Methods and products for genetic engineering

Abstract

To provide an improved tool and method for gene editing by using a CRISPR / Cas technique.SOLUTION: The present invention relates to virus-derived particles including one or more Cas proteins, and a kit and a method using the particles in order to change a target nucleic acid. The present invention further relates to (i) a fusion protein including a viral protein which self assembles for generating virus-derived particles, where the virus protein is fused to (ii) the Cas protein. In some embodiments, the fusion protein includes a cleavable portion positioned between the viral protein and the Cas protein, particularly a cleavable portion positioned between a Gag protein and a Cas9 protein.SELECTED DRAWING: None

Description

Technical Field

[0001] Field of the Invention The present invention relates to the field of gene targeting by methods using a virus-derived vector system related to clustered regularly interspaced short palindromic repeat (CRISPR) and its components.

Background Art

[0002] Background of the Invention Genome editing using targetable nucleases is a new technology for precise genome modification of organisms ranging from bacteria to plants and animals (including humans). Its attraction is that it can be used for almost all organisms for which targeted genome modification was impossible with other types of methods.

[0003] Improvement of protocols for expressing exogenous proteins in human cells is of great interest for research and medical purposes. Despite the continuous evolution of transfection methods and performance of viral vectors, especially in primary cells that are very sensitive to modification of their environment and can vary in response to transfection agents / vectors, the efficiency of these approaches can vary dramatically. Also, delivery of genetic information via integration / non-integration of coding DNA can cause harmful effects such as induction of unwanted stress signals or unexpected insertion of exogenous genes into the cell genome, which is particularly serious in the case of therapeutic use of stem cells.

[0004] Recent approaches to targeted genome modification (zinc finger nucleases (ZFNs) and activator-like effector nucleases (TALENs)) have enabled researchers to generate persistent mutations by introducing double-strand breaks and activating repair pathways. The ability of engineered nucleases (e.g., ZFNs and TALENs) to induce DNA double-strand breaks at desired locations in the genome has led to optimism about the therapeutic applications of locus-specific genome manipulation. However, these approaches are costly and time-consuming for engineers, limiting their widespread use, particularly in large-scale, high-throughput studies.

[0005] More recently, novel tools based on entirely separate and specific systems (i.e., bacterial CRISPR-related protein-9 nuclease (Cas9) from Streptococcus pyogenes) have attracted considerable attention.

[0006] To achieve site-specific DNA recognition and cleavage, Cas9 must form a complex with both crRNA and a separate transactivating crRNA (tracrRNA or trRNA) (which is partially complementary to crRNA) (11). tracrRNA is required for crRNA maturation from primary transcripts encoding multiple pre-crRNAs.

[0007] During target DNA cleavage, the HNH and RuvC-like nuclease domains cut both DNA strands, generating double-strand breaks (DSBs) at sites determined by a 20-nucleotide guide sequence in the associated crRNA transcript (which base-pairs with the target DNA). The HNH domain cleaves the target DNA strand complementary to the guide RNA, while the RuvC domain cleaves the non-complementary strand. Cas9's double-strand endonuclease activity also requires a short, conserved sequence (2–5 nt) known as a protospacer-associated motif (PAM) to be immediately after the 3' end of the crRNA complementary sequence.

[0008] The simplicity of the type II CRISPR nuclease, which has only three essential components (Cas9 plus crRNA and trRNA), makes this system suitable for genome editing. This potential was realized in 2012 by Doudna and Charpentier laboratories (Jinek et al., 2012, Science, Vol.337: 816-821). Based on previously described type II CRISPR systems, a simple two-component system was developed by aligning trRNA and crRNA with a single synthetic single guide RNA (sgRNA). The sgRNA-programmed Cas9 was shown to be effective as Cas9 programmed with separate trRNA and crRNA when guiding target gene changes.

[0009] Mainly, genome editing protocols employ three different variants of the Cas9 nuclease. The first is wild-type Cas9, which can site-specifically cleave double-stranded DNA, leading to activation of the double-strand break (DSB) repair mechanism. DSBs are repaired by the non-homologous end joining (NHEJ) pathway (Overballe-Petersen et al., 2013, Proc Natl Acad Sci USA, Vol. 110: 19860-19865), potentially resulting in insertions and / or deletions (indels) that disrupt the target locus. Alternatively, if a donor template homologous to the target locus is supplied, the DSB can be repaired by a homology-specific repair (HDR) pathway that enables precise substitution mutations (Overballe-Petersen et al., 2013, Proc Natl Acad Sci USA, Vol. 110: 19860-19865; Gong et al., 2005, Nat. Struct Mol Biol, Vol. 12: 304-312).

[0010] Cong et al. (2013, Science, Vol. 339: 819-823) further advanced the Cas9 system to higher precision by developing a mutant (known as Cas9D10A) that possesses only nickase activity. This means that Cas9D10A cleaves only one DNA strand and does not activate the NHEJ. Instead, when a homologous repair template is provided, DNA repair occurs only via the high-fidelity HDR pathway, reducing indel mutations (Cong et al., 2013, Science, Vol. 339: 819-823; Jinek et al., 2012, Science, Vol.337: 816-821; Qi et al., 2013 Cell, Vol. 152: 1173-1183). When locus is targeted by a pair of Cas9 complexes designed to generate adjacent DNA nicks, Cas9D10A becomes even more attractive in terms of target specificity.

[0011] A third variant is nuclease-deficient Cas9 (Qi et al., 2013 Cell, Vol. 152: 1173-1183). Mutations H840A in the HNH domain and D10A in the RuvC domain inactivate cleavage activity but do not prevent DNA binding. Therefore, this variant can be used to sequence-specifically target any region of the genome without cleavage. Alternatively, by fusing with various effector domains, dCas9 can be used as either a gene silencing or activation tool. Furthermore, it can be used as a visualization tool by coupling guide RNA or the Cas9 protein to a fluorophore or fluorescent protein.

[0012] Following its initial demonstration in 2012 (9), the CRISPR / Cas9 system has been widely adopted in the scientific community. It is found in humans (Mali et al., 2013, Science, Vol. 339: 823-826), bacteria (Fabre et al., 2014, PLoS Negl. Trop. Dis., Vol. 8:e2671.), zebrafish (Hwang et al., 2013, PLoS One, Vol. 8:e68708.), C. elegans (Hai et al., 2014 Cell Res. doi: 10.1038 / cr.2014.11.), bacteria (Fabre et al., 2014, PLoS Negl. Trop. Dis., Vol. 8:e2671.), and plants (Mali et al., 2013, Science, Vol. 339: 823-826), Xenopus tropicalis (Guo et al., 2014, Development, Vol. 141: 707-714.), yeast (DiCarlo et al., 2013, Nucleic Acids Res., Vol. 41: 4336-4343.), Drosophila (Gratz et al., 2014 Genetics, doi:10.1534 / genetics.113.160713), monkey (Niu et al., 2014, Cell, Vol. 156: 836-843.), rabbit (Yang et al., 2014, J. Mol. Cell Biol., Vol. 6: 97-99.), pig (Hai et al., 2014, Cell Res. doi: 10.1038 / cr.2014.11.), rat (Ma et al., 2014, Cell Res., Vol. This method has been successfully used to target important genes in many cell lines and organisms, including mice (Mashiko et al., 2014, Dev. Growth Differ. Vol. 56: 122-129.). Currently, several groups are using this method to introduce single point mutations (deletions or insertions) into specific target genes via single gRNAs.Alternatively, pairs of gRNA-specific Cas9 nucleases can be used to induce larger deletions or genomic rearrangements, such as inversions or translocations. A recent exciting development is the use of the dCas9 version of the CRISPR / Cas9 system to target protein domains for transcriptional regulation, epigenetic modification, and microscopic visualization of specific genomic loci.

[0013] To alter target specificity, the CRISPR / Cas9 system requires only crRNA redesign. This contrasts with other genome editing tools (including zinc fingers and TALENs) that require redesign of the protein-DNA interface. Furthermore, CRISPR / Cas9 enables rapid, genome-wide investigations of gene function by generating large gRNA libraries for genome screening.

[0014] Therefore, CRISPR / Cas9 technology can be easily adapted to any gene of interest, offering unparalleled potential for genetic modification (knockout, knock-in, and precise mutation introduction). Its adoption in the scientific community has been remarkably rapid, triggering the recent surge in scientific communication using it.

[0015] Generally, CRISPR delivery is carried out by DNA transfection or via the use of viral vectors encoding Cas9. While both methods are convenient, they are limited to specific cell types and are quite interfering. Furthermore, Cas9-mediated cleavage occurs rapidly (Jinek et al., 2013, eLife, Vol. 2, e00471) and can even be toxic in the long term, so maintaining Cas9 expression for extended periods is likely toxic and, at best, unnecessary. Other approaches have successfully delivered RNPc via proteotransfection or physical microinjection using recombinant Cas9 and synthetic RNA, but these CRISPR systems are still limited to targeting vulnerable primary cells.

[0016] In this field, there is a need for improved tools and methods for gene editing using CRISPR / Cas technology. [Overview of the project]

[0017] The present invention relates to products and methods for inducing changes in genomic nucleic acids; these changes include mutations resulting from the introduction of nucleic acid insertions and deletions, including knock-in and knock-out genomic alterations.

[0018] More precisely, the present invention relates to a product and a method of using the same, which aims to induce nucleic acid alteration events caused by the CRISPR-Cas complex, particularly the CRISPR-Cas9 complex.

[0019] The present invention relates to virus-derived particles containing one or more Cas proteins, particularly the Cas9 protein.

[0020] In some embodiments, the virus-derived particles further comprise or are further complexed with one or more CRISPR-Cas guide RNAs.

[0021] In some embodiments, the virus-derived particles further contain or are further complexed with targeting nucleic acids.

[0022] In some embodiments, the virus-derived particles are retrovirus-derived particles, such as lentivirus-derived vector particles.

[0023] The present invention further relates to a composition for altering a target nucleic acid in eukaryotic cells, comprising virus-derived particles containing one or more Cas proteins, particularly Cas9 protein.

[0024] In some embodiments, the composition further comprises or alternatively is further complexed with one or more CRISPR-Cas system guide RNAs.

[0025] In some embodiments, the composition further comprises a targeting nucleic acid.

[0026] The invention also relates to a kit comprising the necessary substances for preparing the virus-derived particle or composition as defined above.

[0027] It also relates to a genetically modified cell, particularly a cell in the form of a stable cell line, which produces the virus-derived particle as defined herein.

[0028] The invention further relates to a fusion protein comprising a viral protein that self-assembles to generate a virus-derived particle, wherein the viral protein is fused to (ii) a Cas protein. In some embodiments, the fusion protein comprises a cleavable site located between the viral protein and the Cas protein, particularly a cleavable site located between the Gag protein and the Cas9 protein.

