Method for producing nucleic acid oligomers
The method of deprotecting ribose hydroxyl groups in nucleic acid oligomers using fluoride ions and radical reaction inhibitors addresses inefficiencies in existing synthesis methods, improving purity and efficiency.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- SUMITOMO CHEM CO LTD
- Filing Date
- 2023-03-20
- Publication Date
- 2026-06-15
- Estimated Expiration
- Not applicable · inactive patent
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical Field] 【0001】 This patent application claims priority and interest under the Paris Convention based on Japanese Patent Application No. 2022-047341 (filed March 23, 2022), and by reference herein the entire contents of the said application are incorporated herein by reference. The present invention relates to a method for producing nucleic acid oligomers containing ribose, and more specifically, to a method for deprotecting the hydroxyl group protecting group of ribose contained in nucleic acid oligomers. 【0002】 In recent years, there has been growing interest in the medical applications of nucleic acid oligomers. Examples include antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, and these are collectively known as nucleic acid drugs. 【0003】 Nucleic acid oligomers can be synthesized by solid-phase synthesis, in which phosphoramidites of nucleosides (hereinafter referred to as "amidites") are used as raw materials. Nucleic acid oligomers synthesized by extending nucleic acids on a solid support are cleaved from the solid support, and then, in nucleic acid oligomers containing ribose, the protecting group of the hydroxyl group at the 2' position of ribose is deprotected and removed to produce the desired nucleic acid oligomer. The purity of nucleic acid oligomers synthesized in this way is not always satisfactory because they go through multiple steps such as the nucleic acid extension reaction step on the solid support, the cleavage step from the solid support, and the deprotection step of each protecting group, and the synthesis was not efficient (Patent Documents 1 and 2). [Prior art documents] [Patent Documents] 【0004】 [Patent Document 1] International Publication No. 2006 / 022323 [Patent Document 2] International Publication No. 2013 / 027843 [Overview of the Initiative] [Problems that the invention aims to solve] 【0005】 The present invention aims to provide an efficient method for producing nucleic acid oligomers. [Means for solving the problem] 【0006】 As a result of diligent research to achieve the above objective, the inventors have discovered that the protecting group of the hydroxyl group of ribose contained in nucleic acid oligomers can be efficiently deprotected by contacting the nucleic acid oligomers with fluoride ions in the presence of a radical reaction inhibitor. As a result, an efficient method for producing nucleic acid oligomers can be provided. 【0007】 This invention was completed based on these findings and includes, but is not limited to, the following embodiments. 【0008】 1. In the presence of a radical reaction inhibitor, the following equation (3): [ka] (In the formula, G 4 This represents a protecting group for a hydrogen atom or a hydroxyl group. G 9 This represents an ammonium ion, alkylammonium ion, alkali metal ion, hydrogen ion, or hydroxyalkylammonium ion. B c Each of these independently represents the same or distinct nucleic acid base. Each R independently represents either the same or different hydrogen atom, fluorine atom, or OQ group. Q is independently the same or distinct tert-butyldimethylsilyl group, methyl group, 2-methoxyethyl group, methylene group bonded to the 4' carbon atom of ribose, ethylene group bonded to the 4' carbon atom of ribose, ethylidene group bonded to the 4' carbon atom of ribose, or the following formula (1): [ka] (In the formula, Bonds marked with an asterisk (*) indicate a bond with the oxygen atom of the OQ group. n represents any integer greater than or equal to 0. It represents the protecting group, Y represents either an oxygen atom or a sulfur atom, independently and either identically or distinctly. m represents any integer between 2 and 300. W and X are defined by either (a) or (b) below: (a) When W is a hydroxyl group, X has the same definition as the R group described above. (b) When X is a hydroxyl group, W represents an OV group, V represents a tert-butyldimethylsilyl group or the group of formula (1) above. However, at least one of the groups R, W, and X represents a hydroxyl group protected by the protecting group of formula (1). When m is an integer greater than or equal to 3, the nucleic acid oligomer represented by equation (3) is a nucleic acid oligomer in which non-nucleotide linkers may be incorporated instead of p nucleotides between the 5' and 3' terminal nucleotides (where p is a positive integer satisfying equation: m-1 > p). The following formula (4) is characterized by contacting the nucleic acid oligomer represented by with fluoride ions: [ka] (In the formula, R' independently represents the same or different hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, or OQ' group, Q' independently represents a methylene group, an ethylene group, or an ethylidene group bonded to the 4' carbon atom of ribose, either identical or distinct. Substituent G of formula (4) 4 , G 9 , Y, B cThe definitions of and m are the same as those in equation (3) above, W0 is a hydroxyl group, X0 has the same definition as the R' group described above. Furthermore, when m is an integer greater than or equal to 3, the nucleic acid oligomer represented by equation (4) is a nucleic acid oligomer in which non-nucleotide linkers may be incorporated instead of p nucleotides between the 5' and 3' terminal nucleotides (where p is a positive integer satisfying equation: m-1 > p). A method for producing nucleic acid oligomers as shown (hereinafter referred to as "the method of the present invention" or "the method of production of this embodiment" in this specification). 2. The manufacturing method described in paragraph 1 above, wherein n in formula (1) is 0 or 1. 3. The manufacturing method described in item 1 above, wherein n in formula (1) is 0. 4. The manufacturing method described in item 1 above, wherein n in formula (1) is 1. 5. The manufacturing method according to any one of items 1 to 4 above, wherein the non-nucleotide linker is a linker consisting of an amino acid skeleton. 6. The manufacturing method described in paragraph 5 above, wherein the linker consisting of an amino acid skeleton is a linker having the structure of the following formulas (A14-1), (A14-2), or (A14-3). [ka] [ka] [ka] (In the formula, 5' and 3' represent the 5' and 3' ends of the nucleic acid oligomer, respectively.) 7. A manufacturing method according to any one of items 1 to 6 above, wherein W is a hydroxyl group, X is an R group, W0 is a hydroxyl group, and X0 is an R' group. 8. The manufacturing method according to any one of items 1 to 7 above, wherein the fluoride ion source is tetraalkylammonium fluoride. 9. The production method according to any one of the preceding items 1 to 8, wherein the fluoride ion source is tetra-n-butylammonium fluoride. 10. The production method according to any one of the preceding items 1 to 9, wherein the radical reaction inhibitor is a radical chain initiation inhibitor, a radical scavenger, or a peroxide decomposer. 11. The production method according to any one of the preceding items 1 to 9, wherein the radical reaction inhibitor is a radical scavenger. 12. The production method according to item 11 above, wherein the radical scavenger is a phenolic antioxidant or a hindered amine light stabilizer. 13. The production method according to item 11 above, wherein the radical scavenger is a phenolic antioxidant. 14. The production method according to item 12 or 13 above, wherein the phenolic antioxidant is a compound represented by the following formula (8). 【Chemical formula】 (In the formula, R 10 , R 11 , R 12 , and R 13 are the same or different and represent a chain hydrocarbon group, a carbocyclic group, a heterocyclic group, an alkoxy group, an alkylsulfanyl group {the chain hydrocarbon group, the carbocyclic group, the heterocyclic group, the alkoxy group, the alkylsulfanyl group may have one or more substituents}, SiR 51 R 52 R 53 , an amide group, C(O)R 61 , OC(O)R 61 , a hydroxyl group, or a hydrogen atom, and R 51 , R 52 and R 53 are the same or different and represent an alkyl group, an alkoxy group, or a hydrogen atom, and R 61 represents a chain hydrocarbon group.) 15. The production method according to item 12 above, wherein the radical scavenger is a hindered amine light stabilizer. 16. The production method according to item 12, 14, or 15 above, wherein the hindered amine light stabilizer is a compound represented by formula (12). [ka] (In the formula, R 14 O(O)R 20 NHR 20 , or indicates a hydrogen atom, R 19 R represents an alkyl group, alkoxy group, oxygen free radical, hydroxyl group, or hydrogen atom. 15 , R 16 , R 17 , and R 18 R represents an alkyl group or a hydrogen atom, either identical or distinct. 20 The chain hydrocarbon group, the carbocyclyl group, the heterocyclyl group, the alkoxy group, the alkylsulfanyl group {the chain hydrocarbon group, the carbocyclyl group, the heterocyclyl group, the alkoxy group, and the alkylsulfanyl group may have one or more substituents}, SiR 54 R 55 R 56 R represents an amide group, a hydroxyl group, or a hydrogen atom. 54 , R 55 and R 56 (These represent an alkyl group, alkoxy group, or hydrogen atom, either identical or distinct.) 17. The manufacturing method according to any one of paragraphs 1 to 9 above, wherein the radical reaction inhibitor is a peroxide decomposition agent. 18. The manufacturing method described in paragraph 17, wherein the peroxide decomposing agent is a phosphorus-based antioxidant or a sulfur-based antioxidant. 19. The manufacturing method described in paragraph 17 above, wherein the peroxide decomposing agent is a phosphorus-based antioxidant. 20. The manufacturing method described in paragraph 17 above, wherein the peroxide decomposing agent is a sulfur-based antioxidant. 21. The manufacturing method according to any one of paragraphs 1 to 9 above, wherein the radical reaction inhibitor is a radical chain initiation inhibitor. 22. The manufacturing method according to paragraph 21, wherein the radical chain initiation inhibitor is a metal deactivator or an ultraviolet absorber. 23. The manufacturing method according to paragraph 21, wherein the radical chain initiation inhibitor is a metal deactivator. 24. The manufacturing method according to item 21 above, wherein the radical chain initiation inhibitor is an ultraviolet absorber. 25. The manufacturing method according to any one of items 1 to 24 above, wherein the amount of radical reaction inhibitor used is 9 moles or less per mole, which is the number of moles obtained by multiplying the number of moles of nucleic acid oligomers represented by formula (3) by the number of groups represented by formula (1) in formula (3). 26. A method for producing a nucleic acid oligomer according to any one of paragraphs 1 to 25 above, wherein the proportion of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 10% or more, and the nucleic acid chain length is 10 chains or more. [Effects of the Invention] 【0009】 This invention provides an efficient method for producing nucleic acid oligomers. It is expected to improve the purity of the produced nucleic acid oligomers. [Modes for carrying out the invention] 【0010】 The present invention will be described by illustrating embodiments, but the present invention is not limited to the following embodiments. 