Antibody oligonucleotide conjugate composition, and method for inducing DMD exon 44 skipping.

Antibody-oligonucleotide conjugates are developed to deliver antisense oligonucleotides to muscle cells, addressing the lack of exon 44 skipping therapies for DMD by inducing exon 44 skipping and producing a functional dystrophin protein, thereby treating DMD.

JP7879260B2Active Publication Date: 2026-06-23AVIDITY BIOSCI INC
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
JP2024559146
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2022-04-05
Filing Date
2023-04-05
Publication Date
2026-06-23
Estimated Expiration
2043-04-05

AI Technical Summary

Technical Problem

There are currently no FDA-approved exon skipping therapies for Duchenne muscular dystrophy (DMD) patients suitable for exon 44 skipping, affecting approximately 6% of the DMD patient population, despite extensive research in this area.

Method used

Development of antibody-oligonucleotide conjugates (AOCs) that target antisense oligonucleotides to deliver them specifically to muscle cells, inducing exon 44 skipping in the DMD gene by hybridizing to the exon 44 acceptor splice site, thereby producing a cleaved dystrophin protein.

Benefits of technology

The AOCs effectively induce exon 44 skipping, leading to the production of a functional, cleaved dystrophin protein, potentially treating DMD by modulating muscular dystrophy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007879260000041
    Figure 0007879260000041
  • Figure 0007879260000042
    Figure 0007879260000042
  • Figure 0007879260000043
    Figure 0007879260000043
Patent Text Reader

Abstract

Disclosed herein are antibody-oligonucleotide conjugates and pharmaceutical compositions that induce changes in incorrectly spliced ​​dystrophin mRNA transcripts to induce exon 44 skipping. Also described herein are methods for treating muscular dystrophies, including Duchenne muscular dystrophy, comprising administering an antibody-oligonucleotide conjugate or pharmaceutical composition that induces changes in incorrectly spliced ​​dystrophin mRNA transcripts to induce exon 44 skipping.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross-reference This application claims the benefit of U.S. Provisional Patent Application No. 63 / 327,725, filed Apr. 5, 2022, which is hereby incorporated by reference in its entirety.

Background Art

[0002] Duchenne muscular dystrophy (DMD) is a rare X-linked neuromuscular disease that primarily affects male children, affecting approximately 1 in 5,000 to 10,000 males born worldwide. There are approximately 300,000 DMD patients worldwide. DMD is a single-gene disease that is progressive, severe, and irreversible. This disease is caused by mutations in the DMD gene, the longest gene in the human genome (79 exons), which encodes the dystrophin protein (430 kDa). The central domain of dystrophin, called the rod domain, is formed by 24 spectrin repeats that function as shock absorbers and protect muscle cells from damage during operation.

[0003] DMD is caused by mutations (changes) in the dystrophin gene. The most common type of mutation is the deletion of one or more exons. Since the dystrophin gene has a total of 79 exons, there are many possible types of deletions. However, there are specific regions of the gene that are more likely to contain deletions, and these regions are called "hotspots." Many large gene deletions in the DMD gene, along with non-randomly distributed deletions, can be detected in specific hotspot regions of the gene. These hotspots are clustered within two main regions, with approximately 20% of deletions occurring in the 5' proximal portion of the gene (exons 1, 3, 4, 5, 8, 13, 19) and approximately 80% occurring in the intermediate-distal region, i.e., 42-45, 47, 48, 50-53 (Den Dunnen et al., Am J Hum Genet. 1989;45(6):835-847). Mutated DMD genes are unable to produce any functional dystrophin, and the lack of functional dystrophin leads to progressive muscle weakness due to muscle damage, repair, inflammatory changes, and paralysis.

[0004] Current research into DMD treatments includes stem cell replacement therapy, analog up-regulation, gene replacement, and exon skipping techniques. Exon skipping techniques utilize structural analogs of DNA called antisense oligonucleotides, which help cells skip specific exons during RNA splicing. These antisense oligonucleotides allow the defective portion of the dystrophin gene to be skipped when the dystrophin gene is transcribed into RNA for protein production, enabling muscle cells to produce a cleaved but more functional version of the dystrophin protein.

[0005] Several antisense oligonucleotides are already approved for DMD patients who adapt to exon 45, 51, or 53 skipping. An antisense oligonucleotide named eteplirsen is approved in the U.S. for treating mutations suitable for dystrophin exon 51 skipping. An antisense oligonucleotide named golodyrsen was approved in the U.S. in 2019 for medical use in treating cases where skipping exon 53 of the dystrophin transcript could be beneficial. An antisense oligonucleotide named Casimersen was approved in the U.S. in February 2021 for treating patients with confirmed DMD gene mutations suitable for exon 45 skipping.

[0006] Despite extensive research using exon skipping for exon 44 (U.S. Patent Nos. 9,447,417, 8,461,325, and 8,361,979), there are currently no FDA-approved exon skipping therapies for DMD patients suitable for exon 44 skipping. Approximately 6% of the DMD patient population are suitable for exon 44 skipping, and the majority of these DMD patients may also have a deletion of exon 45 in their DMD transcript.

[0007] A new class of therapeutic agents called antibody-oligonucleotide conjugates (AOCs) improves the delivery of antisense oligonucleotides. These AOCs target antisense oligonucleotides and deliver them to specific tissues and cell types, including muscle cells. These AOCs are being developed as groundbreaking therapeutic candidates for DMD patients, including those suitable for exon 44 skipping. There is a need to provide treatments for DMD patients suitable for exon 44 skipping. [Prior art documents] [Patent Documents]

[0008] [Patent Document 1] U.S. Patent No. 9,447,417 [Patent Document 2] U.S. Patent No. 8,461,325 [Patent Document 3] U.S. Patent No. 8,361,979 [Non-patent literature]

[0009] [Non-Patent Document 1] Den Dunnen et al., Am J Hum Genet. 1989;45(6):835-847. [Overview of the project]

[0010] In certain embodiments of this specification, a PMO conjugate is disclosed comprising an anti-transferrin receptor antibody or an antigen-binding fragment thereof conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO) molecule, wherein the PMO molecule comprises a sequence selected from the group consisting of SEQ ID NOs. 100–133. In some embodiments, the PMO molecule hybridizes to an acceptor splice site, donor splice site, or exon splice enhancer element of the pre-mRNA transcript of the DMD gene, inducing exon 44 skipping in the pre-mRNA transcript to produce an mRNA transcript encoding a cleaved DMD protein. In some embodiments, the PMO molecule comprises at least about 10–30 nucleotides in length. In some embodiments, the PMO molecule is delivered into a muscle cell. In some embodiments, the PMO molecule hybridizes in the pre-mRNA transcript to the exon 44 acceptor splice site of the pre-mRNA transcript of the DMD gene to produce an mRNA transcript encoding a cleaved dystrophin protein. In some embodiments, the anti-transferrin receptor antibody or its antigen-binding fragment includes a humanized antibody or its antigen-binding fragment, a chimeric antibody or its antigen-binding fragment, a monoclonal antibody or its antigen-binding fragment, a monovalent Fab', a bivalent Fab2, a single-chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single-domain antibody (sdAb), or a camelid antibody or its antigen-binding fragment. In some embodiments, a PMO molecule is conjugated to the anti-transferrin receptor antibody or its antigen-binding fragment via a linker. In some embodiments, the linker is a cleavable linker. In some embodiments, the linker is a non-cleavable linker. In some embodiments, the linker is selected from the group consisting of a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or its derivative, a C1-C6 alkyl group, and combinations thereof. In some embodiments, the PMO conjugate has a PMO molecule-to-antibody ratio (DAR) of approximately 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, or higher. In some embodiments, the PMO conjugate has an average DAR of approximately 1, 2, 3, 4, 5, 6, 7, 8, or higher.In some embodiments, the PMO conjugate has an average DAR in the range of 3.5 to 4.5. In some embodiments, the PMO conjugate has an average DAR in the range of 7.5 to 8.5. In some embodiments, the PMO conjugate has an average DAR of approximately 4. In some embodiments, the PMO conjugate has an average DAR of approximately 8. In some embodiments, the PMO conjugate has a DAR of approximately 4. In some embodiments, the PMO conjugate has a DAR of approximately 8. In some embodiments, the PMO conjugate is formulated for parenteral administration. In some embodiments, the truncated dystrophin protein modulates muscular dystrophy. In some embodiments, the muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy.

[0011] Furthermore, in certain embodiments of this specification, a method for treating muscular dystrophy in subjects requiring treatment of muscular dystrophy is disclosed, comprising the step of administering a PMO conjugate to a subject, the PMO conjugate comprising an anti-transferrin receptor antibody or an antigen-binding fragment conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO) molecule containing a sequence selected from the group consisting of SEQ ID NOs. 100 to 133, wherein the PMO molecule hybridizes to an acceptor splice site, donor splice site, or exon splice enhancer element of the pre-mRNA transcript of the DMD gene, inducing exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a cleaved dystrophin protein. In some embodiments, the PMO molecule is delivered into muscle cells. In some embodiments, the anti-transferrin receptor antibody or its antigen-binding fragment includes a humanized antibody or its antigen-binding fragment, a chimeric antibody or its antigen-binding fragment, a monoclonal antibody or its antigen-binding fragment, a monovalent Fab', a bivalent Fab2, a single-chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single-domain antibody (sdAb), or a camelid antibody or its antigen-binding fragment. In some embodiments, the PMO molecule contains at least about 10 to about 30 nucleotides in length. In some embodiments, the PMO molecule is conjugated to the anti-transferrin receptor antibody or its antigen-binding fragment via a linker. In some embodiments, the linker is a cleavable linker. In some examples, the linker is a non-cleavable linker. In some embodiments, the linker is selected from the group consisting of a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or its derivatives, a C1-C6 alkyl group, and combinations thereof. In some embodiments, the PMO conjugate has an average PMO molecule-to-antibody ratio (DAR) of approximately 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1. In some embodiments, the PMO conjugate has an average DAR in the range of 3.5 to 4.5. In some embodiments, the PMO conjugate has an average DAR in the range of 7.5 to 8.5. In some embodiments, the PMO conjugate has an average DAR of approximately 4.In some embodiments, the PMO conjugate has an average DAR of approximately 8. In some embodiments, the PMO conjugate is administered parenterally. In some embodiments, the truncated dystrophin protein modulates muscular dystrophy. In some embodiments, the muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy.

[0012] Furthermore, in certain embodiments herein, a method for inducing exon 44 skipping in a targeted pre-mRNA transcript of the DMD gene, comprising the steps of (a) contacting muscle cells with a phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugate, wherein the PMO-antibody conjugate targets an anti-transferrin receptor antibody or its antigen-binding fragment, and an acceptor splice site, donor splice site, or exon splice enhancer element of the targeted pre-mRNA transcript of the DMD gene. A method is also disclosed comprising the steps of (b) including a PMO molecule, wherein the PMO molecule induces exon 44 skipping to a targeted pre-mRNA transcript, thereby preferentially delivering a PMO-antibody conjugate into muscle cells; (b) hybridizing the PMO molecule to a targeted pre-mRNA transcript to induce exon 44 skipping to the targeted pre-mRNA transcript; and (c) translating the mRNA transcript produced from the targeted pre-mRNA transcript treated in step (b) in muscle cells to generate a cleaved dystrophin protein. In some embodiments, the anti-transferrin receptor antibody or its antigen-binding fragment includes a humanized antibody or its antigen-binding fragment, a chimeric antibody or its antigen-binding fragment, a monoclonal antibody or its antigen-binding fragment, a monovalent Fab', a bivalent Fab2, a single-chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single-domain antibody (sdAb), or a camelid antibody or its antigen-binding fragment. In some embodiments, the PMO molecule contains at least about 10 to about 30 nucleotides in length. In some embodiments, the PMO molecule contains at least 90%, 95%, 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs. 100 to 133. In some embodiments, the PMO molecule targets the acceptor site of exon 44. In some embodiments, the PMO molecule is conjugated to an anti-transferrin receptor antibody or its antigen-binding fragment via a linker. In some embodiments, the linker is a cleavable linker. In some embodiments, the linker is a non-cleavable linker.In some embodiments, the linker is selected from the group consisting of heterobifunctional linkers, homobifunctional linkers, maleimide groups, dipeptide moieties, benzoic acid groups or their derivatives, C1-C6 alkyl groups, and combinations thereof. In some embodiments, the PMO conjugate has an average PMO-to-antibody ratio (DAR) of approximately 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, or higher. In some embodiments, the PMO conjugate has a DAR of approximately 1, 2, 3, 4, 5, 6, 7, 8, or higher. In some embodiments, the PMO conjugate has an average DAR in the range of 3.5 to 4.5. In some embodiments, the PMO conjugate has an average DAR in the range of 7.5 to 8.5. In some embodiments, the PMO conjugate has an average DAR of approximately 4. In some embodiments, the PMO conjugate has an average DAR of approximately 8. In some embodiments, the method is an in vivo method.

[0013] Furthermore, in certain embodiments of this specification, a method for inducing exon 44 skipping in a DMD subject requiring induction of exon 44 skipping is disclosed, comprising the step of administering a PMO conjugate to a DMD subject, the PMO conjugate comprising an anti-transferrin receptor antibody or an antigen-binding fragment conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO) molecule containing a sequence selected from the group consisting of SEQ ID NOs. 100 to 133, wherein the PMO molecule hybridizes to the exon 44 acceptor splice site of the pre-mRNA transcript of the DMD gene, inducing exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a cleaved dystrophin protein.

[0014] In a particular aspect of this specification, a method for repairing dystrophin in a DMD subject requiring dystrophin repair is also disclosed, comprising the step of administering a PMO conjugate to a DMD subject, the PMO conjugate comprising an anti-transferrin receptor antibody or its antigen-binding fragment conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO) molecule containing a sequence selected from the group consisting of SEQ ID NOs. 100 to 133, wherein the PMO molecule hybridizes to the exon 44 acceptor splice site of the pre-mRNA transcript of the DMD gene, inducing exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a cleaved dystrophin protein.

[0015] Furthermore, in certain embodiments of this specification, a method for generating a cleaved dystrophin protein in a DMD subject requiring the generation of a cleaved dystrophin protein is disclosed, comprising the step of administering a PMO conjugate to a DMD subject, the PMO conjugate containing an anti-transferrin receptor antibody or its antigen-binding fragment conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO) molecule containing a sequence selected from the group consisting of SEQ ID NOs. 100 to 133, wherein the PMO molecule hybridizes to the exon 44 acceptor splice site of the pre-mRNA transcript of the DMD gene, inducing exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a cleaved dystrophin protein. [Brief explanation of the drawing]

[0016] [Figure 1] This plot compares predicted exon 44 skipping activity for 25-mer and 30-mer phosphorodiamidate morpholino oligomers (PMOs) with experimental values ​​of exon 44 skipping. [Figure 2] This is a plot of dose-response curves relating to the relative levels of exon 44 skipping in response to increasing concentrations of 12 different 30-mer PMOs in human immortalized myoblasts. [Figure 3]This is a plot of dose-response curves relating to the relative levels of exon 44 skipping in response to increasing concentrations of three different PMOs: hEx44_Ac7_26, hEx44_Ac5_27, and hEx44_Ac4_28. [Figure 4A] The dose-response curves for the relative levels of exon 44 skipping in response to increasing hEx44_Ac7_26 concentrations in myotubes are plotted. Figure 4A shows the dose-response curves for the relative levels of exon 44 skipping in response to increasing hEx44_Ac7_26 concentrations in healthy primary and immortalized cells. [Figure 4B] The dose-response curves for the relative levels of exon 44 skipping in response to increased hEx44_Ac7_26 concentration in myotubes are plotted. Figure 4B shows the dose-response curves for the relative levels of exon 44 skipping in response to increased hEx44_Ac7_26 concentration in primary DMD cells derived from DMD patients. [Figure 4C] The dose-response curve plots relating to the relative level of exon 44 skipping in response to an increase in the concentration of hEx44_Ac7_26 in myotubes are shown. Figure 4C is a plot of the dose-response curve relating to the relative level of exon 44 skipping in response to an increase in the concentration of hEx44_Ac7_26 in DMD-immortalized cells. [Figure 5A] This figure shows the level of dystrophin protein in response to increased hEx44_Ac7_26 concentration in cultured myotubes derived from DMD patients. Figure 5A shows immunofluorescence staining images of dystrophin-positive fibers in healthy human cells and cultured myotubes derived from DMD patients transfused with hEx44_Ac7_26. [Figure 5B] This figure shows the level of dystrophin protein in response to an increase in the concentration of hEx44_Ac7_26 in cultured myotubes derived from DMD patients. Figure 5B is a plot of dose-response curves for the relative levels of dystrophin quantified by immunofluorescence staining in response to an increase in the concentration of hEx44_Ac7_26 in cultured myotubes derived from DMD patients. [Figure 5C]It is a diagram showing the level of dystrophin protein in response to the increased concentration of hEx44_Ac7_26 in cultured myotubes derived from DMD patients. Figure 5C is a bar graph quantifying the level of dystrophin protein in response to the increased concentration of hEx44_Ac7_26 in cultured myotubes derived from healthy patients and DMD patients by Jess capillary assay. [Figure 6A] It is a plot of the dose response regarding the relative level of exon 44 skipping in response to the increased concentration of hEx44_Ac7_26 in non-human primate myotubes. Figure 6A is a plot of the dose response curve regarding the relative level of exon 44 skipping in response to the increased concentration of hEx44_Ac7_26 in non-human primate myotubes. [Figure 6B] It is a plot of the dose response regarding the relative level of exon 44 skipping in response to the increased concentration of hEx44_Ac7_26 in non-human primate myotubes. Figure 6B is a bar graph quantifying the number of exon 44 skip copies in response to the increased concentration of hEx44_Ac7_26 in non-human primate myotubes. [Figure 6C] It is a plot of the dose response regarding the relative level of exon 44 skipping in response to the increased concentration of hEx44_Ac7_26 in non-human primate myotubes. Figure 6C is a bar graph quantifying the total number of dystrophin copies in the presence of the increased concentration of hEx44_Ac7_26 in non-human primate myotubes. [Figure 7] It is a graph illustrating the binding assay of DAR8 hEx44_Ac7_26 AOC or unmodified anti-transferrin receptor monoclonal antibody to the transferrin receptor by ELISA. [Figure 8] It is a bar graph showing the number of exon 44 skip copies in muscle tissue and non-muscle tissue obtained from cynomolgus monkeys that were injected once with hEx44_Ac7_26-AOC at a dose of 159.9 mg / kg on day 0 and sampled on days 43 / 44.

Modes for Carrying Out the Invention

[0017] In some aspects of this specification, antibody-polynucleic acid conjugate compositions for the treatment of muscular dystrophy are disclosed. Also disclosed in some aspects of this specification is a method for treating muscular dystrophy caused by an improperly spliced ​​DMD mRNA transcript in a subject requiring treatment for muscular dystrophy, comprising the step of administering an antibody-polynucleic acid conjugate to the subject, wherein the antibody-polynucleic acid conjugate induces a change in the improperly spliced ​​pre-mRNA dystrophy transcript, thereby inducing exon 44 skipping of the DMD mRNA transcript to produce a fully treated DMD mRNA transcript, the fully treated DMD mRNA transcript encoding a functional, cleaved dystrophin protein, thereby treating the disease or disorder of the subject. As used herein, the term "polynucleic acid" is to be used interchangeably with the term "oligonucleotide."

[0018] In some aspects of this specification, antibody-antisense oligonucleotide (ASO) conjugate compositions or antibody-phosphodiamide morpholino oligomer (PMO) conjugate compositions for the treatment of muscular dystrophy are disclosed. Also disclosed is a method for treating muscular dystrophy caused by an improperly spliced ​​DMD mRNA transcript in a subject requiring treatment for muscular dystrophy, comprising the step of administering an antibody-ASO conjugate or an antibody-PMO conjugate to the subject, wherein the ASO or PMO induces alteration in the improperly spliced ​​pre-mRNA dystrophy transcript, thereby inducing exon 44 skipping of the DMD mRNA transcript to produce a fully treated DMD mRNA transcript, the fully treated DMD mRNA transcript encoding a functional, cleaved dystrophin protein, thereby treating the disease or disorder of the subject.

[0019] In some cases, antibody-polynucleic acid conjugates are used in one area: treating muscular dystrophy. Muscular dystrophy encompasses several diseases that affect the muscles. Duchenne muscular dystrophy is a severe form of muscular dystrophy caused by mutations in the DMD gene. In some cases, mutations in the DMD gene disrupt the translational reading frame, resulting in a non-functional dystrophin protein.

[0020] In certain aspects of this specification, methods and compositions relating to nucleic acid therapy are described for inducing insertions, deletions, duplications, or alterations in improperly spliced ​​mRNA transcripts to induce exon skipping or exon inclusion, which are used to repair translational reading frames. Also described in some aspects of this specification are methods and compositions for treating diseases or disorders characterized by improperly processed mRNA transcripts, wherein, after exon removal, the mRNA can encode a functional protein, thereby treating the disease or disorder. Further aspects of this specification also include pharmaceutical compositions and kits for treating muscular dystrophy.

[0021] RNA treatment RNA plays a central role in regulating gene expression and cell physiology. Proper RNA processing is crucial for the translation of functional proteins. Alterations in RNA processing, such as those resulting from inaccurate splicing, can lead to disease. For example, mutations at splice sites can cause exposure of early stop codons, loss of exons, or intron inclusion. In some cases, alterations in RNA processing result in insertions, deletions, or duplications. In some cases, alterations in RNA processing result in exon insertions, deletions, or duplications. Alterations in RNA processing can sometimes result in intron insertions, deletions, or duplications.

[0022] Exxon skipping As used herein, the term “pre-mRNA” refers to a transcript composed of both exons (coding sequences) and introns (non-coding sequences). Exon skipping is a form of RNA splicing. In some cases, exon skipping occurs when an exon is skipped on a pre-mRNA transcript or spliced ​​from treated mRNA. As a result of exon skipping, the treated mRNA does not contain the skipped exon. In some cases, exon skipping results in the expression of altered transcripts and / or mRNA products. For example, exon 44 skipping occurs when exon 44 is skipped in a pre-mRNA transcript or spliced ​​from treated DMD mRNA. As a result of exon 44 skipping, the treated DMD mRNA does not contain the skipped exon 44. In some cases, exon 44 skipping results in the expression of cleaved dystrophin protein. In some cases, exon 44 skipping results in the expression of functional dystrophin protein. In some cases, exon 44 skipping leads to the expression of cleaved, functional dystrophin proteins.

