Use of microbial inoculum containing Fusarium brachygibotum or Fusarium brachygibotum strain FXFB001 and acceptable auxiliary materials in the production of mycelial protein, edible mycelium, Fusarium brachygibotum strain FXFB001, microbial inoculum for producing protein or protein-rich mycelium, use of microbial inoculum, method for producing edible mycelium using Fusarium brachygibotum, use of edible mycelium

Fusarium brachygibbosum strain FXFB001 enhances mycelial protein production yield and nutritional quality, addressing the limitations of existing Fusarium venenatum strains by achieving high protein content and low fat, making it an efficient and environmentally friendly alternative protein source.

JP7881733B2Active Publication Date: 2026-06-29JIANGXI FUSHINE BIOTECHNOLOGY CO LTD +1
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
JIANGXI FUSHINE BIOTECHNOLOGY CO LTD
Filing Date
2024-03-11
Publication Date
2026-06-29

AI Technical Summary

Technical Problem

Current Fusarium venenatum strains used in mycelial protein production have low yield and require genetic modifications, and there is a need for naturally high-protein-producing filamentous fungal strains to improve industrial production efficiency and nutritional quality of mycelial proteins.

Method used

Utilization of Fusarium brachygibbosum strain FXFB001, with at least 95% homology to SEQ ID NO:5 for TEF1 gene and 97% homology to SEQ ID NO:6 for ITS1 gene, for producing mycelial protein with high protein content and low fat, through a fermentation process optimized with specific media and culture conditions.

Benefits of technology

Fusarium brachygibbosum strain FXFB001 achieves a mycelial protein content of 55.39% with low fat and high dietary fiber, providing a safe and efficient alternative protein source with improved production efficiency and reduced environmental impact.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007881733000020
    Figure 0007881733000020
  • Figure 0007881733000021
    Figure 0007881733000021
  • Figure 0007881733000022
    Figure 0007881733000022
Patent Text Reader

Abstract

This invention, which focuses on the application of Fusarium brachygibosum in the production of mycelial protein, belongs to the field of microbial fermentation. This invention is the first to demonstrate that Fusarium brachygibosum possesses the characteristics of high mycelial protein yield, significantly higher than that of other Fusarium species reported to date. The mycelial protein produced by Fusarium brachygibosum is filamentous, flesh-colored, elastic, and toxin-free, making it an ideal alternative protein. Therefore, this invention provides a new means for the industrial production of alternative proteins and simultaneously lays the foundation for the development of safe food. At the same time, fermentation-based production can significantly improve protein production efficiency, reduce carbon emissions, and protect the environment.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention belongs to the field of functional microorganisms, and more specifically, relates to the application of Fusarium brachygibotum in the production of mycelial proteins. [Background technology]

[0002] Alternative proteins are proteins produced from plant or animal cells, or through microbial fermentation. These innovative foods are designed to taste as good as, or better than, conventional animal-based foods, and offer the same or lower health benefits, such as zero cholesterol, low fat, and low fiber content, at an equivalent or lower cost. Alternative proteins require fewer inputs, such as land, fertilizer, and water, than conventionally produced animal products, and generate fewer negative externalities, such as greenhouse gas emissions and air pollution. At the same time, alternative proteins also reduce the contribution of food production to the risk of pandemics and antimicrobial resistance.

[0003] Microbial fermentation proteins, one form of alternative protein production, utilize the fermentation of microorganisms or algae to produce proteins. These proteins contain cellulose, abundant enzymes, and biologically active substances, are cholesterol-free, and are gentler on patients with cardiovascular and cerebrovascular diseases. Industrially, the main industrial strains used for fermentation to produce microbial protein meat include algae, yeast, and filamentous fungi. Algae have problems such as slow growth rate and low density, and have so far been mainly used for small-scale protein production. Yeast grows quickly, has a high cell density, and requires simple production equipment, but the digestibility of its cell wall is low and its nucleic acid content is high, which somewhat limits the further development of yeast fermentation proteins. Filamentous fungi that produce proteins are mainly concentrated in Fusarium. The mycelium produced by Fusarium is tastier than single-cell proteins such as yeast and bacteria, has a tissue structure similar to meat, and at the same time, its abundant edible crude fiber aids in the digestion of the human gastrointestinal tract, making it a meat substitute that can meet the nutritional needs of modern people. Currently, strains of Fusarium venenatum have been developed, and mycelium with higher protein content is used in the production of meat products (Patent Document 1). However, the yield of mycelial protein produced by Fusarium venenatum needs improvement. Furthermore, Patent Document 2 discloses that mycelial protein production in Fusarium venenatum can be effectively promoted by deleting the pyruvate decarboxylase gene FvPDC6 within the fungus. It is currently known that there are very few naturally occurring high-protein-producing mycelial species. Searching for more potentially and naturally high-productivity filamentous fungal protein strains represents a development of great commercial value. [Prior art documents] [Patent Documents]

[0004] [Patent Document 1] Chinese Patent Application Publication No. 115851458 Specification [Patent Document 2] Chinese Patent Application Publication No. 116640753 Specification [Overview of the project]

Problems to be Solved by the Invention

[0005] In consideration of this, an object of the present invention is to provide an application of a novel Fusarium fungus in the production of mycelial protein.

Means for Solving the Problems

[0006] The present invention provides an application of Fusarium brachygibbosum or a microbial inoculant thereof in the production of mycelial protein.

[0007] Preferably, the Fusarium brachygibbosum is a Fusarium brachygibbosum strain having a TEF1 gene sequence with at least 95% homology to SEQ ID NO:5 and / or an ITS1 gene sequence with at least 97% homology to SEQ ID NO:6, or a composition formed by the Fusarium brachygibbosum strain.

[0008] Preferably, the Fusarium brachygibbosum includes the Fusarium brachygibbosum strain FXFB001, and the deposit number of the Fusarium brachygibbosum strain FXFB001 is CGMCC No:41066.

[0009] Preferably, the Fusarium brachygibbosum includes a spore form and / or a mycelial form.

[0010] The present invention provides an edible mycelium. Based on the dry mass of the edible mycelium, the protein content in the edible mycelium is 40% or more, and / or the dietary fiber content is 20% or more, and / or the fat content is 8% or less. The edible mycelium is derived from Fusarium brachygibbosum, and the Fusarium brachygibbosum is the Fusarium brachygibbosum in the above application.

[0011] Preferably, the edible mycelium is rich in elasticity and / or toughness.

[0012] The present invention provides a Fusarium brachygibbosum strain FXFB001 with a deposit number of CGMCC No: 41066.

[0013] The present invention provides a microbial inoculant for producing a protein or a mycelium rich in protein, comprising the Fusarium brachygibbosum strain FXFB001 and an auxiliary material acceptable for the inoculant.

[0014] Preferably, the mass ratio of the Fusarium brachygibbosum strain FXFB001 to the auxiliary material is 1 to 10: 1 to 100.

[0015] Preferably, the auxiliary material comprises one or more of a culture medium, an additive, and a carrier.

[0016] The present invention provides the application of the Fusarium brachygibbosum strain FXFB001 or the microbial inoculant in the production of a protein or a mycelium.

[0017] The present invention provides a method for producing an edible mycelium using Fusarium brachygibbosum, inoculating a seed solution prepared from Fusarium brachygibbosum or its microbial inoculant into a fermentation medium for fermentation culture to obtain a fermentation broth, and after sterilizing the fermentation broth, separating the fermentation product to obtain an edible mycelium, where the Fusarium brachygibbosum is the Fusarium brachygibbosum in the above application.

[0018] Preferably, the fermentation medium comprises a first fermentation medium and / or a second fermentation medium, The aforementioned first fermentation medium contains the following components: 23-27 g / L of starch, 0.8-1.2 g / L of citric acid, 0.8-1.2 g / L of potassium dihydrogen phosphate, 4.5-5.5 g / L of ammonium sulfate, 17-21 mg / L of magnesium salt (concentration calculated in Mg equivalent), 2.8-43 mg / L of calcium salt (concentration calculated in Ca equivalent), 0.48-0.62 mg / L of manganese salt (concentration calculated in Mn equivalent), 0.96-1.05 mg / L of iron salt or ferrous salt (concentration calculated in Fe equivalent), 0.72-0.91 mg / L of zinc salt (concentration calculated in Zn equivalent), 0.44-0.54 mg / L of cobalt salt (concentration calculated in Co equivalent), and 0.08-0.12 mg / L of multivitamins. The aforementioned second fermentation medium contains 15-60 kg / m³ of glucose. 3 K2SO4 0.5~1.5kg / m 3 H3PO4 0.4~0.8 kg / m 3 Calculate the concentration in Mg equivalent: Magnesium salt 9.75~58.5g / m³ 3 The zinc salt concentration is calculated in Zn equivalents: 2.2~22.5 g / m³ 3 Calculate the concentration of manganese salt in Mn equivalent: 2.46~9.85 g / m³ 3 Calcium acetate 0.1~0.3 kg / m 3 and defoaming agent 0.08~0.12 kg / m 3 It contains the following amount of ingredients.

[0019] Preferably, when fermentation is carried out using a first fermentation medium, the fermentation culture conditions are: During the first 15 hours of fermentation culture, the aeration rate is controlled to 900-1100 L / h and the pressure to 0.04-0.06 MPa. After 15 hours of fermentation culture, material supply was started at a rate of 0.5-2.0 mL / L / h, with an aeration rate of 1400-1600 L / h, a pressure of 0.08-0.12 MPa, and a pH value of the fermentation liquid of 4.0-6.0. The fermentation culture temperature is 27°C to 29°C, the rotation speed is 100 to 450 rpm, the dissolved oxygen level is 20% to 50%, and the fermentation culture time is 68 to 76 hours. The material supplied at the time of the aforementioned material supply contains glucose at a concentration of 280-320 g / L and multivitamins at a concentration of 0.08-0.12 mg / L. The multivitamin contains components in parts by mass of vitamin B1 0.08 to 0.12 parts, vitamin B 12 0.08 to 0.12 parts, vitamin B2 0.08 to 0.12 parts, vitamin B3 0.08 to 0.12 parts, vitamin B5 0.08 to 0.12 parts, vitamin B6 0.08 to 0.12 parts, vitamin B9 0.08 to 0.12 parts, vitamin C 0.08 to 0.12 parts, and vitamin H 0.08 to 0.12 parts.