【0011】 Let's explain substituents. A halogen atom refers to a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom. When a substituent is substituted with two or more halogen atoms or substituents, those halogen atoms or substituents may be the same or different. A chain-like hydrocarbon group refers to an alkyl group, an alkenyl group, or an alkynyl group. Examples of alkyl groups include methyl, ethyl, propyl, isopropyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 1-ethylpropyl, butyl, sec-butyl, isobutyl, tert-butyl, pentyl, and hexyl groups. Examples of alkenyl groups include vinyl, 1-propenyl, 2-propenyl, 1-methyl-1-propenyl, 1-methyl-2-propenyl, 1,2-dimethyl-1-propenyl, 1-ethyl-2-propenyl, 3-butenyl, 4-pentenyl, and 5-hexenyl groups. Examples of alkynyl groups include ethynyl group, 1-propynyl group, 2-propynyl group, 1-methyl-2-propynyl group, 1,1-dimethyl-2-propynyl group, 1-ethyl-2-propynyl group, 2-butynyl group, 4-pentynyl group, and 5-hexynyl group. Examples of alkoxy groups include methoxy, ethoxy, propoxy, isopropoxy, butoxy, tert-butoxy, pentyloxy, hexyloxy, and octyloxy groups. Examples of alkylsulfanyl groups include methylsulfinyl group, ethylsulfinyl group, propylsulfinyl group, isopropylsulfinyl group, butylsulfinyl group, tert-butylsulfinyl group, pentylsulfinyl group, hexylsulfinyl group, and octylsulfinyl group. Examples of alkenyloxy groups include the 2-propenyloxy group, the 2-butenyloxy group, and the 5-hexenyloxy group. Examples of alkynyloxy groups include 2-propynyloxy, 2-butynyloxy, and 5-hexynyloxy groups. The term "carbocyric group" refers to both a cyclic aromatic carbon ring group and an alicyclic hydrocarbon group. Examples of aromatic carbocyclic groups include phenyl groups and naphthyl groups. Alicyclic hydrocarbon groups include cycloalkyl groups, cycloalkenyl groups, and the like. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl groups. Examples of cycloalkenyl groups include cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, and cycloheptenyl groups. A heterocyclyl group refers to a cyclic group having one or more heteroatoms as ring constituent atoms, and includes aromatic heterocyclic groups and non-aromatic heterocyclic groups. Examples of heterocyclyl groups include pyrrolyl group, furyl group, thienyl group, pyrazolyl group, imidazolyl group, triazolyl group, tetrazolyl group, oxazolyl group, isoxazolyl group, thiazolyl group, isothiazolyl group, oxadiazolyl group, thiadiazolyl group, pyridyl group, pyridadinyl group, pyrimidinyl group, pyrazinyl group, triazinyl group, tetradinyl group, pyrrolidinyl group, imidazolinyl group, imidazolidinyl group, piperidinyl group, tetrahydropyrimidinyl group, hexahydropyrimidinyl group, piperazinyl group, oxazolidinyl group, isoxazolidinyl group, 1,3-oxazinanyl group, morpholinyl group, thiazolidinyl group, isothiazolidinyl group, 1,3-thiadinyl group, and thiomorpholinyl group. 【0012】 The following describes a method for producing a nucleic acid oligomer represented by formula (4) in which the protecting group of formula (1) is deprotected by contacting the nucleic acid oligomer represented by formula (3) with fluoride ions in the presence of a radical reaction inhibitor. [ka] 【0013】 In formula (1), n is any integer greater than or equal to 0, more preferably an integer between 0 and 3, more preferably an integer between 0 and 2, even more preferably 0 or 1, and particularly preferably 1. 【0014】 At least one of the R, W, and X groups in formula (3) represents a hydroxyl group protected by the protecting group of formula (1). The proportion of formula (1) among R, W, and X may be 1% or more, more preferably 5% or more, more preferably 10% or more, more preferably 20% or more, more preferably 30% or more, more preferably 40% or more, more preferably 50% or more, more preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably 90% or more, and even more preferably 95% or more. Furthermore, the length of the nucleic acid chain to be synthesized (base length, number of polymerization units of nucleic acid, and mass) is preferably 10 chains or more, more preferably 20 chains or more, more preferably 30 chains or more, more preferably 40 chains or more, and even more preferably 50 chains or more. 【0015】 In the deprotection step of the protecting group shown in formula (1), tetraalkylammonium fluoride is typically used as the fluoride ion source. Examples of tetraalkylammonium fluorides include tetrabutylammonium fluoride or tetramethylammonium fluoride. Among these, tetrabutylammonium fluoride (TBAF) is more preferred. The amount of fluoride ions used is typically 1 to 1000 moles per mole of protecting group removed, preferably 1 to 500, more preferably 2 to 200, and more preferably 4 to 100 moles. 【0016】 Examples of radical reaction inhibitors include radical chain initiation inhibitors, radical scavengers, and peroxide decomposers. 【0017】 Examples of radical chain initiation inhibitors include metal deactivators, ultraviolet absorbers, or quenchers. Examples of metal deactivators include amide compounds and hydrazide compounds, specifically n-octanohydrazide, succinate dihydrazide, 2-Hydroxy-N-1H-1,2,4-triazol-3-ylbenzamide, N'1,N'12-Bis(2-hydroxybenzoyl)dodecanedihydrazide, N,N'-Bis[3-(3,5-di-tert-butyl-4-hydroxyphenyl)propionyl]hydrazine, or 1,3,5-Triazine-2,4,6-triamine. Examples of UV absorbers include triazole compounds, triazine compounds, or benzophenone compounds, specifically benzophenone, 2-(2H-Benzotriazol-2-yl)-4,6-bis(1-methyl-1-phenylethyl)phenol, 2-(2H-Benzotriazol-2-yl)-4-(1,1,3,3-tetramethylbutyl)phenol, 2,2'-Methylenebis[6-(2H-benzotriazol-2-yl)-4-(1,1,3,3-tetramethylbutyl)phenol], and 2-(2H-Benzo triazol-2-yl)-p-cresol, 2-(5-chloro-2H-benzotriazol-2-yl)-6-tert-butyl-4-methylphenol, 2-(4,6-Diphenyl-1,3,5-triazin-2-yl)-5-[2-(2-ethylhexano yloxy)ethoxy]phenol, 2,4,6-tris(2-hydroxy-4-hexyloxy-3-methylphenyl)-1,3,5-triazine, or [2-hydroxy-4-(octyloxy)phenyl](phenyl)methane. Examples of quenchers include organonickel compounds. Specifically, these include bis(1,2-bis(2-methoxyphenyl)-1,2-ethylenedithiolat)nickel complexes, Raney nickel, tetracarbonickel, and NiX2(PR3) [wherein X represents a halogen atom and PR3 represents a phosphine ligand (e.g., a tertiary phosphine such as triphenylphosphine)]. 【0018】 Examples of radical scavengers include phenolic antioxidants or hindered amine light stabilizers (HALS). 【0019】 Examples of phenolic antioxidants include hindered phenol compounds, semi-hindered phenol compounds, or less-hindered phenol compounds. 【0020】 Examples of phenolic antioxidants include the following compounds, but any compound commonly used as a phenolic antioxidant can be used in this embodiment. 【0021】 The compound represented by the following formula (8). [ka] 【0022】 In equation (8), R 12 Compounds in which the atom is a hydrogen atom can also be represented by the following formula (8a). [ka] 【0023】 In equation (8), R 11 Compounds in which the atom is a hydrogen atom can also be represented by the following formula (8b). [ka] 【0024】 In equations (8), (8a), and (8b), R 10 Preferably, R is a tert-butyl group, a sec-butyl group, or a methyl group. 11 and R 12 R is the same or different, preferably a tert-butyl group, a sec-butyl group, a methyl group, or a hydrogen atom. 13 Preferably, this is a tert-butyl group, a sec-butyl group, a methyl group, a hydroxyl group, or a hydrogen atom. 【0025】 The compound represented by the following formula (13a). [ka] (In the formula, R 10 , R 11 , R 12 The definition of is the same as the definition in equation (8), and R 10‘ , R 11’ , R 12‘ , R 21 , R 22 , and R 23 The same or different chain hydrocarbon group, carbocykyl group, heterocyclyl group, alkoxy group, alkylsulfanyl group {the chain hydrocarbon group, the carbocykyl group, the heterocyclyl group, the alkoxy group, and the alkylsulfanyl group may have one or more substituents}, SiR 51 R 52 R 53 amide group, C(O)R 61 ,OC(O)R 61 R represents a hydroxyl group or a hydrogen atom. 24 R represents an oxygen atom, a sulfur atom, S(O), or S(O)2, 25 n represents an oxygen atom or a sulfur atom. 1 , n 2 , n 3 , and n 4 Each represents any 0 or positive integer, and the (CR in [] represents any 0 or positive integer. 21 R 22 ) n1 , (NR 23 ) n2 , (R 24 ) n3, and (C=R 25 ) n4 The order is arbitrary, and when there are multiple of each, they do not have to be consecutive.) 【0026】 A compound represented by the following formula (13b). 【Chemical formula】 (In the formula, the definitions of the symbols are the same as those in formula (13a).) 【0027】 A compound represented by the following formula (13c). 【Chemical formula】 (In the formula, R 10 , R 11 , R 12 , R 10‘ , R 11’ , R 12’ , and n 1 are defined the same as in the above formula (13a), and R 10” , R 11” , R 12” , R 21’ , R 22‘ , R 21” , and R 22” are the same or different and represent a chain hydrocarbon group, a carbocyclic group, a heterocyclic group, an alkoxy group, an alkylsulfanyl group {the chain hydrocarbon group, the carbocyclic group, the heterocyclic group, the alkoxy group, the alkylsulfanyl group may have one or more substituents}, SiR 51 R 52 R 53 , an amide group, C(O)R 61 , OC(O)R 61 , a hydroxyl group, or a hydrogen atom, and n 1’ and n 1” each represent an arbitrary 0 or positive integer.) 【0028】 A compound represented by the following formula (13d). 【Chemical formula】 (In the formula, the definitions of the symbols are the same as those in formula (13c).) 【0029】 A compound represented by the following formula (13e). 【Chemical formula】 (In the formula, R 10 , R 11 , R 12 , R 10‘ , R 11’ , R 12’ , R 10” , R 11” , R 12” , R 21’ , R 22‘ , R 21” , R 22” , n 1 , n 1’ , and n 1” have the same definitions as those in the above formula (13c), and R 10”’ , R 11”’ , R 12”’ , R 21’” , and R 22‘” are the same or different and represent a chain hydrocarbon group, a carbocyclic group, a heterocyclic group, an alkoxy group, an alkylsulfanyl group {the chain hydrocarbon group, the carbocyclic group, the heterocyclic group, the alkoxy group, the alkylsulfanyl group may have one or more substituents}, SiR 51 R 52 R 53 , an amide group, C(O)R 61 , OC(O)R 61 , a hydroxyl group, or a hydrogen atom, and n 1”’ represents an arbitrary 0 or positive integer.) 【0030】 A compound represented by the following formula (13f). 【Chemical formula】 (In the formula, R 10 , R 11 , R 12 , R 10‘ , R 11’ , R 12’ , R 10” , R11” , R 12” , R 21’ , R 22‘ , R 21” , R 22” , n 1 , n 1’ , and n 1” The definition of is the same as the definition in formula (13c) above, and R 21”” , R 22”” , and R 23”” The same or different chain hydrocarbon group, carbocykyl group, heterocyclyl group, alkoxy group, alkylsulfanyl group {the chain hydrocarbon group, the carbocykyl group, the heterocyclyl group, the alkoxy group, and the alkylsulfanyl group may have one or more substituents}, SiR 51 R 52 R 53 amide group, C(O)R 61 ,OC(O)R 61 (This represents a hydroxyl group or a hydrogen atom.) 【0031】 R 10 , R 11 , R 12 , R 13 , R 10‘ , R 11’ , R 12‘ , R 21 , R 22 , R 23 , R 10” , R 11” , R 12” , R 21’ , R 22‘ , R 21” , R 22” , R 10”’ , R 11”’ , R 12”’ , R 21’” , R 22‘” , R 21”” , R 22”” , and R 23”” The substituents that the chain hydrocarbon group, carbocykyl group, heterocyclyl group, alkoxy group, and alkylsulfanyl group may have are, for example, halogen atoms, carbocykyl groups, heterocyclyl groups, hydroxyl groups, amino groups, alkoxy groups, sulfanyl groups, alkylsulfanyl groups, SiR 51 R52 R 53 , O(SiR 51 R 52 R 53 ), C(O)R 61 ,OC(O)R 61 , and P(O)(OR 62 )2 is cited. Here, R 62 This indicates a chain-like hydrocarbon group. 