[0029] It also relates to a nucleic acid and a vector encoding the fusion protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] [Figure 1A]Molecular basis of Cas9-VLP assembly and transfer of CRISPR components into recipient cells. (A) Schematic diagram of Cas9-VLP assembly from HEK293T cells. Six steps are shown. (1) HEK293T cells are transfected with GAG-CAS9, GAG ProPol, and viral envelope protein in conjunction with a construct encoding guide RNA. The GAG ​​and viral envelope tend to localize to the membrane where the assembly of virus-derived particles (which may also be referred to herein as “virus-like particles” or “VLPs”) occurs (2). As the concentration of GAG increases, mechanical forces induce particle formation (3), which will budding from the producing cells after all participating elements of the CRISPR mechanism have been incorporated (4). These particles are enrichable and ultrastable for 15 days at 4°C. During the maturation process, viral proteases may have released most of the Cas9 protein from the GAG ​​platform within the particles (5). Upon exposure to target cells, VLPs may be able to bind and fuse with the cell membrane via envelope / receptor interactions (and thus depend on the envelope used to pseudotype the particle and the target cell under consideration). Following fusion with the cell membrane, VLPs transport their cargo into the recipient cell, which may contain a Cas9 / gRNA ribonucleo complex (possibly free gRNA or Cas9 associated with a non-protease GAG) (still unclear). Nevertheless, fully active CRISPR RNPc is delivered to the nucleus of the recipient cell (possibly by reassociation of Cas9 and free gRNA within the target cell) and mediates the cleavage of genomic DNA at precisely the site specified by the gRNA (6). (B) Molecular design of the GAG-Cas9 coding construct. hCMVp (human cytomegalovirus initial promoter) drives the expression of mRNA incorporating intron (rBG) and polyadenylation (rBGpA) signals (both derived from the rabbit β-globin gene sequence). This construct consists of a fusion of the MLV-GAG polyprotein and a codon-optimized Cas9 sequence derived from Streptococcus pyogenes.The two parts are separated by the MLV protease cleavage site (ps) and the flag tag sequence fused to the Cas9 sequence. [Figure 1B]Molecular basis of Cas9-VLP assembly and transfer of CRISPR components into recipient cells. (A) Schematic diagram of Cas9-VLP assembly from HEK293T cells. Six steps are shown. (1) HEK293T cells are transfected with GAG-CAS9, GAG ProPol, and viral envelope protein in conjunction with a construct encoding guide RNA. The GAG ​​and viral envelope tend to localize to the membrane where the assembly of virus-derived particles (which may also be referred to herein as “virus-like particles” or “VLPs”) occurs (2). As the concentration of GAG increases, mechanical forces induce particle formation (3), which will budding from the producing cells after all participating elements of the CRISPR mechanism have been incorporated (4). These particles are enrichable and ultrastable for 15 days at 4°C. During the maturation process, viral proteases may have released most of the Cas9 protein from the GAG ​​platform within the particles (5). Upon exposure to target cells, VLPs may be able to bind and fuse with the cell membrane via envelope / receptor interactions (and thus depend on the envelope used to pseudotype the particle and the target cell under consideration). Following fusion with the cell membrane, VLPs transport their cargo into the recipient cell, which may contain a Cas9 / gRNA ribonucleo complex (possibly free gRNA or Cas9 associated with a non-protease GAG) (still unclear). Nevertheless, fully active CRISPR RNPc is delivered to the nucleus of the recipient cell (possibly by reassociation of Cas9 and free gRNA within the target cell) and mediates the cleavage of genomic DNA at precisely the site specified by the gRNA (6). (B) Molecular design of the GAG-Cas9 coding construct. hCMVp (human cytomegalovirus initial promoter) drives the expression of mRNA incorporating intron (rBG) and polyadenylation (rBGpA) signals (both derived from the rabbit β-globin gene sequence). This construct consists of a fusion of the MLV-GAG polyprotein and a codon-optimized Cas9 sequence derived from Streptococcus pyogenes.The two parts are separated by the MLV protease cleavage site (ps) and the flag tag sequence fused to the Cas9 sequence. [Figure 2A] Molecular validation of gene cleavage by YFP-CRISPR-VLP (A) Localization of gRNA recognition site on the YFP gene, primers used, and principle of the surveyor assay. The YFP coding vector was lenticular transduction into L929 mouse cells at a low MOI. Then, after 72 hours, the cells were treated with VLPs loaded with gRNAs targeting the YFP gene at two different locations shown. To confirm YFP cleavage, cells treated with Cas9-VLPs were lysed, genomic DNA was extracted, and analyzed by an S1 nuclease-based surveyor assay. The test detects the heteroduplex formed when two closely related ssDNA molecules hybridize: therefore, S1 nuclease digestion is evidence that the DNA was cleaved by Cas9. (B) Surveyor assay of L929 cells treated with VLPs loaded with gRNA2, 1, or a combination of both. We detect the formation of heteroduplexes under each rRNA condition and identify truncated YFPs whose size depends on the position of the gRNA on the YFP sequence. [Figure 2B]Molecular validation of gene cleavage by YFP-CRISPR-VLP (A) Localization of gRNA recognition site on the YFP gene, primers used, and principle of the surveyor assay. The YFP coding vector was lenticular transduction into L929 mouse cells at a low MOI. Then, after 72 hours, the cells were treated with VLPs loaded with gRNAs targeting the YFP gene at two different locations shown. To confirm YFP cleavage, cells treated with Cas9-VLPs were lysed, genomic DNA was extracted, and analyzed by an S1 nuclease-based surveyor assay. The test detects the heteroduplex formed when two closely related ssDNA molecules hybridize: therefore, S1 nuclease digestion is evidence that the DNA was cleaved by Cas9. (B) Surveyor assay of L929 cells treated with VLPs loaded with gRNA2, 1, or a combination of both. We detect the formation of heteroduplexes under each rRNA condition and identify truncated YFPs whose size depends on the position of the gRNA on the YFP sequence. [Figure 3A]CRISPR-mediated disruption of YFP in L929 mouse cells by Cas9-VLP. (A) Guide RNA was created to target YFP downstream of the start codon ATG. After cleavage, cells were able to repair this gap by NHEJ (a mechanism that can create small deletions and indels (damages that can alter the YFP frame in some cells)). Thus, three different versions of repaired YFP can be produced by the innate repair mechanism, but only one of them repairs in-frame YFP and maintains the YFP phenotype. Therefore, cleavage should induce a detectable but incomplete reduction of YFP in the target cells. (B) VLPs loaded with Cas9 and guide RNA targeting YFP were produced and directly introduced into the medium of YFP-L929 cells (mouse fibroblast cell line #), and YFP was stably incorporated into the genome by lentivector transduction. Unenveloped VLPs were also produced and used as a negative control. 72 hours after treatment, cells were analyzed by flow cytometry (FACS) and the overall mean fluorescence intensity (MFI) was monitored to reveal the strong effect of YFP disruption Cas9-VLP on YFP L929 target cells. Cells treated with enveloped VLP showed a 7-fold reduction in MFI compared to untreated YFP cells or cells treated with non-enveloped VLP*. Here, we demonstrate that Cas9-VLP loaded with specific guide RNA can be used as a CRISPR delivery agent without further enrichment / purification processes. [Figure 3B]CRISPR-mediated disruption of YFP in L929 mouse cells by Cas9-VLP. (A) Guide RNA was created to target YFP downstream of the start codon ATG. After cleavage, cells were able to repair this gap by NHEJ (a mechanism that can create small deletions and indels (damages that can alter the YFP frame in some cells)). Thus, three different versions of repaired YFP can be produced by the innate repair mechanism, but only one of them repairs in-frame YFP and maintains the YFP phenotype. Therefore, cleavage should induce a detectable but incomplete reduction of YFP in the target cells. (B) VLPs loaded with Cas9 and guide RNA targeting YFP were produced and directly introduced into the medium of YFP-L929 cells (mouse fibroblast cell line #), and YFP was stably incorporated into the genome by lentivector transduction. Unenveloped VLPs were also produced and used as a negative control. 72 hours after treatment, cells were analyzed by flow cytometry (FACS) and the overall mean fluorescence intensity (MFI) was monitored to reveal the strong effect of YFP disruption Cas9-VLP on YFP L929 target cells. Cells treated with enveloped VLP showed a 7-fold reduction in MFI compared to untreated YFP cells or cells treated with non-enveloped VLP*. Here, we demonstrate that Cas9-VLP loaded with specific guide RNA can be used as a CRISPR delivery agent without further enrichment / purification processes. [Figure 4A]Conventional Cas9 delivery method and deletion of the Myd88 locus using Cas9 VLP (A) Schematic diagram of the locations of Myd88 genomic DNA and various tools used in the Myd88 cleavage assay. Two different CRISPR sequences were designed for the human Myd88 gene, as shown in purple and green. The gray box corresponds to the region where the two PCR primers hybridize. They are optimized for amplification of gMyd88, which produces an amplicon size of 420nt. If the CRISPR system is active in target cells, a 160nt deletion occurs in some cells, which can be repaired by NHEJ, resulting in a truncated gene of 260nt size. (B) PCR amplification of gMyd88 in wt-HEK or after transfection with both Myd88 CRISPR and Cas9 coding plasmids. After extraction of genomic DNA, PCR assays were performed using the Myd88 primer set. In populations treated with CRISPR components, two amplicons are generated corresponding to the uncut Myd88 (or single-CRISPR-cut version) and the double-cut version after gene cleavage at two target sites. Myd88 deletion does not affect all treated cells, which may be considered to indicate that cleavage mediated by the transfection CRISPR component system is not complete. (C) The inventors also attempted to deliver both Myd88 guide RNAs by Cas9-loaded VLPs. For this purpose, VLPs were produced according to the procedure shown in Figure 1, and different experimental procedures were investigated depending on the plasmid ratio and envelope (R1-R4) properties used. After collection and enrichment, the VLPs were introduced into HEK or HeLa cell medium, and the efficiency of Myd88 cleavage was then evaluated by PCR. (D) Myd88 amplification using a Myd88 primer set and genomic DNA extracted from cells treated with VLPs. In HEK cells, all preparations were equally efficient in cleaving Myd88 (left panel), but some differences could be observed in HeLa cells, reflecting the importance of the envelope / ratio used. A specific protocol appears to be optimal for both cell types (R1). [Figure 4B] Conventional Cas9 delivery method and deletion of the Myd88 locus using Cas9 VLP (A) Schematic diagram of the locations of Myd88 genomic DNA and various tools used in the Myd88 cleavage assay. Two different CRISPR sequences were designed for the human Myd88 gene, as shown in purple and green. The gray box corresponds to the region where the two PCR primers hybridize. They are optimized for amplification of gMyd88, which produces an amplicon size of 420nt. If the CRISPR system is active in target cells, a 160nt deletion occurs in some cells, which can be repaired by NHEJ, resulting in a truncated gene of 260nt size. (B) PCR amplification of gMyd88 in wt-HEK or after transfection with both Myd88 CRISPR and Cas9 coding plasmids. After extraction of genomic DNA, PCR assays were performed using the Myd88 primer set. In populations treated with CRISPR components, two amplicons are generated corresponding to the uncut Myd88 (or single-CRISPR-cut version) and the double-cut version after gene cleavage at two target sites. Myd88 deletion does not affect all treated cells, which may be considered to indicate that cleavage mediated by the transfection CRISPR component system is not complete. (C) The inventors also attempted to deliver both Myd88 guide RNAs by Cas9-loaded VLPs. For this purpose, VLPs were produced according to the procedure shown in Figure 1, and different experimental procedures were investigated depending on the plasmid ratio and envelope (R1-R4) properties used. After collection and enrichment, the VLPs were introduced into HEK or HeLa cell medium, and the efficiency of Myd88 cleavage was then evaluated by PCR. (D) Myd88 amplification using a Myd88 primer set and genomic DNA extracted from cells treated with VLPs. In HEK cells, all preparations were equally efficient in cleaving Myd88 (left panel), but some differences could be observed in HeLa cells, reflecting the importance of the envelope / ratio used. A specific protocol appears to be optimal for both cell types (R1). [Figure 4C]Conventional Cas9 delivery method and deletion of the Myd88 locus using Cas9 VLP (A) Schematic diagram of the locations of Myd88 genomic DNA and various tools used in the Myd88 cleavage assay. Two different CRISPR sequences were designed for the human Myd88 gene, as shown in purple and green. The gray box corresponds to the region where the two PCR primers hybridize. They are optimized for amplification of gMyd88, which produces an amplicon size of 420nt. If the CRISPR system is active in target cells, a 160nt deletion occurs in some cells, which can be repaired by NHEJ, resulting in a truncated gene of 260nt size. (B) PCR amplification of gMyd88 in wt-HEK or after transfection with both Myd88 CRISPR and Cas9 coding plasmids. After extraction of genomic DNA, PCR assays were performed using the Myd88 primer set. In populations treated with CRISPR components, two amplicons are generated corresponding to the uncut Myd88 (or single-CRISPR-cut version) and the double-cut version after gene cleavage at two target sites. Myd88 deletion does not affect all treated cells, which may be considered to indicate that cleavage mediated by the transfection CRISPR component system is not complete. (C) The inventors also attempted to deliver both Myd88 guide RNAs by Cas9-loaded VLPs. For this purpose, VLPs were produced according to the procedure shown in Figure 1, and different experimental procedures were investigated depending on the plasmid ratio and envelope (R1-R4) properties used. After collection and enrichment, the VLPs were introduced into HEK or HeLa cell medium, and the efficiency of Myd88 cleavage was then evaluated by PCR. (D) Myd88 amplification using a Myd88 primer set and genomic DNA extracted from cells treated with VLPs. In HEK cells, all preparations were equally efficient in cleaving Myd88 (left panel), but some differences could be observed in HeLa cells, reflecting the importance of the envelope / ratio used. A specific protocol appears to be optimal for both cell types (R1). [Figure 4D] Conventional Cas9 delivery method and deletion of the Myd88 locus using Cas9 VLP (A) Schematic diagram of the locations of Myd88 genomic DNA and various tools used in the Myd88 cleavage assay. Two different CRISPR sequences were designed for the human Myd88 gene, as shown in purple and green. The gray box corresponds to the region where the two PCR primers hybridize. They are optimized for amplification of gMyd88, which produces an amplicon size of 420nt. If the CRISPR system is active in target cells, a 160nt deletion occurs in some cells, which can be repaired by NHEJ, resulting in a truncated gene of 260nt size. (B) PCR amplification of gMyd88 in wt-HEK or after transfection with both Myd88 CRISPR and Cas9 coding plasmids. After extraction of genomic DNA, PCR assays were performed using the Myd88 primer set. In populations treated with CRISPR components, two amplicons are generated corresponding to the uncut Myd88 (or single-CRISPR-cut version) and the double-cut version after gene cleavage at two target sites. Myd88 deletion does not affect all treated cells, which may be considered to indicate that cleavage mediated by the transfection CRISPR component system is not complete. (C) The inventors also attempted to deliver both Myd88 guide RNAs by Cas9-loaded VLPs. For this purpose, VLPs were produced according to the procedure shown in Figure 1, and different experimental procedures were investigated depending on the plasmid ratio and envelope (R1-R4) properties used. After collection and enrichment, the VLPs were introduced into HEK or HeLa cell medium, and the efficiency of Myd88 cleavage was then evaluated by PCR. (D) Myd88 amplification using a Myd88 primer set and genomic DNA extracted from cells treated with VLPs. In HEK cells, all preparations were equally efficient in cleaving Myd88 (left panel), but some differences could be observed in HeLa cells, reflecting the importance of the envelope / ratio used. A specific protocol appears to be optimal for both cell types (R1). [Figure 5] Dose-dependent cleavage of the Myd88 gene induced by Cas9-VLP: Cas9-VLPs loaded with two gRNAs targeting the Myd88 gene were produced, concentrated, and stored at 4°C for 15 days. Then, incremental amounts of VLP were added to the culture medium of HEK293T target cells plated in 12w plates (150,000 cells / w). Twenty hours after VLP treatment, cells were lysed, genomic DNA was purified, and gene cleavage at the Myd88 locus was analyzed. The signal indicating deletion of Myd88 (260nt) increased with the amount of VLP introduced into the medium. This indicates that Cas9-VLPs are active in target cells within 24 hours of their introduction. The VLP preparations were found to be stable at 4°C for at least 15 days. [Figure 6] Cas9-VLP-mediated cleavage of the Myd88 gene in HEK targets is enhanced by polybren. Suboptimal doses of Cas9-VLP loaded with two gRNAs targeting the Myd88 gene were introduced into 3 × 10⁶ HEK target cells grown in complete medium supplemented or unsupplemented with hexadimethrin bromide (polybren) (a polycation that facilitates contact between particles and target cells). 48 hours after VLP treatment, cells were lysed, genomic DNA was purified, and gene cleavage at the Myd88 locus was analyzed. Under these conditions using unsaturated VLP, Myd-88 cleavage was undetectable in cells cultured in standard medium, but was strongly enhanced by the addition of polybren. [Figure 7A]Cas9-VLP-induced cleavage of the Myd88 gene in human monocyte-derived macrophages. Genotype (A) Cas9-VLPs loaded with two gRNAs targeting the Myd88 gene were enriched and introduced into the culture medium of human monocyte-derived macrophages after 6 days of differentiation with granulocyte-macrophage colony-stimulating factor (GMCSF) (100,000 cells / well in a 48w plate). 48 hours after VLP treatment, cells were lysed, genomic DNA was purified, and gene cleavage in the Myd88 locus was analyzed. Under these conditions, the Myd88 gene was cleaved with such high efficiency after VLP treatment that the wt sequence could not even be detected by conventional PCR, suggesting that Myd88-VLP-mediated cleavage in primary non-dividing cells is nearly complete. Phenotype (B) According to Lombardo et al*, human macrophages die in large numbers by apoptosis when cultured without GMCSF unless stimulated by a TLR-4 agonist such as LPS. This apoptosis resistance is LPS and Myd88-dependent. To check whether VLP-treated cells lost their Myd88 function, we cultured them without GMCSF (in RPMI medium) and stimulated them with LPS for 72 hours. Under this treatment, WT macrophages were resistant to GMCSF depletion (comparison of conditions 2 and 3), but macrophages treated with Myd88-cleaved Cas9-VLP died in large numbers (condition 4). This strongly suggests that VLP treatment inactivated Myd88 at a functional level. [Figure 7B]Cas9-VLP-induced cleavage of the Myd88 gene in human monocyte-derived macrophages. Genotype (A) Cas9-VLPs loaded with two gRNAs targeting the Myd88 gene were enriched and introduced into the culture medium of human monocyte-derived macrophages after 6 days of differentiation with granulocyte-macrophage colony-stimulating factor (GMCSF) (100,000 cells / well in a 48w plate). 48 hours after VLP treatment, cells were lysed, genomic DNA was purified, and gene cleavage in the Myd88 locus was analyzed. Under these conditions, the Myd88 gene was cleaved with such high efficiency after VLP treatment that the wt sequence could not even be detected by conventional PCR, suggesting that Myd88-VLP-mediated cleavage in primary non-dividing cells is nearly complete. Phenotype (B) According to Lombardo et al*, human macrophages die in large numbers by apoptosis when cultured without GMCSF unless stimulated by a TLR-4 agonist such as LPS. This apoptosis resistance is LPS and Myd88-dependent. To check whether VLP-treated cells lost their Myd88 function, we cultured them without GMCSF (in RPMI medium) and stimulated them with LPS for 72 hours. Under this treatment, WT macrophages were resistant to GMCSF depletion (comparison of conditions 2 and 3), but macrophages treated with Myd88-cleaved Cas9-VLP died in large numbers (condition 4). This strongly suggests that VLP treatment inactivated Myd88 at a functional level. [Figure 8]Myd88 gene cleavage induced by Cas9-VLP in newly purified primary human lymphocytes. Purified human lymphocytes (Ficoll / percoll) were plated in 48w plates at a cell density of 40 × 10⁶ cells / ml with 200 μl of plated cells. The cells were then treated with a fresh preparation of Cas9-VLP targeting Myd88, and the older medium was maintained at 4°C for 20 days in transduction medium supplemented with polyblen (4 μg / ml). After 2 hours, 500 μl of fresh medium was added to the transduction medium, and the cells were maintained in the culture medium for 40 hours before being lysed and genomic DNA extracted. Myd88 cleavage was then investigated by PCR, revealing either whole or cleaved Myd88. Myd88 gene cleavage occurred under both VLP conditions. One million quiescent lymphocytes were genetically modified within 48 hours by a single VLP treatment without any apparent toxicity. [Figure 9] Myd88 gene cleavage induced by Cas9-VLP in mouse bone marrow-derived macrophages. Macrophages were differentiated from bone marrow cells extruded from mouse femurs incubated in MCSF-containing medium for 8 days. The cells were then treated with a fresh preparation of Cas9-VLP targeting mMyd88 in a medium supplemented with polyblen (4 μg / ml). Notably, two novel gRNAs that specifically target the mouse gene were designed for this experiment. Cells were cultured 48 hours prior to lysis and genomic DNA extraction. Next, Myd88 cleavage was investigated by PCR, revealing either wt or cleaved forms of the mouse Myd88 gene based on the design of the hMyd88 assay. In VLP-treated cells, very efficient cleavage was detected by PCR, although the band corresponding to complete or partially cleaved mMyd88 (only one gRNA) appeared faint. [Figure 10A]Targeted insertion of flag tag sequences in endogenous DDX3 genomic locus mediated by an "all-in-one" Cas9-VLP. (A) Schematic diagram of the human DDX3 genomic locus and various tools used in the experiment. Purple arrows represent locus cleaved by DDX3 CRISPR, and gray areas represent intron regions of DDX3. The FLAG IN rep primer (ssODN) is represented as a single-stranded DNA showing a 40nt homologous repair arm adjacent to the Flag tag sequence (which is homologous to the DDX3 locus). Primers used in the PCR assay are shown. (B) Principle of the "all-in-one" VLP delivering Cas9 protein, gRNA, and repair primer. VLPs targeting DDX3 were produced, centrifuged, and stored at 4°C. The VLPs were then combined with incremental amounts of ssODN and added to HEK target cells cultured in classical growth medium. Next, the target cells were lysed after 72 hours for the preparation of protein extracts and genomic DNA. (C) Western blot analysis of cells treated with "All-in-One" DDX3 VLP. The Western blot signal corresponding to the predicted molecular weight of DDX3 (86 kDa) revealed by the flag antibody can be detected at the highest concentration of ssODN. This indicates that the Flag sequence was successfully inserted into the DDX3 locus of VLP-treated cells. This was further confirmed by PCR on genomic DNA extracted from VLP-treated cells. Since the forward primer hybridizes to the Flag sequence and the reverse primer hybridizes to the intron of DDX3, the primers used (shown in A) should amplify the DNA segment only if the Flag sequence was inserted into the DDX3 gene. As shown in the panel below, the genetic modification is evident at high primer concentrations and decreases with dose, but is still detectable at the DNA level at low concentrations of 0.01 nmol / ml (lane 4). (D) Introduction of the Flag sequence upstream of the endogenous locus of DDX3 in human monocyte-derived dendritic cells (Mo-derived DCs).VLP and ssODN (final 5 nmol / μl) were