[0020] Preferably, when performing the fermentation culture using the secondary fermentation medium, the fermentation culture conditions are that the aeration rate is 900 to 1600 L / h, the pressure is controlled to 0.04 to 0.12 MPa, the pH value of the fermentation broth is 4.0 to 6.0, the fermentation culture temperature is 27°C to 29°C, the rotation speed is 100 to 450 rpm, the dissolved oxygen content is 20% to 50%, and the fermentation culture time is 72 to 480 hours, when the reducing sugar content in the fermentation system is less than 2 to 5 g / L, 20% to 90% by volume of the fermentation broth is discharged, and the secondary fermentation medium is added back to the original volume.

[0021] Preferably, the method for preparing the inoculum solution of Fusarium brachygibbosum is inoculating the Fusarium brachygibbosum into the primary inoculum medium, sequentially performing primary inoculum culture and secondary inoculum culture to obtain a secondary inoculum solution, and inoculating the secondary inoculum solution into the secondary inoculum medium and performing tertiary inoculum culture to obtain a tertiary inoculum solution.

[0022] Preferably, the first culture medium contains the following components: glucose 28-32 g / L, yeast extract powder 23-27 g / L, potassium dihydrogen phosphate 0.8-1.2 g / L, magnesium salt 17-21 mg / L (concentration calculated in Mg equivalent), and calcium salt 3-4 mg / L (concentration calculated in Ca equivalent); and the second culture medium contains starch 23-27 g / L, citric acid 0.8-1.2 g / L, potassium dihydrogen phosphate 0.8-1.2 g / L, and ammonium sulfate. It contains the following components: magnesium salts at 4.8-5.2 g / L (calculated using Mg equivalent), 17-21 mg / L (calculated using Ca equivalent), 0.003-0.004 g / L (calculated using Ca equivalent), 0.48-0.62 mg / L (calculated using Mn equivalent), 0.96-1.05 mg / L (calculated using Fe equivalent), 0.72-0.91 mg / L (calculated using Zn equivalent), and 0.44-0.54 mg / L (calculated using Co equivalent).

[0023] Preferably, the culture temperature for the primary, secondary, or tertiary inoculum culture is 25°C to 30°C. The incubation time for the primary, secondary, or tertiary inoculum culture is 22 to 26 hours. The rotation speed for the primary, secondary, or tertiary inoculation culture is 100-200 rpm. The aeration rate of the aforementioned tertiary inoculum culture is 8-12 L / min. The pressure for the tertiary inoculum culture was 0.04 to 0.06 MPa. The pH value of the aforementioned tertiary inoculum culture system is 4.0 to 6.0.

[0024] Preferably, the sterilization method for the fermentation liquid is heat sterilization. The aforementioned heat sterilization procedure involves maintaining a temperature of 60°C to 70°C for 18 to 22 minutes, and then raising the temperature to 88°C to 92°C and maintaining it for 8 to 15 minutes.

[0025] Preferably, the method for separating the fermentation product includes separating the solid phase and liquid phase of the fermentation liquid, washing the solid phase, and then drying it to obtain edible mycelium.

[0026] The present invention provides the application of edible mycelium or edible mycelium prepared by the method described above in the preparation of meat substitutes.

[0027] Preferably, the preparation method does not include structural processing. [Effects of the Invention]

[0028] This invention provides an application of Fusarium brachygibbosum in the production of mycelial protein, and for the first time develops the use of Fusarium brachygibbosum in the fermentation production of mycelial protein. Experiments have shown that Fusarium brachygibbosum is superior to other Fusarium fungi (such as Fusarium venenatum) in terms of fermentation production of mycelial protein content. Using the Kjeldahl method, a mycelial protein content of 55.39% or more was detected, and it also has the characteristics of being low in fat and high in dietary fiber, with a total fat content of 7.97% and a dietary fiber content of 26.01%. The produced mycelial protein does not contain toxins, making it an ideal alternative protein. In this invention, the mycelium produced by Fufusarium brachygibotum was found to have a high mycelial protein content, good morphology, and no toxic side effects. Therefore, this invention provides a new means for the industrial production of alternative proteins and simultaneously provides a basis for the development of safe foods. Furthermore, production based on fermentation methods can significantly improve protein production efficiency, reduce carbon emissions, and protect the environment.

[0029] The present invention also provides the Fusarium brachygibbosum strain FXFB001, with deposit number CGMCC No: 41066. The present invention isolated strain FXFB001 from a forest humus soil sample from the Tibet Autonomous Region, and morphological and molecular identification revealed that strain FXFB001 is Fusarium brachygibbosum. Initial screening showed that the strain produces pale yellow, filamentous, and elastic mycelium, with a protein content of 55.39% or higher as measured by the Kjeldahl method. The protein-rich mycelium produced by strain FXFB001 exhibits good filamentous growth upon fermentation culture, and the fermentation liquid has a natural flesh color without heating and is odorless. The Fusarium brachygibosum strain FXFB001 provided by this invention is found to have a significantly higher protein yield than other Fusarium strains currently reported, and the protein it produces is toxin-free, safe, and side-effect-free, naturally protein-rich microbial strain. Therefore, this invention provides a novel means for the industrial production of alternative proteins and, at the same time, provides a foundation for the development of safe foods. [Brief explanation of the drawing]

[0030] [Figure 1] This shows the colony morphology of strain FXFB001 isolated and purified in Example 1 of the present invention. [Figure 2] This is a phylogenetic tree of the bacterial strain FXFB001 constructed based on multiple genes in Example 1 of the present invention. [Figure 3] This is a fungal cake obtained by initial screening and culture of strain FXFB001 in Example 2 of the present invention. [Figure 4] This is a fermentation product obtained by fermentation culture of strain FXFB001 in Example 3 of the present invention. [Figure 5] This is the result of observing the protein-rich mycelium obtained by fermenting and culturing strain FXFB001 in Example 3 of the present invention under a microscope. [Modes for carrying out the invention]

[0031] [Cross-reference of related applications] This application was filed with the Chinese National Intellectual Property Office on 11 January 2024, claiming priority to the Chinese Patent Application No. 202410044012.8, titled "Application of Fusarium brachygibothum in the production of mycelial proteins," all of which are incorporated herein by reference.

[0032] Deposit information for biological materials The Fusarium brachygibbosum strain FXFB001 provided by this invention was deposited with the China General Microbiological Culture Collection Center (CGMCC) (CN) on December 13, 2023. The depositary's abbreviation is CGMCC, its address is the Institute of Microbiology, Chinese Academy of Sciences, No. 1, Beichen West Road, Chaoyang District, Beijing, and its deposit number is CGMCC No: 41066.

[0033] This invention provides the application of Fusarium brachygibbosum or its microbial inoculant in the production of mycelial proteins.

[0034] In the present invention, Fusarium brachygibotum includes a single Fusarium brachygibotum strain or a combination of multiple Fusarium brachygibotum strains. The present invention does not impose any special restrictions on Fusarium brachygibotum strains, and all strains identified taxonomically as Fusarium brachygibotum are included within the scope of protection of the present invention. For example, any strain having a TEF1 gene sequence with 95%, 96%, 97%, 98%, 99%, and 100% homology to SEQ ID NO:5 and an ITS1 gene sequence with 97%, 98%, 99%, and 100% homology to SEQ ID NO:6, such as Fusarium brachygibotum strain FXFB001. The deposit number for the Fusarium brachygibosum strain FXFB001 is CGMCC No: 41066, and it possesses excellent ability to produce protein-rich mycelium.

[0035] In the present invention, the production is preferably fermentation production. Fermentation production is a process of preparing microbial cells themselves, direct metabolites, or secondary metabolites by utilizing the life activities of microorganisms under aerobic or anaerobic conditions. In one embodiment of the present invention, the fermentation production is a process of growing Fusarium brachygibotum in large quantities under the conditions of nutrients provided by a fermentation medium to obtain protein-rich mycelium. The present invention is not particularly limited to the form of Fusarium brachygibotum, and any living form of Fusarium brachygibotum known in the art, including, for example, spore form and / or hyphae form, may be used.

[0036] This invention provides the Fusarium brachygibbosum strain FXFB001, with deposit number CGMCC No: 41066.

[0037] In this invention, the Fusarium brachygibosum strain FXFB001 was isolated and purified from a forest humus soil sample from Shannan City, Tibet Autonomous Region. Morphological identification revealed that the aerial hyphae growing on PSA medium were felt-like, initially white, gradually changing to pink, and the underside of the plate was orange-red to deep red. The conidial morphology was as follows: large conidia were sickle-shaped with slightly pointed ends, possessing 3-5 septa, and measuring 10.8-25.1 μm × 2.0-3.6 μm. Miniature conidia were spindle-shaped, slightly curved, with slightly flattened ends, and possessing 0-2 septa. Thick-walled spores were spherical and present alone within the hyphae, measuring 5.2-7.5 μm. Simultaneously, molecular identification based on the TEF1 and ITS sequences was performed. The results showed that the TEF1 sequence of strain FXFB001 had 99.84% homology with Fusarium brachygibbosum (NCBI: MK752485.1), and the ITS1 sequence of strain FXFB001 had 100% homology with Fusarium brachygibbosum (NCBI: GQ505450.1). A phylogenetic tree was constructed simultaneously, and it was shown that strain FXFB001 and Fusarium brachygibbosum were clustered on a single branch. Based on the morphological and molecular identification results, strain FXFB001 was classified as Fusarium brachygibbosum.

[0038] In one embodiment of the present invention, an initial screening was performed on the protein production characteristics of the strain FXFB001. The initial screening method preferably involves inoculating strain FXFB001 into a type 1 culture medium, performing constant temperature shaking culture, separating the solid phase culture product, drying it, and measuring the crude protein content. The type 1 culture medium preferably contains components in the following amounts: glucose 28-32 g / L, yeast extract powder 23-27 g / L, potassium dihydrogen phosphate 0.8-1.2 g / L, magnesium sulfate heptahydrate 0.18-0.22 g / L, and calcium chloride 0.009-0.011 g / L, and more preferably contains components in the following amounts: glucose 30 g / L, yeast extract powder 27 g / L, potassium dihydrogen phosphate 1.0 g / L, magnesium sulfate heptahydrate 0.2 g / L, and calcium chloride 0.01 g / L. The temperature of the constant temperature shaking culture is preferably 25-30°C, more preferably 28°C. The duration of the constant-temperature shaking culture is preferably 45 to 50 hours, more preferably 48 hours. The rotation speed of the constant-temperature shaking culture is preferably 180 to 220 rpm, more preferably 200 rpm. The method for separating the solid-phase culture is preferably suction filtration using a vacuum suction filtration device, and the filtration cake is thoroughly washed. The drying is preferably oven drying. The oven drying temperature is preferably 55°C to 65°C, more preferably 60°C. The protein-rich mycelium prepared by fermentation using strain FXFB001 has a filamentous mycelial form and a pale yellow filtration cake color, the filtration cake is elastic, and the dry weight biomass percentage is 0.63%. The protein content measured by the Kjeldahl method is 55.39% or more.