【0032】 Examples of phenolic antioxidants include 2,6-di-tert-butyl-p-cresol, 4-sec-butyl-2,6-di-tert-butylphenol, 6-tert-butyl-2,4-xylenol, 4,6-di-tert-butyl-m-cresol, 1,4-dihydroxybenzene, 2,6-Di-tert-butyl-4-ethylphenol, 4,4'-Dihydroxy-3,3',5,5'-tetraisopropylbiphenyl, 3-(3,5-Di-tert-butyl-4-hydroxyphenyl)-N'-[3-(3,5-di-tert-butyl-4-hydroxyphenyl)propanoyl]propanehydrazide, and Methyl 3-(3,5-Di-tert-butyl-4-hydroxyphenyl)propionate, 2,2'-Methylenebis(6-tert-butyl-4-ethylphenol), 2,2'-Methylenebis[6-(1-methylcyclohexyl)-p-cresol], 1,3,5-Tris( 3,5-di-tert-butyl-4-hydroxybenzyl)-1,3,5-triazinane-2,4,6-trione, 2,5-Bis(1,1,3,3-tetramethylbutyl)hydroquinone, 2,5-Di-tert-butylhydroquinone, 4,4'-Butylideneb is(6-tert-butyl-m-cresol), 4-(Hexyloxy)-2,3,6-trimethylphenol, N,N'-(Hexane-1,6-diyl)bis[3-(3,5-di-tert-butyl-4-hydroxyphenyl)propanamide], 2,2',6,6'-Tetra-ter t-butyl-4,4'-dihydroxybiphenyl, 2,5-Di-tert-amylhydroquinone, 2,4-Bis[(dodecylthio)methyl]-6-methylphenol, 4-[[4,6-Bis(n-octylthio)-1,3,5-triazin-2-yl]amino]-2,6-di-tert-butylphenol、Galvinoxyl Free Radical、Pentaerythritol Tetrakis[3-(3,5-di-tert-butyl-4-hydroxyphenyl)propionate]、Hexadecyl 3,5-Di-tert-butyl-4-hydroxybenzoate、4,4'-Thiobis(6-tert-butyl-m-cresol)、3,3',5,5'-Tetra-tert-butyl-4,4'-stilbenequinone、2,4,6-Tris(3',5'-di-tert-butyl-4'-hydroxybenzyl)mesitylene、2,6-Di-tert-butyl-4-methoxyphenol、2,2'-Methylenebis(6-cyclohexyl-p-cresol)、[Oxalylbis(azanediyl)]bis(ethane-2,1-diyl) Bis[3-(3,5-di-tert-butyl-4-hydroxyphenyl)propanoate]、3,6-Dihydroxybenzonorbornane、2-Methyl-4,6-bis[(n-octylthio)methyl]phenol、2,6-Di-tert-butylphenol、2,4,8,10-Tetraoxaspiro[5.5]undecane-3,9-diylbis(2-methylpropane-2,1-diyl) Bis[3-[3-(tert-butyl)-4-hydroxy-5-methylphenyl]propanoate]、Diethyl 3,5-Di-tert-butyl-4-hydroxybenzylphosphonate、2,4,6-Tris(2,4-dihydroxyphenyl)-1,3,5-triazine、2-tert-Butyl-6-(3-tert-butyl-2-hydroxy-5-methylbenzyl)-4-methylphenyl Acrylate、Triethylene Glycol Bis[3-(3-tert-butyl-4-hydroxy-5-methylphenyl)propionate]、3-(3,5-Di-tert-butyl-4-hydroxyphenyl)propionic acid, Stearyl 3-(3,5-Di-tert-butyl-4-hydroxyphenyl)propionate, 4,6-Di-tert-butylresorcinol, 1,3,5-tris(3,5-di-tert-butyl-4-hydroxybenzyl)-1,3,5-triazine-2,4 ,6(1H,3H,5H)-trione, 4,4',4''-(1-methylpropanyl-3-ylidene)tris(6-tert-butyl-m-cresol), 6,6'-di-tert-butyl-4,4'-butylidenedi-m-cresol, Octadecyl 3-(3,5-di-tert-butyl-4-hydroxyphenyl)propionate, Pentaerythritol tetrakis[3-(3,5-di-tert-butyl-4-hydroxyphenyl)propionate], 3,9-Bis{2-[3-(3-tert-butyl-4-hydroxy-5-methylphenyl)propionyloxy]-1,1-dim ethylethyl}-2,4,8,10-tetraoxaspiro[5.5]undecane, or 1,3,5-tris(3,5-di-tert-butyl-4-hydroxyphenylmethyl)-2,4,6-trimethylbenzene. , 【0033】 Examples of hindered amine light stabilizers (HALS) include the following compounds, but any compound commonly used as a phenolic antioxidant can be used in this embodiment. 【0034】 The compound represented by the following formula (12). [ka] In equation (12), R 15 , R 16 , R 17 , and R 18 The group is preferably a methyl group. 【0035】 In equation (12), R 15 , R 16 , R 17 , and R 18 Compounds in which the group is a methyl group can also be represented by the following formula (12A). [ka] 【0036】 The compound represented by the following formula (12a). [ka] (In the formula, R 15 , R 16 , R 17 , R 18 , and R 19 The definition of is the same as the definition in equation (12) above, and R 19‘ R represents an alkyl group, alkoxy group, oxygen free radical, hydroxyl group, or hydrogen atom. 15’ , R 16‘ , R 17’ , R 18‘ , R 26 , R 27 , R 28 , and R 29 n represents an alkyl group or a hydrogen atom, either identical or distinct. 5 (This represents any 0 or positive integer.) 【0037】 The compound represented by the following formula (12b). [ka] (In the formula, the definitions of the symbols are the same as those in formula (12a) above.) 【0038】 The compound represented by the following formula (12c). [ka] (In the formula, R 15 , R 16 , R 17 , R18 , R 19 , R 15’ , R 16‘ , R 17’ , R 18‘ , R 19‘ , R 28 , and R 29 The definition of is the same as the definition in formula (12a) above, and R 30 , R 31 , R 32 , and R 33 (These represent an alkyl group or a hydrogen atom, either identical or distinct.) 【0039】 R 20 The substituents that the chain hydrocarbon group, carbocykyl group, heterocyclyl group, alkoxy group, and alkylsulfanyl group may have are, for example, halogen atoms, carbocykyl groups, heterocyclyl groups, hydroxyl groups, amino groups, alkoxy groups, sulfanyl groups, alkylsulfanyl groups, SiR 54 R 55 R 56 , O(SiR 51 R 52 R 53 ), C(O)R 63 ,OC(O)R 63 , and P(O)(OR 64 )2 is cited. Here, R 63 R represents a chain-like hydrocarbon group. 62 This indicates a chain-like hydrocarbon group. R 15 , R 16 , R 17 , R 18 , R 19 , R 15’ , R 16‘ , R 17’ , R 18‘ , R 26 , R 27 , R 28 , and R 29 The alkyl group in this may have substituents (e.g., alkyl groups, hydroxyl groups) or substituents such as phenyl groups. 【0040】 Hindered amine light stabilizers (HALS) include, specifically, bis(2,2,6,6-tetramethyl-4-piperidyl) sebacate, 2,2,6,6-tetramethyl-4-piperidyl methacrylate, or 2,2,6,6-tetramethylpiperidine 1-oxyl-free radical (TEMPO free radical), N,N'-Bis(2,2,6,6-tetramethylpiperidin-4-yl)hexane-1,6-diamine, 2,2,6,6-tetramethylpiperidine 1-oxyl, Bis(2,2,6,6-tetramethyl-4-piperidyl-1-oxyl) Sebacate, Bis(1,2,2,6,6-pentamethyl-4-piperidyl) Sebacate, and Bis(2,2,6,6-tetramethyl-4-piperidyl) Sebacate, 1,2,2,6,6-Pentamethyl-4-piperidyl Methacrylate, N 1 ,N 3-Bis(2,2,6,6-tetramethylpiperidin-4-yl)isophthalamide、Bis(1,2,2,6,6-pentamethyl-4-piperidyl) Butyl(3,5-di-tert-butyl-4-hydroxybenzyl)malonate、2,2,6,6-Tetramethyl-4-piperidyl Methacrylate、Tetrakis(1,2,2,6,6-pentamethyl-4-piperidyl) butane-1,2,3,4-tetracarboxylate、Tetrakis(2,2,6,6-tetramethyl-4-piperidyl) butane-1,2,3,4-tetracarboxylate、1,2,3,4-Butanetetracarboxylic acid, tetramethyl ester, reaction products with 1,2,2,6,6-pentamethyl-4-piperidinol and β,β,β',β'-tetramethyl-2,4,8,10-tetraoxaspiro[5.5]undecane-3,9-diethanol、1,2,3,4-Butanetetracarboxylic acid, tetramethyl ester, reaction products with 2,2,6,6-tetramethyl-4-piperidinol and β,β,β',β'-tetramethyl-2,4,8,10-tetraoxaspiro[5.5]undecane-3,9-diethanol, Bis(1,2,2,6,6-pentamethyl-4-piperidyl) sebacate, Bis(2,2,6,6-tetramethyl-4-piperidyl) sebacate, Bis(1-undecanoxy-2,2,6,6-tetramethylpiperidin-4-yl)carbonate, 1,2,2,6,6-Pentamethyl-4-piperidyl methacrylate, 2,2,6,6-Tetramethyl-4-piperidyl methacrylate, reaction mass of: 2,2,6,6-tetramethylpiperidin-4-yl hexadecanoate 2,2,6,6-tetramethylpiperidin-4-yl octadecanoate, or 2,2,6,6-tetramethylpiperidin-4-yl hexadecanoate 2,2,6,6-tetramethylpiperidin-4-yl octadecanoate, etc. can be mentioned. 【0041】 Examples of peroxide decomposing agents include phosphorus-based antioxidants or sulfur-based antioxidants. Examples of phosphorus-based antioxidants include phosphine compounds or phosphite compounds, specifically triphenylphosphine, triphenyl phosphite, 3,9-Bis(octadecyloxy)-2,4,8,10-tetraoxa-3,9-diphosphaspiro[5.5]undecane, 3,9-Bis(2,6-di-tert-butyl-4-methylphenoxy)-2,4,8,10-tetraoxa-3,9-diphosphaspiro[5.5]undecane, 2,2'-Methylenebis(4,6-di-tert-butylphenyl) 2-ethylhexyl phosphite, Tris(2,4-ditert-butylphenyl) phosphite, Tris(nonylphenyl) phosphite, and Tetra-C12-15-alkyl (propane-2,2-diylbis(4,1-phenylene)). Examples include bis(phosphite), 2-Ethylhexyl diphenyl phosphite, Isodecyl diphenyl phosphite, or Triisodecyl phosphite. Examples of sulfur-based antioxidants include sulfide compounds, specifically dioctadecyl sulfide, 2,2-Bis{[3-(dodecylthio)-1-oxopropoxy]methyl}propane-1,3-diyl bis[3-(dodecylthio)propionate], or Di(tridecyl) 3,3'-thiodipropionate. 【0042】 The amount of radical reaction inhibitor used is typically 10 moles or less, 9 moles or less, 8 moles or less, 6 moles or less, 5 moles or less, 4 moles or less, 3 moles or less, 2 moles or less, 1.5 moles or less, 1.3 moles or less, or 1.1 moles or less per mole, and 0.001 moles or more, 0.01 moles or more, 0.05 moles or more, or 0.1 moles or more. , or 0.5 moles or more, preferably 0.01 to 10 moles, 0.01 to 8 moles, 0.05 to 8 moles, 0.05 to 5 moles, 0.1 to 5 moles, 0.1 to 4 moles, 0.1 to 3 moles, 0.1 to 2 moles, 0.1 to 1.5 moles, 0.1 to 1.3 moles, 0.1 to 1.1 moles, 0.5 to 5 moles, 0.5 to 4 moles, 0.5 to 3 moles, 0.5 to 2 moles, 0.5 to 1.5 moles, 0.5 to 1.3 moles, 0.5 to 1.2 moles, or 0.5 to 1.1 moles. When the radical reaction inhibitor is a hindered amine-based light stabilizer, the amount used is preferably 5 moles or less, 4 moles or less, 3 moles or less, 2 moles or less, 1.5 moles or less, 1.3 moles or less, or 1.1 moles or less per mole, with 0.001 moles or more, 0.01 moles or more, and 0.00 The amount is 5 moles or more, 0.1 moles or more, or 0.5 moles or more, preferably 0.01 to 5 moles, 0.1 to 5 moles, 0.1 to 4 moles, 0.1 to 3 moles, 0.1 to 2 moles, 0.1 to 1.5 moles, 0.1 to 1.3 moles, 0.1 to 1.1 moles, 0.5 to 5 moles, 0.5 to 4 moles, 0.5 to 3 moles, 0.5 to 2 moles, 0.5 to 1.5 moles, 0.5 to 1.3 moles, 0.5 to 1.2 moles, or 0.5 to 1.1 moles. 【0043】 In this process, an organic solvent that is inert to the reaction is usually used. Specifically, examples include sulfoxide solvents, nitrile solvents, ether solvents, amide solvents, ketone solvents, aliphatic hydrocarbon solvents, ester solvents, aromatic solvents, or mixtures of two or more of these. Of these solvents, sulfoxide solvents are preferred. Examples of sulfoxide solvents include dimethyl sulfoxide. Examples of nitrile solvents include acetonitrile or propionitrile. Examples of ether solvents include tetrahydrofuran. Examples of amide solvents include N-methyl-2-pyrrolidone. Examples of ketone solvents include acetone or methyl ethyl ketone. Examples of aliphatic hydrocarbon solvents include hexane or heptane. Examples of ester solvents include methyl acetate or ethyl acetate. Examples of aromatic solvents include toluene or pyridine. Among these, dimethyl sulfoxide or a mixture of dimethyl sulfoxide and acetonitrile is preferred. 【0044】 The fluoride ion source, which is a reagent used in the deprotection step of the protecting group shown in formula (1), is usually dehydrated after being dissolved in a solvent. Examples of dehydrating agents include molecular sieves or sulfates, and molecular sieve 4A is preferably used. 【0045】 The amount of solvent used is typically 5 to 8,000 L, preferably 50 to 2,000 L, and more preferably 100 to 1,600 L per mole of nucleic acid oligomer subjected to the deprotection step. 【0046】 If necessary, a compound that reacts with the compound shown in formula (2) below, which is a by-product of this process, to capture the compound may be added. Examples of such capturing compounds include nitroalkanes, alkylamines, amidines, thiols, thiol derivatives, or mixtures of two or more of these. An example of a "nitroalkane" is nitromethane. Examples of "alkylamines" include linear alkylamines having 1 to 6 carbon atoms and cyclic amines having 1 to 8 carbon atoms. Specifically, examples include methylamine, ethylamine, n-propylamine, n-butylamine, n-pentylamine, n-hexylamine, morpholine, or piperidine. Examples of "amidines" include benzamidine or formamidine. An example of a "thiol" is linear thiol having 1 to 6 carbon atoms. Specifically, examples include methanethiol, ethanethiol, 1-propanethiol, 1-butanethiol, 1-pentanethiol, or 1-hexanethiol. Examples of "thiol derivatives" include alcohols or ethers having the same or different linear alkylthiol groups having 1 to 6 carbon atoms. Specifically, examples include 2-mercaptoethanol, 4-mercapto-1-butanol, 6-mercapto-1-hexanol, mercaptomethyl ether, 2-mercaptoethyl ether, 3-mercaptopropyl ether, 4-mercaptobutyl ether, 5-mercaptopentyl ether, or 6-mercaptohexyl ether. Nitromethane is more preferably used. 【0047】 Formula (2): [ka] 【0048】 The amount of the compound used to capture the by-product compound shown in formula (2) can be 0.1 to 100.0 mol%, preferably 1.0 to 50.0 mol%, and more preferably 2.0 to 40.0 mol%, relative to the fluoride ion source that deprotects the hydroxyl group protecting group shown in formula (1). 【0049】 The reaction between the nucleic acid oligomer represented by formula (3) and fluoride ions can be carried out by adding the fluoride ions to the nucleic acid oligomer represented by formula (3), or conversely, by adding the nucleic acid oligomer represented by formula (3) to the fluoride ions, or by adding both simultaneously. The method of adding the fluoride ions to the nucleic acid oligomer represented by formula (3) is preferred. The time required to add the entire amount of fluoride ions to the nucleic acid oligomer represented by formula (3) is preferably 5 minutes or more, more preferably 10 minutes or more, more preferably 15 minutes or more, more preferably 30 minutes or more, and even more preferably 1 hour or more, by dropwise addition. Such addition is preferably carried out by dropping it onto the surface or into the solution containing the nucleic acid oligomer represented by formula (3) over a period of 5 minutes or more, more preferably over 10 minutes or more, more preferably over 15 minutes or more, more preferably over 30 minutes or more, and even more preferably over 1 hour or more. It is preferable that the radical reaction inhibitor be present in the reaction system before the addition of fluoride ions. 