of LNA14 or vehicle administered IN two weeks prior to PR8 virus infection (-14 days). (f) Kaplan-Meier survival plots. (g) Percentage of mouse body weight relative to day 0. (h) Clinical score. (i-l) Mice (n=7) were administered a single intranasal dose of 40 μg of LNA14 one week prior to primary lethal PR8 virus infection (e) at 1 LD100. 65 days after the initial infection, surviving mice from (e) were subjected to a second dose of 10 LD100 along with age-matched naive controls (n=7 / group). (i) Timeline of the loading study. (j) Percentage of mouse body weight relative to day 0. (k) Clinical score. (l) Kaplan-Meier survival curve. (m) Mice (n=10 / group) were infected with a lethal dose of PR8 wild-type virus. Three days after infection, mice were administered a single dose of 40 μg of LNA14, LNA9, scrambled LNA, or vehicle control by intravenous injection. Kaplan-Meier survival plot.
[0218] References 1.M.J.Memoli,R.J.Hrabal,A.Hassantoufighi,M.C.Eichelberger,J.K.Taubenberger,Rapid selection of oseltamivir-and peramivir-resistant pandemic H1N1 virus during therapy in 2 immunocompromised hosts.Clin Infect Dis 50,1252-1255(2010);published online EpubMay 1(10.1086 / 651605). 2.R.Hai,M.Schmolke,V.H.Leyva-Grado,R.R.Thangavel,I.Margine,E.L.Jaffe,F.Krammer,A.Solorzano,A.Garcia-Sastre,P.Palese,N.M.Bouvier,Influenza A(H7N9)virus gains neuraminidase inhibitor resistance without loss of in vivo virulence or transmissibility.Nature communications 4,2854(2013)10.1038 / ncomms3854). 3.F.G.Hayden,M.D.de Jong,Emerging influenza antiviral resistance threats.J Infect Dis 203,6-10(2011);published online EpubJan 1(10.1093 / infdis / jiq012). 4.X.Liu,T.Li,Y.Zheng,K.W.Wong,S.Lu,H.Lu,Poor responses to oseltamivir treatment in a patient with influenza A(H7N9)virus infection.Emerging microbes & infections 2,e27(2013);published online EpubMay(10.1038 / emi.2013.30). 5.J.Parsons,M.P.Castaldi,S.Dutta,S.M.Dibrov,D.L.Wyles,T.Hermann,Conformational inhibition of the hepatitis C virus internal ribosome entry site RNA.Nat Chem Biol 5,823-825(2009);published online EpubNov(10.1038 / nchembio.217). 6.C.Romero-Lopez,A.Berzal-Herranz,Unmasking the information encoded as structural motifs of viral RNA genomes:a potential antiviral target.Rev Med Virol 23,340-354(2013);published online EpubNov(10.1002 / rmv.1756). 7.P.S.Palese,M.L.,Fields Virology.D.M.e.a.Knipe,Ed.,Orthomyxoviridae(Lippincott Williams & Wilkins,ed.5th,2007). 8.R.W.Compans,J.Content,P.H.Duesberg,Structure of the ribonucleoprotein of influenza virus.J Virol 10,795-800(1972);published online EpubOct( 9.E.C.Hutchinson,J.C.von Kirchbach,J.R.Gog,P.Digard,Genome packaging in influenza A virus.J Gen Virol 91,313-328(2010);published online EpubFeb(10.1099 / vir.0.017608-0). Rev Med Virol 20,380-391(2010);Structure of influenza virus ribonucleoprotein complexes and their packaging into virions. [ PMC free article ] [ PubMed ] [ Cross Ref ] 11. Y. Muramoto, A. Takada, K. Fujii, T. Noda, K. Iwatsuki-Horimoto, S. Watanabe, T. Horimoto, H. Kida, Y. Kawaoka, Hierarchy among viral RNA(vRNA)segments in their role in vRNA incorporation into influenza A virions.J Virol 80.2318–2325(2006);published online EpubMar(10.1128 / jvi.80.5.2318–2325.2006). [ PubMed ] 12.Q.Gao,YYChou,S.Doganay,R.Vafabakhsh,T.Ha,P.Palese,The influenza A virus PB2,PA,NP,and M segments play a pivotal role during genome packaging.J Virol 86,7043-7051(2012);published online EpubJul(10.1128 / jvi.00662-12). 13.GAMarsh,R.Rabadan,AJLevine,P.Palese,Highly conserved regions of influenza a virus polymerase gene segments are critical for efficient viral RNA packaging.J Virol 82,2295-2304(2008); 14.E.Fournier,V.Moules,B.Essere,JCPaillart,JDSirbat,C.Isel,A.Cavalier,JPRolland,D.Thomas,B.Lina,R.Marquet,A supramolecular assembly formed by influenza A virus genomic RNA segments.Nucleic Acids Res 40,2197-2209(2012);published online EpubMar(10.1093 / nar / gkr985). 15.C.Gavazzi,C.Isel,E.Fournier,V.Moules,A.Cavalier,D.Thomas,B.Lina,R.Marquet,An in vitro network of intermolecular interactions between viral RNA segments of an avian H5N2 influenza A virus: comparison with a human H3N2 virus.Nucleic Acids Res 41,1241-1254(2013);published online EpubJan(10.1093 / nar / gks1181). 16.JRGog,S.Afonso Edos,RMDalton,I.Leclercq,L.Tiley,D.Elton,JCvon Kirchbach,N.Naffakh,N.Escriou,P.Digard,Codon conservation in the influenza A virus genome defines RNA packaging signals.Nucleic Acids Res 35,1897-1907(2007)10.1093 / nar / gkm087). 17.W.N.Moss,S.F.Priore,D.H.Turner,Identification of potential conserved RNA secondary structure throughout influenza A coding regions.Rna 17,991-1011(2011);published online EpubJun(10.1261 / rna.2619511). 18.Y.Liang,T.Huang,H.Ly,T.G.Parslow,Mutational analyses of packaging signals in influenza virus PA,PB1,and PB2 genomic RNA segments.J Virol 82,229-236(2008);published online EpubJan(10.1128 / JVI.01541-07). 19.K.A.Wilkinson,E.J.Merino,K.M.Weeks,Selective 2’-hydroxyl acylation analyzed by primer extension(SHAPE):quantitative RNA structure analysis at single nucleotide resolution.Nature protocols 1,1610-1616(2006)10.1038 / nprot.2006.249). 20.P.S.Pang,M.Elazar,E.A.Pham,J.S.Glenn,Simplified RNA secondary structure mapping by automation of SHAPE data analysis.Nucleic Acids Res 39,e151(2011);published online EpubDec(10.1093 / nar / gkr773). 21.S.F.Priore,W.N.Moss,D.H.Turner,Influenza A virus coding regions exhibit host-specific global ordered RNA structure.PLoS One 7,e35989(2012)10.1371 / journal.pone.0035989). 22.W.Kladwang,R.Das,A mutate-and-map strategy for inferring base pairs in structured nucleic acids:proof of concept on a DNA / RNA helix.Biochemistry 49,7414-7416(2010);published online EpubSep 7(10.1021 / bi101123g). 23.S.Tian,P.Cordero,W.Kladwang,R.Das,High-throughput mutate-map-rescue evaluates SHAPE-directed RNA structure and uncovers excited states.Rna 20,1815-1826(2014);published online EpubNov(10.1261 / rna.044321.114). 24.B.Vester,J.Wengel,LNA(locked nucleic acid):high-affinity targeting of complementary RNA and DNA.Biochemistry 43,13233-13241(2004);published online EpubOct 26(10.1021 / bi0485732). 