[0039] The present invention provides a microbial inoculant for producing mycelial proteins, comprising the Fusarium brachygibosum strain FXFB001 and auxiliary materials.

[0040] In the present invention, the mass ratio of Fusarium brachygibosum strain FXFB001 to the auxiliary material is preferably 1 to 10:1 to 100, more preferably 1 to 10:5 to 80, and even more preferably 1:10 to 50. The type of auxiliary material varies depending on the dosage form of the microbial inoculant.

[0041] In the present invention, the microbial inoculant preferably comprises a freeze-dried powder or an aqueous solution. The method for preparing the aqueous microbial inoculant preferably comprises preparing a spawn solution of Fusarium brachygibosum strain FXFB001 and preparing the aqueous solution. The method for preparing the freeze-dried powder microbial inoculant preferably comprises preparing a spawn solution of Fusarium brachygibosum strain FXFB001 and freeze-drying it.

[0042] In one embodiment of the present invention, a method for preparing a microbial inoculant seed solution of the Fusarium brachygibosum strain FXFB001 preferably includes the steps of: inoculating the activated strain FXFB001 into a first medium to perform primary seed culture to obtain a primary seed solution; inoculating the primary seed solution again into the first medium to perform secondary seed culture to obtain a secondary seed solution; and inoculating the secondary seed solution into a second medium to perform tertiary seed culture to obtain a tertiary seed solution.

[0043] In the present invention, the culture uses an artificially prepared culture medium and artificially created culture conditions (such as culture temperature) so that a certain (species) of microorganism can grow and reproduce rapidly. The first type culture medium contains components with the following concentrations: glucose 28-32 g / L, yeast extract powder 23-27 g / L, potassium dihydrogen phosphate 0.8-1.2 g / L, magnesium salt 17-21 mg / L (concentration calculated in Mg equivalent), and calcium salt 3-4 mg / L (concentration calculated in Ca equivalent). More preferably, it contains components with the following concentrations: glucose 30 g / L, yeast extract powder 25 g / L, potassium dihydrogen phosphate 1.0 g / L, magnesium salt 19 mg / L (concentration calculated in Mg equivalent), and calcium salt 3.5 mg / L (concentration calculated in Ca equivalent). The aforementioned Type 2 bacterial culture medium contains the following components: 23-27 g / L of starch, 0.8-1.2 g / L of citric acid, 0.8-1.2 g / L of potassium dihydrogen phosphate, 4.8-5.2 g / L of ammonium sulfate, 17-21 mg / L of magnesium salt (concentration calculated in Mg equivalent), 3-4 mg / L of calcium salt (concentration calculated in Ca equivalent), 0.48-0.62 mg / L of manganese salt (concentration calculated in Mn equivalent), 0.96-1.05 mg / L of iron salt or ferrous salt (concentration calculated in Fe equivalent), 0.72-0.91 mg / L of zinc salt (concentration calculated in Zn equivalent), and 0.44-0.54 mg / L of cobalt salt (concentration calculated in Co equivalent), more preferably 25 g / L of starch, 1 g / L of citric acid, 1 g / L of potassium dihydrogen phosphate, 5 g / L of ammonium sulfate, and magnesium salt (concentration calculated in Mg equivalent). The present invention contains components with the following concentrations: 19 mg / L of calcium salt (calculated on a Ca basis), 3.5 mg / L of manganese salt (calculated on a Mn basis), 0.56 mg / L of iron salt or ferrous salt (calculated on a Fe basis), 1 mg / L of zinc salt (calculated on a Zn basis), and 0.49 mg / L of cobalt salt (calculated on a Co basis). The present invention has no particular restrictions on the type of starch, and any starch known in the art, such as sweet potato starch, corn starch, cassava starch, or potato starch, may be used.In the present invention, the forms in which the calcium salt, cobalt salt, and zinc salt exist are not particularly limited, and any form of each metal salt known in the art may be used. For example, the calcium salt exists in one or more forms from among calcium chloride, calcium sulfate, calcium bicarbonate, etc., the cobalt salt preferably exists in the form of cobalt chloride, and the zinc salt exists in one or two forms from among zinc chloride, zinc sulfate, etc. The magnesium salt preferably includes one or more from among magnesium sulfate, magnesium chloride, magnesium nitrate, etc. The manganese salt preferably includes one or more from among manganese sulfate, manganese chloride, potassium permanganate, potassium manganate, etc. In the present invention, there are no particular restrictions on the source of the components of the fermentation medium, and any source of components known in the art may be used. In the present invention, there are no particular restrictions on the method of preparing the first culture medium and the second culture medium, and any method of preparing microbial culture media well known in the art may be used. After preparation is complete, the culture medium is preferably sterilized. The sterilization method is preferably autoclaving. In the embodiments of the present invention, the culture medium for the first strain of bacteria preferably contains components in the following amounts: glucose 28-32 g / L, yeast extract powder 23-27 g / L, potassium dihydrogen phosphate 0.8-1.2 g / L, magnesium sulfate heptahydrate 0.18-0.22 g / L, and calcium chloride 0.003-0.004 g / L, and more preferably contains components in the following amounts: glucose 30 g / L, yeast extract powder 25 g / L, potassium dihydrogen phosphate 1.0 g / L, magnesium sulfate heptahydrate 0.2 g / L, and calcium chloride 0.005 g / L.The aforementioned Type 2 bacterial culture medium contains the following components: starch 23-27 g / L, citric acid 0.8-1.2 g / L, potassium dihydrogen phosphate 0.8-1.2 g / L, ammonium sulfate 4.8-5.2 g / L, magnesium sulfate heptahydrate 0.18-0.22 g / L, calcium salt 0.003-0.004 g / L, manganese sulfate monohydrate 1.5-1.9 mg / L, ferrous sulfate heptahydrate 4.8-5.2 mg / L, zinc chloride 0.72-0.91 mg / L, and cobalt chloride 0.44-0.54 mg / L. More preferably, it contains starch 25 g / L, citric acid 1.0 g / L, potassium dihydrogen phosphate 1.0 g / L, ammonium sulfate 5.0 g / L, magnesium sulfate heptahydrate 0.017-0.021 g / L, and calcium chloride. The culture medium contains the following components: 0.01 g / L of manganese sulfate monohydrate, 1.5 mg / L of ferrous sulfate heptahydrate, 1.9-2.0 mg / L of zinc sulfate, and 1.8-2.2 mg / L of cobalt chloride. In the examples of the present invention, when preparing each culture medium, the error in the measurement of each drug and reagent shall not exceed 10%. The culture temperature for the primary, secondary, or tertiary inoculum culture is preferably 25°C to 30°C, more preferably 28°C. The culture time for the primary and secondary or tertiary inoculum culture is preferably 22-26 hours, more preferably 24 hours. The primary and secondary or tertiary inoculum culture is preferably completed in the culture bottle. The rotation speed for the primary and secondary inoculum culture is preferably 180-220 rpm, more preferably 200 rpm. The inoculation amount for the secondary inoculum culture is preferably 4% to 6%, more preferably 5%. The rotation speed for the tertiary inoculum culture is preferably 100 to 220 rpm, more preferably 150 rpm. During the culture period, the culture bottles are preferably placed on a vibrating table and subjected to shaking culture. In the tertiary inoculum culture, the inoculation amount is preferably 5% to 10%, more preferably 8%. In the present invention, there are no special restrictions on the method of inoculating the inoculum solution; for example, any inoculation method known in the art, such as transferring a small amount of culture solution to the corresponding medium using a sterile pipette under sterile conditions, may be used. The aeration rate for the tertiary inoculum culture is preferably 8 to 12 L / min, more preferably 10 L / min.The pressure of the tertiary inoculum culture is preferably 0.04 to 0.06 MPa, more preferably 0.05 MPa. The pH value of the tertiary inoculum culture system is preferably 4.0 to 6.0, more preferably 5.0. The tertiary inoculum culture is preferably carried out in a culture tank equipped with a pressure valve. The present invention does not impose any special restrictions on the specifications or brand of the culture tank, and any culture tank well known in the art may be used.

[0044] In the present invention, when preparing a microbial inoculant, spores are separated from the tertiary seed solution, and the separated spores are mixed with an aqueous solvent or a freeze-dried protective agent to prepare an aqueous solution or a freeze-dried powder. The method for separating molecular spores is preferably centrifugation. In the present invention, the type of auxiliary material for the aqueous solution is not particularly limited, and any type of auxiliary material for aqueous solutions that is well known in the art, such as a culture medium, may be used. In the aqueous microbial inoculant, the number of effective spores of the strain FXFB001 is (1 to 100) × 10⁻⁶. 7 / mL, more preferably 5×10 7 The concentration is / mL. In the aqueous formulation, which is a microbial inoculant, the number of effective spores of the strain FXFB001 is (1~100) × 10 7 / g, more preferably (1~100) × 10 7 It is / g.

[0045] This invention provides a method for producing edible mycelium using Fusarium brachygibosum. The steps include: inoculating a fermentation medium with a prepared inoculum of Fusarium brachygibosum or its microbial inoculum, fermenting and culturing it to obtain a fermented liquid; The step of sterilizing the fermentation liquid and then separating the fermentation product to obtain edible mycelium is included. The Fusarium brachygibotum described above is the Fusarium brachygibotum in the application described in the technical solution above.

[0046] In the present invention, the method for preparing the inoculum solution prepared by Fusarium brachygibotum is the same as described above, so a detailed explanation is omitted here.