【0050】 When fluoride ions are added to the nucleic acid oligomer represented by formula (3), the temperature of both or one of the solutions may be 80°C or lower, preferably both are 40°C or lower, preferably both are 35°C or lower, more preferably both are 30°C or lower, more preferably both are 25°C or lower, more preferably both are 20°C or lower, more preferably both are 15°C or lower, more preferably both are 10°C or lower, and even more preferably both are 5°C or lower. After the addition of fluoride ions to the nucleic acid oligomer represented by formula (3) is completed, the mixture may be kept warm for 1 minute or more, preferably 5 minutes or more, more preferably 10 minutes or more, more preferably 15 minutes or more, more preferably 30 minutes or more, and even more preferably 1 hour or more. Furthermore, after maintaining the temperature, the temperature may be raised, preferably to 5°C or more and 80°C or less, preferably to 10°C or more and 40°C or less, preferably to 10°C or more and 35°C or less, preferably to 15°C or more and 35°C or less, more preferably to 20°C or more and 35°C or less, and even more preferably to 25°C or more and 35°C or less. After further heating, the time required for the deprotection reaction varies depending on the type of deprotecting agent used and the reaction temperature, but is typically 1 to 100 hours, preferably 1 to 24 hours, more preferably 2 to 12 hours, and even more preferably 3 to 6 hours. Furthermore, fluoride ions may be added at any time. 【0051】 While stirring the reaction system is not essential during the deprotection reaction of a protecting group, a stirring power Pv of 0.0-0.5 kW / m is typically used. 3 Stirring is performed within the range, and Pv is 0.1~0.3kW / m 3 Stirring is preferred. 【0052】 Conventional methods are employed to separate and purify the nucleic acid oligomers produced by the reaction from the reaction mixture. For example, by means of extraction, concentration, neutralization, filtration, centrifugation, recrystallization, silica gel column chromatography, thin-layer chromatography, reverse-phase column chromatography, ion-exchange column chromatography, gel filtration column chromatography, hydrophobic interaction chromatography, hydrophilic interaction liquid chromatography, affinity chromatography, precipitation (e.g., precipitation of nucleic acid oligomers using ethanol, isopropanol, methanol, or polyethylene glycol), dialysis, or ultrafiltration, the purified nucleic acid oligomers can be isolated. The isolated nucleic acid oligomers are usually obtained as nucleic acid oligomers with their 5'-terminus hydroxyl group protected. 【0053】 The reaction to obtain the nucleic acid oligomer shown in formula (4) by deprotecting the protecting group shown in formula (1) from the nucleic acid oligomer shown in formula (3) is as follows (Scheme 1). [ka] Here, G in the equation 4 This represents a protecting group for a hydrogen atom or a hydroxyl group. G 9 This represents an ammonium ion, alkylammonium ion, alkali metal ion, hydrogen ion, or hydroxyalkylammonium ion. B c Each of these independently represents the same or distinct nucleic acid base. Each R independently represents either the same or different hydrogen atom, fluorine atom, or OQ group. Q is independently the same or distinct tert-butyldimethylsilyl group, methyl group, 2-methoxyethyl group, methylene group bonded to the 4' carbon atom of ribose, ethylene group bonded to the 4' carbon atom of ribose, ethylidene group bonded to the 4' carbon atom of ribose, or the following formula (1): [ka] (In the formula, Bonds marked with an asterisk (*) indicate a bond with the oxygen atom of the OQ group. n represents any integer greater than or equal to 0. It represents the protecting group, Y represents either an oxygen atom or a sulfur atom, independently and either identically or distinctly. m represents any integer between 2 and 200, W and X are defined by either (a) or (b) below: (a) When W is a hydroxyl group, X has the same definition as the R group described above. (b) When X is a hydroxyl group, W represents an OV group, V represents a tert-butyldimethylsilyl group or the group of formula (1) above. However, at least one of the groups R, W, and X represents a hydroxyl group protected by the protecting group of formula (1). When m is an integer greater than or equal to 3, the nucleic acid oligomer represented by equation (3) is a nucleic acid oligomer in which non-nucleotide linkers may be incorporated instead of p nucleotides between the 5' and 3' terminal nucleotides (where p is a positive integer satisfying equation: m-1 > p). 【0054】 In formula (3) or formula (4), when R represents an OQ group and R' represents an OQ' group, the structure of ribose is shown by the following formulas (LNA-1), (LNA-2), or (LNA-3). [ka] [ka] [ka] (In the formula, Base represents a nucleic acid base.) 【0055】 Examples of nucleosides (ribose and deoxyribose) contained in the nucleic acid oligomer used in this embodiment include DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA, or the aforementioned LNA, but the nucleosides are not limited to these. 【0056】 The nucleic acid oligomer represented by formula (3) can be obtained, for example, by cleaving a nucleic acid oligomer produced by solid-phase synthesis shown in formula (5) from a solid-phase support, as shown in scheme 2 below. [ka] 【0057】 This section describes the nucleic acid oligomer of formula (5) synthesized on a solid support. Substituent B aEach of these independently represents an identical or distinct, potentially protected nucleic acid base. G 4 And Y are as defined in equation (3) above, G 2 Each of these independently represents the same or different protecting groups of phosphoric acid. When X1 represents OZ, W1 represents an OV group. V represents a tert-butyldimethylsilyl group or the group of formula (1) above. When X1 represents an R group, W1 represents a group represented by OZ. Z represents a group consisting of a solid support and a linking portion that connects the solid support to the oxygen atom of the hydroxyl group at the 2' or 3' position of the ribose at the 3' end of the nucleic acid oligomer. 【0058】 More specifically, Z represents the structure schematically shown in equation (6) below. -[Sp]-[Linker]-[Solid Support] ··· (6) Here, in equation (6), Sp represents a spacer. An example of a spacer (Sp) is one having the structural formula shown in equation (7) below. 【0059】 [ka] 【0060】 A Linker represents a structure that forms a linker (joint structure). The structure of the Linker may be, for example, the structure shown in the following equations (8-1), (8-2), (8-3), (8-4), (8-5), (8-6), (8-7), or (8-8). A solid support refers to a structure that serves as a solid carrier. Examples of solid supports include inorganic porous carriers and organic resin carriers. Examples of inorganic porous carriers include controlled pore glass (CPG) and zeolites. Examples of organic resin carriers include carriers made of polystyrene. 【0061】 [ka] [ka] [ka] 【0062】 [ka] [ka] [ka] [ka] [ka] (In the formula, A may independently be a hydroxyl group, an alkoxy group, or an alkyl group. Examples of alkoxy groups include methoxy and ethoxy groups. Examples of alkyl groups include methyl, ethyl, isopropyl, and n-propyl groups. Si indicates that it is bonded to the oxygen of the hydroxyl group on the support surface.) 【0063】 G 4 G represents a protecting group for a hydrogen atom or hydroxyl group, and when it represents a protecting group, it is written as G. 1 It represents the same protecting group as G. 4 When deprotected, it is a hydrogen atom, and in that case, the nucleotide compound is also subjected to a series of nucleic acid elongation reactions. 【0064】 G 9This represents ammonium ions, alkylammonium ions, alkali metal ions, hydrogen ions, or hydroxyalkylammonium ions, etc. Specific examples of alkylammonium ions include the alkyl portion, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, dibutyl, isobutyl, tert-butyl, n-pentyl, isopentyl, or hexyl. More specifically, examples include diethylammonium ions, triethylammonium ions, tetrabutylammonium ions, hexylammonium ions, or dibutylammonium ions. Alkali metal ions include, for example, sodium ions or lithium ions. Specific examples of hydroxyalkylammonium ions include the hydroxyalkyl portion, such as hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, or trishydroxymethyl. More specifically, examples of hydroxyalkylammonium ions include trishydroxymethylammonium ions. 【0065】 The compound of formula (5) can be produced, for example, by the amidite method using the amidite compound of formula (A13) shown below. [ka] (In the formula, R represents a hydrogen atom, a fluorine atom, or an OQ group. Q represents a tert-butyldimethylsilyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4' carbon atom, an ethylene group bonded to the 4' carbon atom, an ethylidene group bonded to the 4' carbon atom, or a protecting group represented by formula (1) above. B a This represents a nucleic acid base that may be protected, G 1 This represents a protecting group for hydroxyl groups, G 2 This represents the protecting group of phosphate, G 3(These are alkyl groups, or groups linked at their ends to form a cyclic structure.) 【0066】 B a B c This represents a nucleic acid base represented by or a nucleic acid base protected by a protecting group. B a The nucleic acid bases in this compound are not particularly limited. Examples of such nucleic acid bases include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudracil. Furthermore, the nucleic acid bases may be substituted with substituents. Examples of such substituents include halogen atoms such as fluoro groups, chloro or bromo groups, or iodo groups; acyl groups such as acetyl groups; alkyl groups such as methyl or ethyl groups; aryl alkyl groups such as benzyl groups; alkoxy groups such as methoxy groups; alkoxyalkyl groups such as methoxyethyl groups; cyanoalkyl groups such as cyanoethyl groups; hydroxyl groups; hydroxyalkyl groups; acyloxymethyl groups; amino groups; monoalkylamino groups; dialkylamino groups; carboxyl groups; cyano groups; or nitro groups, as well as combinations of two or more substituents thereof. 【0067】 When a nucleic acid base has an amino group outside the ring, the protecting group for the amino group is not particularly limited, and any protecting group used in known nucleic acid chemistry can be used. Examples of such protecting groups include benzoyl group, 4-methoxybenzoyl group, acetyl group, propionyl group, butyryl group, isobutyryl group, phenylacetyl group, phenoxyacetyl group, 4-tert-butylphenoxyacetyl group, 4-isopropylphenoxyacetyl group, or (dimethylamino)methylene group, as well as combinations of two or more of these protecting groups. 【0068】 B a More specifically, [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] 【0069】 (In the above formula, R 4 This represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group. R 5represents a hydrogen atom, an acetyl group, an isobutyryl group or a benzoyl group, R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group or an isobutyryl group, R 7 represents a 2-cyanoethyl group, R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group or a 4-methylbenzoyl group, R 9 represents a dimethylaminomethylene group.) represents a group represented by any of them. 【0070】 G 1 can be used without particular limitation as long as it can function as a protecting group, and known protecting groups used in amidite compounds can be widely used. 【0071】 G 1 is preferably the following group. 【0072】 【Chemical formula】 (In the formula, R 1 , R 2 and R 3 represent the same or different hydrogen or alkoxy groups.) 【0073】 R 1 , R 2 and R 3 are preferably such that one is hydrogen and the remaining two are the same or different (preferably the same) alkoxy groups, and the alkoxy group is particularly preferably a methoxy group. 【0074】 G 2 can be used without particular limitation as long as it can function as a protecting group, and known protecting groups used in amidite compounds can be widely used. G 2Examples include alkyl groups, alkenyl groups, alkynyl groups, cycloalkyl groups, haloalkyl groups, aryl groups, heteroaryl groups, arylalkyl groups, cycloalkenyl groups, cycloalkylalkyl groups, cyclylalkyl groups, hydroxyalkyl groups, aminoalkyl groups, alkoxyalkyl groups, heterocyclylalkenyl groups, heterocyclylalkyl groups, heteroarylalkyl groups, silyl groups, silyloxyalkyl groups, mono, dialkylsilyl groups, or trialkylsilyl groups, or monoalkylsilyloxyalkyl groups, dialkylsilyloxyalkyl groups, or trialkylsilyloxyalkyl groups, which may be substituted with one or more electron-withdrawing groups. 