Antigen-binding proteins and their uses

TCRs targeting the HPV16 E7 antigen address the ineffectiveness of current HPV treatments by specifically recognizing and killing HPV-positive tumor cells, offering a promising therapeutic solution for HPV-associated malignancies.

JP7869587B2Active Publication Date: 2026-06-03CORREGENE BIOTECHNOLOGY CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2024515466
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2021-09-07
Filing Date
2022-09-07
Publication Date
2026-06-03
Estimated Expiration
2042-09-07

AI Technical Summary

Technical Problem

Current treatments for HPV infections and resulting malignancies, such as cervical cancer, are ineffective, with preventive vaccines failing to eliminate existing infections and therapeutic vaccines showing limited efficacy against advanced tumors.

Method used

Development of antigen-binding proteins, specifically T cell receptors (TCRs) that target the HPV16 E7 antigen, allowing for the recognition and killing of HPV-positive tumor cells by transduced T cells.

Benefits of technology

The TCRs demonstrate high affinity and stability in binding to the HPV16 E7 antigen, mediating effective killing of antigen-positive cells and providing a therapeutic approach for HPV-associated diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007869587000008
    Figure 0007869587000008
  • Figure 0007869587000009
    Figure 0007869587000009
  • Figure 0007869587000010
    Figure 0007869587000010
Patent Text Reader

Abstract

Provided are antigen-binding proteins, nucleic acids encoding the antigen-binding proteins, vectors comprising the nucleic acids, cells comprising the antigen-binding proteins, nucleic acids or vectors, methods for preparing the cells, conjugates or compositions comprising the antigen-binding proteins, methods for preventing and / or treating disease by using the antigen-binding proteins or cells, and methods for detecting the presence of disease in a subject.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to antigen-binding proteins, particularly T cell receptors (TCRs), and their use, especially in the prevention, treatment, or detection of HPV-positive diseases.

[0002] This international patent application claims the benefit of Chinese Patent Application No. 202111043194.X, filed on September 7, 2021, which is incorporated herein by reference in its entirety for all purposes. [Background technology]

[0003] Cervical cancer is the fourth most common tumor among women worldwide. The World Health Organization (WHO) estimates that there are 604,000 new cases and 342,000 deaths from cervical cancer globally. In China, the incidence of cervical cancer has been rising in recent years, with approximately 109,000 new cases and 59,000 deaths annually. The five-year survival rate for metastatic, advanced cervical cancer is only about 10%. Almost all cervical cancers are associated with infection with high-risk HPV types, with HPV16 being the most common type, accounting for 60% of all high-risk HPV types. HPV infection can also lead to cancers of the head and neck, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, vulvar cancer, and penile cancer. Currently, there is no effective treatment for HPV infection and the resulting malignancies. While preventive vaccines induce specific neutralizing antibodies produced by the organism against new viral infections, they cannot eliminate existing HPV infections. While therapeutic vaccines, still in clinical trials, can slow the progression of precancerous lesions to some extent, it is difficult to say that they are therapeutically effective against advanced tumors.

[0004] TCR-T confers novel antigen recognition specificity to T cells by cloning a TCR that specifically recognizes a specific HLA tumor antigen peptide complex using corresponding experimental techniques, followed by delivering the TCR gene coding sequence to these T cells via gene delivery means such as lentiviruses. Patient-derived T cells transduced with the TCR gene in vitro and amplified in large quantities can effectively recognize tumor cell-specific antigens. These T cells are then returned to the patient and injected to specifically kill tumor cells and exert antitumor activity. Since both intracellular and extracellular antigens can be recognized by the TCR after HLA presentation, TCR-T can target most tumor-specific antigens, and in particular, it can recognize these intracellular tumor antigens (approximately 90% of all antigens). Therefore, TCR-T may be used in the treatment of almost all tumors, especially various solid tumors.

[0005] The E6 and E7 proteins of the HPV16 virus are key oncogenes that drive the development and progression of cervical cancer, and almost all HPV16-positive tumor cells stably express these two antigens. HPV-associated cervical cancer can be effectively managed if E6 and E7 protein-positive tumor cells can be effectively recognized and killed. Previous studies have found that the E6 and E7 antigens of the HPV16 virus are effectively presented by HLA molecules and become potential antigenic targets recognized by specific TCRs. Therefore, there is a need to develop TCR products that specifically target HPV16, and in particular the HPV16 E7 antigen. [Overview of the project] [Problems that the invention aims to solve]

[0006] This disclosure provides a novel antigen-binding protein that specifically binds to the HPV16 E7 antigen, particularly the HPV16 E711-19 epitope, or a complex of the epitope with an MHC molecule, for example, a complex of the HPV16 E711-19 epitope with HLA-A*02. The antigen-binding protein of this disclosure may be in the form of a TCR or an antigen-binding fragment thereof. The antigen-binding protein of this disclosure can bind to the target antigen peptide with high affinity, has good expression stability, and can mediate the specific killing effect of effector cells against antigen-positive target cells. [Means for solving the problem]

[0007] Accordingly, in one embodiment, the present disclosure provides an antigen-binding protein comprising a T cell receptor (TCR) alpha chain variable region and a TCR beta chain variable region, wherein the TCR alpha chain variable region comprises CDR3 having the amino acid sequence: AVISAGTALI (SEQ ID NO: 3), or a functional variant thereof formed by the insertion, deletion, or substitution of one or more amino acids, and binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO: 11) or a complex of the epitope with an MHC molecule.

[0008] In another aspect, the disclosure provides an antigen-binding protein comprising a T cell receptor (TCR) alpha chain variable region and a TCR beta chain variable region, wherein the TCR beta chain variable region comprises CDR3 having the amino acid sequence: ASSLGWRGGLYTEAF (SEQ ID NO: 8), or a functional variant thereof formed by the insertion, deletion, or substitution of one or more amino acids, and binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO: 11) or to a complex of the epitope with an MHC molecule.

[0009] In yet another aspect, the disclosure provides an antigen-binding protein comprising a T cell receptor (TCR) alpha chain variable region and a TCR beta chain variable region, wherein the TCR alpha chain variable region comprises a CDR3 having the amino acid sequence: AVISAGTALI (SEQ ID NO: 3), or a functional variant thereof formed by the insertion, deletion, or substitution of one or more amino acids; and the TCR beta chain variable region comprises a CDR3 having the amino acid sequence: ASSLGWRGGLYTEAF (SEQ ID NO: 8), or a functional variant thereof formed by the insertion, deletion, or substitution of one or more amino acids, and binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO: 11) or a complex of the epitope with an MHC molecule.

[0010] In some embodiments, the MHC molecule is HLA-A * Type 02, for example, HLA-A * 02:01 type, HLA-A * 02:03 type, HLA-A * 02:05 type, HLA-A * 02:06 type, HLA-A * 02:07 type, HLA-A * 02:10 type or HLA-A * It is of type 02:11.

[0011] In some embodiments, the TCR alpha chain variable region includes a CDR3 having the amino acid sequence shown in SEQ ID NO: 3, and / or the TCR beta chain variable region includes a CDR3 having the amino acid sequence shown in SEQ ID NO: 8.

[0012] In some embodiments, the TCR alpha chain variable region includes functional variants thereof formed by CDR1, CDR2, and CDR3 having the amino acid sequences shown in SEQ ID NOs: 1, 2, and 3, respectively, or by the insertion, deletion, or substitution of one or more amino acids; and / or the TCR beta chain variable region includes functional variants thereof formed by beta chain CDR1, CDR2, and CDR3 having the amino acid sequences shown in SEQ ID NOs: 6, 7, and 8, respectively, or by the insertion, deletion, or substitution of one or more amino acids.

[0013] In another aspect, the present disclosure provides an antigen-binding protein comprising a T cell receptor (TCR) alpha chain variable region and a TCR beta chain variable region, wherein the TCR alpha chain variable region comprises CDR1, CDR2, and CDR3 having amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively; and / or the TCR beta chain variable region comprises beta chain CDR1, CDR2, and CDR3 having amino acid sequences shown in SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, respectively.

[0014] In some embodiments, the TCR alpha chain variable region includes CDR1, CDR2, and CDR3 having the amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively; and the TCR beta chain variable region includes beta chain CDR1, CDR2, and CDR3 having the amino acid sequences shown in SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, respectively.

[0015] In some embodiments of the antigen-binding proteins of this disclosure, the TCR alpha chain variable region includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 4, and / or the TCR beta chain variable region includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 9.

[0016] In some embodiments, the TCR alpha chain variable region includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 4, and the TCR beta chain variable region includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 9.

[0017] In some embodiments, the TCR alpha chain variable region includes the amino acid sequence shown in SEQ ID NO: 4, and / or the TCR beta chain variable region includes the amino acid sequence shown in SEQ ID NO: 9.

[0018] In some embodiments, the TCR alpha chain variable region is contained in a first polypeptide, and the TCR β chain variable region is contained in a different second polypeptide. In some embodiments, the TCR alpha chain variable region and the TCR β chain variable region are contained in a single polypeptide.

[0019] In some embodiments, the antigen-binding protein is soluble or membrane-bound.

[0020] In some embodiments, the antigen-binding protein is selected from TCRs, chimeric antigen receptors (CARs), Fc polypeptides, or antigen-binding fragments thereof.

[0021] In some embodiments, the antigen-binding protein is the TCR or an antigen-binding fragment thereof, and the antigen-binding protein further comprises the TCR constant region or a fragment thereof.

[0022] In some embodiments, the TCR steady region is either a murine steady region or a human steady region.

[0023] In some embodiments, the TCR constant region comprises a TCR alpha chain constant region and / or a TCR beta chain constant region; preferably, the TCR alpha chain constant region and / or the TCR beta chain constant region comprises at least one cysteine ​​mutation compared to the wild-type sequence such that a disulfide bond is formed between the TCR alpha chain and the TCR beta chain.

[0024] In some embodiments, the TCR alpha chain constant region includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with any one of SEQ ID NOs: 14-19, and / or the TCR beta chain constant region includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with any one of SEQ ID NOs: 21-30.

[0025] In some embodiments, the TCR alpha chain constant region includes the amino acid sequence shown in SEQ ID NO: 19, and the TCR beta chain constant region includes the amino acid sequence shown in SEQ ID NO: 26.

[0026] In some embodiments, the fragment of the constant TCR region is the extracellular segment of the constant TCR region.

[0027] In some embodiments, the antigen-binding protein further comprises a transmembrane region and / or a cytoplasmic region.

[0028] In some embodiments, the antigen-binding protein comprises a TCR alpha chain containing an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity in any one selected from SEQ ID NOs. 32-37; and / or a TCR beta chain containing an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity in any one selected from SEQ ID NOs.