25.K.Klumpp,R.W.Ruigrok,F.Baudin,Roles of the influenza virus polymerase and nucleoprotein in forming a functional RNP structure.Embo J 16,1248-1257(1997);published online EpubMar 17(10.1093 / emboj / 16.6.1248). 26.R.Coloma,J.M.Valpuesta,R.Arranz,J.L.Carrascosa,J.Ortin,J.Martin-Benito,The structure of a biologically active influenza virus ribonucleoprotein complex.PLoS Pathog 5,e1000491(2009);published online EpubJun(10.1371 / journal.ppat.1000491). 27.F.Baudin,C.Bach,S.Cusack,R.W.Ruigrok,Structure of influenza virus RNP.I.Influenza virus nucleoprotein melts secondary structure in panhandle RNA and exposes the bases to the solvent.Embo J 13,3158-3165(1994);published online EpubJul 1( 28.T.Coelho,D.Adams,A.Silva,P.Lozeron,PNHawkins,T.Mant,J.Perez,J.Chiesa,S.Warrington,E.Tranter,M.Munisamy,R.Falzone,J.Harrop,J.Cehelsky,BRBettencourt,M.Geis sler,JSButler,A.Sehgal,REMeyers,Q.Chen,T.Borland,RMHutabarat,VAClausen,R.Alvarez,K.Fitzgerald,C.Gamba-Vitalo,SVNochur,AKVaishnaw,DWSah,JAGollob,OBSuhr,Safety and efficacy of RNAi therapy for transthyretin amyloidosis.N Engl J Med 369,819-829(2013);published online EpubAug 29(10.1056 / NEJMoa1208760). 29.K.Fitzgerald,M.Frank-Kamenetsky,S.Shulga-Morskaya,A.Liebow,B.R.Bettencourt,J.E.Sutherland,R.M.Hutabarat,V.A.Clausen,V.Karsten,J.Cehelsky,S.V.Nochur,V.Kotelianski,J.Horton,T.Mant,J.Chiesa,J.Ritter,M.Munisamy,A.K.Vaishnaw,J.A.Gollob,A.Simon,Effect of an RNA interference drug on the synthesis of proprotein convertase subtilisin / kexin type 9(PCSK9)and the concentration of serum LDL cholesterol in healthy volunteers:a randomised,single-blind,placebo-controlled,phase 1 trial.Lancet 383,60-68(2014);published online EpubJan 4(10.1016 / S0140-6736(13)61914-5). 30.J.Gottlieb,M.R.Zamora,T.Hodges,A.W.Musk,U.Sommerwerk,D.Dilling,S.Arcasoy,J.DeVincenzo,V.Karsten,S.Shah,B.R.Bettencourt,J.Cehelsky,S.Nochur,J.Gollob,A.Vaishnaw,A.R.Simon,A.R.Glanville,ALN-RSV01 for prevention of bronchiolitis obliterans syndrome after respiratory syncytial virus infection in lung transplant recipients.J Heart Lung Transplant 35,213-221(2016);published online EpubFeb(10.1016 / j.healun.2015.08.012). 31.E.Hoffmann,G.Neumann,Y.Kawaoka,G.Hobom,R.G.Webster,A DNA transfection system for generation of influenza A virus from eight plasmids.Proc Natl Acad Sci U S A 97,6108-6113(2000);published online EpubMay 23(10.1073 / pnas.100133697). 32.K.J.Szretter,A.L.Balish,J.M.Katz,Influenza:propagation,quantification,and storage.Current protocols in microbiology Chapter 15,Unit 15G 11(2006);published online EpubDec(10.1002 / 0471729256.mc15g01s3). 33.G.A.Marsh,R.Hatami,P.Palese,Specific residues of the influenza A virus hemagglutinin viral RNA are important for efficient packaging into budding virions.J Virol 81,9727-9736(2007);published online EpubSep(10.1128 / jvi.01144-07). 34.S.A.Mortimer,K.M.Weeks,Time-resolved RNA SHAPE chemistry:quantitative RNA structure analysis in one-second snapshots and at single-nucleotide resolution.Nature protocols 4,1413-1421(2009)10.1038 / nprot.2009.126). 35.A.Akbari,G.Marthinsen,J.T.Lifjeld,F.Albregtsen,L.Wennerberg,N.C.Stenseth,K.S.Jakobsen,Improved DNA fragment length estimation in capillary electrophoresis.Electrophoresis 29,1273-1285(2008);published online EpubMar(10.1002 / elps.200700523). 36.P.S.Pang,E.A.Pham,M.Elazar,S.G.Patel,M.R.Eckart,J.S.Glenn,Structural map of a microRNA-122:hepatitis C virus complex.J Virol 86,1250-1254(2012);published online EpubJan(10.1128 / JVI.06367-11). 37.K.E.Deigan,T.W.Li,D.H.Mathews,K.M.Weeks,Accurate SHAPE-directed RNA structure determination.Proc Natl Acad Sci U S A 106,97-102(2009);published online EpubJan 6(10.1073 / pnas.0806929106). 38.P.De Rijk,J.Wuyts,R.De Wachter,RnaViz 2:an improved representation of RNA secondary structure.Bioinformatics 19,299-300(2003);published online EpubJan 22. 39.W.Kladwang,C.C.VanLang,P.Cordero,R.Das,A two-dimensional mutate-and-map strategy for non-coding RNA structure.Nature chemistry 3,954-962(2011);published online EpubDec(10.1038 / nchem.1176). 40.W.Kladwang,P.Cordero,R.Das,A mutate-and-map strategy accurately infers the base pairs of a 35-nucleotide model RNA.Rna 17,522-534(2011);published online EpubMar(10.1261 / rna.2516311). 41.P.Cordero,W.Kladwang,C.C.VanLang,R.Das,in RNA Folding(Methods in Molecular Biology),C.Waldsich,Ed.(2013),pp.in press. 42.S.A.Mortimer,K.M.Weeks,A fast-acting reagent for accurate analysis of RNA secondary and tertiary structure by SHAPE chemistry.J Am Chem Soc 129,4144-4145(2007);published online EpubApr 11(10.1021 / ja0704028). 43.S.Yoon,J.Kim,J.Hum,H.Kim,S.Park,W.Kladwang,R.Das,HiTRACE:high-throughput robust analysis for capillary electrophoresis.Bioinformatics 27,1798-1805(2011);published online EpubJul 1(10.1093 / bioinformatics / btr277). 44.H.Kim,P.Cordero,R.Das,S.Yoon,HiTRACE-Web:an online tool for robust analysis of high-throughput capillary electrophoresis.Nucleic Acids Research 41,W492-W498(2013);published online EpubJuly 1,2013(10.1093 / nar / gkt501). 45.J.Kim,S.Yu,B.Shim,H.Kim,H.Min,E.-Y.Chung,R.Das,S.Yoon,A robust peak detection method for RNA structure inference by high-throughput contact mapping.Bioinformatics 25,1137-1144(2009);published online EpubMay 1,2009(10.1093 / bioinformatics / btp110). 46.W.Kladwang,T.H.Mann,A.Becka,S.Tian,H.Kim,S.Yoon,R.Das,Standardization of RNA chemical mapping experiments.Biochemistry 53,3063-3065(2014);published online EpubMay 20(10.1021 / bi5003426). 47.D.H.Mathews,M.D.Disney,J.L.Childs,S.J.Schroeder,M.Zuker,D.H.Turner,Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure.Proc Natl Acad Sci U S A 101,7287-7292(2004);published online EpubMay 11(10.1073 / pnas.0401799101). 48.K.Darty,A.Denise,Y.Ponty,VARNA:Interactive drawing and editing of the RNA secondary structure.Bioinformatics 25,1974-1975(2009);published online EpubAug 1(10.1093 / bioinformatics / btp250). 49. P. Cordero, JBLucks, R. Das, An RNA Mapping DataBase for curating RNA structure mapping experiments.Bioinformatics 28, 3006-3008(2012); published online EpubNov 15(10.1093 / bioinformatics / bts554).