complexed, and this mixture was used to treat Mo-derived DCs in transduction medium containing polyblen (4 μg / ml). Genomic DNA analysis showed that a single treatment with VLP successfully added the flag sequence to the endogenous locus of DDX3 in human primary DCs. [Figure 10B]Targeted insertion of flag tag sequences in endogenous DDX3 genomic locus mediated by an "all-in-one" Cas9-VLP. (A) Schematic diagram of the human DDX3 genomic locus and various tools used in the experiment. Purple arrows represent locus cleaved by DDX3 CRISPR, and gray areas represent intron regions of DDX3. The FLAG IN rep primer (ssODN) is represented as a single-stranded DNA showing a 40nt homologous repair arm adjacent to the Flag tag sequence (which is homologous to the DDX3 locus). Primers used in the PCR assay are shown. (B) Principle of the "all-in-one" VLP delivering Cas9 protein, gRNA, and repair primer. VLPs targeting DDX3 were produced, centrifuged, and stored at 4°C. The VLPs were then combined with incremental amounts of ssODN and added to HEK target cells cultured in classical growth medium. Next, the target cells were lysed after 72 hours for the preparation of protein extracts and genomic DNA. (C) Western blot analysis of cells treated with "All-in-One" DDX3 VLP. The Western blot signal corresponding to the predicted molecular weight of DDX3 (86 kDa) revealed by the flag antibody can be detected at the highest concentration of ssODN. This indicates that the Flag sequence was successfully inserted into the DDX3 locus of VLP-treated cells. This was further confirmed by PCR on genomic DNA extracted from VLP-treated cells. Since the forward primer hybridizes to the Flag sequence and the reverse primer hybridizes to the intron of DDX3, the primers used (shown in A) should amplify the DNA segment only if the Flag sequence was inserted into the DDX3 gene. As shown in the panel below, the genetic modification is evident at high primer concentrations and decreases with dose, but is still detectable at the DNA level at low concentrations of 0.01 nmol / ml (lane 4). (D) Introduction of the Flag sequence upstream of the endogenous locus of DDX3 in human monocyte-derived dendritic cells (Mo-derived DCs).VLP and ssODN (final 5 nmol / μl) were complexed, and this mixture was used to treat Mo-derived DCs in transduction medium containing polyblen (4 μg / ml). Genomic DNA analysis showed that a single treatment with VLP successfully added the flag sequence to the endogenous locus of DDX3 in human primary DCs. [Figure 10C]Targeted insertion of flag tag sequences in endogenous DDX3 genomic locus mediated by an "all-in-one" Cas9-VLP. (A) Schematic diagram of the human DDX3 genomic locus and various tools used in the experiment. Purple arrows represent locus cleaved by DDX3 CRISPR, and gray areas represent intron regions of DDX3. The FLAG IN rep primer (ssODN) is represented as a single-stranded DNA showing a 40nt homologous repair arm adjacent to the Flag tag sequence (which is homologous to the DDX3 locus). Primers used in the PCR assay are shown. (B) Principle of the "all-in-one" VLP delivering Cas9 protein, gRNA, and repair primer. VLPs targeting DDX3 were produced, centrifuged, and stored at 4°C. The VLPs were then combined with incremental amounts of ssODN and added to HEK target cells cultured in classical growth medium. Next, the target cells were lysed after 72 hours for the preparation of protein extracts and genomic DNA. (C) Western blot analysis of cells treated with "All-in-One" DDX3 VLP. The Western blot signal corresponding to the predicted molecular weight of DDX3 (86 kDa) revealed by the flag antibody can be detected at the highest concentration of ssODN. This indicates that the Flag sequence was successfully inserted into the DDX3 locus of VLP-treated cells. This was further confirmed by PCR on genomic DNA extracted from VLP-treated cells. Since the forward primer hybridizes to the Flag sequence and the reverse primer hybridizes to the intron of DDX3, the primers used (shown in A) should amplify the DNA segment only if the Flag sequence was inserted into the DDX3 gene. As shown in the panel below, the genetic modification is evident at high primer concentrations and decreases with dose, but is still detectable at the DNA level at low concentrations of 0.01 nmol / ml (lane 4). (D) Introduction of the Flag sequence upstream of the endogenous locus of DDX3 in human monocyte-derived dendritic cells (Mo-derived DCs).VLP and ssODN (final 5 nmol / μl) were complexed, and this mixture was used to treat Mo-derived DCs in transduction medium containing polyblen (4 μg / ml). Genomic DNA analysis showed that a single treatment with VLP successfully added the flag sequence to the endogenous locus of DDX3 in human primary DCs. [Figure 10D]Targeted insertion of flag tag sequences in endogenous DDX3 genomic locus mediated by an "all-in-one" Cas9-VLP. (A) Schematic diagram of the human DDX3 genomic locus and various tools used in the experiment. Purple arrows represent locus cleaved by DDX3 CRISPR, and gray areas represent intron regions of DDX3. The FLAG IN rep primer (ssODN) is represented as a single-stranded DNA showing a 40nt homologous repair arm adjacent to the Flag tag sequence (which is homologous to the DDX3 locus). Primers used in the PCR assay are shown. (B) Principle of the "all-in-one" VLP delivering Cas9 protein, gRNA, and repair primer. VLPs targeting DDX3 were produced, centrifuged, and stored at 4°C. The VLPs were then combined with incremental amounts of ssODN and added to HEK target cells cultured in classical growth medium. Next, the target cells were lysed after 72 hours for the preparation of protein extracts and genomic DNA. (C) Western blot analysis of cells treated with "All-in-One" DDX3 VLP. The Western blot signal corresponding to the predicted molecular weight of DDX3 (86 kDa) revealed by the flag antibody can be detected at the highest concentration of ssODN. This indicates that the Flag sequence was successfully inserted into the DDX3 locus of VLP-treated cells. This was further confirmed by PCR on genomic DNA extracted from VLP-treated cells. Since the forward primer hybridizes to the Flag sequence and the reverse primer hybridizes to the intron of DDX3, the primers used (shown in A) should amplify the DNA segment only if the Flag sequence was inserted into the DDX3 gene. As shown in the panel below, the genetic modification is evident at high primer concentrations and decreases with dose, but is still detectable at the DNA level at low concentrations of 0.01 nmol / ml (lane 4). (D) Introduction of the Flag sequence upstream of the endogenous locus of DDX3 in human monocyte-derived dendritic cells (Mo-derived DCs).VLP and ssODN (final 5 nmol / μl) were complexed, and this mixture was used to treat Mo-derived DCs in transduction medium containing polyblen (4 μg / ml). Genomic DNA analysis showed that a single treatment with VLP successfully added the flag sequence to the endogenous locus of DDX3 in human primary DCs. [Figure 11]A Series of Possibilities Using Nanoblades and Association with “Helper” VLPs We have shown that it is possible to create an “all-in-one” VLP incorporating Cas9, a gRNA, and optionally combined with repair ssDNA, to deliver a complete package to recipient cells. This agent, shown in (a), is highly versatile in itself. Since VLPs can incorporate several gRNAs and reliably complex with different repair primers after production, many possibilities are offered to scientists / companies to create low-cost, dedicated tools. As mentioned in (Abe et al. J Virol 1998), VLPs of different properties can complex extracellularly after production and may be complementary to each other, for example, one assisting the other in entering the cell. Given this property of VLPs, we can imagine other methods for preparing activators for transporting CRISPR system components by mixing particles, each dedicated to a specific cargo. (b) proposes a system in which gRNA-Cas9-VLPs can be mixed with particles that have simply complexed with repair primers: in this case, the mixture of both types of particles would be the final activator. Going further, it is also possible to package gRNAs into specific types of particles and combine them with unloaded Cas9-VLPs after production to create particle mixtures that can deliver all components. This system is shown in (c). Given the theoretical possibility of incorporating several gRNAs into VLPs, the inventors can even imagine more complex drugs to select different viral envelopes to pseudotype each type of VLP and to associate them with different types of ssDNA. (d) While this segregation of CRISPR components in different types of particles may certainly affect the overall efficiency of the final drug, it could offer companies producing nanoblades a wide range of possibilities to improve their nanoblade services and make them lower cost. If the system in (c) is sufficiently efficient, it would suffice to prepare large batches of well-titrated common Cas9-VLPs and associate them with gRNA particles specifically customized for each application.This system appears to be highly beneficial from an industrial standpoint, as it provides a highly accurate molecular service requiring only the rapid and low-cost preparation of gRNA-VLPs. [Figure 12A] Western blot analysis and characterization of CAS9 virus-derived particles separated by a discontinuous sucrose gradient. Figure 12A shows Western blot gel electrophoresis. Lanes (from left to right): (i) Incubation with anti-Flag antibody; (ii) Incubation with anti-VSV-G antibody; (iii) Incubation with anti-CAS9 antibody; (iv) Incubation with anti-GAGmlv antibody. Figure 12B shows dot blots of fractions 1-24 collected after separation of CAS9 virus-derived particles by a discontinuous sucrose gradient. Columns (from left to right): Fractions n°1-n°24. Lanes in Figure 12B (from top to bottom): (i) Incubation with anti-VSV-G antibody; (ii) Incubation with anti-CAS9 antibody; (iii) Incubation with anti-GAGmlv antibody. [Figure 12B] Western blot analysis and characterization of CAS9 virus-derived particles separated by a discontinuous sucrose gradient. Figure 12A shows Western blot gel electrophoresis. Lanes (from left to right): (i) Incubation with anti-Flag antibody; (ii) Incubation with anti-VSV-G antibody; (iii) Incubation with anti-CAS9 antibody; (iv) Incubation with anti-GAGmlv antibody. Figure 12B shows dot blots of fractions 1-24 collected after separation of CAS9 virus-derived particles by a discontinuous sucrose gradient. Columns (from left to right): Fractions n°1-n°24. Lanes in Figure 12B (from top to bottom): (i) Incubation with anti-VSV-G antibody; (ii) Incubation with anti-CAS9 antibody; (iii) Incubation with anti-GAGmlv antibody. [Figure 13] Gag / Cas9 fusion actively loads guide RNA into virus-like particles (VLPs). Northern blot of the conserved region of the guide RNA using total RNA extracted from producing cells (lanes 2-4) or the corresponding purified VLPs (lanes 5-7). [Figure 14A]Figure 14A: Schematic diagram of coding cassettes designed for the production of MLV-based VLPs or HIV-1-based VLPs. Eukaryotic expression vectors containing an initial hCMV promoter, rabbit B-globin intron, and rabbit pA signaling were incorporated into both cassettes. Both systems were optimized by exploring and testing various proteolytic sites for isolating the GAG ​​cassette from the Cas9 gene. MLV-based VLPs were produced as described elsewhere, and HIV-1-based VLPs were produced similarly, except that an HIV-1 helper construct encoding the GAG ​​POL Tat Rev protein was transfected in place of the MLV GAG POL plasmid. The production of HIV-1 VLPs followed the same procedure as for MLV-based VLPs. Figure 14B: 30,000 HEK293T cells expressing GFP were transductioned using enriched VLPs engineered to incorporate guide RNA targeting the GFP gene. Using the same load gRNA (target sequence: CGAGGAGCTGTTCACCGGGG - SEQ ID NO: 38), HIV-1 and MLV-based particles were produced. The day before, recipient cells were plated in 96w plates. Polyblen (4 μg / ml) was supplemented in the transduction medium. 72 hours after treatment with each of the three escalating dose VLP batches, fluorescence intensity was measured by fluorometer (excitation 488, emission 535). A clear decrease in fluorescence was observed in VLP-treated cells compared to untreated control cells (C), indicating cleavage of the GFP gene in the recipient cells. The results indicate that HIV-1-based VLPs are more efficient in delivering the CRISPR / CAS9 system to these recipient cells, at a slightly lower level of efficiency than MLV-based VLPs (1.5–2 times less efficient). Figure 14C: Cleavage of the WASP gene in IL7-stimulated primary human T cells. In this experiment, two guide RNAs targeting the human WASP gene were incorporated into HIV-1 or MLV-based VLPs before processing fresh purified T cells stimulated with IL-7. 500,000 cells were plated in 400 μl of RPMI medium supplemented with polyblen (4 μg / ml) and IL-7 in 24w plates.Enriched HIV-1 or MLV VLP (10 μl of VLP administered with 1 μM CAS9) was added to the culture medium. Next, 24 hours after treatment, WASP deletion by CRISPR-CAS9 was measured in recipient cells by PCR. The primers used for amplification of the genomic WASP gene were: forward: 5'-ATTGCGGAAGTTCCTCTTCTTACCCTG (SEQ ID NO: 36) Reverse: 5'-TTCCTGGGAAGGGTGGATTATGACGGG (SEQ ID NO: 37). The PCR conditions were 95°C for 5 minutes, followed by 25 cycles of (95°C for 30 seconds - 57°C for 30 seconds - 72°C for 30 seconds), followed by 72°C for 5 minutes. Next, the amplicons were loaded onto a gel to determine the WASP status (wt or cleaved) in the VLP recipient T cells. Gel analysis performed using ImageJ software enabled the quantification of the dual-cut efficiency of MLV-based VLP (32%) and HIV-1-based VLP (6%). [Figure 14B]Figure 14A: Schematic diagram of coding cassettes designed for the production of MLV-based VLPs or HIV-1-based VLPs. Eukaryotic expression vectors containing an initial hCMV promoter, rabbit B-globin intron, and rabbit pA signaling were incorporated into both cassettes. Both systems were optimized by exploring and testing various proteolytic sites for isolating the GAG ​​cassette from the Cas9 gene. MLV-based VLPs were produced as described elsewhere, and HIV-1-based VLPs were produced similarly, except that an HIV-1 helper construct encoding the GAG ​​POL Tat Rev protein was transfected in place of the MLV GAG POL plasmid. The production of HIV-1 VLPs followed the same procedure as for MLV-based VLPs. Figure 14B: 30,000 HEK293T cells expressing GFP were transductioned using enriched VLPs engineered to incorporate guide RNA targeting the GFP gene. Using the same load gRNA (target sequence: CGAGGAGCTGTTCACCGGGG - SEQ ID NO: 38), HIV-1 and MLV-based particles were produced. The day before, recipient cells were plated in 96w plates. Polyblen (4 μg / ml) was supplemented in the transduction medium. 72 hours after treatment with each of the three escalating dose VLP batches, fluorescence intensity was measured by fluorometer (excitation 488, emission 535). A clear decrease in fluorescence was observed in VLP-treated cells compared to untreated control cells (C), indicating cleavage of the GFP gene in the recipient cells. The results indicate that HIV-1-based VLPs are more efficient in delivering the CRISPR / CAS9 system to these recipient cells, at a slightly lower level of efficiency than MLV-based VLPs (1.5–2 times less efficient). Figure 14C: Cleavage of the WASP gene in IL7-stimulated primary human T cells. In this experiment, two guide RNAs targeting the human WASP gene were incorporated into HIV-1 or MLV-based VLPs before processing fresh purified T cells stimulated with IL-7. 500,000 cells were plated in 400 μl of RPMI medium supplemented with polyblen (4 μg / ml) and IL-7 in 24w plates.Enriched HIV-1 or MLV VLP (10 μl of VLP administered with 1 μM CAS9) was added to the culture medium. Next, 24 hours after treatment, WASP deletion by CRISPR-CAS9 was measured in recipient cells by PCR. The primers used for amplification of the genomic WASP gene were: forward: 5'-ATTGCGGAAGTTCCTCTTCTTACCCTG (SEQ ID NO: 36) Reverse: 5'-TTCCTGGGAAGGGTGGATTATGACGGG (SEQ ID NO: 37). The PCR conditions were 95°C for 5 minutes, followed by 25 cycles of (95°C for 30 seconds - 57°C for 30 seconds - 72°C for 30 seconds), followed by 72°C for 5 minutes. Next, the amplicons were loaded onto a gel to determine the WASP status (wt or cleaved) in the VLP recipient T cells. Gel analysis performed using ImageJ software enabled the quantification of the dual-cut efficiency of MLV-based VLP (32%) and HIV-1-based VLP (6%). [Figure 14C]Figure 14A: Schematic diagram of coding cassettes designed for the production of MLV-based VLPs or HIV-1-based VLPs. Eukaryotic expression vectors containing an initial hCMV promoter, rabbit B-globin intron, and rabbit pA signaling were incorporated into both cassettes. Both systems were optimized by exploring and testing various proteolytic sites for isolating the GAG ​​cassette from the Cas9 gene. MLV-based VLPs were produced as described elsewhere, and HIV-1-based VLPs were produced similarly, except that an HIV-1 helper construct encoding the GAG ​​POL Tat Rev protein was transfected in place of the MLV GAG POL plasmid. The production of HIV-1 VLPs followed the same procedure as for MLV-based VLPs. Figure 14B: 30,000 HEK293T cells expressing GFP were transductioned using enriched VLPs engineered to incorporate guide RNA targeting the GFP gene. Using the same load gRNA (target sequence: CGAGGAGCTGTTCACCGGGG - SEQ ID NO: 38), HIV-1 and MLV-based particles were produced. The day before, recipient cells were plated in 96w plates. Polyblen (4 μg / ml) was supplemented in the transduction medium. 72 hours after treatment with each of the three escalating dose VLP batches, fluorescence intensity was measured by fluorometer (excitation 488, emission 535). A clear decrease in fluorescence was observed in VLP-treated cells compared to untreated control cells (C), indicating cleavage of the GFP gene in the recipient cells. The results indicate that HIV-1-based VLPs are more efficient in delivering the CRISPR / CAS9 system to these recipient cells, at a slightly lower level of efficiency than MLV-based VLPs (1.5–2 times less efficient). Figure 14C: Cleavage of the WASP gene in IL7-stimulated primary human T cells. In this experiment, two guide RNAs targeting the human WASP gene were incorporated into HIV-1 or MLV-based VLPs before processing fresh purified T cells stimulated with IL-7. 500,000 cells were plated in 400 μl of RPMI medium supplemented with polyblen (4 μg / ml) and IL-7 in 24w plates.Enriched HIV-1 or MLV VLP (10 μl of VLP administered with 1 μM CAS9) was added to the culture medium. Next, 24 hours after treatment, WASP deletion by CRISPR-CAS9 was measured in recipient cells by PCR. The primers used for amplification of the genomic WASP gene were: forward: 5'-ATTGCGGAAGTTCCTCTTCTTACCCTG (SEQ ID NO: 36) Reverse: 5'-TTCCTGGGAAGGGTGGATTATGACGGG (SEQ ID NO: 37). The PCR conditions were 95°C for 5 minutes, followed by 25 cycles of (95°C for 30 seconds - 57°C for 30 seconds - 72°C for 30 seconds), followed by 72°C for 5 minutes. Next, the amplicons were loaded onto a gel to determine the WASP status (wt or cleaved) in the VLP recipient T cells. Gel analysis performed using ImageJ software enabled the quantification of the dual-cut efficiency of MLV-based VLP (32%) and HIV-1-based VLP (6%). [Figure 15A] CRISPR Delivery to Thy1-GFP Mouse Embryos by Cas9-Containing Virus-Derived Particles Figure 15A shows injection of CAS-containing virus-derived particles into the zona pellucida of Thy1-GFP mouse embryos. Figure 15B shows the results of cleavage of the Thy1-GFP allele in adult mice (F0) derived from mouse embryos injected with CAS9-containing virus-derived particles. Figure 15C shows the changes in the Thy1-GFP allele in F1 mice derived from the F0 mice shown in Figure 15B. Figures 15D, E, F, and G: GFP change rates in mice #78, #79, #21, and #22, respectively, calculated from chromatograms (results are compared to untreated Thy-GFP control mice). Horizontal axis: GFP change rate in F1 mice. *Percentages are not complete due to the fact that the selected Thy1-GFP strain has several copies of GFP / allele (6-10). Results should be reproducible in mouse strains with one constitutive GFP copy per allele (in preparation). [Figures 15B-15C]CRISPR Delivery to Thy1-GFP Mouse Embryos by Cas9-Containing Virus-Derived Particles Figure 15A shows injection of CAS-containing virus-derived particles into the zona pellucida of Thy1-GFP mouse embryos. Figure 15B shows the results of cleavage of the Thy1-GFP allele in adult mice (F0) derived from mouse embryos injected with CAS9-containing virus-derived particles. Figure 15C shows the changes in the Thy1-GFP allele in F1 mice derived from the F0 mice shown in Figure 15B. Figures 15D, E, F, and G: GFP change rates in mice #78, #79, #21, and #22, respectively, calculated from chromatograms (results are compared to untreated Thy-GFP control mice). Horizontal axis: GFP change rate in F1 mice. *Percentages are not complete due to the fact that the selected Thy1-GFP strain has several copies of GFP / allele (6-10). Results should be reproducible in mouse strains with one constitutive GFP copy per allele (in preparation). [Figure 15D] CRISPR Delivery to Thy1-GFP Mouse Embryos by Cas9-Containing Virus-Derived Particles Figure 15A shows injection of CAS-containing virus-derived particles into the zona pellucida of Thy1-GFP mouse embryos. Figure 15B shows the results of cleavage of the Thy1-GFP allele in adult mice (F0) derived from mouse embryos injected with CAS9-containing virus-derived particles. Figure 15C shows the changes in the Thy1-GFP allele in F1 mice derived from the F0 mice shown in Figure 15B. Figures 15D, E, F, and G: GFP change rates in mice #78, #79, #21, and #22, respectively, calculated from chromatograms (results are compared to untreated Thy-GFP control mice). Horizontal axis: GFP change rate in F1 mice. *Percentages are not complete due to the fact that the selected Thy1-GFP strain has several copies of GFP / allele (6-10). Results should be reproducible in mouse strains with one constitutive GFP copy per allele (in preparation). [Figure 15E]CRISPR Delivery to Thy1-GFP Mouse Embryos by Cas9-Containing Virus-Derived Particles Figure 15A shows injection of CAS-containing virus-derived particles into the zona pellucida of Thy1-GFP mouse embryos. Figure 15B shows the results of cleavage of the Thy1-GFP allele in adult mice (F0) derived from mouse embryos injected with CAS9-containing virus-derived particles. Figure 15C shows the changes in the Thy1-GFP allele in F1 mice derived from the F0 mice shown in Figure 15B. Figures 15D, E, F, and G: GFP change rates in mice #78, #79, #21, and #22, respectively, calculated from chromatograms (results are compared to untreated Thy-GFP control mice). Horizontal axis: GFP change rate in F1 mice. *Percentages are not complete due to the fact that the selected Thy1-GFP strain has several copies of GFP / allele (6-10). Results should be reproducible in mouse strains with one constitutive GFP copy per allele (in preparation). [Figure 15F] CRISPR Delivery to Thy1-GFP Mouse Embryos by Cas9-Containing Virus-Derived Particles Figure 15A shows injection of CAS-containing virus-derived particles into the zona pellucida of Thy1-GFP mouse embryos. Figure 15B shows the results of cleavage of the Thy1-GFP allele in adult mice (F0) derived from mouse embryos injected with CAS9-containing virus-derived particles. Figure 15C shows the changes in the Thy1-GFP allele in F1 mice derived from the F0 mice shown in Figure 15B. Figures 15D, E, F, and G: GFP change rates in mice #78, #79, #21, and #22, respectively, calculated from chromatograms (results are compared to untreated Thy-GFP control mice). Horizontal axis: GFP change rate in F1 mice. *Percentages are not complete due to the fact that the selected Thy1-GFP strain has several copies of GFP / allele (6-10). Results should be reproducible in mouse strains with one constitutive GFP copy per allele (in preparation). [Figure 15G]CRISPR Delivery to Thy1-GFP Mouse Embryos by Cas9-Containing Virus-Derived Particles Figure 15A shows injection of CAS-containing virus-derived particles into the zona pellucida of Thy1-GFP mouse embryos. Figure 15B shows the results of cleavage of the Thy1-GFP allele in adult mice (F0) derived from mouse embryos injected with CAS9-containing virus-derived particles. Figure 15C shows the changes in the Thy1-GFP allele in F1 mice derived from the F0 mice shown in Figure 15B. Figures 15D, E, F, and G: GFP change rates in mice #78, #79, #21, and #22, respectively, calculated from chromatograms (results are compared to untreated Thy-GFP control mice). Horizontal axis: GFP change rate in F1 mice. *Percentages are not complete due to the fact that the selected Thy1-GFP strain has several copies of GFP / allele (6-10). Results should be reproducible in mouse strains with one constitutive GFP copy per allele (in preparation). [Modes for carrying out the invention]