[0029] In some embodiments, the antigen-binding protein further comprises an intracellular signaling region. In some embodiments, the antigen-binding protein further comprises one or more antigen-binding regions that bind to other antigens or epitopes.

[0030] In some embodiments, the antigen-binding protein is isolated or purified.

[0031] In a further embodiment, the Disclosure provides nucleic acids encoding antigen-binding proteins of the Disclosure.

[0032] In some embodiments, the nucleic acid includes a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 5, and / or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 10. In some embodiments, the nucleic acid includes the amino acid sequence shown in SEQ ID NO: 5 and the nucleotide sequence shown in SEQ ID NO: 10.

[0033] In some embodiments, the nucleic acid further comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 20, and / or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 31. In some embodiments, the nucleic acid further comprises the nucleotide sequence shown in SEQ ID NO: 20 and the nucleotide sequence shown in SEQ ID NO: 31.

[0034] In another embodiment, the Disclosure provides a vector comprising the nucleic acid of the Disclosure.

[0035] In some embodiments, the vector is selected from the group consisting of lentiviral vectors, retroviral vectors, plasmids, DNA vectors, mRNA vectors, transposon-based vectors, and artificial chromosomes.

[0036] In yet another aspect, the Disclosure provides cells comprising antigen-binding proteins, nucleic acids, or vectors as a result of the Disclosure.

[0037] In some embodiments, the cells are selected from a group consisting of lymphocytes (e.g., T cells, NK cells), monocytes (e.g., PBMCs), and stem cells. In some embodiments, the stem cells are lymphoid progenitor cells or induced pluripotent stem cells (iPSCs).

[0038] In some embodiments, the cells are T cells. In some embodiments, the T cells do not express an endogenous TCR.

[0039] In another aspect, the Disclosure provides a method for preparing cells according to the Disclosure, comprising the step of transfecting or transfecting cells using the vector of the Disclosure.

[0040] In some embodiments, the method further includes a step of growing and / or activating cells before or after transfection or transfection.

[0041] In another embodiment, the Disclosure provides a conjugate comprising an antigen-binding protein of the Disclosure and an activator coupled to or conjugated to the antigen-binding protein.

[0042] In some embodiments, the activator is selected from the group consisting of detectable markers, immunostimulant molecules, and therapeutic agents; preferably, the detectable marker is selected from the group consisting of biotin, streptavidin, enzymes or catalytically active fragments thereof, radionuclides, nanoparticles, paramagnetic metal ions, nucleic acid probes, contrast agents, and fluorescent molecules, phosphorescent molecules, or chemiluminescent molecules; preferably, the immunostimulant molecule is selected from the group consisting of cytokines, chemokines, platelet factors, and complement initiation factors; preferably, the therapeutic agent is selected from the group consisting of immunomodulators, radioactive compounds, enzymes, chemotherapeutic agents, and toxins.

[0043] In another aspect, the Disclosure provides compositions comprising an antigen-binding protein, nucleic acid, vector, or cell of the Disclosure; preferably further comprising a pharmaceutically acceptable carrier or excipient.

[0044] In some embodiments, the composition further comprises a second therapeutic agent, preferably selected from the group consisting of antibodies, chemotherapeutic agents, and small molecule drugs.

[0045] In yet another aspect, the Disclosure provides a method for treating or preventing an HPV-positive disease in a subject, comprising administering an effective amount of the antigen-binding protein of the Disclosure to the subject.

[0046] In another aspect, the Disclosure provides a method for treating or preventing an HPV-positive condition in a subject, which includes administering an effective amount of the Cells of the Disclosure to the subject.

[0047] In some embodiments of the treatment methods of this disclosure, the cells are autologous or homogeneous with respect to the subject.

[0048] In some embodiments, the method comprises the steps of: (i) isolating a sample containing cells from a subject; (ii) transducing or transfecting the cells with a vector of the present disclosure; and (iii) administering the cells obtained in step (ii) to the subject. In some embodiments, the method further comprises the step of knocking out the endogenous TCR in the cells after step (i) and before step (ii).

[0049] In some embodiments, the HPV-positive disease is selected from the group consisting of HPV infection, HPV pre-malignancy, and HPV cancer. Preferably, the cancer is selected from the group consisting of cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, and penile cancer.

[0050] In some embodiments, the method further comprises administering a second therapeutic agent, and preferably, the second therapeutic agent is selected from the group consisting of an antibody, a chemotherapeutic agent, and a small molecule drug.

[0051] In some embodiments of the treatment method of the present disclosure, the subject has HLA-A * 02 allele, for example, HLA-A * 02:01, HLA-A * 02:03, HLA-A * 02:05, HLA-A * 02:06, HLA-A * 02:07, HLA-A * 02:10 or HLA-A * 02:11 allele.

[0052] In another embodiment, the Disclosure provides a method for detecting (e.g., diagnosing) an HPV-positive disease in a subject, comprising the steps of (i) contacting a sample obtained from the subject with an antigen-binding protein, cell, or conjugate of the Disclosure; and (ii) detecting the presence of an HPV antigen in the sample, wherein the presence of the HPV antigen indicates an HPV-positive disease. In some embodiments, the HPV-positive disease is selected from the group consisting of HPV infection, HPV pre-malignancy, and HPV cancer. Preferably, the cancer is selected from the group consisting of cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, and penile cancer.

[0053] In yet another aspect, the Disclosure provides a kit comprising an antigen-binding protein or conjugate according to the Disclosure, used to detect the presence of a positive epitope in a sample to be tested, wherein the epitope is an epitope comprising YMLDLQPET (SEQ ID NO: 11).

[0054] In one specific embodiment, the kit is used to detect (e.g., diagnose) an HPV-positive disease in a subject, and the kit comprises the antigen-binding protein or conjugate of the present disclosure. In some embodiments, the HPV-positive disease is selected from the group consisting of HPV infection, HPV pre-malignancies, and HPV cancers. Preferably, the cancer is selected from the group consisting of cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, and penile cancer.

[0055] In another aspect, the Disclosure provides the use of antigen-binding proteins, nucleic acids, vectors, cells, or compositions of the Disclosure in the preparation of a medicament for treating or preventing an HPV-positive disease in a subject.

[0056] In yet another aspect, the Disclosure provides antigen-binding proteins, nucleic acids, vectors, cells, or compositions of the Disclosure for use in treating or preventing HPV-positive diseases in subjects.

[0057] In another aspect, the present disclosure provides the use of an antigen-binding protein or conjugate of the present disclosure in the preparation of a kit for detecting (e.g., diagnosing) the presence of a positive epitope in a sample to be tested, wherein the epitope comprises YMLDLQPET (SEQ ID NO: 11), and provides a use for detecting (e.g., diagnosing) an HPV-positive disease in a subject.

[0058] In yet another aspect, the Disclosure provides an antigen-binding protein or conjugate of the Disclosure for use in detecting (e.g., diagnosing) the presence of a positive epitope in a sample being tested, wherein the epitope comprises YMLDLQPET (SEQ ID NO: 11), and for use in detecting (e.g., diagnosing) an HPV-positive disease in a subject.

[0059] In some embodiments of the use of this disclosure, HPV-positive diseases are selected from the group consisting of HPV infection, HPV pre-malignant neoplasms, and HPV cancers. Preferably, cancers are selected from the group consisting of cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, and penile cancer. In some embodiments, the cancer is HPV16-positive. In some embodiments, the subject is HLA-A * 02:01 Alleles, e.g., HLA-A * 02:01, HLA-A * 02:03, HLA-A * 02:05, HLA-A * 02:06, HLA-A * 02:07, HLA-A * 02:10 or HLA-A * It possesses the 02:11 allele. [Brief explanation of the drawing]

[0060] [Figure 1]This figure shows the screening process and initial characterization of HPV16 E7-specific TCRs. (A) Screening and cloning of HPV16 E7-specific TCRs; (B) The HPV16 E7-specific TCR (CRTE7A2) specifically recognizes the HLA-A*02:01-presenting HPV16 E711-19 epitope, as determined by flow cytometry. [Figure 2] This figure shows the binding affinity of CRTE7A2 to the target antigen peptide (YMLDLQPET) (SEQ ID NO: 11), as determined by flow cytometry. KITE-439 was used as a control. [Figure 3] This figure shows the phenotypes of CRTE7A2 and KITE-439 TCR-T cells as determined by flow cytometry. [Figure 4A] This figure shows the specific killing of CRTE7A2 TCR-T cells against antigen-positive tumor cells. (A) Killing effect of CRTE7A2 TCR-T cells against positive and negative target cells. [Figure 4B] This figure shows the specific killing effect of CRTE7A2 TCR-T cells against antigen-positive tumor cells. (B) Specific killing effect of CRTE7A2 TCR-T cells against antigen-positive tumor cells. KITE-439 TCR-T was used as a control. [Figure 5] This figure shows the specific killing effect of CRTE7A2 TCR-T cells against antigen-positive tumor cells as determined by an IFN-γ secretion assay. [Figure 6] This figure shows the specific secretion of IFN-γ by CRTE7A2 TCR-T cells against antigen-positive tumor cells. KITE-439 TCR-T cells were used as a control. [Figure 7] This figure shows the specific secretion of IFN-γ from CRTE7A2 TCR-T cells against antigen-positive target cells as determined by the ELISpot assay. Each group was replicated at least twice. [Figure 8] This figure shows antigen-specific proliferation of CRTE7A2 TCR-T cells. [Figure 9]This figure shows the in vivo antitumor activity of CRTE7A2 TCR-T cells against Hela cell transplanted tumors. [Modes for carrying out the invention]

[0061] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as generally understood by those skilled in the art. For example, terms used herein are defined as those in Immunobiology, 5th edition, New York: Garland Science (2001) by Janeway CA Jr, Travers P, Walport M et al., and in Leuenberger, HGW, Nagel, B., and Kolbl, H. eds (1995), A multilingual glossary of biotechnological terms: (IUPAC Recommendations), Helvetica Chimica Acta, CH-4010 Basel, Switzerland.

[0062] It should be noted that, as used herein and in the appended claims, the singular forms “a,” “an,” and “the / the” include the plural form unless the context explicitly defines otherwise. Thus, the terms “a,” “an,” “one or more,” and “at least one” may be used interchangeably. Similarly, the terms “comprise,” “include,” and “have” may be used interchangeably.

[0063] When the term “comprise” is used herein and in the appended claims, it does not exclude other elements. For the purposes of the present invention, the term “comprises” is considered a preferred embodiment of the term “comprise.” Where a group is defined below as including or comprising at least a certain number of embodiments, it is also understood to disclose a group preferably consisting only of these embodiments.