[0219] Although the aforementioned invention has been described in some detail by examples and illustrations for the purpose of clear understanding, it will be readily apparent to those skilled in the art that certain changes and modifications can be made in light of the teachings of the present invention without departing from the spirit or scope of the appended claims.
[0220] Therefore, the above merely illustrates the principles of the present invention. Those skilled in the art will understand that various arrangements embodying the principles of the present invention and falling within its spirit and scope can be devised, although these are not expressly described or shown herein. Furthermore, all examples and conditional language described herein are intended primarily to help the reader understand the principles of the present invention and the concepts to which the inventors contribute to the advancement of the art, and should be interpreted as not being limited to such specifically described examples and conditions. Moreover, all descriptions herein describing the principles, aspects, and embodiments of the present invention, as well as specific examples thereof, are intended to encompass both their structural and functional equivalents. In addition, such equivalents are intended to include both currently known equivalents and future-developed equivalents, i.e., any elements developed to perform the same function regardless of structure. Therefore, the scope of the present invention is not intended to be limited to the embodiments shown and described herein. Rather, the scope and spirit of the present invention are embodied by the appended embodiments.
[0221] Notwithstanding the attached claims, the disclosures described herein are also described by the following sections. Item 1. An oligonucleotide compound comprising an oligonucleotide sequence complementary to the PB2 vRNA region, wherein the region comprises nucleotides 34-87 in the (-) sense notation of the 5' coding region of PB2 vRNA, or a salt thereof. Item 2. The compound described in Item 1, comprising an oligonucleotide sequence containing at least eight nucleoside subunits complementary to the region of PB2 vRNA. Item 3. The compound according to item 1 or 2, wherein the oligonucleotide is complementary to the region of the packaging stem-loop 2 (PSL2) motif of the PB2 vRNA region. Item 4. A compound according to any one of items 1 to 3, wherein the oligonucleotide comprises an internucleoside bond selected from phosphorothioate, phosphorodithioate, phosphoramidate, and thiophosphoramidate bonds. Item 5. A compound according to any one of items 1 to 4, wherein all internucleoside bonds of the oligonucleotide are selected from phosphorothioates, phosphorodithioates, phosphoramidates, thiophosphoramidates, and phosphodiester bonds. Item 6. The compound according to item 4 or 5, wherein the internuseroside bond of the oligonucleotide is chiral. Item 7. A compound according to any one of items 1 to 5, wherein the oligonucleotide comprises a cross-linked nucleic acid (BNA) nucleotide. Item 8. A compound according to any one of items 1 to 5, wherein the oligonucleotide comprises a locic nucleic acid (LNA) nucleotide. Item 9. A compound according to any one of items 1 to 5, wherein the oligonucleotide comprises an ethylene-crosslinked nucleic acid (ENA) nucleotide. Item 10. A compound according to any one of items 1 to 5, wherein the oligonucleotide comprises a restricted ethyl nucleic acid (cEt) nucleotide. Item 11. A compound according to any one of items 1 to 5, wherein the oligonucleotide contains a 2'-modified nucleotide. Item 12. Oligonucleotides are, 5'ACCAAAAGAAT3' (Sequence ID 45), 5'TGGCCATCAAT3' (Sequence ID 46), 5'TAGCATACTTA3' (SEQ ID NO: 47), 5'CCAAAAGA3' (Sequence ID 48), 5'CATACTTA3' (SEQ ID NO: 49), 5'CAGACACGACCAAAA3' (Sequence ID 50), 5'TACTTACTGACAGCC3' (Sequence ID 51), 5'AGACACGACCAAAAG3' (Sequence ID 52), 5'ACCAAAAGAAT3' (Sequence ID 53), 5'TGGCCATCAAT3' (Sequence ID 54), 5'TAGCATACTTA3' (SEQ ID NO: 55), 5'CGACCAAAAGAATTC3' (Sequence ID 56), 5'CGACCAAAAGAATTC3' (Sequence ID 57), 5'GATGGCCATCAATTA3' (Sequence ID 58), 5'GATGGCCATCAATTA3' (Sequence ID 59), 5'TCTAGCATACTTACT3' (Sequence ID 60), 5'TCTAGCATACTTACT3' (Sequence ID 61), 5'GAATTCGGATGGCCA3' (Sequence ID 62), 5'GGCCATCAATTAGTG3' (Sequence ID 63), 5'TTCGGATGGCCATCA3' (Sequence ID 64), 5'AGCCAGACAGCGA3' (Sequence ID 65), 5'GACAGCCAGACAGCA3' (Sequence No. 66), 5'CGACCAAAAGAATT3' (Sequence ID 98), 5'GACCAAAAGAATTCGG3' (Sequence ID 99), 5'AGCATACTTACTGACA3' (Sequence ID 100), 5'CATACTTACTGACA3' (Sequence ID 101), 5'ATACTTACTGACAG3' (Sequence ID 102), 5'CATACTTACTGACAGC3' (Sequence ID 103), 5'AGACAGCGACCAAAAG3' (Sequence ID 104), 5'ACAGCGACCAAAAG (Sequence ID 105), 5'CAGCCAGACAGCGAC3' (Sequence ID 106), 5'CAGCCAGACAGCGA3' (Sequence ID 107), 5'ACAGCCAGACAGCGA3' (Sequence ID 108), 5'GACAGCCAGACAGCG3' (Sequence ID 109), 5'CATCAATTAGTGTCG3' (Sequence ID 110), 5'CCATCAATTAGTGTCG3' (Sequence ID 111), 5'GCCATCAATTAGTGTG3' (Sequence ID 112), 5'AAGAATTCGGATGGC3' (Sequence ID 113), 5'CAGACAGCGACCAA3' (SEQ ID NO: 114), A compound according to any one of items 1 to 11, comprising a sequence selected from 5'TGACAGCCAGACAGC3' (SEQ ID NO: 115). Item 13. Oligonucleotides are, 5'GAATTCGGATGGCCA3' (Sequence ID 62), 5'AGCCAGACAGCGA3' (Sequence ID 65), 5'CGACCAAAAGAATT3' (Sequence ID 98), 5'GACCAAAAGAATTCGG3' (Sequence ID 99), 5'AGCATACTTACTGACA3' (Sequence ID 100), 5'CATACTTACTGACA3' (Sequence ID 101), 5'ATACTTACTGACAG3' (Sequence ID 102), 5'CATACTTACTGACAGC3' (Sequence ID 103), 5'AGACAGCGACCAAAAG3' (Sequence ID 104), 5'ACAGCGACCAAAAG (Sequence ID 105), 5'CAGCCAGACAGCGAC3' (Sequence ID 106), 5'CAGCCAGACAGCGA3' (Sequence ID 107), 5'ACAGCCAGACAGCGA3' (Sequence ID 108), 5'GACAGCCAGACAGCG3' (Sequence ID 109), 5'CATCAATTAGTGTCG3' (Sequence ID 110), 5'CCATCAATTAGTGTCG3' (Sequence ID 111), 5'GCCATCAATTAGTGTG3' (Sequence ID 112), 5'AAGAATTCGGATGGC3' (Sequence ID 113), 