Reorientation of AAV capsids
The TRACER platform addresses the limitations of existing AAV capsid technologies by enabling cell type-specific biopanning, resulting in AAV vectors with enhanced CNS tropism and transduction efficiency through RNA-driven screening.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- VOYAGER THERAPEUTICS INC
- Filing Date
- 2025-01-22
- Publication Date
- 2026-06-30
Smart Images

Figure 0007882996000084 
Figure 0007882996000085 
Figure 0007882996000086
Abstract
Description
Technical Field
[0001] The present disclosure relates to compositions, methods, and processes for preparing adeno-associated virus capsid proteins, their use, and / or formulations, wherein the capsid proteins include target-directed peptide inserts for enhancing tropism for target tissues.
Background Art
[0002] Gene delivery to the adult central nervous system (CNS) remains a major challenge in gene therapy, and genetically engineered AAV capsids with improved brain tropism are an attractive solution. Adeno-associated virus (AAV)-derived vectors are promising tools for clinical gene transfer because of their non-pathogenic nature, low immunogenic profile, low rate of integration into the host genome, and long-term transgene expression in non-dividing cells. However, in certain organs, the transduction efficiency of AAV natural variants is too low to be clinically applicable, and capsid neutralization by existing neutralizing antibodies may prevent treatment of most patients. For these reasons, significant efforts have been made to obtain novel capsid variants with enhanced properties. Among the many techniques tested so far, the most significant progress has come from the directed evolution of AAV capsids using in vitro or in vivo selection of capsid variants generated by capsid sequence randomization using either error-prone PCR, shuffling of various parental serotypes, or insertion of fully randomized short peptides at defined positions.
[0003] To enable targeted evolution of AAV capsids, the sequence encoding the viral capsid is flanked with an inverted terminal repeat (ITR) so that it can be packaged within its own capsid shell. After infecting cultured cells or animals with a mixed population of capsids, the DNA encoding the capsid variant that successfully induced the target tissue is recovered by PCR and subjected to further selection. This method recovers all viral DNA species present in a given tissue, without distinguishing specific cell types or vectors capable of complete transduction (cell surface binding, endocytosis, transport, nuclear translocation, decoction, double-strand synthesis, transcription). For example, in highly complex tissues containing multiple cell types, such as the central nervous system (CNS), it is highly desirable to apply more stringent selective pressure aimed at recovering capsid variants capable of transducing neurons and / or astrocytes rather than microglia or vascular endothelial cells.
[0004] Attempts to improve the CNS tropism of AAV capsids during systemic administration have only achieved limited success. Two previous approaches have been used to address this problem. The first strategy involved co-infection with adenovirus in cultured cells (Non-Patent Literature 1) or in situ animal tissue (Non-Patent Literature 2) to trigger exponential replication of infectious AAV DNA. Another successful approach involved using cell-specific CRE transgenic mice (Non-Patent Literature 3) to specifically enable viral DNA recombination in astrocytes, followed by the recovery of CRE-recombinant capsid variants. Both approaches have proven successful, allowing for the isolation of several capsid variants with enhanced transduction into target cell populations.
[0005] These findings suggest that cell type-specific library selection can improve the outcomes of directed evolution. However, the transgenic CRE system used by Deverman et al. is difficult to handle in other animal species, and the AAV variants selected by directed evolution in mouse tissues do not exhibit similar characteristics in large animals. Therefore, it is expected that the entire directed evolution process needs to be directly implemented in non-human primates to increase the probability of translationability in human subjects. None of the previously described transduction-specific methods are suitable for large animal studies for the following reasons: 1) the target tissues (e.g., CNS) are often not readily available for adenovirus co-infection; 2) the specific Ad tropism itself biases the library distribution; and 3) large animals are typically unsuitable for transgenesis and cannot be genetically engineered to express CRE recombinase in a given cell type.
[0006] To address this problem, the inventors have developed a widely applicable functional AAV capsid library screening platform for cell type-specific biopanning in non-transgenic animals. In the TRACER (Tropism Redirection of AAV by Cell type-specific Expression of RNA) platform system, the capsid gene is under the control of a cell type-specific promoter so that capsid mRNA expression is driven in the absence of helper virus co-infection. This RNA-driven screening increases the selective pressure to favor capsid variants that transduce specific cell types.
[0007] The TRACER platform enables the generation of AAV capsid libraries, and the specific recovery and subcloning of capsid mRNA expressed in transduced cells is achieved without the need for transgenic animals or helper virus co-infection. Since mRNA transcription is a definitive feature of complete transduction, this method allows for the identification of fully infectious AAV capsid mutants. In addition to its higher stringency, this method allows for the identification of capsids with high tropism to specific cell types by using libraries designed to express CAP mRNA under the control of any cell-specific promoter, including but not limited to synapsin-1 promoter (neurons), GFAP promoter (astrocytes), TBG promoter (liver), CAMK promoter (skeletal muscle), and MYH6 promoter (cardiomyocardium). [Prior art documents] [Non-patent literature]
[0008] [Non-Patent Document 1] Grimm et al., 2008 [Non-Patent Document 2] Lisowski et al., 2014 [Non-Patent Document 3] Deverman et al., 2016 [Overview of the project]
[0009] This disclosure provides compositions and methods for genetically manipulating and / or redirecting the tropism of AAV capsids. The Specification also provides peptides that can be inserted into AAV capsid sequences to increase the capsid's tropism to specific tissues. In one embodiment, such peptides can be used to target the capsid to the brain or a region of the brain or the spinal cord.
[0010] This disclosure presents a method for generating one or more variant AAV capsid polypeptides. In certain embodiments, the variant AAV capsid polypeptide exhibits at least one of improved transduction or increased cell specificity or tissue specificity compared to a parent AAV capsid polypeptide. In certain embodiments, the method comprises (a) generating a library of variant AAV capsid polypeptides, the library comprising (i) a plurality of capsid polypeptides having a region of randomized sequences of 2, 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids, or (ii) a plurality of capsid polypeptides derived from one or more parent AAV capsid polypeptides; and (b) generating an AAV vector library by cloning the capsid polypeptides of library (a)(i) or (a)(ii) into an AAV vector, the AAV vector comprising a first promoter and a second promoter, the second promoter driving capsid mRNA expression in the absence of helper virus co-infection.
[0011] In certain embodiments, the first promoter is AAV2 P40. In certain embodiments, the second promoter is a ubiquitous promoter. In certain embodiments, the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter.
[0012] In certain embodiments, the first promoter is AAV2 P40. In certain embodiments, the second promoter is a cell type-specific promoter. In certain embodiments, the first promoter is AAV2 P40, and the second promoter is a cell type-specific promoter.
[0013] In certain embodiments, the promoter is selected from any of the promoters listed in Table 3. In certain embodiments, a ubiquitous promoter or a cell-specific promoter enables the expression of RNA encoding a capsid polypeptide.
[0014] In certain embodiments, the method includes a step of recovering RNA encoding a capsid polypeptide. In certain embodiments, the method includes a step of sequencing the capsid polypeptide. In certain embodiments, the recovered capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide.
[0015] In certain embodiments, the target cells are nerve cells, neural stem cells, astrocytes, oligodendrocytes, microglia, retinal cells, tumor cells, hematopoietic stem cells, insulin-producing beta cells, lung epithelial cells, endothelial cells, hepatocytes, skeletal muscle cells, muscle stem cells, muscle satellite cells, or cardiomyocytes.
[0016] In a particular embodiment, the AAV vector comprises a first promoter and a second promoter, the second promoter located downstream of the capsid gene, and drives its antisense RNA expression in the absence of helper virus co-infection.
[0017] In certain embodiments, the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter. In certain embodiments, the first promoter is AAV2 P40 and the second promoter is a cell-specific promoter. In certain embodiments, the ubiquitous promoter or the cell-specific promoter enables the expression of a gene encoding the variant AAV capsid polypeptide in the antisense direction, resulting in antisense RNA. In certain embodiments, the method included a step of recovering antisense RNA that can be converted into RNA encoding the variant AAV capsid polypeptide, which is used to sequence the variant AAV capsid polypeptide.
[0018] In certain embodiments, the variant AAV capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide. The aforementioned and other objectives, features, and advantages will become apparent from the following description relating to specific embodiments of the present disclosure, as illustrated in the accompanying drawings. The drawings are not necessarily to scale and are rather focused on illustrating the principles of the various embodiments of the present disclosure. [Brief explanation of the drawing]
[0019] [Figure 1A] Figure 1A shows maps of wild-type AAV capsid gene transcription and CMV-CAP vectors. The transcription of VP1, VP2, and VP3 AAV from the wild-type AAV genome is shown. The transcription start sites of each viral promoter are indicated: SD, splice donor, SA, and splice acceptor. The sequence of the start codon of each reading frame is shown. Translation of AAP and VP3 is performed by leaky scanning of the major mRNA. [Figure 1B] Figure 1B shows a map of the wild-type AAV capsid gene transcription and the CMV-CAP vector. Figure 1B shows the structure of the CMV-p40 dual promoter vector used to determine the minimum regulatory sequence required for efficient virus production. The pREP2ΔCAP vector shown at the bottom is obtained by deleting most of the CAP reading frame and is used to provide the REP protein in trans. [Figure 2A]A histogram representation of data showing the effect of CMV promoter position on virus yield and CAP mRNA splicing. Figure 2A shows the average yield of AAV9 produced in HEK-293T cells co-transfected with an Ad helper vector using the constructs described in Figure 1. Wild-type AAV9 plasmid (pAV9) is used as a positive control. The Y-axis values represent the number of AAV DNA copies per 1 μl (total of approximately 1000 μl, left panel) or the percentage of wtAAV9 (right panel) derived from each 15 cm plate. [Figure 2B] A histogram representation of data showing the effect of CMV promoter position on virus yield and CAP mRNA splicing. Figure 2B shows evidence of CAP transcript expression in transfected cells. mRNA derived from transfected 293T cells was subjected to RT-PCR using primers specific for the major splicing CAP transcript. Note that p40-driven transcription is absent in the absence of the Ad helper vector (lane 2). [Figure 3A] A figure showing the effect of REP helper plasmid optimization on virus yield. Figure 3A shows the design of the modified pREP helper vector. Deletion of the MscI fragment removes the C-terminal portion of the VP proteins required for capsid formation. The asterisk represents an early stop codon introduced to disrupt the potential for encoding the VP1, VP2, and VP3 reading frames. [Figure 3B] A figure showing the effect of REP helper plasmid optimization on virus yield. Figure 3B shows the yield of synapsin-p40-CAP9 AAV produced using various REP plasmid architectures. The values on the Y-axis represent the percentage of VG relative to wild-type AAV9. [Figure 3C]Figure showing the effect of REP helper plasmid optimization on virus yield. Figure 3C shows the quantification of recombination and / or non-canonical packaging of full-length REP from the pREP plasmid. The virus stocks produced were subjected to qPCR using a Taqman probe located at the N-terminal portion of REP that is not present in the ITR-containing vector. [Figure 4A] Figure describing the in vivo analysis of second-generation vectors. Figure 4A shows the design of the Pro9 vector. The architecture of all three vectors is based on the BstEII construct. The AAV9 capsid RNA is placed under the control of the P40 promoter and the CMV, hSyn1, or GFAP promoter, respectively. [Figure 4B] Figure describing the in vivo analysis of second-generation vectors. Figure 4B shows the silver staining of an SDS-PAGE gel obtained by running 1e10 VG of each vector after double iodixanol purification. [Figure 4C] Figure describing the in vivo analysis of second-generation vectors. Figure 4C shows the in vivo distribution of viral DNA in mouse brain (cortex), liver, and heart after tail vein injection of 1e12 VG per mouse. The AAV9 VP3 DNA was quantified by Taqman