[0064] In one embodiment, the present disclosure provides an antigen-binding protein comprising a T cell receptor (TCR) alpha chain variable region and a TCR beta chain variable region, wherein the TCR alpha chain variable region comprises CDR3 having the amino acid sequence: AVISAGTALI (SEQ ID NO: 3), or a functional variant thereof formed by the insertion, deletion, or substitution of one or more amino acids, and binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO: 11) or to a complex of the epitope with an MHC molecule.

[0065] In another aspect, the disclosure provides an antigen-binding protein comprising a T cell receptor (TCR) alpha chain variable region and a TCR beta chain variable region, wherein the TCR beta chain variable region comprises CDR3 having the amino acid sequence: ASSLGWRGGLYTEAF (SEQ ID NO: 8), or a functional variant thereof formed by the insertion, deletion, or substitution of one or more amino acids, and binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO: 11) or to a complex of the epitope with an MHC molecule.

[0066] In yet another aspect, the disclosure provides an antigen-binding protein comprising a T cell receptor (TCR) alpha chain variable region and a TCR beta chain variable region, wherein the TCR alpha chain variable region comprises a CDR3 having the amino acid sequence: AVISAGTALI (SEQ ID NO: 3), or a functional variant thereof formed by the insertion, deletion, or substitution of one or more amino acids; and the TCR beta chain variable region comprises a CDR3 having the amino acid sequence: ASSLGWRGGLYTEAF (SEQ ID NO: 8), or a functional variant thereof formed by the insertion, deletion, or substitution of one or more amino acids, and binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO: 11) or a complex of the epitope with an MHC molecule.

[0067] As used herein, the term “antigen-binding protein” refers to a protein or polypeptide comprising at least one TCR alpha chain CDR3 (CDR3α) and / or at least one TCR beta chain CDR3 (CDR3β) as disclosed herein, and capable of binding to the antigenic target HPV E7. Further consideration herein is an antigen-binding protein comprising at least one of CDR1α, CDR2α, CDR1β, CDR2β, an alpha chain variable region, a beta chain variable region, an alpha chain and / or a beta chain, or a combination thereof, in combination with other protein domains or parts thereof as optionally enumerated herein.

[0068] As used herein, the term “functional variant” refers to a polypeptide that has significant sequence identity with a parent polypeptide and retains the biological activity of the parent polypeptide. Functional variants include, for example, variants of polypeptides or proteins described herein that retain the ability to specifically bind to the HPV16 E7 antigen to a similar degree, the same degree, or a higher degree than the parent polypeptide. The amino acid sequence of a functional variant may have, for example, at least about 50%, 75%, 80%, 90%, 95%, 96%, 97%, 98%, 98.2%, 98.4%, 98.6%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or even higher sequence identity with that of the parent polypeptide.

[0069] The term “epitope” typically refers to a site on an antigen, usually a (poly)peptide, recognized by a binding domain. The term “binding domain,” in its broader sense, refers to an “antigen-binding site,” i.e., a domain that characterizes a molecule that binds to / interacts with a specific epitope on an antigenic target. An antigenic target may contain a single epitope, but typically contains at least two epitopes depending on the size, conformation, and type of the antigen; an antigenic target may contain any number of epitopes. The term “epitope” typically includes both linear and conformational epitopes. A linear epitope is a close-proximate epitope contained in the primary sequence of amino acids, typically containing at least two or more amino acids. A conformational epitope is formed by non-close-proximate amino acids juxtaposed by the folding of the target antigen, particularly the target (poly)peptide.

[0070] In the context of this invention, the term "binding domain" refers in particular to the variable regions of the TCR alpha and / or beta chains, especially CDR3α and CDR3β of the TCR.

[0071] As used herein, the term “T cell receptor” or “TCR” includes native TCRs and TCR variants, fragments, and constructs. Thereafter the term includes heterodimers and multimers and single-stranded constructs comprising TCR alpha and TCR beta chains; optionally, antigen-binding proteins target antigenic targets (preferably HLA-A * This includes other domains and / or parts, as long as it retains its ability to recognize its complex with 02.

[0072] In its natural form, the TCR exists as a complex of several proteins on the surface of T cells. The T cell receptor is produced by separate T cell receptor alpha and beta (TCRα and TCRβ) genes and consists of two (separate) protein chains called the alpha chain and the beta chain. Each chain of the TCR has an N-terminal immunoglobulin-like (Ig) variable (V) region / domain, an Ig constant (C) region / domain, a transmembrane / transmembrane region that firmly anchors the chain to the cell membrane, and a short cytoplasmic end at the C-terminus.

[0073] Antigen specificity is conferred by the variable regions of the α and β chains of the TCR. Both the α and β chains of the TCR contain three highly variable or complementarity-determining regions (CDR1α / β, CDR2α / β, and CDR3α / β) surrounded by a framework (FR) region. CDR3 is the primary determinant of antigen recognition and specificity (i.e., the ability to recognize and interact with a specific antigen), while CDR1 and CDR2 primarily interact with the MHC molecule presenting the antigen peptide.

[0074] Natural TCRs recognize antigen peptides that bind to major histocompatibility complex (MHC) molecules on the surface of antigen-presenting cells ("presenting on MHC molecules"). Antigen peptides presented on MHC molecules are also referred herein to as "epitope-MHC complexes," "epitope-MHC complexes," or "target antigen peptide-MHC complexes." There are two distinct classes of MHC molecules: MHC I and MHC II, which present peptides derived from different cellular compartments. MHC class I molecules are expressed on the surface of all human nucleated cells and present peptides or protein fragments derived from intracellular compartments to cytotoxic T cells. In humans, MHC is also known as human leukocyte antigen (HLA). There are three main types of MHC class I molecules: HLA-A, HLA-B, and HLA-C. When a TCR binds to its specific epitope-MHC complex, the T cell is activated and exerts its biological effector function.

[0075] As will be discussed in more detail below, the TCRs provided herein are HPV16 E7 antigens, in particular HPV16 E7 11-19 Epitopes or complexes of epitopes with MHC molecules, e.g., HPV16 E7 11-19 Epitope and HLA-A * It can advantageously (specifically) recognize complexes with 02.

[0076] In some embodiments of the antigen-binding proteins of this disclosure, the MHC molecule is HLA-A * Type 02, for example, HLA-A * 02:01 type, HLA-A * 02:03 type, HLA-A * 02:05 type, HLA-A * 02:06 type, HLA-A * 02:07 type, HLA-A * 02:10 type or HLA-A * It is of type 02:11.

[0077] In some embodiments, the TCR alpha chain variable region includes a CDR3 having the amino acid sequence shown in SEQ ID NO: 3, and / or the TCR beta chain variable region includes a CDR3 having the amino acid sequence shown in SEQ ID NO: 8.

[0078] As previously described, it has been identified that CDR1 and CDR2 of the TCRα and β chains are primarily involved in MHC recognition. HLA-A * There is a limited "pool" of CDR1 and CDR2 sequences known to be involved in restrictive antigen recognition. Antigen-binding proteins, like the TCRs evaluated in the attached examples, target antigenic targets (preferably HLA-A) to the same or even higher degree. * As long as it retains its ability to recognize its complex with 02, it is predicted that the CDR3 domain of the present invention can, in principle, be combined with any one of the CDR1 and CDR2 shown in SEQ ID NOs: 1-2 and 6-7. Available examples of CDR1 and CDR2 domains include CDR1α containing or consisting of the sequence shown in SEQ ID NO: 1, CDR2α containing or consisting of the sequence shown in SEQ ID NO: 2, CDR1β containing or consisting of the sequence shown in SEQ ID NO: 6, and CDR2β containing or consisting of the sequence shown in SEQ ID NO: 7.

[0079] In some embodiments, the TCR alpha chain variable region includes functional variants thereof formed by CDR1, CDR2, and CDR3 having the amino acid sequences shown in SEQ ID NOs: 1, 2, and 3, respectively, or by the insertion, deletion, or substitution of one or more amino acids; and / or the TCR beta chain variable region includes functional variants thereof formed by beta chain CDR1, CDR2, and CDR3 having the amino acid sequences shown in SEQ ID NOs: 6, 7, and 8, respectively, or by the insertion, deletion, or substitution of one or more amino acids.

[0080] In another embodiment, the disclosure provides an antigen-binding protein comprising a T cell receptor (TCR) alpha chain variable region and a TCR beta chain variable region, wherein the TCR alpha chain variable region comprises CDR1, CDR2, and CDR3 having amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively; and / or the TCR beta chain variable region comprises beta chain CDR1, CDR2, and CDR3 having amino acid sequences shown in SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, respectively. In some embodiments, the TCR alpha chain variable region comprises CDR1, CDR2, and CDR3 having amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively; and the TCR beta chain variable region comprises beta chain CDR1, CDR2, and CDR3 having amino acid sequences shown in SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, respectively.

[0081] In some embodiments of the antigen-binding proteins of this disclosure, the TCR alpha chain variable region includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 4.

[0082] In some embodiments of the antigen-binding proteins of this disclosure, the TCR beta chain variable region includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 9.

[0083] As used herein, the term “sequence identity” refers to the degree to which two (nucleotide or amino acid) sequences have the same residues at the same positions in alignment, and is typically expressed as a percentage. Preferably, identity is determined over the entire length of the sequences being compared. Thus, two copies of the same sequence will have 100% identity, while sequences that are not highly conserved and have deletions, additions, or substitutions will have a lower degree of identity. Those skilled in the art will recognize that numerous algorithms, such as Blast (Arthur (Altschul) et al., (1997) Nucleic Acids Res. 25:3389-3402), Blast2 (Arthur (Altschul) et al., (1990) J.Mol. Biol. 215:403-410), Smith-Waterman (Smith (Smith) et al., (1981) J.Mol. Biol. 147:195-197), and ClustalW, can be used to determine sequence identity using standard parameters.

[0084] Therefore, the amino acid sequence of sequence number 4 or 9 could be, for example, a "target sequence" or "reference sequence," while a different amino acid sequence in the TCR alpha or beta chain variable region could be a "query sequence."

[0085] In some embodiments, the TCR alpha chain variable region includes the amino acid sequence shown in SEQ ID NO: 4. In some embodiments, the TCR beta chain variable region includes the amino acid sequence shown in SEQ ID NO: 9.

[0086] In some embodiments, the TCR alpha chain variable region is contained in a first polypeptide, and the TCR β chain variable region is contained in a different second polypeptide. In some embodiments, the TCR alpha chain variable region and the TCR β chain variable region are contained in a single polypeptide.

[0087] In some embodiments, the antigen-binding protein is soluble or membrane-bound.