5'CAGACAGCGACCAA3' (SEQ ID NO: 114), and The compound described in item 12, comprising a sequence selected from 5'TGACAGCCAGACAGC3' (SEQ ID NO: 115). The compound according to item 12, comprising an oligonucleotide having at least 70% sequence identity with a sequence selected from item 14 (SEQ ID NOs: 45-66) and (SEQ ID NOs: 98-115). The compound according to item 14, comprising an oligonucleotide having at least 80% sequence identity with a sequence selected from (SEQ ID NOs: 45-66) and (SEQ ID NOs: 98-115). The compound according to item 15, comprising an oligonucleotide having at least 90% sequence identity with a sequence selected from item 16 (SEQ ID NOs: 45-66) and (SEQ ID NOs: 98-115). Item 17. The compound according to Item 12, wherein one or more nucleotides of the oligonucleotide are modified nucleotides (for example, as described herein). Item 18. A compound according to item 12, wherein one or more nucleotides of the oligonucleotide are cross-linked nucleic acid (BNA) nucleotides. Item 19. A compound described in Item 12, wherein all nucleotides of the oligonucleotide are locic nucleic acid (LNA) nucleotides. Item 20. The compounds described in Item 12, wherein one or more nucleotides of the oligonucleotide are ethylene cross-linked nucleic acid (ENA) nucleotides. Item 21. The compounds described in Item 12, wherein one or more nucleotides of the oligonucleotide are restricted ethyl nucleic acid (cEt) nucleotides. Item 22. The compound described in Item 12, wherein one or more nucleotides of the oligonucleotide contain a 2'-modified nucleotide. Item 23. Oligonucleotides are, LNA1:5'AccAaaAGaaT3'(SEQ ID NO: 67) LNA2:5'TggCcATcaaT3'(SEQ ID NO: 68) LNA3:5'TagCAtActtA3' (SEQ ID NO: 69) LNA4:5'CCAAAAGA3' (SEQ ID NO: 70) LNA5:5'CATACTTA3' (SEQ ID NO: 71) LNA6:5'CagaCaCGaCCaaAA3' (SEQ ID NO: 72) LNA7:5'TAcTtaCTgaCagCC3' (SEQ ID NO: 73) LNA8:5'AGACacgaccaAAAG3' (SEQ ID NO: 74) LNA9:5'TACTtactgacaGCC3' (SEQ ID NO: 75) LNA9.2:5'TACttactgacAGCC3' (SEQ ID NO: 76) LNA10:5'ACCaaaagAAT3' (SEQ ID NO: 77) LNA11:5'TGGccatcAAT3' (SEQ ID NO: 78) LNA12:5'TAGcatacTTA3' (SEQ ID NO: 79) LNA13:5'CgacCAaaAGaattC3' (SEQ ID NO: 80) LNA14:5'CGACcaaaagaATTC3' (SEQ ID NO: 81) LNA15:5'GaTGgCcATcaAttA3' (SEQ ID NO: 82) LNA16:5'GATGgccatcaATTA3' (SEQ ID NO: 83) LNA17:5'TcTAgCaTActTacT3' (SEQ ID NO: 84) LNA18:5'TCTAgcatactTACT3' (SEQ ID NO: 85) LNA19:5'GAAttcggatgGCCA3' (SEQ ID NO: 86) LNA20:5'GGCCatcaattaGTG3' (Sequence ID 87), LNA21:5'TTCGgatggccaTCA3' (Sequence ID 88) LNA22:5'AGCCagacagCGA3' (Sequence ID 89), LNA23:5'GACAgccagacaGCA3' (SEQ ID NO: 90) LNA9.G74C:5'TACTtactgacaGTC3' (SEQ ID NO: 91), and Includes a sequence selected from LNA9.T80C:5'TACTtaccgacaGCC3' (SEQ ID NO: 92), The compounds described in item 12, where uppercase letters indicate LNA nucleotides and lowercase letters indicate DNA nucleotides. Item 24. Oligonucleotides are, LNA19:5'GAAttcggatgGCCA3' (SEQ ID NO: 86) LNA22:5'AGCCagacagCGA3' (Sequence ID 89), LNA22.2:5'CAGCcagacagCGAC3' (SEQ ID NO: 116) LNA22.3:5'CAGccagacagCGAC3' (SEQ ID NO: 117) LNA22.5:5'CAGccagacaGCGA3' (SEQ ID NO: 118) LNA22.6:5'CAGccagacagCGA3' (SEQ ID NO: 119) LNA22.7:5'CAGCcagacagCGA3' (SEQ ID NO: 120) LNA22.8:5'ACAgccagacagCGA3' (SEQ ID NO: 121) LNA22.9:5'ACAGccagacaGCGA3' (SEQ ID NO: 122) LNA22.10:5'ACAgccagacaGCGA3' (SEQ ID NO: 123) LNA22.11:5'GACAgccagacaGCG3' (SEQ ID NO: 124) LNA22.13:5'GACagccagacaGCG3' (SEQ ID NO: 125), and The compound described in item 12, comprising a sequence selected from LNA22.14:5'GACAgccagacAGCG (SEQ ID NO: 126). Item 25. Oligonucleotides are, LNA24:5'CATcaattagtgTCG3'(Sequence ID 127), LNA25:5'CCAtcaattagtgTCG3'(Sequence ID 128), LNA26:5'GCCatcaattagtGTG3' (SEQ ID NO: 129) LNA27:5'AAGAattcggaTGGC3' (SEQ ID NO: 130) LNA28:5'CAGacagcgacCAA3' (SEQ ID NO: 131), and The compound described in item 12, comprising a sequence selected from LNA29:5'TGAcagccagacAGC3' (SEQ ID NO: 132). Item 26. Oligonucleotides are, LNA14:5'CGACcaaaagaATTC3' (SEQ ID NO: 81) LNA14.5:5'CGACcaaaagaATT3' (SEQ ID NO: 135) LNA14.8:5'CGACcaaaagaaTTC3' (SEQ ID NO: 137) LNA14.28:5'GACcaaaagaatTCGG3' (Sequence ID 148) LNA14.30:5'GACCaaaagaattCGG3' (SEQ ID NO: 149) LNA9:5'TACTtactgacaGCC3' (SEQ ID NO: 75) LNA9.1:5'AGCAtacttactGACA3' (SEQ ID NO: 159) LNA9.2a:5'CATacttactgACA3' (SEQ ID NO: 160) LNA9.8:5'ATActtactgACAG(SEQ ID NO: 164) LNA9.12:5'CATActtactgacAGC(SEQ ID NO: 167) LNA8a:5'AGAcagcgaccaaAAG (Sequence ID 188) LNA8a.1:5'AGACagcgaccaAAAG (SEQ ID NO: 189), and The compound described in item 12, comprising a sequence selected from LNA8a.2:5'ACAGcgaccaAAAG (SEQ ID NO: 190). A compound according to any one of claims 23 to 26, comprising an oligonucleotide having at least 70% sequence identity with a sequence selected from (SEQ ID NOs. 67-92) and (SEQ ID NOs. 116-191). The compound according to item 27, comprising an oligonucleotide having at least 80% sequence identity with a sequence selected from item 28 (SEQ ID NOs. 67-92) and (SEQ ID NOs. 116-191). The compound according to item 28, comprising an oligonucleotide having at least 90% sequence identity with a sequence selected from item 29 (SEQ ID NOs. 67-92) and (SEQ ID NOs. 116-191). Item 30. A compound according to any one of items 1 to 29, wherein the oligonucleotide comprises at least five deoxyribonucleotide units and is capable of recruiting an RNase. Item 31. A compound described in any one of items 1 to 30, wherein binding to a region of PB2 vRNA disrupts the overall secondary RNA structure of PB2 vRNA. Item 32. A compound according to any one of items 1 to 30, wherein binding to the PB2 vRNA region of the compound inhibits the packaging ability of PB2 vRNA. Item 33. A compound according to any one of items 1 to 32, wherein the compound is an oligonucleotide conjugate having enhanced cellular uptake. Item 34. The compound described in Item 33, wherein the compound is an oligonucleotide-lipid conjugate. Item 35. A compound according to any one of items 1 to 33, wherein the compound is an oligonucleotide conjugate with a cell-specific protein. Item 36. A method for inhibiting influenza A virus in cells, comprising contacting a sample containing viral RNA (vRNA) having a PSL2 motif with an effective amount of a drug that specifically binds to the PSL2 motif to inhibit influenza A virus. Item 37. The method according to item 36, wherein the drug is an oligonucleotide compound or a salt thereof comprising at least eight nucleoside subunits complementary to the PSL2 motif of the vRNA. Item 38. The method according to item 36 or 37, wherein the drug is an oligonucleotide compound described in any one of items 1 to 35. Item 39. The method according to any one of items 36-38, wherein the vRNA in the sample is PB2 vRNA. Item 40. Contacting the sample with the drug results in at least 1 log of the virus. 