[0047] In the present invention, fermentation is a process of preparing microbial cells themselves, or direct metabolites or secondary metabolites, by utilizing the life activities of microorganisms under aerobic or anaerobic conditions. Fermentation generally refers to a specific decomposition process of organic matter by living organisms. Fusarium brachygibotum fermentation is a process in which Fusarium brachygibotum is used to decompose and utilize the nutrients in a fermentation medium, allowing it to continuously grow and form a large amount of mycelium. The composition of the fermentation medium includes a nitrogen source, a carbon source, inorganic salts, and water. The fermentation medium includes a first fermentation medium and / or a second fermentation medium. The aforementioned first fermentation medium preferably contains 23-27 g / L of starch, 0.8-1.2 g / L of citric acid, 0.8-1.2 g / L of potassium dihydrogen phosphate, 4.5-5.5 g / L of ammonium sulfate, 17-21 mg / L of magnesium salt (concentration calculated in Mg equivalent), 2.8-43 mg / L of calcium salt (concentration calculated in Ca equivalent), 0.48-0.62 mg / L of manganese salt (concentration calculated in Mn equivalent), 0.96-1.05 mg / L of iron salt or ferrous salt (concentration calculated in Fe equivalent), 0.72-0.91 mg / L of zinc salt (concentration calculated in Zn equivalent), 0.44-0.54 mg / L of cobalt salt (concentration calculated in Co equivalent), and 0.08-0.12 mg / L of multivitamins. More preferably, it contains 25 g / L of starch, 1 g / L of citric acid, 1 g / L of potassium dihydrogen phosphate, and ammonium sulfate. The medium contains the following components: 5 g / L of magnesium salt (concentration calculated in Mg equivalent), 19 mg / L of calcium salt (concentration calculated in Ca equivalent), 25 mg / L of manganese salt (concentration calculated in Mn equivalent), 0.54 mg / L of iron salt or ferrous salt (concentration calculated in Fe equivalent), 1 mg / L of zinc salt (concentration calculated in Zn equivalent), 0.81 mg / L of cobalt salt (concentration calculated in Co equivalent), and 0.1 mg / L of multivitamins. The second fermentation medium preferably contains glucose at a concentration of 15-60 kg / m³. 3 K2SO4 0.5~1.5kg / m 3 H3PO4 0.4~0.8 kg / m 3 Calculate the concentration of magnesium salts in Mg equivalent: 9.75~58.5 g / m³ 3 Calculate the concentration of zinc salt in Zn equivalent: 2.2~22.5 g / m³ 3Calculate the concentration of manganese salts in Mn equivalent: 2.46~9.85 g / m³ 3 Calcium acetate 0.1~0.3 kg / m 3 and defoaming agent 0.08~0.12 kg / m 3 It contains ingredients with the following content, and more preferably glucose 25-55 kg / m³ 3 K2SO4 0.8~1.3kg / m 3 H3PO4 0.5~0.7 kg / m 3 Calculate the concentration of magnesium salts in Mg equivalent: 12.5~50.5 g / m³ 3 Calculate the concentration of zinc salts in Zn equivalent: 4.5~20.5 g / m³ 3 Calculate the concentration of manganese salt in Mn equivalent: 5.2~7.5 g / m³ 3 Calcium acetate 0.15~0.25 kg / m 3 and defoaming agent 0.1 kg / m 3 It contains the following amount of ingredients.

[0048] The present invention does not have any particular restrictions on the type of starch, and any starch known in the art, such as sweet potato starch, corn starch, cassava starch, or potato starch, may be used. In the present invention, the forms in which calcium salts, cobalt salts, and zinc salts exist are not particularly limited, and any form of each metal salt known in the art may be used. For example, calcium salts exist in one or more forms from among calcium chloride, calcium sulfate, calcium bicarbonate, etc., cobalt salts preferably exist in the form of cobalt chloride, and zinc salts exist in one or two forms from among zinc chloride, zinc sulfate, etc. The magnesium salts preferably include one or more from among magnesium sulfate, magnesium chloride, and magnesium nitrate, etc. The iron salts or ferrous salts whose concentration is calculated in terms of Fe preferably include one or more from among ferrous sulfate heptahydrate, ferric chloride, or ferrous chloride, etc. The manganese salts preferably include one or more from among magnesium sulfate, manganese chloride, potassium permanganate, potassium manganese, etc. In the present invention, there are no particular restrictions on the source of the components of the fermentation medium, and any source of components that is well known in the art may be used.

[0049] In the embodiments of the present invention, the first fermentation medium preferably contains the following components: 23-27 g / L of starch, 0.8-1.2 g / L of citric acid, 0.8-1.2 g / L of potassium dihydrogen phosphate, 4.5-5.5 g / L of ammonium sulfate, 0.18-0.22 g / L of magnesium sulfate heptahydrate, 0.008-0.012 g / L of calcium chloride, 1.5-1.9 mg / L of manganese sulfate monohydrate, 4.5-5.5 mg / L of ferrous sulfate heptahydrate, 1.8-2.2 mg / L of zinc chloride, 1.8-2.2 mg / L of cobalt chloride, and 0.08-0.12 mg / L of multivitamins. More preferably, it contains 25 g / L of starch, 1.0 g / L of citric acid, 1.0 g / L of potassium dihydrogen phosphate, 5.0 g / L of ammonium sulfate, and magnesium sulfate heptahydrate. The medium contains the following components: 0.2 g / L of glycerin, 0.0034 g / L of calcium salt, 1.7 mg / L of manganese sulfate monohydrate, 5.0 mg / L of ferrous sulfate heptahydrate, 0.8 mg / L of zinc salt, 0.5 mg / L of cobalt chloride, and 0.1 mg / L of multivitamins. In the examples of the present invention, the second fermentation medium is preferably 35 kg / m³ of glucose. 3 K2SO4 1.0 kg / m 3 H3PO4 0.6 kg / m³ 3 Magnesium sulfate heptahydrate 0.25 kg / m 3 , zinc sulfate heptahydrate 0.05g / m 3 Manganese sulfate tetrahydrate 0.03 g / m³ 3 Calcium acetate 0.1~0.3 kg / m 3 and defoaming agent 0.1 kg / m 3 It contains the following amount of ingredients.

[0050] In the present invention, there are no particular restrictions on the method of preparing the fermentation medium, and any preparation method well known in the art may be used. After preparation is complete, the fermentation medium is preferably sterilized. In the present invention, there are no particular restrictions on the method of sterilizing the fermentation medium, and any sterilization method well known in the art, such as autoclaving, may be used. After sterilization is complete, the fermentation medium is left at room temperature and inoculated under sterile conditions. In the present invention, there are no particular restrictions on the inoculation method, and any inoculation method well known in the art may be used, for example, accurately measuring a certain amount of starter culture using a sterile container in a sterile environment, transferring it to the fermentation medium, and mixing it uniformly. The fermentation is preferably completed in a fermentation tank equipped with a pressure valve. In the present invention, there are no particular restrictions on the specifications or brand of the fermentation tank, and any fermentation tank well known in the art may be used.

[0051] In this invention, in addition to the fermentation medium that affects the fermentation process and results, fermentation conditions are also important factors that affect the fermentation results. For example, temperature, fermentation time, system pH, dissolved oxygen, rotation speed, pressure, timing and amount of material supply all affect the fermentation results. When fermentation is carried out using the first fermentation medium, the fermentation culture conditions are preferably such that during the first 15 hours of fermentation culture, the aeration rate is controlled to 900-1100 L / h and the pressure to 0.04-0.06 MPa, after 15 hours of fermentation culture, material supply is started at a rate of 0.5-2.0 mL / L / h, the aeration rate is 1400-1600 L / h, the pressure is 0.08-0.12 MPa, the pH value of the fermentation liquid is 4.0-6.0, the fermentation culture temperature is 27°C-29°C, the rotation speed is 100-450 rpm, and the dissolved oxygen The material content is 20% to 50%, and the fermentation culture time is 68 to 76 hours. More preferably, during the first 15 hours of fermentation culture, the aeration rate is controlled to 1000 L / h and the pressure to 0.05 MPa. After 15 hours of fermentation culture, material supply is started at a rate of 1.2 mL / L / h, with an aeration rate of 1500 L / h, a pressure of 0.1 MPa, a pH of fermentation liquid of 5.0, a fermentation culture temperature of 28°C, a rotation speed of 280 rpm, a dissolved oxygen content of 35%, and a fermentation culture time of 72 hours. The material supply rate refers to the volume of material supplied medium added per liter of medium per hour. When the fermentation culture is performed using the first fermentation medium, the material supplied components at the time of material supply include glucose 280 to 320 g / L and multivitamins 0.08 to 0.12 mg / L, more preferably glucose 300 g / L and multivitamins 0.1 mg / L. The aforementioned multivitamin contains 0.08 to 0.12 parts of vitamin B1, and vitamin B 12 The mixture contains parts by mass of 0.08-0.12 parts of vitamin B2, 0.08-0.12 parts of vitamin B3, 0.08-0.12 parts of vitamin B5, 0.08-0.12 parts of vitamin B6, 0.08-0.12 parts of vitamin B9, 0.08-0.12 parts of vitamin C, and 0.08-0.12 parts of vitamin H. Adding the multivitamins during the fermentation process improves the elasticity and toughness of the mycelium. The present invention is not particularly limited to the source of vitamins in the fermentation medium, and any commercially available vitamin sources known in the art may be used.

[0052] In the present invention, when the fermentation culture is performed using the second fermentation medium, the fermentation culture conditions are controlled to an aeration rate of 900 to 1600 L / h, a pressure of 0.04 to 0.12 MPa, a pH value of the fermentation liquid of 4.0 to 6.0, a fermentation culture temperature of 27°C to 29°C, a rotation speed of 100 to 450 rpm, a dissolved oxygen content of 20% to 50%, and a fermentation culture time of 72 to 480 hours. More preferably, the aeration rate is controlled to 1000 to 1400 L / h, the pressure of 0.05 to 0.1 MPa, a pH value of the fermentation liquid of 5.0, a fermentation culture temperature of 28°C, a rotation speed of 280 rpm, and a dissolved oxygen content of 35%. During the fermentation culture period, if the reducing sugar in the fermentation system is less than 2 to 5 g / L or 3 to 4 g / L, 20% to 90% of the volume fraction of the fermentation liquid is discharged, and the second fermentation medium is added to the original volume. The volume of the discharged fermentation liquid is preferably 30% to 80%, more preferably 40% to 70%, and most preferably 50% of the original volume of fermentation liquid. Adding the second fermentation medium to the original volume is preferably completed within 10 to 30 minutes, and preferably within 20 minutes, when the material supply is completed. During the fermentation period, when the reducing sugar level falls below 2 to 5 g / L, material supply is started, and the material supply operation can be repeated multiple times.

[0053] In the present invention, after the completion of fermentation, the fermentation liquid is preferably sterilized. Sterilization of the fermentation liquid is beneficial for inactivating live bacteria in the fermentation liquid and at the same time further decomposes nucleic acid molecules produced during the fermentation process, reducing the nucleic acid content of the mycelium obtained by fermentation, which is convenient for subsequent processing and application. The sterilization method for the fermentation liquid is preferably heat sterilization. The heat sterilization procedure is preferably to maintain a temperature of 60°C to 70°C for 18 to 22 minutes, and then maintain at 88°C to 92°C for 8 to 15 minutes, more preferably to maintain at 65°C for 20 minutes and then at 90°C for 12 minutes.