【0075】 G 2 Preferably, the element is an alkyl group substituted with an electron-withdrawing group. Examples of such electron-withdrawing groups include cyano groups, nitro groups, alkylsulfonyl groups, halogen atoms, arylsulfonyl groups, trihalomethyl groups, or trialkylamino groups, with cyano groups being preferred. 【0076】 G 2 The following groups are particularly preferable: [ka] 【0077】 G 3 , 2 G 3 They may be bonded to each other to form a ring structure. 3 Preferably, both are isopropyl groups. 【0078】 The aforementioned R 1 , R 2 , R 3 and G 2In the definition, the alkyl group may be either linear or branched, preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, or hexyl, etc. The alkyl group part constituting the alkoxy group in the above definition has the same definition as the alkyl group here. 【0079】 <( In this specification, the nucleobase means a group having a natural or non-natural nucleobase skeleton. The nucleobase also includes a modified form in which the natural or non-natural nucleobase skeleton is modified. B C More specifically, the nucleobases represented by B are exemplified by the following structures. [Chemical formula] [Chemical formula] [Chemical formula] [Chemical formula] [Chemical formula] [Chemical formula] [Chemical formula] [Chemical formula] [Chemical formula] [Chemical formula] [Chemical formula] [ka] [ka] [ka] [ka] [ka] 【0080】 (In the above formula, R 4’ This represents a hydrogen atom or a methyl group. R 5’ This represents a hydrogen atom or an acetyl group. R 6’ This represents a hydrogen atom, R 8’ (These represent a hydrogen atom and a methyl group.) 【0081】 We will now describe non-nucleotide linkers that may be introduced in place of the p nucleotides between the 5' and 3' terminal nucleotides of the nucleic acid oligomers of formulas (3) and (4) (where p is a positive integer satisfying formula: m-1 > p). Examples of non-nucleotide linkers include linkers consisting of an amino acid skeleton (for example, linkers consisting of an amino acid skeleton described in Japanese Patent Publication No. 5157168 or Japanese Patent Publication No. 5554881). Specifically, as non-limiting examples, linkers represented by the following formulas (A14-1), (A14-2), or (14-3) (for example, described in Japanese Patent Publication No. 5555346 or Japanese Patent Publication No. 5876890) are also examples. In addition to these linkers, linkers described in International Publication No. 2012 / 005368, International Publication No. 2018 / 182008, or International Publication No. 2019 / 074110 are also examples. 【0082】 [ka] [ka] [ka] 【0083】 Nucleotides and amidites in which the R group in formula (3) and the R' group in formula (4) are substituents other than hydroxyl groups can also be produced from nucleosides synthesized by known methods described in Japanese Patent No. 3745226, International Publication No. 2001 / 053528, or Japanese Patent Application Publication No. 2014-221817 and known methods cited herein. Furthermore, commercially available products can be produced in accordance with the methods described in the examples below, or by appropriately modifying these methods. 【0084】 Excavation of nucleic acid oligomers (hereinafter also referred to as oligonucleotides) from solid support The cleavage process was carried out using concentrated ammonia water as the cleavage agent for nucleic acid oligomers of the desired chain length. 【0085】 In the phosphoramidite method, the nucleic acid extension reaction is carried out by repeatedly performing the deprotection step, condensation step, and oxidation step according to a generally known method (for example, the method described in the aforementioned Japanese Patent Publication No. 5157168 or Japanese Patent Publication No. 5554881). 【0086】 (Nucleic acid elongation reaction) In this specification, "nucleic acid elongation reaction" refers to a reaction in which an oligonucleotide is elongated by sequentially linking nucleotides via phosphodiester bonds. The nucleic acid elongation reaction can be carried out according to the procedure of a general phosphoramidite method. The nucleic acid elongation reaction may also be carried out using an automated nucleic acid synthesizer employing the phosphoramidite method. 【0087】 The chain length of the nucleic acid oligomer may be, for example, 2-200 mers, 10-150 mers, or 15-110 mers. 【0088】 The 5' deprotection step is a process of deprotecting the 5' hydroxyl group at the end of an RNA chain supported on a solid phase carrier. Common protecting groups include the 4,4'-dimethoxytrityl group (DMTr group), the 4-monomethoxytrityl group, and the 4,4',4”-trimethoxytrityl group. Deprotection can be carried out using an acid. Examples of acids used for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, or p-toluenesulfonic acid. 【0089】 The condensation step is a reaction in which a nucleoside phosphoramidite represented by formula (A13) is attached to the 5' hydroxyl group at the end of the oligonucleotide chain, which has been deprotected in the deprotection step. The phosphoramidite used for nucleic acid elongation is an amidite compound represented by formula (A13) or (A12). Other usable phosphoramidites include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl group, 2'-O-methoxyethyl group, 2'-H, 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl, etc. The nucleoside phosphoramidite used is one in which the 5' hydroxyl group is protected by a protecting group (e.g., DMTr group). The condensation step can be carried out using an activator that activates the nucleoside phosphoramidite. Examples of activators include 5-(benzylthio)-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-(ethylthio)-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), or 1-hydroxybenzotriazole (HOBT) or 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole. 【0090】 After the condensation step, unreacted 5'-hydroxyl groups may be capped as appropriate. Capping can be carried out using known capping solutions such as acetic anhydride-tetrahydrofuran solution or phenoxyacetic anhydride / N-methylimidazole solution. 【0091】 The oxidation step is a step in which the phosphite group formed in the condensation step is converted into a phosphate group or a thiophosphate group. This step is a reaction that converts trivalent phosphorus to pentavalent phosphorus using an oxidizing agent, and can be carried out by reacting an oxidizing agent with an oligonucleotide derivative supported on a solid support. When converting phosphite groups to phosphate groups, the "oxidizing agent" can be, for example, iodine, or peracids such as tert-butyl hydroperoxide or hydrogen peroxide, or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO), or a mixture of two or more of these. The oxidizing agent can be used after being diluted with a suitable solvent to a concentration of 0.005 to 2 M. The solvent used in the reaction is not particularly limited as long as it does not participate in the reaction, but examples include pyridine, THF, water, acetonitrile, or any mixture of two or more of these. For example, iodine / water / pyridine / acetonitrile, or iodine / water / pyridine, or iodine / water / pyridine / acetonitrile / NMI, or iodine / water / pyridine / THF, or iodine / water / pyridine / THF / NMI, or CSO / acetonitrile, or iodine / pyridine-acetic acid or peracids (tert-butyl hydroperoxide / methylene chloride). 【0092】 When converting phosphite triester groups to thiophosphate groups, for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazoline-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazoline-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), or phenylacetyl disulfide (PADS) can be used as the "oxidizing agent." The oxidizing agent can be diluted with a suitable solvent to a concentration of 0.01 to 2 M. The solvent used in the reaction is not particularly limited as long as it does not participate in the reaction, but examples include dichloromethane, acetonitrile, pyridine, or any mixture thereof. The oxidation step may be performed after the capping operation, or conversely, after the oxidation step; the order is not limited. 【0093】 The step of deprotecting the phosphate protecting group involves treating the nucleic acid having the desired sequence with an amine after the synthesis is complete to deprotect the phosphate moiety. Examples of amines include diethylamine, as described in Japanese Patent Publication No. 4705716. 【0094】 The protecting group of the 5' hydroxyl group of the nucleoside introduced at the end of the extension process may be used for column purification tagging the 5' protecting group after cleavage from the solid support and deprotection of the protecting group as described later, and the protecting group of the 5' hydroxyl group may be deprotected after column purification. 【0095】 Furthermore, oligonucleotide chains are cleaved and recovered from the solid support using ammonia water or amines, for example, as shown in Scheme 2 above. Examples of amines include methylamine, ethylamine, propylamine, isopropylamine, ethylenediamine, or diethylamine. 【0096】 Nucleic acid oligomers that can be produced using the manufacturing method of this embodiment include, but are not limited to, nucleic acid oligomers in which the nucleoside contained within the nucleic acid oligomer is RNA, DNA, and RNA or LNA having 2'-O-MOE, 2'-O-Me, or 2'-F. For example, various examples of nucleosides can be found in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, or in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558. 【0097】 Typical examples of nucleic acid oligomers that can be used in the manufacturing method of this embodiment are shown below, in addition to the examples described in the examples, but are not limited to these. In the following sequence descriptions, U represents uridine, C represents cytidine, A represents adenosine, and G represents guanosine. 【0098】 Nucleic acid oligomers having the following sequences (B) and (C), as described in International Publication No. 2019 / 060442, are listed below. Sequence (B): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3'(Antisense)(Sequence ID 3) 21mer Array (C): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3'(Sense)(Sequence ID 4) 21mer In sequences (B) and (C), Um represents 2'-O-methyluridine, Cm represents 2'-O-methylcytidine, and dT represents thymidine. 【0099】 Nucleic acid oligomers described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553) are examples. A typical example is a nucleic acid oligomer having the following sequence (D). Sequence (D): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (Sequence ID 5) 36mer 【0100】 Examples include nucleic acid oligomers described in Japanese Patent Publication No. 4965745. A typical example is a nucleic acid oligomer having the following sequence (E). Sequence (E): 5'-CCAUGAGAAGUAUGACAACAGCC-P-GGCUGUUGUCAUACUUCUCAUGGUU-3' 49mer. This sequence consists of CCAUGAGAAGUAUGACAACAGCC (sequence number 6) and GGCUGUUGUCAUACUUCUCAUGGUU (sequence number 7). In array (E), "P" is represented by the substructure separated by a wavy line in the following equation (A5). 【0101】 Nucleic acid oligomers having the following sequence (F), as described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547, are listed below. Sequence (F): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (Sequence ID 8) 67mer 【0102】 The following nucleic acid oligomers having the sequence (G) are listed on page 173 of JP 2015-523856. Sequence (G): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3'(Sequence ID 9) 94mer 【0103】 Nucleic acid oligomers described in JP 2017-537626 are examples. Typical examples include nucleic acid oligomers having the following sequences (H), (J), (K), and (L). Sequence (H): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (Sequence ID 10) 100mer Sequence (J): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (Sequence ID 11) 113mer Array (K): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU -3'(Sequence ID 12) 113mer In sequence (K), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine. Sequence (L): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsUmsU-3'(Sequence ID 13) 113mer In sequence (L), Um represents 2'-O-methyluridine, Am represents 2'-O-methyladenosine, and Gm represents 2'-O-methylguanosine, or phosphorothioate modification. [Examples] 【0104】 The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples. 