10 The method according to any one of claims 36 to 39, which results in a loss of titer. Item 41. Contacting the sample with the drug results in at least 2 logs of the virus. 10 The method according to any one of claims 36 to 39, which results in a loss of titer. Item 42. The method according to any one of items 36-41, wherein the drug disrupts the overall structure of the PSL2 motif of the vRNA. Item 43. The method according to any one of items 36-41, wherein the drug inhibits the packaging ability of the PSL2 motif of vRNA. Item 44. The method according to any one of items 36-41, wherein vRNA is isolated from a virion or cell. Item 45. The method according to any one of items 36 to 41, wherein the vRNA is contained in the virion or infected cell. Item 46. The method according to any one of claims 36 to 45, wherein the sample is in vitro. Item 47. The method according to any one of claims 36 to 41 or 45, wherein the sample is in vivo. Item 48. A method for treating or preventing influenza A virus infection in a subject, comprising administering to a subject requiring treatment or prevention of influenza A virus infection a pharmaceutical composition containing an effective amount of an activator that specifically binds to the PSL2 motif of viral RNA (vRNA). Item 49. The method according to item 48, wherein the vRNA is PB2 vRNA. 50. The method according to item 48 or 49, wherein the activator is a compound comprising an oligonucleotide sequence containing at least eight nucleoside subunits complementary to the region of PB2 vRNA. Item 51. The method according to any one of items 48 to 50, wherein the drug is an oligonucleotide compound as described in any one of items 1 to 35. Item 52. The method according to any one of items 48 to 51, wherein the subject is at risk of influenza A virus infection, and the administration of the oligonucleotide compound protects the subject from infection for more than one week (e.g., more than two weeks, more than three weeks, more than one month, more than two months, more than three months, etc.). Item 53 The method according to item 52, wherein the administration comprises administering an effective dose of an oligonucleotide compound weekly, bi-weekly, or monthly. Item 54. The administration reduces the virus in the sample by at least 1 log. 10 The method according to any one of claims 48 to 53, which results in a loss of titer. Item 55. The administration reduces the virus in the sample by at least 2 log. 10 The method according to any one of claims 48 to 53, which results in a loss of titer. Item 56. The method according to any one of items 48 to 53, wherein the activator is an oligonucleotide conjugate having enhanced cellular uptake. Item 57. The method according to any one of items 48 to 55, wherein the activator is an oligonucleotide conjugate with a cell-specific protein. Item 58. The method according to any one of items 48 to 55, wherein the pharmaceutical composition comprises a cell uptake enhancer. Item 59. The method according to any one of items 48 to 55, wherein the pharmaceutical composition further comprises an additional activator selected from a second oligonucleotide activator and an antiviral agent. Item 60. The method according to any one of items 48 to 55, wherein the activator is siRNA, shRNA, antisense RNA, or antisense DNA. Item 61. The subject is at risk of influenza A virus infection, and the method is to prevent infection, as described in any one of items 48-55. Item 62. A subject diagnosed with or suspected of having influenza A virus infection, and the method is to treat the infection, as described in any one of items 48-55. Item 63. A method for screening candidate drugs for their ability to inhibit influenza A virus in cells, wherein the method is The process involves contacting a sample containing viral RNA (vRNA) with the PSL2 motif with a candidate drug, This includes determining whether a candidate drug specifically binds to the PSL2 motif, A method for inhibiting influenza A virus in cells involves using a drug that specifically binds to the PSL2 motif. Item 64. The method according to item 63, wherein the candidate drug is selected from small molecules, nucleic acids, and polypeptides. 65. The method according to 64, wherein the step of determining includes detecting cellular parameters, and changes in intracellular parameters compared to cells not in contact with the candidate drug indicate that the candidate drug specifically binds to the PSL2 motif. Item 66. The method according to any one of items 63 to 65, wherein a drug that specifically binds to the PSL2 motif treats a subject having an influenza A virus infection. Item 67. Methods for treating or preventing respiratory viral infections in subjects, A method comprising administering to a subject in need of treatment or prevention of a respiratory viral infection a pharmaceutical composition containing an effective amount of an activator that specifically binds to a target motif of the target viral RNA (vRNA) or miRNA that associates with the target motif. Item 68. The method according to item 67, wherein the drug is an oligonucleotide compound comprising a sequence selected from the group consisting of SEQ ID NOs: 45 to 907. Item 69. The method according to item 68, wherein the method