[0023] In some cases, morpholino or phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugates (PMO-AOCs) are used to induce exon skipping. In some cases, morpholino or phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugates are used to deliver PMO to induce exon skipping (e.g., to cells, preferably muscle cells, etc.). In some cases, the delivered PMO is used to induce exon skipping. For example, PMO binds to splice sites or exon enhancers. In some cases, when PMO binds to a specific mRNA or pre-mRNA sequence, a double-stranded region is generated. In some cases, PMO binds to acceptor or donor splice sites at the exon start and / or end. In some cases, morpholino or phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugates are used to induce exon 44 skipping. In some cases, morpholino or phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugates are used to deliver PMO to induce exon 44 skipping. The delivered PMO is used to induce exon 44 skipping. For example, the delivered PMO binds to at least one of the splice sites or exon enhancers of exon 44. In some cases, when PMO binds to a specific mRNA or pre-mRNA sequence, a double-stranded region is generated. In some cases, PMO binds to acceptor or donor splice sites at the start and / or end of exon 44. In some cases, PMO binds to acceptor splice sites at the start of exon 44. In some cases, PMO binds to donor splice sites at the start of exon 44. In some cases, antisense oligonucleotides (AON, ASO) are used to induce exon skipping. As used herein, the term "AON" is used interchangeably with the term "ASO" and both refer to antisense oligonucleotides.In some cases, AONs are short nucleic acid sequences that bind to specific mRNA or pre-mRNA sequences. For example, AONs bind to splice sites or exon enhancers. In some cases, when an AON binds to a specific mRNA or pre-mRNA sequence, a double-stranded region is generated. In some cases, the formation of the double-stranded region occurs at a site where a spliceosome or spliceosome-related protein would normally bind to an exon and skip it. In some cases, exon skipping results in the repair of the transcriptional reading frame, enabling the production of at least partially functional dystrophin proteins.

[0024] Indications In some embodiments, the polynucleic acid molecules (oligonucleotides, e.g., PMOs, ASOs, etc.) described herein, or pharmaceutical compositions containing such polynucleic acid molecules, are used to treat diseases or disorders characterized by deficient mRNA. In some embodiments, the polynucleic acid molecules (oligonucleotides, e.g., PMOs, ASOs, etc.) described herein, or pharmaceutical compositions containing such polynucleic acid molecules, are used to treat diseases or disorders by inducing insertion, deletion, duplication, or alteration of improperly spliced ​​mRNA transcripts to induce exon skipping or exon inclusion.

[0025] Most human protein-coding genes are alternatively spliced. In some cases, mutations result in improperly spliced ​​or partially spliced ​​mRNA. For example, mutations can be located in at least one of the following locations within a protein-coding gene: a splice site, a silencer or enhancer sequence, an exon sequence, or an intron sequence. In some cases, mutations result in gene dysfunction. In other cases, mutations result in disease or impairment.

[0026] Improperly spliced ​​or partially spliced ​​mRNA can, in some cases, cause neuromuscular diseases or disorders. Exemplary neuromuscular diseases include muscular dystrophy such as Duchenne muscular dystrophy, Becker muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, or myotonic dystrophy. In some cases, muscular dystrophy is hereditary. In some cases, muscular dystrophy arises from spontaneous mutations. Becker muscular dystrophy and Duchenne muscular dystrophy have been shown to involve mutations in the DMD gene, which encodes the protein dystrophin.

[0027] In some cases, improperly spliced ​​or partially spliced ​​mRNA can cause Duchenne muscular dystrophy. Duchenne muscular dystrophy is caused by mutations in the DMD gene that result in severe muscle weakness and loss of functional dystrophin production. In some cases, Duchenne muscular dystrophy is the result of a mutation in exon 44 of the DMD gene. In some cases, multiple exons are mutated / deleted. For example, mutations in exons 44 and 45 are common in patients with Duchenne muscular dystrophy. In some cases, Duchenne muscular dystrophy is the result of a mutation in exon 44. In some cases, Duchenne muscular dystrophy is the result of a mutation in exon 44 and a deletion in exon 45.

[0028] In some cases, the polynucleic acid-antibody conjugates described herein or pharmaceutical compositions containing such polynucleic acid-antibody conjugates are used to treat muscular dystrophy. In some cases, the polynucleic acid-antibody conjugates described herein or pharmaceutical compositions containing such polynucleic acid-antibody conjugates are used to treat Duchenne muscular dystrophy, Becker muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, or myotonic dystrophy. In some cases, the polynucleic acid-antibody conjugates described herein or pharmaceutical compositions containing such polynucleic acid-antibody conjugates are used to treat Duchenne muscular dystrophy. In some cases, the PMO-antibody conjugates described herein or pharmaceutical compositions containing such PMO-antibody conjugates are used to induce exon 44 skipping in the treatment of muscular dystrophy. In some cases, the PMO-antibody conjugates described herein or pharmaceutical compositions containing such PMO-antibody conjugates are used to induce exon 44 skipping in the treatment of Duchenne muscular dystrophy or Becker muscular dystrophy.

[0029] Antibody-polynucleic acid conjugate In some embodiments, the antibody is conjugated to a polynucleic acid molecule. The polynucleic acid molecule may be an ASO or a PMO. In some examples, one or more polynucleic acid molecules are PMOs. The antibody may be an anti-transferrin receptor (anti-CD71) antibody or its antigen-binding fragment. In some embodiments, the antibody is conjugated to a polynucleic acid molecule nonspecifically. In some examples, the antibody is conjugated to a polynucleic acid molecule via a lysine residue. In some examples, the antibody is conjugated to a polynucleic acid molecule via a cysteine ​​residue. In some examples, the antibody is conjugated to a polynucleic acid molecule non-site-specifically via a lysine residue or a cysteine ​​residue. In some examples, the antibody is conjugated to a polynucleic acid molecule non-site-specifically via a lysine residue, e.g., a lysine residue present in the antibody. In some cases, the antibody is conjugated to a polynucleic acid molecule non-site-specifically via a cysteine ​​residue, e.g., a cysteine ​​residue present in the antibody.

[0030] In some embodiments, antibodies are site-specifically conjugated to polynucleic acid molecules. In some examples, antibodies are site-specifically conjugated to polynucleic acid molecules via lysine residues, cysteine ​​residues, at the 5' end, at the 3' end, via unnatural amino acids, or via enzyme-modified or enzyme-catalyzed residues. In some examples, antibodies are conjugated to polynucleic acid molecules via lysine residues (e.g., lysine residues present in the antibody in a site-specific manner). In some examples, antibodies are conjugated to polynucleic acid molecules via cysteine ​​residues (e.g., cysteine ​​residues present in the antibody in a site-specific manner). In some examples, antibodies are site-specifically conjugated to polynucleic acid molecules at the 5' end. In some examples, antibodies are site-specifically conjugated to polynucleic acid molecules at the 3' end. In some examples, antibodies are site-specifically conjugated to polynucleic acid molecules via unnatural amino acids. In some examples, antibodies are site-specifically conjugated to polynucleic acid molecules via enzyme-modified or enzyme-catalyzed residues. In some cases, antibodies are conjugated to polynucleic acid molecules via a linker or one or more linkers.

[0031] In some embodiments, one or more polynucleotide molecules are conjugated to an antibody. These one or more polynucleotide molecules may be ASOs or PMOs. In some examples, one or more polynucleotide molecules are PMOs. The antibody may be an anti-transferrin receptor (anti-CD71) antibody or its antigen-binding fragment. In some examples, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more polynucleotide molecules are conjugated to one antibody. In some examples, about 1 polynucleotide molecule is conjugated to one antibody. In some examples, about 2 polynucleotide molecules are conjugated to one antibody. In some examples, about 3 polynucleotide molecules are conjugated to one antibody. In some examples, about 4 polynucleotide molecules are conjugated to one antibody. In some examples, about 5 polynucleotide molecules are conjugated to one antibody. In some cases, approximately 6 polynucleotide molecules are conjugated to one antibody. In some cases, approximately 7 polynucleotide molecules are conjugated to one antibody. In some cases, approximately 8 polynucleotide molecules are conjugated to one antibody. In some cases, approximately 9 polynucleotide molecules are conjugated to one antibody. In some cases, approximately 10 polynucleotide molecules are conjugated to one antibody. In some cases, approximately 11 polynucleotide molecules are conjugated to one antibody. In some cases, approximately 12 polynucleotide molecules are conjugated to one antibody. In some cases, approximately 13 polynucleotide molecules are conjugated to one antibody. In some cases, approximately 14 polynucleotide molecules are conjugated to one antibody. In some cases, approximately 15 polynucleotide molecules are conjugated to one antibody. In some cases, approximately 16 polynucleotide molecules are conjugated to one antibody. In some cases, one or more polynucleotide molecules are the same. In other cases, one or more polynucleic acid molecules are distinct.

[0032] In some embodiments, the number of polynucleic acid molecules conjugated to an antibody forms a constant ratio. In some examples, this ratio is called the DAR (drug-to-antibody) ratio, where the drug is a polynucleic acid molecule. In some examples, the DAR ratio of polynucleic acid molecule to antibody is approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or higher. In some examples, the DAR ratio of polynucleic acid molecule to antibody A is approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or higher. In some examples, the DAR ratio includes not only integers but also fractions or decimals. For example, fractional or decimal DAR ratios include X.1, X.2, X.3, X.4, X.5, X.6, X.7, X.8, X.9 (e.g., 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, etc.). In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 1 or greater. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 2 or greater. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 3 or greater. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 4 or greater. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 5 or greater. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 6 or greater. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 7 or greater. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 8 or greater. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 9 or higher. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 10 or higher. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 11 or higher. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 12 or higher.

[0033] In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 1. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 2. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 3. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 4. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 5. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 6. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 7. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 8. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 9. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 10. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 11. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 12. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 13. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 14. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 15. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 16.

[0034] In some cases, the DAR ratio of polynucleotide molecules to antibodies is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some cases, the DAR ratio of polynucleotide molecules to antibodies is 1. In some cases, the DAR ratio of polynucleotide molecules to antibodies is 2. In some cases, the DAR ratio of polynucleotide molecules to antibodies is 4. In some cases, the DAR ratio of polynucleotide molecules to antibodies is 6. In some cases, the DAR ratio of polynucleotide molecules to antibodies is 8. In some cases, the DAR ratio of polynucleotide molecules to antibodies is 12. In some cases, the DAR ratio of polynucleotide molecules to antibodies is 16.

[0035] In some embodiments, the composition comprises multiple antibody-polynucleic acid conjugates. In some examples, the number of polynucleic acid molecules conjugated to the antibody forms a constant ratio. In some examples, this ratio is referred to as the DAR (drug-to-antibody) ratio, where the drug is a polynucleic acid molecule. In some examples, multiple antibody-polynucleic acid conjugates in the composition have the same DAR ratio. In some examples, multiple antibody-polynucleic acid conjugates in the composition have different DAR ratios. In some examples, at least two of the antibody-polynucleic acid conjugates in the composition have different DAR ratios. In some examples, the DAR ratio is the average DAR (drug-to-antibody) ratio, which is the average number of DAR ratios of the multiple antibody-polynucleic acid conjugates in the composition. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or higher. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or higher. In some cases, the average DAR ratio includes fractions or decimals in addition to integers. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 1 or higher. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 2 or higher. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 3 or higher. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 4 or higher. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 5 or higher. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 6 or higher. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 7 or higher. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 8 or higher. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 9 or higher. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 10 or higher. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 11 or higher. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 12 or higher.

[0036] In some cases, the average DAR ratio of polynucleotide molecules to antibody A is approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some cases, the average DAR ratio of polynucleotide molecules to antibody is approximately 1. In some cases, the average DAR ratio of polynucleotide molecules to antibody is approximately 2. In some cases, the average DAR ratio of polynucleotide molecules to antibody is approximately 3. In some cases, the average DAR ratio of polynucleotide molecules to antibody is approximately 4. In some cases, the average DAR ratio of polynucleotide molecules to antibody is approximately 5. In some cases, the average DAR ratio of polynucleotide molecules to antibody is approximately 6. In some cases, the average DAR ratio of polynucleotide molecules to antibody is approximately 7. In some cases, the average DAR ratio of polynucleotide molecules to antibody is approximately 8. In some cases, the average DAR ratio of polynucleotide molecules to antibody is approximately 9. In some cases, the average DAR ratio of polynucleotide molecules to antibody is approximately 10. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 11. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 12. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 13. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 14. In some cases, the DAR ratio of polynucleotide molecules to antibodies is approximately 15. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is approximately 16.

[0037] In some cases, the average DAR ratio of polynucleotide molecules to antibodies is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is 1. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is 2. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is 4. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is 6. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is 8. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is 12. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is 16.

[0038] In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 1.5–2.5, 2.5–3.5, 3.5–4.5, 4.5–5.5, 5.5–6.5, 6.5–7.5, 7.5–8.5, 8.5–9.5, 9.5–10.5, 10.5–11.5, 11.5–12.5, 12.5–13.5, 13.5–14.5, 14.5–15.5, 15.5–16.5, or 16.5–17.5. In some cases, the average DAR ratio of polynucleotide molecules to antibody A is in the range of 1.5–2.5. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 2.5–3.5. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 3.5–4.5. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 4.5 to 5.5. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 5.5 to 6.5. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 6.5 to 7.5. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 7.5 to 8.5. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 8.5 to 9.5. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 9.5 to 10.5. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 10.5 to 11.5. In some cases, the average DAR ratio of polynucleotide molecules to antibody A is in the range of 11.5 to 12.5. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 12.5 to 13.5. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 13.5–14.5. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 14.5–15.5. In some cases, the DAR ratio of polynucleotide molecules to antibodies is in the range of 15.5–16.5. In some cases, the average DAR ratio of polynucleotide molecules to antibodies is in the range of 16.5–17.5.

[0039] In some cases, conjugates containing polynucleotide molecules and antibodies exhibit improved activity compared to conjugates containing polynucleotide molecules but without antibodies. In some cases, this improved activity results in enhanced biologically relevant functions, such as improved stability, affinity, binding, functional activity, and efficacy in treating or preventing disease conditions. In some cases, disease conditions are the result of mutations in one or more exons of a gene. In some cases, conjugates containing polynucleotide molecules and antibodies increase exon skipping of one or more mutated exons compared to conjugates containing polynucleotide molecules but without antibodies. In some cases, exon skipping is increased by at least or about 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 95%, or more in conjugates containing polynucleotide molecules but without antibodies compared to conjugates containing polynucleotide molecules but without antibodies.

[0040] PMO molecule in PMO-antibody conjugate In some embodiments, the polynucleic acid is an antisense oligonucleotide (ASO) molecule or a PMO molecule. In some embodiments, the antibody-polynucleic acid conjugate is an ASO-antibody conjugate. In some embodiments, the antibody-polynucleic acid conjugate is a PMO-antibody conjugate. In some embodiments, the PMO molecule of the PMO-antibody conjugate described herein induces exon 44 skipping, thereby inducing alteration in an improperly spliced ​​mRNA transcript. In some examples, the PMO molecule repairs the translational reading frame of the dystrophin protein by altering the improperly spliced ​​mRNA transcript. In some examples, the PMO molecule results in a functional, cleaved dystrophin protein by repairing the translational reading frame of the dystrophin protein.

[0041] In some embodiments, polynucleic acid molecules are conjugated to antibodies for delivery to the target site. In some cases, PMO molecules are conjugated to antibodies. In some cases, PMO molecules are conjugated to antibodies for delivery to the target site.

[0042] In some embodiments, the PMO molecule is conjugated to an antibody for delivery to muscle cells. In some cases, the PMO molecule for skipping exon 44 is conjugated to an antibody. In some cases, the PMO molecule for skipping exon 44 is conjugated to an antibody for delivery to muscle cells.

[0043] In some cases, the antibody is conjugated to at least one PMO molecule. In some cases, the antibody forms a PMO-antibody conjugate by being conjugated to at least one PMO molecule. In some embodiments, the antibody is conjugated to the 5' end of a PMO molecule, the 3' end of a PMO molecule, an internal site on a PMO molecule, or any combination thereof. In some cases, the antibody is conjugated to at least two PMO molecules. In some cases, the antibody is conjugated to at least two, three, four, five, six, seven, eight, or more PMO molecules.

[0044] In some cases, the PMO molecule in the PMO-antibody conjugate targets and hybridizes to the pre-mRNA sequence of the DMD gene. In some cases, the PMO molecule targets and hybridizes to the splice site of exon 44 of the pre-mRNA sequence of the DMD gene. In some cases, the PMO molecule targets and hybridizes to the cis-regulatory element of exon 44 of the pre-mRNA sequence of the DMD gene. In some cases, the PMO molecule targets and hybridizes to the trans-regulatory element of the exon of the pre-mRNA sequence of the DMD gene. In some cases, the PMO molecule targets the exon splice enhancer or intron splice enhancer of exon 44 of the pre-mRNA sequence of the DMD gene. In some cases, the PMO molecule targets and hybridizes to the exon splice silencer or intron splice silencer of exon 44 of the pre-mRNA sequence of the DMD gene. In some cases, the PMO molecule targets the acceptor site at exon 44 of the pre-mRNA sequence of the DMD gene and hybridizes to it.

[0045] In some cases, the PMO molecule in a PMO-antibody conjugate targets and hybridizes to a sequence found in an intron or exon of the pre-mRNA sequence of the DMD gene. For example, the PMO molecule targets and hybridizes to a sequence found in exon 44 of the pre-mRNA sequence of the DMD gene that mediates exon splicing. In some cases, the PMO molecule targets an exon recognition sequence of the pre-mRNA sequence of the DMD gene. In some cases, the PMO molecule targets a sequence upstream of an exon in the pre-mRNA sequence of the DMD gene. In some cases, the PMO molecule targets a sequence downstream of an exon in the pre-mRNA sequence of the DMD gene.

[0046] As mentioned above, PMO molecules target improperly processed mRNA transcripts that result in neuromuscular diseases or disorders. In some cases, these neuromuscular diseases or disorders are Duchenne muscular dystrophy or Becker muscular dystrophy.

[0047] In some cases, polynucleic acid molecules (e.g., PMO molecules, antisense oligonucleotides, etc.) target regions (sequences) adjacent to the mutated exon. In other cases, if there is a mutation in exon 44, the polynucleic acid molecule targets a sequence within exon 44 of the DMD gene's pre-mRNA sequence (e.g., a region within exon 44) so ​​that exon 44 is skipped.

[0048] In some cases, the polynucleic acid molecules described herein target the region at the exon-intron junction of exon 44 of the pre-mRNA sequence of the DMD gene.

[0049] In some cases, the PMO molecule in the PMO-antibody conjugate hybridizes to a target region located at either the 5' intron-exon junction or the 3' exon-intron junction of exon 44 of the pre-mRNA of the DMD gene.

[0050] In some cases, polynucleotide molecules hybridize to a target region located at the 5' intron-exon junction of exon 44 of the pre-mRNA of the DMD gene.

[0051] In some cases, the PMO molecule hybridizes to a target region located at the 3' exon-intron junction of exon 44 of the pre-mRNA of the DMD gene.

[0052] In some cases, the PMO molecule of the PMO-antibody conjugate described herein targets the splice site of exon 44 of the pre-mRNA of the DMD gene. In some cases, the PMO molecule of the PMO-antibody conjugate described herein targets the splice site of exon 44 of the pre-mRNA of the DMD gene. As used herein, the splice site includes a standard splice site, a cryptic splice site, or an alternative splice site capable of inducing insertion, deletion, duplication, or alteration of an inaccurately spliced ​​mRNA transcript to induce exon 44 skipping.

[0053] In some cases, the PMO molecule in the PMO-antibody conjugate hybridizes to a target region proximal to the exon-intron junction. In some cases, the PMO molecules described herein target a region at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt upstream (or 5') of exon 44 of the pre-mRNA of the DMD gene. In some cases, the PMO molecules described herein target a region at least 1000 nt, 500 nt, 400 nt, 300 nt, 200 nt, 100 nt, 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt upstream (or 5') of exon 44 of the pre-mRNA of the DMD gene.

[0054] In some cases, the PMO molecule in the PMO-antibody conjugate hybridizes to a target region located downstream (or 3') of exon 44 of the DMD gene's pre-mRNA. In some cases, the polynucleic acid molecule hybridizes to a target region located approximately 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 nt downstream (or 3') of exon 44 of the DMD gene's pre-mRNA.

[0055] In some cases, the PMO molecule in the PMO-antibody conjugate described herein targets an internal region within exon 44 of the pre-mRNA of the DMD gene.

[0056] In some embodiments, the PMO molecule of the PMO-antibody conjugate described herein targets a partially spliced ​​mRNA sequence containing exon 44 of the DMD gene pre-mRNA. In some examples, the PMO molecule hybridizes to a target region upstream (or 5') of exon 44 of the DMD gene pre-mRNA. In some examples, the PMO molecule hybridizes to a target region approximately 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp upstream (or 5') of exon 44 of the DMD gene pre-mRNA. In some examples, the PMO molecule hybridizes to a target region downstream (or 3') of exon 44 of the DMD gene pre-mRNA. In some cases, the PMO molecule hybridizes to a target region located approximately 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp downstream (or 3') of exon 44 of the DMD gene's pre-mRNA.

[0057] In some cases, the PMO molecule hybridizes to a target region within exon 44 of the DMD gene's pre-mRNA. In other cases, the PMO molecule hybridizes to a target region located at either the 5' intron-exon 44 junction or the 3' exon 44-intron junction of the DMD gene's pre-mRNA.

[0058] In some embodiments, the PMO molecule contains a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to a sequence selected from SEQ ID NOs. 100-133.

[0059] In some embodiments, the PMO molecule includes a core sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to a sequence selected from SEQ ID NOs. 100-133.

[0060] In some embodiments, the PMO molecule of the PMO-antibody conjugate contains at least 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more consecutive bases from a sequence selected from SEQ ID NOs. In some cases, the PMO molecule further contains 1, 2, 3, or 4 mismatches, or 1, 2, 3, or 4 or fewer mismatches, derived from a sequence selected from SEQ ID NOs.

[0061] Tables 1 and 10 list the PMO molecules with sequence numbers 100 to 133.

[0062] [Table 1]

[0063] [Table 2]

[0064] In some embodiments, the polynucleic acid molecule is an antisense oligonucleotide (ASO) molecule or a phosphorodiamidate morpholino oligonucleotide (PMO) molecule.

[0065] In some embodiments, the PMO molecule is at least about 10 to about 50 nucleotides long. In some examples, the PMO molecule is about 10 to about 30, about 15 to about 30, about 18 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, about 19 to about 30, about 19 to about 25, about 19 to about 24, about 19 to about 23, about 20 to about 30, about 20 to about 25, about 20 to about 24, about 20 to about 23, or about 20 to about 22 nucleotides long.

[0066] In some embodiments, polynucleic acid molecules include natural, synthetic, or artificial nucleotide analogs or bases. In some cases, the ASO or PMO molecule in a polynucleic acid molecule-antibody conjugate (e.g., PMO-antibody conjugate or ASO-antibody conjugate) includes a combination of DNA, RNA, and / or nucleotide analogs. In some examples, the synthetic or artificial nucleotide analogs or bases include modifications in one or more of the ribose, phosphate, nucleoside, or combinations thereof.

[0067] In some embodiments, nucleotide analogs or artificial nucleotide bases comprise nucleic acids having modifications to the 2' hydroxyl group of the ribose moiety. In some examples, the modifications include H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, where R is an alkyl moiety. Exemplary alkyl moieties include, but are not limited to, halogens, sulfurs, thiols, thioethers, thioesters, amines (primary, secondary, or tertiary), amides, ethers, esters, alcohols, and oxygen. In some examples, the alkyl moiety further comprises modifications. In some examples, the modifications include azo groups, keto groups, aldehyde groups, carboxyl groups, nitro groups, nitroso groups, nitrile groups, heterocyclic (e.g., imidazole, hydrazino, or hydroxylamino) groups, isocyanate or cyanate groups, or sulfur-containing groups (e.g., sulfoxides, sulfones, sulfides, or disulfides). In some examples, the alkyl moiety further comprises heterosubstitutions. In some cases, the carbon atoms of the heterocyclic group are substituted with nitrogen, oxygen, or sulfur. Examples of heterocyclic substitutions include, but are not limited to, morpholinos, imidazoles, and pyrrolidinos.