[0031] Detailed description of the invention This invention relates to delivering CRISPR / Cas proteins to target cells using virus-derived particles to induce targeted changes in the genomes of eukaryotes, preferably mammals, and particularly human organisms.

[0032] Surprisingly, the inventors have shown that site-directed genomic alterations, such as site-directed genomic deletions or site-directed genomic insertions, can be successfully induced by delivering the Cas protein to target cells via the use of viral vector particles in which the Cas protein is packaged.

[0033] The inventors have devised a potent method for transferring the CRISPR-active mechanism into human cells and other mammalian cells (including primary cell types) using multi-purpose virus-derived particles (also referred to herein as "virus-like particles" or "VLPs").

[0034] The inventors have shown that these VLPs ensure dose-dependent transient delivery of CRISPR-RNPc (also referred to as the “CRISPR-ribonucleoprotein complex”) to target cells and induce robust and rapid cleavage of the desired target gene. As illustrated in the examples, when the Myd-88 gene was used as the readout, the inventors observed complete cleavage of the latter gene in human cells within 6 hours. This remarkable speed, which may contribute to the high efficiency of the virus-derived particle system described herein, involves the direct delivery of the Cas protein, most preferably the Cas9 protein, and CRISPR guide RNA (also referred to herein as “gRNA”), instead of performing nucleic acid transfer of a polynucleotide encoding the Cas protein, as in most known CRISPR delivery systems. As described in the examples herein, the CRISPR guide RNA is efficiently encapsulated in the CAS-containing VLP. As also described in the examples, the encapsulation of the CRISPR guide RNA is highly influenced by the presence of the CAS protein in the VLP.

[0035] The inventors have also shown that CAS-containing VLPs can be prepared from various virus-derived particles, particularly from virus-derived particles in which the GAG ​​protein contained can originate from various viruses. Notably, CAS-containing virus-derived particles containing MLV-derived GAG protein and CAS-containing virus-derived particles containing HIV1-derived GAG protein are described in the examples. It is shown herein that both types of CAS-containing virus-derived particles efficiently manipulate target genes, for example, efficiently cleave target genes.

[0036] Furthermore, the inventors have demonstrated that GAG-containing virus-derived particles efficiently alter desired target sequences in vivo. Exemplarily, the examples show that GAG-containing virus-derived particles can be used to induce desired genomic alterations in living embryos (e.g., to induce cleavage at desired locations in the genome). The genomic alterations performed in living embryos are also shown herein to be present in the resulting adult mammals and subsequently passed on to the next generation.

[0037] Our findings are particularly important considering that key gene expression processes (e.g., transcription and translation) are not very active in some primary cell subsets that could be major targets for CRISPR strategies, and therefore can reduce the efficiency of conventional delivery methods such as DNA transfection and conventional lentiviral vectors.

[0038] In this regard, the Cas9 virus-derived particle technology devised by the present inventors appears to be an optimal tool for genome editing, particularly for genome editing in inactive, non-dividing primary cells such as lymphocytes, which are unsuitable for transfection / transduction procedures and exhibit low metabolism before activation.

[0039] Furthermore, according to the inventors' results, the effect of CRISPR RNPc is transient in recipient target cells and is expected to exert its biological activity for at most several hours after introduction of RNPc through contact between the virus-derived particles described herein and the target cells.

[0040] The transient delivery of CRIPSR components to target cells, and the fact that this technique does not introduce plasmid DNA into target cells, are expected to reduce potential toxicity and the risk of off-target cleavage.

[0041] Furthermore, the fact that this technology does not introduce plasmid DNA into target cells makes it possible to avoid the possibility of exogenous DNA being incorporated into the target genome.

[0042] Exemplary examples include the vulnerability of human stem CD34 by virus-derived particles described herein, as shown in the examples. + Treatment of cells or human lymphocytes did not induce detectable cytotoxicity, and did not result in cell death even after injecting large amounts of the virus-derived particles.

[0043] Notably, the inventors manipulated a chimeric Cas9 protein so that it could be packaged into MLV-derived VLPs or HIV-1-derived VLPs by fusing it with the structural GAG protein of mouse leukemia virus.

[0044] Therefore, this concept was readily extended to other viral structural proteins such as the GAG ​​polyprotein derived from HIV-1 or the GAG ​​polyprotein derived from Roussarcoma virus (RSV).

[0045] The virus-derived particles produced as described herein have been shown to efficiently transfer CRISPR-RNPc into desired target cells. The use of the virus-derived particle technology described herein provides a number of viral envelopes that can be selected for pseudotyping the virus-derived particles, thereby conferring specific properties (directionality, complement resistance, robustness) to the preparation.

[0046] Insertion of the coding sequences of Cas proteins and one or more CRISPR gRNAs into the expression cassette, in particular, insertion of the coding sequences of Cas9 and specially designed gRNAs into the expression cassette, can also be carried out in the skeleton of recombinant viruses (e.g., measles strains or certain influenza strains) that are tolerant of the incorporation of foreign sequences. This allows for the widespread dissemination of active CRISPR RNPc in specific cells / tissues / organs tolerant of the virus under consideration.

[0047] Beyond the use of the Cas9 Streptococcus pyogenes endonuclease, the techniques described herein are readily extended to Cas proteins of other organisms (or, which may be fused to structural viral proteins). By delivering a growing cohort of Cas9 derivatives via the virus-derived particles described herein, a wide variety of genomic alterations can be achieved, including cleavage of only one DNA strand, activation of transcription, and labeling of precise genomic loci. As described in O'Connell et al. (2014, Nature, Vol. 516: 263-266) (this is a technique involving a small DNA sequence (PAMmer) provided in trans), the techniques described herein also enable Cas-based CRISPR strategies, particularly Cas9-based CRISPR strategies, to target intracellular mRNA and induce their cleavage. The virus-derived particle techniques described herein can be adapted to this RNA targeting approach by a simple combination of particles and ssDNA PAMmer in the flagging-DDX3 strategy model described in the examples (see also Figure 10 herein).

[0048] The possibility of combining the virus-derived particles described herein with ssDNA or dsDNA after their production offers broad possibilities in terms of industrial development and rapid, low-cost customization for various nucleic acid manipulation purposes. Furthermore, as described in another technical context by Abe et al. (1998, J Virol, Vol. 72: 6356-6361), it should be noted that virus-derived nanoparticles with different envelopes or protein / nucleic acid cargoes may be trans-complementary when combined as a mixture.

[0049] Multiple methods for transferring the CRISPR effect to target cells by combining the virus-derived particles of the present invention are described elsewhere in this specification. Some of these various embodiments are shown in Figure 11 of this specification. Preliminary data show that when these virus-derived particles and vesicles are prepared and used as taught in another technical context by Mangeot et al. (2011, Mol Ther J Am Soc Gene Ther, Vol. 19: 1956-1666), virus-derived particles containing Cas proteins, particularly Cas9 protein, can be combined with vesicles incorporating one or more CRISPR gRNAs, and that in cells treated with the resulting mixture of Cas-containing virus-derived particles and gRNA-containing vesicles, the CRISPR effect is efficient. The opportunity to sequester CRISPR components into different types of particles can be of great interest from an industrial standpoint and provides a versatile technical solution for generating desired nucleic acid changes.

[0050] The Cas-containing virus-derived particles described herein, particularly Cas9-containing virus-derived particles, can be readily produced in large quantities in the absence of gRNA, yielding carefully administered, quality-controlled VLP batches. These Cas9-VLPs can then be combined with gRNA-containing vesicles and / or target nucleic acid-containing vesicles, upon order, to complement the system with a specific gRNA, a specific repair template, or both.

[0051] As illustrated in detail herein, the Cas-containing virus-derived particle technology described herein offers new possibilities to the CRISPR community, particularly by upgrading the available toolbox for targeting challenging cell types and exploring innovative CRISPR-based therapeutic approaches for in / ex vivo gene therapy.

[0052] Therefore, the inventors have successfully packaged the Cas protein into virus-derived particles by devising a packaging cell that expresses a cleavable fusion protein of (i) a viral structural protein and (ii) a Cas protein. Accordingly, the present invention relates to virus-derived particles containing one or more Cas proteins.

[0053] As used herein, virus-derived particles mean particles formed by an assembly of viral structural proteins that associate to form a particle core (which is then encased in a membrane) (these virus-derived particles do not contain any nucleic acids encoding the nucleic acid or protein of interest). Thus, in contrast to most virus-derived particles known in the art that are designed to deliver expressed nucleic acids to transduction cells, the virus-derived particles described herein are designed to deliver proteins and optionally non-coding nucleic acids (i.e., at least Cas proteins) to transduction cells. As described in detail herein, the virus-derived particles of the present invention may also contain one or more non-coding nucleic acids (these non-coding nucleic acids include CRISPR-Cas system guide RNA and targeting nucleic acids). For clarity, it may occur that the virus-derived particles described herein may contain trace amounts of coding nucleic acids derived from the cells used to produce them, e.g., trace amounts of mRNA or plasmid DNA derived from the producing cells. In some cases, the small amounts of coding nucleic acids that may be present within the virus-derived particles are generally passively encapsulated. However, as described in detail throughout this specification, the virus-derived particles described herein are not at all specialized for the transport of any coding nucleic acid of interest, but rather, in contrast, these virus-derived particles are specialized solely for the transport of proteins (primarily one or more proteins having Cas endonuclease activity) and, in some embodiments, further for the transport of non-coding nucleic acids of interest (i.e., (i) one or more CRISPR guide RNAs and / or one or more targeting nucleic acids).

[0054] As shown in the examples herein, the cleavable fusion protein of (i) a viral structural protein and (ii) the Cas protein is successfully incorporated into virus-derived particles produced by packaging cells, and the resulting virus-derived particles successfully deliver the Cas protein to target cells to alter the target cell genome via site-directed genomic DNA cleavage and, in some embodiments, further nucleic acid insertion by homologous recombination. As shown in the examples herein, the fusion protein contributes to the formation of virus-derived particles, where it associates with the viral structural protein.

[0055] In particular, the inventors have shown that successful genomic alteration can be achieved by using these virus-derived particles in combination with one or more CRIPSR-Cas guide RNAs, and especially by using virus-derived particles that further contain the one or more CRIPSR-Cas guide RNAs within the particles.

[0056] As shown in the examples, the virus-derived particles described herein have been successfully used to disrupt or delete various genes both in vitro and in vivo to produce organisms in which the various genes were knocked out.

[0057] Furthermore, as shown in the examples, the virus-derived particles described herein have been successfully used to create knock-in organisms by targeting the insertion of the desired nucleic acid into the genome of a target cell.

[0058] As experimentally illustrated herein, the inventors fused the Cas9 protein with the GAG ​​protein of mouse leukemia virus and used this construct to produce functional Cas9-loaded virus-derived particles that deliver Cas9 activity to recipient cells.

[0059] As further experimentally illustrated herein, the inventors fused the Cas9 protein with the HIV-1 GAG protein and used this construct to produce functional Cas9-loaded virus-derived particles that deliver Cas9 activity to recipient cells.

[0060] Furthermore, the examples herein demonstrate that guide RNA can be successfully incorporated into virus-derived particles to create fully active CRISPR-RNPc within the virus-like particles, which can then be transmitted to recipient cells. Our experimental results illustrate the high efficiency of these Cas-containing virus-derived particles. These virus-derived particles can completely deliver CRISPR to different cell types (including primary cells) without apparent toxicity. In human naive lymphocytes simply treated with the virus-derived particles that cleave the human (hMyd88) gene, the cleavage efficiency of the genomic target nucleic acid is remarkably close to 100%.

[0061] The present invention relates to virus-derived particles containing one or more Cas proteins. Various embodiments of the virus-derived particles described herein are shown in Figure 11.

[0062] Virus-derived particles The virus-derived particles used herein consist of virus-like particles formed by one or more virus-derived proteins, which substantially lack any nucleic acid encoding the target nucleic acid or protein, or may not. Notably, the virus-derived particles of the present invention substantially lack any nucleic acid encoding the target viral nucleic acid or viral protein, or may not. The virus-derived particles of the present invention are non-replicable.

[0063] Virus-derived particles Any virus suitable for gene therapy may be used, but is not limited to adeno-associated viruses ("AAVs"); adenoviruses; herpesviruses; lentiviruses and retroviruses. Adeno-associated viruses ("AAVs") may be selected from the group including AAV1, AAV6, AAV7, AAV8, AAV9, or rh10, which are particularly suitable for use in human subjects.

[0064] Common methods known in the art for producing viral vector particles generally containing the target coding nucleic acid can also be used to produce the virus-derived particles of the present invention that do not contain the target coding nucleic acid.

[0065] Conventional viral vector particles include retroviruses, lentiviruses, adenoviruses, and adeno-associated virus vector particles, which are well known in the art. For a review of the various viral vector particles that can be used, those skilled in the art may refer in particular to Kushnir et al. (2012, Vaccine, Vol. 31: 58-83), Zeltons (2013, Mol Biotechnol, Vol. 53: 92-107), Ludwig et al. (2007, Curr Opin Biotechnol, Vol. 18(n°6): 537-55) and Naskalaska et al. (2015, Vol. 64 (n°1): 3-13). Furthermore, those skilled in the art will find references to various methods of using virus-derived particles to deliver proteins to cells in the papers by Maetzig et al. (2012, Current Gene Therapy, Vol. 12: 389-409) and Kaczmarczyk et al. (2011, Proc Natl Acad Sci USA, Vol. 108 (n° 41): 16998-17003).

[0066] Generally, virus-derived particles used in accordance with the present invention (these virus-derived particles may also be referred to as "virus-like particles" or "VLPs") are formed by one or more virus-derived structural proteins and / or one or more virus-derived envelope proteins.

[0067] The virus-derived particles used in accordance with the present invention are unable to replicate in the host cells into which they invade.

[0068] In a preferred embodiment, the virus-derived particle is formed by one or more retroviral structural proteins and optionally one or more virus-derived envelope proteins.

[0069] In preferred embodiments, the virus-derived structural protein is a retroviral gag protein or a peptide fragment thereof. As is known in the art, Gag and Gag / pol precursors are expressed from full-length genomic RNA as polyproteins (which require proteolytic cleavage mediated by retroviral proteases (PRs)) to acquire functional conformation. Furthermore, Gag (which is structurally conserved among retroviruses) consists of at least three protein units (matrix protein (MA), capsid protein (CA), and nucleocapsid protein (NC)), while Pol consists of a retroviral protease (PR), retrotranscriptase (RT), and integrase (IN).

[0070] In some embodiments, the virus-derived particles contain retroviral Gag protein but do not contain Pol protein.

[0071] As is known in the art, the host range of retroviral vectors, including lentiviral vectors, can be expanded or altered by a process known as pseudotyping. Pseudotyped lentiviral vectors consist of viral vector particles having glycoproteins derived from other enveloped viruses. Such pseudotyped viral vector particles have viral directivity from which the glycoproteins originate.

[0072] In some embodiments, the virus-derived particles are pseudotyped virus-derived particles comprising one or more viral structural proteins or viral envelope proteins that confer specific eukaryotic cell directivity to the virus-derived particles. The pseudotyped virus-derived particles described herein may include viral envelope proteins selected from the group comprising VSV-G protein, measles virus HA protein, measles virus F protein, influenza virus HA protein, Molony virus MLV-A protein, Molony virus MLV-E protein, baboon endogenous retrovirus (BAEV) envelope protein, Ebola virus glycoprotein and foamy viral envelope protein, or two or more combinations of these viral envelope proteins, as viral proteins used for pseudotyping.