PCR and normalized to the mouse transferrin receptor gene. [Figure 4D] Figure describing the in vivo analysis of second-generation vectors. Figure 4D shows the capsid RNA recovery from mouse tissues. Total RNA was reverse transcribed and Taqman PCR was performed using capsid-specific Taqman primers and probes. The values represent the VP3c DNA copy number normalized to the TBP housekeeping gene. [Figure 5A]Figure 5A shows the in vitro analysis of second-generation intron vectors. The design of an intron Pro9 vector encapsulating a hybrid CMV / globin intron is shown. The AAV9 capsid RNA is regulated by the P40 promoter and the CBA, hSyn1, or GFAP promoter in either a tandem configuration (top) or an inverted configuration (bottom). The inverted promoter vector has an additional SV40 polyadenylation site (orange) appended to its 3' end to enable polyadenylation of the antisense CAP9 transcript. [Figure 5B] Figure 5B shows in vitro analysis of second-generation intronic vectors. Triple transfection with pHelper and pREP-3stops was used to produce all vectors shown, and the resulting viruses were used to infect HEK-293T cells at an MOI of 1e4VG per cell. RNA was extracted 48 hours after infection and subjected to RT-PCR using primers to amplify the complete capsid (top) or the C-terminal fragment (bottom). [Figure 5C] Figure 5C shows the in vitro analysis of second-generation intronic vectors. AAV9 VP3 cDNA derived from cells infected with intronic or non-intronic viruses with forward-directed tandem promoters was quantified by Taqman PCR and normalized to the GAPDH housekeeping gene. The values represent the ratio of VP3 to GAPDH cDNA. [Figure 5D] Figure 5D shows in vitro analysis of second-generation intronic vectors. Figure 5D shows mapping of capsid RNA recovery from cells infected with tandem or inverted constructs. Total RNA was reverse transcribed and PCR was performed using primers that flanked the entire capsid gene. White arrows represent VP3-sized variants resulting from abnormal splicing of antisense CAP mRNA. [Figure 5E]Figure 5E shows the in vitro analysis of second-generation intron vectors. Figure 5E illustrates the analysis of globin intron splicing. cDNA derived from HEK-293T cells transduced by the CAG9 plasmid (left) or CAG9 virus was subjected to PCR using forward primers located either before (Glo ex1) or within (GloSpliceF4 (SEQ ID NO: 26) and GloSpliceF6 (SEQ ID NO: 13)) the globin exon junction. Primers spanning the junction between exon 1 (ununderlined) and exon 2 (underlined) are shown in the lower panel. [Figure 6] The figure provides in vitro evidence that the presence of the P40 promoter downstream of the synapsin promoter or the Gfabc1D promoter does not desuppress either promoter in HEK-293T cells. [Figure 7] A diagram illustrating the basic structure of the TRACER platform. [Figure 8] A diagram illustrating the features of the TRACER platform, including the use of tissue-specific promoters and RNA retrieval. [Figure 9] A diagram providing one embodiment of the TRACER production architecture. [Figure 10] A figure providing a comparison between conventional vDNA recovery and second-generation vRNA recovery. [Figure 11] A diagram providing an overview of the use of cell-specific RNA expression for targeted evolution. [Figure 12A] Figure 12B provides diagrams representing the transcription of capsid genes in natural AAV (Figure 12A) and TRACER libraries. [Figure 12B] Figure 12B provides diagrams representing the transcription of capsid genes in natural AAV (Figure 12A) and TRACER libraries. [Figure 13] Figure shows diagrams of the AAV6, AAV5, and AAV-DJ capsid peptide display libraries used for in vivo evolution (sequence numbers 27-32, in order of appearance). [Figure 14]This figure shows a diagram of the AAV9 capsid peptide display library used for in vivo evolution (sequence numbers 33-42, in order of appearance). [Figure 15A] A diagram illustrating the method used for library construction. Figure 15A shows the sequence of insertion sites used to introduce the random library (sequences 43-46, in order of appearance). [Figure 15B] A diagram illustrating the method used for building the library. Figure 15B provides an explanation of the assembly procedure. [Figure 16] This figure (SEQ ID NO: 47; NNK7) provides a typical diagram of the cloning-free rolling circle procedure used for library amplification. [Figure 17] Figure showing sequences of codon mutant AAV9 library shuttles designed to minimize wild-type interference (sequences 33-34 and 48-52, respectively, in order of appearance). [Figure 18] A diagram illustrating AAV9 peptide library biopanning. [Figure 19] A diagram illustrating the recovery process with 50% recovery from the initial pool. [Figure 20] A figure providing examples of cDNA recovery and amplification from GFAP-driven libraries (groups B and F). [Figure 21] Figure 21A shows the progression of AAV9 peptide library diversity throughout the biopanning process. Figures 21B and 21C show the amino acid distribution of NNK machine mix preparations against P0 and P1 viruses. [Figure 22] A figure showing the neuron (SYN)-AAV9 peptide library composition in P2. [Figure 23] A figure showing the astrocyte (GFAP)-AAV9 peptide library composition in P2. [Figure 24]A figure providing estimations of brain / liver specificity in candidate GFAP-AAV9 peptide libraries. [Figure 25] A figure providing estimations of brain / liver specificity in candidate GFAP-AAV9 peptide libraries. [Figure 26] A figure illustrating an example of subgroup selection for a variant. [Figure 27] A diagram providing a typical design for library generation and cloning procedures. [Figure 28] This figure shows the NNK / NNM codon distribution (covariance of codon mutants) of AAV produced by a synthetic library of 666 sequence variants (GFAP promoter). [Figure 29] This figure shows the NNK / NNM codon distribution (covariance of codon mutants) of AAV produced by a synthetic library of 666 sequence variants (SYN9 promoter). [Figure 30] Figure showing data derived from tissue recovery from brain and liver punches one month after injection. [Figure 31A] Figure 31A shows the results for control capsids from NGS analysis of syn-driven synthetic libraries. Figure 31A shows enrichment analysis of internal AAV9, PHP.B, and PHP.eB controls (sequences 53-58 and 53-58, respectively, in order of appearance). [Figure 31B] Figure 31B, Figure 31C, and Figure 31D show the NNK / NNM codon distribution in mRNA derived from mouse brain tissue. [Figure 31C] Figure 31B, Figure 31C, and Figure 31D show the NNK / NNM codon distribution in mRNA derived from mouse brain tissue. [Figure 31D] Figure 31B, Figure 31C, and Figure 31D show the NNK / NNM codon distribution in mRNA derived from mouse brain tissue. [Figure 32A]Figures showing the results of NGS analysis of neuron synthesis libraries (in order of appearance, sequence numbers 59-60, 59-61, 61-63, 62, 64, 64, 63, 65-67, 67, 65, 68, 66, 69, 70-71, and 70-74). [Figure 32B] Figures showing the results of NGS analysis of neuron synthesis libraries (in order of appearance, sequence numbers 59-60, 59-61, 61-63, 62, 64, 64, 63, 65-67, 67, 65, 68, 66, 69, 70-71, and 70-74). [Figure 33] Figure showing the results of NGS analysis of an astrocyte synthetic library (sequences 53-58, 53-58, and 53-58, respectively, in order of appearance). [Figure 34A] This figure provides a codon mutant covariance in an astrocyte synthetic library. [Figure 34B] This figure provides a codon mutant covariance in an astrocyte synthetic library. [Figure 35]Figure showing the results of NGS analysis of astrocyte synthetic libraries (in order of appearance, each sequence number 75, 75-78, 76-77, 79-83, 65, 78, 84, 80, 85, 70, 86, 82, 81, 79, 87, 65, 85, 84, 70, 86, 88-90, 87, 91, 83, 88, 63, 89-90, 92-93, 91, 94-97, 93, 95, 98, 98, 97, 63, 92, 94, 99-101, 75, 75) ~78, 76~77, 79~83, 65, 78, 84, 80, 85, 70, 86, 82, 81, 79, 87, 65, 85, 84, 70, 86, 88~90, 87, 91, 83, 88, 63, 89~90, 92~93, 91, 94~97, 93, 95, 98, 98, 97, 63, 92, 94, 99~102, 99, 103, 103~104, 96, 105~106, 101, 100, 102, 107, 104~105, 108~ 113, 106, 60, 66, 114~117, 109, 113, 72, 108, 110, 67, 118~119, 116, 120, 120, 107, 112, 121~123, 66, 124~125, 115, 118, 126, 121, 127~128, 60, 129, 119, 130~132, 72, 133, 123, 125, 69, 134~139, 62, 124, 67, 111, 114, 126, 140~141, 1 22, 142, 128-129, 143, 138, 144, 134, 62, 136, 145, 141, 146-153, 127, 154, 69, 144, 155, 71, 156, 133, 132, 137, 147, 157-158, 135, 159, 140, 117, 160, 139, 161-162, 130, 163, 143, 164, 152, 151, 165-167, 155, 168, 71, 169, and 146). [Figure 36] A figure showing NGS analysis of a GFAP synthetic library. [Figure 37A]Figure 37A shows the phylogenetic analysis of the 9-mer peptide sequences, along with the sequences of the peptide variants (in order of appearance, respectively: SEQ ID NOs. 67, 59, 64, 61, 77, 84, 96, 60, 80, 82, 66, 62, 83, 85, 106, 131, 94, 90, 76, 68-69, 79, 75, 81, 88, 139, 78, 155, 102, 63, 140, 87, 70, 105, 120, 89, 65, and 109). The highlighted sequences represent peptides selected for individual transduction assays. [Figure 37B] Figure 37B shows the top 38 variants from synthetic library screening. Figure 37B shows a graphical representation of the neurotropy and astrocyte tropism of each peptide, with both axes showing the inverse ranking in synapsin screening and GFAP screening. [Figure 38] Figure showing the top consensus sequences compared to PHP.N and PHP.B (sequences 168 and 71, in order of appearance, respectively). [Figure 39] This diagram shows the Gibson assembly library cloning procedure. [Figure 40] A figure showing examples of TRIM / NNK peptide appearances (sequence numbers 170-171, in order of appearance). [Figure 41] Figures providing peptide diversity statistics for studies using Illumina adapters with 42 million bacterial transformants, 81 million sequence reads, and 12 million sequence variants (in order of appearance, SEQ ID NOs. 172-173, 48-49, and 174-175, respectively). [Figure 42] This figure provides a typical diagram of cloning-free DNA amplification using rolling circle amplification. [Figure 43] A diagram illustrating the protelomerase monomer processing (sequences 176-178, in order of appearance). [Figure 44] A diagram providing a comparison between the conventional method and the cloning-free method. [Figure 45A]Figure 45A and Figure 45B provide a complete ranking of 333 Syn-driven (Figure 45A) and GFAP-driven (Figure 45B) variants in brain, spinal cord, liver, and cardiac tissues. Capsid variants are ranked by their mean brain RNA enrichment score (mean NNK and NNM codons). Rankings of internal control capsids PHP.B, PHP.eB, and AAV9 are shown (Figures 45A and 45B). A combined comparison of Syn-driven and GFAP-driven results is provided (Figure 45C). Only four animals represented the GFAP-driven library, as two out of six mice showed very different ranking profiles and were considered outliers. [Figure 45B] Figure 45A and Figure 45B provide a complete ranking of 333 Syn-driven (Figure 45A) and GFAP-driven (Figure 45B) variants in brain, spinal cord, liver, and cardiac tissues. Capsid variants are ranked by their mean brain RNA enrichment score (mean NNK and NNM codons). Rankings of internal control capsids PHP.B, PHP.eB, and AAV9 are shown (Figures 45A and 45B). A combined comparison of Syn-driven and GFAP-driven results is provided (Figure 45C). Only four animals represented the GFAP-driven library, as two out of six mice showed very different ranking profiles and were considered outliers. [Figure 45C] Figure 45A and Figure 45B provide a complete ranking of 333 Syn-driven (Figure 45A) and GFAP-driven (Figure 45B) variants in brain, spinal cord, liver, and cardiac tissues. Capsid variants are ranked by their mean brain RNA enrichment score (mean NNK and NNM codons). Rankings of internal control capsids PHP.B, PHP.eB, and AAV9 are shown (Figures 45A and 45B). A combined comparison of Syn-driven and GFAP-driven results is provided (Figure 45C). Only four animals represented the GFAP-driven library, as two out of six mice showed very different ranking profiles and were considered outliers. [Figure 46A]Figure 46A shows a comparison of the results of NGS analysis of neuronal and astrocyte synthetic libraries. [Figure 46B] Figure 46B shows a scatter plot illustrating the correlation between synth-driven libraries and GFAP-driven libraries. [Figure 47] This figure illustrates one embodiment in which research was conducted on multiple species (e.g., rodents) followed by next-generation sequencing (NGS). [Figure 48A] Figure 48A shows the results of comparing multiple strains / species of 333 capsid variants. Figure 48A shows the ranking of the 333 capsids by brain RNA enrichment score in C57BL / 6 mice, BALB / C mice, and rats. The capsids are ranked according to the syn-driven brain enrichment score in C57BL / 6 mice. [Figure 48B] Figure 48B shows the results of comparing multiple lines / species of 333 capsid variants. Figure 48B shows a scatter plot illustrating the correlation between C57BL / 6 enrichment scores and BALB / C enrichment scores derived from the Syn-driven pool and the GFAP-driven pool. [Figure 48C] Figure 48C shows the results of comparing multiple strains / species of 333 capsid variants. The Venn diagram shows the crossover and consensus sequences of capsids with >10 times higher brain enrichment scores than AAV9 (either syn-driven or GFAP-driven) in the C57BL / 6 and BALB / C strains. In rats, no capsids showed a >10 times enrichment score compared to AAV9. [Figure 49A] Figure 49A shows transduction (RNA) and in vivo distribution (DNA) analysis of 10 capsid variants (sequence numbers 179-188, in order of appearance). The autocomplementary CBA-EGFP genome was packaged using the individual capsids (Figure 49B) and intravenously injected into C57BL / 6 mice. [Figure 49B]Figure 49A shows transduction (RNA) and in vivo distribution (DNA) analysis of 10 capsid variants (sequence numbers 179-188, in order of appearance). The autocomplementary