comprises two or more administered sequences selected from the group consisting of SEQ ID NOs: 45 to 907. Item 70. The method according to item 69, wherein two or more sequences are directed to different respiratory viruses. Item 71. The method according to any one of items 67-70, wherein the subject is at risk of respiratory viral infection and the administration of the oligonucleotide compound protects the subject from infection for more than one week (e.g., more than two weeks, more than three weeks, more than one month, more than two months, more than three months, etc.). Claim 72 The method according to Claim 71, wherein the administration comprises administering an effective dose of an oligonucleotide compound weekly, bi-weekly, or monthly. Item 73. The administration reduces the virus in the sample by at least 1 log. 10 The method according to any one of claims 67 to 72, which results in a loss of titer. Item 74. The subject is at risk of respiratory viral infection, and the method is to prevent infection, as described in any one of items 67-73. Item 75. A subject diagnosed with or suspected of having a respiratory viral infection, and the method is a treatment for the infection, as described in any one of items 67-73.
[0222] In at least some of the embodiments described above, one or more elements used in the embodiments may be interchangeably used in other embodiments unless such substitution is technically feasible. Those skilled in the art will understand that various other omissions, additions, and modifications can be made to the above methods and structures without departing from the scope of the claimed subject matter. All such modifications and changes are intended to fall within the scope of the subject matter as defined by the appended claims.
[0223] In general, it will be understood by those skilled in the art that the terms used herein, particularly in the appended claims (e.g., the body of the appended claims), are generally intended to be “open” terms (for example, the term “includes” should be interpreted as “includes, but not limited to,” the term “has” should be interpreted as “has at least,” and the term “includes” should be interpreted as “includes, but not limited to,” etc.). It will be further understood by those skilled in the art that if a certain number of introduced claims are intended, such intention is explicitly stated in the claims, and if such statement is absent, such intention is not present. For example, for the sake of understanding, the following appended claims may include the use of the introductory phrases “at least one” and “one or more” to introduce claims. However, the use of such phrases should not be interpreted as meaning that the introduction of a claim by the indefinite article “a” or “an” limits any particular claim containing such introduced claims to embodiments containing only one such claim. The same claims include introductory phrases such as "one or more" or "at least one" and indefinite articles such as "a" or "an" (e.g., "a" and / or "an" means "at least one" or "one or more"); the same applies to the use of definite articles used to introduce the description of a claim. In addition, even if a specific number of descriptions in an introduced claim is explicitly stated, a person skilled in the art will recognize that such a description should be interpreted as meaning at least the number stated (e.g., the literal description of "two descriptions" without other modifiers means at least two descriptions, or two or more descriptions). Furthermore, when a convention similar to "at least one of A, B, and C, etc." is used, such a construction is generally intended in the sense that a person skilled in the art will understand the convention (e.g., "a system having at least one of A, B, and C" includes, but is not limited to, systems having only A, only B, only C, both A and B, both A and C, both B and C, and / or both A, B, and C, etc.).Where conventions similar to “at least one of A, B, or C” are used, such configurations are generally intended to be understood by those skilled in the art (for example, “a system having at least one of A, B, or C” includes, but is not limited to, systems having only A, only B, only C, both A and B, both A and C, both B and C, and / or both A, B, and C). It will further be understood by those skilled in the art that substantially any separate words and / or phrases presenting two or more alternative terms, whether in the specification, claims, or drawings, should be understood to contemplate the possibility of including one of the terms, either of the terms, or both. For example, the phrase “A or B” will be understood to include the possibilities of “A” or “B” or “A and B”.
[0224] In addition, if any feature or aspect of the present disclosure is described in relation to the Markush group, a person skilled in the art will recognize that the present disclosure also describes any individual member or subgroup of any member of the Markush group.
[0225] For all purposes, including providing written explanations, as will be understood by those skilled in the art, all scopes disclosed herein also encompass all possible sub-scopes and combinations of sub-scopes. Any enumerated scope can be readily recognized as sufficient to explain and enable that the same scope can be divided into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each scope considered herein can readily be broken down into lower thirds, middle thirds, upper thirds, etc. Also, as will be understood by those skilled in the art, all terms such as “maximum,” “at least,” “greater than,” and “less than” include the number stated and refer to a scope that can be subsequently broken down into sub-scopes as considered above. Finally, as will be understood by those skilled in the art, a scope includes each individual member. Thus, for example, a group having 1 to 3 items means a group having 1, 2, or 3 items. Similarly, a group having 1 to 5 items means a group having 1, 2, 3, 4, or 5 items, etc.