[0073] A well-known example of pseudotyping of viral vector particles is the pseudotyping of viral vector particles using vesicular stomatitis virus glycoprotein (VSV-G). Those skilled in the art may particularly refer to Yee et al. (1994, ProcNatl Acad Sci, USA, Vol. 91: 9564-9568) and Cronin et al. (2005, Curr Gene Ther, Vol. 5(n°4): 387-398) for pseudotyping of viral vector particles.

[0074] For the production of virus-derived particles, more precisely VSV-G pseudotype virus-derived particles, for delivering the target protein to target cells, those skilled in the art may refer to Mangeot et al. (2011, Molecular Therapy, Vol. 19 (n°9): 1656-1666).

[0075] In some preferred embodiments, the VSV-G protein used to pseudotype the virus-derived particles of the present invention has an amino acid sequence of SEQ ID NO: 23, which may be encoded by a nucleic acid containing the sequence of SEQ ID NO: 28.

[0076] In some preferred embodiments, the BAEV-G (BAEV) protein used to pseudotype the virus-derived particles of the present invention has the amino acid sequence of SEQ ID NO: 25, which may be encoded by a nucleic acid containing the sequence of SEQ ID NO: 27.

[0077] Therefore, in some embodiments, the virus-derived particles further comprise a viral envelope protein, wherein (i) the viral envelope protein is derived from the same virus as the viral structural protein (e.g., from the same virus as the viral Gag protein), or (ii) the viral envelope protein is derived from a different virus from the virus from which the viral structural protein is derived (e.g., from a different virus from the virus from which the viral Gag protein is derived).

[0078] As will be readily understood by those skilled in the art, the virus-derived particles used in accordance with the present invention may be selected from the group including Moloney mouse leukemia virus-derived vector particles, bovine immunodeficiency virus-derived particles, monkey immunodeficiency virus-derived vector particles, feline immunodeficiency virus-derived vector particles, human immunodeficiency virus-derived vector particles, equine anemia virus-derived vector particles, canine arthritis encephalitis virus-derived vector particles, baboon endogenous virus-derived vector particles, rabies virus-derived vector particles, influenza virus-derived vector particles, norovirus-derived vector particles, respiratory syncytial virus-derived vector particles, hepatitis A virus-derived vector particles, hepatitis B virus-derived vector particles, hepatitis E virus-derived vector particles, Newcastle disease virus-derived vector particles, Norwalk virus-derived vector particles, parvovirus-derived vector particles, papillomavirus-derived vector particles, yeast retrotransposon-derived vector particles, measles virus-derived vector particles, and bacteriophage-derived vector particles.

[0079] In particular, the virus-derived particles used in accordance with the present invention are retrovirus-derived particles. Such retroviruses can be selected from Moloney's mouse leukemia virus-derived vector particles, bovine immunodeficiency virus-derived particles, monkey immunodeficiency virus-derived vector particles, feline immunodeficiency virus-derived vector particles, human immunodeficiency virus-derived vector particles, equine anemia virus-derived vector particles, and canine arthritis encephalitis virus-derived vector particles.

[0080] In another embodiment, the virus-derived particles used in accordance with the present invention are lentivirus-derived particles. Lentiviruses belong to the retroviridae family and have the unique ability to infect non-dividing cells.

[0081] Such lentiviruses can be selected from among bovine immunodeficiency virus-derived particles, monkey immunodeficiency virus-derived vector particles, feline immunodeficiency virus-derived vector particles, human immunodeficiency virus-derived vector particles, equine anemia virus-derived vector particles, and canine arthritis encephalitis virus-derived vector particles.

[0082] Those skilled in the art may particularly refer to the methods disclosed in Sharma et al. (1997, Proc Natl Acad Sci USA, Vol. 94: 10803+-10808) and Guibingua et al. (2002, Molecular Therapy, Vol. 5(n°5): 538-546) for the preparation of Molony mouse leukemia virus-derived vector particles. Molony mouse leukemia virus-derived (MLV-derived) vector particles may be selected from the group including MLV-A-derived vector particles and MLV-E-derived vector particles.

[0083] Those skilled in the art may particularly refer to the method disclosed in Rasmussen et al. (1990, Virology, Vol. 178(n°2): 435-451) for the preparation of bovine immunodeficiency virus-derived vector particles.

[0084] Those skilled in the art can particularly refer to the methods disclosed in Mangeot et al. (2000, Journal of Virology, Vol. 71(n°18): 8307-8315), Negre et al. (2000, Gene Therapy, Vol. 7: 1613-1623), and Mangeot et al. (2004, Nucleic Acids Research, Vol. 32 (n° 12), e102) for the preparation of simian immunodeficiency virus-derived vector particles, including VSV-G pseudotype SIV virus-derived particles.

[0085] Those skilled in the art may, in particular, refer to the method disclosed in Saenz et al. (2012, Cold Spring Harb Protoc, (1): 71-76; 2012, Cold Spring Harb Protoc, (1): 124-125; 2012, Cold Spring Harb Protoc, (1): 118-123) for the preparation of feline immunodeficiency virus-derived vector particles.

[0086] Those skilled in the art may particularly refer to the methods disclosed in Jalaguier et al. (2011, PlosOne, Vol. 6(n°11), e28314), Cervera et al. (J Biotechnol, Vol. 166(n°4): 152-165), and Tang et al. (2012, Journal of Virology, Vol. 86(n°14): 7662-7676) for the preparation of human immunodeficiency virus-derived vector particles.

[0087] Those skilled in the art may particularly refer to the method disclosed in Olsen (1998, Gene Ther, Vol. 5(n°11): 1481-1487) for the preparation of vector particles derived from equine anemia virus.

[0088] Those skilled in the art may particularly refer to the method disclosed in Mselli-Lakhal et al. (2006, J Virol Methods, Vol. 136(n°1-2): 177-184) for the preparation of vector particles derived from the canine arthritis encephalitis virus.

[0089] Those skilled in the art may, in particular, refer to the method disclosed in Girard-Gagnepain et al. (2014, Blood, Vol. 124(n°8): 1221-1231) for the preparation of baboon endogenous virus-derived vector particles.

[0090] Those skilled in the art can, in particular, refer to the methods disclosed in Kang et al. (2015, Viruses, Vol. 7: 1134-1152, doi:10.3390 / v7031134), Fontana et al. (2014, Vaccine, Vol. 32(n°24): 2799-27804) or the PCT application published in WO2012 / 0618 for the preparation of rabies virus-derived vector particles.

[0091] Those skilled in the art may particularly refer to the methods disclosed in Quan et al. (2012, Virology, Vol. 430: 127-135) and Latham et al. (2001, Journal of Virology, Vol. 75(n°13),: 6154-6155) for the preparation of influenza virus-derived vector particles.

[0092] Those skilled in the art may particularly refer to the method disclosed in Tome-Amat et al., (2014, Microbial Cell Factories, Vol. 13: 134-142) for the preparation of norovirus-derived vector particles.

[0093] Those skilled in the art may, in particular, refer to the method disclosed in Walpita et al. (2015, PlosOne, DOI:10.1371 / journal.pone.0130755) for the preparation of respiratory syncytial virus-derived vector particles.

[0094] Those skilled in the art may, in particular, refer to the method disclosed in Hong et al. (2013, Vol. 87(n°12): 6615-6624) for the preparation of hepatitis B virus-derived vector particles.

[0095] Those skilled in the art may, in particular, refer to the method disclosed in Li et al. (1997, Journal of Virology, Vol. 71(n°10): 7207-7213) for the preparation of hepatitis E virus-derived vector particles.

[0096] Those skilled in the art may, in particular, refer to the method disclosed in Murawski et al. (2010, Journal of Virology, Vol. 84(n°2): 1110-1123) for the preparation of Newcastle disease virus-derived vector particles.

[0097] Those skilled in the art may, in particular, refer to the method disclosed in Herbst-Kralovetz et al. (2010, Expert Rev Vaccines, Vol. 9(n°3): 299-307) for the preparation of Norwalk virus-derived vector particles.

[0098] Those skilled in the art may, in particular, refer to the method disclosed in Ogasawara et al. (2006, In Vivo, Vol. 20: 319-324) for the preparation of parvovirus-derived vector particles.

[0099] Those skilled in the art may, in particular, refer to the method disclosed in Ogasawara et al. (2006, In Vivo, Vol. 20: 319-324) for the preparation of papillomavirus-derived vector particles.

[0100] Those skilled in the art may refer to the methods disclosed in Peifang et al. (1994, Clin Exp Immunol, Vol. 97(n°3): 361-366) or U.S. Patent No. 6,060,064 for the preparation of yeast retrotransposon-derived vector particles.

[0101] Those skilled in the art may, in particular, refer to the method disclosed in Brandler et al. (2008, Vol. 31(n°2-3): 271-291) for the preparation of measles virus-derived vector particles.

[0102] Those skilled in the art may particularly refer to the method disclosed in Brown et al. (2009, Biochemistry, Vol. 48(n°47): 11155-11157) for the preparation of bacteriophage-derived vector particles, especially Q-β virus-like particles.

[0103] The virus-derived particles used herein contain Gag proteins and most preferably contain Gag proteins derived from viruses selected from the group including Roussarcoma virus (RSV), feline immunodeficiency virus (FIV), simian immunodeficiency virus (SIV), Moloney's leukemia virus (MLV), and human immunodeficiency virus (HIV-1 and HIV-2), particularly human immunodeficiency virus type 1 (HIV-1).

[0104] In some embodiments, the virus-derived particles may also contain one or more viral envelope proteins. As is known in the Art, the presence of one or more viral envelope proteins can confer more specific targeting of the virus-derived particles to the cells being targeted. The one or more viral envelope proteins may be selected from the group including retroviral envelope proteins, non-retroviral envelope proteins, and chimeras of these viral envelope proteins with other peptides or proteins. An example of a non-lentiviral envelope glycoprotein of interest is the lymphocytic choriomeningitis virus (LCMV) strain WE54 envelope glycoprotein. These envelope glycoproteins increase the range of cells that can be transductioned with retroviral vectors.

[0105] In some preferred embodiments, the virus-derived particles include a Gag protein derived from a virus selected from the group including Roussarcoma virus (RSV) and Moloney's leukemia virus (MLV).

[0106] In some preferred embodiments, the virus-derived particles used herein further comprise pseudotyping viral envelope proteins, most preferably VSV-G proteins.

[0107] Cas protein The virus-derived particles contain Cas proteins. The Cas proteins may be selected from the group that includes type I Cas proteins, type II Cas proteins, and type III Cas proteins.

[0108] Those skilled in the art can refer to the following for the use of type I, type II, or type III Cas proteins: Chylinski et al. (2014, Nucleic Acids Research, Vol. 42(n°10): 6091-6105), Sinkunas et al. (2011, The EMBO Journal, Vol. 30(n°7): 1335-1342), Aliyari et al. (2009, Immunological Reviews, Vol. 227(n°1): 176-188), Cass et al. (Biosci Rep, doi:10.1042 / BSR20150043), Makarova et al. (2011, Biology Direct, Vol. 6: 38), Gasiunas et al. (2012, Proc NatlAcad Sci USA, Vol. 109(n°39): E2579-E2586), Heller et al. (2015, Nature, Vol. 519(n°7542): 199-202), Esvelt et al. (2013, Nat Methods, Vol. 10(n°11): doi :10.138 / nmeth.2681) or Chylinski et al. (2013, Biology, Vol. 10(n°5): 726-737).

[0109] In some embodiments, the CAS protein may consist of a type II Cas protein named Cpf1, disclosed in Zeische et al. (2015, Cell, http: / / dx.doi.org / 10.1016 / j.cell.2015.09.038, in Press).

[0110] Preferably, the virus-derived protein includes a type II Cas protein. The type II Cas protein is most preferably the Cas9 protein.

[0111] Most preferably, the Cas protein contained within the virus-derived particles described herein is the Cas9 protein or its homolog or derivative. The Cas9 protein may be selected from the group including the Cas9 protein derived from Streptococcus thermophilus and the Cas9 protein derived from Streptococcus pyogenes, or their homologs or derivatives. The Cas9 protein derived from Streptococcus thermophilus is particularly described in Gasiunas et al. (2012, Proc NatlAcad Sci USA, Vol. 109(n°39): E2579-E2586). The Cas9 protein derived from Streptococcus pyogenes is particularly described in Heler et al. (2015, Nature, Vol. 519(n°7542): 199-202) and Sanjana et al. (2014, Nat Methods, Vol. 11(n°18): 783-784).

[0112] The Cas9 proteins that can be used in accordance with the present invention include naturally occurring Cas9 proteins, as well as proteins that are homologs, mutants, or derivatives of the Cas9 proteins described, for example, Cong et al. (2013, Science, Vol. 339: 819-823).

[0113] The Cas9 protein and vectors encoding the Cas9 protein are commercially available from Sigma-Aldrich Company. The Cas9 protein and its variants that may be used in the virus-derived particles described herein are also described in PCT applications published as WO2013 / 163628, WO2014 / 093595, WO2015 / 089247 and WO2015 / 089486.

[0114] In some embodiments, the Cas9 protein is produced so as to be incorporated into virus-derived particles during their formation. Exemplarily, Cas9 may be encoded by a nucleic acid sequence inserted into an expression vector contained in a virus-derived particle-producing cell. In preferred embodiments, the Cas9 coding nucleic acid is placed under the control of a regulatory sequence that allows its overexpression in the producing cell. In some embodiments, the Cas9 protein consists of the protein of SEQ ID NO: 31, encoded by the nucleic acid sequence of SEQ ID NO: 32.

[0115] In some embodiments of the virus-derived particles described herein, the Cas protein is produced and integrated within the virus-derived particles as a fusion protein of (i) a viral structural protein and (ii) the Cas protein. In some of these embodiments, the Cas protein is produced and integrated within the virus-derived particles as a GAG-Cas9 fusion protein. As confirmed by the inventors, such fusion proteins are successfully integrated within the resulting virus-derived particles, and the Cas moiety is fully active (i.e., the Cas moiety has its endonuclease activity). According to these embodiments, the embedded Cas protein is released into the target cell after entry of the virus-derived particle.

[0116] In other embodiments, the Cas protein contained in the virus-derived particles is first produced as a cleavable fusion protein of (i) a viral structural protein and (ii) a Cas protein. An example of such a cleavable fusion protein is the cleavable GAG-Cas9 protein described in the examples herein. According to these other embodiments, the cleavable fusion protein is integrated into the resulting virus-derived particles at the time of its production by the producing cell. Then, some or all of the fusion protein is cleaved in the final virus-derived particles, resulting in a population of virus-derived particles comprising (i) some virus-derived particles in which the cleavable fusion protein has not been cleaved, (ii) some virus-derived particles in which at least some of the cleavable fusion protein has been cleaved, releasing the Cas protein portion into the virus-derived particles, and (iii) some virus-derived particles in which all or substantially all of the cleavable fusion protein has been cleaved, releasing all or substantially all of the Cas protein portion into the virus-derived particles. In some preferred embodiments, the cleavable GAG-Cas9 protein is a GAG-Cas9 protein having the amino acid sequence of SEQ ID NO: 22, which can be encoded by the sequence of SEQ ID NO: 26. In other embodiments, it may be used as a cleavable GAG-Cas9 protein encoded by the nucleic acid sequence of Sequence ID:34 (which may be referred to herein as "KLAP229").

[0117] Therefore, in virus-derived particles that can be used according to the present invention, the Cas protein, typically the Cas9 protein, may exist as (i) an incleavable fusion protein, typically an incleavable Gag-Cas9 fusion protein, (ii) a cleavable fusion protein, typically a cleavable Gag-Cas9 fusion protein, (iii) a Cas protein, typically a Cas9 protein resulting from the proteolytic cleavage of the fusion protein, or (iv) both the fusion protein and the Cas protein. The virus-derived particles used herein are produced in packaging cells that specifically express a protein, typically a cleavable Gag-Cas9 fusion protein, which is a combination of (i) a viral structural protein and (ii) a Cas protein. It should be understood that this includes a cleavable fusion protein, typically a cleavable Gag-Cas9 fusion protein, which is a combination of (i) a viral structural protein and (ii) a Cas protein. As shown in the examples herein, the cleavable fusion protein is incorporated directly into the virus-derived particle and then at least partially cleaved within the virus-derived particle to release a functional Cas protein within the virus-derived particle. However, since the Cas protein is initially incorporated into the virus-derived particle in the form of the cleavable fusion protein, there are many intermediate states in which the Cas protein exists partially as a cleavable fusion protein and partially as a free Cas protein resulting from the cleavage of the cleavable fusion protein.

[0118] In a preferred embodiment, the fusion protein includes a proteolytic cleavage site between the viral structural protein portion and the Cas protein portion, typically located between the Gag protein portion and the Cas9 protein portion. Proteolytic sites, also known as protease sites, are well known to those skilled in the art. Protease sites that may be included in a cleavable fusion protein may be sites that can be cleaved by proteases selected from the group including trypsin (EC3.4.21.4), chymotrypsin (EC3.4.21.1), endoproteinase Glu C (EC3.4.21.19), endoproteinase Lys-C (EC3.4.21.50), pepsin (EC3.4.23.1), elastase (EC3.4.21.36), and carboxypeptidase (EC3.4.17.1).

[0119] In some embodiments, the protease cleavage site is selected from the group including the amino acid sequence SSLYPALTP (SEQ ID NO: 29), which can be encoded by the sequence containing SEQ ID NO: 30.

[0120] Protease-cleavable fusion proteins of Gag and the target protein, and vectors for expressing such fusion proteins, are particularly described in Voelkel et al. (2010, Proc Natl Acad Sci USA, Vol. 107(n°17): 7805-7810), which can be referenced by those skilled in the art.

[0121] As described in the examples herein, virus-derived particles in some embodiments are formed in packaging cells expressing the Gag-Pro-Pol viral protein. While not bound by any particular theory, the inventors believe that in these embodiments, the Pro protein (i.e., viral protease) is released into the virus-derived particles and cleaves the fusion protein, typically the Gag-Cas fusion protein, particularly the Gag-Cas9 fusion protein, to produce a free Cas protein, particularly a free Cas9 protein. In some preferred embodiments, the Gag-Pro-Pol protein has the amino acid sequence of SEQ ID NO: 24.