CBA-EGFP genome was packaged using the individual capsids (Figure 49B) and intravenously injected into C57BL / 6 mice. [Figure 49C] Figure 49A shows transduction (RNA) and in vivo distribution (DNA) analysis of 10 capsid variants (sequence numbers 179-188, in order of appearance). The autocomplementary CBA-EGFP genome was packaged using each capsid (Figure 49B) and intravenously injected into C57BL / 6 mice. Figure 49C shows RNA expression in brain and spinal cord samples. [Figure 49D] Figure 49A shows transduction (RNA) and in vivo distribution (DNA) analysis of 10 capsid variants (sequence numbers 179-188, in order of appearance). The autocomplementary CBA-EGFP genome was packaged using each capsid (Figure 49B) and intravenously injected into C57BL / 6 mice. Figure 49D shows the DNA distribution in brain and spinal cord samples. [Figure 50A] Figures showing the results of testing individual capsids in the brain, spinal cord, and liver, as well as their mRNA expression. EGFP mRNA expression results are shown for the brain (Figure 50A), spinal cord (Figure 50B), and liver (Figure 50C). [Figure 50B] Figures showing the results of testing individual capsids in the brain, spinal cord, and liver, as well as their mRNA expression. EGFP mRNA expression results are shown for the brain (Figure 50A), spinal cord (Figure 50B), and liver (Figure 50C). [Figure 50C] Figures showing the results of testing individual capsids in the brain, spinal cord, and liver, as well as their mRNA expression. EGFP mRNA expression results are shown for the brain (Figure 50A), spinal cord (Figure 50B), and liver (Figure 50C). [Figure 51]Figure 51 shows the results of NGS screening using neuronal NeuN markers for both GFAP screening and SYN screening. [Figure 52] A figure showing the test results of individual capsids in the whole brain. [Figure 53] Figure showing the results of testing additional individual capsids in the whole brain. [Figure 54] A figure showing the test results of individual capsids in the cerebellum. [Figure 55] A figure showing the test results of individual capsids in the cortex. [Figure 56] A diagram showing the test results of individual capsids in the hippocampus. [Figure 57A] Figure 57B shows transduction data (Figure 57B) and whole tissue fluorescence (Figure 57A) of 10 capsid variants in mouse liver analyzed by EGFP RNA expression. [Figure 57B] Figure 57B shows transduction data (Figure 57B) and whole tissue fluorescence (Figure 57A) of 10 capsid variants in mouse liver analyzed by EGFP RNA expression. [Figure 58A] This figure shows the results of a comparative study on the effectiveness of CNS transduction of 333 capsid variants into C57BL / 6 mouse BMVEC (Figure 58A) and human BMVEC (Figure 58B). [Figure 58B] This figure shows the results of a comparative study on the effectiveness of CNS transduction of 333 capsid variants into C57BL / 6 mouse BMVEC (Figure 58A) and human BMVEC (Figure 58B). [Figure 59A] A diagram providing an external barcode assignment for NGS analysis and full-length capsid variant recovery. A typical barcode pair is shown (Figure 59C). A complete ITR-to-ITR construct is shown with barcode pairs for the 5' of the CAP sequence (Figure 59A) and the 3' of the CAP sequence (Figure 59B). [Figure 59B]A diagram providing an external barcode assignment for NGS analysis and full-length capsid variant recovery. A typical barcode pair is shown (Figure 59C). A complete ITR-to-ITR construct is shown with barcode pairs for the 5' of the CAP sequence (Figure 59A) and the 3' of the CAP sequence (Figure 59B). [Figure 59C] A diagram providing an external barcode assignment for NGS analysis and full-length capsid variant recovery. A typical barcode pair is shown (Figure 59C). A complete ITR-to-ITR construct is shown with barcode pairs for the 5' of the CAP sequence (Figure 59A) and the 3' of the CAP sequence (Figure 59B). [Figure 60A] Figure 60A shows a detailed analysis of viral production and RNA splicing using several configurations of the intron barcode platform. Typical ITR-to-ITR constructs are shown in Figure 60A (sequence numbers 189-193, in order of appearance), along with gel columns showing intron barcode yield (Figure 60B) and results for AAV intron splicing and globin intron splicing (Figure 60C). [Figure 60B] Figure 60A shows a detailed analysis of viral production and RNA splicing using several configurations of the intron barcode platform. Typical ITR-to-ITR constructs are shown in Figure 60A (sequence numbers 189-193, in order of appearance), along with gel columns showing intron barcode yield (Figure 60B) and results for AAV intron splicing and globin intron splicing (Figure 60C). [Figure 60C] Figure 60A shows a detailed analysis of viral production and RNA splicing using several configurations of the intron barcode platform. Typical ITR-to-ITR constructs are shown in Figure 60A (sequence numbers 189-193, in order of appearance), along with gel columns showing intron barcode yield (Figure 60B) and results for AAV intron splicing and globin intron splicing (Figure 60C). [Modes for carrying out the invention]
[0020] Details of one or more embodiments of this disclosure are given in the appendix below. Any materials and methods similar to or equivalent to those described herein may be used in carrying out or testing this disclosure, but preferred materials and methods are described herein. Other features, purposes, and advantages of this disclosure will become apparent from this description. In this description, singular nouns also include plural nouns unless explicitly indicated otherwise. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which this disclosure belongs. In the event of any conflict, this description shall prevail.
[0021] This disclosure provides AAV particles with enhanced tropism to target tissues (e.g., CNS), as well as related processes for targeting, preparing, formulating, and using them. Target-directed peptides and nucleic acid sequences encoding target-directed peptides are provided. These target-directed peptides can be inserted into AAV capsid protein sequences to modify their tropism to specific cell types, tissues, organs, or organisms in vivo, ex vivo, or in vitro.
[0022] As used herein, “AAV particle” or “AAV vector” comprises a capsid protein and a viral genome, the viral genome comprising at least one payload region and at least one inverted terminal repeat (ITR). The AAV particle and / or its components, the capsid and viral genome, may be genetically engineered to alter their tropism to a particular cell type, tissue, organ, or organism.
[0023] As used herein, “viral genome” or “vector genome” refers to a nucleic acid sequence encapsulated in an AAV particle. The viral genome comprises a nucleic acid sequence having at least one payload region encoding a payload and at least one ITR.
[0024] As used herein, “payload region” is any nucleic acid molecule encoding one or more “payloads” of this disclosure. In non-limiting examples, the payload region may be a nucleic acid sequence encoding a payload comprising an RNAi agent or polypeptide.
[0025] As used herein, “target-directed peptide” refers to a peptide with a length of 3 to 20 amino acids. Such target-directed peptides can be inserted into or attached to a parent amino acid sequence to alter the properties (e.g., tropism) of the parent protein. As a non-limiting example, target-directed peptides can be inserted into AAV capsid sequences to enhance target-direction to desired cell types, tissues, organs, or organisms.
[0026] The AAV particles and payloads of this disclosure can be delivered to one or more target cells, tissues, organs, or organisms. In preferred embodiments, the AAV particles of this disclosure demonstrate enhanced tropism to target cell types, tissues, or organs. In non-limiting examples, the AAV particles may exhibit enhanced tropism to cells and tissues of the central nervous system or peripheral nervous system (CNS and PNS, respectively). In addition to or instead of this, the AAV particles of this disclosure may exhibit reduced tropism to undesirable target cell types, tissues, or organs.
[0027] Adeno-associated viruses (AAVs) are small, non-enveloped, icosahedral capsid viruses belonging to the Parvoviridae family, characterized by a single-stranded DNA genome. Parvoviridae viruses comprise two subfamilies: the Parvovirinae, which infects vertebrates, and the Densovirinae, which infects invertebrates. The Parvoviridae family includes, but is not limited to, the Dependvirus genus, which contains AAVs capable of replicating in vertebrate hosts, including humans, primates, cattle, dogs, horses, and sheep.
[0028] Parvoviruses and other members of the Parvoviridae family are outlined in Chapter 69 of Kenneth I. Berns, "The Viruses and Their Replication," FIELDS VIRORLOGY (3rd Ed. 1996). The entire content of this document is referenced by reference.
[0029] AAVs have proven useful as biological tools because of their relatively simple structure, their ability to infect a wide range of cells (including quiescent and dividing cells) without being integrated into the host genome or replicated, and their relatively benign immunogenicity profile. The viral genome can be engineered to contain the minimum components necessary to assemble a functional recombinant virus or viral particle that is loaded with a desired payload or is genetically engineered to target a specific tissue and express or deliver a desired payload.
[0030] The wild-type AAV virus genome is a linear single-stranded DNA (ssDNA) molecule approximately 5,000 nucleotides (nt) long. Inverted terminal repeats (ITRs) traditionally cap the viral genome at both the 5' and 3' ends, providing an origin for viral genome replication. While we do not wish to be constrained by theory, the AAV virus genome typically contains two ITR sequences. These ITRs have a characteristic T-shaped hairpin structure defined by self-complementary regions (145 nt in the wild type) at the 5' and 3' ends of the ssDNA, which form energetically stable double-stranded regions. The double-stranded hairpin structure has multiple functions, including, but is not limited to, acting as an origin for DNA replication by functioning as a primer for the endogenous DNA polymerase complex in host viral replication cells.
[0031] The wild-type AAV virus genome contains two open reading frames: one containing the nucleotide sequences of four non-structural Rep proteins (Rep78, Rep68, Rep52, and Rep40, encoded by the Rep gene), and the other containing the nucleotide sequences of three capsids, or structural proteins (VP1, VP2, and VP3, encoded by the capsid gene, i.e., the Cap gene). The Rep proteins are crucial for replication and packaging, while the capsid proteins are assembled to form the protein shell of AAV, i.e., the AAV capsid. Alternative splicing, as well as alternative start codons and promoters, result in the generation of four distinct Rep proteins and three capsid proteins from a single open reading frame. While it varies depending on the AAV serotype, as a non-limiting example, in the case of AAV9 / hu.14 (Sequence ID 123 of U.S. Patent No. 7,906,111; the contents of this document are incorporated herein by reference in their entirety), VP1 refers to amino acids 1-736, VP2 refers to amino acids 138-736, and VP3 refers to amino acids 203-736. In other words, VP1 is the full-length capsid sequence, while VP2 and VP3 are shorter components of the whole. Consequently, while sequence changes in the VP3 region also occur in VP1 and VP2, the percentage difference compared to the parent sequence is greatest in VP3 because it is the shortest of the three sequences. Although amino acid sequences are described here, the nucleic acid sequences encoding these proteins can be described similarly. The three capsid proteins are assembled together to produce the AAV capsid protein. While we do not wish to be constrained by theory, AAV capsid proteins typically contain VP1:VP2:VP3 in a molar ratio of 1:1:10. As used herein, “AAV serotype” is primarily defined by the AAV capsid. In some cases, the ITR is also specifically described by the AAV serotype (e.g., AAV2 / 9).
[0032] The AAV vectors of this disclosure may be recombinantly produced or based on an adeno-associated virus (AAV) parent or reference sequence. As used herein, “vector” is any molecule or portion that transports, transduces, or otherwise acts as a carrier for a heterologous molecule, such as a nucleic acid, as described herein.
[0033] This disclosure provides not only single-stranded AAV viral genomes (e.g., ssAAV) but also self-complementary AAV (scAAV) viral genomes. The scAAV vector genome contains DNA strands that anneal together to form double-stranded DNA. scAAV enables rapid expression in transduced cells by skipping second strand synthesis.
[0034] In one embodiment, the AAV particles of this disclosure are scAAVs. In one embodiment, the AAV particles of this disclosure are ssAAV. Methods for producing and / or modifying AAV particles, such as pseudotype AAV vectors, are disclosed in the Art (International Publication No. 200028004; International Publication No. 200123001; International Publication No. 2004112727; International Publication No. 2005005610; and International Publication No. 2005072364. The contents of each of these documents are incorporated herein by reference in their entirety).
[0035] In one embodiment, AAV particles of the present disclosure, comprising a capsid with an inserted target-directed peptide and a viral genome, can exhibit enhanced tropism to human CNS cell types or tissues.
[0036] AAV Capsid The AAV particles of this disclosure may contain or be derived from any natural or recombinant AAV serotype. AAV serotypes, though not limited to these, may differ in characteristics such as packaging, tropism, transduction, and immunogenicity profiles. While we do not wish to be constrained by theory, AAV capsid proteins are often considered to drive AAV particle tropism to specific tissues.