[0088] The antigen-binding protein of the present invention may be provided in a soluble form, for example, in the form of a soluble TCR. Soluble TCRs (sTCRs) can be used as diagnostic tools and as vectors or "adapters" for specifically targeting therapeutic agents or effector cells to cancer cells expressing antigenic targets recognized by the soluble TCR, for example. A soluble TCR is typically a fragment or construct comprising a TCR alpha chain and / or beta chain or its variable region or CDR, optionally stabilized by disulfide bonds or covalently linked by a suitable linker. Typically, a soluble TCR does not include, for example, a transmembrane region.

[0089] The antigen-binding protein of the present invention may also be provided in a membrane-bound form, for example, in the form of a membrane-bound TCR. Typically, a membrane-bound TCR includes a transmembrane region that firmly anchors it to the cell membrane.

[0090] In some embodiments, the antigen-binding protein is selected from TCRs, chimeric antigen receptors (CARs), Fc polypeptides, or antigen-binding fragments thereof.

[0091] In some embodiments, the antigen-binding protein is the TCR or an antigen-binding fragment thereof, and the antigen-binding protein further comprises the TCR constant region or a fragment thereof.

[0092] As used herein, the term “constant region” may be a human constant region or a region of other species origin, which may result in a “chimeric” TCR. For example, human α and / or β chains may be replaced by their murin counterparts (“murin-derived”), which have been found to enhance the surface expression of human TCRs and enhance the binding stability of human TCRs to the CD3 coreceptor by supporting preferential pairing of TCR α and β chains.

[0093] In some embodiments, the TCR steady-state region is either the murin steady-state region or the human steady-state region.

[0094] It has been reported that the addition of a disulfide bond to the constant region can promote the correct pairing of the TCRα and TCRβ chains (Kuball J et al., Blood. 2007 Mar 15;109(6):2331-8). Therefore, the present invention also predicts the addition of one or more cysteine ​​modifications to the constant region to form a disulfide bond between the TCRα and TCRβ chains.

[0095] In some embodiments, the TCR constant region comprises a TCR alpha chain constant region and / or a TCR beta chain constant region; preferably, the TCR alpha chain constant region and / or the TCR beta chain constant region comprises at least one cysteine ​​mutation compared to the wild-type sequence such that a disulfide bond is formed between the TCR alpha chain and the TCR beta chain.

[0096] In some embodiments, the cysteine ​​mutation is located at one or more of the following positions: position 48 of the wild-type human TCR alpha chain constant region, position 48 of the wild-type murin TCR alpha chain constant region, position 57 of the wild-type human TCR beta chain constant region, and position 57 of the wild-type murin TCR beta chain constant region.

[0097] The sequence of the wild-type TCR constant region can be found in the public database of the International Immunogenetics Information System (IMGT). For example, the sequence of the TCR alpha chain constant domain is "TRAC * The sequence of the TCR beta chain constant domain is "TRBC1 * 01" or "TRBC2 * It is "01".

[0098] To facilitate the description of the location of cysteine ​​mutations, the amino acid sequences in the wild-type TCR constant region are numbered according to the nomenclature of the International Immunogenetics Information System (IMGT) in this invention. For example, if an amino acid in the TCR alpha chain constant region (TRAC) is designated with position number 48 in IMGT, it is described herein as the amino acid at position 48 of the TCR alpha chain constant region (TRAC); if an amino acid in the TCR beta chain constant region (TRBC) is designated with position number 57 in IMGT, it is described herein as the amino acid at position 57 of the TCR beta chain constant region (TRBC); and so on. In this invention, the amino acid sequence numbering of the variable regions TRAV and TRBV is based on the position numbering enumerated in IMGT. If an amino acid in TRAV is designated with position number 46 in IMGT, it is described herein as the amino acid at position 46 of TRAV; and so on. Where the sequence numbering of other amino acids is specifically described in this invention, they are numbered as specifically described.

[0099] In some embodiments, the TCR alpha chain constant region is defined as having a constant region (and / or transmembrane region) with an amino acid sequence L L VI VL Further includes LVL mutations or LIV mutations to include RIL. For example, if the TCR alpha chain contains a human constant region, the human constant region is such that the constant region (and / or transmembrane region) has an amino acid sequence L L VI VL The LVL mutation may include RIL. If the TCR alpha chain contains a murin constant region, the murin constant region is such that the constant region (and / or transmembrane region) has an amino acid sequence L L V IV The LIV mutation may include LRIL.

[0100] In some embodiments, the TCR alpha chain constant region includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with any one of SEQ ID NOs. 14-19, and / or the TCR beta chain constant region includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with any one of SEQ ID NOs. 21-30.

[0101] In some embodiments, the TCR alpha chain constant region includes the amino acid sequence shown in SEQ ID NO: 19, and the TCR beta chain constant region includes the amino acid sequence shown in SEQ ID NO: 26.

[0102] In some embodiments, the fragment of the TCR constant region is an extracellular segment of the TCR constant region.

[0103] In some embodiments, the antigen-binding protein is a TCR comprising an alpha chain and a beta chain. In some embodiments, the TCR alpha chain and / or beta chain may include a leader sequence. For example, the leader sequence of the TCR alpha chain may have the amino acid sequence shown in SEQ ID NO: 12 (MISLRVLLVILWLQLSWVWSQ). The leader sequence of the TCR beta chain may have the amino acid sequence shown in SEQ ID NO: 13 (MGPGLLCWALLCLLGAGLV). The leader sequence of the TCR alpha chain may be encoded by the nucleotide sequence shown in SEQ ID NO: 48 (ATGATATCCTTGAGAGTTTTACTGGTGATCCTGTGGCTTCAGTTAAGCTGGGTTTGGAGCCAA). The leader sequence of the TCR β chain may be encoded by the nucleotide sequence shown in SEQ ID NO: 49 (ATGGGCCCCGGGCTCCTCTGCTGGGCACTGCTTTGTCTCCTGGGAGCAGGCTTAGTG).

[0104] In some embodiments, the antigen-binding protein further comprises a transmembrane region and / or a cytoplasmic region.

[0105] In some embodiments, the antigen-binding protein comprises a TCR alpha chain containing an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity in any one selected from SEQ ID NOs. 32-37; and / or a TCR beta chain containing an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity in any one selected from SEQ ID NOs. 38-47.

[0106] In some embodiments, the antigen-binding protein further comprises an intracellular signaling region. In some embodiments, the antigen-binding protein further comprises one or more antigen-binding regions that bind to other antigens or epitopes.

[0107] In some embodiments, the antigen-binding protein is isolated or purified.

[0108] As used herein, the term “isolated or purified” means that the “isolated or purified” antigen-binding protein is identified, isolated, and / or recovered from components of the environment in which it is produced, such that it does not contain, or substantially contains, other contaminating components that may interfere with its therapeutic or diagnostic use. Examples of contaminating components include enzymes, hormones, and other proteins or non-protein solutes. Thus, the “isolated or purified” antigen-binding protein may be prepared by at least one purification step that removes, or substantially removes, these contaminating components. In yet another aspect, the present disclosure provides nucleic acids encoding the antigen-binding proteins of the present disclosure.

[0109] In some embodiments, the nucleic acid includes a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 5, and / or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 10. In some embodiments, the nucleic acid further comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 20, and / or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 31.

[0110] In another embodiment, the Disclosure provides a vector comprising the nucleic acid of the Disclosure.

[0111] As used herein, the term “vector” refers to a nucleic acid molecule used as a vehicle for transferring (exogenous) genetic material to a host cell, for example, in which it can be replicated and / or expressed. The term “vector” includes, but is not limited to, plasmids, viral vectors (including retroviral vectors, lentiviral vectors, adenovirus vectors, cowpox virus vectors, polyomavirus vectors, and adeno-associated virus vectors (AAVs)), phages, phasmids, cosmids, and artificial chromosomes (including BACs and YACs). A vector itself is typically a nucleotide sequence and usually includes a DNA sequence containing an insert (transgene) and a larger sequence that acts as the “backbone” of the vector. An engineered vector typically includes a starting point for self-replication in the host cell (where stable expression of polynucleotides is desired), a selection marker, and restriction enzyme cleavage sites (e.g., polyclonal sites, MCSs). A vector may additionally include a promoter, a genetic marker, a reporter gene, a target sequence, and / or a protein purification tag. As is well known to those skilled in the art, numerous suitable vectors are well known to them and many are commercially available. Examples of suitable vectors are provided in J. Sambrook et al., Molecular Cloning: a Laboratory Manual (4th ed.), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York (2012), which is incorporated herein by reference in its entirety.

[0112] In some embodiments, the vector is preferably selected from the group consisting of lentiviral vectors, retroviral vectors, plasmids and DNA vectors, mRNA vectors, transposon-based vectors and artificial chromosomes.

[0113] In yet another aspect, the Disclosure provides cells comprising antigen-binding proteins, nucleic acids, or vectors as a result of the Disclosure.

[0114] As used herein, the term “cell” means any type of cell capable of expressing the antigen-binding proteins of this disclosure. The cell may be a eukaryotic cell, e.g., a plant cell (that does not have the potential to develop into a plant), an animal cell, a fungal cell, or an algal cell, or a prokaryotic cell, e.g., a bacterial cell or a protozoan cell. The cell may be a cultured cell or a primary cell, i.e., a cell directly isolated from an organism, e.g., a human. The cell may be an adherent cell or a suspension cell, i.e., a cell that grows in a suspension. Suitable host cells are well known in the art and include, for example, DH5α E. coli cells, Chinese hamster ovary cells, monkey VERO cells, COS cells, HEK293 cells, and the like. For the purpose of producing the antigen-binding proteins of this disclosure, the cell is preferably a mammalian cell. Most preferably, the host cell is a human cell.

[0115] In some embodiments, cells are selected from the group consisting of lymphocytes (e.g., T cells, NK cells), monocytes (e.g., PBMCs), and stem cells. As used herein, the term “stem cell” refers to a stem cell used to express the antigen-binding protein (in particular, TCR) of this disclosure. For example, stem cells may be lymphoid progenitor cells, induced pluripotent stem cells (iPSCs), or hematopoietic stem cells (HSCs). In some embodiments, stem cells do not include embryonic stem cells obtained by disrupting a human embryo, and / or totipotent stem cells used to develop into and form individual animals. Since stem cells do not express the CD3 molecule on their surface, transferring genes to stem cells typically does not result in TCR expression on the cell surface. However, when stem cells differentiate into lymphoid progenitor cells that migrate to the thymus, the expression of the CD3 molecule initiates the expression of the introduced TCR molecule on the surface of the thymocytes.

[0116] In some embodiments, the stem cells are lymphoid progenitor cells or induced pluripotent stem cells (iPSCs).