【0105】 (Measurement method) The measurement methods used in the following tests are shown below. 【0106】 (Measurement method 1: Method for measuring the purity of oligonucleotides) The purity of the crude oligonucleotide product after solid-phase synthesis was measured by HPLC. The crude product was separated into its components by HPLC (wavelength: 260 nm, column: ACQUITY UPLC Oligonucleotide BEH C18, 2.1 mm × 100 mm, 1.7 μm (Waters)), and the purity of the oligonucleotide was calculated from the area value of the main product in the total area value of the resulting chromatogram. 【0107】 The HPLC measurement conditions are shown in Table 1 below. [Table 1] 【0108】 (Measurement method 2: Measurement of oligonucleotide yield) OD of the crude product 260 OD was measured. 260This represents the absorbance at UV260nm per 10mm optical path length in a 1mL solution (pH=7.5). Generally, it is known that 1OD = 40μg for RNA, so the above OD 260 Based on the measured values, the yield was calculated. Furthermore, the yield per unit volume of the solid support was calculated. For Examples 1 to 21, the relative yield to the yield of Comparative Example 1 was determined. For Examples 22 to 33, the relative yield to the yield of Comparative Example 2 was determined. 【0109】 (Solid-phase synthesis of oligonucleotides) Sequence (I):5'-AGCAGAGUACACACAGCAUAUACC-P-GGUAUAUGCUGUGUGUACUCUGCUUC-PG-3' 53mer In the above sequence (I), "A" is represented by the substructure separated by the wavy line in the following formula (A1). "C" is represented by the substructure separated by the wavy line in the following formula (A2). "G" is represented by the substructure separated by the wavy line in the following formula (A3). U is represented by the substructure separated by the wavy line in the following formula (A4). "P" is represented by the substructure separated by the wavy line in the following formula (A5). Note that the "A" at the 5' end is represented by the substructure separated by the wavy line in the following formula (A6). Also, the "G" at the 3' end is represented by the substructure separated by the wavy line in the following formula (A7). However, the phosphate group in the structural formula may be a salt. In other words, sequence (I) consists of AGCAGAGUAC ACACAGCAUA UACC (sequence number 1) and GGUAUAUGCU GUGUGUACUC UGCUUC (sequence number 2), which are joined by the aforementioned "P". 【0110】 [ka] 【0111】 [ka] 【0112】 [ka] 【0113】 [ka] 【0114】 [ka] 【0115】 [ka] 【0116】 [ka] 【0117】 Using controlled pore glass (CPG) as the solid phase support and an AKTA oligopilot plus100 (GE Healthcare) as the nucleic acid synthesizer, oligonucleotides consisting of the above sequence (I) were synthesized from the 3' end to the 5' end by phosphoramidite solid-phase synthesis. The synthesis was carried out on a 77.89 μmol scale. In addition, the following compounds were used in the synthesis: uridine EMM amidite (A11) described in Example 2 of International Publication No. 2013 / 027843, cytidine EMM amidite (A9) described in Example 3, adenosine EMM amidite (A8) described in Example 4, guanosine EMM amidite (A10) described in Example 5, and compound (A12) described in International Publication No. 2017 / 188042, and N described in Example 9 of Japanese Patent No. 5157168. 6 -Acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-(2-cyanoethoxymethyl)adenosine 3'-O-(2-cyanoethyl N,N-diisopropyl phosphoramidite (A15), as described in Example 8 2-Acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-(2-cyanoethoxymethyl)guanosine 3'-O-(2-cyanoethyl N,N-diisopropylphosphoramidite) (A17), N as described in Example 5 4 -Acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-(2-cyanoethoxymethyl)cytidine 3'-O-(2-cyanoethyl N,N-diisopropylphosphoramidite) (A16) and 5'-O-(4,4'-dimethoxytrityl)-2'-O-(2-cyanoethoxymethyl)uridine 3'-O-(2-cyanoethyl N,N-diisopropylphosphoramidite) (A18) described in Example 2 were used. Dichloroacetic acid toluene solution was used as the deblocking solution, 5-(benzylthio)-1H-tetrazole was used as the condensing agent, iodine solution was used as the oxidizing agent, and phenoxyacetic anhydride solution and N-methylimidazole solution were used as the capping solutions. After nucleic acid extension was complete, the cyanoethyl protecting group of the phosphate moiety was selectively deprotected by treating the nucleic acid on the support with diethylamine solution. 【0118】 [ka] 【0119】 [ka] 【0120】 [ka] 【0121】 [ka] 【0122】 [ka] 【0123】 [ka] 【0124】 [ka] 【0125】 [ka] 【0126】 [ka] 【0127】 Next, a specific example of the production of oligonucleotides (nucleic acid oligomers) by the manufacturing method of this embodiment is shown. The reaction was carried out under air (oxygen concentration 21%). Here, in the following example, the oligonucleotides produced by the manufacturing method of this embodiment are oligonucleotides having the sequence (I) shown in Sequence IDs 1 and 2. Furthermore, the guanosine derivatives described in the following examples and comparative examples refer to the compounds shown in the following structural formula. The circles shown in the following structural formula schematically represent CPG. 【0128】 [ka] 【0129】 (Example 1) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.504 μmol of the solution was collected in a 15 mL Falcon tube. To this, 0.73 mg of 2,6-di-tert-butyl-p-cresol (BHT) was added (0.1 moles of BHT per mole of protecting group), dissolved, and then 0.75 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (27.1 moles of TBAF per mole of protecting group), which had been dehydrated with molecular sieve 4A, was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.4 mg and the purity was 52%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0130】 (Example 2) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.504 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.85 mg of 2,6-di-tert-butyl-p-cresol (BHT) was added (0.5 moles of BHT per mole of protecting group), dissolved, and then 0.75 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (27.1 moles of TBAF per mole of protecting group), which had been dehydrated with molecular sieve 4A, was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.2 mg and the purity was 53%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0131】 (Example 3) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.503 μmol of the solution was collected in a 15 mL Falcon tube. To this, 5.83 mg of 2,6-di-tert-butyl-p-cresol (BHT) was added (1.0 mol of BHT per mole of protecting group), dissolved, and then 0.75 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (27.2 mol of TBAF per mole of protecting group), which had been dehydrated with molecular sieve 4A, was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.2 mg and the purity was 53%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0132】 (Example 4) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.489 μmol of the solution was collected in a 15 mL Falcon tube. To this, 11.56 mg of 2,6-di-tert-butyl-p-cresol (BHT) was added (2.1 moles of BHT per mole of protecting group), dissolved, and then 0.75 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (28.0 moles of TBAF per mole of protecting group), which had been dehydrated with molecular sieve 4A, was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.0 mg and the purity was 53%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0133】 (Example 5) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.512 μmol of the solution was collected in a 15 mL Falcon tube. To this, 17.81 mg of 2,6-di-tert-butyl-p-cresol (BHT) was added (3.0 moles of BHT per mole of protecting group), dissolved, and then 0.79 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (28.1 moles of TBAF per mole of protecting group), which had been dehydrated with molecular sieve 4A, was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.2 mg and the purity was 52%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0134】 (Example 6) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.510 μmol of the solution was collected in a 15 mL Falcon tube. To this, 23.11 mg of 2,6-di-tert-butyl-p-cresol (BHT) was added (4.0 moles of BHT per mole of protecting group), dissolved, and then 0.76 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (27.2 moles of TBAF per mole of protecting group), which had been dehydrated with molecular sieve 4A, was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.2 mg and the purity was 52%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0135】 (Example 7) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.503 μmol of the solution was collected in a 15 mL Falcon tube. To this, 7.20 mg of 4-sec-butyl-2,6-di-tert-butylphenol was added (1.0 mole of 4-sec-butyl-2,6-di-tert-butylphenol per mole of protecting group), dissolved, and then 0.75 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (27.2 moles of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.2 mg and the purity was 54%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0136】 (Example 8) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.485 μmol of the solution was collected in a 15 mL Falcon tube. To this, 4.20 mg of 6-tert-butyl-2,4-xylenol was added (0.9 moles of 6-tert-butyl-2,4-xylenol per mole of protecting group), dissolved, and then 0.76 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (28.6 moles of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.1 mg and the purity was 56%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0137】 (Example 9) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.492 μmol of the solution was collected in a 15 mL Falcon tube. To this, 5.30 mg of 4,6-di-tert-butyl-m-cresol was added (0.9 moles of 4,6-di-tert-butyl-m-cresol per mole of protecting group), dissolved, and then 0.77 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (28.5 moles of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.4 mg and the purity was 52%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0138】 (Example 10) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.506 μmol of the solution was collected in a 15 mL Falcon tube. To this, 3.00 mg of 1,4-dihydroxybenzene was added (1.0 mol of 1,4-dihydroxybenzene per mole of protecting group), dissolved, and then 0.75 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (27.0 mol of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.3 mg and the purity was 53%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0139】 (Example 11) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.493 μmol of the solution was collected in a 15 mL Falcon tube. To this, 1.30 mg of bis(2,2,6,6-tetramethyl-4-piperidyl) sebacate was added (0.1 moles of bis(2,2,6,6-tetramethyl-4-piperidyl) sebacate per mole of protecting group), dissolved, and then 0.79 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) that had been dehydrated with molecular sieve 4A (29.2 moles of TBAF per mole of protecting group) was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.3 mg and the purity was 52%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0140】 (Example 12) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.492 μmol of the solution was collected in a 15 mL Falcon tube. To this, 6.40 mg of bis(2,2,6,6-tetramethyl-4-piperidyl) sebacate was added (0.5 moles of bis(2,2,6,6-tetramethyl-4-piperidyl) sebacate per mole of protecting group), dissolved, and then 0.76 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) that had been dehydrated with molecular sieve 4A (28.2 moles of TBAF per mole of protecting group) was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.3 mg and the purity was 54%. The purity of the oligonucleotides of the obtained crude product was measured using the method described in Measurement Method 1, and the yield of oligonucleotides was measured using the method described in Measurement Method 2. 