[0037] In one embodiment, the AAV particles may have capsid proteins and ITR sequences derived from the same parental serotype (e.g., AAV2 capsid and AAV2 ITR). In another embodiment, the AAV particles may be pseudotype AAV particles, in which case the capsid proteins and ITR sequences are derived from different parental serotypes (e.g., AAV9 capsid and AAV2 ITR; AAV2 / 9).
[0038] The AAV particles of this disclosure may comprise an AAV capsid protein in which a target-directed peptide is inserted into a parent sequence. The parent capsid or serotype may comprise or be derived from any natural or recombinant AAV serotype. As used herein, the “parent” sequence is the nucleotide sequence or amino acid sequence into which the target-directed sequence is inserted (i.e., a nucleotide insertion into a nucleic acid sequence or an amino acid sequence insertion into an amino acid sequence).
[0039] In a preferred embodiment, the parent AAV capsid nucleotide sequence is as shown in Sequence ID No. 1. In another embodiment, the parent AAV capsid nucleotide sequence is the K449R variant of SEQ ID NO: 1, in which the codon encoding lysine (e.g., AAA or AAG) at position 449 of the amino acid sequence (nucleotides 1345-1347) is replaced with one encoding arginine (CGT, CGC, CGA, CGG, AGA, AGG). The K449R variant has the same function as wild-type AAV9.
[0040] In one embodiment, the parent AAV capsid amino acid sequence is as shown in Sequence ID No. 2. In another embodiment, the parent AAV capsid amino acid sequence is as shown in SEQ ID NO: 3.
[0041] In one embodiment, the parent AAV capsid sequence is one of those shown in Table 1.
[0042] [Table 1]
[0043] Each of the patents, applications, and / or publications listed in Table 1 is incorporated herein by reference in whole. The parent AAV serotype and associated capsid sequence may be any known in the art. Non-limiting examples of such AAV serotypes include: AAV9, AAV9 K449R (or K449R AAV9), AAV1, AAVrh10, AAV-DJ, AAV-DJ8, AAV5, AAVPHP.B (PHP.B), AAVPHP.A (PHP.A), AAVG2B-26, AAVG2B-13, AAVTH1.1-32, AAVTH1.1-35, AAVPHP.B2 (PHP.B2), AAVPHP.B3 (PHP.B3), AAVPHP.N / PHP.B-DGT, AAVPHP.B-EST, and AAVPHP.B-GGT. , AAVPHP.B-ATP, AAVPHP.B-ATT-T, AAVPHP.B-DGT-T, AAVPHP.B-GGT-T, AAVPHP.B-SGS, AAVPHP.B-AQP, AAVPHP.B-QQP , AAVPHP.B-SNP(3), AAVPHP.B-SNP, AAVPHP.B-QGT, AAVPHP.B-NQT, AAVPHP.B-EGS, AAVPHP.B-SGN, AAVPHP.B-EGT, AAV PHP.B-DST, AAVPHP.B-DST, AAVPHP.B-STP, AAVPHP.B-PQP, AAVPHP.B-SQP, AAVPHP.B-QLP, AAVPHP.B-TMP, AAVPHP.B- TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3(G2A3), AAVG2B4(G2B4), AAVG2B5(G2B5), PHP.S, AAV2, AAV2G9, AAV3, AAV3a, AA V3b, AAV3-3, AAV4, AAV4-4, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9.11, AAV9.13, AAV9.16, AAV9. 24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12、AAV42-1b、AAV42-2、AAV42-3a、AAV42-3b、AAV42-4、AAV42-5a、AAV42-5b、AAV42-6b、AAV42-8、AAV42-10、AAV42-11、AAV42-12、AAV42-13、AAV42-1 5、AAV42-aa、AAV43-1、AAV43-12、AAV43-20、AAV43-21、AAV43-23、AAV43-25、AAV43-5、AAV44.1、AAV44.2、AAV44.5、AAV223.1、AAV223.2、AAV223.4 AV223.5、AAV223.6、AAV223.7、AAV1-7 / rh.48、AAV1-8 / rh.49、AAV2-15 / rh.62、AAV2-3 / rh.61、AAV2-4 / rh.50、AAV2-5 / rh.51、AAV3.1 / rh.6、AAV3.1 / rh.61 hu.9、AAV3-9 / rh.52、AAV3-11 / rh.53、AAV4-8 / r11.64、AAV4-9 / rh.54、AAV4-19 / rh.55、AAV5-3 / rh.57、AAV5-22 / rh.58、AAV7.3 / rh.7、AAV16.8 / hu.1 0、AAV16.12 / hu.11、AAV29.3 / bb.1、AAV29.5 / bb.2、AAV106.1 / hu.37、AAV114.3 / hu.40、AAV127.2 / hu.41、AAV127.5 / hu.42、AAV128.3 / hu.44、AAV130.4 / hu.48、AAV145.1 / hu.53、AAV145.5 / hu.54、AAV145.6 / hu.55、AAV161.10 / hu.60、AAV161.6 / hu.61、AAV33.12 / hu.17、AAV33.4 / hu.15、AAV33.8 / hu .16、AAV52 / hu.19、AAV52.1 / hu.20、AAV58.2 / hu.25、AAVA3.3、AAVA3.4、AAVA3.5、AAVA3.7、AAVC1、AAVC2、AAVC5、AAVF3、AAVF5、AAVH2、AAVrh.72、AAV hu.8、AAVrh.68、AAVrh.70、AAVpi.1、AAVpi.3、AAVpi.2、AAVrh.60、AAVrh.44、AAVrh.65、AAVrh.55、AAVrh.47、AAVrh.69、AAVrh.45、AAVrh.59、AAVhu.12、AAVH6、AAVH-1 / hu.1、AAVH-5 / hu.3、AAVLG-10 / rh.40、AAVLG-4 / rh.38、AAVLG-9 / hu.39、AAVN721-8 / rh.43、AA VCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5R1、AAVCy.5R2、AAVCy.5R3、AAVCy.5R4、AAVcy. 6、AAVhu.1、AAVhu.2、AAVhu.3、AAVhu.4、AAVhu.5、AAVhu.6、AAVhu.7、AAVhu.9、AAVhu.10、AAVhu.11、AAVhu.13、AAVhu. AVhu.15、AAVhu.16、AAVhu.17、AAVhu.18、AAVhu.20、AAVhu.21、AAVhu.22、AAVhu.23.2、AAVhu.24、AAVhu.25、AAVhu. u.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.31、AAVhu.32、AAVhu.34、AAVhu.35、AAVhu.37、AAVhu.39、AAVhu.4 0、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44R1、AAVhu.44R2、AAVhu.44R3、AAVhu.45、AAVhu.46、AAVhu. 47、AAVhu.48、AAVhu.48R1、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.51、AAVhu.52、AAVhu.54、AAVhu.55、AAVhu. u.56、AAVhu.57、AAVhu.58、AAVhu.60、AAVhu.61、AAVhu.63、AAVhu.64、AAVhu.66、AAVhu.67、AAVhu.14 / 9、AAVhu.t 19、AAVrh.2、AAVrh.2R、AAVrh.8、AAVrh.8R、AAVrh.10、AAVrh.12、AAVrh.13、AAVrh.13R、AAVrh.14、AAVrh.17、AAVrh.18、AAVrh.19、AAVrh.20、AAVrh. rh.21、AAVrh.22、AAVrh.23、AAVrh.24、AAVrh.25、AAVrh.31、AAVrh.32、AAVrh.33、AAVrh.34、AAVrh.35、AAVrh.36、AAVrh.37、AAVrh.37、AAVrh.37、AAVrh.38、AAVrh.39、AAVrh.40、AAVrh.46、AAVrh.48、AAVrh.48.1、AAVrh.48.1.2、AAVrh.48.2、AAVrh.49、AAVrh.51、AAVrh.52、AAVrh.53、AAVrh. h.54、AAVrh.56、AAVrh.57、AAVrh.58、AAVrh.61、AAVrh.64、AAVrh.64R1、AAVrh.64R2、AAVrh.67、AAVrh.73、AAVrh.74、AAVrh.8R、AAVrh.8R. A586R mutation、AAVrh8R R533A mutation、AAAV、BAAV、ヤギAAV、ウシAAV、AAVhE1.1、AAVhEr1.5、AAVhER1.14、AAVhEr1.8、AAVhEr1.16、AAVhEr1.18、AAVhEr1.35、AAVhEr1.7、AAVhEr1.36、AAV hEr2.29、AAVhEr2.4、AAVhEr2.16、AAVhEr2.30、AAVhEr2.31、AAVhEr2.36、AAVhER1.23、AAVhEr3.1、AAV2.5T、AAV-PAEC、AAV-LK01、AAV-LK02、AAV-LK03、AAV-LK03 LK04、AAV-LK05、AAV-LK06、AAV-LK07、AAV-LK08、AAV-LK09、AAV-LK10、AAV-LK11、AAV-LK12、AAV-LK13、AAV-LK14、AAV-LK15、AAV-LK16、AAV-LK17、AAV-LK18 、AAV-LK19、AAV-PAEC2、AAV-PAEC4、AAV-PAEC6、AAV-PAEC7、AAV-PAEC8、AAV-PAEC11、AAV-PAEC12、AAV-2-pre-miRNA-101、AAV-8h、AAV-8b、AAV-h、AAV-b、AAV SM 10-2、AAVシャッフル(AAV Shuffle)100-1、AAVシャッフル100-3、AAVシャッフル100-7、AAVシャッフル10-6、AAVシャッフル10-8、AAV SM 10-8、AAV SM 100-3、AAV SM 10-8 100-10、BNP61 AAV、BNP62 AAV、BNP63. AAV、AAVrh.50、AAVrh.43、AAVrh.62、AAVrh.48、AAVhu.19、AAVhu.11、AAVhu.53、AAV4-8 / rh.64、AAVLG-9 / hu.39、AAV54.5 / hu.23、AAV AAV(true types AAV)(ttAAV)、UPENN AAV10、ジャパニーズAAV10 serotype(Japanese AAV 10 serotype)、AAV CBr-7.1、AAV CBr-7.10、AAV CBr-7.2、AAV CBr-7.3、AAV CBr-7.4、AAV CBr-7.5、AAV CBr-7.7、AAV CBr-7.8、AAV CBr-B7.3、AAV CBr-B7.4、AAV CBr-E1、AAV CBr-E2、AAV CBr-E3、AAV CBr-E4、AAV CBr-E5、AAV CBr-e5、AAV CBr-E6、AAV CBr-E7、AAV CBr-E8、AAV CHt-1、AAV CHt-2、AAV CHt-3、AAV CHt-6.1、AAV CHt-6.10、AAV CHt-6.5、AAV CHt-6.6、AAV CHt-6.7、AAV CHt-6.8、AAV CHt-P1、AAV CHt-P2、AAV CHt-P5、AAV CHt-P6、AAV CHt-P8、AAV CHt-P9、AAV CKd-1、AAV CKd-10、AAV CKd-2、AAV CKd-3、AAV CKd-4、AAV CKd-6、AAV CKd-7、AAV CKd-8、AAV CKd-B1、AAV CKd-B2、AAV CKd-B3、AAV CKd-B4、AAV CKd-B5、AAV CKd-B6、AAV CKd-B7、AAV CKd-B8、AAV CKd-H1、AAV CKd-H2、AAV CKd-H3、AAV CKd-H4、AAV CKd-H5、AAV CKd-H6、AAV CKd-N3、AAV CKd-N4、AAV CKd-N9、AAV CLg-F1、AAV CLg-F2、AAV CLg-F3、AAV CLg-F4、AAV CLg-F5、AAV CLg-F6、AAV CLg-F7、AAV CLg-F8、AAV CLv-1、AAV CLv1-1、AAV CLv1-10、AAV CLv1-2、AAV CLv-12、AAV CLv1-3、AAV CLv-13、AAV CLv1-4、AAV Clv1-7、AAV Clv1-8、AAV Clv1-9、AAV CLv-2、AAV CLv-3、AAV CLv-4、AAV CLv-6、AAV CLv-8、AAV CLv-D1、AAV CLv-D2、AAV CLv-D3、AAV CLv-D4、AAV CLv-D5、AAV CLv-D6、AA V CLv-D7、AAV CLv-D8、AAV CLv-E1、AAV CLv-K1、AAV CLv-K3、AAV CLv-K6、AAV CLv-L4、AAV CLv-L5、AAV CLv-L6、AAV CLv-M1、AAV CLv-M11、AAV CLv-M2、AAV CLv-M5、AAV CLv-M6、AAV CLv-M7、AAV CLv-M8、AAV CLv-M9、AAV CLv-R1、AAV CLv-R2、AAV CLv-R3、AAV CLv-R4、AAV CLv-R5、AAV CLv-R6、AAV CLv-R7、AAV CLv-R8、AAV CLv-R9、AAV CSp-1、AAV CSp-10、AAV CSp-11、AAV CSp-2、AAV CSp-3、AAV CSp-4、AAV CSp-6、AAV CSp-7, AAV CSp-8, AAV CSp-8.10, AAV CSp-8.2, AAV CSp-8.4, AAV CSp-8.5, AAV CSp-8.6, AAV CSp-8.7, AAV CSp-8.8, AAV CSp-8.9, AAV CSp-9, AAV.hu.48R3, AAV.VR-355, AAV3B, AAV4, AAV5, AAVF1 / HSC1, AAVF11 / HSC11, AAVF12 / HSC12, AAVF13 / HSC13, AAVF14 / HSC14, AAVF15 / HSC15, AAVF16 / HSC16, AAVF17 / HSC17, AAVF2 / HSC2, AAVF3 / HSC3, AAVF4 / HSC4, AAVF5 / HSC5, AAVF6 / HSC6, AAVF7 / HSC7, AAVF8 / HSC8, and / or AAVF9 / HSC9, and their variants.