[0117] In some embodiments, the cells are T cells. The T cells may be any T cells, such as cultured T cells, e.g., primary T cells or T cells derived from cultured T cell lines, e.g., Jurkat, SupTl, etc., or T cells obtained from mammals. When obtained from mammals, the T cells may be obtained from a number of sources, including, but not limited to, blood, bone marrow, lymph nodes, thymus, or other tissues or body fluids. The T cells may be concentrated or purified. Preferably, the T cells are human T cells. More preferably, the T cells are T cells isolated from humans. The T cells may be any type of T cell, but not limited to, CD4+ / CD8+ double-positive T cells, CD4+ helper T cells, e.g., Th1 and Th2 cells, CD4+ T cells, CD8+ T cells (e.g., cytotoxic T cells), tumor-infiltrating lymphocytes (TILs), memory T cells (e.g., central memory T cells and effector memory T cells), naive T cells, and any other developmental stage. In some embodiments, T cells do not express endogenous TCRs.

[0118] Effector cells expressing antigen-binding proteins (such as TCRs) described herein have an antigenic target (preferably HLA-A * HPV16 E7 presented by antigen-presenting cells in 02 11-19It is predicted that the antigen will bind with high affinity to the epitope. The term "affinity" or "binding affinity" refers to the ability of a cell (in particular, a T cell expressing the TCR described herein) to express an antigen-binding protein in response to a given concentration in vitro, and this ability is thought to correlate with the in vivo effector capacity of the cell expressing the antigen-binding protein (e.g., TCR). By definition, a cell expressing an antigen-binding protein (e.g., TCR) with high binding affinity will respond to a very low dose of antigen in vitro, while a cell with low binding activity will require a larger amount of antigen if an immune response similar to that of a cell expressing an antigen-binding protein (e.g., TCR) with high affinity is desired. Therefore, binding affinity can be considered a quantitative determinant of the activation threshold of a cell expressing an antigen-binding protein (e.g., TCR). This is measured by exposing such cells to varying amounts of homologous antigen in vitro. A cell expressing an antigen-binding protein (e.g., TCR) with high affinity will respond to a low dose of antigen. For example, antigen-negative HLA- * When TCR-expressing cells are co-cultured with target cells, if TCR-expressing cells secrete at least approximately 200 pg / mL or more (for example, 200 pg / mL or more, 300 pg / mL or more, 400 pg / mL or more, 500 pg / mL or more, 600 pg / mL or more, 700 pg / mL or more, 1000 pg / mL or more, 5,000 pg / mL or more, 7,000 pg / mL or more, 10,000 pg / mL or more, or 20,000 pg / mL or more), it is generally believed that TCR-expressing cells bind to their antigen target with "high" affinity.

[0119] In another aspect, the Disclosure provides a method for preparing cells according to the Disclosure, comprising the step of transfecting or transfecting cells using the vector of the Disclosure.

[0120] As used herein, the term “transfection” refers to the process of intentionally introducing a nucleic acid molecule or polynucleotide (including a vector) into a target cell. An example is RNA transfection, i.e., the process of introducing RNA (e.g., in vitro transcribed RNA, ivtRNA) into a host cell. This term is primarily used for non-viral methods in eukaryotic cells. The term “transduction” is generally used to describe the virus-mediated transfer of nucleic acid molecules or polynucleotides. Transfection of animal cells typically involves creating transient pores or “holes” in the cell membrane to allow uptake of the material. Transfection may be carried out by using calcium phosphate, electroporation, cell extrusion, or by mixing cationic lipids with the material to produce liposomes that fuse to the cell membrane and deposit their cargo inside. Exemplary techniques for transfecting eukaryotic host cells include lipid vesicle-mediated uptake, heat shock-mediated uptake, calcium phosphate-mediated transfection (calcium phosphate / DNA coprecipitation), microinjection, and electroporation.

[0121] In some embodiments, the method further includes a step of growing and / or activating cells before or after transfection or transfection.

[0122] In another embodiment, the Disclosure provides a conjugate comprising an antigen-binding protein of the Disclosure and an activator coupled to or conjugated to the antigen-binding protein.

[0123] In some embodiments, the activator is selected from the group consisting of detectable markers, immunostimulant molecules, and therapeutic agents. Preferably, the detectable marker is selected from the group consisting of biotin, streptavidin, enzymes or catalytically active fragments thereof, radionuclides, nanoparticles, paramagnetic metal ions, nucleic acid probes, contrast agents, and fluorescence-generating molecules, phosphorescent molecules, or chemiluminescent molecules. Preferably, the immunostimulant molecule is selected from the group consisting of cytokines (e.g., IL-2 and IFN-γ), chemokines (e.g., IL-8), platelet factors (e.g., platelet factor IV), and complement initiation factors. Preferably, the therapeutic agent is selected from the group consisting of immunomodulators, radioactive compounds, enzymes, chemotherapeutic agents, and toxins. Other suitable therapeutic agents include small molecule cytotoxic agents, i.e., compounds having the ability to kill mammalian cells and having a molecular weight of less than 700 daltons. Such compounds may also contain toxic metals that have cytotoxic effects. Furthermore, it should be understood that these small molecule cytotoxic agents also include drug precursors, i.e., compounds that are broken down or converted under physiological conditions to release cytotoxic agents.Examples of such drugs include cisplatin, maytenin derivatives, rashelmycin, calicheamicin, docetaxel, etoposide, gemcitabine, isocyclic phosphorylamine, irinotecan, melphalan, mitoxantrone, and sorfimer sodium photophylline. Sodium photofrin (II), temozolomide, topotecan, trimetrexate glucuronic acid, auristatin E, vincristine, and doxorubicin; peptide cytotoxins, i.e., proteins or fragments thereof that have the ability to kill mammalian cells; e.g., lysine, diphtheria toxin, Pseudomonas bacterial exotoxin A, DNase, and RNase; radionuclides, i.e., unstable isotopes of elements that emit one or more alpha or beta particles or gamma rays upon decay, e.g., iodine-131, rhenium-186, indium-111, yttrium-90, bismuth-210, bismuth-213, actinium-225, and astatine-213; chelating agents that may be used to facilitate the binding of these radionuclides to molecules or their polymers; or heterogeneous protein domains, homologous protein domains, viral / bacterial protein domains, viral / bacterial peptides.

[0124] In another embodiment, the Disclosure provides compositions comprising antigen-binding proteins, nucleic acids, vectors, or cells of the Disclosure, preferably further comprising pharmaceutically acceptable carriers or excipients.

[0125] The term “composition” specifically refers to a composition suitable for administration to humans. However, the term generally also includes compositions suitable for administration to non-human animals. The composition and its components (i.e., the activator and optionally the carrier or excipient) are preferably pharmaceutically acceptable, that is, capable of producing the desired therapeutic effect without causing any undesirable local or systemic effects in the recipient. The pharmaceutically acceptable compositions of the present invention may, for example, be sterile. Specifically, the term “pharmaceutically acceptable” may indicate approval by a regulatory authority or other approved pharmacopoeia for use in animals, and more specifically in humans.

[0126] The term "excipient" includes injectors, adhesives, disintegrants, coatings, adsorbents, anti-adhesives, flow aids, preservatives, antioxidants, flavorings, colorants, sweeteners, solvents, co-solvents, buffers, chelating agents, viscosity modifiers, surfactants, diluents, wetting agents, carriers, diluents, preservatives, emulsifiers, stabilizers, and tension regulators. Selecting suitable excipients for preparing the compositions of the present invention is well known to those skilled in the art. Exemplary carriers for use in the compositions of the present invention include saline, buffered saline, glucose, and water. Typically, the selection of suitable excipients depends, in particular, on the activators used, the disease being treated, and the desired dosage form of the composition.

[0127] Depending on the activator used (e.g., soluble TCR), the compositions of this disclosure may be formulated in various forms, such as solid, liquid, gaseous, or lyophilized forms, particularly ointments, creams, transdermal patches, gels, powders, tablets, solutions, aerosols, granules, pills, suspensions, emulsions, capsules, syrups, liquids, elixirs, injectables, tinctures or fluid extracts, or any form particularly suitable for a desired method of administration. The drug production processes well known to the present invention are described in the 22nd edition of Remington's Pharmaceutical Sciences (Ed. Maack Publishing Co, Easton, Pa., 2012) and include, for example, conventional steps such as mixing, dissolution, granulation, sugar coating, grinding, emulsification, encapsulation, embedding, or lyophilization. For example, compositions comprising host cells or soluble TCRs as described herein are typically provided in liquid form and preferably contain pharmaceutically acceptable buffers.

[0128] In some embodiments, the compositions of the present disclosure further comprise a second therapeutic agent, preferably selected from the group consisting of antibodies, chemotherapeutic agents, and small molecule drugs.

[0129] Examples of preferred second therapeutic agents include well-known anticancer drugs, such as cisplatin, meitenin derivatives, rashelmycin, calicheamicin, docetaxel, etoposide, gemcitabine, isocyclic phosphorylamine, irinotecan, melphalan, mitoxantrone, solfimer sodium photophylline II, temozolomide, topotecan, trimethrexate glucuronic acid, auristatin E, vincristine, and doxorubicin; and peptide cytotoxins, such as lysine and diphtheria. Toxins, Pseudomonas bacterial exotoxin A, DNase and RNase; radionuclides, e.g., iodine-131, rhenium-186, indium-111, yttrium-90, bismuth-210 and 213, actinium-225 and astatine-213; prodrugs, e.g., antibody-directed enzyme prodrugs; immunostimulants, e.g., IL-2; chemokines, e.g., IL-8, platelet factor 4; antibodies or their fragments, e.g., anti-CD3 antibodies or their fragments; complement initiators; heterogeneous protein domains, homologous protein domains, viral / bacterial protein domains and viral / bacterial peptides.

[0130] In yet another aspect, the Disclosure provides a method for treating or preventing an HPV-positive disease in a subject, comprising administering an effective amount of the antigen-binding protein of the Disclosure to the subject.

[0131] In another aspect, the Disclosure provides a method for treating or preventing an HPV-positive disease in a subject, comprising administering an effective amount of the Cells of the Disclosure to the subject.

[0132] As used herein, the terms “treatment,” “to treat,” or “to treat” include therapeutic or prophylactic treatment in a subject requiring such treatment. The term “therapeutic or prophylactic treatment” includes prophylactic treatment intended to completely prevent clinical and / or pathological findings, or therapeutic treatment intended to improve or alleviate clinical and / or pathological findings. Thus, the term “treatment” also includes the improvement or prevention of disease.