【0141】 (Example 13) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.511 μmol of the solution was collected in a 15 mL Falcon tube. To this, 0.66 mg of 2,2,6,6-tetramethyl-4-piperidyl methacrylate was added (0.1 moles of 2,2,6,6-tetramethyl-4-piperidyl methacrylate per mole of protecting group), dissolved, and then 0.75 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (26.8 moles of TBAF per mole of protecting group), was added and the mixture was uniformly stirred using a vortex mixer. The mixture was then kept warm at 30°C for 4 hours to deprotect the 2'-cyanoethoxymethoxy (CEM) protecting group. The crude product was obtained by precipitation. The yield was 4.2 mg and the purity was 52%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 of the obtained crude product, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 of the same product. 【0142】 (Example 14) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.499 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.80 mg of 2,2,6,6-tetramethyl-4-piperidyl methacrylate was added (0.5 moles of 2,2,6,6-tetramethyl-4-piperidyl methacrylate per mole of protecting group), dissolved, and then 0.79 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (28.9 moles of TBAF per mole of protecting group), was added and the mixture was uniformly stirred using a vortex mixer. The mixture was then kept warm at 30°C for 4 hours to deprotect the 2'-cyanoethoxymethoxy (CEM) protecting group. The crude product was obtained by precipitation. The yield was 4.0 mg and the purity was 52%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0143】 (Example 15) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.495 μmol of the solution was collected in a 15 mL Falcon tube. To this, 6.50 mg of 2,2,6,6-tetramethyl-4-piperidyl methacrylate was added (1.1 moles of 2,2,6,6-tetramethyl-4-piperidyl methacrylate per mole of protecting group), dissolved, and then 0.75 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (27.6 moles of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.0 mg and the purity was 52%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0144】 (Example 16) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.508 μmol of the solution was collected in a 15 mL Falcon tube. To this, 4.9 mg of 2,2,6,6-tetramethylpiperidine 1-oxyl free radical was added (1.2 moles of 2,2,6,6-tetramethylpiperidine 1-oxyl free radical per mole of protecting group), dissolved, and then 0.83 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (29.8 moles of TBAF per mole of protecting group), was added and the mixture was uniformly stirred using a vortex mixer. The mixture was then kept warm at 30°C for 4 hours to deprotect the 2'-cyanoethoxymethoxy (CEM) protecting group. The crude product was obtained by precipitation. The yield was 4.2 mg and the purity was 55%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0145】 (Example 17) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.485 μmol of the solution was collected in a 15 mL Falcon tube. To this, 14.30 mg of dioctadecyl sulfide was added (1.1 moles of dioctadecyl sulfide per mole of protecting group), and then 0.28 g of dimethyl sulfoxide was added and dissolved. Then, 0.78 g of a dimethyl sulfoxide solution of 1 M tetra-n-butylammonium fluoride (TBAF) dehydrated with molecular sieve 4A (29.3 moles of TBAF per mole of protecting group) was added, and the mixture was uniformly stirred using a vortex mixer. The mixture was then kept warm at 30°C for 4 hours to deprotect the 2'-cyanoethoxymethoxy (CEM) protecting group. The crude product was obtained by precipitation. The yield was 4.0 mg and the purity was 55%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 of the obtained crude product, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 of the obtained crude product. 【0146】 (Example 18) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.489 μmol of the solution was collected in a 15 mL Falcon tube. 5.00 mg of benzophenone was added (1.1 moles of benzophenone per mole of protecting group), dissolved, and then 0.79 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (29.5 moles of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.2 mg and the purity was 55%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0147】 (Example 19) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.505 μmol of the solution was collected in a 15 mL Falcon tube. To this, 4.10 mg of n-octanohydrazide was added (1.0 mol of n-octanohydrazide per mole of protecting group), dissolved, and then 0.79 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (28.5 mol of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.3 mg and the purity was 54%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0148】 (Example 20) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.500 μmol of the solution was collected in a 15 mL Falcon tube. To this, 3.90 mg of succinate dihydrazide was added (1.0 mol of succinate dihydrazide per mole of protecting group), dissolved, and then 0.81 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (29.6 mol of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.1 mg and the purity was 52%. The purity of the oligonucleotides in the obtained crude product was measured using the method described in Measurement Method 1, and the yield of oligonucleotides was measured using the method described in Measurement Method 2. 【0149】 (Example 21) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.494 μmol of the solution was collected in a 15 mL Falcon tube. To this, 6.00 mg of triphenylphosphine was added (0.9 moles of triphenylphosphine per mole of protecting group), dissolved, and then 0.79 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (29.2 moles of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-cyanoethoxymethoxy (CEM) protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.3 mg and the purity was 54%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0150】 (Comparative Example 1) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.79 μmol of a guanosine derivative and an amidite shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12). Subsequently, a CPG support supporting 30.03 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.15 g of aqueous ammonia and 3.07 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and then 0.46 g of nitromethane and 2.99 g of acetonitrile were added to the solution. 0.498 μmol of the solution was collected in a 15 mL Falcon tube. 0.78 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), dehydrated with molecular sieve 4A (28.6 moles of TBAF per mole of protecting group), was added to the mixture and uniformly stirred using a vortex mixer. The mixture was then kept at 30°C for 4 hours to deprotect the 2'-cyanoethoxymethoxy (CEM) protecting group. The crude product was obtained by precipitation. The yield was 4.1 mg and the purity was 48%. The purity of the oligonucleotides in the obtained crude product was measured using the method described in Measurement Method 1, and the yield of oligonucleotides was measured using the method described in Measurement Method 2. 【0151】 (Example 22) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. From this solution, 0.504 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane and 1.15 mg of 2,6-di-tert-butyl-p-cresol (BHT) were added (0.2 moles of BHT per mole of protecting group), dissolved, and then 0.78 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (28.2 moles of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-EMM protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.2 mg and the purity was 53%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0152】 (Example 23) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. From this solution, 0.513 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane and 5.87 mg of 2,6-di-tert-butyl-p-cresol (BHT) were added (1.0 mol of BHT per mole of protecting group), dissolved, and then 0.78 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (27.7 mol of TBAF per mole of protecting group), which had been dehydrated using molecular sieve 4A, was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-EMM protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.0 mg and the purity was 53%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0153】 (Example 24) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. From this solution, 0.511 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane and 23.20 mg of 2,6-di-tert-butyl-p-cresol (BHT) were added (4.0 moles of BHT per mole of protecting group), dissolved, and then 0.78 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (27.8 moles of TBAF per mole of protecting group), which had been dehydrated using molecular sieve 4A, was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-EMM protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.3 mg and the purity was 55%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0154】 (Example 25) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. From this solution, 0.514 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane and 34.10 mg of 2,6-di-tert-butyl-p-cresol (BHT) were added (5.8 moles of BHT per mole of protecting group), dissolved, and then 0.82 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (29.1 moles of TBAF per mole of protecting group), which had been dehydrated using molecular sieve 4A, was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-EMM protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.4 mg and the purity was 55%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0155】 (Example 26) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. From this solution, 0.508 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane and 47.10 mg of 2,6-di-tert-butyl-p-cresol (BHT) were added (8.1 moles of BHT per mole of protecting group), dissolved, and then 0.76 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (27.3 moles of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-EMM protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.3 mg and the purity was 54%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0156】 (Example 27) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. From this solution, 0.513 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane and 6.00 mg of 6-tert-butyl-2,4-xylenol were added (1.3 moles of 6-tert-butyl-2,4-xylenol per mole of protecting group), dissolved, and then 0.78 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (27.8 moles of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-EMM protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.5 mg and the purity was 54%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0157】 (Example 28) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. 0.520 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane and 5.10 mg of 4,6-di-tert-butyl-m-cresol were added (0.9 moles of 4,6-di-tert-butyl-m-cresol per mole of protecting group), dissolved, and then 0.78 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (27.3 moles of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-EMM protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.3 mg and the purity was 53%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0158】 (Example 29) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. From this solution, 0.504 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane and 0.70 mg of 2,2,6,6-tetramethyl-4-piperidyl methacrylate were added (0.1 moles of 2,2,6,6-tetramethyl-4-piperidyl methacrylate per mole of protecting group), dissolved, and then 0.78 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) that had been dehydrated with molecular sieve 4A (28.2 moles of TBAF per mole of protecting group) was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-EMM protecting group was deprotected by keeping the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.2 mg and the purity was 50%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 of the obtained crude product, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 of the obtained crude product. 