[0226] Although the aforementioned invention has been described in some detail by examples and illustrations for the purpose of clear understanding, it will be readily apparent to those skilled in the art that certain changes and modifications can be made in light of the teachings of the present invention without departing from the spirit or scope of the appended claims.
[0227] Therefore, the above merely illustrates the principles of the present invention. Those skilled in the art will understand that various arrangements embodying the principles of the present invention and falling within its spirit and scope can be devised, although not expressly described or shown herein. Furthermore, all examples and conditional language described herein are intended primarily to help the reader understand the principles of the present invention and the concepts to which the inventors contribute to the advancement of the art, and should be construed as not being limited to such specifically described examples and conditions. Moreover, all descriptions herein describing the principles, aspects, and embodiments of the present invention, as well as specific examples thereof, are intended to encompass both their structural and functional equivalents. In addition, such equivalents are intended to include both currently known equivalents and equivalents to be developed in the future, i.e., any elements developed to perform the same function regardless of their structure. Furthermore, nothing disclosed herein is intended to be dedicated to the public, whether such disclosure is expressly described in the claims or not.
[0228] Accordingly, the scope of the present invention is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention are embodied in the appended claims. In the claims, Section 112(f) or Section 112(6) of the U.S. Patent Act is expressly defined as being exercised for the limitation in the claims only if the exact phrase “means for” or “steps for” is found at the beginning of such limitation in the claims, and if such exact phrase is not used in the limitation in the claims, Section 112(f) or Section 112(6) of the U.S. Patent Act is not exercised. In certain embodiments, for example, the following are provided: (Item 1) An oligonucleotide compound or a salt thereof comprising an oligonucleotide sequence containing at least eight nucleoside subunits complementary to the packaging stem-loop 2 (PSL2) motif region of PB2 viral RNA (vRNA) or a variant thereof, wherein the oligonucleotide compound inhibits viral production. (Item 2) The compound according to item 1, wherein the oligonucleotide comprises an internucleoside bond selected from phosphorothioate, phosphorodithioate, phosphoramidate, and thiophosphoramidate bonds. (Item 3) The compound according to item 2, wherein the oligonucleotide contains one or more chiral nucleoside bonds. (Item 4) The compound described in item 1, wherein the oligonucleotide comprises a cross-linked nucleic acid (BNA) nucleotide. (Item 5) The compound according to item 4, wherein the BNA nucleotide is selected from the group consisting of locked nucleic acid (LNA) nucleotide, ethylene-crosslinked nucleic acid (ENA) nucleotide, and restricted ethyl (cEt) nucleotide. (Item 6) The compound according to item 1, wherein the oligonucleotide comprises one or more 2'-modified nucleotides. (Item 7) The oligonucleotide is 5'ACCAAAAGAAT3' (Sequence ID 45), 5'TGGCCATCAAT3' (Sequence ID 46), 5'TAGCATACTTA3' (SEQ ID NO: 47), 5'CCAAAAGA3' (Sequence ID 48), 5'CATACTTA3' (SEQ ID NO: 49), 5'CAGACACGACCAAAA3' (Sequence ID 50), 5'TACTTACTGACAGCC3' (Sequence ID 51), 5'AGACACGACCAAAAG3' (Sequence ID 52), 5'ACCAAAAGAAT3' (Sequence ID 53), 5'TGGCCATCAAT3' (Sequence ID 54), 5'TAGCATACTTA3' (SEQ ID NO: 55), 5'CGACCAAAAGAATTC3' (Sequence ID 56), 5'CGACCAAAAGAATTC3' (Sequence ID 57), 5'GATGGCCATCAATTA3' (Sequence ID 58), 5'GATGGCCATCAATTA3' (Sequence ID 59), 5'TCTAGCATACTTACT3' (Sequence ID 60), 5'TCTAGCATACTTACT3' (Sequence ID 61), 5'GAATTCGGATGGCCA3' (Sequence ID 62), 5'GGCCATCAATTAGTG3' (Sequence ID 63), 5'TTCGGATGGCCATCA3' (Sequence ID 64), 5'AGCCAGACAGCGA3' (Sequence ID 65), 5'GACAGCCAGACAGCA3' (Sequence No. 66), 5'CGACCAAAAGAATT3' (Sequence ID 98), 5'GACCAAAAGAATTCGG3' (Sequence ID 99), 5'AGCATACTTACTGACA3' (Sequence ID 100), 5'CATACTTACTGACA3' (Sequence ID 101), 5'ATACTTACTGACAG3' (Sequence ID 102), 5'CATACTTACTGACAGC3' (Sequence ID 103), 5'AGACAGCGACCAAAAG3' (Sequence ID 104), 5'ACAGCGACCAAAAG (Sequence ID 105), 5'CAGCCAGACAGCGAC3' (Sequence ID 106), 5'CAGCCAGACAGCGA3' (Sequence ID 107), 5'ACAGCCAGACAGCGA3' (Sequence ID 108), 5'GACAGCCAGACAGCG3' (Sequence ID 109), 5'CATCAATTAGTGTCG3' (Sequence ID 110), 5'CCATCAATTAGTGTCG3' (Sequence ID 111), 5'GCCATCAATTAGTGTG3' (Sequence ID 112), 5'AAGAATTCGGATGGC3' (Sequence ID 113), 5'CAGACAGCGACCAA3' (SEQ ID NO: 114), and Includes a sequence selected from 5'TGACAGCCAGACAGC3' (sequence number 115), The compound according to item 1, wherein the oligonucleotide comprises one or more modified nucleic acids (e.g., BNA, LNA, ENA, cEt, or 2' modification). (Item 8) The oligonucleotide is 5'GAATTCGGATGGCCA3' (Sequence ID 62), 5'AGCCAGACAGCGA3' (Sequence ID 65), 5'CGACCAAAAGAATT3' (Sequence ID 98), 5'GACCAAAAGAATTCGG3' (Sequence ID 99), 5'AGCATACTTACTGACA3' (Sequence ID 100), 5'CATACTTACTGACA3' (Sequence ID 101), 5'ATACTTACTGACAG3' (Sequence ID 102), 5'CATACTTACTGACAGC3' (Sequence ID 103), 5'AGACAGCGACCAAAAG3' (Sequence ID 104), 5'ACAGCGACCAAAAG (Sequence ID 105), 5'CAGCCAGACAGCGAC3' (Sequence ID 106), 5'CAGCCAGACAGCGA3' (Sequence ID 107), 5'ACAGCCAGACAGCGA3' (Sequence ID 108), 5'GACAGCCAGACAGCG3' (Sequence ID 109), 5'CATCAATTAGTGTCG3' (Sequence ID 110), 5'CCATCAATTAGTGTCG3' (Sequence ID 111), 