[0054] In the present invention, the fermentation product is separated after sterilization. The preferred method for separating the fermentation product is to separate the solid phase and liquid phase of the fermentation liquid, wash the solid phase, and then dry it. The solid-liquid separation method includes filtration or centrifugation. In one embodiment of the present invention, the preferred method for separating the fermentation product is to use a vacuum suction filtration device to perform suction filtration and thoroughly wash the filtered cake. After solid-liquid separation, the solid phase is recovered and washed with purified water. The number of washes is preferably 1 to 3 times, more preferably 2 times. The drying is preferably oven drying. The oven drying temperature is preferably 55°C to 65°C, more preferably 60°C. When the filtered cake is observed, the mycelial morphology is in good condition and filamentous, the color of the filtered cake is pale yellow, the filtered cake is elastic, and the dry weight biomass percentage is 0.63% or more. The protein content measured by the Kjeldahl method is 55.39% or more. After toxin testing, the filtered cake did not contain toxins. At the same time, the mycelium produced by the Fusarium brachygibotum strain FXFB001 is toxin-free and possesses excellent mycelial properties, being rich in protein. Therefore, the present invention provides the application of the Fusarium brachygibotum strain FXFB001 or the microbial inoculant in the production of mycelial protein.

[0055] The present invention provides edible mycelium, wherein, based on the dry mass of the edible mycelium, the protein content is 40% or more, and / or the dietary fiber content is 20% or more, and / or the fat content is 8% or less, and the edible mycelium is derived from Fusarium brachygibbosum, for example, edible mycelium can be obtained by fermentation of Fusarium brachygibbosum.

[0056] In the present invention, the protein content of the edible mycelium is preferably 45%, 50%, 55%, 60%, or 65% or more. The dietary fiber content of the edible mycelium is preferably 25%, 30%, 35%, 40%, or 45% or more. The fat content of the edible mycelium is preferably 7%, 6%, 5%, 4%, or 3% or less.

[0057] In the present invention, the edible mycelium is preferably derived from the Fusarium brachygibbosum strain with deposit number CGMCC No: 41066. By adding the multivitamins during the fermentation and cultivation process of the edible mycelium, the elasticity and toughness of the mycelium are improved.

[0058] In the present invention, the fermentation method is the same as the method for producing edible mycelium using Fusarium brachygibosum described in the technical solution above. The edible mycelium prepared by fermentation is preferably filamentous in appearance, flesh-colored, and elastic. Physical and chemical tests have shown that the protein-rich mycelium does not contain toxins and has good properties that make it safe to eat.

[0059] Since the edible mycelium is rich in protein, it can be used in industrial production as a raw material for alternative proteins. The present invention provides applications of the edible mycelium or edible mycelium prepared by the above method in the preparation of meat substitutes.

[0060] In the present invention, the meat substitute refers to a type of processed edible mycelium, such as a nutritional food or health food, that is produced without structurally processing the edible mycelium. The structural processing preferably includes shearing.

[0061] In the present invention, a method for producing meat substitutes uses protein-rich edible mycelium as a raw material for producing various products by processing or deep processing it. A method for producing nutritional foods from the protein-rich mycelium preferably includes using the protein-rich mycelium as is, or extracting higher-purity protein and using other auxiliary materials to produce nutritional foods. Because the mycelium is highly elastic and tough, and its abundant protein contains various essential amino acids, the nutritional value of the produced food can be greatly increased. The food is preferably provided in the form of a nutritional supplement. Similarly, the food can be compounded to enhance its flavor or combined with common foods to make it more appealing to consumers. In certain embodiments, the compositions of the present invention are produced as milk-based products or meat-based products. In one embodiment of the present invention, edible mycelium obtained by fermentation is used to produce ham and sausages in place of meat raw materials (such as pork, beef, chicken, fish, lamb, rabbit, or donkey meat). The term "milk-based product" means any liquid or semi-solid milk or whey-based product containing varying fat content. Milk-based products include, for example, cow's milk, goat's milk, sheep's milk, skim milk, whole milk, powdered milk and milk reconstituted without any processing of whey, or processed products such as fermented milk, curd, yogurt, acidified whole milk, buttermilk and other yogurt products. Another important group includes milk beverages such as whey drinks, fermented milk, condensed milk, infant or toddler formula, and milk-containing foods such as flavored milk, ice cream, and sugar.

[0062] In the present invention, a method for producing a health food from the protein-rich mycelium preferably includes using the protein-rich mycelium as is, extracting higher-purity proteins, or producing the health food using other active ingredients and auxiliary materials. The health food contains an acceptable excipient or carrier. Carriers or diluents acceptable for health use are well known in the field of health foods. For example, the carrier preferably comprises one or more of the following: lactose, starch, glucose, methylcellulose, magnesium stearate, mannitol, sorbitol, or analogs thereof. The diluent preferably comprises ethanol, glycerol, and water or other solvents. The choice of pharmaceutical carrier, excipient, or diluent can be made considering the intended route of administration and standard pharmaceutical / health food practices. In addition to the carrier, excipient, or diluent, the health food may contain any suitable adhesive, lubricant, suspending agent, coating agent, or solubilizer. The adhesives include starch, gelatin, and natural sugars such as glucose, anhydrous lactose, free-flowing lactose, and β-lactose, as well as natural and synthetic gums such as corn syrup, gum arabic, tragacanth gum or sodium alginate, methylcellulose carboxylate, and polyethylene glycol. The lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, and sodium chloride. Preservatives, stabilizers, dyes, and even flavorings may be included in the health foods. Preservatives include sodium benzoate, sorbic acid, cysteine, and paraben esters. Antioxidants and suspending agents may also be used. Another example of a suitable carrier is sucrose. Another example of a preservative is cysteine.

[0063] When used in the claims and / or specification in combination with the term "including," the terms "a" or "an" may refer to "one," but may also refer to "one or more," "at least one," and "one or more."

[0064] As used in the claims and specification, the terms “includes,” “has,” “contains,” or “contains” are inclusive or open and do not exclude any additional undescribed elements or steps of the method.

[0065] The disclosed information supports the definitions of the terms “or” as “substitutes only” and “and / or,” but unless explicitly stated as “substitutes only” or the substitutes are mutually exclusive, the term “or” in the claims means “and / or.”

[0066] When used in the claims or specification, the selected / optional / preferred “numerical range” includes not only the numerical endpoints at both ends of the range, but also all natural numbers covered by the aforementioned numerical endpoints compared to the aforementioned numerical endpoints.

[0067] "Edible mycelium" refers to a fermented fungal culture or concentrate, or an edible mycelial concentrate obtained by further dehydrating and removing nucleic acids from a fermented fungal culture. Depending on the water content of the dehydrated concentrate, the edible mycelium may be in a solid state or a mixture of solid and liquid.

[0068] "Mycelium" refers to the vegetative growth portion of a fungus, consisting of hyphae, and is an important source of fungal protein production. In this disclosure, the mycelium is a fungus derived from the genus Fusarium, and edible mycelium is obtained after fungal fermentation. In some embodiments, the edible mycelium is derived from a fermented culture of a single species of fungus. In some embodiments, the edible mycelium is derived from a fermented culture of multiple species of fungi.

[0069] The application of Fusarium brachygibotum in the production of mycelial proteins provided by the present invention will be described in detail below with reference to examples, but these should not be understood as limiting the scope of protection of the present invention.

[0070] Example 1 Isolation and screening method for Fusarium brachygibosum strain FXFB001 1. Source of bacterial strains 1.1 Sample Collection: Strain FXFB001 was collected in June 2018 from a forest humus sample in Shannan City, Tibet Autonomous Region.

[0071] 1.2 Separation process: A forest humus soil sample was homogenously mixed, 5 g was weighed out, and placed in an Erlenmeyer flask containing 45 mL of sterile 0.7% sodium carboxymethylcellulose solution and 15 glass beads. The flask was shaken at 30°C and 150 rpm for 30 minutes. 1 mL of the soil suspension was taken and diluted with sterile water for 10 minutes. -1 , 10 -2 , 10 -3 Dilute with a series of concentration gradients, then 10 -2 and 10 -3 Dilutions of the two concentrations were taken and spread onto MGA 2.5 plates (containing chloramphenicol and tetracycline hydrochloride) at a rate of 100 μL / dish, ensuring uniform distribution. After the plate surface dried, the plates were inverted and incubated at 28°C for 2-7 days. The MGA 2.5 medium contained 15 g / L of peptone, 1.0 g of KH2PO4, 0.5 g of MgSO4·7H2O, 0.0025 g of malachite green oxalate, 20 g of agar, and 1 L of distilled water.

[0072] 1.3 Purification process: The mycelium was purified using a stepwise hyphal end transplantation method. After colonies formed on a plate, the mycelium from the end of a single colony was collected and placed on malt extract agar / wort agar medium (MEA, purchased from Beijing Aoboying Biotechnology Co., Ltd.). The culture was kept at 28°C until pure colonies were obtained, and the resulting colonies were stored at -80°C and named strain FXFB001.

[0073] 2. Identification of the bacterial strain 2.1 Morphological characteristics of strain FXFB001 Strain FXFB001 was inoculated into MEA medium and cultured at 28°C for 4 days. The shape of the hyphae, the color of the colonies, the number and shape of the microconidia and macroconidia, the spore-forming cells, the shape and presence or absence of chlamydospores, and the type of fruiting body were described according to the growth rate, and the strain was identified. Culture characteristics: Colony diameter reached 3.8 cm in 4 days. The aerial hyphae growing on PSA medium were felt-like, initially white, gradually changing to pink, and the underside of the plate turned from orange-red to deep red (see Figure 1). Morphological characteristics: Conidia: Large conidia were sickle-shaped with slightly pointed ends, possessed 3-5 septa, and measured 10.8-25.1 μm × 2.0-3.6 μm. Miniature conidia were spindle-shaped, slightly curved, with slightly flattened ends, and possessed 0-2 septa. Thick-walled spores were spherical and present alone within the hyphae, measuring 5.2-7.5 μm.

[0074] 2.2 Molecular Biological Identification of Strain FXFB001 2.2.1 TEF1 and ITS Sequence Analysis 1. Preparation of DNA template An appropriate amount of mycelium from the fungal strain was collected in a PCR tube containing 50 μL of lysis solution, placed in a PCR instrument (Toshō ETC811), heated at 95°C for 30 minutes, then transferred to -20°C and frozen for 15 minutes. After removal, the tube was placed in a centrifuge (SIGMA 3K15) at 3000 rpm for 2 minutes to allow cell debris and lysis solution to settle at the bottom of the PCR tube. Simultaneously, the supernatant was basically clear, and the fungal genetic material was dissolved in the supernatant.