[0068] In some examples, the modification at the 2'-hydroxyl group is either 2'-O-methyl modification or 2'-O-methoxyethyl (2'-O-MOE) modification. Depending on the case, 2'-O-methyl modification adds a methyl group to the 2'-hydroxyl group of the ribose moiety, while 2'O-methoxyethyl modification adds a methoxyethyl group to the 2'-hydroxyl group of the ribose moiety. Exemplary chemical structures of the 2'-O-methyl modification of adenosine molecules and the 2'O-methoxyethyl modification of uridine are shown below.

[0069] [ka]

[0070] In some examples, the modification at the 2'-hydroxyl group is a 2'-O-aminopropyl modification in which an extended amine group containing a propyl linker attaches the amine group to the 2' oxygen. In some examples, this modification neutralizes the overall negative charge derived from the phosphate of the oligonucleotide molecule by introducing one positive charge from the amine group for each sugar, thereby improving the cellular uptake characteristics due to the zwitterionic properties. Exemplary chemical structures of 2'-O-aminopropyl nucleoside phosphoramidites are shown below.

[0071] [ka]

[0072] In some examples, the modification at the 2' hydroxyl group is a locked or crosslinked ribose modification (e.g., locked nucleic acid or LNA), in which the oxygen molecule bonded at the 2' carbon is linked to the 4' carbon by a methylene group, thus forming a 2'-C,4'-C-oxymethylene-linked bicyclic ribonucleotide monomer. Exemplary representations of the chemical structure of LNA are shown below. The representation on the left emphasizes the chemical bonding properties of the LNA monomer. The representation on the right emphasizes the locked 3'-end (3E) conformation of the furanose ring of the LNA monomer.

[0073] [ka]

[0074] In some examples, modifications at the 2'-hydroxyl group involve ethylene nucleic acids (ENAs), such as 2'-4'-ethylene-bridged nucleic acids, which lock the sugar conformation into the C3'-endoglycan puckering conformation. ENAs are further part of the bridged nucleic acid class of modified nucleic acids, including LNAs. Exemplary chemical structures of ENAs and bridged nucleic acids are shown below.

[0075] [ka]

[0076] In some embodiments, further modifications of the 2'-hydroxyl group include 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA).

[0077] In some embodiments, the nucleotide analogs are modified bases, for example, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N,-dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine, and other nucleotides having modifications at the 5-position, 5-(2-amino)propyluridine, 5-halocytidine, 5-halolysine, 4-acetylcytidine, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyluridine, 5-methyloxyuridine, diazanucleotides, for example, 7-deaza-adenosine, 6-azouridine, 6-azocytidine, 6-a This includes zothymidine, 5-methyl-2-thiouridine, other thiobases such as 2-thiouridine and 4-thiouridine and 2-thiocytidine, dihydrouridine, pseudouridine, quaesin, archaeosin, naphthyl and substituted naphthyl groups, any O- and N-alkylated purines and pyrimidines such as N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridine-4-one, pyridine-2-one, phenyl and modified phenyl groups such as aminophenol or 2,4,6-trimethoxybenzene, modified cytosine acting as a G-clamp nucleotide, 8-substituted adenine and guanine, 5-substituted uracil and thymine, azapyrimidine, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkylcarbonylalkylated nucleotides. Modified nucleotides also include nucleotides modified to the sugar moiety, as well as nucleotides having a non-ribosyl sugar or its analogue. For example, the sugar portion may be mannose, arabinose, glucopyranose, galactopyranose, 4'-thioribose, and other sugars, heterocyclic or carbocyclic, or based on them. The term nucleotide also includes those known in the art as universal bases.Examples of universal bases include, but are not limited to, 3-nitropyrrole, 5-nitroindole, or nebularin.

[0078] In some embodiments, nucleotide analogs further include morpholino, peptide nucleic acid (PNA), methylphosphonate nucleotide, thiolphosphonate nucleotide, 2'-fluoroN3-P5'-phosphoramidite, 1',5'-anhydrohexitol nucleic acid (HNA), or combinations thereof. Morphorino or phosphorodiamidate morpholino oligomers (PMOs) include synthetic molecules that mimic native nucleic acid structures by deviating from the usual sugar and phosphate structures. In some examples, a five-membered ribose ring is replaced by a six-membered morpholino ring containing four carbon atoms, one nitrogen atom, and one oxygen atom. In some cases, the ribose monomer is linked by a phosphorodiamidate group instead of a phosphate group. In such cases, the skeletal modification removes all positive and negative charges, allowing the morpholino neutral molecule to cross the cell membrane without the aid of cell delivery agents, such as those used with charged oligonucleotides.

[0079] [ka]

[0080] In some embodiments, the peptide nucleic acid (PNA) does not contain sugar rings or phosphate bonds, and the bases are attached by oligoglycine-like molecules with appropriate spacing, thereby eliminating skeletal charge.

[0081] [ka]

[0082] In some embodiments, one or more modifications occur optionally on internucleotide bonds. In some examples, the modified internucleotide bonds include phosphorothioates, phosphorodithioates, methylphosphonates, 5'-alkylenephosphonates, 5'-methylphosphonates, 3'-alkylenephosphonates, borontrifluorides, boranophosphates and selenophosphates having 3'-5' or 2'-5' bonds, phosphotriesters, thionoalkylphosphotriesters, phosphonate hydrogen bonds, alkylphosphonates, alkylphosphonothioates, arylphosphonothioates, phosphoroselenoates, phosphorodiselenoates, phosphinates, phosphoramidates, 3'-alkylphosphoramidates, aminoalkylphosphoramidates, thionophosphoramidates, and phosphoropiperadates. Examples include, but are not limited to, phosphoranilothioates, phosphoranilideates, ketones, sulfones, sulfonamides, carbonates, carbamates, methylenehydrazo, methylenedimethylhydrazo, formacetals, thioformacetals, oximes, methyleneiminos, methylenemethyliminos, thioamides, bonds to riboacetyl groups, aminoethylglycine, silyl or siloxane bonds, alkyl or cycloalkyl bonds of 1 to 10 carbon atoms, with or without heteroatoms, which may be saturated or unsaturated and / or substituted and / or contain heteroatoms, bonds to morpholino structures, amides, polyamides in which a base is directly or indirectly attached to the aza nitrogen of the skeleton, and combinations thereof. Phosphothioate antisense oligonucleotides (PS ASOs) are antisense oligonucleotides containing phosphorothioate bonds. Exemplary PS ASOs are shown below.

[0083] [ka]

[0084] In some examples, the modifications are methyl or thiol modifications, such as methylphosphonate modifications or thiolphosphonate modifications. Exemplary thiolphosphonate nucleotides (left) and methylphosphonate nucleotides (right) are shown below.

[0085] [ka]

[0086] In some examples, the modified nucleotides include, but are not limited to, the 2'-fluoroN3-P5'-phosphoramidite, as shown below.

[0087] [ka]

[0088] In some examples, modified nucleotides include, but are not limited to, hexitol nucleic acids (i.e., 1',5'-anhydrohexitol nucleic acids (HNAs)) as shown below.

[0089] [ka]

[0090] In some embodiments, the nucleotide analogs or artificial nucleotide bases described above include a 5'-vinylphosphonate modified nucleotide having a modification to the 5' hydroxyl group of the ribose moiety. In some embodiments, the 5'-vinylphosphonate modified nucleotide is selected from the nucleotides provided below, where X is O or S and B is a heterocyclic base moiety.

[0091] [ka]

[0092] In some cases, the modification at the 2' hydroxyl group is a 2'-O-aminopropyl modification in which an extended amine group containing a propyl linker attaches the amine group to the 2' oxygen. In some cases, this modification neutralizes the overall negative charge derived from the phosphate of the oligonucleotide molecule by introducing one positive charge from the amine group for each sugar, thereby improving the cellular uptake characteristics due to the zwitterionic properties.

[0093] In some cases, 5'-vinylphosphonate-modified nucleotides are further modified with locked or crosslinked ribose modifications at the 2' hydroxyl group (e.g., locked nucleic acids or LNA), in which the oxygen molecule bonded at the 2' carbon is linked to the 4' carbon by a methylene group, thus forming a 2'-C,4'-C-oxymethylene-linked bicyclic ribonucleotide monomer. An exemplary representation of the chemical structure of 5'-vinylphosphonate-modified LNA is shown below, where X is O or S, B is a heterocyclic base moiety, and J is an internucleotide linking group that links to adjacent nucleotides of the polynucleotide.

[0094] [ka]

[0095] In some embodiments, further modifications of the 2'-hydroxyl group include 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA).

[0096] In some embodiments, the nucleotide analog is a modified base, for example, but not limited to, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N,-dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine, and other nucleotides having a modification at the 5-position, 5-(2-amino )Propyluridine, 5-halocytidine, 5-halolysine, 4-acetylcytidine, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyluridine, 5-methyloxyuridine, diazanucleotide (7-deaza-adenosine, 6-azouridine, 6-azocytidine, or 6-azocytidine) This includes midins, 5-methyl-2-thiouridine, other thiobases (such as 2-thiouridine, 4-thiouridine, and 2-thiocytidine), dihydrouridine, pseudouridine, quaesin, archaeosin, naphthyl and substituted naphthyl groups, any O- and N-alkylated purines and pyrimidines (such as N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridine-4-one, or pyridine-2-one), phenyl and modified phenyl groups, such as aminophenol or 2,4,6-trimethoxybenzene, modified cytosine acting as a G-clamp nucleotide, 8-substituted adenine and guanine, 5-substituted uracil and thymine, azapyrimidine, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkylcarbonylalkylated nucleotides. 5'-vinylphosphonate-modified nucleotides may also include nucleotides modified with respect to the sugar moiety, as well as 5'-vinylphosphonate-modified nucleotides having a non-ribosyl sugar or its analogue. For example, the sugar moiety may be mannose, arabinose, glucopyranose, galactopyranose, 4'-thioribose, and other sugars, heterocyclic or carbocyclic, or based thereon.The term nucleotide includes those known in the art as universal bases. Examples of universal bases include, but are not limited to, 3-nitropyrrole, 5-nitroindole, or nebularin.

[0097] In some embodiments, 5'-vinylphosphonate-modified nucleotide analogs further include morpholino, peptide nucleic acid (PNA), methylphosphonate nucleotide, thiolphosphonate nucleotide, 2'-fluoroN3-P5'-phosphoramidite, or 1',5'-anhydrohexitol nucleic acid (HNA). Morphorino or phosphorodiamidate morpholino oligomers (PMOs) include synthetic molecules whose structure mimics that of native nucleic acid structures but deviates from the usual sugar and phosphate structures. In some examples, a five-membered ribose ring is replaced by a six-membered morpholino ring containing four carbon atoms, one nitrogen atom, and one oxygen atom. In some cases, the ribose monomer is linked by a phosphorodiamidate group instead of a phosphate group. In such cases, the skeletal modification removes all positive and negative charges, allowing the morpholino neutral molecule to pass through the cell membrane without the aid of cell delivery agents, such as those used with charged oligonucleotides. A non-restrictive example of a 5'-vinylphosphonate-modified morpholino oligonucleotide is shown below, where B is the heterocyclic base moiety.

[0098] [ka]

[0099] In some embodiments, the 5'-vinylphosphonate-modified morpholino or PMO described above is a PMO containing a positive or cationic charge. In some examples, PMO is PMOplus(Sarepta). PMOplus refers to a phosphorodiamidate morpholino oligomer containing any number of (1-piperazino)phosphenylideneoxy, (1-(4-(omega-guanidino-alkanoyl))-piperazino)phosphenylidenoxy bonds (e.g., as described in International Publication No. 2008 / 036127). In some cases, PMO is the PMO described in U.S. Patent No. 7,943,762.

[0100] In some embodiments, the morpholino or PMO described above is PMO-X (Sarepta). In some cases, PMO-X refers to a phosphorodiamidate morpholino oligomer comprising at least one bond or terminal modification disclosed, e.g., those disclosed in International Publication No. 2011 / 150408 and U.S. Patent Application Publication No. 2012 / 0065169.

[0101] In some embodiments, the morpholino or PMO described above is the PMO listed in Table 5 of U.S. Patent Application Publication No. 2014 / 0296321.

[0102] An exemplary representation of the chemical structure of a 5'-vinylphosphonate-modified nucleic acid is shown below, where X is O or S, B is a heterocyclic base moiety, and J is an internucleotide bond.

[0103] [ka]

[0104] In some embodiments, one or more modifications of the 5'-vinylphosphonate modified oligonucleotide occur optionally in the internucleotide bond. In some examples, the modified internucleotide bond may be phosphorothioate, phosphorodithioate, methylphosphonate, 5'-alkylenephosphonate, 5'-methylphosphonate, 3'-alkylenephosphonate, borontrifluoride, boranophosphate and selenophosphate having a 3'-5' or 2'-5' bond, phosphotriester, thionoalkylphosphotriester, phosphonic acid hydrogen bond, alkylphosphonate, alkylphosphonothioate, arylphosphonothioate, phosphoroselenoate, phosphorodiselenoate, phosphineate, phosphoramide, 3'-alkylphospholamidate, aminoalkylphospholamidate, thionophospholamidate, phosphoropiperadate, Examples include, but are not limited to, sphoroanilothioates, phosphoranilides, ketones, sulfones, sulfonamides, carbonates, carbamates, methylenehydrazo, methylenedimethylhydrazo, formacetals, thioformacetals, oximes, methyleneiminos, methylenemethyliminos, thioamides, bonds to riboacetyl groups, aminoethylglycine, silyl or siloxane bonds, alkyl or cycloalkyl bonds of 1 to 10 carbon atoms, with or without heteroatoms, which may be saturated or unsaturated and / or substituted and / or contain heteroatoms, bonds to morpholino structures, amides, or polyamides in which a base is directly or indirectly attached to the aza nitrogen of the skeleton, and combinations thereof.

[0105] In some examples, the modifications are methyl or thiol modifications, such as methylphosphonate modifications or thiolphosphonate modifications. Exemplary thiolphosphonate nucleotides (left), phosphorodithioates (center), and methylphosphonate nucleotides (right) are shown below.

[0106] [ka]

[0107] Some examples of 5'-vinylphosphonate modified nucleotides include, but are not limited to, phosphoramidites shown below.

[0108] [ka]

[0109] In some cases, the bond between modified nucleotides is a phosphorodiamidate bond. A non-restrictive example of phosphorodiamidate bonding with morpholino systems is shown below.

[0110] [ka]

[0111] In some cases, the bond between modified nucleotides is a methylphosphonate bond. A non-restrictive example of a methylphosphonate bond is shown below.

[0112] [ka]

[0113] In some cases, the bond between modified nucleotides is an amide bond. Non-specific examples of amide bonds are shown below.

[0114] [ka]

[0115] In some examples, 5'-vinylphosphonate modified nucleotides include, but are not limited to, the modified nucleic acids shown below.

[0116] [ka]

[0117] In the formula, B is the heterocyclic base portion.

[0118] [ka]

[0119] In the formula, B is the heterocyclic base portion.

[0120] R4 and R5 are independently selected from hydrogen, halogen, alkyl, or alkoxy.

[0121] J is an internucleotide linking group that connects to adjacent nucleotides in a polynucleotide.

[0122] [ka]

[0123] In the formula, B is the heterocyclic base portion.

[0124] R6 is selected from hydrogen, halogen, alkyl, or alkoxy.

[0125] J is an internucleotide linking group that connects to adjacent nucleotides in a polynucleotide.

[0126] [ka]

[0127] In the formula, B is the heterocyclic base portion.

[0128] J is an internucleotide linking group that connects to adjacent nucleotides in a polynucleotide.

[0129] [ka]

[0130] In the formula, B is the heterocyclic base portion.

[0131] J is an internucleotide linking group that connects to adjacent nucleotides in a polynucleotide.

[0132] [ka]

[0133] In the formula, B is the heterocyclic base portion.

[0134] R6 is selected from hydrogen, halogen, alkyl, or alkoxy.

[0135] J is an internucleotide linking group that connects to adjacent nucleotides in a polynucleotide.

[0136] In some embodiments, the PMO molecule of the PMO-antibody conjugate comprises multiple phosphorodiamidate morpholino oligomers or multiple peptide nucleic acid-modified non-natural nucleotides, and optionally comprises at least one inverted debasement moiety. In some examples, the PMO molecule comprises at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more phosphorodiamidate morpholino oligomer-modified non-natural nucleotides. In some examples, the PMO molecule comprises 100% phosphorodiamidate morpholino oligomer-modified non-natural nucleotides.

[0137] In some examples, the PMO molecule in the PMO-antibody conjugate contains at least one of the following modifications: approximately 5% to approximately 100%, approximately 10% to approximately 100%, approximately 20% to approximately 100%, approximately 30% to approximately 100%, approximately 40% to approximately 100%, approximately 50% to approximately 100%, approximately 60% to approximately 100%, approximately 70% to approximately 100%, approximately 80% to approximately 100%, and approximately 90% to approximately 100%.

[0138] Depending on the circumstances, one or more of the artificial nucleotide analogs described herein may exhibit resistance to nucleases such as ribonucleases including RNase H, deoxyribonucleases including DNase, or exonucleases such as 5'-3' exonucleases and 3'-5' exonucleases, compared to natural polynucleic acid molecules. In some examples, artificial nucleotide analogs, including 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA) modifications, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'-fluoroN3-P5'-phosphoramidite, or combinations thereof, are RNases. It exhibits resistance to nucleases such as ribonucleases like RNase H, deoxyribonucleases like DNase, or exonucleases such as 5'-3' exonucleases and 3'-5' exonucleases. In some cases, 2'-O-methyl modified polynucleic acid molecules exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). In some cases, 2'O-methoxyethyl (2'-O-MOE) modified polynucleic acid molecules exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). In some cases, 2'-O-aminopropyl modified polynucleic acid molecules exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). In some cases, 2'-deoxy-modified polynucleic acid molecules exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease).In some cases, 2'-deoxy-2'-fluoro-modified polynucleic acid molecules exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). In some cases, 2'-O-aminopropyl (2'-O-AP)-modified polynucleic acid molecules exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). In some cases, 2'-O-dimethylaminoethyl (2'-O-DMAOE)-modified polynucleic acid molecules exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). In some cases, 2'-O-dimethylaminopropyl (2'-O-DMAP) modified polynucleic acid molecules exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). In some cases, 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modified polynucleic acid molecules exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). In some cases, 2'-O-methylacetamide (2'-O-NMA) modified polynucleic acid molecules exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). In some cases, LNA-modified polynucleic acid molecules exhibit nuclease resistance (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistance). In some cases, ENA-modified polynucleic acid molecules exhibit nuclease resistance (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistance). In some cases, HNA-modified polynucleic acid molecules exhibit nuclease resistance (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistance). In some cases, morpholino exhibits nuclease resistance (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistance).In some cases, PNA-modified polynucleic acid molecules exhibit resistance to nucleases (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). In some cases, methylphosphonate-modified polynucleic acid molecules exhibit resistance to nucleases (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). In some cases, thiolphosphonate-modified polynucleic acid molecules exhibit resistance to nucleases (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). In some cases, polynucleic acid molecules containing 2'-fluoroN3-P5'-phosphoramidite exhibit resistance to nucleases (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). In some cases, the 5' conjugate described herein inhibits 5'-3' exonucleolytic cleavage. In some cases, the 3' conjugate described herein inhibits 3'-5' exonucleolytic cleavage.

[0139] Polynucleotide molecule synthesis In some embodiments, the polynucleic acid molecules described herein are constructed using chemical synthesis and / or enzymatic ligation reactions employing procedures known in the art. For example, polynucleic acid molecules are chemically synthesized using naturally occurring nucleotides or various modified nucleotides designed to increase the biological stability of the molecule or the physical stability of the double strand formed between the polynucleic acid molecule and the target nucleic acid. Illustrative methods are described in U.S. Patents No. 5,142,047, 5,185,444, 5,889,136, 6,008,400, and 6,111,086, International Publication No. 2009099942, or European Patent Application Publication No. 1579015.Further exemplary methods include "2'-O-aminopropyl ribonucleotides: a zwitterionic modification that enhances the exonuclease resistance and biological activity of antisense oligonucleotides" by Griffey et al., J.Med.Chem. 39(26): pp. 5100-5109 (1997); "Synthesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C3,-endo sugar puckering" by Obika et al., Tetrahedron Letters 38(50): pp. 8735 (1997); "ENA oligonucleotides as therapeutics" by Koizumi, M., Current opinion in molecular therapeutics 8(2): pp. 144-149 (2006); and "Novel oligonucleotide analogues based on morpholino nucleoside subunits-antisense technologies: new chemical" by Abramova et al. Possibilities can be found in "Possibilities," Indian Journal of Chemistry 48B:1721~1726 (2009). Alternatively, polynucleotide molecules can be biologically produced using expression vectors in which the polynucleotide molecule is subcloned in antisense orientation (i.e., the RNA transcribed from the inserted polynucleotide molecule is antisense-oriented relative to the target polynucleotide molecule of interest).

[0140] In some embodiments, polynucleic acid molecules are synthesized by a tandem synthesis method, in which case both strands are synthesized as a single continuous oligonucleotide fragment or chain separated by a cleavable linker, and subsequently cleaved to provide separate fragments or chains that hybridize the double hemisphere and allow for its purification.

[0141] For example, as a further modification method for incorporating sugar modification, base modification, and phosphate modification, see: International Publication No. 92 / 07065 by Eckstein et al.; Nature, 1990, pp. 344, 565-568 by Perrault et al.; Science, 1991, pp. 253, 314-317 by Pieken et al.; Trends in Biochem. Sci., 1992, 17, pp. 334-339; International Publication 93 / 15187 by Usman; U.S. Patent No. 5,334,711 by Sproat; J. Biol. Chem., 270, 25702, 1995 by Beigelman et al.; International Publication No. 97 / 26270 by Beigelman et al.; U.S. Patent No. 5,716,824 by Beigelman et al.; U.S. Patent No. 5,627,053 by Usman et al.; International Publication No. 98 / 13526 by Woolf et al.; U.S. Provisional Patent Application No. 60 / 082,404 filed April 20, 1998 by Thompson et al.; Tetrahedron, 1998 by Karpeisky et al. Examples include Lett., 39, 1131; Earnshaw and Gait, 1998, Biopolymers (Nucleic Acid Sciences), 48, 39-55; Verma and Eckstein, 1998, Annu. Rev. Biochem., 67, 99-134; and Burlina et al., 1997, Bioorg. Med. Chem., 5, 1999-2010. These publications describe general methods and strategies for determining the incorporation sites of sugar, base, and / or phosphate modifications into nucleic acid molecules without modulating catalysis.

[0142] In some cases, chemical modification of the internucleotide bonds of polynucleic acid molecules using phosphorothioates, phosphorodithioates, and / or 5'-methylphosphonate bonds improves stability; however, excessive modification can lead to toxicity or decreased activity. Therefore, when designing nucleic acid molecules, the amount of these internucleotide bonds is sometimes kept to a minimum. In such cases, reducing the concentration of these bonds reduces the toxicity of these molecules, increases their efficacy, and enhances their specificity.