[0133] As used herein, the term “effective dose” refers to the amount of a therapeutic agent sufficient to achieve treatment or prevention of a disease when administered to a subject. “Effective dose” may vary depending on the compound, the disease and its severity, and the age and weight of the subject being treated. “Therapeutic effective dose” refers to the effective dose for therapeutic treatment. “Prophylactic effective dose” refers to the effective dose for prophylactic treatment.

[0134] Therapeutic efficacy and toxicity can be determined by standard procedures such as ED50 (the dose that is therapeutically effective in 50% of the population) and LD50 (the dose that is lethal in 50% of the population) in cell cultures or experimental animals. The dose ratio between therapeutic effect and toxic effect is the therapeutic index and can be expressed as the ED50 / LD50 ratio. Pharmaceutical compositions exhibiting a large therapeutic index are preferred.

[0135] The precise dose of antigen-binding protein or cells to be administered can be determined by those skilled in the art using well-known techniques. A suitable dose provides a sufficient amount of the activator of the present invention and is preferably therapeutically effective, i.e., sufficient to induce a therapeutic or prophylactic response in a subject or animal within a suitable period of time. For example, the dose of the antigen-binding protein of the present invention, e.g., TCR, should be sufficient to bind to a cancer antigen or to detect, treat, or prevent cancer within a period of about two hours or more from the time of administration, e.g., 12 to 24 hours or more (e.g., 1 month, 2 months, 3 months, 6 months, 12 months, 24 months, etc.). In some embodiments, the period may be even longer. As is well known in the art, adjustments may be necessary depending on the therapeutic objective (e.g., mitigation of acute disease onset), route of administration, timing and frequency, timing and frequency of administration of the formulation, age, weight, general health status, sex, diet, severity of disease condition, drug combination, sensitivity to response, and tolerance / response to treatment.

[0136] Numerous assays for determining the dose to be administered are well known in the art. For the purposes of the present invention, an assay may be used to determine the starting dose to be administered to mammals, comprising administering a given dose of T cells expressing the antigen-binding protein of the present disclosure (e.g., TCR) to a group of mammals (each administered with a different dose of T cells) and then comparing the degree of target cell lysis or IFN-γ secretion achieved by such T cells. The degree of target cell lysis or IFN-γ secretion achieved after administration of a given dose may be determined by methods well known in the art. The dose of the antigen-binding protein or cells of the present disclosure is also determined by the presence, nature, and extent of any adverse side effects that may be associated with the administration of the antigen-binding protein or cells of the present disclosure. Typically, the dose of the antigen-binding protein or cells of the present disclosure administered to an individual patient is determined by the attending physician, taking into account various factors such as age, weight, general health, diet, sex, the activator administered, the route of administration, and the severity of the medical condition being treated. In some embodiments of the treatment method of the present disclosure, the number of cells administered per infusion is, for example, about 1 × 10⁶ cells. 6 From each piece, approximately 1 x 10 12 The number may vary if it is more than 1. 6 In some cases, fewer than one dose may be administered.

[0137] It should be recognized that the treatment may require a single or multiple dose of a therapeutically effective amount of the activator of the present invention. For example, depending on the formulation, half-life, and clearance of the specific composition, some compositions may be administered every 3 to 4 days, weekly, or every 2 weeks, or once a month.

[0138] The compositions of this disclosure may be suitable for administration by various routes. Typically, administration is achieved parenterally. Parenteral delivery methods include topical, intra-arterial, intramuscular, subcutaneous, intramedullary, subarachnoid, intracardiac, intravenous, intraperitoneal, intrauterine, intravaginal, sublingual, or intranasal administration.

[0139] The terms “subject,” “individual,” “animal,” or “patient” are used interchangeably herein and refer to any subject requiring treatment, particularly mammalian subjects. Generally, mammalian subjects include humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, and dairy cows. However, the TCRs, nucleic acids, vectors, host cells, and pharmaceutical compositions provided herein may also be used for human subjects, particularly HLA-A * For example, HLA-A is positive for O2. * 02:01, HLA-A * 02:03, HLA-A * 02:05, HLA-A * 02:06, HLA-A * 02:07 HLA-A * 02:10 or HLA-A * It is easily understood that this is particularly expected to be used to treat human subjects who test positive for 02:11.

[0140] In some embodiments of the treatment methods of this disclosure, the cells are autologous or homogeneous to the subject.

[0141] In some embodiments, the method includes the steps of: (i) isolating a sample containing cells derived from a subject; (ii) transfecting or transfecting the cells using a vector of the Disclosure; and (iii) administering the cells obtained in step (ii) to the subject. In some embodiments, the method further includes knocking out endogenous TCRs in the cells after step (i) but before step (ii). In some embodiments, the method further includes administering a second therapeutic agent. Preferably, the second therapeutic agent is selected from the group consisting of antibodies, chemotherapeutic agents and small molecule drugs. Preferred examples of the second therapeutic agent are described above.

[0142] In some embodiments of the treatment methods of this disclosure, the HPV-positive disease is selected from the group consisting of HPV infection, HPV pre-malignant neoplasms, and HPV cancer. The cancer may be any cancer, including acute lymphoblastic carcinoma, acute myeloid leukemia, alveolar rhabdomyosarcoma, bone cancer, brain cancer, breast cancer, anal cancer, anal canal cancer or intrarectal anal cancer, eye cancer, intrahepatic cholangiocarcinoma, joint cancer, cervical cancer, gallbladder cancer or pleural cancer, nasal cancer, nasal cavity cancer or middle ear cancer, oral cancer, vaginal cancer, vulvar cancer, chronic lymphocytic leukemia, chronic myeloid carcinoma, colon cancer, esophageal cancer, cervical cancer, gastrointestinal carcinoid tumor, and nephrosis. Examples of cancers treated include glioma, Hodgkin lymphoma, hypopharyngeal cancer, kidney cancer, laryngeal cancer, liver cancer, lung cancer, malignant mesothelioma, melanoma, multiple myeloma, nasopharyngeal cancer, non-Hodgkin lymphoma, oropharyngeal cancer, ovarian cancer, penile cancer, pancreatic cancer, peritoneal cancer, omental and mesenteric cancer, pharyngeal cancer, prostate cancer, rectal cancer, kidney cancer, skin cancer, small intestine cancer, soft tissue cancer, gastric cancer, testicular cancer, thyroid cancer, uterine cancer, ureteral cancer, and bladder cancer. Preferred cancers are HPV16-positive cancers. Cancers most commonly associated with HPV16 infection include cervical cancer, oropharyngeal cancer, anal cancer, anal canal cancer, colorectal cancer, vaginal cancer, vulvar cancer, and penile cancer, but the methods of the present invention can be used to treat any HPV16-positive cancer, including those present in other anatomical regions. Preferably, the cancer is selected from the group consisting of cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, and penile cancer.

[0143] In another aspect, the Disclosure provides a method for detecting (e.g., diagnosing) an HPV-positive disease in a subject, comprising: (i) contacting a sample obtained from the subject with an antigen-binding protein, cell, or conjugate of the Disclosure; and (ii) detecting the presence of an HPV antigen in the sample, wherein the presence of the HPV antigen indicates an HPV-positive disease. HPV-positive diseases may be selected, for example, from the group consisting of HPV infection, HPV pre-malignancies, and HPV cancers. Cancer is as defined above.

[0144] In some embodiments, the sample obtained from the subject may be a blood sample, a urine sample, a tissue sample, or a cell sample. In some embodiments, the method is carried out in vitro. In some embodiments, the method includes (i) contacting the sample obtained from the subject with a conjugate of the Disclosure, wherein the conjugate contains a detectable marker; and (ii) detecting the presence of HPV antigen in the sample by detecting the detectable marker. Examples of detectable markers, but not limited to, include biotin, streptavidin, enzymes or catalytically active fragments thereof, radionuclides, nanoparticles, paramagnetic metal ions, nucleic acid probes, contrast agents, and fluorescent molecules, phosphorescent molecules, or chemiluminescent molecules; preferably, enzymes or catalytically active fragments thereof, radionuclides, fluorescent molecules, phosphorescent molecules, or chemiluminescent molecules.

[0145] In yet another aspect, the Disclosure provides a kit for detecting the presence of a positive epitope in a sample to be tested, comprising an antigen-binding protein or conjugate according to the Disclosure, wherein the epitope is an epitope comprising YMLDLQPET (SEQ ID NO: 11).

[0146] In some embodiments, the kit is a kit for detecting (e.g., diagnosing) an HPV-positive disease in a subject, comprising the antigen-binding protein or conjugate of the present disclosure. The HPV-positive condition is selected from, for example, the group consisting of HPV infection, HPV pre-malignancy, and HPV cancer. Cancer is as defined above.

[0147] In some embodiments, the conjugate includes a detectable marker. Examples of detectable markers, but not limited to, include biotin, streptavidin, enzymes or their catalytically active fragments, radionuclides, nanoparticles, paramagnetic metal ions, nucleic acid probes, contrast agents, and fluorescence-generating, phosphorescent, or chemiluminescent molecules; preferably, enzymes or their catalytically active fragments, radionuclides, fluorescence-generating molecules, phosphorescent molecules, or chemiluminescent molecules. In some embodiments, the kit further includes instructions on how to use the kit.

[0148] In another aspect, the Disclosure provides the use of antigen-binding proteins, nucleic acids, vectors, cells, or compositions of the Disclosure in the preparation of pharmaceuticals for the treatment or prevention of HPV-positive diseases in subjects.

[0149] In yet another aspect, the Disclosure provides antigen-binding proteins, nucleic acids, vectors, cells, or compositions of the Disclosure for use in the treatment or prevention of HPV-positive diseases in subjects.

[0150] In another aspect, the Disclosure provides the use of the antigen-binding protein or conjugate of the Disclosure in the preparation of a kit for detecting the presence of a positive epitope in a sample to be tested, wherein the epitope comprises YMLDLQPET (SEQ ID NO: 11).

[0151] In some embodiments, the Disclosure provides the use of antigen-binding proteins or conjugates of the Disclosure in the preparation of a kit for detecting (e.g., diagnosing) an HPV-positive disease in a subject.

[0152] In yet another aspect, the Disclosure provides an antigen-binding protein or conjugate of the Disclosure for use in detecting the presence of a positive epitope in a sample under test, wherein the epitope comprises YMLDLQPET (SEQ ID NO: 11), and is for use in detecting (e.g., diagnosing) an HPV-positive disease in a subject.