[0075] 2. Preparation of the PCR system A 25 μL PCR system was prepared: 2 μL supernatant, 8.8 μL ultrapure sterile water, 12 μL 2× PCR mix, 1 μL DMSO, 0.6 μL 10 μmol / L upstream primer, and 0.6 μL 10 μmol / L downstream primer. The primer sequences are shown in Table 1.

[0076] Table 1. Amplification primer sequences of two genes [Table 1]

[0077] 3. PCR amplification 2 μL of supernatant and the prepared PCR system were added to a PCR tube and placed in a PCR instrument (Dongsheng ETC811) for PCR amplification. The PCR reaction conditions are shown in the table below. After amplification was complete, the PCR product was sent to Beijing Jingke Biotechnology Co., Ltd. for sequencing using a sequencer (abi3730XL).

[0078] The PCR reaction conditions are as follows: TEF1: Pre-denaturation at 94°C for 3 minutes, denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, amplification at 72°C for 34 cycles for 1 minute, and retention at 72°C for 5 minutes. ITS1: Pre-denaturation at 94°C for 2.5 minutes, denaturation at 95°C for 30 seconds, annealing at 52°C for 30 seconds, amplification at 72°C for 30 cycles for 1 minute, and retention at 72°C for 5 minutes.

[0079] 4. The PCR product was sequenced, and the sequence of the obtained PCR product is as follows: TEF1 array: GACTCTGGCAAGTCGACCACTGTAAGTACCACCAAGCCTCGACCCCGCCTAGATTTGGTGGGGTAGTCTCAAGATTCATCCATACTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTCCCTCGATCGCGCGCCCTTTTACCCATCGATCCATCATTCGACTCGCTCTCTCACGACGACTCGATCCGCGCCCGTTACCCCGCTCGAGCTCAAAAATTTTGCGAATCAATCGTAATTTTTTTCTTGATGGGGCTCATACCCCGCCACTCGAGTGACGGGCGCGCTTGCCCTCTTCCCACAGTCATATTCATATGGGCGCGCATCATCACGTGTCTACCAGTCACTAACCACTTGACAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGCTGTCACCGTTGCCTTCATCACATCCTCATACTAACACGTCCACCAGAC(SEQ ID NO:5).

[0080] ITS1 sequence: The two gene sequences were compared using the NBCI online comparison system (Blast), with the comparison database being the Nucleotide collection (nr / nt). The most similar comparison results for the two genes are shown in Table 2.

[0081] Table 2 Comparison results of the two gene sequences of the aforementioned strains [Table 2]

[0082] The TEF1 and ITS1 gene sequences of all FSAMSC strains were collected from the FUSARIOID-ID database (www.fusarium.org), and the evolutionary position of the current strains was analyzed by constructing a multiple gene phylogenetic tree.

[0083] The procedure for analyzing the multiple gene phylogenetic tree is as follows: First, multiple sequence comparisons of each gene were performed individually using MAFFT (version v7.310). Next, the multiple sequence comparison result file was trimmed using GBLOCKS (version 0.91b). Then, the trimming was done manually using AliView. After trimming, the sequences of the two genes were spliced ​​consecutively, and a multiple gene phylogenetic tree of the spliced ​​sequences was constructed using IQ-TREE (version 2.2.5), which is shown in Figure 2.

[0084] Based on morphological characteristics and analysis of ITS1 and TEF1 sequences, strain FXFB001 was identified as Fusarium brachygibbosum. This strain was deposited with the China General Microbiological Culture Collection Center on December 13, 2023, under deposit number CGMCC No: 41066.

[0085] Example 2 Initial screening experiment of mycelial protein-producing strains 1 Preparation method of mycelial protein by initial screening The strain FXFB001 isolated and identified in Example 1 and other microbial strains isolated in the same batch as the strain FXFB001 were respectively inoculated into 250 mL Erlenmeyer flasks containing 50 mL of initial screening medium, and cultured with shaking at a constant temperature of 200 rpm for 48 hours. The formulation of the initial screening medium was 30 g / L glucose, 30 g / L yeast extract powder, 1 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, and 0.2 g / L CaCl2, and it was sterilized by high-pressure steam at 121 °C for 20 minutes. The filter cake was suction-filtered using a vacuum suction filtration device, washed thoroughly, placed in an electric blast drying oven, and oven-dried at 60 °C. The mass of the dried filter cake was accurately measured, the biomass concentration was calculated, and then, referring to <<National Food Safety Standard for the Determination of Protein in Foods GB 5009.5-2016>>, the Kjeldahl method was used to measure the crude protein of the mycelium.

[0086] 2 The results of preparing mycelium by initial screening are shown in Table 3.

[0087] Table 3 List of the states of mycelium produced by strains through initial screening

Table 3

[0088] Strain number 41 is identified as strain FXFB001. The mycelium prepared by fermentation of strain FXFB001 exhibited filamentous mycelial morphology, a pale yellow filter cake color, and an elastic texture (Figure 3). The dry weight biomass reached 0.63%, and the protein content of the mycelium was measured to be 55.39% by the Kjeldahl method. In other words, the protein-rich mycelium prepared by strain FXFB001 did not show spores under a microscope, had a good filamentous shape, a pale yellow and elastic filter cake, and was odorless.

[0089] Example 3 Mycelial amplification culture and fermentation production of strain FXFB001 and several microbial strains obtained from its initial screening culture.

[0090] 1 Culture method 1.1 The shaken flask culture media used are shown in Table 4 (Primary and Secondary Culture Media) and Table 5 (Tertiary Culture Media).

[0091] Table 4 Culture media for primary and secondary inoculum culture [Table 4]

[0092] Table 5 Tertiary culture medium [Table 5]

[0093] 1.2 Culture conditions for the inoculum: For the preparation of the primary inoculum, the inoculum medium shown in Table 4 above was used, and an activated strain of the present invention was selected (a strain with good mycelial morphology in the inoculum and fermentation liquid and good performance in each indicator was selected; see Table 7). This strain was inoculated into a 250 mL tri-concave Erlenmeyer flask containing 50 mL of initial screening medium and cultured with shaking at a constant temperature of 200 rpm for 24 hours. For the preparation of the secondary inoculum, the inoculum medium shown in Table 4 above was used, and 5% of the inoculum was transferred to a 3 L tri-concave Erlenmeyer flask containing 1 L of inoculum medium. The flask was cultured for 24 hours at a vibration speed of 200 rpm, and the secondary inoculum was inoculated into a 10 L fermentation tank containing the inoculum medium shown in Table 5 at an inoculum of 8%. The aeration rate was 10 L / min, the tank pressure was 0.05 Mpa, the stirring speed was 150 rpm, the temperature was 28°C, and the pH was adjusted online to 5.0 with ammonia water. The fermentation time was approximately 24 hours.

[0094] 1.3 Fermentation culture produced protein-rich mycelium: 1.3.1 The first fermentation medium for producing protein-rich mycelium is shown in Table 6.

[0095] Table 6 First fermentation medium [Table 6]

[0096] In this example, the multivitamin used is vitamin B1 / thiamine, vitamin B 12 It contains cobalamin, vitamin B2 / riboflavin, vitamin B3 / niacin, vitamin B5 / calcium D-pantothenate, vitamin B6 / pyridoxine, vitamin B9 / folic acid, vitamin C, and vitamin H / D-biotin in equal mass ratios.

[0097] 1.4 The fermentation culture method is as follows: The three-stage inoculum cultured for 24 hours was inoculated at an inoculum size of 5% and pumped through a sterilized hose from the bottom valve into a 50 L fermentation tank containing 30 L of the first fermentation medium. The aeration rate for the first 15 hours was 1000 L / h, and the tank pressure was 0.05 mpa. After 15 hours, the material supply was started at a rate of 0.5 mL / L / h. The components of the material supply included 320 g / L of glucose and 0.1 mg / L of multivitamins. The aeration rate was adjusted to 1500 L / h, and the tank pressure was adjusted to 0.1 mpa. The pH was controlled at 6.0 with ammonia water, and the culture was carried out at 28°C for 72 hours with a rotation speed of 100 rpm and a dissolved oxygen of 50%.

[0098] 1.5 Processing process after fermentation culture (1) Heat treatment: After fermentation, the fermentation broth was heated to 65°C and held for about 20 minutes, then heated to 90°C and held for about 10 minutes, and then cooled to room temperature. (2) Pressurized filtration and refrigeration: After heat treatment, the fermentation broth was pressurized and filtered using a plate and frame filter press. After sufficient washing and ventilation, the filter cake was taken out and stored at 4°C. (3) Detection: The crude protein measurement sample was pretreated, the dried sample was pulverized and passed through a 60-mesh sieve, and then the measurement was carried out according to the <<National Food Safety Standard for the Determination of Protein in Foods GB5009.5-2016>>. For the detection of common mycotoxins in foods, the detection was entrusted to a third-party SGS.

[0099] The fermentation results of each strain are shown in Table 7.

[0100] Table 7 Rescreening results of Fusarium 50 L fermentation tank

Table 7

[0101] Comparison of the mycelium results obtained by fermenting and culturing the Fusarium brachygibbosum strain FXFB001 in the first fermentation medium supplemented with multivitamins with the results of the initial screening in Example 2 to prepare protein-rich mycelium 1. The mycelium prepared by the initial screening did not show spores under a microscope, the filtered cake was grayish-white, had good elasticity and toughness, and had no foul odor. 2. The mycelial proteins obtained by continuous fermentation culture were observed under a microscope to be in a good filamentous form (Figures 4 and 5), the fermentation liquid naturally showed a flesh-colored appearance without heating, and the protein content was approximately 55%.

[0102] The toxin detection results showed that no fungal toxins contained in strain FXFB001 were detected under the above fermentation culture conditions (below the limit, see Table 8, detection method refer to SN / T3136-2012 standard). Total fat content was 7.97%, crude protein content was 60.51%, and dietary fiber content was 26.01%.

[0103] Table 8: Summary of Physical and Chemical Detection Results [Table 8]

[0104] Example 4 Method for producing protein-rich mycelium from Fusarium brachygibotum through fermentation. 1 Culture method 1.1 The components of the shaken flask culture medium used are shown in Table 9 (Primary culture medium and secondary culture medium) and Table 10 (Tertiary culture medium).