[0143] antibody In some embodiments, the antibody or its antigen-binding fragment includes a humanized antibody or its antigen-binding fragment, a mouse antibody or its antigen-binding fragment, a chimeric antibody or its antigen-binding fragment, a monoclonal antibody or its antigen-binding fragment, a monovalent Fab', a bivalent Fab2, an F(ab)'3 fragment, a single-chain variable fragment (scFv), a bis-scFv, (scFv)2, a diabody, a minibody, a nanobody, a triabody, a tetrabody, a disulfide-stabilized Fv protein (dsFv), a single-domain antibody (sdAb), an Ig NAR, a camelid antibody or its antigen-binding fragment, a bispecific antibody or its antigen-binding fragment, or a chemically modified derivative thereof.

[0144] In some cases, the antibody is an anti-transferrin receptor (anti-CD71) antibody or its antigen-binding fragment. In some cases, the anti-transferrin receptor antibody is a humanized antibody or its antigen-binding fragment. In other cases, the anti-transferrin receptor antibody is a chimeric antibody or its antigen-binding fragment. Further cases, the anti-transferrin receptor antibody is a monovalent, bivalent, or polyvalent antibody or its antigen-binding fragment. In some embodiments, exemplary anti-transferrin receptor antibodies or their antigen-binding fragments include MAB5746 from R&D Systems, AHP858 from Bio-Rad Laboratories, A80-128A from Bethyl Laboratories, Inc., and T2027 from MilliporeSigma. In some embodiments, examples of anti-transferrin receptor antibodies or their antigen-binding fragments include antibodies disclosed in U.S. Patent No. 10,913,800 or U.S. Patent No. 11,028,179.

[0145] In some examples, the anti-transferrin receptor antibody comprises a variable heavy chain (VH) region and a variable light chain (VL) region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of EINPIX1GRSNYAX2KFQG (SEQ ID NO: 12), where X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19.

[0146] In some embodiments, the VH region of the anti-transferring antibody includes HCDR1, HCDR2, and HCDR3 sequences selected from Table 2.

[0147] [Table 3]

[0148] In some embodiments, the VH region includes an HCDR1 sequence containing or consisting of the sequence of sequence number 17, an HCDR2 sequence containing or consisting of the sequence of sequence number 18, 20, or 21, and an HCDR3 sequence containing or consisting of the sequence of sequence number 19. In some examples, the VH region includes an HCDR1 sequence containing or consisting of the sequence of sequence number 17, an HCDR2 sequence containing or consisting of the sequence of sequence number 18, and an HCDR3 sequence containing or consisting of the sequence of sequence number 19. In some examples, the VH region includes an HCDR1 sequence containing or consisting of the sequence of sequence number 17, an HCDR2 sequence containing or consisting of the sequence of sequence number 20, and an HCDR3 sequence containing or consisting of the sequence of sequence number 19. In some examples, the VH region includes an HCDR1 sequence containing or consisting of the sequence of sequence number 17, an HCDR2 sequence containing or consisting of the sequence of sequence number 21, and an HCDR3 sequence containing or consisting of the sequence of sequence number 19.

[0149] In some embodiments, the VL region of the anti-transferrin receptor antibody includes an LCDR1 sequence containing or consisting of the sequence RTSENIYX3NLA (SEQ ID NO: 13), an LCDR2 sequence containing or consisting of the sequence AX4TNLAX5 (SEQ ID NO: 14), and an LCDR3 sequence containing or consisting of the sequence QHFWGTPLTX6 (SEQ ID NO: 15), where X3 is selected from N or S, X4 is selected from A or G, X5 is selected from D or E, and X6 may or may not be present, and if present, is F.

[0150] In some embodiments, the VL region of the anti-transferrin receptor antibody includes an LCDR1 sequence, an LCDR2 sequence, and an LCDR3 sequence selected from Table 3.

[0151] [Table 4]

[0152] In some examples, the VL region includes an LCDR1 sequence containing or consisting of the sequence of sequence number 13, an LCDR2 sequence containing or consisting of the sequences of sequence numbers 23, 25, or 28, and an LCDR3 sequence containing or consisting of the sequence of sequence number 24 or 26, where X3 is selected from N or S.

[0153] In some examples, the VL region includes an LCDR1 sequence containing or consisting of sequence number 22 or 27, an LCDR2 sequence containing or consisting of sequence number 14, and an LCDR3 sequence containing or consisting of sequence number 24 or 26, where X4 is selected from A or G and X5 is selected from D or E.

[0154] In some examples, the VL region includes an LCDR1 sequence containing or consisting of sequence number 22 or 27, an LCDR2 sequence containing or consisting of sequence number 23, 25, or 28, and an LCDR3 sequence containing or consisting of sequence number 15, and X6 may or may not be present, and if present it is F.

[0155] In some examples, the VL region includes an LCDR1 sequence containing or consisting of the sequence of sequence number 22, an LCDR2 sequence containing or consisting of the sequence of AATNLAX5 (sequence number 16), and an LCDR3 sequence containing or consisting of the sequence of sequence number 15, where X5 is selected from D or E, and X6 may or may not exist, if present it is F.

[0156] In some examples, the VL region includes an LCDR1 sequence containing or consisting of the sequence of sequence number 22, an LCDR2 sequence containing or consisting of the sequence of sequence number 23, and an LCDR3 sequence containing or consisting of the sequence of sequence number 24.

[0157] In some examples, the VL region includes an LCDR1 sequence containing or consisting of the sequence of sequence number 22, an LCDR2 sequence containing or consisting of the sequence of sequence number 25, and an LCDR3 sequence containing or consisting of the sequence of sequence number 26.

[0158] In some examples, the VL region includes an LCDR1 sequence containing or consisting of the sequence of sequence number 27, an LCDR2 sequence containing or consisting of the sequence of sequence number 28, and an LCDR3 sequence containing or consisting of the sequence of sequence number 26.

[0159] In some embodiments, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, the VL region comprising an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 13, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 14, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 15, wherein X3 is selected from N or S, X4 is selected from A or G, X5 is selected from D or E, and X6 may or may not be present, and if present, is F.

[0160] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 12, where X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, the VL region comprising an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 13, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24 or 26, where X3 is selected from N or S.

[0161] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 12, where X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 14, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 24 or 26, where X4 is selected from A or G and X5 is selected from D or E.

[0162] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 12, where X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 15, where X6 may or may not be present, and if present, is F.

[0163] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 12, where X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 16, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 15, where X5 is selected from D or E, and X6 may or may not be present, if present being F.

[0164] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, the VL region comprising an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24.

[0165] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 25, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 26.

[0166] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 26.

[0167] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 13, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 24 or 26, where X3 is selected from N or S.

[0168] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 14, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 24 or 26; X4 is selected from A or G, and X5 is selected from D or E.

[0169] In some examples, the anti-transferrin receptor antibody includes a VH region and a VL region, the VH region includes an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region includes an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 15; and X6 may or may not be present, and if present, it is F.

[0170] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 16, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 15; X5 is selected from D or E; X6 is present or absent, and if present, is F.

[0171] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19, and the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 23, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 24.

[0172] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19, and the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 21, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 26.

[0173] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19, and the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 27, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 28, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 26.

[0174] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 13, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 24 or 26, where X3 is selected from N or S.

[0175] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 14, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 24 or 26; X4 is selected from A or G, and X5 is selected from D or E.

[0176] In some examples, the anti-transferrin receptor antibody includes a VH region and a VL region, the VH region includes an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19, the VL region includes an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 15, and X6 may or may not be present, and if present, it is F.

[0177] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 16, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 15; X5 is selected from D or E; X6 is present or absent, and if present, is F.

[0178] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19, and the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 23, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 24.

[0179] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19, and the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 25, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 26.

[0180] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19, and the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 27, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 28, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 26.

[0181] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 13, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 24 or 26, where X3 is selected from N or S.

[0182] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 14, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 24 or 26; X4 is selected from A or G, and X5 is selected from D or E.

[0183] In some examples, the anti-transferrin receptor antibody includes a VH region and a VL region, the VH region includes an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region includes an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 15; and X6 may or may not be present, and if present, it is F.

[0184] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19; the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 16, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 15; X5 is selected from D or E; X6 is present or absent, and if present, is F.

[0185] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19, and the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 23, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 24.

[0186] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19, and the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 25, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 26.

[0187] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 19, and the VL region comprising an LCDR1 sequence containing or consisting of the sequence of SEQ ID NO: 27, an LCDR2 sequence containing or consisting of the sequence of SEQ ID NO: 28, and an LCDR3 sequence containing or consisting of the sequence of SEQ ID NO: 26.

[0188] In some embodiments, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the sequence of the VH region contains or comprises a sequence having approximately 80%, approximately 85%, approximately 90%, approximately 95%, approximately 96%, approximately 97%, approximately 98%, approximately 99%, or approximately 100% sequence identity with a sequence selected from SEQ ID NOs. 29-33, and the sequence of the VL region contains or comprises a sequence having approximately 80%, approximately 85%, approximately 90%, approximately 95%, approximately 96%, approximately 97%, approximately 98%, approximately 99%, or approximately 100% sequence identity with a sequence selected from SEQ ID NOs. 34-38. In some embodiments, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the sequence of the VH region contains or comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with a sequence selected from sequences of SEQ ID NOs. 29 to 33, and the sequence of the VL region contains or comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with a sequence selected from sequences of SEQ ID NOs. 34 to 38.

[0189] In some embodiments, the VH region contains or consists of sequences selected from sequence numbers 29-33 (Table 4), and the VL region contains or consists of sequences selected from sequence numbers 34-38 (Table 5). The underlined regions in Tables 4 and 5 indicate the respective CDR1, CDR2, or CDR3 sequences.

[0190] [Table 5]

[0191] [Table 6]

[0192] In some embodiments, the anti-transferrin receptor antibody includes the VH region and VL region as illustrated in Table 6.

[0193] [Table 7]

[0194] In some embodiments, the anti-transferrin receptor antibodies described herein include an IgG framework, an IgA framework, an IgE framework, or an IgM framework. In some examples, the anti-transferrin receptor antibody includes an IgG framework (e.g., IgG1, IgG2, IgG3, or IgG4). In some cases, the anti-transferrin receptor antibody includes an IgG1 framework. In some cases, the anti-transferrin receptor antibody includes an IgG2 (e.g., IgG2a or IgG2b) framework. In some cases, the anti-transferrin receptor antibody includes an IgG2a framework. In some cases, the anti-transferrin receptor antibody includes an IgG2b framework. In some cases, the anti-transferrin receptor antibody includes an IgG3 framework. In some cases, the anti-transferrin receptor antibody includes an IgG4 framework.

[0195] In some cases, anti-transferrin receptor antibodies contain one or more mutations in the framework region, e.g., the CH1 domain, CH2 domain, CH3 domain, hinge region, or a combination thereof. In some cases, one or more mutations are intended to stabilize the antibody and / or extend its half-life. In some cases, one or more mutations are intended to modulate Fc receptor interactions and reduce or eliminate Fc effector functions such as FcyR, antibody-dependent cell-mediated cytotoxicity (ADCC), or complement-dependent cytotoxicity (CDC). In further cases, one or more mutations are intended to modulate glycosylation.

[0196] In some embodiments, one or more mutations are located in the Fc region. In some examples, the Fc region contains mutations at residue positions L234, L235, or a combination thereof. In some examples, the mutations include L234 and L235. In some examples, the mutations include L234A and L235A. In some cases, the residue positions relate to IgG1.

[0197] In some cases, the Fc region contains mutations at residue positions L234, L235, D265, N21, K46, L52, or P53, or combinations thereof. In some cases, the mutations include L234 and L235 in combination with mutations at residue positions K46, L52, or P53. In some cases, the Fc region contains mutations at L234, L235, and K46. In some cases, the Fc region contains mutations at L234, L235, and L52. In some cases, the Fc region contains mutations at L234, L235, and P53. In some cases, the Fc region contains mutations at D265 and N21. In some cases, the residue positions relate to IgG1.

[0198] In some cases, the Fc region includes L234A, L235A, D265A, N21G, K46G, L52R, or P53G, or a combination thereof. In some cases, the Fc region includes L234A and L235A in combination with K46G, L52R, or P53G. In some cases, the Fc region includes L234A, L235A, and K46G. In some cases, the Fc region includes L234A, L235A, and L52R. In some cases, the Fc region includes L234A, L235A, and P53G. In some cases, the Fc region includes D265A and N21G. In some cases, the residue position is related to IgG1.

[0199] In some cases, the Fc region contains mutations or combinations of mutations at residue positions L235, L236, D265, N21, K46, L52, or P53. In some cases, the Fc region contains mutations at L235 and L236. In some cases, the Fc region contains mutations at L235 and L236 in combination with mutations at residue positions K46, L52, or P53. In some cases, the Fc region contains mutations at L235, L236, and K46. In some cases, the Fc region contains mutations at L235, L236, and L52. In some cases, the Fc region contains mutations at L235, L236, and P53. In some cases, the Fc region contains mutations at D265 and N21. In some cases, the residue positions relate to IgG2b.

[0200] In some embodiments, the Fc region includes L235A, L236A, D265A, N21G, K46G, L52R, or P53G, or a combination thereof. In some examples, the Fc region includes L235A and L236A. In some examples, the Fc region includes L235A and L236A in combination with K46G, L52R, or P53G. In some cases, the Fc region includes L235A, L236A, and K46G. In some cases, the Fc region includes L235A, L236A, and L52R. In some cases, the Fc region includes L235A, L236A, and P53G. In some cases, the Fc region includes D265A and N21G. In some cases, the residue position relates to IgG2b.

[0201] In some embodiments, the Fc region contains mutations at residue positions L233, L234, D264, N20, K45, L51, or P52, where the residues correspond to positions 233, 234, 264, 20, 45, 51, and 52 of SEQ ID NO: 39. In some examples, the Fc region contains mutations at L233 and L234. In some examples, the Fc region contains mutations at L233 and L234 in combination with mutations at residue positions K45, L51, or P52. In some cases, the Fc region contains mutations at L233, L234, and K45. In some cases, the Fc region contains mutations at L233, L234, and L51. In some cases, the Fc region contains mutations at L233, L234, and K45. In some cases, the Fc region contains mutations at L233, L234, and P52. In some examples, the Fc region contains mutations at D264 and N20. In some cases, the intended positions are those equivalent to residues L233, L234, D264, N20, K45, L51, or P52 in the IgG1, IgG2, IgG3, or IgG4 framework. In some cases, mutations are also intended for residues corresponding to residues L233, L234, D264, N20, K45, L51, or P52 in Sequence ID No. 39 in the IgG1, IgG2, or IgG4 framework.

[0202] In some embodiments, the Fc region includes L233A, L234A, D264A, N20G, K45G, L51R, or P52G, with residues corresponding to positions 233, 234, 264, 20, 45, 51, and 52 of SEQ ID NO: 39. In some examples, the Fc region includes L233A and L234A. In some examples, the Fc region includes L233A and L234A in combination with K45G, L51R, or P52G. In some cases, the Fc region includes L233A, L234A, and K45G. In some cases, the Fc region includes L233A, L234A, and L51R. In some cases, the Fc region includes L233A, L234A, and K45G. Depending on the case, the Fc region may include L233A, L234A, and P52G. Depending on the case, the Fc region may include D264A and N20G.

[0203] In some embodiments, the constant region of human IgG is, for example, Natsume et al., 2008 Cancer Res, 68(10): pp. 3863-72; Idusogie et al., 2001 J Immunol, 166(4): pp. 2571-75; Moore et al., 2010 mAbs, 2(2): pp. 181-189; Lazar et al., 2006 PNAS, 103(11): pp. 4005-4010; Shields et al., 2001 JBC, 276(9): pp. 6591-6604; Stavenhagen et al., 2007 Cancer Res, 67(18): pp. 8882-8890; Stavenhagen et al., 2008 Advan. Enzyme Regul., 48: pp. 152-164; Alegre et al., 1992 J The amino acid modifications described in Immunol, 148: pp. 3461-3468; Reviewed in Kaneko and Niwa, 2011 Biodrugs, 25(1): pp. 1-11 are used to alter antibody-dependent cell-mediated cytotoxicity (ADCC) and / or complement-dependent cell-mediated cytotoxicity (CDC).

[0204] In some embodiments, the anti-transferrin receptor antibodies described herein are full-length antibodies comprising a heavy chain (HC) and a light chain (LC). The heavy chain (HC) may contain a sequence selected from Table 7. The light chain (LC) may contain a sequence selected from Table 8. Underlined regions indicate the respective CDRs.

[0205] [Table 8-1]

[0206] [Table 8-2]

[0207] [Table 8-3]

[0208] [Table 8-4]

[0209] [Table 8-5]

[0210] [Table 9]

[0211] In some embodiments, the anti-transferrin receptor antibodies described herein have an improved serum half-life compared to a reference anti-transferrin receptor antibody. In some examples, the improved serum half-life is at least 30 minutes, 1 hour, 1.5 hours, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 14 days, 30 days, or longer than that of the reference anti-transferrin receptor antibody.

[0212] In some embodiments, an antibody or its antigen-binding fragment is further modified using conventional techniques known in the art, for example, by the use of amino acid deletions, insertions, substitutions, and additions, and / or by the use of recombination and / or any other modifications known in the art (e.g., post-translational modifications such as glycosylation and phosphorylation, and chemical modifications), either alone or in combination. In some examples, the modifications further include modifications to modulate interaction with the Fc receptor. In some examples, one or more modifications include, for example, those described in International Publication 97 / 34631, which discloses amino acid residues involved in the interaction between the Fc domain and the FcRn receptor. Methods for introducing such modifications into the nucleic acid sequence underlying the amino acid sequence of an antibody or its binding fragment are well known to those skilled in the art.

[0213] In some cases, the antibody or its antigen-binding fragment comprises a polypeptide sequence that further includes its derivatives and contains at least one CDR.

[0214] In some examples, the term “single-chain” as used herein means that the first and second domains of a bispecific single-chain construct are covalently linked in the form of a collinear amino acid sequence that can be encoded by a single nucleic acid molecule, preferably.

[0215] In some examples, a bispecific single-chain antibody construct relates to a construct containing two antibody-derived binding domains. In such embodiments, the bispecific single-chain antibody construct is tandem with respect to a bi-scFv or diabody. In some examples, the scFv contains VH and VL domains linked by a linker peptide. In some examples, the linker has sufficient length and sequence to ensure that each of the first and second domains independently maintains their different binding specificities.

[0216] In some embodiments, binding or interaction, as used herein, defines the binding / interaction of at least two antigen interaction sites to each other. In some examples, an antigen interaction site defines a polypeptide motif that exhibits the ability to specifically interact with a specific antigen or a specific group of antigens. In some cases, binding / interaction is also understood to define specific recognition. In such cases, specific recognition refers to whether an antibody or its binding fragment can specifically interact with and / or bind to at least two amino acids of a target molecule. For example, specific recognition relates to the specificity of an antibody molecule, or the ability of an antibody molecule to discriminate a specific region of a target molecule. In further examples, the specific interaction of an antigen interaction site with its specific antigen results in the initiation of a signal, for example, due to the induction of a change in the conformation of the antigen, oligomerization of the antigen, etc. In further embodiments, binding is illustrated by the specificity of the "key-lock principle". Therefore, in some cases, antigen interaction sites and specific motifs in the amino acid sequence of the antigen bind to each other as a result of their primary, secondary, or tertiary structures, as well as as a result of secondary modifications of these structures. In such cases, the specific interaction between the antigen interaction site and its specific antigen also results in simple binding of the site to the antigen.

[0217] In some cases, specific interactions further refer to reduced cross-reactivity of an antibody or its binding fragment, or a reduction in off-target effects. For example, an antibody or its antigen-binding fragment that binds to a target polypeptide / protein but does not bind to or is essentially not bound to any other polypeptide is considered specific to the target polypeptide / protein. Examples of specific interactions between an antigen interaction site and a specific antigen include the specificity of a ligand to its receptor, e.g., the interaction between an antigenic determinant (epitope) and the antigen-binding site of an antibody.

[0218] Therefore, in some examples, the polynucleic acid molecule conjugate comprises a polynucleic acid molecule (e.g., a PMO molecule) containing or consisting of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs. 100-133, and an anti-transferrin receptor antibody or its antigen-binding fragment conjugated to the polynucleic acid such that the polynucleic acid molecule conjugate induces exon skipping of the pre-mRNA of the DMD gene.

[0219] In a particular embodiment, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or its antigen-binding fragment conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to the sequence of a target region of the pre-mRNA transcript of the DMD gene, wherein the polynucleic acid molecule has a sense chain comprising or having a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs. 100-133, and the anti-transferrin receptor antibody or its antigen-binding fragment comprises a variable heavy chain (VH) region and a variable light chain (VL) region. The VH region includes an HCDR1 sequence containing or consisting of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of SEQ ID NO: 20, and an HCDR3 sequence containing or consisting of SEQ ID NO: 19; the VL region includes an LCDR1 sequence containing or consisting of SEQ ID NO: 22, an LCDR2 sequence containing or consisting of SEQ ID NO: 23, and an LCDR3 sequence containing or consisting of SEQ ID NO: 24; and the anti-transferrin receptor antibody or its antigen-binding fragment and polynucleic acid molecule are conjugated via a linker containing 4-(N-maleimidomethyl)cyclohexane-1-amidate (SMCC).

[0220] In a particular embodiment, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or its antigen-binding fragment conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to the sequence of a target region of the pre-mRNA transcript of the DMD gene, wherein the polynucleic acid molecule contains or comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs. 100-133, and the anti-transferrin receptor antibody or The antigen-binding fragment comprises a variable heavy chain (VH) region and a variable light chain (VL) region, wherein the VH region contains or comprises a sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 30, and the VL region contains or comprises a sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 34, and the anti-transferrin receptor antibody or its antigen-binding fragment and polynucleic acid molecule are conjugated via a maleimide linker.

[0221] In a particular embodiment, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or its antigen-binding fragment conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to the sequence of a target region of the pre-mRNA transcript of the DMD gene, wherein the polynucleic acid molecule contains or comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs. 100-133, wherein the polynucleic acid molecule has at least 3, 4, 5, or 6 consecutive 2'-O-methyl-modified nucleotides at its 5' end, and at least 2 The anti-transferrin receptor antibody or its antigen-binding fragment comprises at least three 2'-F modified nucleotides, and includes a variable heavy chain (VH) region and a variable light chain (VL) region, wherein the VH region contains or comprises a sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 30, and the VL region contains or comprises a sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 34, and the anti-transferrin receptor antibody or its antigen-binding fragment and the polynucleic acid molecule are conjugated via a maleimide linker.

[0222] In a particular embodiment, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or its antigen-binding fragment conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to the sequence of a target region of the pre-mRNA transcript of a DMD gene, wherein the polynucleic acid molecule comprises or comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs. 100-133, wherein the polynucleic acid molecule has at least two, at least three, at least four, or at least five consecutive 2'-O-methyl-modified nucleotides at its 3' end, and at least one, at least two, and at least The anti-transferrin receptor antibody or its antigen-binding fragment comprises three, or at least four, 2'-F modified nucleotides, and comprises a variable heavy chain (VH) region and a variable light chain (VL) region, wherein the VH region comprises an HCDR1 sequence containing or consisting of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of SEQ ID NO: 20, and an HCDR3 sequence containing or consisting of SEQ ID NO: 19, and the VL region comprises an LCDR1 sequence containing or consisting of SEQ ID NO: 22, an LCDR2 sequence containing or consisting of SEQ ID NO: 23, and an LCDR3 sequence containing or consisting of SEQ ID NO: 24, and the anti-transferrin receptor antibody or its antigen-binding fragment and the polynucleic acid molecule are conjugated via a maleimide linker.