[0153] In some embodiments of the use of this disclosure, the subject is HLA-A * 02 Alleles, for example, HLA-A * 02:01, HLA-A * 02:03, HLA-A * 02:05, HLA-A * 02:06, HLA-A * 02:07, HLA-A * 02:10 or HLA-A * It has the 02:11 allele. In some embodiments, HPV-positive diseases are selected from the group consisting of HPV infection, HPV pre-malignant neoplasms, and HPV cancers. Preferably, cancers are selected from the group consisting of cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, and penile cancer. [Examples]

[0154] The present invention is further described by the following specific embodiments. It should be understood that these embodiments are intended to illustrate the present invention only and not to limit its scope. Experimental methods in the following embodiments where specific conditions are not indicated are carried out using conventional conditions in the art, for example, those described by Sambrook and Russeii et al., Molecular Cloning: A Laboratory Manual (Third Edition) (2001), CSHL Press, or those recommended by the manufacturer. Unless otherwise stated, the experimental materials and reagents used in the following embodiments are commercially available.

[0155] <Example 1: Screening for HPV16 E7-specific TCRs> After obtaining ethical approval and informed consent from the patient, HPV16-positive cervical cancer (HLA-A * Postoperative tumor tissue was obtained from patients with 02:01), and tumor-infiltrating lymphocytes (TILs) were cultured and expanded from the tumor tissue. After adequately expanding the TILs, CD8 and HLA-A were analyzed. * 02:01 / HPV16 E7 11-19 Strongly stained tetramer-positive cells were selected using flow cytometry. mRNA was extracted from the selected CD8+ / tetramer+ cells, reverse transcribed, and amplified to obtain the TCRα and β chain variable region (V region) genes. The obtained TCRα and β chain V region genes were further constructed in a lentiviral vector containing the TCR constant region (C region) gene. The cloned vector was able to express the complete TCRα and β chains, respectively (Figure 1A).

[0156] Various candidate TCR pairs were introduced into established T cell reporter cell lines, and the antigen specificity and affinity of the TCR pairs were confirmed by antigen-specific activation assays. Using the above cloning and confirmation scheme, HLA-A * HPV16 E7 presented by 02:01 11-19 We obtained a TCR called CRTE7A2 that specifically recognizes the epitope (YMLDLQPET, SEQ ID NO: 11) (Figure 1B).

[0157] The amino acid sequences and coding sequences of the variable regions of CRTE7A2 are shown in Tables 1 and 2, respectively, and the CDR sequences of the α-chain and β-chain variable regions are shown in Table 3. The sequence of the constant region of the recombinant TCR is shown in Table 4. The amino acid sequences of the α-chain and β-chain of the recombinant TCR are shown in Table 5.

[0158] [Table 1]

[0159] [Table 2]

[0160] [Table 3]

[0161] [Table 4]

[0162] [Table 5]

[0163] [Table 6]

[0164] [Table 7]

[0165] The α and β chain variable regions of CRTE7A2 were fused to the murin constant region (SEQ ID NO: 19 (α chain) and SEQ ID NO: 26 (β chain)), and for subsequent use, a lentiviral vector was constructed in series in the order β-T2A-α.

[0166] <Example 2: Binding affinity of CRTE7A2 to target antigen peptide> To confirm the affinity of CRTE7A2 for the target antigen peptide (YMLDLQPET, SEQ ID NO: 11), KITE-439, a TCR targeting HPV16 E7 developed by Kite Pharma, was used as a control. CRTE7A2 and KITE-439 were introduced into Jurkat cells (Jurkat-NFAT-GFP, with the endogenous TCR knocked out) possessing the NFAT-GFP reporter gene using lentivirus. Jurkat cells were co-incubated with T2 cells loaded with various concentrations of the target antigen peptide, and the activation level of the reporter gene in Jurkat cells was measured. The result showed that the EC50 of CRTE7A2 binding to the target antigen was 3.10. * 10 -8 The value is M, and the EC50 of KITE-439 binding to the target antigen is 4.85. * 10 -8 The result shows that CRTE7A2 TCR-T cells exhibit superior and stronger reactivity to the target antigen peptide compared to KITE-439 TCR-T cells (Figure 2). The above results indicate that CRTE7A2 has high binding affinity to the target antigen peptide.

[0167] <Example 3: Cell membrane expression stability of CRTE7A2> PBMCs were transduced with equal volumes of KITE-439 and CRTE7A2 lentivirus (MOI 20), then cultured for 9 days. Good TCR transduction was confirmed using human CD3-FITC antibody. TCR-T expression was detected by staining with anti-mouse TCRβ-APC antibody; the CD4 / CD8 ratio was measured by staining with human CD4-APC and CD8-PE-Cy7 antibodies. Flow cytometry results showed that the CD4 / CD8 ratio and TCR positivity ratio of each cell after transduction of both TCRs were substantially the same under the same transduction and culture conditions (Figure 3). The expression intensity of CRTE7A2 was significantly better than that of KITE-439, indicating that the CRTE7A2 TCR has better cell membrane expression stability and suggesting that CRTE7A2 potentially possesses better antigen reactivity and antitumor activity.

[0168] <Example 4: Specific killing activity of CRTE7A2 TCR-T cells against antigen-positive tumor cells> T cells expressing CRTE7A2 or KITE-439 TCR were used as effector cells, and PBMCs that were grown and cultured in parallel without transduction using the TCR were used as a control for the effector cells. 10 -6 M HPV16 E7 11-19 T2 cells loaded with polypeptides (HLA-A * 02:01 positive), Caski cells (HPV16 E7 positive, HLA-A * 02:01 positive) and Hela-E7-0201 cells (HPV16 E7 and HLA-A * Cells overexpressing 02:01 were used as HLA antigen peptide match-positive target cells. HPV16 E7 11-19 T2 cells and A375 cells (HPV16 E7 negative, HLA-A) that are not loaded with polypeptides. * 02:01 Positive) and A549 cells (HPV16 E7 Negative, HLA-A * Effector cells (02:01 negative) were used as HLA antigen peptide mismatch negative target cells. All target cells stably expressed the luciferase gene. Effector cells were incubated with various target cells for 16 hours at effector cell-to-target cell ratios (E:T) of 9:1, 3:1, and 1:1, respectively, and luciferase substrate was added to detect viable target cells. The percentage of killed target cells was calculated based on the number of remaining target cells.

[0169] The results show that CRTE7A2 TCR-T cells exhibit a significant killing effect against positive target cells but no killing effect against negative target cells (Figure 4A), indicating that CRTE7A2 TCR-T cells have the ability to specifically kill HLA antigen peptide-matched target cells. Comparison with the results for KITE-439 shows that CRTE7A2 TCR-T cells exhibit significantly superior killing activity against target cells compared to KITE-439 (Figure 4B). These results demonstrate a significantly more efficient and specific killing effect of CRTE7A2 TCR-T cells against antigen-positive tumor cells.

[0170] <Example 5: Specific Response of CRTE7A2 TCR-T Cells to Antigen-Positive Target Cells> T cells expressing CRTE7A2 TCR were used as effector cells, and PBMCs that were not transduced with TCR, grown in parallel, and cultured were used as controls for the effector cells. 10 -6 HPV16 E7 of 10 11-19 T2 cells loaded with the polypeptide (HLA-A * 02:01 positive), Caski cells (HPV16 E7 positive, HLA-A * 02:01 positive), and Hela-E7-0201 cells (overexpressing HPV16 E7 and HLA-A * 02:01) were used as HLA antigen peptide-matched positive target cells. HPV16 E7 11-19 T2 cells not loaded with the polypeptide, A375 cells (HPV16 E7 negative, HLA-A * 02:01 positive), and A549 cells (HPV16 E7 negative, HLA-A * 02:01 negative) were used as HLA antigen peptide non-matched negative target cells. The number of CRTE7A2 TCR-T cells was 10 5 cells. CRTE7A2 TCR-T cells were incubated with various target cells at an E:T ratio of 1:1 for 24 hours, and the secretion of IFN-γ in the supernatant was detected using an IFN-γ ELISA kit (Thermo, catalog number 88-7316-76). The results are as shown in Figure 5.

[0171] The results showed that CRTE7A2 TCR-T cells produced IFN-γ secretion against HLA antigen peptide-matched positive target cells and did not produce IFN-γ secretion against HLA antigen peptide non-matched negative target cells, indicating a well-specific killing effect of CRTE7A2 TCR-T cells.

[0172] TCR-T cells expressing CRTE7A2 or KITE-439 were used as effector cells. 10 -6 HPV16 E7 of 1011-19 T2 cells loaded with a polypeptide (HLA-A * 02:01 positive), Caski cells (HPV16 E7 positive, HLA-A * 02:01 positive), and Hela-E7-0201 cells (overexpressing HPV16 E7 and HLA-A * 02:01) were used as HLA antigen peptide-matched positive target cells. The number of CRTE7A2 TCR-T cells was 10 5 cells. CRTE7A2 TCR-T cells were incubated with various target cells at E:T ratios of 9:1, 3:1, and 1:1 for 24 hours each, and the secretion of IFN-γ in the supernatant was detected. The results are as shown in Figure 6. The results indicate that, similar to KITE-439 TCR-T cells, CRTE7A2 TCR-T cells can secrete high levels of IFN-γ under stimulation by antigen-positive target cells.

[0173] <Example 6: Specific IFN-γ secretion by CRTE7A2 TCR-T cells against antigen-positive target cells> 10 5 CRTE7A2 TCR-T cells were added to ELISpot detection wells A, B, C, and D that can capture IFN-γ secreted by cells. To different wells were added: (A) 25 ng / ml PHA (T cell cytokine) as a positive control; (B) CRTE7A2 TCR-T cells as a self-control; (C) culture medium for culturing CRTE7A2 as a negative control; and (D) 10 nM HPV16 E7 11-19 polypeptide-loaded HLA-A * 02:01-positive T2 cells. ELISpot staining was performed after incubation for 16 - 24 hours, and the results are as shown in Figure 7. The results show that CRTE7A2 in well A showed a brown positive response to PHA stimulation; wells B and C acted as negative controls and showed no obvious brown spots; and CRTE7A2 in well D showed obvious brown spots under stimulation by 10 nM HPV16 E7 11-19 polypeptide. This indicates that CRTE7A2 is HLA-A* 02:01 - HPV16 E7 presented by positive T2 cells 11-19 This demonstrates the production of specific IFN-γ secretion under polypeptide stimulation.

[0174] <Example 7: CRTE7A2 efficiently mediates antigen-specific T cell proliferation> CRTE7A2 TCR-T cells and PBMCs not transduced using TCR were left to stand for 24 hours in IL-2-free, lymphocyte-serum-free medium X VIVO-15 (Lonza, catalog number BE02-060F), and then stained and labeled with CFSE (C34554, Invitrogen) and labeled with 10 nM or 1 nM HPV16 E7. 11-19 Polypeptide-loaded T2 cells were co-cultured for 5 days. The mixed cells were then stained for mouse TCRβ-APC and human CD8α-PE Cy7. CD8 and mouse TCRβ-positive cells were selected for cell proliferation analysis. Unrelated polypeptide-loaded T2 cells were used as controls for polypeptides, and PBMCs not transduced using TCR were used as negative controls. The results are shown in Figure 8.