[0122] However, as illustrated in the examples herein, in embodiments in which the virus-derived particles lack any viral proteases, a functional Cas protein, typically a functional Cas9 protein, is released into the target cell when the virus-derived particles are formed in packaging cells expressing, for example, a viral structural protein (e.g., Gag) and optionally one or more viral envelope proteins (e.g., VSV-G and / or BAEV-G).

[0123] Guide RNA When using the virus-derived particles described herein to induce site-directed changes in the target nucleic acid, one or more CRISPR-Cas guide RNAs are required.

[0124] The number of CRISPR-Cas guide RNAs, also referred to as "guide RNAs" or "gRNAs," may vary depending on the type of change being sought in the target nucleic acid. A single guide RNA may be used in combination with a virus-derived particle to induce a single DNA cleavage event in the target nucleic acid. Two or more guide RNAs may be used in combination with virus-derived particles to induce two or more cleavage events in the target nucleic acid, or to induce cleavage events in multiple target nucleic acids.

[0125] Methods for designing guide RNAs that, when combined with Cas proteins, induce cleavage of target nucleic acids are well known to those skilled in the art. As is well known in the art, the guide RNA is a polynucleotide that has sufficient complementarity with the target nucleic acid and hybridizes with the target nucleic acid to induce sequence-specific binding of the CRISPR complex to the target nucleic acid.

[0126] Various tools are readily available to those skilled in the art for designing guide RNAs, including tools sold by Company GenScript (United States) under the name GenCRISPR® gRNA constructs. The GenCRISPR® gRNA constructs collection contains approximately six guide RNAs that specifically target about 20,000 genes in the human genome. Guide RNAs can also be used as Ran et al. (2013, Cell, Vol. 154: 1380-1389), Mail et al. (2013, Science, Vol. 339: 823-826), Wang et al. USA, Vol. 110: 13904-13909), Cong et al. (2013, Science, Vol. 339: 819-823), Shalem et al. (2014, Science, Vol. 343: 84-87), Maeder et al. (2013, Nat Methods; Vol. 10: 977-979), Qi et al. (2013, Cell, Vol. It can be designed according to the instructions in 152: 1173-1183), Farboud et al. (2015, Genetics, doi 10.1534 / genetics.115.175166) or Ma et al. (2013, BioMed research International, Vol. 2013, Article ID 270805, doi.org / 10.1155 / 2013 / 270805).

[0127] In some embodiments, the virus-derived particles described herein further comprise one or more CRISPR-Cas guide RNAs. Each guide RNA hybridizes with a specific target sequence contained in the target nucleic acid.

[0128] In some embodiments, the virus-derived particles described herein include a single guide RNA. Such embodiments of virus-derived particles enable the generation of a single cleavage at a desired location in the target nucleic acid.

[0129] In some other embodiments, the virus-derived particles described herein include two distinct guide RNAs, each guide RNA hybridizing with a specific target sequence contained in the same target nucleic acid to generate two cleavage events at sites recognized by each of the two distinct guide RNAs. Such embodiments allow for the introduction of a polynucleotide deletion framed by two cleavage sites within the target nucleic acid. If further template nucleic acids of interest are added, such embodiments allow for the insertion of a desired exogenous nucleic acid of interest between these two cleavage sites within the nucleic acid target.

[0130] In some preferred embodiments, one or more guide RNAs are incorporated within the virus-derived particle. Typically, the virus-derived particle is produced by a packaging cell expressing (i) a required viral structural protein (e.g., Gag), (ii) one or more viral envelope proteins (e.g., VSV-G and / or BAEV-G), (iii) a Cas fusion protein (e.g., a Gag-Cas9 fusion protein), and (iv) one or more CRISPR-Cas guide RNAs. According to these embodiments, one or more guide RNAs are incorporated within the virus-derived particle, but these are produced by the packaging cell. In these embodiments, where the virus-derived particle includes a Cas protein, particularly a Cas9 protein, and one or more guide RNAs, the virus-derived particle includes a CRISPR-Cas ribonucleoprotein complex, which is a complex of the Cas protein and the guide RNA.

[0131] According to some of these embodiments, the virus-derived particles comprise one or more complexes of a Cas protein and a guide RNA, and each CRISPR-Cas complex comprises a single Cas protein complexed with a single guide RNA. In some of these embodiments where multiple cleavages of a target nucleic acid are required, the virus-derived particles comprise the same number of CRISPR-Cas complex species, and each type of CRISPR-Cas complex is specific to cause DNA cleavage at a desired site in the target nucleic acid where the corresponding guide RNA hybridizes.

[0132] In a more preferred embodiment, one or more guide RNAs are first produced by specific packaging cells expressing the one or more guide RNAs, which also express viral proteins necessary for the production of other viral particles or other viral vesicles (or other virus-like particles or VLPs). The guide RNA-containing viral particles are then brought into contact with virus-derived particles containing Cas proteins to produce, by complementarity, final virus-derived particles containing both Cas proteins and the one or more guide RNAs initially present in the other viral particles. For the acquisition of these virus-derived particles by complementarity, those skilled in the art may refer in particular to Abe et al. (1998, Journal of Virology, Vol. 72(n°8): 6356-6361). Exemplaryly, a Gag-based virus-derived particle containing a Cas protein as described herein may be brought into contact with a VSV-G-based virus particle containing one or more CRISPR-Cas guide RNAs to obtain a final virus-derived particle comprising the Cas protein and the one or more CRISPR-Cas guide RNAs, the final virus-derived particle consisting of a Gag-based VSV-G pseudotype VLP.

[0133] In some other embodiments, part of all of the one or more guide RNAs are not contained within the virus-derived particles, but instead form complexes with these virus-derived particles. According to these other embodiments, the guide RNAs that have formed complexes with the virus-derived particles also enter the target cells together with the virus-derived particles on which these guide RNAs have formed complexes.

[0134] Targeting nucleic acids For the purpose of altering target nucleic acids by using the virus-derived particles described herein, targeting nucleic acids may be used in combination with these virus-like particles, particularly when alteration of target nucleic acids by homologous recombination is required.

[0135] Methods for targeting nucleic acids for the purpose of altering their sequences by homologous recombination are well known to those skilled in the art. Typically, a homologous repair donor nucleic acid includes (i) a first sequence homologous to a first locus of the target genome sequence, and (ii) a second sequence homologous to a second locus of the genome sequence. Generally, for the purpose of altering the target nucleic acid by homologous recombination, the first sequence (i) and the second sequence (ii) are located on either side of the cleavage site produced by the CRISPR-Cas / guide RNA complex.

[0136] Methods for inducing changes in target nucleic acids via homologous recombination using the CRISPR-Cas system are well known in the art. Those skilled in the art may particularly refer to Jinek et al. (2013, eLife, Vol.2: e00471, doi: 10.754 / eLife.00471) and Lin et al. (2014, eLife, Vol. 3: e04766, DOI:10.7554 / eLife.04766).

[0137] Typically, a homologous recombination template nucleic acid (which may also be referred to herein as a template nucleic acid) contains variable-length exogenous sequences at its 5' and 3' ends, respectively, adjacent to the sequences to hybridize into the target nucleic acid. If the exogenous sequence to be inserted into the genome is less than 50 nt in length, the adjacent hybridization sequences, also referred to as homologous recombination arms, should be in the range of 20 to 50 nucleotides in length. If the exogenous sequence to be inserted is greater than 100 nt, the homologous recombination arms should be considerably longer (approximately 800 bp).

[0138] The targeting nucleic acid or template nucleic acid may have any suitable length, e.g., about 10, 15, 20, 25, 50, 75, 100, 150, 200, 500, 1000 nucleotides or more. When optimally aligned, the targeting nucleic acid may overlap with one or more nucleotides in the target sequence, e.g., more than about one, five, ten, fifteen, twenty or more nucleotides.

[0139] Based on the general knowledge of those skilled in the art, the virtually only requirement for designing targeting nucleic acids for homologous recombination purposes is prior knowledge of the nucleic acid sequence of the target nucleic acid.

[0140] In some embodiments, the targeting nucleic acid is contained within the virus-derived particles described herein. According to these embodiments, the virus-derived particles comprising a Cas protein, one or more guide RNAs, and one or more targeting nucleic acids are preferably produced by packaging cells expressing the Cas protein, the required viral protein, the required guide RNA, and the required targeting nucleic acid.

[0141] In some other embodiments, the targeting nucleic acid is not contained within the virus-derived particle but forms a complex with the virus-derived particle.

[0142] nucleic acid expression vectors As already stated elsewhere in this specification, the virus-derived particles described herein are produced in cells (hereinafter also called packaging cells) that express the necessary proteins (i.e., at least a fusion viral structural protein / Cas protein and one or more proteins necessary to form the virus particle (which may also be referred to as a virus-like particle or VLP)). In a preferred embodiment, the packaging cells also express one or more CRISPR-Cas guide RNAs and optionally further targeting nucleic acids (also referred to as template nucleic acids).

[0143] As used herein, the term “expression vector” refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a particular host organism. The nucleic acid sequences necessary for expression in eukaryotic cells generally include a promoter, an enhancer, and termination and polyadenylation signals. In some embodiments, the “expression vector” is used to enable pseudotyping of viral envelope proteins.

[0144] Generally, a vector for expressing a required protein or nucleic acid is a vector suitable for expressing the nucleic acid sequence in a desired host cell used as a packaging cell. Preferably, the packaging cell is a mammalian cell. In particular, a vector for expressing a required protein or nucleic acid includes an open reading frame that is controlled by functional regulatory elements in the packaging cell in which their expression is required. Specifically, these vectors include, for each protein or nucleic acid to be expressed, an open reading frame and a polyadenylation sequence that are controlled by an appropriate promoter sequence.

[0145] Packaging cell lines provide the viral proteins necessary for particle assembly (Markowitz et al., 1988, J. Virol., Vol. 62 :1120).

[0146] As is well known in this field, nucleic acid vectors are introduced into packaging cells by one of various techniques (e.g., calcium phosphate coprecipitation, lipofection, electroporation). Viral proteins produced by the packaging cells mediate the insertion of viral and Cas proteins into virus-derived particles, which are then released into the culture supernatant.

[0147] The nucleic acid vectors used may be derived from retroviruses (e.g., lentiviruses). Retroviral vectors suitable for producing the virus-derived particles described herein allow (1) transfection of host cells with the packaging vector and envelope vector to form a packaging cell line that produces virus-derived particles that are essentially free of the packaging vector RNA, and (2) packaging the Cas protein and optionally further CRISPR guide RNA into the virus-derived particles, and ultimately packaging the targeting nucleic acid into the virus-derived particles.

[0148] Vectors and packaging cells for use in accordance with the present invention are illustrated in the examples herein.

[0149] For example, vectors for expressing viral structural proteins / Cas proteins, such as the Gag-Cas9 protein, can be prepared by those skilled in the art, as taught in Voelkel et al. (2010, Proc Natl Acad Sci USA, Vol. 107: 7805-7810).

[0150] For example, vectors for expressing viral structural proteins, such as Gag proteins or Gag-Pro-Pol fusion proteins, and optionally further viral envelope proteins, such as VSV-G proteins or BAEV-G proteins, can be prepared by those skilled in the art according to the teachings of Negre et al. (2000, Gene Ther, Vol. 7: 1613-1623) and Yee et al. (1994, Methids Cell Biol, Vol. 43 PtA: 99-112).

[0151] For example, a vector for expressing CRISPR guide RNA can be prepared as instructed in Kieusseian et al. (2006, Blood, Vol. 107: 492-500).

[0152] Packaging Cells A host cell is a cell into which the target vector can be introduced and replicated; in the case of an expression vector, it is a cell into which one or more vector-based genes can be expressed.

[0153] Any suitable permissible or packaging cells known in the art may be used in the production of virus-derived particles as described herein. Mammalian cells or insect cells are preferred. Examples of cells useful for the production of virus-derived particles in the implementation of the present invention include, for example, human cell lines such as VERO, WI38, MRC5, A549, HEK293, HEK293T, B-50, or any other HeLa cells, HepG2, Saos-2, HuH7, and HT1080 cell lines.

[0154] Exemplary cell lines for use as packaging cells are insect cell lines. Any insect cell that enables AAV replication and can be maintained in culture can be used in accordance with the present invention. Examples include Spodoptera frugiperda, e.g., Sf9 or Sf21 cell lines, Drosophila species cell lines, or mosquito cell lines, e.g., Aedes albopictus-derived cell lines. A preferred insect cell line is the Spodoptera frugiperda Sf9 cell line. The following references are incorporated herein for instruction on the use of insect cells for the expression of heterologous polypeptides, methods for introducing nucleic acids into such cells, and methods for maintaining such cells in culture: Methods in Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors: A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., J. Vir. 63:3822-8 (1989); Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88: 4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al., Vir. 219:37-44 (1996); Zhao et al., Vir. 272:382-93 (2000); and Samulski et al., US Pat. No. 6,204,059.

[0155] Cells having one or more of the aforementioned functions already incorporated may be supplied, for example, cell lines having one or more vector functions incorporated extrachromosomally or integrated into the cell's chromosomal DNA, cell lines having one or more packaging functions incorporated extrachromosomally or integrated into the cell's chromosomal DNA, or cell lines having helper functions incorporated extrachromosomally or integrated into the cell's chromosomal DNA. A packaging cell line is a suitable host cell transfected with one or more nucleic acid vectors that, under achievable conditions, produces virus-derived particles containing a Cas protein and, in some embodiments, one or more CRIPSR guide RNAs and ultimately further targeting nucleic acids.

[0156] As used herein, the term “packaging cell line” typically refers to a cell line that expresses viral structural proteins (e.g., gag, pol, and env) but does not contain a packaging signal. For example, a cell line may be genetically engineered to have a 5'-LTR-gag-pol-3'-LTR fragment (called Δ-psi) lacking a functional psi+ sequence in one chromosomal region of its genome, and a 5'-LTR-env-3'-LTR fragment (also Δ-psi) in another chromosomal region.

[0157] Several cell types encompassing the following may be used: a) NIH-3T3 mouse cells, currently widely used as packaging cells for recombinant retrovirus production in clinical applications (Takahara et al., Journal of Virology, (June 1992), 66 (6) 3725-32). b) TK cells including NIH-3T3 TK cells -Cell lines have already been described (F. Wagner et al., EMBO Journal (1985), Vol. 4 (n°3): 663-666); these cells may die when cultured in selective media such as HAT. If they are complemented for kinase thymidine function (e.g., from HSV1-TK virus), they may grow in selective media; therefore, such strains offer the possibility of using the HSV1-TK gene as a selective gene. Genes encoding HSV1 thymidine kinase or one of its functional derivatives are also widely used as transgenes as prodrugs to transform ganciclovir or acyclovir into cytotoxic drugs for cells, so they may be applied to selective cell disruption of cancerous cells, for example (see, e.g., International Publication No. 95 / 22617).

[0158] Exemplary examples, the packaging cells may be a well-known HEK293T cell line, as shown in the examples herein.

[0159] The present invention also relates to a cell line for producing the viral particles described herein, - One or more nucleic acids encoding proteins necessary for forming the virus-derived particles, and - Nucleic acid containing an expression cassette encoding a viral structural protein-Cas fusion protein Regarding cell lines including...

[0160] In some embodiments, the nucleic acids encoding the proteins necessary to form the virus-derived particles include nucleic acids encoding viral structural proteins such as the Gag protein.

[0161] In some embodiments, the cell line also comprises nucleic acids encoding viral envelope proteins, selected from the group including, for example, VSV-G protein and BAEV-G protein.

[0162] In some embodiments, the cell line further comprises nucleic acids encoding one or more CRISPR guide RNAs.

[0163] In some embodiments, the cell line further comprises nucleic acids encoding one or more targeting nucleic acids.

[0164] Compositions and kits The present invention provides virus-derived particle compositions and kits suitable for use in the therapies (in vivo or in vivo) described herein.

[0165] In some embodiments, the composition comprises virus-derived particles containing Cas proteins, particularly Cas9 proteins, and lacks guide RNA and targeting nucleic acids. In these embodiments, gRNA or targeting nucleic acids are not present in the virus-derived particles, either as nucleic acids within the virus-derived particles or as nucleic acids complexed with the virus-derived particles.

[0166] The present invention relates to a composition for altering a target nucleic acid in eukaryotic cells, comprising at least one virus-derived particle described herein.

[0167] In some embodiments, the composition further comprises one or more CRISPR-Cas guide RNAs.

[0168] In some of these embodiments, the one or more CRISPR-Cas guide RNAs are contained within the virus-derived particle.

[0169] In some other embodiments, the one or more CRISPR-Cas guide RNAs are compounded with the virus-derived particles.

[0170] In some embodiments of the composition, the composition comprises (i) Cas-containing virus-derived particles in combination with (ii) vesicles containing gRNA and / or targeting nucleic acids. According to some of these embodiments, each gRNA present in the composition is contained within a specific type of vesicle. According to some other embodiments of these embodiments, one or more gRNAs, including all gRNAs, are contained within a specific type of vesicle. In some of these embodiments, the targeting nucleic acids are contained within a specific type of vesicle. In some other embodiments of these embodiments, if one or more targeting nucleic acids are present in the composition, all targeting nucleic acids are contained within a specific type of vesicle. In further embodiments, all gRNAs and targeting nucleic acids present in the composition are contained within the same vesicle.

[0171] As used herein, “a particular type” of vesicle is defined uniquely with respect to its particular contents of gRNA and / or targeting nucleic acid, regardless of the structural characteristics of the vesicle itself.

[0172] Most preferably, the vesicles are composed of viral proteins. In some embodiments, the vesicles have the same structural features of viral proteins as virus-derived particles containing the Cas protein described herein. In some other embodiments, the vesicles are composed mainly or entirely of viral envelope proteins, such as VSV-G or BAEV-G.

[0173] When present in the composition of the present invention, CAS-containing virus-derived particles and gRNA and / or targeting nucleic acid-containing vesicles complement the trans to efficiently induce desired nucleic acid changes in target cells. Such trans complementarity in another technical context is taught in Mangeot et al. (2011, Ther J am Soc Gene Ther, Vol. 19: 1656-1666).

[0174] The compositions described herein include pharmaceutical compositions used for the purpose of carrying out methods of gene therapy in mammals that require it (this includes non-human mammals and human individuals that require it).