[0223] In a particular embodiment, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or its antigen-binding fragment conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to the sequence of a target region of the pre-mRNA transcript of the DMD gene, wherein the polynucleic acid molecule contains or comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs. 100-133, and the polynucleic acid molecule comprises one or more 2'-O-methyl-modified nucleotides at the 5' and / or 3' ends of the polynucleic acid molecule, and anti-transferrin The transferrin receptor antibody or its antigen-binding fragment comprises a variable heavy chain (VH) region and a variable light chain (VL) region, wherein the VH region comprises an HCDR1 sequence containing or consisting of SEQ ID NO: 17, an HCDR2 sequence containing or consisting of SEQ ID NO: 18, and an HCDR3 sequence containing or consisting of SEQ ID NO: 19, and the VL region comprises an LCDR1 sequence containing or consisting of SEQ ID NO: 22, an LCDR2 sequence containing or consisting of SEQ ID NO: 3, and an LCDR3 sequence containing or consisting of SEQ ID NO: 24, and the anti-transferrin receptor antibody or its antigen-binding fragment and polynucleic acid molecules are conjugated via a maleimide linker.

[0224] In a particular embodiment, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or its antigen-binding fragment conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to a target sequence of the pre-mRNA transcript of the DMD gene, wherein the polynucleic acid molecule comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs. 100-133, and the anti-transferrin receptor antibody or its antigen-binding fragment comprises a variable heavy chain (VH) region and a variable light chain (VL) region. The VH region includes or comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to one of SEQ ID NOs. 29-33, and the VL region includes or comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NOs. 34-38, and the anti-transferrin receptor antibody or its antigen-binding fragment and the polynucleic acid molecule are conjugated via a 6-amino-1-hexanol linker. In some examples, the polynucleic acid molecule contains at least one or more 2'-modified nucleotides. In some examples, the polynucleic acid molecule contains at least five consecutive 2'-O-methyl-modified nucleotides at its 3' end. In some examples, the polynucleic acid molecule contains at least three or at least four 2'-F-modified nucleotides, any two of which are not consecutive.

[0225] In some embodiments, the antibody or its antigen-binding fragment is non-specifically conjugated to any of the PMO molecules disclosed herein. In some examples, the antibody or its antigen-binding fragment is non-site-specifically conjugated to any of the PMO molecules disclosed herein via a lysine residue or a cysteine ​​residue. In some examples, the antibody or its antigen-binding fragment is non-site-specifically conjugated to any of the PMO molecules disclosed herein via a lysine residue. In some cases, the antibody or its antigen-binding fragment is non-site-specifically conjugated to any of the PMO molecules disclosed herein via a cysteine ​​residue.

[0226] In some embodiments, an antibody or its antigen-binding fragment is site-specifically conjugated to one of the PMO molecules disclosed herein. In some examples, an antibody or its antigen-binding fragment is site-specifically conjugated to one of the PMO molecules disclosed herein via a lysine residue, a cysteine ​​residue, at the 5' end, at the 3' end, via a non-native amino acid, or via an enzyme-modified or enzyme-catalyzed residue. In some examples, an antibody or its antigen-binding fragment is site-specifically conjugated to one of the PMO molecules disclosed herein via a lysine residue. In some examples, an antibody or its antigen-binding fragment is site-specifically conjugated to one of the PMO molecules disclosed herein via a cysteine ​​residue. In some examples, an antibody or its antigen-binding fragment is site-specifically conjugated at the 5' end to one of the PMO molecules disclosed herein. In some examples, an antibody or its antigen-binding fragment is site-specifically conjugated at the 3' end to one of the PMO molecules disclosed herein. In some cases, an antibody or its antigen-binding fragment is site-specifically conjugated to one of the PMO molecules disclosed herein via non-natural amino acids. In some cases, an antibody or its antigen-binding fragment is site-specifically conjugated to one of the PMO molecules disclosed herein via enzyme-modified residues or enzyme-catalyzed residues.

[0227] In some embodiments, one or more PMO molecules are conjugated to one of the antibodies or antigen-binding fragments disclosed herein. In some examples, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more PMO molecules are conjugated to an antibody or antigen-binding fragment. In some examples, about 1 PMO molecule is conjugated to one antibody or antigen-binding fragment. In some examples, about 2 PMO molecules are conjugated to one antibody or antigen-binding fragment. In some examples, about 3 PMO molecules are conjugated to one antibody or antigen-binding fragment. In some examples, about 4 PMO molecules are conjugated to one. In some examples, about 5 PMO molecules are conjugated to one antibody or antigen-binding fragment. In some examples, about 6 PMO molecules are conjugated to one antibody or antigen-binding fragment. In some cases, approximately seven PMO molecules are conjugated to one antibody or its antigen-binding fragment. In other cases, approximately eight PMO molecules are conjugated to one antibody or its antigen-binding fragment.

[0228] In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some examples, at least 1 PMO molecule is conjugated to one antibody or an antigen-binding fragment thereof. In some examples, at least 2 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some examples, at least 3 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some examples, at least 4 PMO molecules are conjugated to one. In some examples, at least 5 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some examples, at least 6 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some examples, at least 7 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some examples, at least 8 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof.

[0229] In some examples, from about 1 to about 16 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some examples, from about 2 to about 15 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some examples, from about 3 to about 14 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some examples, from about 4 to about 13 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some examples, from about 5 to about 12 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some examples, from about 6 to about 11 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some examples, from about 7 to about 10 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some examples, from about 8 to about 9 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof.

[0230] In some embodiments, an average of one or more PMO molecules are conjugated to an antibody or its antigen-binding fragment. In some examples, an average of approximately one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelfth, thirteen, fourteen, fifteen, sixteen, or more PMO molecules are conjugated to an antibody or its antigen-binding fragment. In some examples, an average of approximately one PMO molecule is conjugated to one antibody or its antigen-binding fragment. In some examples, an average of approximately two PMO molecules are conjugated to one antibody or its antigen-binding fragment. In some examples, an average of approximately three PMO molecules are conjugated to one antibody or its antigen-binding fragment. In some examples, an average of approximately four PMO molecules are conjugated to one. In some examples, an average of approximately five PMO molecules are conjugated to one antibody or its antigen-binding fragment. In some examples, an average of approximately six PMO molecules are conjugated to one antibody or its antigen-binding fragment. In some cases, an average of approximately 7 PMO molecules are conjugated to a single antibody or its antigen-binding fragment. In other cases, an average of approximately 8 PMO molecules are conjugated to a single antibody or its antigen-binding fragment.

[0231] In some examples, on average, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 PMO molecules are conjugated to an antibody or an antigen-binding fragment thereof. In some examples, on average, at least 1 PMO molecule is conjugated to one antibody or an antigen-binding fragment thereof. In some examples, on average, at least 2 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some examples, on average, at least 3 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some examples, on average, at least 4 PMO molecules are conjugated to one. In some examples, on average, at least 5 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some examples, on average, at least 6 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some examples, on average, at least 7 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof. In some examples, on average, at least 8 PMO molecules are conjugated to one antibody or an antigen-binding fragment thereof.

[0232] In some embodiments, the number of PMO molecules conjugated to an antibody forms a constant ratio. In some examples, this ratio is referred to as the DAR (drug-to-antibody) ratio, where the drug referred to herein is the PMO molecule. In some examples, the DAR ratio of PMO molecules to an antibody is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more. In some examples, the DAR ratio of PMO molecules to an antibody is about 1 or more. In some examples, the DAR ratio of PMO molecules to an antibody is about 2 or more. In some examples, the DAR ratio of PMO molecules to an antibody is about 3 or more. In some examples, the DAR ratio of PMO molecules to an antibody is about 4 or more. In some examples, the DAR ratio of PMO molecules to an antibody is about 5 or more. In some examples, the DAR ratio of PMO molecules to an antibody is about 6 or more. In some examples, the DAR ratio of PMO molecules to an antibody is about 7 or more. In some examples, the DAR ratio of PMO molecules to an antibody is about 8 or more.

[0233] In some embodiments, the average number of PMO molecules conjugated to an antibody forms a constant average ratio. In some examples, this average ratio is referred to as the average DAR (drug-to-antibody) ratio, where the drug is the PMO molecule. In some examples, the average DAR ratio of PMO molecules to antibodies is approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or higher. In some examples, the average DAR ratio of PMO molecules to antibodies is approximately 1 or higher. In some examples, the average DAR ratio of PMO molecules to antibodies is approximately 2 or higher. In some examples, the average DAR ratio of PMO molecules to antibodies is approximately 3 or higher. In some examples, the average DAR ratio of PMO molecules to antibodies is approximately 4 or higher. In some examples, the average DAR ratio of PMO molecules to antibodies is approximately 5 or higher. In some examples, the average DAR ratio of PMO molecules to antibodies is approximately 6 or higher. In some examples, the average DAR ratio of PMO molecules to antibodies is approximately 7 or higher. In some cases, the average DAR ratio of PMO molecules to antibodies is approximately 8 or higher.

[0234] In some embodiments, the average number of PMO molecules conjugated to an antibody forms a constant average ratio. In some examples, this average ratio is referred to as the average DAR (drug-to-antibody) ratio, where the drug is the PMO molecule. In some examples, the average DAR ratio of PMO molecules to antibodies is in the range of 1.5–2.5, 2.5–3.5, 3.5–4.5, 4.5–5.5, 5.5–6.5, 6.5–7.5, 7.5–8.5, 8.5–9.5, 9.5–10.5, 10.5–11.5, 11.5–12.5, 12.5–13.5, 13.5–14.5, 14.5–15.5, 15.5–16.5, or 16.5–17.5. In some examples, the average DAR ratio of PMO molecules to antibodies is in the range of 1.5–2.5. In some cases, the average DAR ratio of PMO molecules versus antibodies is in the range of 2.5 to 3.5. In some cases, the average DAR ratio of PMO molecules versus antibodies is in the range of 3.5 to 4.5. In some cases, the average DAR ratio of PMO molecules versus antibodies is in the range of 4.5 to 5.5. In some cases, the average DAR ratio of PMO molecules versus antibodies is in the range of 5.5 to 6.5. In some cases, the average DAR ratio of PMO molecules versus antibodies is in the range of 6.5 to 7.5. In some cases, the average DAR ratio of PMO molecules versus antibodies is in the range of 7.5 to 8.5.

[0235] Conjugation Chemistry

[0236] In some embodiments, polynucleic acid molecules (e.g., PMOs) disclosed herein are conjugated to antibodies (e.g., antibodies disclosed herein). In some examples, antibodies include amino acids, peptides, polypeptides, proteins, antibodies, antigens, toxins, hormones, lipids, nucleotides, nucleosides, sugars, carbohydrates, polymers such as polyethylene glycol and polypropylene glycol, as well as all analogs or derivatives of these classes of substances. Further examples of antibodies also include cholesterol, phospholipids, diacylglycerols and triacylglycerols, fatty acids, hydrocarbons (e.g., saturated, unsaturated, or substituted), enzyme substrates, biotin, digoxigenin, and steroids such as polysaccharides. In some examples, polynucleic acid molecules are further conjugated to polymers and, optionally, to endosomal soluble moieties.

[0237] In some embodiments, polynucleic acid molecules are conjugated to antibodies by a chemical ligation process. In some examples, polynucleic acid molecules are conjugated to antibodies by natural ligation. In some cases, conjugation is described as follows: "Synthesis of proteins by native chemical ligation" by Dawson et al., Science 1994, pp. 266, 776-779; "Modulation of Reactivity in Native Chemical Ligation through the Use of Thiol Additives" by Dawson et al., J.Am.Chem.Soc. 1997, pp. 119, 4325-4329; "Protein synthesis by native chemical ligation: Expanded scope by using straightforward methodology" by Hackeng et al., Proc.Natl.Acad.Sci.USA 1999, pp. 96, 10068-10073; or "Building complex glycopeptides: Development of a cysteine-free native chemical ligation protocol" by Wu et al., Angew.Chem.Int.Ed. 2006, pp. 45, 4116-4125. In some cases, the conjugation is as described in U.S. Patent No. 8,936,910. In some embodiments, polynucleic acid molecules are conjugated to antibodies either site-specifically or non-specifically via natural ligation chemistry.

[0238] In some cases, polynucleotide molecules are conjugated to antibodies by a site-specific method utilizing "traceless" coupling technology (Philochem). In some cases, "traceless" coupling technology utilizes the N-terminal 1,2-aminothiol group on the antibody that is later conjugated with a polynucleotide molecule containing an aldehyde group (see Casi et al., "Site-specific traceless coupling of potent cytotoxic drugs to recombinant antibodies for pharmacodelivery," JACS 134(13):5887-5892 (2012)).

[0239] In some cases, polynucleic acid molecules are conjugated to antibodies by site-specific methods utilizing unnatural amino acids incorporated into the antibody. In some cases, the unnatural amino acid includes p-acetylphenylalanine (pAcPhe). In some cases, the keto group of pAcPhe is selectively coupled to the alkoxyamine derivative conjugate to form an oxime bond (see Axup et al., "Synthesis of site-specific antibody-drug conjugates using unnatural amino acids," PNAS 109(40):16101-16106 (2012)).

[0240] In some cases, polynucleic acid molecules are conjugated to antibodies by site-specific methods utilizing enzyme-catalyzed processes. In some cases, the site-specific method utilizes SMARTag® technology (Redwood). In some cases, SMARTag® technology involves the production of formylglycine (FGly) residues from cysteine ​​by formylglycine-producing enzyme (FGE) via an oxidation process in the presence of an aldehyde tag, followed by the conjugation of FGly to alkylhydraine-functionalized polynucleic acid molecules via hydrazino-Pictet-Spengler (HIPS) ligation (see Wu et al., "Site-specific chemical modification of recombinant proteins produced in mammalian cells by using the genetically encoded aldehyde tag," PNAS 106(9):3000-3005 (2009); Agarwal et al., "A Pictet-Spengler ligation for protein chemical modification," PNAS 110(1):46-51 (2013)).

[0241] In some cases, the enzyme-catalyzed process involves microbial transglutaminase (mTG). In some instances, polynucleic acid molecules are conjugated to antibodies using a transglutaminase-catalyzed process. In some cases, mTG catalyzes the formation of a covalent bond between the amide side chain of glutamine in the recognition sequence and the primary amine of the functionalized polynucleic acid molecule. In some cases, mTG is produced from Streptomyces mobarensis (see Strop et al., "Location matters: site of conjugation modulates stability and pharmacokinetics of antibody drug conjugates," Chemistry and Biology 20(2) pp. 161-167 (2013)).

[0242] In some cases, polynucleic acid molecules are conjugated to antibodies by a method described in International Publication No. 2014 / 140317, which utilizes sequence-specific transpeptidases.

[0243] In some cases, polynucleic acid molecules are conjugated to antibodies by the methods described in U.S. Patent Applications No. 2015 / 0105539 and No. 2015 / 0105540.

[0244] Production of antibodies or their antigen-binding fragments In some embodiments, the polypeptides described herein (e.g., antibodies and antigen-binding fragments) are produced using any method known in the art as useful for the synthesis of polypeptides (e.g., antibodies), specifically by chemical synthesis or recombinant expression, and preferably by recombinant expression techniques.

[0245] In some cases, the antibody or its antigen-binding fragment is recombinantly expressed, and the nucleic acid encoding the antibody or antigen-binding fragment is constructed from chemically synthesized oligonucleotides (as described, for example, by Kutmeier et al. 1994, BioTechniques 17:242), which involves the synthesis of duplicate oligonucleotides containing the antibody-coding portion of the sequence, annealing and ligation of those oligonucleotides, and subsequent amplification of the ligated oligonucleotides by PCR.

[0246] Alternatively, nucleic acid molecules encoding antibodies can be selectively generated from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from any tissue or cell expressing immunoglobulins) by PCR amplification using synthetic primers that can hybridize to the 3' and 5' ends of the sequence, or by cloning using oligonucleotide probes specific to a particular gene sequence.

[0247] In some cases, antibodies or their antigen-binding fragments are optionally generated by immunizing animals such as rabbits to produce polyclonal antibodies, or more preferably by generating monoclonal antibodies as described, for example, Kohler and Milstein (1975, Nature 256: pp. 495-497), or Kozbor et al. (1983, Immunology Today 4: p. 72), or Cole et al. (1985 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Alternatively, clones encoding at least the Fab portion of an antibody can be selectively obtained by screening Fab expression libraries for clones of Fab fragments that bind to specific antigens (e.g., as described by Huse et al. 1989, Science 246:1275-1281) or by screening antibody libraries (e.g., see Clackson et al. 1991, Nature 352:624; Hane et al. 1997 Proc.Natl.Acad.Sci.USA 94:4937).

[0248] In some embodiments, techniques developed for producing "chimeric antibodies" (Morrison et al. 1984, Proc. Natl. Acad. Sci. 81: pp. 851-855; Neuberger et al. 1984, Nature 312: pp. 604-608; Takeda et al. 1985, Nature 314: pp. 452-454) are used, which involve splicing a gene derived from a mouse antibody molecule with appropriate antigen specificity together with a gene derived from a human antibody molecule with appropriate biological activity. Chimeric antibodies are molecules in which various parts originate from different animal species, such as those possessing a variable region derived from a mouse monoclonal antibody and a constant region of human immunoglobulin, for example, a humanized antibody.

[0249] In some embodiments, techniques described for the production of single-chain antibodies (U.S. Patent No. 4,694,778; Bird 1988, Science 242: pp. 423-42; Huston et al. 1988, Proc. Natl. Acad. Sci. USA 85: pp. 5879-5883; Ward et al. 1989, Nature 334: pp. 544-54) are suitable for producing single-chain antibodies. Single-chain antibodies are formed by linking heavy and light chain fragments of the Fv region via amino acid crosslinking to yield a single-chain polypeptide. Techniques for constructing functional Fv fragments in E. coli are also optionally used (Skerra et al. 1988, Science 242: pp. 1038-1041).

[0250] In some embodiments, an expression vector containing the antibody nucleotide sequence, or the antibody nucleotide sequence itself, is transfused into host cells by conventional techniques (e.g., electroporation, liposome transfection, and calcium phosphate precipitation), and the transfected cells are then cultured by conventional techniques to produce the antibody. In certain embodiments, antibody expression is regulated by a constitutive promoter, an inducible promoter, or a tissue-specific promoter.

[0251] In some embodiments, various host expression vector systems are utilized to express the antibodies or antigen-binding fragments thereof described herein. Such host expression systems represent vehicles in which the antibody coding sequences are produced and later purified, but also represent cells that express the antibody or its binding fragment in situ when transformed or transfected with the appropriate nucleotide coding sequence. These include bacteria (e.g., Escherichia coli and Bacillus subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA expression vectors containing the antibody or its binding fragment coding sequence; yeast cells (e.g., Saccharomyces Pichia) transformed with recombinant yeast expression vectors containing the antibody or its binding fragment coding sequence; insect cell lines infected with recombinant virus expression vectors (e.g., baculovirus) containing the antibody or its binding fragment coding sequence; plant cell lines infected with recombinant virus expression vectors (e.g., Cauliflower mosaic virus (CaMV) and Tobacco mosaic virus (TMV)) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing the antibody or its binding fragment coding sequence; or mammalian cell lines (e.g., COS cells, CHO cells, BH cells, 293 cells, 293T cells, 3T3 cells) having a recombinant expression construct containing a promoter derived from a mammalian cell genome (e.g., metallothionein promoter] or a promoter derived from a mammalian virus (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter), but are not limited thereto.

[0252] For long-term, high-yield production of recombinant proteins, stable expression is preferred. In some cases, cell lines that stably express antibodies are manipulated by arbitrary selection. Host cells are transformed with DNA controlled by appropriate expression regulatory elements (e.g., promoters, enhancers, sequences, transcription terminators, polyadenylation sites, etc.) and selectable markers, rather than using expression vectors containing viral replication origins. After introduction of the foreign DNA, the manipulated cells are grown in concentrated medium for 1-2 days and then switched to selective medium. The selectable markers in the recombinant plasmid confer resistance to selection, allowing the cells to stably incorporate the plasmid into their chromosomes and grow, forming lesions that are later cloned and expanded into cell lines. This method can advantageously be used to manipulate cell lines that express antibodies or their conjugated fragments.

[0253] In some cases, several selective systems, including but not limited to the genes for herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 192, Proc. Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase (Lowy et al., 1980, Cell 22:817), are used for TK cells, HGPRT cells, or APRT cells, respectively. Furthermore, antimetabolite resistance is also used as a basis for selecting the following genes: dhfir, which confers resistance to methotrexate (Wigler et al. 1980, Proc. Natl. Acad. Sci. USA 77:357; O'Hare et al. 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolate (Mulligan & Berg 1981, Proc. Natl. Acad. Sci. USA 78:2072); and neo, which confers resistance to aminoglycoside G-418 (Clinical Pharmacy 12:488-505; Wu and Wu 1991, Biotherapy). 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62:191-217; May, 1993, TIB TECH 11(5):155-215), and hygro (Santerre et al., 1984, Gene 30:147), which confers resistance to hygromycin.Well-known methods in the field of available recombinant DNA technology are described in Chapters 12 and 13 of Ausubel et al. (eds.), 1993, Current Protocols in Molecular Biology, John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY; and Dracopoli et al. (eds.), 1994, Current Protocols in Human Genetics, John Wiley & Sons, NY; and Colberre-Garapin et al., 1981, J.Mol.Biol.150:1).

[0254] In some cases, antibody expression levels increase with vector amplification (see Bebbington and Hentschel, *The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning*, Vol. 3 (Academic Press, New York, 1987) for an overview). If a marker in an antibody-expressing vector system is amplified, an increase in the level of the inhibitor present in the host cell culture increases the copy number of the marker gene. Since the amplified region is associated with the antibody's nucleotide sequence, antibody production also increases (Crouse et al., 1983, Mol. Cell Biol. 3:257).

[0255] In some cases, any method known in the art for the purification or analysis of antibodies or antibody conjugates is used, for example, by chromatography (e.g., ion exchange chromatography, particularly affinity chromatography based on affinity for specific antigens after protein A, and sizing column chromatography), centrifugation, solubility difference, or any other standard technique in protein purification. Exemplary chromatographic methods include, but are not limited to, strong anion exchange chromatography, hydrophobic interaction chromatography, size exclusion chromatography, and high-performance protein liquid chromatography.

[0256] Linker In some embodiments, the linkers described herein are either severable or non-severable linkers. In some examples, the linker is a severable linker. In other examples, the linker is a non-severable linker.

[0257] In some cases, the linker is a non-polymer linker. A non-polymer linker refers to a linker that does not contain repeating units of monomers produced by the polymerization process. Examples of non-polymer linkers include, but are not limited to, C1-C6 alkyl groups (e.g., C5, C4, C3, C2, or C1 alkyl groups), homobifunctional crosslinkers, heterobifunctional crosslinkers, peptide linkers, traceless linkers, self-sacrificing linkers, maleimide linkers, or combinations thereof. In some cases, a non-polymer linker includes C1-C6 alkyl groups (e.g., C5, C4, C3, C2, or C1 alkyl groups), homobifunctional crosslinkers, heterobifunctional crosslinkers, peptide linkers, traceless linkers, self-sacrificing linkers, maleimide linkers, or combinations thereof. In further cases, a non-polymer linker does not contain more than two of the same type of linkers, for example, more than two homobifunctional crosslinkers or more than two peptide linkers. In further cases, the nonpolymer linker optionally includes one or more reactive functional groups.