[0175] The result was HPV16 E7 11-19 This study demonstrates that polypeptides can specifically stimulate the proliferation of CRTE7A2 TCR-T cells, further confirming antigen-specific activation of CRTE7A2 TCR-T cells.

[0176] <Example 8: In vivo antitumor activity of CRTE7A2> We established a tumorigenetic model (CDX model) in B2M knockout NDG immunodeficient mice using the cervical cancer cell line Hela-E7-A0201, and obtained 5 × 10⁻¹⁰ 6 pieces and 10 7 Reinfusion of 10 CRTE7A2 TCR-T cells into the tail vein, and 10 as a control. 7The reinjection of individual PBMCs continued. The growth of subcutaneously transplanted Hela tumors was monitored, and the results are shown in Figure 9A. The results demonstrate that CRTE7A2 TCR-T cells possess dose-dependent tumor inhibitory activity. 5×10 6 pieces and 10 7 Individual CRTE7A2 TCR-T cells can significantly inhibit the proliferation of tumor cells, and 10 7 Each cell is 5 × 10 6 It has a better tumor inhibitory effect than that of individual cells. Using a luciferase live imaging system, the proliferation of subcutaneously transplanted Hela tumors monitored for 21 days after TCR-T cell reinfusion was 5 × 10⁻⁶. 6 pieces and 10 7 Reinjection of individual CRTE7A2 TCR-T cells can significantly inhibit tumor cell proliferation, and 10 7 Each cell is 5 × 10 6 This demonstrates that it has a better tumor-inhibiting effect than that of cells (Figure 9B).

[0177] These results suggest that CRTE7A2 TCR-T cells possess significant in vivo antitumor activity.

[0178] This application references and incorporates by reference various published patents, published patent applications, academic papers, and other publications. In the event of any conflict between any of the references incorporated herein and this specification, the specification shall prevail. In addition, any specific embodiment of the present invention that falls within the scope of the prior art may be expressly excluded from any one or more claims. Such embodiments may be excluded even if the exclusion is not expressly stated in this application, as they are considered to be well known to those skilled in the art. Any specific embodiment of the present invention may be excluded from any claim for any reason, whether or not it is related to the existence of the prior art.

[0179] Although the present invention has been described with reference to its specific embodiments, it should be understood by those skilled in the art that various modifications are possible and equivalents can be substituted without departing from the true spirit and scope of the invention. In addition, numerous modifications can be made to produce specific examples, materials, compositions, methods, and steps of the method that are suitable for the object, spirit, and scope of the invention. All such modifications are intended to be within the scope of the claims.

Claims

1. An antigen-binding protein comprising a T cell receptor (TCR) alpha chain variable region and a TCR beta chain variable region, The TCR alpha chain variable region includes CDR1, CDR2, and CDR3 having amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively, and the TCR beta chain variable region includes beta chain CDR1, CDR2, and CDR3 having amino acid sequences shown in SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, respectively. The antigen-binding protein is characterized by binding to an epitope containing the amino acid sequence of YMLDLQPET (SEQ ID NO: 11), or to a complex of the epitope and an MHC molecule.

2. The antigen-binding protein according to claim 1, The MHC molecule is HLA-A * An antigen-binding protein characterized by being of type 02:

01.

3. An antigen-binding protein according to claim 1 or 2, An antigen-binding protein characterized in that the TCR alpha chain variable region contains an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 4, and / or the TCR beta chain variable region contains an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO:

9.

4. An antigen-binding protein according to claim 1 or 2, The TCR alpha chain variable region is contained in a first polypeptide, and the TCR beta chain variable region is contained in a different second polypeptide, or An antigen-binding protein characterized in that the TCR alpha chain variable region and the TCR beta chain variable region are contained within a single polypeptide.

5. An antigen-binding protein according to claim 1 or 2, The antigen-binding protein is soluble or membrane-bound, or The antigen-binding protein further comprises an intracellular signaling region, or The antigen-binding protein further comprises one or more antigen-binding regions that bind to other antigens or epitopes, The antigen-binding protein is characterized by being isolated or purified.

6. An antigen-binding protein according to claim 1 or 2, The antigen-binding protein is selected from TCR, chimeric antigen receptor (CAR), Fc polypeptide, or its antigen-binding fragment, or The antigen-binding protein is characterized in that the antigen-binding protein is a TCR or an antigen-binding fragment thereof, and the antigen-binding protein further comprises a TCR constant region or a fragment thereof, or an extracellular segment of the TCR constant region.

7. The antigen-binding protein according to claim 6, The TCR steady-state region is either the murin steady-state region or the human steady-state region, or The TCR constant region includes the TCR alpha chain constant region and / or the TCR beta chain constant region, or The TCR constant region includes at least one TCR alpha chain constant region and TCR beta chain constant region containing at least one cysteine ​​mutation compared to the wild-type sequence, so as to form a disulfide bond between the TCR alpha chain and the TCR beta chain, or An antigen-binding protein characterized in that the constant region of the TCR alpha chain contains an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with any one of SEQ ID NOs: 14 to 19, and / or the constant region of the TCR beta chain contains an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with any one of SEQ ID NOs: 21 to 30.

8. The antigen-binding protein according to claim 6, The antigen-binding protein is characterized by further comprising a transmembrane region and / or a cytoplasmic region.

9. The antigen-binding protein according to claim 6, The antigen-binding protein is characterized by comprising a TCR alpha chain containing an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity in any one selected from SEQ ID NOs: 32 to 37; and / or a TCR beta chain containing an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity in any one selected from SEQ ID NOs: 38 to 47.

10. A nucleic acid characterized by encoding an antigen-binding protein as described in claim 1 or 2.

11. The nucleic acid according to claim 10, Sequence ID 5 contains a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity, and / or Sequence ID 10 contains a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity, or The nucleic acid is characterized by further comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 20, and / or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO:

31.

12. A vector characterized by containing the nucleic acid described in claim 10.

13. The vector according to claim 12, The vector is characterized by being selected from the group consisting of lentiviral vectors, retroviral vectors, plasmids, DNA vectors, mRNA vectors, transposon-based vectors, and artificial chromosomes.

14. A cell characterized by comprising an antigen-binding protein according to claim 1 or 2, a nucleic acid encoding the antigen-binding protein, or a vector containing the nucleic acid.

15. The cell according to claim 14, The cells are selected from the group consisting of lymphocytes, monocytes, and stem cells, or The aforementioned cells are selected from the group consisting of T cells, NK cells, and PBMCs, or The aforementioned cells are selected from the group consisting of lymphoid progenitor cells or induced pluripotent stem cells, or The aforementioned cells are characterized by being T cells that do not express endogenous TCRs.

16. A method for preparing cells according to claim 14, A method characterized by comprising the step of transfecting or transfecting cells using a vector containing a nucleic acid encoding the antigen-binding protein.

17. The method according to claim 16, A method further comprising the step of increasing and / or activating cells before or after the transfection or introduction.

18. A conjugate characterized by comprising an antigen-binding protein according to claim 1 or 2, and an activator that is conjugated to or coupled to the antigen-binding protein.

19. The conjugate according to claim 18, The activator is selected from the group consisting of detectable markers, immunostimulant molecules, and therapeutic agents, or A conjugate characterized in that the activator is selected from the group consisting of biotin, streptavidin, enzymes or catalytically active fragments thereof, radionuclides, nanoparticles, paramagnetic metal ions, nucleic acid probes, contrast agents, fluorescent molecules, phosphorescent molecules or chemiluminescent molecules, cytokines, chemokines, platelet factors, complement initiation factors, immunomodulators, radioactive compounds, enzymes, chemotherapeutic agents and toxins.

20. The antigen-binding protein according to claim 1 or 2, The nucleic acid encoding the antigen-binding protein, A vector containing the nucleic acid, or A cell containing the antigen-binding protein, a nucleic acid encoding the antigen-binding protein, or a vector containing the nucleic acid, A composition characterized by containing the following:

21. The composition according to claim 20, The composition further comprises a pharmaceutically acceptable carrier or excipient, The composition further comprises a second therapeutic agent, or The composition is characterized by further comprising an antibody, a chemotherapy drug, or a small molecule drug.

22. Use of the antigen-binding protein according to claim 1 or 2 in the preparation of a medicament for treating or preventing an HPV-positive disease in a subject.

23. Use of cells according to claim 14 in the preparation of a pharmacopoeia for treating or preventing an HPV-positive disease in a subject.

24. The use described in claim 23, The cells are autologous or homogeneous with respect to the subject, or The aforementioned target is HLA-A * Use characterized by having 02:01 alleles.

25. The use described in claim 22, The aforementioned HPV-positive disease is selected from the group consisting of HPV infection, HPV pre-malignant neoplasm, and HPV cancer, or The use is characterized in that the HPV-positive disease is selected from the group consisting of cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, and penile cancer.

26. The use described in claim 22, The aforementioned pharmaceutical further comprises a second therapeutic agent, or The use of the aforementioned pharmaceutical product is characterized by further comprising an antibody, a chemotherapy drug, or a small molecule drug.

27. (i) Contacting a sample obtained from a subject with a cell containing the antigen-binding protein described in claim 1 or 2, the antigen-binding protein, a nucleic acid encoding the antigen-binding protein, or a vector containing the nucleic acid, or a conjugate containing the antigen-binding protein and an activator conjugated to or coupled to the antigen-binding protein; and (ii) Detecting the presence of HPV antigen in the sample, wherein the presence of HPV antigen indicates an HPV-positive disease; A method characterized by being for detecting HPV-positive diseases in a subject, including the subject.

28. The method according to claim 27, The aforementioned HPV-positive disease is selected from the group consisting of HPV infection, HPV pre-malignant neoplasm, and HPV cancer, or A method characterized in that the HPV-positive disease is selected from the group consisting of cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, and penile cancer.

29. A kit comprising an antigen-binding protein according to claim 1 or 2, or a conjugate comprising the antigen-binding protein and an activator conjugated to or coupled to the antigen-binding protein, A kit used to detect the presence of a positive epitope in a sample being tested, characterized in that the epitope is an epitope containing YMLDLQPET (SEQ ID NO: 11).

Citation Information

Patent Citations

  • TCR for identifying human papilloma virus HPV16-E7 antigen

    CN110357952A

  • T cell receptor for recognizing HPV (human papillomavirus) antigen and coding sequence of T cell receptor

    CN113072635A

  • HPV-specific binding molecules

    JP2019536437A