[0175] The compositions of the present invention can be formulated for delivery to animals (e.g., livestock, e.g., cattle, pigs, etc.) and other non-human mammalian subjects for veterinary use, as well as for delivery to human subjects. Virus-derived particles can be formulated using physiologically acceptable carriers for use in gene transfer and gene therapy applications.

[0176] In some embodiments, the composition further comprises one or more transduction helper compounds. As specifically described in Zuris et al. (2015, Nat Biotechnol, Vol. 33(n°1): 73-80), the transduction helper compounds are preferably selected from the group comprising cationic polymers. Transduction helper compounds include polyblen (also known as hexadimethrin bromide), protamine sulfate, 12-myristo-13-acetate (also known as phorbol myristate acetate or PMA) (described in Johnston et al., 2014, Gene Ther, Vol. 21(12): 1008-1020), vectofusin (described in Fenard et al., 2013, Molecular Therapy Nucleic Acids, Vol. 2: e90), poloxamer P338 (described in Anastasov et al., 2016, Lentiviral vectors and exosomes as gene and protein delivery tools, in Methods in Molecular Biology, Vol. 1448: 49-61), RetroNectin® reagent (commercially available from Clontech Laboratories Inc.), and Viral The following may be selected: Plus® Transduction Enhancer (commercially available from Applied Biological Materials Inc.), TransPlus® Viral Transduction Enhancer (commercially available from Clinisciences), Lentiboost® (commercially available from Sirion Biotech), or ExpressMag® Transduction System (commercially available from Sigma-Aldrich). As shown in the examples herein, the cation transduction helper compound may consist of polyblen.

[0177] Virus-derived particles can be formulated in conventional methods using one or more physiologically acceptable carriers or excipients. Virus-derived particles can be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage forms, for example, in ampoules or in multi-dose containers, along with further preservatives. Virus-derived particle compositions may take the form of suspensions, solutions, or emulsions of oily or aqueous vehicles and may contain formulation agents such as suspending agents, stabilizers, and / or dispersants. Liquid preparations of virus-derived particle compositions may be prepared by conventional means using pharmaceutically acceptable additives, such as suspending agents (e.g., sorbitol syrup, cellulose derivatives, or hydrogenated edible fats); emulsifiers (e.g., lecithin or gum arabic); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoate or sorbic acid). Preparations may also contain buffer salts. Alternatively, the composition may be in powder form for preparation with a suitable vehicle, such as pyrogen-free sterile water, before use.

[0178] The virus-derived particle composition of the present invention can be administered to a subject in a therapeutically effective dose to induce a desired genomic alteration in target cells, target tissues or organs, or in target nucleic acids contained in target organisms, particularly target mammals (which include target non-human mammals and human individuals). The therapeutically effective dose refers to an amount of the pharmaceutical composition sufficient to produce improvement in symptoms caused by the occurrence of a desired genomic alteration event in the target nucleic acid.

[0179] In one embodiment, the amount of the virus-derived particle composition of the present invention is administered in dose units ranging from about 0.1 to 5 micrograms (μg) per kilogram (kg). For this purpose, to treat an average subject weighing 70 kg, the virus-derived particle composition of the present invention can be formulated in doses ranging from about 7 mg to about 350 mg. The amount of the virus-derived particle composition of the present invention that can be administered can be selected from the group including 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1.0 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg, 3.0 mg / kg, 3.5 mg / kg, 4.0 mg / kg, 4.5 mg / kg, or 5.0 mg / kg. In particular, to treat an average subject weighing 70 kg, the dose of virus-derived particles in the unit dose of the composition may be selected from groups including 7 mg, 8 mg, 9 mg, 10 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 375 mg, 400 mg, 425 mg, 450 mg, 475 mg, 500 mg, 525 mg, 550 mg, 575 mg, 600 mg, 625 mg, 650 mg, 675 mg, 700 mg, 725 mg, or 750 mg. These doses may be administered once or repeatedly, for example, daily, every other day, weekly, every other week, or monthly. In some embodiments, the virus-derived particle composition may be administered to the subject in single, double, triple, quadruple, quintuple, six or more doses. The interval between doses may be determined based on the practitioner's determination that it is necessary.

[0180] The virus-derived particle composition may, optionally, be presented in a pack or dispenser device that can contain one or more unit dosage forms containing the active ingredient. The pack may include, for example, metal or plastic foil such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration.

[0181] The virus-derived particle composition may be in liquid or solid (e.g., freeze-dried) form.

[0182] kit The present invention further relates to a kit for preparing virus-derived particles as described herein.

[0183] The present invention is a kit for preparing virus-derived particles for altering target nucleic acids in eukaryotic cells, Nucleic acids containing an expression cassette encoding a GAG-Cas fusion protein, and - Nucleic acids containing one or more expression cassettes encoding virus-like aggregate proteins Regarding the kit that includes this.

[0184] In some embodiments, the kit further comprises nucleic acids including an expression cassette encoding a pseudotyping viral envelope protein.

[0185] In some embodiments of the kit, the virus-derived aggregate protein is a virus-derived Gag protein.

[0186] In some embodiments, the Gag protein is encoded by an expression cassette selected from the group including an expression cassette encoding a GAG-PRO-POL polyprotein and an expression cassette encoding a GAG protein.

[0187] In some embodiments, the kit further comprises one or more nucleic acids encoding CRISPR-Cas system guide RNAs.

[0188] In certain embodiments of the kit, the nucleic acids are localized in eukaryotic cells as a result of their transfection into the eukaryotic cells. In some of these embodiments, the nucleic acids are in the form of a nucleic acid vector in the eukaryotic cells (these cells may also be referred to herein as packaging cells). In some other embodiments of these embodiments, some or all of these nucleic acids are integrated into the genome of these eukaryotic cells (these cells may also be referred to herein as packaging cells).

[0189] Therefore, in some embodiments of the kit of the present invention, the eukaryotic cells consist of a packaging cell line.

[0190] The kit of the present invention may optionally include different containers (e.g., vials, ampoules, test tubes, flasks, or bottles) for each individual composition or element contained therein. The kit may also contain further reagents for the formulation of the individual components, such as buffers, diluents, etc. Each component would generally be suitable to be provided either dispensed into its respective container or in a concentrated form.

[0191] Instructions for using the kit in accordance with the methods described herein may be included. The explanatory materials may include publications, records, diagrams, or any other medium of representation that can be used to convey the usefulness of the methods of the present invention in a kit for evaluating the quality of oocytes. The accompanying documentation may include text contained in any physical medium, e.g., paper, cardboard, film, or in an electronic medium, e.g., diskette, chip, memory stick, or other electronic storage format. The explanatory materials for the kit of the present invention may, for example, be attached to the container containing the other contents of the kit, or shipped together with the container containing the kit. Alternatively, the explanatory materials may be shipped separately from the container, with the intention that the recipient use the explanatory materials and the contents of the kit in coordination.

[0192] Methods for altering target nucleic acids Virus-derived particles and compositions containing them may be used for gene therapy.

[0193] A further aspect of the present invention is a method of treating a subject with virus-derived particles of the present invention or with a composition containing them.

[0194] The administration of virus-derived particles to human subjects or animals requiring such administration may be by any means known in the art for administering viral vectors.

[0195] Exemplary modes of administration include rectal, transmucosal, topical, transdermal, inhalation, parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular, and intra-articular) administration, and direct tissue or organ injection or subarachnoid, direct intramuscular, intraventricular, intraperitoneal, intranasal, or intraocular injection. Injectable preparations may be prepared in conventional forms, such as liquid solutions or suspensions, solid forms suitable for liquid solutions or suspensions before injection, or emulsions. Alternatively, the virus may be administered topically rather than systemically, for example, in depot or sustained-release formulations.

[0196] The present invention also provides a method for altering a target nucleic acid, which includes at least a target sequence, in eukaryotic cells. a) A step of bringing the eukaryotic cell into contact with the virus-derived particles described herein or the composition described herein, and b) A step of collecting eukaryotic cells having altered target nucleic acids. Regarding methods including

[0197] In some embodiments, virus-derived particles or compositions containing them are administered directly to a subject in vivo. In some other embodiments, subject cells are provided, and then virus-derived particles or compositions containing them are transdulated to the cells in vitro. A further method step involves administering the transdulated subject cells back into the subject's body.

[0198] In some embodiments, the method is carried out in vitro or ex vivo.

[0199] The present invention also relates to compositions described herein for use in preventing or treating any disease or disorder suitable for gene therapy.

[0200] The present invention provides a method for preventing or treating any disease or disorder suitable for gene therapy. In one embodiment, “treatment” or “to treat” refers to improvement of a disease or disorder or at least one identifiable symptom thereof. In another embodiment, “treatment” or “to treat” refers to improvement of at least one measurable physical parameter associated with a disease or disorder that is not necessarily identifiable by the subject. In yet another embodiment, “treatment” or “to treat” refers to physically inhibiting the progression of a disease or disorder, e.g., stabilization of an identifiable symptom, e.g., physiologically inhibiting stabilization of a physical parameter, or both. Other conditions, including cancer, immune disorders, and veterinary symptoms, may also be treated.

[0201] The types of diseases and disorders that can be treated by the method of the present invention include, but are not limited to, age-related macular degeneration; diabetic retinopathy; for example, HIV generalized influenza, Category 1 and 2 bioweapons, or any emerging viral infection; autoimmune diseases; cancer; multiple myeloma; diabetes; systemic lupus erythematosus (SLE); hepatitis C; multiple sclerosis; Alzheimer's disease; Parkinson's disease; amyotrophic lateral sclerosis (ALS), Huntington's disease; epilepsy; chronic obstructive pulmonary disease (COPD); arthritis; myocardial infarction (MI); congestive heart failure (CHF); hemophilia A; or hemophilia B.

[0202] Infectious diseases that can be treated or prevented by the methods of the present invention are, but are not limited to, those caused by infectious agents including viruses, bacteria, fungi, protozoa, helminths, and parasites. The present invention is not limited to the treatment or prevention of infectious diseases caused by intracellular pathogens. Many medically relevant microorganisms are extensively described in the literature; see, for example, CG A Thomas, Medical Microbiology, Bailliere Tindall, Great Britain 1983 (the entire contents of which are incorporated herein by reference).

[0203] The types of cancer that can be treated or prevented by the method of the present invention include, but are not limited to, human sarcomas and carcinomas, such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endothelioma, lymphangiosarcoma, lymphoendothelial cell sarcoma, synoviomas, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, liver cancer, bile duct cancer, choriocarcinoma, seminoma, fetal carcinoma, Wilms' tumor, and cervical cancer. These include testicular tumors, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pineal glandoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma; leukemia, such as acute lymphoblastic leukemia and acute myeloid leukemia (myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia); chronic leukemia (chronic myeloid (granulocytic) leukemia and chronic lymphocytic leukemia); and polycythemia vera, lymphoma (Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenström macroglobulinemia, and heavy chain disorders.

[0204] The present invention is further illustrated, but is not limited to, the following embodiments. [Examples]

[0205] A. Materials and Methods A.1. Structures As described in (Voelkel et al., 2010), a GAG-Cas9 coding plasmid was designed. Using the lentiCRISPR plasmid (Addgene plasmid 4953) as a template, the codon-optimized sequence of flag-Cas9 from Streptococcus pyogenes was PCR-amplified. This final construct was donated by the F. Zhang laboratory (Shalem et al., 2014, Science, Vol. 343: 84-87). Next, flag-Cas9 was inserted downstream of the mouse leukemia virus GAG sequence (MA-CA-NC). The flame was harmonized to generate a polyprotein. The two parts were separated by an MLV-protease cleavage site that releases flag-Cas9 from the GAG ​​during the viral maturation process. This chimeric protein was expressed under the control of an hCMV promoter equipped with an intron and a polyA signal (both derived from rabbit β-globin mRNA). The expression plasmid encoding the GagProPol polyprotein of MLV (Negre et al., 2000, Gene Ther, Vol. 7: 1613-1623) and the VSVG encoding plasmid (Yee et al., 1994, Methods Cell Biol, Vol. 43 PtA: 99-112) were described elsewhere.

[0206] < <crizi>The gRNA coding plasmid referred to as > is derived from a previously described lentiviral construct (Kieusseian et al., 2006, Blood, Vol. 107: 492-500) into which a U6 cassette derived from the lentiCRISPR plasmid was inserted. Following the procedure described by the authors, CRISPR gRNA sequences were cloned into CRIZI between BsmBI sites upstream of the U6 promoter. The gRNA sequences used in this study were designed using Crispseek software (potential off-target >3 mismatches) (Zhu et al., 2014, PloS One, Vol. 9: e108424). The primer sequences for each gRNA are shown below: [Table 1] [Table 2] [Table 3]

[0207] A.2. Production of VLPs Cas9-VLPs are referred to as preparations of VLPs incorporating one of several gRNAs that target a specific gene. VLP preparation requires cotransfection of several plasmids. VLPs were produced by transfection of Lenti-X™ 293T (Clontech) using JetPei (Polyplus) according to the manufacturer's instructions. JetPrime transfection agent (Polyplus) or the calcium phosphate method (CalPhos mammalian kit, Clontech) can also be used.

[0208] The classic ratio of plasmids mixed in the JetPei transfection recipe is GAG-Cas9 (20%), GagProPol (20%), VSV-G or other envelope (20%), and gRNA-encoding construct (40%).

[0209] For Cas9Myd88VLP, two different gRNAs were introduced into the recipe to achieve simultaneous packaging of both RNA species into nascent VLPs. HEK293T cells plated in 3 × 10⁶ cells / 10 cm plates 24 hours prior to transfection were transfected with a mixture containing the following: -R1: GAG-Cas9 4μg, GagProPol 4μg, VSVG 2μg, BaEV envelope (Girard-Gagnepain et al., 2014) 2μg, Myd88-gRNA1 coding plasmid 2μg, Myd88-gRNA2 coding plasmid 2μg. -R2: GAG-Cas9 6μg, GagProPol 6μg, VSVG 4μg, Myd88-gRNA1 coding plasmid 4μg, Myd88-gRNA2 coding plasmid 4μg. -R3: GAG-Cas9 4μg, GagProPol 8μg, VSVG 2μg, BaEV envelope 2μg, Myd88-gRNA1 coding plasmid 2μg, Myd88-gRNA2 coding plasmid 2μg. -R4: GAG-Cas9 4-6 μg, VSVG 2 μg, BaEV envelope 2 μg, Myd88-gRNA1 coding plasmid 5 μg, Myd88-gRNA2 coding plasmid 5 μg.

[0210] Forty hours after transfection, the VLP-containing supernatant was collected and clarified by short-term centrifugation (2000g, 3 minutes). L929 cells were transductioned using the clarified Cas9-YFPVLP directly. Cas9-hh / mMyd88VLP and Cas9-DDX3VLP were pelletized by ultracentrifugation at 35000 rpm for 1 hour using an SW41 rotor, gently agitated, and resuspended overnight in ice-cold PBS. 10 ml of the supernatant was concentrated to produce 100 μl of concentrated VLP in cold PBS solution (concentration ratio: 100-fold). The concentrated VLP batch was stored at -80°C and was shown to be stable for at least two weeks at 4°C after thawing. Before centrifugation / transduction, the VLP-containing supernatant can be filtered using a 0.45 μm pore filter.

[0211] A.3. Proteotransduction procedure using Cas9-VLP Cas9-YFPVLP was transduction into 3 × 10⁵ L929-YFP cells by adding 400 μl of clarified VLP-containing supernatant to 400 μl of culture medium in a 6-well plate. After 2 hours, 2 ml of DMEM 10% FCS was added to the culture medium.

[0212] Transduction of primary cells was performed as usual by adding 5-20 μl of 100×VLP to 300 μl of culture medium in a 48-well plate. After 2 hours, 0.5 ml of fresh culture medium was added to this transduction medium. When used at a final concentration of 4 μg / ml in the transduction medium, the addition of polybrene was shown to have the potential for proteotransduction.

[0213] A.4. PCR-based genotyping assays Genomic DNA extraction from VLP-treated cells was achieved using the Nucleospin Tissue Kit (Machery Nagel) according to the manufacturer's instructions. DNA preparation was performed 24–48 hours after VLP treatment, but further experiments showed that in HEK293T recipient cells, cleavage was completed immediately 6 hours after VLP exposure.

[0214] PCR amplification of Myd88 was performed in 50 μl using GOTAQ polymerase (Promega). 100 ng of cell genomic DNA was used as a template for the PCR reaction as follows: 5 minutes at 94°C, 3 cycles of (30 seconds at 94°C, 30 seconds at 68°C), 3 cycles of (30 seconds at 94°C, 30 seconds at 64°C, 30 seconds at 72°C), 27 cycles of (30 seconds at 94°C, 30 seconds at 57°C, 30 seconds at 72°C), 5 minutes at 72°C, and 12°C. PCR amplicon analysis was performed on ethidium bromide-stained 2.5% agarose gel.

[0215] A.5. Primers used for genotyping analysis (5'-NNN-3'): [Table 4] [Table 5]

[0216] A.6. Combination of Cas9-DDX3VLP and ssDNA 15 μl of concentrated Cas9-DDX3 VLP was mixed with 10 μl of PBS containing 8 μg / ml polybrene. Next, 5 μl of each dilution of Flag-DDX3 primer was added to this mixture, with the best results obtained at higher concentrations (5 μl of 100 pmol / μl primer). This "all-in-one" complex was incubated at 4°C for 15 minutes, and 30 μl was added to the medium (400 μl + 4 μg / ml polybrene) of HEK293T cells (200,000 cells plated the previous day) cultured in a 12-well plate. After 2 hours, 1 ml of DMEM 10% FCS was added to the transduction medium. 40 hours after VLP treatment, cells were divided for amplification and analysis of gene insertion of the flag sequence upstream of the DDX3 gene, and WB analysis was performed after 72 hours.

[0217] A.7. Flag-DDX3 primer sequence (HPLC purification): [Table 6]

[0218] Example 1: Cleavage of the YFP gene by Cas9-YFPVLP Molecular manipulation of viral structures enables the creation of viruses / VLPs that can incorporate target proteins. Among numerous examples are the design of HIV-1 clones incorporating fluorescent genes to facilitate easy monitoring of infection (Dale et al., 2011, Methods San Diego Calif, Vol. 53: 20-26), VLPs with viral epitopes useful for animal vaccination (Garrone et al., 2011, Sci Transl Med, Vol. 3: 94ra71), and VLPs used to deliver protein-functional cargo to recipient cells (Voelkel et al., 2010, Proc Natl Acad Sci USA, Vol. 107: 7805-7810), (Mangeot et al., 2011, Mol Ther J Am Soc Gene Ther, Vol. 19: 1656-1666). To achieve efficient Cas9-VLP production, Cas9 was fused to the structural GAG protein of mouse leukemia virus (MLV), as previously described (Voelkel et al., 2010, op. cit.). Essentially, when this chimeric protein is expressed in HEK293T cells along with a viral protease (Pro) and envelope, it is expected that VLPs will be produced in which the Cas9 portion is incorporated into the viral core, and Cas9 will be cleaved from the GAG ​​platform by the viral protease.