[0258] In some cases, the non-polymer linker does not contain the polymer described above. In some cases, the non-polymer linker does not contain the polymer contained by polymer portion C. In some cases, the non-polymer linker does not contain polyalkylene oxides (e.g., PEG). In some cases, the non-polymer linker does not contain PEG.

[0259] In some cases, the linker includes homobifunctional linkers. Exemplary homobifunctional linkers include Lomant's reagent dithiobis(succinimidylpropionate) DSP, 3'3'-dithiobis(sulfosuccinimidylpropionate) (DTSSP), disuccinimidylsberate (DSS), bis(sulfosuccinimidyl)sberate (BS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfoDST), and ethyl Inglicobis(succinimidyl succinate) (EGS), disuccinimidyl glutarate (DSG), N,N'-disuccinimidyl carbonate (DSC), dimethyladipimidate (DMA), dimethylpimeridate (DMP), dimethylsvelimidate (DMS), dimethyl-3,3'-dithiobispropionimidate (DTBP), 1,4-di-3'-(2'-pyridyldithio)propionamide Examples include, but are not limited to, butane (DPDPB), bismaleimide hexane (BMH), aryl halide-containing compounds (DFDNB), such as 1,5-difluoro-2,4-dinitrobenzene or 1,3-difluoro-4,6-dinitrobenzene, 4,4'-difluoro-3,3'-dinitrophenyl sulfone (DFDNPS), bis-[β-(4-azidosalicylamido)ethyl]disulfide (BASED), formaldehyde, glutaraldehyde, 1,4-butanediol diglycidyl ether, adipic acid dihydrazide, carbohydrazide, o-toluidine, 3,3'-dimethylbenzidine, benzidine, α,α'-p-diaminodiphenyl, diiodo-p-xylenesulfonic acid, N,N'-ethylene-bis(iodoacetamide), or N,N'-hexamethylene-bis(iodoacetamide).

[0260] In some embodiments, the linker includes a heterobifunctional linker. Exemplary heterobifunctional linkers include amine-reactive and sulfhydryl crosslinkers, such as N-succinimidyl 3-(2-pyridyldithio)propionate (sPDP), long-chain N-succinimidyl 3-(2-pyridyldithio)propionate (LC-sPDP), water-soluble long-chain N-succinimidyl 3-(2-pyridyldithio)propionate (sulfo-LC-sPDP), succinimidyloxycarbonyl-α-methyl-α-(2-pyridyldithio)toluene (sMPT), and sulfosuccinimidyl-6-[α -Methyl-α-(2-pyridyldithio)toluamide]hexanoate (sulfo-LC-sMPT), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC), sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC), m-maleimidobenzoyl-N-hydroxysuccinimid ester (MBs), m-maleimidobenzoyl-N-hydroxysulfosuccinimid ester (sulfo-MBs), N-succinimidyl (4-iodoacteyl)aminobenzoate (sIAB), sulfosuccinimidyl(4-iodoacteyl)aminobenzoate (sulfo-sIAB), succinimidyl-4-(p-maleimidophenyl)butyrate (sMPB), sulfosuccinimidyl-4-(p-maleimidophenyl)butyrate (sulfo-sMPB), N-(γ-maleimidobutyryloxy)succinimidate ester (GMBs), N-(γ-maleimidobutyryloxy)sulfosuccinimidate ester (sulfo-GMBs) ), succinimidyl 6-((iodoacetyl)amino)hexanoate (sIAX), succinimidyl 6-[6-(((iodoacetyl)amino)hexanoyl)amino]hexanoate (sIAXX), succinimidyl 4-(((iodoacetyl)amino)methyl)cyclohexane-1-carboxylate (sIAC), succinimidyl 6-((((4-iodoacetyl)amino)methyl)cyclohexane-1-carbonyl)amino)hexanoate (sIACX), p-nitrophenyliodoacetate (NPIA),Carbonyl-reactive and sulfhydryl-reactive crosslinkers, e.g., 4-(4-N-maleimidophenyl)butyrate hydrazide (MPBH), 4-(N-maleimidomethyl)cyclohexane-1-carboxyl-hydrazide-8 (M2C2H), 3-(2-pyridyldithio)propionyl hydrazide (PDPH), amine-reactive and photoreactive crosslinkers, e.g., N-hydroxysuccinimidyl-4-azidosalicylic acid (NHs-AsA), N-hydroxysulfosuccinimidyl-4-azidosalicylic acid (sulfo-NHs-AsA), sulf Fosuccinimidyl-(4-azidosalicylamide)hexanoate (sulfo-NHs-LC-AsA), sulfosuccinimidyl-2-(p-azidosalicylamide)ethyl-1,3'-dithiopropionate (sAsD), N-hydroxysuccinimidyl-4-azidobenzoate (HsAB), N-hydroxysulfosuccinimidyl-4-azidobenzoate (sulfo-HsAB), N-succinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate (sANPAH), sulfosuccinimidyl-6-(4'-A (Dido-2'-nitrophenylamino)hexanoate (sulfo-sANPAH), N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOs), sulfosuccinimidyl-2-(m-azido-o-nitrobenzoamide)-ethyl-1,3'-dithiopropionate (sAND), N-succinimidyl-4(4-azidophenyl)1,3'-dithiopropionate (sADP), N-sulfosuccinimidyl(4-azidophenyl)-1,3'-dithiopropionate (sulfo-sADP), sulfosuccinimidyl-4-(ρ- Azidophenyl)butyrate (sulfo-sAPB, sulfosuccinimidyl 2-(7-azido-4-methylcoumarin-3-acetamido)ethyl-1,3'-dithiopropionate (sAED), sulfosuccinimidyl 7-azido-4-methylcoumain (methylcoumain)-3-acetate (sulfo-sAMCA), ρ-nitrophenyldiazopirubate (ρNPDP), ρ-nitrophenyl-2-diazo-3,3,3-trifluoropropionate (PNP-DTP), sulfhydryl-reactive and photoreactive crosslinkers, for example,Examples include, but are not limited to, 1-(ρ-azidosalicylamide)-4-(iodoacetamide)butane (AsIB), N-[4-(ρ-azidosalicylamide)butyl]-3'-(2'-pyridyldithio)propionamide (APDP), benzophenone-4-iodoacetamide, benzophenone-4-maleimide carbonyl-reactive and photoreactive crosslinkers, e.g., ρ-azidobenzoylhydrazide (ABH), carboxylate-reactive and photoreactive crosslinkers, e.g., 4-(ρ-azidosalicylamide)butylamine (AsBA), and arginine-reactive and photoreactive crosslinkers, e.g., ρ-azidophenylglyoxal (APG).

[0261] In some cases, the linker contains a reactive functional group. In some cases, the reactive functional group contains a nucleophile that is reactive to an electrophile present on the antibody. Exemplary electrophiles include carbonyl groups, such as aldehydes, ketones, carboxylic acids, esters, amides, enones, acyl halides, or acid anhydrides. In some embodiments, the reactive functional group is an aldehyde. Exemplary nucleophiles include hydrazides, oximes, aminos, hydrazines, thiosemicarbazones, hydrazine carboxylates, and aryl hydrazides.

[0262] In some embodiments, the linker contains a maleimide group. In some examples, the maleimide group is also called a maleimide spacer. In some examples, the maleimide group further contains caproic acid to form maleimidocaproyl (me). In some cases, the linker contains maleimidocaproyl (me). In some cases, the linker is maleimidocaproyl (me). In other examples, the maleimide group contains a maleimidomethyl group such as succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) or sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC).

[0263] In some embodiments, the maleimide group is a self-stabilizing maleimide. In some examples, the self-stabilizing maleimide utilizes diaminopropionic acid (DPR) to incorporate a basic amino group adjacent to the maleimide, providing intramolecular catalytic activity for thiosuccinimide ring hydrolysis, thereby preventing the maleimide from being eliminated by the retromichael reaction. In some examples, the self-stabilizing maleimide is the maleimide group described by Lyon et al., "Self-hydrolyzing maleimides improves the stability and pharmacological properties of antibody-drug conjugates," Nat. Biotechnol. 32(10): pp. 1059-1062 (2014). In some examples, the linker contains a self-stabilizing maleimide. In some examples, the linker is a self-stabilizing maleimide.

[0264] In some embodiments, the linker includes a peptide moiety. In some examples, the peptide moiety includes at least 2, 3, 4, 5, or 6 or more amino acid residues. In some examples, the peptide moiety includes up to 2, 3, 4, 5, 6, 7, or 8 amino acid residues. In some examples, the peptide moiety includes approximately 2, 3, 4, 5, or 6 amino acid residues. In some examples, the peptide moiety is cleavable (e.g., enzymatically or chemically). In some examples, the peptide moiety is incleavable. In some examples, the peptide portion includes Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 96), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu (SEQ ID NO: 97), or Gly-Phe-Leu-Gly (SEQ ID NO: 98). In some cases, the linker contains peptide moieties such as Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly, Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu, or Gly-Phe-Leu-Gly. In some cases, the linker contains Val-Cit. In some cases, the linker is Val-Cit.

[0265] In some embodiments, the linker includes a benzoic acid group or a derivative thereof. In some examples, the benzoic acid group or a derivative thereof includes para-aminobenzoic acid (PABA). In some examples, the benzoic acid group or a derivative thereof includes gamma-aminobutyric acid (GABA).

[0266] In some embodiments, the linker comprises one or more of the maleimide group, the peptide moiety, and / or benzoic acid groups in any combination. In some embodiments, the linker comprises a combination of the maleimide group, the peptide moiety, and / or benzoic acid groups. In some examples, the maleimide group is maleimidocaproyl (mc). In some examples, the peptide group is val-cit. In some examples, the benzoic acid group is PABA. In some examples, the linker comprises an mc-val-cit group. In some cases, the linker comprises a val-cit-PABA group. In further cases, the linker comprises an mc-val-cit-PABA group.

[0267] In some embodiments, the linker is a self-sacrificing or self-eliminating linker. In some cases, the linker is a self-destructing linker. In other cases, the linker is a self-eliminating linker (e.g., a cyclized self-eliminating linker). In some examples, the linker includes the linkers described in U.S. Patent No. 9,089,614 or International Publication No. 2015038426.

[0268] In some embodiments, the linker is a dendritic linker. In some examples, the dendritic linker includes a branched, polyfunctional linker moiety. In some examples, the dendritic linker is used to increase the molar ratio of polynucleotides to antibodies. In some examples, the dendritic linker includes a PAMAM dendrimer.

[0269] In some embodiments, the linker is a traceless linker, i.e., a linker that does not leave a linker portion (e.g., an atom or linker group) on the binding portion (e.g., an antibody), polynucleotide, polymer, or endosomal lytic portion after cleavage. Examples of traceless linkers include, but are not limited to, germanium linkers, silicon linkers, sulfur linkers, selenium linkers, nitrogen linkers, phosphorus linkers, boron linkers, chromium linkers, or phenylhydrazide linkers. In some cases, the linker is a traceless aryl-triazene linker as described by Hejesen et al., "A traceless aryl-triazene linker for DNA-directed chemistry," Org Biomol Chem 11(15): pp. 2493-2497 (2013). In some examples, the linker is a traceless linker as described by Blaney et al., "Traceless solid-phase organic synthesis," Chem. Rev. 102: pp. 2607-2024 (2002). In some cases, the linker is a traceless linker as described in U.S. Patent No. 6,821,783.

[0270] In some cases, the linker is U.S. Patent No. 6,884,869, No. 7,498,298, No. 8,288,352, No. 8,609,105, or No. 8,697,688, U.S. Patent Application No. 2014 / 0127239, No. 2013 / 028919, No. 2014 / 286970, and The linker described in Specification No. 2013 / 0309256, Specification No. 2015 / 037360, or Specification No. 2014 / 0294851, or in International Publication No. 2015057699, International Publication No. 2014080251, International Publication No. 2014197854, International Publication No. 2014145090, or International Publication No. 2014177042.

[0271] In some examples, the linker is a C1-C6 alkyl group. In some cases, the linker is a C1-C6 alkyl group, such as a C5, C4, C3, C2, or C1 alkyl group. In some cases, the C1-C6 alkyl group is an unsubstituted C1-C6 alkyl group. In the context of linkers, and especially when used in the context of linkers, alkyl means a saturated linear or branched hydrocarbon radical containing up to six carbon atoms. In some examples, the linker is a nonpolymer linker. In some examples, the linker includes the homobifunctional or heterobifunctional linkers described above. In some cases, the linker includes a heterobifunctional linker. In some cases, the linker includes (includes or comprises) an sMCC. In other examples, the linker includes a heterobifunctional linker optionally conjugated to a C1-C6 alkyl group. In other examples, the linker includes an sMCC optionally conjugated to a C1-C6 alkyl group. In further cases, the linker does not include either the homobifunctional or heterobifunctional linkers described above.

[0272] Pharmaceutical preparations In some embodiments, the pharmaceutical formulations described herein are administered to a target by multiple routes of administration, including but not limited to parenteral (e.g., intravenous, subcutaneous, intramuscular), oral, intranasal, buccal, rectal, or transdermal administration routes. In some examples, the pharmaceutical compositions described herein are formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular, intra-arterial, intraperitoneal, intrathecal, intracerebral, intraventricular, or intracranial) administration. In other examples, the pharmaceutical compositions described herein are formulated for oral administration. In yet another example, the pharmaceutical compositions described herein are formulated for intranasal administration.

[0273] In some embodiments, pharmaceutical formulations include, but are not limited to, aqueous liquid dispersants, self-emulsifying dispersants, solid solutions, liposome dispersants, aerosols, solid dosage forms, powders, immediate-release formulations, controlled-release formulations, rapidly dissolving formulations, tablets, capsules, pills, delayed-release formulations, sustained-release formulations, pulsed-release formulations, multi-particle formulations (e.g., nanoparticle formulations), and immediate-release / controlled-release mixed formulations.

[0274] In some cases, the pharmaceutical formulation includes multi-particle formulations. In some cases, the pharmaceutical formulation includes nanoparticle formulations. In some cases, the nanoparticles include cMAP, cyclodextrin, or lipids. Depending on the case, the nanoparticles include solid lipid nanoparticles, polymer nanoparticles, self-emulsifying nanoparticles, liposomes, microemulsions, or micelle solutions. Further exemplary nanoparticles include, but are not limited to, paramagnetic nanoparticles, superparamagnetic nanoparticles, metallic nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as those having covalently bonded metal chelates), nanofibers, nanohorns, nanoonions, nanorods, nanoropes, and quantum dots. In some examples, nanoparticles are nanoparticles of metals, such as scandium, titanium, vanadium, chromium, manganese, iron, cobalt, nickel, copper, zinc, yttrium, zirconium, niobium, molybdenum, ruthenium, rhodium, palladium, silver, cadmium, hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum, gold, gadolinium, aluminum, gallium, indium, tin, thallium, lead, bismuth, magnesium, calcium, strontium, barium, lithium, sodium, potassium, boron, silicon, phosphorus, germanium, arsenic, antimony, and combinations, alloys, or oxides thereof.

[0275] In some examples, nanoparticles include a core, or a core and a shell, as in core-shell nanoparticles.

[0276] In some examples, the nanoparticles are further coated with molecules for the attachment of functional elements (e.g., one or more polynucleic acid molecules or binding sites (e.g., antibodies as described herein)). In some examples, the coating includes chondroitin sulfate, dextran sulfate, carboxymethyl dextran, alginic acid, pectin, carrageenan, fucoidan, agaropectin, porphyran, karaya gum, gellan gum, xanthan gum, hyaluronic acid, glucosamine, galactosamine, chitin (or chitosan), polyglutamic acid, polyaspartic acid, lysozyme, cytochrome C, ribonuclease, trypsinogen, chymotrypsinogen, α-chymotrypsin, polylysine, polyarginine, histone, protamine, ovalbumin, or dextrin or cyclodextrin. In some examples, the nanoparticles include graphene-coated nanoparticles.

[0277] In some cases, the nanoparticles have at least one dimension of approximately 500 nm, 400 nm, 300 nm, 200 nm, or less than 100 nm.

[0278] In some examples, nanoparticle formulations include paramagnetic nanoparticles, superparamagnetic nanoparticles, metallic nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as those having covalently bonded metal chelates), nanofibers, nanohorns, nanoonions, nanorods, nanoropes, or quantum dots. In some examples, polynucleic acid molecules or binding sites (e.g., antibodies) described herein are conjugated directly or indirectly to nanoparticles. In some examples, at least 1, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more polynucleic acid molecules or binding sites described herein are conjugated directly or indirectly to nanoparticles.

[0279] In some embodiments, the pharmaceutical formulation includes a delivery vector, such as a recombinant vector, for delivering polynucleic acid molecules to cells. In some examples, the recombinant vector is a DNA plasmid. In other examples, the recombinant vector is a viral vector. Exemplary viral vectors include vectors derived from adeno-associated viruses, retroviruses, adenoviruses, or alphaviruses. In some examples, recombinant vectors capable of expressing polynucleic acid molecules result in stable expression in target cells. In further examples, viral vectors that result in transient expression of polynucleic acid molecules are used.

[0280] In some embodiments, the pharmaceutical formulation includes a carrier or carrier material selected based on its compatibility with the compositions disclosed herein and the release profile characteristics of the desired dosage form. Exemplary carrier materials include, for example, binders, suspending agents, disintegrants, fillers, surfactants, solubilizers, stabilizers, lubricants, wetting agents, and diluents. Examples of pharmaceutically compatible carrier materials include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerin, magnesium silicate, polyvinylpyrrolidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars of sodium stearoyl lactate, carrageenan, monoglycerides, diglycerides, and pregelatinized starch. For example, see Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H.A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins 1999).

[0281] Treatment regimen In some embodiments, the pharmaceutical compositions described herein are administered for therapeutic purposes. In some embodiments, the pharmaceutical compositions are administered once daily, twice daily, three times daily, or more frequently. The pharmaceutical compositions are administered daily, every other day, five days a week, once a week, every other week, two weeks a month, three weeks a month, once a month, twice a month, three times a month, or more frequently. The pharmaceutical compositions are administered for at least one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, twelve months, eighteen months, two years, three years, or longer.

[0282] In some embodiments, one or more pharmaceutical compositions are administered simultaneously, consecutively, or at regular time intervals. In some embodiments, one or more pharmaceutical compositions are administered simultaneously. In some cases, one or more pharmaceutical compositions are administered consecutively. In further cases, one or more pharmaceutical compositions are administered at regular time intervals (for example, the first administration of the first pharmaceutical composition is performed on day 1, and thereafter, an interval of at least 1, 2, 3, 4, 5 days or more is provided before the administration of at least the second pharmaceutical composition).

[0283] In some embodiments, two or more different pharmaceutical compositions are co-administered. In some cases, two or more different pharmaceutical compositions are co-administered simultaneously. In some cases, two or more different pharmaceutical compositions are co-administered consecutively without any time gap between administrations. In other cases, two or more different pharmaceutical compositions are co-administered consecutively with intervals of approximately 0.5 hours, 1 hour, 2 hours, 3 hours, 12 hours, 1 day, 2 days, or longer between administrations.

[0284] If the patient's condition improves, the administration of the composition may, at the physician's discretion, be continued, or alternatively, the dose of the composition administered may be temporarily reduced or interrupted over a certain period (i.e., a “drug-free period”). In some cases, the length of the drug-free period may vary between 2 days and 1 year, and include, but are not limited to, 2, 3, 4, 5, 6, 7, 10, 12, 15, 20, 28, 35, 50, 70, 100, 120, 150, 180, 200, 250, 280, 300, 320, 350, or 365 days. The dose reduction during the drug-free period ranges from 10% to 100%, and includes, but are not limited to, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0285] Once the patient's condition improves, a maintenance dose is administered as needed. Subsequently, the dose, frequency, or both may be reduced, depending on the symptoms, to a level that maintains improvement in the disease, impairment, or illness.

[0286] In some embodiments, the amount of a given drug corresponding to such a quantity varies depending on factors such as the specific compound, the severity of the disease, and the identity of the subject or host requiring treatment (e.g., body weight), but nevertheless, it is conventionally determined in a manner known in the art, according to the specific circumstances surrounding the case, including, for example, the specific drug administered, the route of administration, and the subject or host being treated. In some examples, the desired dose is conveniently provided as a single dose, or as divided doses administered simultaneously (or over a short period) or at appropriate intervals, e.g., two, three, four, or more subdose times a day.

[0287] Given the large number of variables involved in individual treatment regimens, and the frequent deviations from these recommendations, the aforementioned ranges are merely suggestive. Such dosages are not limited but will vary depending on numerous variables, including the activity of the compound used, the disease or illness being treated, the form of administration, the requirements of the individual patient, the severity of the disease or illness being treated, and the judgment of the healthcare professional.

[0288] In some embodiments, the toxicity and therapeutic effect of such treatment regimens are determined by standard pharmaceutical procedures for cell cultures or experimental animals, including but not limited to determining the LD50 (lethal dose for 50% of the population) and ED50 (therapeutably effective dose for 50% of the population). The dose ratio between toxic effect and therapeutic effect is the therapeutic index, expressed as the ratio between LD50 and ED50. Compounds exhibiting a high therapeutic index are preferred. Data obtained from cell culture assays and animal studies are used in formulating a range of doses for human use. Doses of such compounds are preferably within the range of circulating concentrations containing the ED50 with minimal toxicity. Doses vary within this range depending on the dosage form and route of administration used.

[0289] Kit / Manufactured product In certain embodiments of this specification, kits and products for use with one or more of the compositions and methods described herein are disclosed. Such kits include a carrier, package, or container partitioned to house one or more containers, such as vials or tubes, each container containing one of the separate elements used in the methods described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In one embodiment, the containers are formed from a variety of materials, such as glass or plastic.

[0290] The products provided herein are accompanied by packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles, and any packaging material suitable for the selected formulation, intended dosage form, and form of treatment.

[0291] For example, a container contains the target nucleic acid molecule described herein. Such a kit may optionally include an identifying statement, label, or instructions for use in the method described herein.

[0292] A kit typically includes a label listing the contents and / or instructions for use, as well as accompanying documentation with instructions for use. A set of instructions is also typically included.

[0293] In one embodiment, the label is on or attached to the container. In one embodiment, the label is on the container if the letters, numbers, or other characters forming the label are attached to, printed on, or etched onto the container itself. If the label is present within a receptacle or carrier that also holds the container, the label is attached to the container, for example, as an accompanying document. In one embodiment, the label is used to indicate that the contents are to be used for a specific therapeutic purpose. The label may also indicate instructions for using the contents in the methods described herein.

[0294] In certain embodiments, the pharmaceutical composition is provided in a pack or dispenser device containing one or more unit dosage forms containing the compounds provided herein. The pack contains metal or plastic foil, such as a blister pack. In one embodiment, the pack or dispenser device is accompanied by instructions for administration. In one embodiment, the pack or dispenser is also accompanied by a notice attached to the container in the form prescribed by a government agency that regulates the manufacture, use, or sale of pharmaceuticals, the notice reflecting the government agency's approval of the form of the drug for administration to humans or animals. Such notices are, for example, labels or approved product inserts approved by the U.S. Food and Drug Administration for prescription drugs. In one embodiment, a composition containing the compounds provided herein, formulated in a suitable pharmaceutical carrier, is also prepared, placed in a suitable container, and labeled for the treatment of a specified disease.