[0044] In some embodiments, the serotype may be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al. (Journal of Virology 82(12):5887-5911(2008), U.S. Patent Application Publication No. 20140359799, and U.S. Patent No. 7,588,772; each of these documents is incorporated herein by reference in whole). The amino acid sequence of AAVDJ8 may contain two or more mutations to remove the heparin-binding domain (HBD). As a non-limiting example, the AAV-DJ sequence is as described in Sequence ID No. 1 of U.S. Patent No. 7,588,772 (the contents of which are incorporated herein by reference in their entirety), and the AAV-DJ8 sequence may contain two mutations: (1) R587Q, in which arginine (R;Arg) at amino acid 587 is changed to glutamine (Q;Gln), and (2) R590T, in which arginine (R;Arg) at amino acid 590 is changed to threonine (T;Thr). As another non-limiting example, the AAV-DJ8 sequence may contain three mutations: (1) K406R, in which lysine (K;Lys) at amino acid 406 is changed to arginine (R;Arg); (2) R587Q, in which arginine (R;Arg) at amino acid 587 is changed to glutamine (Q;Gln); and (3) R590T, in which arginine (R;Arg) at amino acid 590 is changed to threonine (T;Thr).
[0045] In one embodiment, the parent AAV capsid sequence includes an AAV9 sequence. In one embodiment, the parent AAV capsid sequence includes the K449R AAV9 sequence. In one embodiment, the parent AAV capsid sequence includes an AAVDJ sequence.
[0046] In one embodiment, the parent AAV capsid sequence includes the AAVDJ8 sequence. In one embodiment, the parent AAV capsid sequence includes the AAVrh10 sequence. In one embodiment, the parent AAV capsid sequence includes the AAV1 sequence.
[0047] In one embodiment, the parent AAV capsid sequence includes the AAV5 sequence. While we do not wish to be constrained by theory, it is understood that the parent AAV capsid sequence includes the VP1 region. In one embodiment, the parent AAV capsid sequence includes the VP1, VP2, and / or VP3 regions, or any combination thereof. The parent VP1 sequence can be considered synonymous with the parent AAV capsid sequence.
[0048] This disclosure refers to structural capsid proteins (including VP1, VP2, and VP3) encoded by capsid (Cap) genes. These capsid proteins form the outer protein structural shell (i.e., capsid) of viral vectors such as AAV. VP capsid proteins synthesized from Cap polynucleotides generally contain methionine (Met1) as the first amino acid of the peptide sequence, which is associated with the start codon (AUG or ATG) of the corresponding Cap nucleotide sequence. However, the first methionine (Met1) residue, or generally any first amino acid (AA1), is commonly cleaved by protein processing enzymes such as Met-aminopeptidases after or during polypeptide synthesis. This "Met / AA clipping" process often correlates with the corresponding acetylation of the second amino acid of the polypeptide sequence (e.g., alanine, valine, serine, threonine, etc.). Met clipping generally occurs in VP1 and VP3 capsid proteins, but may also occur in VP2 capsid proteins.
[0049] Incomplete Met / AA clipping may result in the production of a mixture of one or more (1, 2, or 3) VP capsid proteins constituting the viral capsid, some of which may contain the Met1 / AA1 amino acid (Met+ / AA+), while others may lack the Met1 / AA1 amino acid as a result of Met / AA clipping (Met- / AA-). For further consideration of Met / AA clipping of capsid proteins, see the following literature: Jin, et al. Direct Liquid Chromatography / Mass Spectrometry Analysis for Complete Characterization of Recombinant Adeno-Associated Virus Capsid Proteins. Hum Gene Ther Methods. 2017 Oct. 28(5):255-267; Hwang, et al. N-Terminal Acetylation of Cellular Proteins Creates Specific Degradation Signals. Science. 2010 February 19. 327(5968):973-977. The contents of these references are incorporated herein by reference in their entirety.
[0050] According to this disclosure, references to capsid proteins are not limited to either clipped (Met- / AA-) or unclipped (Met+ / AA+), but may, depending on the context, refer to independent capsid proteins, viral capsids composed of mixtures of capsid proteins, and / or polynucleotide sequences (or fragments thereof) that encode, describe, produce, or result in the capsid proteins of this disclosure. Also, direct references to “capsid proteins” or “capsid polypeptides” (such as VP1, VP2, or VP2) may include VP capsid proteins containing the Met1 / AA1 amino acid (Met+ / AA+) and corresponding VP capsid proteins lacking the Met1 / AA1 amino acid as a result of Met / AA clipping (Met- / AA-).
[0051] Furthermore, according to this disclosure, any reference to specific sequence numbers (whether protein or nucleic acid) containing or encoding one or more capsid proteins (Met+ / AA+) containing the Met1 / AA1 amino acid should be understood to indicate VP capsid proteins lacking the Met1 / AA1 amino acid upon sequence examination, and any sequence lacking only the first amino acid (whether Met1 / AA1 or not) is immediately apparent.
[0052] As a non-restrictive example, a reference to a (Met+)VP1 polypeptide sequence that is 736 amino acids long and contains the amino acid "Met1" encoded by an AUG / ATG start codon can be understood to also teach a (Met-)VP1 polypeptide sequence that is 735 amino acids long and contains a 736-amino acid Met+ sequence that does not contain the "Met1" amino acid. As a second non-restrictive example, a reference to a (AA+)VP1 polypeptide sequence that is 736 amino acids long and contains the amino acid "AA1" encoded by an arbitrary NNN start codon can be understood to also teach a (AA-)VP1 polypeptide sequence that is 735 amino acids long and contains a 736-amino acid AA+ sequence that does not contain the "AA1" amino acid.
[0053] References to viral capsids formed from VP capsid proteins (such as references to specific AAV capsid serotypes) may include VP capsid proteins containing the Met1 / AA1 amino acid (Met+ / AA1+), corresponding VP capsid proteins lacking the Met1 / AA1 amino acid as a result of Met / AA1 clipping (Met- / AA1-), and combinations thereof (Met+ / AA1+ and Met- / AA1-).
[0054] As a non-limiting example, AAV capsid serotypes may include VP1(Met+ / AA1+), VP1(Met- / AA1-), or combinations of VP1(Met+ / AA1+) and VP1(Met- / AA1-). Furthermore, AAV capsid serotypes may include VP3(Met+ / AA1+), VP3(Met- / AA1-), or combinations of VP3(Met+ / AA1+) and VP3(Met- / AA1-), and may also include similar optional combinations of VP2(Met+ / AA1) and VP2(Met- / AA1-).
[0055] In one embodiment, the parent AAV capsid sequence may contain an amino acid sequence that has 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any of the following.
[0056] In one embodiment, the parent AAV capsid sequence may be encoded by a nucleotide sequence having 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any of the following.
[0057] In one embodiment, the parent sequence is not the AAV capsid sequence, but rather a different vector (e.g., a lentivirus, plasmid, etc.). In another embodiment, the parent sequence is a delivery vehicle (e.g., nanoparticles) to which the target-directed peptide is attached.
[0058] Target-directed peptides This specification discloses target-directed peptides for enhancing or improving the transduction of target tissues (e.g., cells of the CNS or PNS), and related AAV particles comprising capsid proteins having one or more target-directed peptide inserts.
[0059] In one embodiment, the target-directed peptide can direct the AAV particles towards cells or tissues of the CNS. Cells of the CNS may be, but are not limited to, supporting cells of the brain such as neurons (e.g., excitatory, inhibitory, motor, sensory, autonomic, sympathetic, parasympathetic, Purkinje, Betz, etc.), glial cells (e.g., microglia, astrocytes, oligodendroglia), and / or immune cells (e.g., T cells). Tissues of the CNS may be, but are not limited to, the cortex (e.g., frontal, parietal, occipital, temporal), thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, or deep cerebellar nuclei.
[0060] In one embodiment, a target-directed peptide can direct AAV particles to cells or tissues of the PNS. These cells or tissues of the PNS may, but are not limited to, dorsal root ganglia (DRGs).
[0061] Target-directed peptides can direct AAV particles towards the CNS (e.g., the cortex) after intravenous administration. Target-directed peptides can direct AAV particles towards the PNS (e.g., DRG) after intravenous administration.
[0062] Target-directed peptides may vary in length. In one embodiment, the target-directed peptide is 3 to 20 amino acids long. As a non-limiting example, the target-directed peptide may be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 3 to 5, 3 to 8, 3 to 10, 3 to 12, 3 to 15, 3 to 18, 3 to 20, 5 to 10, 5 to 15, 5 to 20, 10 to 12, 10 to 15, 10 to 20, 12 to 20, or 15 to 20 amino acids long.
[0063] The target-directed peptides of this disclosure can be identified and / or designed by any method known in the art. As a non-limiting example, the CREATE systems described in Deverman et al. (Nature Biotechnology 34(2):204-209 (2016)), Chan et al. (Nature Neuroscience 20(8):1172-1179 (2017)), and in international publications 2015038958 and 2017100671, can be used as means of identifying target-directed peptides in mice or other research animals, including non-human primates. The contents of each of these publications are incorporated herein by reference in whole.
[0064] Target-directed peptides and associated AAV particles can be identified from a library of AAV capsids containing target-directed peptide variants. In one embodiment, the target-directed peptide may be a 7-amino acid sequence (7-mer). In another embodiment, the target-directed peptide may be a 9-amino acid sequence (9-mer). Furthermore, the target-directed peptides may vary in the methods used to produce or design them, including, in non-limiting examples, random peptide selection, site-saturated mutagenesis, and / or optimization of specific regions of the peptide (e.g., flanking regions or central core).
[0065] In one embodiment, the target-directed peptide library includes target-directed peptides of 7 amino acid length (7-mer) randomly generated by PCR. In one embodiment, the target-directed peptide library includes a target-directed peptide having three mutant amino acids. In one embodiment, these three mutant amino acids are consecutive amino acids. In another embodiment, these three mutant amino acids are discontinuous amino acids. In one embodiment, the parent target-directed peptide is a heptamer. In another embodiment, the parent peptide is a nnamer.
[0066] In one embodiment, the target-directed peptide library comprises a heptomer of target-directed peptides, and the amino acids of the target-directed peptides and / or flanking sequences have been evolved by site-saturated mutagenesis of three consecutive amino acids. In one embodiment, the site-saturated mutagenesis sequence is generated using an NNK (N=any base; K=G or T) codon.
[0067] AAV particles containing a capsid protein with a target-directed peptide insert are generated, and a viral genome encoding a reporter (e.g., GFP) is encapsulated within them. These AAV particles (or AAV capsid libraries) are then administered to transgenic mice via intravenous delivery into the tail vein. When these capsid libraries are administered to cre-expressing mice, cre is expressed, resulting in the expression of the reporter payload in the target tissue.
[0068] To identify enrichment of target-directed peptides and associated AAV particles indicating enhanced transduction of the target tissue, AAV particles and / or viral genomes may be recovered from the target tissue. Enrichment can be determined using, but is not limited to, next-generation sequencing (NGS), viral genome quantification, biochemical assays, immunohistochemistry, and / or imaging of the target tissue sample, using standard methods in the art.
[0069] The target tissue may be any cell, tissue, or organ of the subject. In non-limiting examples, the sample may be selected from the brain, spinal cord, dorsal root ganglia and associated roots, liver, heart, gastrocnemius muscle, soleus muscle, pancreas, kidney, spleen, lung, adrenal gland, stomach, sciatic nerve, saphenous nerve, thyroid gland, eye (with or without optic nerve), pituitary gland, skeletal muscle (rectus femoris), colon, duodenum, ileum, jejunum, skin of the leg, superior cervical ganglia, bladder, ovaries, uterus, prostate, testes, and / or any site or site of interest identified as having a lesion.