[0105] Table 9 Culture media for primary and secondary inoculum culture [Table 9]

[0106] Table 10 Tertiary culture medium [Table 10]

[0107] 1.2 Culture conditions for the inoculum: For the preparation of the primary inoculum, the inoculum medium shown in Table 9 was used, and the activated strain FXFB001 was collected and inoculated into a 250 mL triangular Erlenmeyer flask containing 50 mL of the medium, and incubated with constant temperature shaking at 180 rpm for 26 hours. For the preparation of the secondary inoculum, the inoculum medium shown in Table 9 was used, and a 6% inoculum was transferred to a 3 L triangular Erlenmeyer flask containing 1 L of the inoculum medium, incubated at a vibration table speed of 200 rpm for 22 hours, and the secondary inoculum was inoculated into a 10 L fermentation tank containing the medium described in Table 10 at an inoculum of 10%, with an aeration rate of 11 L / min, a tank pressure of 0.06 MPa, a stirring speed of 220 rpm, a temperature of 26 °C, and pH adjusted online to 6.0 with ammonia water. The fermentation time was 36 hours.

[0108] 1.3 Fermentation culture produced protein-rich mycelium: 1.3.1 Table 11 shows the fermentation media for producing protein-rich mycelium.

[0109] Table 11 Second fermentation medium [Table 11]

[0110] 1.4 The fermentation culture method is as follows: A tertiary inoculum cultured for 22 hours was injected at a 7% inoculum volume into a 50L fermentation tank containing the second fermentation medium shown in Table 11, using a pump through a valve at the bottom via a sterile hose. The fermentation conditions were: aeration rate of 1100 L / h and tank pressure of 0.05 MPa. When the reducing sugar content in the fermentation medium was less than 2 g / L, 80% of the medium was released, and the material was supplied back to its original volume within 20 minutes. The material supplied was the second fermentation medium, with the aeration rate adjusted to 1400 L / h and the tank pressure to 0.1 MPa. The system's pH was controlled to 5.2 with ammonia water, and the culture was carried out at 28°C with a rotation speed of 350 rpm and 40% dissolved oxygen for 480 hours.

[0111] 1.5 Post-fermentation culture processing (1) Heat treatment: After fermentation ended, the fermentation broth was heated to 65°C and held for about 20 minutes, then heated to 90°C and held for about 10 minutes, and then cooled to room temperature. (2) Pressurized filtration and refrigeration: After heat treatment, the fermentation broth was press-filtered using a plate and frame filter press. After sufficient washing and ventilation, the filter cake was taken out and stored at 4°C. (3) Detection: The crude protein measurement sample was pretreated, the dried sample was pulverized, passed through a 60-mesh sieve, and then measured according to <<National Food Safety Standard for the Determination of Protein in Foods GB5009.5-2016>>. For the detection of common mycotoxins in foods, the detection was entrusted to the third-party SGS.

[0112] Under the above fermentation culture conditions, no toxin was detected in the mycelium produced by the fermentation of strain FXFB001. In the case of the mycelium dry basis, the total fat was 5.8%, the crude protein content was 54.2%, and the dietary fiber content was 20.4%.

[0113] Example 5 1 Culture method 1.1 The components of the shaking flask inoculum medium used are as shown in Table 12 (medium for primary inoculum culture and medium for secondary inoculum culture) and Table 13 (medium for tertiary inoculum culture).

[0114] Table 12 Medium for primary inoculum culture and secondary inoculum culture

Table 12

[0115] Table 13 Medium for tertiary inoculum culture

Table 13

[0116] 1.2 Culture conditions of the inoculum solution: For the preparation of the primary inoculum, the culture medium shown in Table 12 was used, and the activated strain FXFB001 was collected and inoculated into a 250 mL Erlenmeyer flask containing 50 mL of the culture medium. The flask was then incubated with constant temperature shaking at 200 rpm for 24 hours. For the preparation of the secondary inoculum, the inoculum culture medium shown in Table 12 was used, and a 5% inoculum was transferred to a 3 L Erlenmeyer flask containing 1 L of the inoculum culture medium. The flask was incubated for 24 hours at a vibration speed of 200 rpm. The secondary inoculum was then inoculated into a 10 L fermentation tank containing the culture medium shown in Table 13 at an inoculum of 8%, with an aeration rate of 10 L / min, a tank pressure of 0.05 MPa, a stirring speed of 150 rpm, a temperature of 27°C, and the pH was adjusted online to 5.5 with ammonia water. The fermentation time was approximately 24 hours.

[0117] 1.3 Fermentation culture produced protein-rich mycelium: 1.3.1 The components of the fermentation medium for producing protein-rich mycelium are shown in Table 14.

[0118] Table 14 First Fermentation Medium [Table 14]

[0119] The aforementioned vitamin complex contains vitamin B1 / thiamine 0.1 mg, vitamin B 12 The vitamins were as follows in mass ratio: Cobalamin 0.1mg, Vitamin B2 / Riboflavin 0.1mg, Vitamin B3 / Niacin 0.1mg, Vitamin B5 / Calcium D-Pantothenate 0.1mg, Vitamin B6 / Pyridoxine 0.1mg, Vitamin B9 / Folic Acid 0.1mg, Vitamin C 0.1mg, and Vitamin H / D-Biotin 0.1mg.

[0120] 1.4 The fermentation culture method is as follows: The three-stage inoculum solution cultured for 24 hours was inoculated at a 10% inoculum volume. Through a sterilized hose, it was pumped from the bottom valve and injected into a 50L fermentation tank containing the first fermentation medium shown in Table 14 with a liquid volume of 25L. The aeration volume in the first 15 hours was 900L / h, and the tank pressure was 0.04mpa. After 15 hours, the material supply was started at 2ml / L / h. The material supply medium was glucose 300g / L and multivitamin 0.1mg / L. Then, the aeration volume was adjusted to 1600L / h, the tank pressure was adjusted to 0.1mpa, the pH was controlled at 4.5 with ammonia water, and it was cultured at 28°C with a rotation speed of 100rpm and a dissolved oxygen of 30% for 70 hours.

[0121] 1.5 Processing Process after Fermentation Culture (1) Heat Treatment: After fermentation, the fermentation broth was heated to 65°C and held for about 20 minutes, then heated to 90°C and held for about 10 minutes, and then cooled to room temperature. (2) Pressurized Filtration and Refrigeration: After heat treatment, the fermentation broth was pressurized filtered using a plate and frame filter press. After sufficient washing and ventilation, the filter cake was taken out and stored at 4°C. (3) Detection: The crude protein measurement sample was pretreated, the dried sample was pulverized and passed through a 60-mesh sieve, and then the measurement was carried out according to <<National Food Safety Standard for the Determination of Protein in Foods GB5009.5-2016>>. For the detection of common mycotoxins in foods, the detection was entrusted to the third-party SGS.

[0122] Under the above fermentation culture conditions, no toxin was detected in the mycelium produced by the fermentation of strain FXFB001. In the case of the mycelium dry basis, the total fat was 8%, the crude protein content was 60.5%, and the dietary fiber content was 26.0%.

[0123] Example 6 Method for Producing Protein-Rich Mycelium by Fermentation of Fusarium brachygibbosum 1 Culture Method 1.1 The components of the shaking flask inoculum medium used are as shown in Table 15 (Primary Inoculum Culture Medium and Secondary Inoculum Culture Medium) and Table 16 (Tertiary Inoculum Medium).

[0124] Table 15 Culture media for primary and secondary inoculum culture [Table 15]

[0125] Table 16 Tertiary culture medium [Table 16]

[0126] 1.2 Culture conditions for the inoculum: For the preparation of the primary inoculum, the inoculum culture medium shown in Table 15 was used, and the activated strain FXFB001 of the present invention was collected and inoculated into a 250 mL triangular Erlenmeyer flask containing 50 mL of the culture medium. The flask was then incubated with constant temperature shaking at 200 rpm for 22 hours. For the preparation of the secondary inoculum, the inoculum culture medium shown in Table 15 was used, and a 6% inoculum was transferred to a 3 L triangular Erlenmeyer flask containing 1 L of the inoculum culture medium. The flask was incubated for 22 hours at a vibration speed of 220 rpm. The secondary inoculum was then inoculated into a 10 L fermentation tank containing the culture medium shown in Table 16 at a dose of 10%, with an aeration rate of 11 L / min, a tank pressure of 0.06 Mpa, a stirring speed of 220 rpm, a temperature of 28 °C, and the pH was adjusted online to 5.0 with ammonia water. The fermentation time was 42 hours.

[0127] 1.3 Fermentation culture produced protein-rich mycelium: 1.3.1 Table 17 shows the fermentation media for producing protein-rich mycelium.

[0128] Table 17 Second fermentation medium [Table 17]

[0129] 1.4 The fermentation culture method is as follows: The three-stage inoculum solution cultured for 22 hours was inoculated at an inoculation amount of 7%, and pumped through a sterilized hose from the bottom valve into a 50 L fermentation tank containing the second fermentation medium shown in Table 17 with a liquid volume of 30 L. The fermentation conditions were an aeration rate of 1100 L / h and a tank pressure of 0.05 mpa. When the reducing sugar in the fermentation system was less than 5 g / L, 50% of the medium was discharged, and then the material was supplied to the original volume within 20 minutes. The material supply medium was the second fermentation medium. The aeration rate was adjusted to 1400 L / h, the tank pressure was adjusted to 0.1 mpa, the pH value of the system was controlled at 5.0 with ammonia water, cultured at 28 °C, the rotation speed was 350 rpm, the dissolved oxygen was 40%, and cultured for 120 hours.

[0130] 1.5 Post-treatment process after fermentation culture (1) Heat treatment: After fermentation, the fermentation broth was heated to 65 °C and held for about 20 minutes, then heated to 90 °C and held for about 10 minutes, and then cooled to room temperature. (2) Pressurized filtration and refrigeration: After heat treatment, the fermentation broth was pressurized filtered using a plate and frame filter press. After sufficient washing and ventilation, the filter cake was taken out and stored at 4 °C. (3) Detection: The crude protein measurement sample was pretreated, the dried sample was pulverized and passed through a 60-mesh sieve, and then the measurement was carried out according to the <<National Food Safety Standard for the Determination of Protein in Foods GB5009.5-2016>>. For the detection of common mycotoxins in foods, the detection was entrusted to the third-party SGS.

[0131] Under the above fermentation culture conditions, no toxin was detected in the mycelium produced by the fermentation of strain FXFB001. In the case of the mycelium dry basis, the total fat was 8.0%, the crude protein content was 60.5%, and the dietary fiber content was 26.0%.

[0132] Example 7 Microbial inoculant containing strain FXFB001 The Fusarium brachygibbosum strain FXFB001 was enlarged cultured according to the method described in Example 3, 50% glycerin was added to the obtained three-stage inoculum solution, and it could be stored frozen at -80 °C.