5'GCCATCAATTAGTGTG3' (Sequence ID 112), 5'AAGAATTCGGATGGC3' (Sequence ID 113), 5'CAGACAGCGACCAA3' (SEQ ID NO: 114), and The compound described in item 1, comprising a sequence selected from 5'TGACAGCCAGACAGC3' (SEQ ID NO: 115). (Item 9) The compound described in item 1, comprising an oligonucleotide sequence having at least 70% sequence identity with a sequence selected from (SEQ ID NOs. 45-66) and (SEQ ID NOs. 98-115). (Item 10) The compound according to item 8, wherein the oligonucleotide comprises at least five deoxyribonucleotide units and is capable of recruiting an RNase. (Item 11) The oligonucleotide is LNA19:5'GAAttcggatgGCCA3' (SEQ ID NO: 86) LNA22:5'AGCCagacagCGA3' (Sequence ID 89), LNA22.2:5'CAGCcagacagCGAC3' (SEQ ID NO: 116) LNA22.3:5'CAGccagacagCGAC3' (SEQ ID NO: 117) LNA22.5:5'CAGccagacaGCGA3' (SEQ ID NO: 118) LNA22.6:5'CAGccagacagCGA3' (SEQ ID NO: 119) LNA22.7:5'CAGCcagacagCGA3' (SEQ ID NO: 120) LNA22.8:5'ACAgccagacagCGA3' (SEQ ID NO: 121) LNA22.9:5'ACAGccagacaGCGA3' (SEQ ID NO: 122) LNA22.10:5'ACAgccagacaGCGA3' (SEQ ID NO: 123) LNA22.11:5'GACAgccagacaGCG3' (SEQ ID NO: 124) LNA22.13:5'GACagccagacaGCG3' (SEQ ID NO: 125) LNA22.14:5'GACAgccagacAGCG(SEQ ID NO: 126) LNA24:5'CATcaattagtgTCG3'(Sequence ID 127), LNA25:5'CCAtcaattagtgTCG3'(Sequence ID 128), LNA26:5'GCCatcaattagtGTG3' (SEQ ID NO: 129) LNA27:5'AAGAattcggaTGGC3' (SEQ ID NO: 130) LNA28:5'CAGacagcgacCAA3' (Sequence ID 131) LNA29:5'TGAcagccagacAGC3' (SEQ ID NO: 132) LNA14.5:5'CGACcaaaagaATT3' (SEQ ID NO: 135) LNA14.8:5'CGACcaaaagaaTTC3' (SEQ ID NO: 137) LNA14.28:5'GACcaaaagaatTCGG3' (Sequence ID 148) LNA14.30:5'GACCaaaagaattCGG3' (SEQ ID NO: 149) LNA9.1:5'AGCAtacttactGACA3' (SEQ ID NO: 159) LNA9.2a:5'CATacttactgACA3' (SEQ ID NO: 160) LNA9.8:5'ATActtactgACAG(SEQ ID NO: 164) LNA9.12:5'CATActtactgacAGC(SEQ ID NO: 167) LNA8a:5'AGAcagcgaccaaAAG (Sequence ID 188) LNA8a.1:5'AGACagcgaccaAAAG (SEQ ID NO: 189), and Includes a sequence selected from LNA8a.2:5'ACAGcgaccaAAAG (sequence number 190), Compounds listed in item 7, where uppercase letters indicate LNA nucleotides and lowercase letters indicate DNA nucleotides. (Item 12) The compound described in item 1, comprising an oligonucleotide sequence having at least 70% sequence identity with a sequence selected from LNA1 to LNA29 (sequence numbers 67 to 92 and 116 to 191). (Item 13) A method for inhibiting influenza A virus in cells, A method comprising contacting a sample containing viral RNA (vRNA) having a PSL2 motif with an effective amount of the oligonucleotide compound described in item 1. (Item 14) Contacting the sample with the drug results in at least 1 log of the virus 10 The method according to item 13, wherein the agent causes a loss of titer or the agent disrupts the overall structure of the PSL2 motif of the vRNA. (Item 15) The method according to item 13, wherein the vRNA is isolated from a virion or cell. (Item 16) A method for treating or preventing influenza A virus infection in a subject, A method comprising administering a pharmaceutical composition containing an effective amount of the oligonucleotide compound described in item 1 to a subject requiring treatment or prevention of influenza A virus infection. (Item 17) The method according to item 16, wherein the subject is at risk of influenza A virus infection, and the administration of the oligonucleotide compound protects the subject from infection for one week or more. (Item 18) The method according to item 17, wherein the administration comprises administering an effective dose of the oligonucleotide compound weekly, bi-weekly, or monthly. (Item 19) The method according to item 16, wherein the pharmaceutical composition further comprises an additional activator selected from a second oligonucleotide activator and an antiviral agent. (Item 20) The method described in item 16, wherein the subject has been diagnosed with or is suspected of having influenza A virus infection.
Claims
1. An antiviral oligonucleotide compound or salt thereof with a length of 30 nucleotides or less, wherein the oligonucleotide compound contains the oligonucleotide sequence 5'ATGCTGATCCTGTC3' (SEQ ID NO: 508) which has antirespiratory virus activity.
2. The aforementioned oligonucleotide sequence is as follows: LNA-6810.2:5'ATGCtgatccctGTC3' (Sequence ID 784), The antiviral oligonucleotide compound according to claim 1, wherein uppercase letters indicate LNA nucleotides and lowercase letters indicate DNA nucleotides.
3. The antiviral oligonucleotide compound according to claim 1 or 2, wherein the oligonucleotide comprises at least one internucleoside bond selected from phosphorothioate, phosphorodithioate, phosphoramidate, and thiophosphoramidate bond.
4. The antiviral oligonucleotide compound according to claim 3, wherein the oligonucleotide comprises at least one phosphorothioate bond.
5. The antiviral oligonucleotide compound according to claim 3, wherein all of the nucleoside bonds are phosphorothioate bonds.
6. The antiviral oligonucleotide compound according to any one of claims 1 to 5, wherein the oligonucleotide comprises one or more 2'-modified nucleotides.
7. The antiviral oligonucleotide compound according to any one of claims 1 to 6, wherein the oligonucleotide comprises at least one LNA nucleotide.
8. The antiviral oligonucleotide compound according to any one of claims 1 to 7, wherein the oligonucleotide comprises a plurality of LNA nucleotides.
Citation Information
Patent Citations
Pharmaceutical compositions containing antimirna antisense oligonucleotides
JP2009532392A
Anti-microRNA oligonucleotide molecules
US20050182005A1
Oligomeric compounds and compositions for use in modulation of small non-coding rnas
WO2005013901A2
Methods for altering virus replication
WO2013166264A2