[0070] Target-directed peptide sequences In one embodiment, the target-directed peptide may contain sequences as shown in Table 2. In Table 2, "_1" refers to an NNM codon in which A or C is in the third position, and "_2" refers to an NNK codon in which G or T is in the third position. In addition, since Met or Trp can only be coded by the codons ATG and TGG, respectively, the NNM codons cannot cover the entire repertoire of amino acids. Therefore, some "NNM" sequences also contain some codons ending in G.
[0071] [Table 2-1]
[0072] [Table 2-2]
[0073] [Table 2-3]
[0074] [Table 2-4]
[0075] [Table 2-5]
[0076] [Table 2-6]
[0077] [Table 2-7]
[0078] In one embodiment, the target-directed peptide sequence may include an amino acid sequence that has 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any of the sequences shown in Table 2.
[0079] In one embodiment, the target-directed peptide may contain any four or more consecutive amino acids from any of the target-directed peptides disclosed herein. In one embodiment, the target-directed peptide may contain any four consecutive amino acids from any of the sequences shown in Table 2. In one embodiment, the target peptide may contain any five consecutive amino acids from any of the sequences shown in Table 2. In one embodiment, the target-directed peptide may contain any six consecutive amino acids from any of the sequences shown in Table 2.
[0080] In one embodiment, the AAV particles of the present disclosure comprise an AAV capsid having a target-directed peptide insert, the target-directed peptide having an amino acid sequence as shown in any of Table 2.
[0081] In one embodiment, the AAV particles of the present disclosure comprise an AAV capsid having a target-directed peptide insert, the target-directed peptide having an amino acid sequence comprising at least four consecutive amino acids in any of the sequences shown in Table 2.
[0082] In one embodiment, the AAV particles of the present disclosure comprise an AAV capsid having a target-directed peptide insert, the target-directed peptide having an amino acid sequence substantially comprising any of the sequences shown in Table 2.
[0083] In one embodiment, the AAV particles of the present disclosure comprise an AAV capsid polynucleotide having a target-directed nucleic acid insert, the target-directed nucleic acid insert having a nucleotide sequence substantially comprising any of those shown in Table 2.
[0084] AAV particles of this disclosure, including a target-directed nucleic acid insert, may have a polynucleotide sequence having 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity with the parent capsid sequence.
[0085] AAV particles of this disclosure, including a target-directed peptide insert, may have an amino acid sequence having 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity with the parent capsid sequence.
[0086] In any DNA and RNA sequences referenced and / or described herein, single-letter symbols have the following meanings: A is adenine; C is cytosine; G is guanine; T is thymine; U is uracil; W is a weak base such as adenine or thymine; S is a strong nucleotide such as cytosine and guanine; M is an aminonucleotide such as adenine and cytosine; K is a ketonucleotide such as guanine and thymine; R is adenine and guanine which are purines; Y is cytosine and thymine which are pyrimidines; B is any base other than A (e.g., cytosine, guanine, and thymine); D is any base other than C (e.g., adenine, guanine, and thymine); H is any base other than G (e.g., adenine, cytosine, and thymine); V is any base other than T (e.g., adenine, cytosine, and guanine); N is any nucleotide (not a gap); and Z is zero.
[0087] In any amino acid sequence referenced and / or described herein, single-letter symbols have the following meanings: G (Gly) is glycine; A (Ala) is alanine; L (Leu) is leucine; M (Met) is methionine; F (Phe) is phenylalanine; W (Trp) is tryptophan; K (Lys) is lysine; Q (Gln) is glutamine; E (Glu) is glutamic acid; S (Ser) is serine; P (Pro) is proline; V (Val) is valine; I (Ile) iso Leucine; C (Cys) is cysteine; Y (Tyr) is tyrosine; H (His) is histidine; R (Arg) is arginine; N (Asn) is asparagine; D (Asp) is aspartic acid; T (Thr) is threonine; B (Asx) is aspartic acid or asparagine; J (Xle) is leucine or isoleucine; O (Pyl) is pyrrolidine; U (Sec) is selenocysteine; X (Xaa) is any amino acid; and Z (Glx) is glutamine or glutamic acid.
[0088] Use of target-directed peptides in AAV particles The target-directed peptide may be an independent peptide, or it may be inserted into or conjugated to a parent sequence. In one embodiment, the target-directed peptide is inserted into the capsid protein of the AAV particle.
[0089] One or more target-directed peptides may be inserted into the parent AAV capsid sequence to generate the AAV particles of this disclosure. Target-directed peptides may be inserted into the parent AAV capsid sequence at any position that results in fully functional AAV particles. Target-directed peptides may be inserted into VP1, VP2, and / or VP3. Because amino acid residue numbering differs across AAV serotypes, the exact amino acid position of the target-directed peptide insertion may not be critical. As used herein, the amino acid positions of the parent AAV capsid sequence are described with reference to AAV9 (SEQ ID NO: 2).
[0090] In one embodiment, a target-directed peptide is inserted into a hypervariable region of the AAV capsid sequence. Non-limiting examples of such hypervariable regions include loops IV and VIII of the parent AAV capsid. Although we do not wish to be constrained by theory, these surface-exposed loops are ideal regions for the insertion of target-directed peptides because they are unstructured and poorly conserved.
[0091] In one embodiment, the target-directed peptide is inserted into loop IV. In another embodiment, the target-directed peptide is used to replace part or all of loop IV. As a non-limiting example, the addition of a target-directed peptide to the parent AAV capsid sequence may result in the substitution or mutation of at least one amino acid in the parent AAV capsid.
[0092] In one embodiment, the target-directed peptide is inserted into loop VIII. In another embodiment, the target-directed peptide is used to replace part or all of loop VIII. As a non-limiting example, the addition of a target-directed peptide to the parent AAV capsid sequence may result in the substitution or mutation of at least one amino acid in the parent AAV capsid.
[0093] In one embodiment, more than one target-directed peptide is inserted into the parent AAV capsid sequence. As a non-limiting example, the target-directed peptide may be inserted into both loop IV and loop VIII of the same parent AAV capsid sequence.
[0094] Target-directed peptides may be inserted at any amino acid position in the parent AAV capsid sequence, including, but are not limited to, positions 586-592, 588-589, 586-589, 452-458, 262-269, 464-473, 491-495, 546-557, and / or 659-668.
[0095] In a preferred embodiment, the target-directed peptide is inserted into the parent AAV capsid sequence between amino acids at positions 588 and 589 (loop VIII). In one embodiment, the parent AAV capsid is AAV9 (SEQ ID NO: 2). In a second embodiment, the parent AAV capsid is K449R AAV9 (SEQ ID NO: 3).
[0096] The target-directed peptides described herein can increase the transduction of AAV particles into target tissues compared to parent AAV particles lacking the target-directed peptide insert. In one embodiment, the target-directed peptide increases the transduction of AAV particles into target tissues by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500%, or more compared to parent AAV particles lacking the target-directed peptide insert.
[0097] In one embodiment, a target-directed peptide increases the transduction of AAV particles into CNS cells or tissues by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500%, or more, compared to parent AAV particles lacking the target-directed peptide insert.
[0098] In one embodiment, a target-directed peptide increases the transduction of AAV particles into cells or tissues of PNS by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500%, or more, compared to parent AAV particles lacking the target-directed peptide insert.
[0099] In one embodiment, a target-directed peptide increases the transduction of DRGs into cells or tissues of AAV particles by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500%, or more, compared to parent AAV particles lacking the target-directed peptide insert.
[0100] AAV production The virus production disclosed herein describes processes and methods for producing AAV particles (with enhanced, improved, and / or increased tropism towards target tissues) that can be used to deliver a payload by contacting target cells.
[0101] This disclosure provides a method for generating AAV particles containing target-directed peptides. In one embodiment, the AAV particles are prepared by viral genome replication in viral replication cells. Any method known in the art can be used to prepare the AAV particles. In one embodiment, the AAV particles are produced in mammalian cells (e.g., HEK293). In another embodiment, the AAV particles are produced in insect cells (e.g., Sf9).
[0102] Methods for producing AAV particles are well known in the art and are described, for example, in the following documents: U.S. Patent Nos. 6,204,059, 5,756,283, 6,258,595, 6261,551, 6270,996, 6281,010, 636,5394, 6475,769, 6482,634, 6485,966, 6943,019, 6953,690, 7022,519, 723,8526, 7291,498, and 7491,500. Specification No. 8, Specification No. 5064764, Specification No. 6194191, Specification No. 6566118, Specification No. 8137948; or International Publication Brochure No. 1996039530, International Publication Brochure No. 1998010088, International Publication Brochure No. 1999014354, International Publication Brochure No. 1999015685, International Publication Brochure No. 1999047691, International Publication Brochure No. 2000055342, International Publication Brochure No. 2000075353, and International Publication Brochure No. 2001023597; Methods in Molecular Biology, edited by Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford University Press (1994); Samulski et al. (et al.), J.Vir.63:3822-8 (1989); Kajigaya et al., Proc.Nat'l.Acad.Sci.USA 88:4646-50 (1991); Ruffing et al., J.Vir.66:6922-30 (1992); Kimbauer et al. al.), Vir., 219:37-44 (1996); Zhao et al., Vir. 272:382-93 (2000). The contents of each of these documents are incorporated herein by reference in their entirety. In one embodiment, AAV particles are produced using the method described in International Publication No. 2015191508. The contents of this document are incorporated herein by reference in their entirety.
[0103] Therapeutic applications This disclosure provides a method for treating a disease, disorder, and / or condition in a mammalian subject, including a human subject, the method comprising the steps of administering AAV particles as defined herein, comprising a novel capsid as defined herein ("TRACER AAV particle"), or administering any of the compositions as defined herein, comprising a pharmaceutical composition as defined herein.
[0104] In one embodiment, the TRACER AAV particles of the Disclosure are administered prophylactically to a subject to prevent the onset of a disease. In another embodiment, the TRACER AAV particles of the Disclosure are administered to treat (reduce the effects of) a disease or its symptoms. In yet another embodiment, the TRACER AAV particles of the Disclosure are administered to cure (eliminate) a disease. In yet another embodiment, the TRACER AAV particles of the Disclosure are administered to prevent or delay the progression of a disease. In yet another embodiment, the TRACER AAV particles are used to reverse the adverse effects of the disease. The disease state and / or progression can be determined or monitored by standard methods known in the art.
[0105] In some embodiments, the TRACER AAV particles of this disclosure are useful in the medical field for treating, preventing, alleviating, or improving neurological disorders and / or disabilities. In some embodiments, the TRACER AAV particles of this disclosure are useful in the medical field for treating, preventing, alleviating, or improving tauopathy.
[0106] In some embodiments, the TRACER AAV particles of this disclosure are useful in the medical field for treating, preventing, mitigating, or improving Alzheimer's disease. In some embodiments, the TRACER AAV particles of this disclosure are useful in the medical field for treating, preventing, alleviating, or improving Friedreich's ataxia or any disease in which loss or partial loss of frataxin protein is at its core.
[0107] In some embodiments, the TRACER AAV particles of this disclosure are useful in the medical field for treating, preventing, alleviating, or improving Parkinson's disease. In some embodiments, the TRACER AAV particles of this disclosure are useful in the medical field for treating, preventing, alleviating, or improving amyotrophic lateral sclerosis (ALS).
[0108] In some embodiments, the TRACER AAV particles of this disclosure are useful in the medical field for treating, preventing, alleviating, or improving Huntington's disease. In some embodiments, the TRACER AAV particles of this disclosure are useful in the medical field for treating, preventing, alleviating, or improving neuropathic pain.
[0109] In some embodiments, the TRACER AAV particles of this disclosure are useful in the medical field for treating, preventing, alleviating, or improving diseases associated with the central nervous system. In some embodiments, the TRACER AAV particles of this disclosure are useful in the medical field for treating, preventing, alleviating, or improving diseases associated with the peripheral nervous system.
[0110] In one embodiment, the TRACER AAV particles of this disclosure are administered to a subject having at least one of the diseases or conditions described herein. As used herein, any disease associated with the central or peripheral nervous system and its components (e.g., neurons) may be considered a “neurological disease.”