[0133] Example 8 Method for producing a meat substitute (edible fungal protein-based sausage) using mycelium from Example 5 The following raw materials were accurately weighed: 40 kg of edible mycelium, 58 kg of ice water, 0.1 kg of chemical seasonings, 0.7 kg of yeast extract, 1 kg of edible sugar, 0.5 kg of meat flavor, 3 kg of sunflower oil, 0.6 kg of edible salt, 0.6 kg of spices, 2 kg of starch, 2.5 kg of carrageenan, and 0.106 kg of paprika.

[0134] The manufacturing method is, Step 1, which involves mixing carrageenan, starch, and some ice water, chopping them uniformly, and then adding fungal protein, chemical seasonings, sugar, food essence, vegetable oil, salt, spices, coloring, and the remaining ice water, and mixing them uniformly, Step 2 involves filling nylon casings with meat filling using a filling machine, placing the sausages on a stick in a smoker, drying them at 60°C for 20 minutes, steaming them at 95°C for 20 minutes, and then boiling them. Remove it and blow it with cool air to below 25℃, then package it as in step 3, This includes step 4, which involves rapid freezing and storage.

[0135] The above describes only preferred embodiments of the present invention, but it should be noted that those skilled in the art can make several improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The use of a microbial inoculum containing Fusarium brachygibbosum or Fusarium brachygibbosum strain FXFB001 and acceptable auxiliary materials in the production of mycelial proteins, The Fusarium brachygibotum mentioned above is the Fusarium brachygibotum strain FXFB001. The deposit number for the aforementioned Fusarium brachygibbosum strain FXFB001 is CGMCC No: 41066. Use of Fusarium brachygibbosum or its microbial inoculant in the production of mycelial proteins.

2. The use according to claim 1, characterized in that the Fusarium brachygibosum includes a spore form and / or a mycelial form.

3. Edible mycelium, wherein, based on the dry mass of the edible mycelium, the mass percentage content of protein in the edible mycelium is 40% or more, the mass percentage content of dietary fiber is 20% or more, and the mass percentage content of fat is 8% or less. The edible mycelium mentioned above originates from Fusarium brachygibbosum. The edible mycelium is characterized in that the Fusarium brachygibotum is the Fusarium brachygibotum used as described in claim 1.

4. The edible mycelium according to claim 3, characterized in that the edible mycelium is highly elastic or tough.

5. Fusarium brachygibbosum strain FXFB001, characterized by having deposit number CGMCC No: 41066.

6. A microbial inoculant for producing protein or protein-rich mycelium, characterized in that it comprises the Fusarium brachygibosum strain FXFB001 described in claim 5 and auxiliary materials acceptable to the inoculant.

7. The microbial inoculant for producing protein or protein-rich mycelium according to claim 6, characterized in that the mass ratio of Fusarium brachygibosum strain FXFB001 to the auxiliary material is 1 to 10:1 to 100.

8. The microbial inoculant for producing protein or protein-rich mycelium according to claim 6, characterized in that the auxiliary material includes one or more of the culture medium, additives, and carriers.

9. Use of Fusarium brachygibosum strain FXFB001 according to claim 5 or any one of claims 6 to 8 in the production of protein or protein-rich mycelium.

10. A method for producing edible mycelium using Fusarium brachygibbosum, The steps include: inoculating a starter culture prepared with Fusarium brachygibosum or its microbial inoculant into a fermentation medium and fermenting it to obtain a fermented liquid; The step of sterilizing the fermentation liquid and then separating the fermentation product to obtain edible mycelium is included. The method is characterized in that the Fusarium brachygibotum is Fusarium brachygibotum in use as described in claim 1.

11. The fermentation medium includes a first fermentation medium and / or a second fermentation medium. The aforementioned first fermentation medium contains the following components: starch 23-27 g / L, citric acid 0.8-1.2 g / L, potassium dihydrogen phosphate 0.8-1.2 g / L, ammonium sulfate 4.5-5.5 g / L, magnesium salt (concentration calculated in Mg equivalent) 17-21 mg / L, calcium salt (concentration calculated in Ca equivalent) 2.8-43 mg / L, manganese salt (concentration calculated in Mn equivalent) 0.48-0.62 mg / L, iron salt or ferrous salt (concentration calculated in Fe equivalent) 0.96-1.05 mg / L, zinc salt (concentration calculated in Zn equivalent) 0.72-0.91 mg / L, cobalt salt (concentration calculated in Co equivalent) 0.44-0.54 mg / L, and multivitamins 0.08-0.12 mg / L. The second fermentation medium contains glucose at 15 to 60 kg / m 3 , K 2 SO 4 at 0.5 to 1.5 kg / m 3 , H 3 PO 4 at 0.4 to 0.8 kg / m 3 , magnesium salt calculated by concentration in terms of Mg at 9.75 to 58.5 g / m 3 , zinc salt calculated by concentration in terms of Zn at 2.2 to 22.5 g / m 3 , manganese salt calculated by concentration in terms of Mn at 2.46 to 9.85 g / m 3 , calcium acetate at 0.1 to 0.3 kg / m 3 and antifoaming agent at 0.08 to 0.12 kg / m 3 The method according to claim 10, characterized by containing components with the following contents.

12. The fermentation culture conditions when fermentation is carried out using the first fermentation medium are: During the first 15 hours of fermentation culture, the aeration rate is controlled to 900-1100 L / h and the pressure to 0.04-0.06 MPa. After 15 hours of fermentation culture, material supply was started at a rate of 0.5–2.0 mL / L / h, with an aeration rate of 1400–1600 L / h, a pressure of 0.08–0.12 MPa, and a pH value of the fermentation liquid of 4.0–6.

0. The fermentation culture temperature is 27°C to 29°C, the rotation speed is 100 to 450 rpm, the dissolved oxygen level is 20% to 50%, and the fermentation culture time is 68 to 76 hours. The material supplied at the time of the aforementioned material supply contains glucose at a concentration of 280-320 g / L and multivitamins at a concentration of 0.08-0.12 mg / L. The aforementioned multivitamin is vitamin B 1 0.08 to 0.12 parts, Vitamin B 12 0.08 to 0.12 parts, Vitamin B 2 0.08 to 0.12 parts, Vitamin B 3 0.08 to 0.12 parts, Vitamin B 5 0.08 to 0.12 parts, Vitamin B 6 0.08 to 0.12 parts, Vitamin B 9 The method according to 11, characterized in that it contains 0.08 to 0.12 parts by mass of components, 0.08 to 0.12 parts by mass of vitamin C and 0.08 to 0.12 parts by mass of vitamin H.

13. When performing the fermentation culture using the second fermentation medium, the fermentation culture conditions are controlled to have an aeration rate of 900 to 1600 L / h, a pressure of 0.04 to 0.12 MPa, and a pH value of 4.0 to 6.0 for the fermentation liquid. The fermentation culture temperature is 27°C to 29°C, the rotation speed is 100 to 450 rpm, the dissolved oxygen level is 20% to 50%, and the fermentation culture time is 72 to 480 hours. The method according to 11, characterized in that, if the reducing sugar content in the fermentation system is less than 2 to 5 g / L, 20% to 90% of the fermentation liquid by volume is discharged and the second fermentation medium is added back up to the original volume.

14. The method for preparing the Fusarium brachygibosum spawn solution is as follows: The Fusarium brachygibosum is inoculated into the first culture medium, and primary and secondary inoculation are performed sequentially to obtain a secondary inoculation solution. The method according to 10, characterized in that it includes a method of inoculating the secondary inoculum solution into a second inoculum culture medium, performing tertiary inoculum culture, and obtaining a tertiary inoculum solution.

15. The aforementioned culture medium for type 1 contains the following components: glucose 28-32 g / L, yeast extract powder 23-27 g / L, potassium dihydrogen phosphate 0.8-1.2 g / L, magnesium salt 17-21 mg / L (concentration calculated in Mg equivalent), and calcium salt 3-4 mg / L (concentration calculated in Ca equivalent). The method according to 14, characterized in that the aforementioned second culture medium contains the following components: 23-27 g / L of starch, 0.8-1.2 g / L of citric acid, 0.8-1.2 g / L of potassium dihydrogen phosphate, 4.8-5.2 g / L of ammonium sulfate, 17-21 mg / L of magnesium salt (concentration calculated on Mg equivalent), 0.003-0.004 g / L of calcium salt (concentration calculated on Ca equivalent), 0.48-0.62 mg / L of manganese salt (concentration calculated on Mn equivalent), 0.96-1.05 mg / L of iron salt or ferrous salt (concentration calculated on Fe equivalent), 0.72-0.91 mg / L of zinc salt (concentration calculated on Zn equivalent), and 0.44-0.54 mg / L of cobalt salt (concentration calculated on Co equivalent).

16. The culture temperature for the primary, secondary, or tertiary inoculum culture is 25°C to 30°C. The incubation time for the primary, secondary, or tertiary inoculum culture is 22 to 26 hours. The rotation speed for the primary, secondary, or tertiary inoculation culture is 100 to 200 rpm. The aeration rate of the aforementioned tertiary inoculum culture is 8 to 12 L / min. The pressure for the tertiary inoculum culture is 0.04 to 0.06 MPa. The method according to 14, characterized in that the pH value of the tertiary inoculum culture system is 4.0 to 6.

0.

17. The sterilization method for the fermentation liquid is heat sterilization. The method according to 10, characterized in that the heat sterilization procedure involves holding the temperature at 60°C to 70°C for 18 to 22 minutes, and then raising the temperature to 88°C to 92°C and holding it for 8 to 15 minutes.

18. The method according to 10, characterized in that the method for separating the fermentation product includes separating the solid phase and liquid phase of the fermentation liquid, washing the solid phase, and then drying it to obtain edible mycelium.

19. The use of edible mycelium according to claim 3 or 4, or edible mycelium prepared by the method described in any one of claims 10 to 18, in the preparation of a meat substitute.

Citation Information

Patent Citations

  • Fusarium angulatum with high yield of hypha protein and application of fusarium angulatum

    CN115851458A

  • Pyruvate decarboxylase gene FvPDC6 and application of pyruvate decarboxylase gene FvPDC6 in improving yield of fusarium venanii hypha protein

    CN116640753A

  • Edible foodstuffs and bio reactor design

    US20230248039A1

  • Food Materials Comprising Filamentous Fungal Particles and Membrane Bioreactor Design

    US20240023588A1

  • Food products comprising fungal mycelium, process for their preparation and uses thereof

    WO2022091089A1