[0295] Specific terms Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art in the field to which the claimed subject matter pertains. The above summary and the following detailed description are illustrative and descriptive only and should not be considered limiting to any claimed subject matter. In this application, the use of singular nouns includes plural nouns unless specifically stated otherwise. Note that, as used herein and in the appended claims, the singular nouns "a," "an," and "the" include multiple referents unless the context clearly indicates the opposite. In this application, the use of "or" means "and / or" unless specifically stated otherwise. Furthermore, the use of other forms of the term "including," such as "include," "includes," and "included," is not limited to this application.

[0296] As used herein, ranges and quantities can be expressed as specific values ​​or ranges preceded by "about." "About" also includes the exact quantity. Therefore, "about 5 μL" means "about 5 μL," and even "5 μL." Generally, the term "about" includes quantities expected to be within experimental error.

[0297] The section headings used herein are for organizational purposes only and should not be construed as limiting the subjects described.

[0298] As used herein, the terms “individual,” “subject,” and “patient” mean any mammal. In some embodiments, mammals are humans. In some embodiments, mammals are not humans. None of these terms require, or are not limited to, a situation characterized by supervision (e.g., continuous or intermittent) by a healthcare worker (e.g., a physician, registered nurse, nurse practitioner, physician's assistant, skilled worker, or hospice worker).

[0299] As used herein, the term “DMD subject” means any mammal that has or is expected to have DMD and / or has a genetic predisposition to DMD (e.g., a mutation in the DMD gene). In some embodiments, the mammal is a human. In some embodiments, the mammal is not a human. [Examples]

[0300] These examples are provided for illustrative purposes only and do not limit the scope of the claims provided herein.

[0301] Example 1: In silico identification of phosphorodiamidate morpholino oligomers (PMOs) expected to exhibit high hDMD exon 44 skipping activity.

[0302] Several algorithms have been reported for identifying regions on hDMD pre-mRNA that can be modified for exon 44 skipping activity. In PMO screening, we focused on specific regions closest to the exon 44 acceptor site based on predictions reported for exon 44 skipping (Echigoya et al., 2015, PLoS ONE 10(3):e0120058).

[0303] PMOs with hDMD exon 44 skipping activity were identified in silico. Figure 1 shows the exon 44 skipping activity of PMO 30-mer and 25-mer. PMOs that bind to the exon 44 acceptor site are labeled based on the distance (bases) from the acceptor site to their 3' end. Large squares represent the exon 44 skipping activity of PMOs, and dots represent PMOs whose exon 44 skipping activity was predicted. The acceptor site of exon 44 has a length of 148 base pairs (Source: NCBI a Homo sapiens dystrophin (DMD), transcription variant Dp427m, mRNA. ACCESSION NM_004006) 5'-GCGATTTGACAGATCTGTTGAGAAATGGCGGCGTTTTCATTATGATATAAAGATATTTAATCAGTGGCTAACAGAAGCTGAACAGTTTCTCAGAAAGACACAAATTCCTGAGAATTGGGAACATGCTAAATACAAATGGTATCTTAAG-3' (SEQ ID NO: 134), and it was observed that the majority of active exon 44 skipping PMOs interact between the acceptor site at position 0 (Ac0) and the acceptor site at position 20 (Ac20). Twelve additional PMOs (30mers) (see box in Figure 1) were identified that were predicted to have over 70% hDMD exon 44 skipping activity. Table 1 shows the sequences of these 12 PMOs that target the hDMD exon 44 acceptor site.

[0304] result

[0305] Overall, the 12 phosphorodiamidate morpholino oligomers (PMOs) with the highest predicted exon 44 skipping activity were selected based on an algorithm that assisted in identifying regions on hDMD pre-mRNA that could potentially modify exon 44 skipping activity.

[0306] Example 2: Identification and selection of PMOs with high exon 44 skipping activity in healthy primary human skeletal muscle cells (hSkMCs).

[0307] For further in vitro assays on healthy primary human skeletal muscle cells, 12 selected PMOs with high predictive exon 44 skipping activity, as in Example 1, were synthesized. Primary human skeletal muscle cells (SkMCs) were commercially available (Gibco, #A11440). These cells were pre-differentiated and induced to form myotubes by seeding on type I collagen-coated 24-well plates (Gibco, #1970788) (50,000 cells / well) in DMEM supplemented with 2% horse serum and 1× ITS (Gibco, #1933286) for 2 days according to the manufacturer's instructions. Cells were incubated for 24 hours without antibiotics prior to transfection. PMOs were synthesized using GeneTool. PMO uptake into cells was promoted by mixing the PMOs in water, heating at 65-70°C for 5 minutes, and diluting them in warm medium with 2 μM Endo-Porter (Gene Tools, #EP6P1-1). Cells were harvested 48 hours after transfection. The cells were recovered in Trizol and stored at -80°C until processed for RNA isolation using the Direct-zol-96 RNA Isolation Kit (Zymo) according to the manufacturer's instructions. Total RNA concentration was quantified spectroscopically. 100–200 ng of purified RNA was converted to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and the SimpliAmp thermal cycler (Applied Biosystems).DNA fragments representing whole DMD mRNA or exon 44 skipped mRNA were amplified by PCR using either the TaqMan Fast Advanced Master mix (Applied Biosystems) and the hDMD TaqMan assay Hs01049401_ml (VIC-MGB, Thermo Fisher Scientific) or a custom-made TaqMan assay specific to the hDMD exon 43 / 45 junction (FAM-MGB, forward: 5'-CTGTGGAAAGGGTGAAGCTA-3' (SEQ ID NO: 90), reverse: 5'-GACAAGGGAACTCCAGGATG-3' (SEQ ID NO: 91), probe: 5'-AGCTCTCTCCCAGCTTGATTTCCA-3' (SEQ ID NO: 92)). To quantify the exon 44 skip level by gel electrophoresis, the PCR reaction was incubated at 95°C for 20 seconds, followed by 32 cycles of 1 second at 95°C and 20 seconds at 60°C using a QuantStudio 7 Flex (Applied Biosystems). The PCR product was diluted 4:1 with TAE loading buffer and loaded onto a 24-well 4% TAE gel (Embi Tec, #GG3807) containing GelGreen. The PCR product was separated by electrophoresis (50V for 2 hours). The intensity of the bands corresponding to the total DMD product and skipped DMD product was quantified by densitometry using ChemiDoc™ XRS+ (Bio-Rad).

[0308] result

[0309] Twelve selected PMOs were transfected into healthy primary HSkMCs pre-differentiated into myotubes using the Endoporter described above, and harvested 48 hours after transfection. Total DMD mRNA and exon 44-skipped DMD mRNA were amplified by RT-qPCR. PCR products were separated by gel electrophoresis and quantified by densitometry. The presented data were fitted to a specific binding algorithm (single site). The best fit values ​​for binding affinity (Kd=EC50) and (Bmax=maximum skipping%) are reported in Table 9. These results are from two independent experiments using either 1, 3, and 10 μM or 0.1, 1, and 10 μM PMOs.

[0310] [Table 10]

[0311] result

[0312] Figure 2 shows the dose-dependent response of exon 44 skipping activity of 12 selected PMOs (30mers) targeting the acceptor site of human DMD exon 44 in healthy primary human skeletal muscle cells (hSkMCs).

[0313] Assay results in HSkMCs showed that the maximum hDMD exon 44 skipping activity of the tested PMOs was over 75%, and their predicted activities were confirmed as shown in Table 9 and Figure 2. Furthermore, the dose-response of exon 44 skipping-active cells for all 12 selected PMOs (30mers) showed similar binding affinity (Kd) as shown in Table 9 (0.3–1.0 mM, single site, specific binding algorithm).

[0314] Overall, in vitro assays of the activity of 12 selected PMOs were performed to confirm their predicted exon 44 skipping activity.

[0315] Example 3: Selection of length-optimized exon 44 skipping PMOs in healthy human immortalized myoblasts.

[0316] To select a PMO exhibiting the optimal length / activity ratio, the predicted free binding energy (ΔG) targeting the exon 44 acceptor site of short PMO oligonucleotides targeting the Ac0-Ac10 site was analyzed. Table 11 shows the predicted free binding energy (ΔG (kcal / mol)) of various PMO lengths targeting the exon 44 acceptor site of hDMD. ΔG was calculated using DNA-DNA oligonucleotide hybridization (IDT oligoanalyzer) as a first-order approximation.

[0317] [Table 11]

[0318] result

[0319] By characterizing the relationship between PMO molecular length and the predicted free binding energy (ΔG) to DMD target mRNA, we identified PMO oligonucleotides that retained maximum activity at sequence lengths of less than 30 mers. Shorter sequences were predicted to have lower binding energies compared to the 30-mer parent sequence (Table 11). From the predicted free binding energies (ΔG (kcal / mol)) of PMOs in Table 11, we selected and synthesized 13 different PMOs targeting acceptor sites between +2 and +10, with oligonucleotide lengths between 26 and 28 and apparent ΔG less than -50 kcal / mol (see boxes in Table 11). These include PMOs with predicted hDMD exon 44 skipping activity greater than 50% (hEx_44_Ac24_28, hEx_44_Ac25_28, and hEx_44_Ac28) (data not shown). The sequences of each of the 13 PMOs are shown in Table 10. Furthermore, a short 25-mer PMO hEx_44_Ac2_25 with a predicted binding energy (ΔG) of -40.8 kcal / mol was included as an internal control (see Table 11). For further in vitro screening of exon 44 skipping activity in human primary and immortalized skeletal muscle cells (hSkMCs), thirteen selected PMOs in the 26–28-mer range with free binding energy (ΔG) less than -50 kcal / mol, and a 25-mer as a control, were synthesized.

[0320] In vitro screening assay for exon 44 skipping

[0321] Human myoblast cell lines were obtained from the Association Institut de Myologie-Centre de Recherche en Myologie (UMRS 787 INSERM and Sorbonne Universite, France) through MyoBank (certification reference number AC-2019-3502), in partnership with EuroBioBank. The myoblast cell lines were derived from fascia lata (AB1167C20FL) of a healthy 20-year-old male donor. Cells were grown in Promocell growth medium (C-23160) supplemented with 5% FBS at a cell density of less than 80%. Immortalized myoblasts were seeded in growth medium at 50,000 cells / well in 24-well plates and grown until confluence, then differentiated. To induce differentiation into myotubes, cells were rinsed with DMEM and then incubated in differentiation medium (DMEM, 50 ug / mL gentamicin, 10 pg / mL insulin) for 3-4 days. Cells were incubated for 24 hours without antibiotics prior to transfection. PMO uptake into cells was promoted by synthesizing PMO using GeneTool, mixing it with water, heating at 65-70°C for 5 minutes, and diluting it in warm medium with 2 μM Endo-Porter (Gene Tools, #EP6P1-1). Experiments were performed using 0.3, 1, 3.3, and 10 μM PMO. After 48 hours, cells were harvested and RNA isolation and cDNA synthesis were performed as described above. For quantification by qPCR, the PCR reaction was repeated 40 times, and amplification of whole and exon 44-skipped PCR products was monitored using a QuantStudio 6 or 7 Flex Real-Time PCR instrument (Applied Biosystems). Data were analyzed using QuantStudio™ Real-Time PCR software v1.3 (Applied Biosystems). The percentage of exon 44-skipped mRNA was expressed as 100%. *The calculation was performed as 2(CT(total)-CT(skipped)). Primers used: hDMD TaqMan assay Hs01049401_ml (VIC-MGB, Thermo Fisher Scientific) or a custom-made TaqMan assay specific to the hDMD exon 43 / 45 junction (FAM-MGB, forward: 5'-CTGTGGAAAGGGTGAAGCTA-3' (SEQ ID NO: 90), reverse: 5'-GACAAGGGAACTCCAGGATG-3' (SEQ ID NO: 91), probe: 5'-AGCTCTCTCCCAGCTTGATTTCCA-3' (SEQ ID NO: 92). The dose response of the selected PMOs was fitted to a specific binding algorithm (single site). Total DMD mRNA and exon 44-skipped DMD mRNA were monitored by RT-qPCR. The dose response of the selected major PMOs was fitted to a specific binding algorithm (single site).

[0322] Transfecting myotubes derived from healthy, immortalized hSkMCs with selected PMOs revealed that three different PMOs of varying sizes exhibited superior exon 44 skipping activity compared to the others. 26-mer hEx44_Ac7_26, targeting acceptor site 7; 27-mer hEx44_Ac5_27, targeting acceptor site 5; and 28-mer hEx44_Ac4_28, targeting acceptor site 4, all showed at least 75% exon 44 skipping activity at a concentration of 10 μM (Figure 3). Among the three PMOs, PMO hEx44_Ac7-26-mer had the highest length / activity ratio and was selected as the PMO molecule for further evaluation in in vitro and in vivo assays.

[0323] Based on the exon 44 skipping activity derived from healthy immortalized hSkMCs, the 26-mer PMO hEx44_Ac7-26(5'-CGCCGCCATTTCTCAACAGATCTGTC-3' (SEQ ID NO: 118) exhibited the best exon 44 skipping activity among the three PMOs.

[0324] Example 4: hEx44_Ac7_26 induces exon 44 skipping activity in healthy human cells and cells derived from DMD patients.

[0325] Human immortalized and primary skeletal muscle cells (HSkMCs) (DMD cells: AB1323-immortalized, 47811-primary, 47898-primary; healthy cells: AB1167-immortalized, MB07-primary, MB09-primary) were obtained from the Institut de Myologie (loM) in Paris, France (immortalized cells) and the Besta Institute in Italy (primary cells). Two primary cell lines and one immortalized cell line were each derived from DMD patients with exon 45 deletion. Immortalized cells were grown in skeletal muscle growth medium (Promocell, C-23160). Primary cells were grown in GM consisting of DMEM+Glutamax (Gibco, catalog no. 10566-016) supplemented with 20% FBS (Corning), 1% Pen / Strep (ThermoFisher), 10ug / ml insulin (Sigma), 25ng / ml hFGF (Stemcell Technologies), and 10ng / ml EGF (Stemcell Technologies), and seeded into 24-well plates coated with 1% Matrigel (20,000 cells / well). Myoblasts were induced to form myotubes for 2 days in skeletal muscle cell differentiation medium (Promocell, catalog no. C-39366) and DMEM Glutamax (Gibco) supplemented with 1% Pen / Strep, according to the manufacturer's instructions. PMO was synthesized using GeneTool. The PMO was mixed with water, heated at 65-70°C for 5-10 minutes, and diluted in warm medium. Cells were harvested 48 hours after transfection. Cells were harvested in Trizol and stored at -80°C until processed for RNA isolation using the Direct-zol-96 RNA Isolation Kit (Zymo) according to the manufacturer's instructions. Total RNA concentration was quantified spectroscopically. cDNA was prepared from 100–500 ng of purified RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosciences) in a SimpliAmp thermal cycler (Applied Biosystems).40 ng of cDNA was distributed into droplets in three different ways using a QX200 Automated Droplet Generator (BioRad) combined with a Taqman probe (ThermoFischer), 2X ddPCR Supermix (without dUTP) (BioRad), and BamHI restriction enzyme (BioRad). After droplet generation, the mixture was loaded into a deep-well C1000 Touch thermal cycler (BioRad) for PCR amplification. Absolute quantification of target RNA molecules was measured using the QX200 Droplet Digital PCR system (BioRad) with QX Manager software (BioRad). The exon skipping rate was calculated by normalizing the number of target exons relative to total gene expression. Primers used: hDMD TaqMan assay Hs01049401_ml (VIC-MGB, Thermo Fisher Scientific) or a custom-made TaqMan assay specific to the hDMD exon 43 / 45 junction (FAM-MGB, forward: 5'-CTGTGGAAAGGGTGAAGCTA-3' (SEQ ID NO: 90), reverse: 5'-GACAAGGGAACTCCAGGATG-3' (SEQ ID NO: 91), probe: 5'-AGCTCTCTCCCAGCTTGATTTCCA-3' (SEQ ID NO: 92)).

[0326] result

[0327] Exon 44 skipping activity in primary and immortalized healthy patients or DMD patients was evaluated using myotubes transfected with hEx44_Ac7_26 and ddPCR, a highly sensitive and accurate method for quantifying exon skipping. These in vitro assays with hEx44_Ac7_26 were performed on myotubes from healthy patients and DMD patients with exon 45 deletion, suitable for exon 44 skipping therapy. As shown in Figure 4C, hEx44_Ac7_26 was able to induce exon 44 skipping in myotubes from healthy patients and DMD patients, and the exon 44 skipping activity in these cells was dose-dependent. Interestingly, the results show that hEx44_Ac7_26 exhibits higher exon 44 skipping activity in DMD cells than in healthy cells. Exon 44 skipping activity in DMD-derived patient cells transfected with hEx44_Ac7_26 is up to 60% (Figure 4C), while exon 44 skipping activity in healthy primary or immortalized cells is only up to 10% (Figures 4A-4B). While not bound by any particular theory, skipping of specific exons in dystrophin pre-mRNA in healthy cells can lead to destabilization of skipped mRNA and a decrease in total dystrophin mRNA, whereas hEx44_Ac7_26 induces frameshift repair in DMD-derived patient cells and significantly increases the level of skipped DMD transcript, which may correlate highly with an increase in total dystrophin mRNA expression levels to WT levels.

[0328] Overall, hEx44_Ac7_26 can induce exon 44 skipping in healthy human cells and cells derived from DMD patients, and the exon 44 skipping activity in DMD patient-derived cells is greater than that in healthy human cells.

[0329] Example 5: hEx44_Ac7_26 induces dystrophin repair in myotubes derived from DMD patients.

[0330] Human primary myoblasts derived from healthy patients and DMD patients were amplified in skeletal muscle growth medium (GM, Zenbio). On day 0, 15,000 human primary myoblasts per well were seeded in GM in 96-well MyoScreen CYTOO plates (CYTOO) coated with 10 μg / ml fibronectin (Invitrogen). The day after seeding (day 1), the growth medium was replaced with differentiation medium (DM) consisting of Dulbecco's modified Eagle medium: nutrient mixture F12 (DMEM / F12, Invitrogen), 2% horse serum (HS, GE Healthcare), 100 U / ml penicillin, and 100 μg / ml streptomycin (Invitrogen). On day 3 or 6, compounds (PMO and AOC) were added to the DMD cells for 6 days or 3 days, respectively, without changing the medium. PMO was synthesized using GeneTool for PMO treatment. PMO was heated at 70°C for 5 minutes, then slowly cooled before being added to the culture medium. Under these specific conditions, Endo-Porter (GeneTool) was simultaneously added to the wells at a concentration of 1 μM as a delivery reagent. Each experiment included simulated conditions corresponding to the vehicle + / -Endo-Porter, used as a negative control. On day 9, after fixing with 10% formalin (Sigma-Aldrich) for 30 minutes, the myotubes were washed three times with Dulbecco's phosphate-buffered saline (DPBS) and permeabilized with 0.5% Triton X-100 (Sigma-Aldrich). After blocking in 1% bovine serum albumin (BSA, Sigma-Aldrich), the cells were incubated with a primary antibody prepared in the blocking solution, and the myotubes were stained with troponin T-specific antibody (ab45932 Abcam) or myosin heavy chain-specific antibody (14-6503-82 Thermo Fisher). The C-terminal and N-terminal dystrophins were stained with NCL-Dys2 antibody and NCL-DysB antibody (Leica), respectively. After washing three times with DPBS, a secondary antibody prepared in 1% BSA was added to the wells along with Hoechst 33342. Finally, the cells were washed three times with DPBS and acquired.Quantitative microscopy was performed using an Operetta HCS imaging system equipped with a 10x / 0.3NA objective lens (PerkinElmer). Images were analyzed using a script developed with Acapella software (PerkinElmer), including customized segmentation of myotubes and nuclei. Myotubes were defined as areas positive for troponin-T or myosin heavy chain (MHC), skeletal muscle differentiation markers, and fitting specific optimized filters such as minimum / maximum area, maximum orientation, minimum elongation, and minimum / maximum length of myotubes. Nuclei counts were performed to determine the total number of nuclei. The fusion index (FI) was calculated as the number of nuclei within the myotube-stained area divided by the total number of nuclei and expressed as a percentage. After excluding myotubes touching the image boundary, the entire myotube was finally used to extract myotube area and mean dystrophin intensity. Each experiment included three healthy donors. The average intensity of dystrophin expression in these healthy myotubes was calculated and used as a criterion for evaluating the percentage of dystrophin repair in the DMD-treated condition, calculated using the following formula: Dystrophin Repair % = (IDMD Treatment - IDMD Simulation) / (Average Healthy - IDMD Simulation). The percentage of positive myotubes was determined for each condition as the percentage of myotubes expressing dystrophin intensity better than the threshold determined using the corresponding simulation condition.

[0331] Jess Capillary Western Blot

[0332] Immortalized human skeletal myoblasts from patients with exon 45 deletion and healthy human immortalized skeletal myoblasts were seeded in General Media (skeletal muscle growth medium, Promocell c-23160, 5% gentamicin, Gibco 15710064) at an initial density of 20,000 cells / well in 24-well plates coated with 1% Matrigel. Differentiation from myoblasts to myotubes was initiated 3 days after seeding by adding differentiation medium (DMEM + Glutmax Gibco 10566-016, Insulin Promocell C-39366). Myoblasts were harvested 4 days after differentiation and 2 days after PMO treatment. On ice, myoblasts underwent two washing cycles with cold DPBS (Gibco 14190144), followed by incubation for 5 minutes with M-PER lysis buffer (Thermo Fisher, 78501) and Halt protease inhibitor (Thermo Fisher, 78429). Each well was then individually rubbed for 20 seconds. The suspension was then collected and centrifuged at 14000 g for 15 minutes at 4°C. The supernatant was collected, and the total protein concentration was measured using the Pierce BCA protein assay kit (Thermo Scientific, 23227) according to the manufacturer's instructions. The samples were normalized to 300 μg / mL. The samples were then rapidly frozen in liquid nitrogen and quantified by Jess Capillary Western blotting. Dystrophin protein quantification was measured by capillary Western blotting analysis using a Protein Simple Jess system equipped with a 66-440kDA isolation module (Protein Simple, SM-W008), an anti-rabbit detection module (Protein Simple, DM-001), and a Replex module (Protein Simple, RP-001). Anti-dystrophin rabbit monoclonal antibody (Abcam, AB154168)-specific dystrophin was diluted 1:5000 in antibody dilution buffer 2 (Protein Simple). The anti-rabbit detection module contained a blocking reagent (antibody diluent), HRP-conjugated anti-rabbit secondary antibody, and a chemiluminescent substrate.The Replex module contained a total protein normalizing agent and a biotinylating agent. These reagents were seeded according to the manufacturer's protocol. Sample proteins, diluted to appropriate concentrations in sample buffer (10x sample buffer, 100-fold diluted from the separation module), were separated in a capillary and analyzed by chemiluminescence signaling. Dystrophin signals were determined using Compass software (Protein Simple). Low dystrophin signals were distinguished as background using the following criteria: the signal-to-noise (S / N) ratio provided by the software must be greater than 10, and the peak height / baseline ratio (manually calculated from the peak height and baseline values ​​provided by the software) must be greater than 3 (adopted from Beekman et al. 2018). Signals were normalized to the total protein of each sample in final quantification.