[0111] Any neurological disorder, including but not limited to the following, can be treated with the TRACER AAV particles or their pharmaceutical compositions as disclosed herein: defect of septum pellucida, acid lipase disease, acid maltase deficiency, acquired epileptic aphasia, acute disseminated encephalomyelitis, attention deficit hyperactivity disorder (ADHD), Addie pupil, Addie syndrome, adrenoleukodystrophy, corpus callosum agenesis, agnosia, Eicardi syndrome, Eicardi-Gutierre syndrome disorder, AIDS-neurological complications, Alexander disease, Alpers disease, alternating hemiplegia, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), anencephaly, aneurysm, and angel Mann syndrome, hemangioma, oxygen deficiency, antiphospholipid antibody syndrome, aphasia, apraxia, arachnoid cyst, arachnoiditis, Arnold-Chiari malformation, arteriovenous malformation, Asperger's syndrome, ataxia, telangiectatic ataxia, ataxia and cerebellar or spinocerebellar degeneration, atrial fibrillation and stroke, attention deficit hyperactivity disorder, autism spectrum disorder, autonomic dysfunction, back pain, Barth syndrome, Batten disease, Becker myotonia, Behçet's disease, Bell's palsy, benign idiopathic blepharospasm, benign focal muscular atrophy, benign intracranial hypertension, Bernhard-Roth syndrome, Vince Wanger disease, blepharospasm, Bloch-Salzberger syndrome, brachial plexus birth trauma, brachial plexus injury, Bradbury-Eggleston syndrome, brain and spinal cord tumors, cerebral aneurysms, brain injury, Brown-Séquard syndrome, bulbar palsy, spinal and bulbar muscular atrophy, autosomal dominant cerebral arteriovenous disease with subcortical infarction and leukoencephalopathy (CADASIL), Canavan disease, carpal tunnel syndrome, burning pain, cavernous spongioma, cavernous hemangioma, cavernous malformation, central cervical spinal cord syndrome, central spinal cord syndrome, central pain syndrome, central pontine myelin disintegration, head injury, ceramidase deficiency, cerebellar degeneration, cerebellar hypoplasia, cerebral aneurysms, cerebral arteriosclerosis, Brain atrophy, cerebral beriberi, spongiform malformation, cerebral gigantism, cerebral hypoxia, cerebral palsy, cerebro-ocular-facial-skeletal syndrome (COFS), Charcot-Marie-Tooth disease, Chiari malformation, cholesterol ester storage disease, chorea, acanthocyanotic chorea, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic orthostatic intolerance, chronic pain, Cockayne syndrome type II, Coffin-Lowry syndrome, colposphecy, coma, complex regional pain syndrome, concentric sclerosis (Barlow's disease), congenital bilateral facial nerve palsy, congenital myasthenia gravis,Congenital myopathy, congenital vascular cavernous malformation, corticobasal degeneration, cranial arteritis, craniosynostosis, Cree encephalitis, Creutzfeldt-Jakob disease, chronic progressive extraocular palsy, cumulative traumatic injury, Cushing's syndrome, giant cell inclusion body disease, cytomegalovirus infection, Dancing Eyes-Dancing Feet Syndrome, Dandy-Walker syndrome, Dawson's disease, De Morsia syndrome, Dejuline-Klumpke palsy, dementia, multiple stroke-related dementia, semantic dementia, subcortical dementia, Lewy body dementia, demyelinating diseases, dentatecerebellar ataxia, dentatorubral atrophy, dermatomyositis, developmental integrative motor disorder, Devic syndrome, diabetic neuropathy, diffuse sclerosis, distal inherited motor neuropathy, Dravet syndrome, autonomic nervous system disorders, dysgraphia, dyslexia , dysphagia, dysphagia, myoclonus cerebellar synergy disorder, progressive cerebellar synergy disorder, dystonia, early infantile epileptic encephalopathy, empty cell syndrome, encephalitis, lethargic encephalitis, brain herniation, encephalomyelitis, encephalopathy, familial infantile encephalopathy, trigeminal nerve area hemangioma, epilepsy, epileptic hemiplegia, paroxysmal ataxia, Herbe's palsy, Herbe-Duchenne and Dégerine-Krumpke palsy, essential tremor, extraplenishing myelin disintegration Myelinolysis, Faber's disease, Fabri's disease, Faal's syndrome, familial autonomic dysfunction, familial hemangioma, familial idiopathic basal ganglia calcification, familial periodic paralysis, familial spastic paralysis, Faber's disease, febrile seizures, fibromuscular dysplasia, Fisher syndrome, hypotonia syndrome, foot drop, Friedreich's ataxia, frontotemporal dementia, Gaucher disease, systemic gangliosidosis (GM1, GM2), Gerstmann syndrome, Gerstmann-Streussler-Scheinker disease, giant axonal neuropathy, giant cell arteritis, giant cell inclusion disease, globoid cell leukodystrophy, glossopharyngeal neuralgia, glycogen storage disease, Guillain-Barré syndrome, Harrellforden-Spatz disease, head trauma, headache, persistent migraine, hemifacial spasm, alternating hemiplegia Alterans), hereditary neuropathy, hereditary spastic paraplegia, hereditary polyneurotic ataxia, herpes zoster, herpes zoster otosum, Hirayama syndrome, Holmes-Ardie syndrome, holoprosencephalopathy,HTLV-1-associated myelopathy, Hughes syndrome, Huntington's disease, Hurler syndrome, hydrocephalus anencephaly, hydrocephalus, normal pressure hydrocephalus, hydromyelopathy, cortisone excess, hypersomnia, hypertonia, hypotonia, hypoxia, immune-mediated encephalomyelitis, inclusion body myositis, incontinentia pigmenti, infantile hypotonia, infantile neuroaxonal dystrophy, infantile phytanate storage, infantile Refsum disease, infantile spasms, inflammatory myopathy, foramen occipital encephalopathy, enteric steatosis, intracranial cyst, increased intracranial pressure, Isaacs syndrome, Joubay Leigh syndrome, Kearns-Sayre syndrome, Kennedy disease, Kinsborne syndrome, Kleine-Levin syndrome, Klippel-Feyll syndrome, Klippel-Trenaunay syndrome (KTS), Klüber-Bucy syndrome, Korsakoff amnesia syndrome, Krabbe disease, Kugelberg-Verander disease, Kuru disease, Lambert-Eaton myasthenic syndrome, Landau-Kleffner syndrome, lateral femoral cutaneous nerve compression, lateral myelin syndrome, learning disability, Leigh disease, Lennox-Gastaut syndrome, Lesser Neweyhan syndrome, leukodystrophy, Levine-Critchley syndrome, Lewy body dementia, Lichtheim's disease, lipid storage disorder, lipidoid proteinosis, gyral defects, confinement syndrome, Lou Gehrig's disease, lupus-neurological sequelae, Lyme disease-neurological complications, lysosomal storage disorder, Machado-Joseph disease, cerebral encephalopathy, megacephaly, Melkerson-Rosenthal syndrome, meningitis, meningitis and encephalitis, Menkes disease, paresthesia, metachromatic leukodystrophy, microcephaly, dysphagia Pain, Miller-Fischer syndrome, mild stroke, mitochondrial myopathy, mitochondrial DNA depletion syndrome, Moebius syndrome, monolimbic muscular atrophy, Morban syndrome, motor neuron disease, Moyamoya disease, mucolipidosis, mucopolysaccharidosis, multiple infarct dementia, multifocal motor neuropathy, multiple sclerosis, multiple system atrophy, multiple system atrophy with orthostatic hypotension, muscular dystrophy, congenital myasthenia gravis, myasthenia gravis, myelinoclastic diffuse sclerosis (Myelinoclastic Diffuse Sclerosis), myelitis, infantile myoclonic encephalopathy, myoclonus, myoclonic epilepsy, myopathy, congenital myopathy, thyroid-toxic myopathy, myotonia, congenital myotonia, narcolepsy, NARP (neuropathy, ataxia, and retinitis pigmentosa), neuroacidosis, neurodegeneration with cerebral iron accumulation,Neurodegenerative diseases, neurofibromatosis, neuroleptic malignant syndrome, neurological complications of AIDS, neurological complications of Lyme disease, neurological outcomes of cytomegalovirus infection, neurological findings of Pompe disease, neurological complications of lupus, neuromyelitis optica, neuromyotonia, neuronal ceroid lipofuscinosis, neuronal cell migration disorders, neuropathic pain, hereditary neuropathy, neuropathy, neurosarcoidosis, neurosyphilis, neurotoxicity, spongiform nevus, Niemann-Pick disease, O'Sullivan-McLeod syndrome, occipital neuralgia, Ohtahara syndrome, Olivepontocerebellar atrophy, oculoclonal myoclonus, orthostatic hypotension, abuse syndrome, chronic pain, pantothenate kinase-associated neurodegeneration, paraneoplastic syndrome, paresthesia, Parkinson's disease, paroxysmal chorea athetosis, paroxysmal migraine, Parry-Romberg disease, Pelizaeus-Merzbacher disease, Penner-Shocker II syndrome, perineurial cyst, peroneal muscle atrophy, periodic paralysis, peripheral neuropathy, periventricular leukomalacia, persistent vegetative state, pervasive developmental disorder, phytanic acid storage, Pick's disease, nerve compression (Pinched) Nerve), piriformis syndrome, pituitary tumor, polymyositis, Pompe disease, porencephaly, post-polio syndrome, postherpetic neuralgia, post-infectious encephalomyelitis, post-orthostatic hypotension, post-orthostatic tachycardia syndrome, post-orthostatic tachycardia syndrome, primary dentate atrophy, primary lateral sclerosis, primary progressive aphasia, prion disease, progressive bulbar palsy, progressive hemifacial atrophy, progressive gait ataxia, progressive multifocal leukoencephalopathy, progressive muscular atrophy, progressive sclerosing poliodystrophy, progressive supranuclear palsy, prosopagnosia, pseudobulbar palsy, pseudo-Torch syndrome, pseudotoxoplasmosis Syndrome), pseudotumor, psychogenic movement disorders, Ramsay Hunt syndrome I, Ramsay Hunt syndrome II, Rasmussen encephalitis, reflex sympathetic dystrophy syndrome, Refsum disease, infantile Refsum disease, repetitive movement disorder, motor hyperactivity injury, restless limb syndrome, retrovirus-associated myelopathy, Rett syndrome, Rett syndrome, Rheumatoid encephalitis, Riley-Day syndrome, sacral nerve root cyst, chorea, salivary gland disorders, Sandhoff disease, Schilder's disease, cerebral fissure, Zytelberger disease, paroxysmal disorder, semantic dementia, septal optic nerve malformation,Severe myoclonic epilepsy of infants (SMEI), shaken baby syndrome, herpes zoster, Shy-Drager syndrome, Sjögren's syndrome, sleep apnea, sleeping sickness, Sotos syndrome, spasticity, spina bifida, spinal cord infarction, spinal cord injury, spinal cord tumor, spinal muscular atrophy, spinocerebellar ataxia, spinocerebellar atrophy, spinocerebellar degeneration, sporadic ataxia, Steele-Richardson-Olszevski syndrome, generalized rigidity syndrome, striatonigral degeneration, stroke, Sturge-Weber syndrome, subacute sclerosing panencephalitis, subcortical arteriosclerotic encephalopathy, short-lasting, unilateral neuralgia-like symptoms (SUNCT). Neuralgiforms) Headache, dysphagia, Sydenham's chorea, syncope, syphilitic myelosclerosis, syringomyelia, syringomyelia, systemic lupus erythematosus, spinal fistula, tardive dyskinesia, Tahlob's cyst, Tay-Sachs disease, temporal arteritis, tethered cord syndrome, Thomsen myotonia, thoracic outlet syndrome, thyroid toxic myopathy, painful check, Todd's palsy, Tourette's syndrome, transient ischemic attack, transmissible spongiform encephalopathy, transverse myelitis, traumatic brain injury, tremor, trigeminal neuralgia, tropical spastic paraplegia, Troyer's syndrome, tuberous sclerosis, vascular epithelial tumors Tumor, central and peripheral nervous system vasculitis syndromes, vitamin B12 deficiency, von Ekonomo disease, von Hippel-Lindau disease (VHL), von Recklinghausen disease, Wallenberg syndrome, Wertnig-Hoffmann disease, Wernicke-Korsakoff syndrome, West syndrome, whiplash, Wipple disease, Williams syndrome, Wilson's disease, Wollman disease, X-linked spinal muscular atrophy.
[0112] Treatment methods for neurological disorders TRACER AAV particles encoding protein payloads This disclosure provides a method for introducing the TRACER AAV particles of this disclosure into cells, comprising the step of introducing one of the vectors into the cells in an amount sufficient to cause an increase in the production of target mRNA and protein. In some embodiments, the cells may be neurons such as motor neurons, hippocampal neurons, entorhinal neurons, thalamic neurons, cortical neurons, sensory neurons, sympathetic neurons, or parasympathetic neurons, as well as glial cells such as astrocytes, microglia, and / or oligodendrocytes.
[0113] This disclosure discloses a method for treating neurological disorders in subjects requiring treatment that are associated with insufficient function / presence of target proteins (e.g., ApoE, FXN). The method optionally comprises the step of administering a therapeutically effective amount of a composition comprising the TRACER AAV particles of this disclosure to the subject. In a non-limiting example, the TRACER AAV particles can increase target gene expression, increase target protein production, and thus reduce one or more symptoms of the neurological disorder in the subject, thereby therapeutically treating the subject.