【0159】 (Example 30) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. From this solution, 0.511 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane and 4.50 mg of 2,2,6,6-tetramethylpiperidine 1-oxyl free radicals were added (1.1 moles of 2,2,6,6-tetramethylpiperidine 1-oxyl free radicals per mole of protecting group), dissolved, and then 0.78 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (27.8 moles of TBAF per mole of protecting group), was added and the mixture was uniformly stirred using a vortex mixer. The mixture was then kept warm at 30°C for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 4.0 mg and the purity was 52%. The purity of the oligonucleotides of the obtained crude product was measured using the method described in Measurement Method 1, and the yield of oligonucleotides was measured using the method described in Measurement Method 2. 【0160】 (Example 31) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. From this solution, 0.503 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane and 14.00 mg of dioctadecyl sulfide were added (1.0 mol of dioctadecyl sulfide per mole of protecting group), 0.28 g of dimethyl sulfoxide was added and dissolved, and then 0.81 g of a dimethyl sulfoxide solution of 1 M tetra-n-butylammonium fluoride (TBAF) that had been dehydrated with molecular sieve 4A (29.4 mol of TBAF per mole of protecting group) was added and the mixture was uniformly stirred using a vortex mixer. The mixture was then kept warm at 30°C for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 4.0 mg and the purity was 54%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 of the obtained crude product, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 of the obtained crude product. 【0161】 (Example 32) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. From this solution, 0.521 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane and 4.80 mg of benzophenone were added (1.0 mol of benzophenone per mole of protecting group), dissolved, and then 0.83 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (29.0 mol of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-EMM protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.0 mg and the purity was 53%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0162】 (Example 33) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. From this solution, 0.491 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane and 6.40 mg of triphenylphosphine were added (1.0 mol of triphenylphosphine per mole of protecting group), dissolved, and then 0.79 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF), which had been dehydrated with molecular sieve 4A (29.4 mol of TBAF per mole of protecting group), was added. The mixture was then uniformly stirred using a vortex mixer, and the 2'-EMM protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.0 mg and the purity was 53%. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2. 【0163】 (Comparative Example 2) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. From this solution, 0.510 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane was added, and then 1.56 g of a dimethyl sulfoxide solution of 1 M tetra-n-butylammonium fluoride (TBAF) (the amount of TBAF was 55.8 moles per mole of protecting group) that had been dehydrated with molecular sieve 4A was introduced. The mixture was then uniformly stirred using a vortex mixer, and the 2'-EMM protecting group was deprotected by keeping the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.1 mg and the purity was 49%. The purity of the oligonucleotides in the obtained crude product was measured using the method described in Measurement Method 1, and the yield of oligonucleotides was measured using the method described in Measurement Method 2. 【0164】 (Reference example 1) Solid-phase synthesis of sequence (I) was performed using AKTA oligopilot plus100 with a CPG supporting 93.86 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Subsequently, a CPG support supporting 30.02 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid support using 10.18 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.24 g of dimethyl sulfoxide, and 3.00 g of acetonitrile was added to the solution. From this solution, 0.497 μmol of the solution was collected in a 15 mL Falcon tube. To this, 2.89 mg of nitromethane was added, followed by the infusion of 0.82 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (30.1 moles of TBAF per mole of protecting group), which had been dehydrated using molecular sieves 4A. The mixture was then uniformly stirred using a vortex mixer, and the 2'-EMM protecting group was deprotected by incubating the mixture at 30°C for 4 hours. The crude product was obtained by precipitation. The yield was 4.2 mg, and the purity was 49%. Furthermore, 4.7 mL of an aqueous solution containing the entire amount of the obtained crude product was purified by affinity chromatography. Specifically, using a Cytiva AKTA pure 150, the entire amount of the nucleic acid aqueous solution was applied to a commercially available affinity column (SkillPak Toyopearl AF-Chelate-650M, 1 mL, Tosoh Corporation), water was used as the mobile phase, and 20 mL was delivered at a flow rate of 0.6 mL / min. The UV (260 nm) of the eluate was monitored, and the entire amount of the portion in which nucleic acid elution was observed was collected and concentrated by membrane filtration to obtain a nucleic acid purified product. 【0165】 The measurement results are shown in Tables 2 to 4 below. In the table below, the amount of radical reaction inhibitor used represents the amount used relative to the number obtained by multiplying 1 mole of the compound supported on the solid phase carrier by the number of R in formula (3) that is represented by the group shown in formula (1). 【0166】 [Table 2] 【0167】 [Table 3] 【0168】 [Table 4] 【0169】 As shown in Tables 2 to 4 above, when the deprotection reaction of the hydroxyl group protecting the ribose contained in the oligonucleotide described in the specification was carried out in the presence of a radical reaction inhibitor, the deprotection reaction proceeded more efficiently compared to when it was carried out under conditions without the radical reaction inhibitor, and as a result, deprotected oligonucleotides with high purity could be obtained. [Industrial applicability] 【0170】 This invention enables the efficient production of nucleic acid oligomers. [Sequence Listing Free Text] 【0171】 Sequence IDs 1 to 13 in the sequence listing represent the base sequences of oligonucleotides produced according to the manufacturing method of the present invention.
Claims
[Claim 1] In the presence of a radical reaction inhibitor, the following equation (3): 【Chemistry 1】 (In the formula, G 4 This represents a protecting group for a hydrogen atom or a hydroxyl group. G 9 This represents an ammonium ion, alkylammonium ion, alkali metal ion, hydrogen ion, or hydroxyalkylammonium ion. B c Each of these independently represents the same or distinct nucleic acid base. Each R independently represents the same or distinct hydrogen atom, fluorine atom, or OQ group. Q is independently the same or distinct from a tert-butyldimethylsilyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, an ethylidene group bonded to the 4' carbon atom of ribose, or the following formula (1): 【Chemistry 2】 (In the formula, Bonds marked with an asterisk (*) indicate a bond with the oxygen atom of the OQ group. n represents any integer greater than or equal to 0. It represents the protecting group, Each Y independently represents either the same or different oxygen atom or a sulfur atom. m represents any integer between 2 and 300. W and X are defined by either (a) or (b) below: (a) When W is a hydroxyl group, X has the same definition as the R group described above. (b) When X is a hydroxyl group, W represents an OV group, V represents a tert-butyldimethylsilyl group or the group of formula (1) above. However, at least one of the groups R, W, and X represents a hydroxyl group protected by the protecting group of formula (1). When m is an integer greater than or equal to 3, the nucleic acid oligomer represented by equation (3) is a nucleic acid oligomer in which non-nucleotide linkers may be incorporated instead of p nucleotides between the 5' and 3' terminal nucleotides (where p is a positive integer satisfying equation: m-1 > p). The following formula (4) is characterized by contacting the nucleic acid oligomer represented by with fluoride ions: 【Transformation 3】 (In the formula, R' independently represents the same or different hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, or OQ' group,) Q' represents, independently and either identically or distinctly, a methylene group, an ethylene group, or an ethylidene group bonded to the carbon atom at the 4' position of ribose. Substituent G of formula (4) 4 G 9 , Y, B c The definitions of and m are the same as the definitions in formula (3) above, W 0 It is a hydroxyl group, X 0 This has the same definition as the R' group described above. Furthermore, when m is an integer greater than or equal to 3, the nucleic acid oligomer represented by equation (4) is a nucleic acid oligomer in which non-nucleotide linkers may be incorporated instead of p nucleotides between the 5' and 3' terminal nucleotides (where p is a positive integer satisfying equation: m-1 > p). Method for producing nucleic acid oligomers as shown: Here, Radical reaction inhibitors are radical chain initiation inhibitors, radical scavengers, or peroxide decomposers. The radical chain initiation inhibitor is a metal deactivator or an ultraviolet absorber. The metal deactivator is n-octanohydrazide or succinate dihydrazide. The UV absorber is benzophenone. The radical scavenger is a phenolic antioxidant or a hindered amine light stabilizer. The phenolic antioxidants are 2,6-di-tert-butyl-p-cresol (BHT), 4-sec-butyl-2,6-di-tert-butylphenol, 6-tert-butyl-2,4-xylenol, 4,6-di-tert-butyl-m-cresol, or 1,4-dihydroxybenzene. The hindered amine light stabilizers are bis(2,2,6,6-tetramethyl-4-piperidyl) sebacate, 2,2,6,6-tetramethyl-4-piperidyl methacrylate, or 2,2,6,6-tetramethylpiperidine 1-oxyl-free radical (TEMPO free radical), The peroxide decomposition agent is a phosphorus-based antioxidant or a sulfur-based antioxidant. The phosphorus-based antioxidant is triphenylphosphine. The sulfur-based antioxidant is dioctadecyl sulfide. Manufacturing method. [Claim 2] The manufacturing method according to claim 1, wherein n in formula (1) is 0 or 1. [Claim 3] The manufacturing method according to claim 1, wherein n in formula (1) is 0. [Claim 4] The manufacturing method according to claim 1, wherein n in formula (1) is 1. [Claim 5] The manufacturing method according to claim 1, wherein the non-nucleotide linker is a linker consisting of an amino acid skeleton. [Claim 6] The manufacturing method according to claim 5, wherein the linker consisting of an amino acid skeleton is a linker having the structure of the following formulas (A14-1), (A14-2), or (A14-3). 【Chemistry 4】 【Transformation 5】 【Transformation 6】 (In the formula, 5' and 3' represent the 5' and 3' ends of the nucleic acid oligomer, respectively.) [Claim 7] W is a hydroxyl group, X is an R group, W 0 is a hydroxyl group, and X 0 is an R' group, the production method according to any one of claims 1 to 6. [Claim 8] The manufacturing method according to any one of claims 1 to 6, wherein the fluoride ion source is tetraalkylammonium fluoride. [Claim 9] The manufacturing method according to any one of claims 1 to 6, wherein the fluoride ion source is tetra-n-butylammonium fluoride. [Claim 10] The manufacturing method according to any one of claims 1 to 6, wherein the radical reaction inhibitor is a radical scavenger. [Claim 11] The manufacturing method according to any one of claims 1 to 6, wherein the radical reaction inhibitor is a peroxide decomposition agent. [Claim 12] The manufacturing method according to any one of claims 1 to 6, wherein the radical reaction inhibitor is a radical chain initiation inhibitor. [Claim 13] The manufacturing method according to any one of claims 1 to 6, wherein the amount of radical reaction inhibitor used is 9 moles or less per mole, where the number of moles obtained by multiplying the number of moles of nucleic acid oligomers represented by formula (3) by the number of groups represented by formula (1) in formula (3). [Claim 14] A method for producing nucleic acid oligomers according to any one of claims 1 to 6, wherein the proportion of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 10% or more, and the nucleic acid chain length is 10 chains or more.