[0219] Considering the affinity of Cas9 for gRNA, we further hypothesized that gRNA expression in VLP-producing cells might be sufficient to enable their incorporation into particles capable of carrying all components of the CRISPR mechanism. To check these hypotheses, we designed a gRNA expression plasmid to target the YFP gene and attempted to incorporate the gRNA into Cas9-VLPs produced from HEK293T cells. A summary of this approach and the constructs used is shown in Figure 1. Next, VLP-containing supernatant was introduced into the culture medium of mouse L929 cells expressing stable YFP, and then the cleavage of the fluorescent gene was investigated by a surveyor assay. The results shown in Figure 2 indicate that Cas9-VLP delivered the CRISPR mechanism and enabled cleavage of the YFP gene at the expected site determined by the incorporated gRNA. This gene disruption was associated with a dramatic and irreversible loss of fluorescence in the treated population, resulting from the expected rupture of the YFP reading frame (Figure 3). These findings validate the use of Cas9-VLP as a potent delivery agent for CRISPR components.

[0220] Example 2: Disruption of the Myd88 gene in HEK293T and HeLa recipient cells To mediate deletion of the hMyd88 gene, we further investigated the ability of VLPs to incorporate several gRNAs. Myd88 is a crucial adapter protein that transmits signals from most TLRs that activate the transcription of nuclear factors and is particularly involved in macrophage survival under certain conditions (Lombardo et al., 2007, J Immunol Baltim Md 1950, Vol. 178: 3731-3739). Two gRNAs were designed to mediate two different cleavages in the human Myd88 gene, resulting in deletion of the endogenous gene (Figure 4A-B). Cas9-Myd88VLPs were produced by transfection of different combinations of plasmids (described in Materials and Methods). The released particles were then enriched and used to alter the Myd88 gene in different recipient cells, including Hela and HEK293T. The results shown in Figures 4C and 4D indicate that all Cas9-VLP types loaded with Myd88 gRNA were efficient in deleting the expected portion of the Myd88 gene in HEK293T cells. However, HeLa cells were less reactive and were not significantly modified by specific VLP types. In particular, we noted that VLPs lacking protease (R4) were inefficient in HeLa cells but remained fully active in HEK293T target cells. These data suggest that VLP recipes should be optimized for target cell types. Further experiments showed that the effect of Cas9-Myd88VLPs was dose-dependent (Figure 5) and enhanced by the addition of polybrenes (Figure 6).

[0221] Example 3: VLP-mediated disruption of the Myd88 gene in primary cells of human and mouse origin. A more challenging problem is delivering CRISPR components to primary cells that are largely unacceptable to conventional transfection methods and are difficult to transduce by viral vectors. Therefore, we monitored the efficacy of Cas9-Myd88VLP in different cell types (including human macrophages derived from human monocytes) newly isolated from organisms. Genotyping analysis of treated cells revealed clear and highly efficient Myd88 gene cleavage by a single dose of Cas9-Myd88VLP to cultured macrophages (Figure 7A). In addition to genotyping PCR-based assays confirming gene cleavage, Myd88 disruption is the cause of the strong phenotype shown in Figure 7B, supporting inactivation of Myd88 function. We further investigated the remarkable efficiency of VLPs in delivering CRISPR to primary cells in human inactivated lymphocytes (typically unsuitable for most existing genetic modification techniques) (Figure 8). To generalize our observations, we designed several other gRNAs targeting the mouse Myd88 gene and prepared VLP batches specifically for mouse cells. As shown in Figure 9, we used these novel VLP batches to deliver CRISPR RNPc to mouse-derived macrophages with high efficiency. Overall, these results demonstrate that Cas9-VLP is an efficient agent for introducing the functional CRISPR mechanism into primary cells.

[0222] Example 4: Cas9-VLP can mediate the transfer of repair templates: Fabrication of an "all-in-one" VLP complex. Previous studies have focused on the ability of MLV-derived VLPs and other VSV-G-inducing particles to mediate plasmid delivery to human cells and function as virus-derived transfection agents (Okimoto et al., 2001, Mol Ther J Am Soc Gene Ther, Vol. 4: 232-238). Since particles can be combined with dsDNA molecules, we hypothesized that MLV-derived Cas9-VLPs could support combination with ssDNA and mediate their delivery to cells. Leveraging this knowledge, we attempted to combine Cas9-VLPs with repair primers composed of ssDNA. Through this approach, we propose using VLPs to cleave endogenous genes and repairing them in cells via a homologous recombination-like mechanism (HR) using a provided repair template. We investigated this using the DDX3 human gene as a model, employing repair primers designed to insert a FLAG sequence upstream of the ATG codon in the endogenous DDX3 gene. Figure 10 illustrates the principle of this "all-in-one" VLP strategy, as directly investigated by the inventors in both transfection cells and primary cells. Cas9-DDX3VLP, combined with a flag repair primer, successfully cleaved the DDX3 gene (not shown), enabling gene-targeted insertion of the flag sequence into the correct predicted site of the DDX3 5' sequence. This was confirmed by PCR-based genotyping assays and detection of flag-tagged DDX3 protein by Western blotting (Figure 10C). The results were also validated at the gene level in primary human dendritic cells exposed to a single treatment with Cas9-DDX3VLP.

[0223] Example 5: Characterization of particles derived from CAS9 virus. CAS9 VLP was produced as disclosed in the Materials and Methods section and concentrated by first ultracentrifugation with a 20% sucrose cushion. The resulting pellet was then resuspended in PBS and recentrifuged with two sucrose cushions (a 50% sucrose cushion at the bottom of the tube and a 20% sucrose cushion separating the 50% cushion from the sample). After 2 hours of centrifugation, the interface separating the 50% and 20% was collected, recentrifuged to obtain high-purity CAS9-VLP, which was then resuspended in PBS. 10 μg of VLP was dissolved in Laemlli buffer and heated at 95°C for 5 minutes prior to Western blot analysis.

[0224] Western blot analysis is shown in Figure 12A (10 μg per lane). The antibodies used were against GAGmlv (ABCAM R187), VSVG (ABCAM P5D4), CAS9 (7A9-3A3 clone Cell Signaling), and a Flag sequence (Sigma) attached to Cas9. Different forms of mlv GAGs corresponding to cleavage products processed by viral proteases are shown. In the particle preparation, VSVG is clearly detected at the expected size. The CAS9 antibody reveals a larger product exceeding 200 kDa corresponding to the GAG-CAS9 fusion (expected 225 kDa), and this protein is also detected by the Flag antibody (left panel). Both the CAS9 and FLAG antibodies reveal smaller CAS9 products (ranging from 160 to 200 kDa) that may correspond to free CAS9 protein or cleavage products released from GAG after protease processing.

[0225] As illustrated in Figure 12B, 30 μg of total high-purity VLP was loaded into a discontinuous sucrose gradient (10%–60% sucrose in PBS) in a total volume of 12 ml. After 16 hours of centrifugation (25000 rpm, SW41), 500 μl of fractions were collected from the tip of the tube and named 1–24. Next, 2 μl of each fraction was spotted onto a nitrocellulose membrane and immediately blocked by adding milk (TBST 5% low-fat milk). Then, VSVG CAS9 and GAG MLV were detected in each fraction using the same antibodies as above. The results show that CAS9 VLP precipitated at densities of 1,14–1,21, with a peak at 1,17.

[0226] Example 6: Loading guide RNA into CAS9 virus-derived particles Example 6 demonstrates that CAS9 virus-derived particles efficiently incorporate guide RNA.

[0227] Northern blotting of the conserved region of guide RNA using total RNA extracted from producing cells (lanes 2-4) or corresponding purified VLPs (lanes 5-7). Lane 1: Control sample corresponding to total RNA from cells that do not produce VLPs. Lane 2: Total RNA from cells expressing Gag / Cas9 fusion, viral envelope, and guide RNA. Lane 3: Total RNA from cells expressing Gag / Cas9 fusion, viral envelope, and modified guide RNA with a longer stem structure. Lane 4: Total RNA from cells expressing wild-type Cas9 and guide RNA in the absence of Gag. Lanes 5, 6, and 7: Total RNA extracted from the supernatant of corresponding producing cells after filtering through a 0.8 μm filter to remove cell debris (lane 5 corresponds to the supernatant of cells in lane 2, etc.). Lane 7 shows that when Gag / Cas9 fusion is not expressed, guide RNA is not efficiently incorporated into the particle. Interestingly, modified guide RNAs with longer stem structures (lanes 3 and 6) do not appear to be incorporated into the VLP more efficiently than wild-type guide RNAs (lanes 2 and 5).

[0228] Example 7: Comparison of MLV-based virus-derived particles and HIV-based virus-derived particles Figure 14A shows schematic diagrams of coding cassettes designed for the production of MLV-based VLPs or HIV-1-based VLPs. Eukaryotic expression vectors containing an initial hCMV promoter, rabbit B-globin introns, and rabbit pA signaling were incorporated into both cassettes. Both systems were optimized by exploring and testing various proteolytic sites for isolating the GAG ​​cassette from the Cas9 gene. MLV-based VLPs were produced as described in the Materials and Methods section, and HIV-1-based VLPs were produced similarly, except that the MLV GAG POL plasmid was transfected with an HIV-1 helper construct encoding the GAG ​​POL Tat Rev protein (construct SEQ ID NO: 33). The production of HIV-1 VLPs followed the same procedure as for MLV-based VLPs.

[0229] Figure 14B shows a study in which 30,000 HEK293T cells expressing GFP were transductioned using enriched VLPs engineered to incorporate a guide RNA targeting the GFP gene. HIV-1 and MLV-based particles were produced using the same load gRNA (target sequence: CGAGGAGCTGTTCACCGGGG - SEQ ID NO: 35). The recipient cells were plated in 96w plates the day before. Polyblen (4 μg / ml) was supplemented to the transduction medium. Fluorescence intensity was measured by fluoroscopy (excitation 488, emission 535) 72 hours after treatment with each batch of three escalating doses of VLP. A clear decrease in fluorescence was observed in VLP-treated cells compared to untreated control cells (C), indicating cleavage of the GFP gene within the recipient cells. The results show that HIV-1-based VLPs are efficient at delivering the CRISPR / CAS9 system to these recipient cells, at a slightly lower level of efficiency (1.5 to 2 times less efficient) than MLV-based VLPs.

[0230] Figure 14C shows the cleavage of the WASP gene in primary human T cells stimulated with IL-7. In this experiment, two guide RNAs targeting the human WASP gene were incorporated into HIV-1 or MLV-based VLPs before processing fresh purified T cells stimulated with IL-7. Next, 24 hours after processing, WASP deletion by CRISPR-CAS9 was measured by PCR in recipient cells. Gel analysis performed using ImageJ software allowed for the quantification of the dual-cut efficiency of MLV-based VLPs (32%) and HIV-1-based VLPs (6%).

[0231] Example 8: CRISPR delivery to Thy1-GFP mouse embryos using Cas9-containing virus-derived particles. Cas9 VLPs incorporating a guide RNA targeting the GFP gene were produced and highly purified before injection into the zona pellucida of mouse embryos (1-cell stage). All heterozygous embryos possessed the Thy1-GFP allele, which is involved in GFP expression in motor neurons. The objective of this study was to evaluate the ability of VLPs to cleave GFP in embryos and to produce animals in which their Thy1-GFP cassettes were altered after re-implantation of VLP-treated embryos into female mice. Several nanoliters of preparation (6.5 μM Cas9) were used for two injections performed without perforin treatment of the cell membrane, as shown in A. No embryos died with this injection protocol. After re-implantation, the inventors obtained a total of 20 animals (F0). Genomic DNA was extracted from the fingers of neonatal mice and analyzed by a T7 endonuclease assay to reveal GFP cassette cleavage. As shown in B, 6 out of 20 animals were positive in this assay (arrow), and 4 out of 9 animals were positive in the first injection experiment (left panel): in the second injection, animals 5, 7, 8, and 12, as well as animals 40 and 45 (weak). Next, animals 7, 8, and 12 were crossed with wt-C57B6 animals to evaluate the inheritance of the truncated GFP allele to the offspring. As expected, approximately half of the F1 offspring were found to be heterozygous for the Thy1-GFP allele (for all three founders). Next, the Thy1-GFP allele status in heterozygous F1 mice was measured by the T7-endonuclease assay shown in C*. GFP alteration was shown in all F1 heterozygous offspring of mice 7 and 12, as well as in 33% of the offspring of mouse 8. Next, the Thy1-GFP alleles were sequenced for alleles of animals #78, #79, #21, and #22, and the chromatograms were compared with the sequences obtained for Thy1-GFP untreated animals. For this purpose, TIDE software was used to obtain histograms representing the indel properties and the percentage of sequence change for each animal**. The results shown in D, E, F, and G show the percentage of GFP change in F1 mice***.In short, these data demonstrate that Cas9-VLP can support animal gene transfer and can be used as a CRISPR delivery agent for mammalian embryos that modifies genes without the transfer of genetic material or damage to egg cells.

[0232] T7-endonuclease assay protocol: Mouse genomic DNA was extracted from mouse fingers using the Nucleospin Tissue Kit (Macherey Nagel). Next, 3 μl of DNA template was used in 50 μl of PCR reaction mixture (PCR conditions: primers: Forward: 5'-TCTGAGTGGCAAAGGACCTTAGG (Thy1 primer - SEQ ID NO: 39) Reverse: 5'-GAAGTCGTGCTGCTTCATGTGGTCGG (GFP primer - SEQ ID NO: 40) Using this method, the temperature is 95°C for 5 minutes, followed by 3 cycles of (95°C for 30 seconds - 64°C for 30 seconds - 72°C for 30 seconds) and 25 cycles of (95°C for 30 seconds - 57°C for 30 seconds - 72°C for 30 seconds), followed by 72°C for 5 minutes.

[0233] Next, the Thy1-GFP amplicon was subjected to a T7 endonuclease assay in a 40 μl reaction tube, as described by the manufacturer (https: / / www.neb.com / protocols / 2014 / 08 / 11 / determining-genome-targeting-efficiency-using-t7-endonuclease-i). Finally, the digestate was loaded onto a 2.5% agarose gel.

[0234] **TIDE software is a free online tool: https: / / tide.nki.nl / .** A chromatogram sequence (abi file) was uploaded to the software, and a TIDE run was performed without modifying the default settings. The TIDE histogram is shown.

[0235] ***The fact that the selected Thy1-GFP strain has several copies of GFP alleles (6-10) means that the % is not complete. The results should be reproducible in a mouse strain with one constitutive GFP copy per allele (in preparation).

[0236] Other sequences GAG-Cas9 amino acid sequence (SEQ ID NO: 22):

Table 7

Table 8

Table 9

Table 10

Table 11

Table 12

Table 13

Table 14

Table 15

Table 16

Table 17

Claims

1. A virus-like particle (VLP) containing one or more Cas proteins, The one or more Cas proteins are contained within the virus-like particle as a fusion protein between (i) a viral structural protein which is a retroviral gag protein and (ii) the one or more Cas proteins. The VLP further contains one or more CRISPR-Cas system guide RNAs and one or more viral envelope proteins. Virus-like particles (VLPs).

2. The virus-like particle according to claim 1, wherein the VLP comprises a CRISPR-Cas ribonucleoprotein complex, which is a complex of one or more Cas proteins and one or more guide RNAs.

3. The following two CRISPR-Cas system guide RNAs both hybridize with their respective target nucleic acids: a. A first CRISPR-Cas system guide RNA that hybridizes with the first target sequence of the target nucleic acid, and b. A second CRISPR-Cas system guide RNA that hybridizes with a second target sequence of the target nucleic acid. A virus-like particle according to claim 1 or 2, comprising:

4. A virus-like particle according to any one of claims 1 to 3, further comprising a targeting nucleic acid, The targeting nucleic acid is contained within the VLP or is compounded with the VLP. The targeting nucleic acid is at least: a. The first target sequence of the selected target nucleic acid and the first sequence to hybridize with it, b. A second sequence that hybridizes with the second target sequence of the selected target nucleic acid. Virus-like particles, including those containing the virus.

5. A virus-like particle according to any one of claims 1 to 4, which is derived from a lentivirus.

6. A virus-like particle according to claim 1, selected from the group consisting of Moloney mouse leukemia virus-derived vector particles, bovine immunodeficiency virus-derived particles, monkey immunodeficiency virus-derived vector particles, feline immunodeficiency virus-derived vector particles, human immunodeficiency virus-derived vector particles, equine anemia virus-derived vector particles, goat arthritis encephalitis virus-derived vector particles, and baboon endogenous virus-derived vector particles.

7. The virus-like particle according to any one of claims 1 to 6, wherein the Cas protein exists as a cleavable fusion protein including a proteolytic cleavage site located between the viral structural protein portion and the Cas9 protein portion.

8. The virus-like particle according to any one of claims 1 to 6, wherein the Cas9 protein has the amino acid sequence of SEQ ID NO:

31.

9. A composition for altering target nucleic acids in eukaryotic cells, comprising at least one virus-like particle (VLP) according to any one of claims 1 to 8.

10. The composition according to claim 9, further comprising one or more transduction helper compounds.

11. A cell line for producing virus-like particles (VLPs) according to claim 1, a. One or more nucleic acids encoding proteins necessary for forming the VLP, b. Nucleic acids containing an expression cassette encoding a GAG-Cas9 fusion protein, and c. One or more nucleic acids encoding one or more CRISPR guide RNAs Cell lines that include this.

12. An in vitro or ex vivo method for altering a target nucleic acid containing at least one target sequence in a eukaryotic cell, a. The step of bringing the eukaryotic cell into contact with the virus-like particles (VLP) described in any one of claims 1 to 8 or the composition described in claim 9 or 10, and b. A step of collecting eukaryotic cells having altered target nucleic acids. In vitro or ex vivo methods, including those mentioned above.

Images