[0333] result

[0334] A dystrophin repair assay was performed using the MyoScreen platform. This platform utilizes culture conditions optimized for differentiation, maturation, and longevity of cultured myotubes, enabling the quantification of dystrophin repair by immunofluorescence. Figure 5A shows photographs of healthy cells and DMD patient-derived cells on the MyoScreen platform, immunofluoresced against dystrophin-positive fibers. Healthy cells (left panel) and DMD patient-derived cells transfected with hEx44_Ac7_26 (right panel) showed the presence of dystrophin, as indicated by positive cellular immunofluorescence staining, whereas DMD patient-derived cells did not express any dystrophin, as evidenced by the absence of immunofluorescence staining (center panel).

[0335] Quantitative immunofluorescence staining analysis of dystrophin repair in patient-derived cells transfected with PMO44 revealed that hEx44_Ac7_26 efficiently repaired dystrophin in a dose-dependent manner in primary myotubes from three patients (two primary cells with exon 45 deletion and one immortalized cell line) (Figure 5B). hEx44_Ac7_26 could repair up to 100% of dystrophin in immortalized DMD patient-derived cell lines compared to wild-type cells (healthy primary cells), while in two primary DMD patient-derived cell lines, it could induce up to 70% dystrophin repair compared to wild-type cells. Variability in dystrophin repair levels may depend on the DMD donor cells.

[0336] Furthermore, the level of dystrophin repair was quantified using Jess capillary Western blotting in healthy cells and immortalized DMD patient-derived cells (Figure 5C). The results show that hEx44_Ac7_26 can repair dystrophin expression levels in DMD patient-derived cells by up to 50% compared to the level of dystrophin in healthy primary cells.

[0337] Overall, hEx44_Ac7_26 was able to repair dystrophin and DAPC in primary cells and immortalized DMD patient-derived cells, with the degree of dystrophin repair depending on the DMD donor cells.

[0338] Example 6: In vitro dose-dependent exon 44 skipping activity in wild-type monkey myotubes treated with hEx44_Ac7_26

[0339] Wild-type cynomolgus monkey primary skeletal muscle cells (lot number SKM110414) were obtained from Worldwide Primate (WWP). Cells were grown in Zenbio GM medium (SKM-M) and seeded on 24-well plates coated with 1% Matrigel (Corning) (20,000 cells / well). Myoblasts were induced to form myotubes in Zenbio DM medium (SKM-D) for 2 days, according to the manufacturer's instructions. PMO was synthesized using GeneTool. PMO uptake into cells was promoted by mixing PMO with water, heating at 65-70°C for 5-10 minutes, and diluting in warm medium with 1 μM Endo-Porter (Gene Tools, #EP6P1-1). Cells were harvested 48 hours after transfection. Cells were harvested in Trizol and stored at -80°C until processed for RNA isolation using the Direct-zol-96 RNA Isolation Kit (Zymo) according to the manufacturer's instructions. Total RNA concentration was quantified spectroscopically. cDNA was prepared from 100–500 ng of purified RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosciences) in a SimpliAmp thermal cycler (Applied Biosystems). 40 ng of cDNA was distributed into droplets in three different ways using a QX200 Automated Droplet Generator (BioRad) combined with a 60X Taqman probe (ThermoFischer), a Taqman probe (ThermoFischer), a 2X ddPCR Supermix (without dUTP) (BioRad), and BamHI restriction enzyme (BioRad), targeting a skipped DMD (ID number AP7DUYJ) extending to the junction of exons 43-45 and a whole DMD (ID number Mf01049436_m1) extending to the junction of exons 39-40. After droplet generation, the mixture was loaded into a deep-well C1000 Touch thermal cycler (BioRad) for PCR amplification. Absolute quantification of the target RNA molecule was measured using the QX200 Droplet Digital PCR system (BioRad) with QX Manager software (BioRad).The rate of dystrophin exon skipping was calculated by normalizing the number of target exons relative to the total gene expression.

[0340] result

[0341] Since the acceptor sequence of exon 44 in the monkey DMD gene is identical to that of humans, we evaluated the exon 44 skipping activity in primary healthy monkey myotubes treated with increasing concentrations of hEx44_Ac7_26 using ddPCR. As shown in Figures 6A-6B, hEx44_Ac7_26 induces a potent dose-dependent response of exon 44 skipping in primary healthy monkey myotubes in vitro. hEx44_Ac7_26 induces over 25% exon 44 skipping (Figure 6A) and up to 100 exon 44 skipped copies per μl (Figure 6B) in healthy monkey myotubes. Interestingly, hEx44_Ac7_26 reduced the total number of DMD copies per μl to less than 400 compared to dystrophin mRNA copies in the control group. Similar to healthy human myotubes (see Example 4), the reduction in total dystrophin mRNA copy number in healthy monkey cells transfected with hEx44_Ac7_26 was up to 25% compared to DMD cells, which may be due to out-of-frame mutations in dystrophin mRNA resulting in destabilization of skipped exon mRNA.

[0342] Overall, these results demonstrate that hEx44_Ac7_26 can reduce DMD mRNA levels in primary healthy monkey cells, and that PMO-induced exon 44 skipping in healthy cells reduces DMD gene expression that can result from out-of-frame mutations in DMD mRNA.

[0343] Example 7: In vivo distribution of exon 44 skipping copies in muscle and non-muscle tissues of cynomolgus monkeys administered a single dose of hEx44_Ac7_26-AOC at a dose of 159.9 mg / kg, equivalent to a 30 mg / kg PMO(hEx44-Ac7-26) dose level, on day 0.

[0344] Scheme 1: Synthesis and purification of hEx44_Ac7_26-AOC

[0345] Antihuman transferrin receptor antibodies were produced. hEx44_Ac7_26PMO was synthesized using GeneTool. The antibody (10 mg / ml) in borate buffer (25 mM sodium tetraborate, 25 mM NaCl, 1 mM diethylenetriaminepentaacetic acid, pH 8.0) was reduced by adding 4 equivalents of tris(2-carboxyethyl)phosphine (TCEP) in water and incubating at 37°C for 4 hours. 4(N-maleimidomethyl)cyclohexanecarboxylic acid N-hydroxysuccinimide (SMCC) was coupled to the primary amine on the 3' end of hEx44_Ac7_26PMO by incubating hEx44_Ac7_26PMO (50 mg / ml) in DMSO with 10 equivalents of SMCC (10 mg / ml) in DMSO for 1 hour. The unconjugated SMCC was removed by ultrafiltration using an Amicon Ultra-15 centrifugal filter unit equipped with a 3 kDa MWCO. hEx44_Ac7_26PMO-SMCC was washed three times with acetate buffer (10 mM sodium acetate, pH 6.0) and used immediately. The reduced antibody was mixed with 2.25 equivalents of hEx44_Ac7_26PMO-SMCC and incubated overnight at 4°C. The pH of the reaction mixture was then reduced to 7.5, and 8 equivalents of N-ethylmaleimide were added to the mixture at room temperature over 30 minutes to quench the unreacted cysteine.

[0346] The reaction mixture was purified using the HIC method-1 with an AKTA Explorer FPLC. Depending on the conjugate, fractions containing conjugates with a drug-to-antibody ratio of 1 (DAR1), 2 (DAR2), 3 (DAR3), 4 (DAR4), 5 (DAR5), 6 (DAR6), 7 (DAR7), or 8 (DAR8), or fractions containing conjugates with a drug-to-antibody ratio of 3+ (DAR3+), 4+ (DAR4+), 5+ (DAR5+), 6+ (DAR6+), 7+ (DAR7+), or (DAR8+), or fractions containing conjugates with an average drug-to-antibody ratio of 1 (DAR1), 2 (DAR2), 3 (DAR3), 4 (DAR4), 5 (DAR5), 6 (DAR6), 7 (DAR7), or 8 (DAR8), were combined and concentrated using an Amicon Ultra-15 centrifugal filter unit equipped with a 50 kDa MWCO. The concentrated conjugate was buffered with PBS (pH 7.4) using an Amicon Ultra-15 centrifugation filter unit before analysis.

[0347] Hydrophobic Interaction Chromatography (HIC) Method-1 Column: GE, HiScreen Butyl HP, 4.7ml Solvent A: 50 mM phosphate buffer, 0.7 M ammonium sulfate, pH 7.0; Solvent B: 80% 50 mM phosphate buffer, 20% IPA, pH 7.0; Flow rate: 1.0 ml / min gradient: A's % B's % Column volume 100 0 1 70 30 25 0 100 1 0 100 2 hEx44_Ac7_26-AOC was quantified by BCA and analyzed by HIC (Avg DAR ≈ 3.8~4.0), SEC (3.3% HMW), and LAL (<0.025 EU per 1 mg of anti-transferrin receptor antibody). The products were stored at 4°C.

[0348] Scheme 2: Synthesis and purification of hEx44_Ac7_26-AOC

[0349] Antihuman transferrin receptor antibodies were produced. hEx44_Ac7_26PMO was synthesized. The antibody (20.4 mg / ml) in citrate buffer (50 mM sodium citrate, 300 mM sucrose, pH 6.5) was combined with ethylenediaminetetraacetic acid (EDTA, 0.5 M, 0.591 mL), and reduced by adding 2 equivalents of tris(2-carboxyethyl)phosphine (TCEP) in water and incubating at 37°C for 2 hours. 4(N-maleimidomethyl)cyclohexanecarboxylic acid N-hydroxysuccinimide (SMCC) was coupled to the primary amine on the 3' end of hEx44_Ac7_26PMO by incubating hEx44_Ac7_26PMO (50 mg / ml) in 50 mM phosphate buffer at pH 7.2 with 3 equivalents of SMCC (50 mg / ml) in DMSO for 1 hour. Unconjugated SMCC was removed by tangential flow filtration (TFF) using a 3kDa membrane MWCO containing acetate buffer (10 mM sodium acetate, pH 6.0). The reduced antibody was mixed with 4.75 equivalents of hEx44_Ac7_26PMO-SMCC and incubated at room temperature for 1 hour. Unreacted cysteine ​​was quenched by adding N-ethylmaleimide (10 equivalents, 15 mg / ml in DMSO, 25 mg) to the mixture over 30 minutes at room temperature. The reaction product was diluted to 1 L with endotoxin-free water. Excess PMO and NEM were removed by SCX purification using SCX method-1 (GE SP / HP 16 10 resin). The combined fraction was buffer-exchanged to citrate buffer (50 mM sodium citrate, 60 mM NaCl, pH 5.5) via TFF and concentrated to approximately 25 mg Ab / mL. The solution was sterile filtered through a 0.22 μm membrane.

[0350] Strong Cation Chromatography (SCX) Method - 1 Column: GE HiScale 50, HiPrep SP HP, 200ml Solvent A: 25 mM acetate, 25 mM PB, pH 6; Solvent B: 25 mM acetate, 25 mM PB, pH 6, 0.5 mM NaCl; Flow rate: 30 ml / min gradient: A's % B's % Column volume 100 0 3 40 60 1.5 0 100 0.2 0 100 1 hEx44_Ac7_26-AOC was quantified by BCA and analyzed by HIC (Avg DAR ≈ 3.8~4.0), SEC (3.3% HMW), and LAL (<0.025 EU per 1 mg of anti-transferrin receptor antibody). The products were stored at 4°C.

[0351] Scheme 3: Synthesis and purification of hEx44_Ac7_26-AOC

[0352] Anti-human transferrin receptor antibodies were produced in citrate buffer (50 mM sodium citrate, 300 mM sucrose, pH 6.5). hEx44_Ac7_26PMO-SMCC was synthesized by coupling 4(N-maleimidomethyl)cyclohexanecarboxylic acid N-hydroxysuccinimide ester (SMCC) to the primary amine at the 3' end of hEx44_Ac7_26PMO. Ethylenediaminetetraacetic acid (EDTA, 0.5 M, 0.05 mL) was added to the antibody and the solution was thoroughly mixed. The antibody was reduced by adding tris(2-carboxyethyl)phosphine (TCEP, 20 mg / mL in H2O, 10 equivalents, 19.5 mg, 0.973 mL), and the solution was incubated at 37°C for 2 hours. The reduced antibody solution was removed from the incubator and cooled to room temperature. hEx44_Ac7_26PMO-SMCC solution (12 equivalents, 27.4 mg / mL in 10 mM acetate, pH 6, 26.1 mL) was added to the reducing antibody solution and thoroughly mixed. The reaction was allowed to proceed at room temperature for 1 hour. n-ethylmaleimide (NEM) solution (10 equivalents, 25 mg / mL in DMSO, 8.5 mg, 0.34 mL) was added to the reaction mixture, and the reaction was allowed to proceed at room temperature for 30 minutes to quench unreacted cysteine. The reaction mixture was diluted to 0.2 L with endotoxin-free water. Excess PMO and NEM were removed by strong cation chromatography purification using the SCX method-1. The combined fraction was buffer-exchanged with histidine buffer (20 mM histidine, 10 mM methionine, 120 mM sucrose, pH 6.0) by spin filtration and quantified by BCA assay (0.79 g, yield 79%). The solution was sterile filtered through a 0.22 μm membrane. PMO44-AOC was quantified by BCA and analyzed by hydrophobic interaction chromatography (mean DAR ≈ 8), size exclusion chromatography (3.3% HMW), reduced capillary gel electrophoresis (mean DAR ≈ 7.8–8.0), and ELISA binding affinity to the human transferrin receptor (Kd at 74.5 pM). The affinity of hEx44_Ac7_26-AOC DAR8 AOC was equivalent to that of the non-conjugate anti-transferrin receptor antibody, as shown in Figure 7.

[0353] Exon-44 skipping assay

[0354] Cynomolgus monkeys were given a single intravenous (IV) injection of 159.9 mg / kg of hEx44_Ac7_26-AOC, equivalent to a PMO dose level of 30 mg / kg. Muscle tissue and non-muscle biopsy samples were obtained from the monkeys on days 43 / 44 (pre-necropsy). In the vehicle control group, animals did not receive any hEx44_Ac7_26-AOC. Four male animals were analyzed from each group.

[0355] Muscle and non-muscle samples of cynomolgus monkeys ranging from 20 to 50 mg were homogenized in 1 mL of TRIzol (Thermo Fisher) on an OMNI Bead Ruptor Elite system (OMNI International). RNA was isolated from the tissue homogenate supernatant using the Direct-zol-96 RNA kit (Zymo Research) according to the manufacturer's instructions. 250 ng of purified RNA was converted to cDNA using a high-volume cDNA reverse transcription kit (Applied Biosystems) and a SimpliAmp thermal cycler (Applied Biosystems). ddPCR was performed on 50 ng of cDNA in reactions using a commercially available Total DMD Taqman assay (Mf01049436_m1 VIC-MGB, Thermo Fisher), a custom Skipped DMD Taqman assay (forward primer: AAGGACCGACAAGGGAACT (SEQ ID NO: 93), probe (FAM-MGB): TTCTGACAACAGTTTGCCGCTGC (SEQ ID NO: 94), reverse primer: GCTGAAATTATTTCTTCCGCAGTTG (SEQ ID NO: 95, Thermo Fisher), ddPCR Supermix for probes (without dUTP, Bio-Rad), BamHI-HF restriction enzyme (New England BioLabs), and Ambion nuclease-free water (Thermo Fisher). Each sample from the three assays was dispensed into droplets using a QX200 Automated Droplet Generator (Bio-Rad). After droplet generation, the sample was transferred to a C1000 Touch thermal cycler equipped with a 96-Deep Well Reaction Module (Bio-Rad). After PCR amplification, the sample was loaded into a QX200 Droplet Reader (Bio-Rad). Data was analyzed using QX Manager software, standard version, version 1.2 (Bio-Rad). Discrimination between positive and negative droplets was achieved by manually applying a fluorescence amplitude threshold. The exon skipping rate was set to 100. *It was calculated as (number of skipped exon 44 copies per 1 μL / total DMD copies per 1 μL).

[0356] result

[0357] Cynomolgus monkeys received a single intravenous injection of hEx44-Ac7-26-AOC at a dose of 159.9 mg / kg, equivalent to a 30 mg / kg PMO(hEx44-Ac7-26) dose level, on day 0. Muscle and non-muscle tissues obtained from the animals were collected 43 / 44 days after administration, and the number of exon 44 skip copies in these tissues was measured by ddPCR. Exon 44 skipping activity was not detected in PBS-injected samples. 44 days after a single intravenous injection of 159.9 mg / kg of hEx44_Ac7_26-AOC, exon 44 skipping activity was detected in all muscle tissues, but not in non-muscle tissues, including liver and kidney (see Figure 8). Exon 44 skipping activity in muscle was detected in both skeletal muscle and cardiac muscle. The highest level of exon 44 skipping activity in muscle tissue was detected in the rectus femoris muscle, where more than 25 exon 44 skipping copies were detected per 1 ng of cDNA, while the lowest level was detected in the biceps brachii muscle, where fewer than 5 copies were detected per 1 ng of cDNA. Furthermore, exon 44 skipping activity in the cardiac atria and ventricles was measured with an average of approximately 7 exon 44 skipping copies per 1 ng of cDNA. These results indicate that hEx44_Ac7_26-AOC specifically targets muscle tissue, both skeletal and cardiac muscle, and induces exon 44 skipping in these specific tissues. Exon 44 skipping activity was detected 43 days after a single IV infusion of hEx44_Ac7_26-AOC, demonstrating its long-acting activity in the target tissues. Overall, the exon 44 skipping activity induced by hEx44_Ac7_26-AOC is specific to muscle tissue, and hEx44_Ac7_26-AOC possesses challenging exon 44 skipping activity in muscle tissue.

[0358] While preferred embodiments of the Disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided merely as examples. Numerous variations, alterations, and substitutions will be conceivable to those skilled in the art without departing from the Disclosure. It should be understood that various alternatives to the embodiments of the Disclosure described herein may be adopted in the practice of the Disclosure. The following claims define the scope of the Disclosure, and the methods and structures within these claims, as well as their equivalents, are intended to be covered by these claims.

Claims

1. A PMO conjugate comprising an anti-transferrin receptor antibody or its antigen-binding fragment conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO) molecule, which is the PMO molecule of Sequence ID No.

118.

2. The anti-transferrin receptor antibody or its antigen-binding fragment may be a humanized antibody or its antigen-binding fragment, a chimeric antibody or its antigen-binding fragment, a monoclonal antibody or its antigen-binding fragment, a monovalent Fab', or a bivalent Fab. 2 The PMO conjugate according to claim 1, comprising a single-chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single-domain antibody (sdAb), or a camelid antibody or its antigen-binding fragment.

3. The PMO conjugate according to claim 1, wherein the PMO molecule is conjugated to the anti-transferrin receptor antibody or its antigen-binding fragment via a linker.

4. The PMO conjugate according to claim 3, wherein the linker is a cleavable linker or a non-cleavable linker, and the linker is a heterobifunctional linker or a homobifunctional linker.

5. The PMO conjugate according to claim 1, having a PMO molecule-to-antibody ratio (DAR) of 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, or higher.

6. The PMO conjugate according to claim 1, having an average DAR of 1, 2, 3, 4, 5, 6, 7, 8 or more.

7. The PMO conjugate according to claim 1, having an average DAR in the range of 3.5 to 4.5 or 7.5 to 8.

5.

8. The PMO conjugate according to claim 1, having an average DAR of 4 or 8.

9. The PMO conjugate according to claim 1, having 4 or 8 DARs.

10. A pharmaceutical composition for treating muscular dystrophy in subjects requiring treatment for muscular dystrophy, wherein the pharmaceutical composition comprises a PMO conjugate containing an anti-transferrin receptor antibody or its antigen-binding fragment conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO) molecule of Sequence ID No. 118, wherein the PMO molecule induces exon 44 skipping in the pre-mRNA transcript of the DMD gene to produce an mRNA transcript encoding a cleaved dystrophin protein.

11. The pharmaceutical composition according to claim 10, wherein the PMO molecule is delivered into muscle cells.

12. The anti-transferrin receptor antibody or its antigen-binding fragment may be a humanized antibody or its antigen-binding fragment, a chimeric antibody or its antigen-binding fragment, a monoclonal antibody or its antigen-binding fragment, a monovalent Fab', or a bivalent Fab. 2 The pharmaceutical composition according to claim 10, comprising a single-chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single-domain antibody (sdAb), or a camelid antibody or an antigen-binding fragment thereof.

13. The pharmaceutical composition according to claim 10, wherein the PMO molecule is conjugated to the anti-transferrin receptor antibody or its antigen-binding fragment via a linker.

14. The pharmaceutical composition according to claim 13, wherein the linker is a cleavable linker or an incleavable linker, and the linker is a heterobifunctional linker or a homobifunctional linker.

15. The pharmaceutical composition according to claim 10, wherein the PMO conjugate has an average PMO molecule-to-antibody ratio (DAR) of 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:

1.

16. The pharmaceutical composition according to claim 10, wherein the PMO conjugate has an average DAR in the range of 3.5 to 4.5 or 7.5 to 8.

5.

17. The pharmaceutical composition according to claim 10, wherein the PMO conjugate has an average DAR of 4 or 8.

18. The pharmaceutical composition according to claim 10, wherein the PMO conjugate is administered parenterally.

19. The pharmaceutical composition according to claim 10, wherein the cleaved dystrophin protein regulates muscular dystrophy.

20. The pharmaceutical composition according to claim 19, wherein the muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy.

21. The PMO conjugate according to claim 1, wherein the anti-transferrin receptor antibody or its antigen-binding fragment comprises a variable heavy chain (VH) region comprising HCDR1 comprising the sequence of SEQ ID NO: 17, HCDR2 comprising the sequence of SEQ ID NO: 20, and HCDR3 comprising the sequence of SEQ ID NO: 19, and the anti-transferrin receptor antibody or its antigen-binding fragment comprises a variable light chain (VL) region comprising LCDR1 comprising the sequence of SEQ ID NO: 22, LCDR2 comprising the sequence of SEQ ID NO: 23, and LCDR3 comprising the sequence of SEQ ID NO:

24.

22. The PMO conjugate according to claim 21, wherein the VH region includes the sequence of sequence number 30 and the VL region includes the sequence of sequence number 34.

23. The pharmaceutical composition according to claim 10, wherein the anti-transferrin receptor antibody or its antigen-binding fragment comprises a variable heavy chain (VH) region comprising HCDR1 comprising the sequence of SEQ ID NO: 17, HCDR2 comprising the sequence of SEQ ID NO: 20, and HCDR3 comprising the sequence of SEQ ID NO: 19, and the anti-transferrin receptor antibody or its antigen-binding fragment comprises a variable light chain (VL) region comprising LCDR1 comprising the sequence of SEQ ID NO: 22, LCDR2 comprising the sequence of SEQ ID NO: 23, and LCDR3 comprising the sequence of SEQ ID NO:

24.

24. The pharmaceutical composition according to claim 23, wherein the VH region includes the sequence of sequence number 30 and the VL region includes the sequence of sequence number 34.

Citation Information

Patent Citations

  • Probe and non-invasive kit for detecting pseudo-hypertrophic muscular dystrophy

    CN104498614A

  • Pre-mRNA splice-switching or modulating oligonucleotides containing bicyclic scaffold moieties with improved characteristics for the treatment of genetic disorders

    JP2019522972A

  • Nucleic acid polypeptide compositions and methods for inducing exon skipping

    JP2020537497A

  • Means and method for inducing exon-skipping

    US8361979B2

  • Oligomers

    US8461325B2