[0114] In one embodiment, the composition comprising the TRACER AAV particles of the present disclosure is administered to the central nervous system of a target by systemic administration. In one embodiment, systemic administration is by intravenous injection. In some embodiments, a composition comprising the TRACER AAV particles of the Disclosure is administered to the target central nervous system. In other embodiments, a composition comprising the TRACER AAV particles of the Disclosure is administered to the target CNS tissue (e.g., the target putamen, thalamus, or cortex).
[0115] In one embodiment, a composition comprising the TRACER AAV particles of this disclosure is administered to the target central nervous system by intraparenchymal injection. Non-limiting examples of intraparenchymal injection include intraputamen, intracortex, intrathalamus, intrastriatum, intrahippocampus, or intrarhinorhinal cortex.
[0116] In one embodiment, a composition comprising the TRACER AAV particles of the present disclosure is administered to the target central nervous system by intracellular injection and intravenous injection. In one embodiment, the TRACER AAV particles of the present disclosure can be delivered to certain types of targeted cells, including, but not limited to, thalamic neurons, hippocampal neurons, entorhinal neurons, cortical neurons, motor neurons, sensory neurons, excitatory neurons, inhibitory neurons, sympathetic neurons, or parasympathetic neurons; glial cells including oligodendrocytes, astrocytes, and microglia; and / or other cells surrounding neurons, such as T cells.
[0117] In one embodiment, the TRACER AAV particles of this disclosure can be delivered to neurons in the putamen, thalamus, and / or cortex. In some embodiments, the TRACER AAV particles of this disclosure can be used as a therapy for neurological disorders.
[0118] In some embodiments, the TRACER AAV particles of this disclosure can be used as a taupathic therapy. In some embodiments, the TRACER AAV particles of this disclosure can be used as a therapy for Alzheimer's disease.
[0119] In some embodiments, the TRACER AAV particles of this disclosure can be used as a therapy for amyotrophic lateral sclerosis. In some embodiments, the TRACER AAV particles of this disclosure can be used as a therapy for Huntington's disease.
[0120] In some embodiments, the TRACER AAV particles of this disclosure can be used as a therapy for Parkinson's disease. In some embodiments, the TRACER AAV particles of this disclosure can be used as a therapy for Friedreich's ataxia.
[0121] In some embodiments, the TRACER AAV particles of this disclosure can be used as a therapy for chronic pain or neuropathic pain. In one embodiment, administration of the TRACER AAV particles described herein to a subject can increase the target protein levels of the subject. Target protein levels are, but are not limited to, approximately 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100% in the subject, such as the CNS, regions of the CNS, or specific cells of the CNS, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, It can increase levels by 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100%, or 95-100%. As a non-limiting example, TRACER AAV particles can increase the protein level of a target protein by at least 50%. As a non-limiting example, TRACER AAV particles can increase the protein level of a target protein by at least 40%. As a non-limiting example, the subject may show a 10% increase in the target protein. As a non-limiting example, TRACER AAV particles can increase the protein level of a target protein by a doubling from the baseline. In one embodiment, TRACER AAV particles bind to a 5-6 times higher level of the target protein.
[0122] In one embodiment, administration of the TRACER AAV particles described herein to a subject can increase the expression of the target protein in the subject. The expression of the target protein may be, but is not limited to, about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100% in the subject, such as the CNS, regions of the CNS, or specific cells of the CNS, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, It can increase by 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100%, or 95-100%. As a non-limiting example, TRACER AAV particles can increase the expression of target proteins by at least 50%. As a non-limiting example, TRACER AAV particles can increase the expression of target proteins by at least 40%.
[0123] In one embodiment, intravenous administration of the TRACER AAV particles described herein to a subject can increase the CNS expression of the target protein in the subject. The expression of the target protein may be, but is not limited to, about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100% in the subject, such as in the CNS, regions of the CNS, or specific cells of the CNS, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, It can increase by 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100%, or 95-100%. As a non-limiting example, TRACER AAV particles can increase the expression of target proteins in the CNS by at least 50%. As a non-limiting example, TRACER AAV particles can increase the expression of target proteins in the CNS by at least 40%.
[0124] In some embodiments, the TRACER AAV particles of this disclosure can be used to increase the expression of target proteins in astrocytes to treat neurological disorders. The expression of target proteins in astrocytes can be significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30% %, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20- 50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 3 0-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%,50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60- It can be increased by 90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.
[0125] In some embodiments, TRACER AAV particles can be used to increase target proteins in microglia. The increase in target proteins in microglia can be independently and significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10- 30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30- 95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%,It can be increased by 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.
[0126] In some embodiments, TRACER AAV particles can be used to increase target proteins in cortical neurons. The increase in target proteins in cortical neurons can be independently and significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10 ~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50% , 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30- 95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%,It can be increased by 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.
[0127] In some embodiments, TRACER AAV particles can be used to increase target proteins in hippocampal neurons. The increase in target proteins in hippocampal neurons can be independently and significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%, including 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, and 10 ~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50% , 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30- 95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%,It can be increased by 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.
[0128] In some embodiments, TRACER AAV particles can be used to increase target proteins in DRG and / or sympathetic neurons. The increase in target proteins in DRG and / or sympathetic neurons can be independently and significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%,45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60- It can be increased by 85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.
[0129] In some embodiments, the TRACER AAV particles of this disclosure can be used to increase target proteins in sensory neurons to treat neurological disorders. Target proteins in sensory neurons can be significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30% %, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20- 50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 3 0-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%,50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60- It can be increased by 90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.
[0130] In some embodiments, the TRACER AAV particles of this disclosure can be used to increase target proteins and reduce symptoms of a target neurological disorder. The increase in target proteins and / or reduction of symptoms of a neurological disorder can be independently and significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20% %, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40% , 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80% , 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%,50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75 The values can be changed by %, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95% (increasing in the case of target protein production, decreasing in the case of symptoms of neurological disorders).
[0131] In one embodiment, the TRACER AAV particles of this disclosure can be used to reduce declines in functional capacity and activities of daily living as measured by standard assessment methods such as the Total Functional Capacity (TFC) scale, but are not limited to these.
[0132] In one embodiment, the TRACER AAV particles of the present disclosure can be used to improve the ability in any determination used to measure the symptoms of neurological disorders. Such assessments are not limited to these, but include: ADAS-cog (Alzheimer's Disease Assessment Scale - Cognition), MMSE (Mini-Mental State Examination), GDS (Geriatric Depression Scale), FAQ (Functional Activity Questionnaire), ADL (Activities of Daily Living), GPCOG (General Practitioner Cognitive Assessment), Mini-Cog, AMTS (Simplified Mental Health Test Score), Clock Drawing Test, 6-CIT (6-Item Cognitive Impairment Test), TYM (Test Your Memory), MoCa (Montreal Cognitive Assessment), ACE-R (Adenbrooks Cognitive Assessment), MIS (Memory Impairment Screening), BADLS (Bristol Activities of Daily Living Scale), Barthel Index, Assessment of Functional Independence, Instrumental Activities of Daily Living, IQCODE (Informant Questionnaire on Cognitive Decline in the Elderly), Neuropsychiatric Symptom Assessment, and The Cohen-Mansfield Agitation Assessment. Examples include the Inventory, BEHAVE-AD, EuroQol, Short Form-36, and / or the MBR Caregiver Strain Instrument, or any other test as described in Sheehan B (Ther Adv Neurol Disord. 5(6):349-358(2012)). The contents of this document are incorporated herein by reference in their entirety.
[0133] In some embodiments, the composition is administered as a monotherapy or combination therapy for the treatment of neurological disorders. TRACER AAV particles encoding the target protein may be used in combination with one or more other therapeutic agents. “In combination with” does not imply that the agonists must be administered at the same time and / or formulated to be delivered together, but such delivery methods are within the scope of this disclosure. The composition may be administered simultaneously with, before, or after one or more other desired therapeutic agents or medical procedures. Generally, each agonist will be administered in a dose and / or time schedule determined for that agonist.
[0134] Therapeutic agents that can be used in combination with the TRACER AAV particles of this disclosure may include small molecule compounds that are antioxidants, anti-inflammatory agents, anti-apoptotic agents, calcium modulators, anti-glutamatergic agents, structural protein inhibitors, compounds involved in muscle function, and compounds involved in metal ion regulation. In non-limiting examples, the combination therapy may also be in combination with one or more neuroprotective agents, such as small molecule compounds, growth factors, and hormones, whose neuroprotective effects against motor neuron degeneration have been studied.
[0135] Compounds tested for the treatment of neurological disorders that can be used in combination with the TRACER AAV particles described herein include, but are not limited to, the following: cholinesterase inhibitors (donepezil, rivastigmine, galantamine); NMDA receptor antagonists such as memantine; antipsychotics; antidepressants; anticonvulsants (e.g., sodium valproate and levetiracetam for myoclonus); secretase inhibitors; amyloid aggregation inhibitors; copper or zinc modulators; BACE inhibitors; methylene blue, phenotia Tau aggregation inhibitors such as din, anthraquinone, n-phenylamine, or rhodamine; microtubule stabilizers such as NAP, taxol, or paclitaxel; kinase or phosphatase inhibitors such as those targeting GSK3β (lithium) or PP2A; immunization with Aβ peptide or tau phosphoepitope; anti-tau or anti-amyloid antibodies; dopamine depletion agents (e.g., tetrabenazine for chorea), benzodiazepines (e.g., clonazepam for myoclonus, chorea, dystonia, stiffness, and / or spasticity) (e.g., dopamine amino acid precursors (e.g., levodopa for stiffness), skeletal muscle relaxants (e.g., baclofen, tizanidine for stiffness and / or spasticity); inhibitors of acetylcholine release at neuromuscular junctions causing muscle paralysis (e.g., botulinum toxin for bruxism and / or dystonia); atypical neuroleptics (e.g., olanzapine and quetiapine for psychosis and / or irritability, risperidone, sulpiride, and haloperidol for psychosis, chorea, and / or irritability, treatment resistance) Clozapine for psychotic disorders, aripiprazole for psychosis with marked negative symptoms; selective serotonin reuptake inhibitors (SSRIs) (e.g., citalopram, fluoxetine, paroxetine, sertraline, mirtazapine, venlafaxine for depression, anxiety, paranoid obsessive-compulsive behavior, and / or irritability); hypnotics (e.g., xopiclone and / or zolpidem for altering the sleep-wake cycle); anticonvulsants (e.g., sodium valproate and carbamazepine for mania or hypomania);Also, mood stabilizers (e.g., lithium for mania or hypomania).
[0136] To treat neurological disorders, neurotrophic factors can be used in combination therapy with the TRACER AAV particles of this disclosure. Generally, neurotrophic factors are defined as substances that promote the survival, growth, differentiation, proliferation, and / or maturation of neurons, or that stimulate increased neuronal activity. In some embodiments, the method further comprises the step of delivering one or more trophic factors to a subject in need of treatment. Examples of trophic factors, but not limited to, include IGF-I, GDNF, BDNF, CTNF, VEGF, coliberine, xaliprodene, thyroid-stimulating hormone-releasing hormone, and ADNF, and variants thereof.
[0137] In one embodiment, the TRACER AAV particles described herein are AAV-IGF-I (e.g., Vincent et al., Neuromolecular See medicine, 2004, 6, 79-85; the entire contents of this document are incorporated herein by reference) and AAV-GDNF (e.g., Wang et al.) It can be co-administered with TRACER AAV particles expressing neurotrophic factors, such as (see al.), J Neurosci., 2002, 22, 6920-6928; the entire contents of this document are incorporated herein by reference).
[0138] In one embodiment, administration of TRACER AAV particles to a subject increases the expression of a target protein in the subject, and this increased expression of the target protein reduces the effects and / or symptoms of the subject's neurological disorder.
[0139] As a non-limiting example, the target protein may be an antibody or a fragment thereof. TRACER AAV particles containing RNAi agents or regulatory polynucleotides This disclosure provides a method for introducing TRACER AAV particles of this disclosure, which include a viral genome having nucleic acid sequences encoding one or more siRNA molecules, into cells, the method comprising the step of introducing one of the vectors into the cells in an amount sufficient to cause degradation of a target mRNA, thereby activating target-specific RNAi in the cells. In some embodiments, the cells may be neurons such as motor neurons, hippocampal neurons, entorhinal neurons, thalamic neurons, cortical neurons, sensory neurons, sympathetic neurons, or parasympathetic neurons, as well as glial cells such as astrocytes, microglia, and / or oligodendrocytes.
[0140] This disclosure provides a method for treating neurological disorders associated with dysfunction of a target protein in a subject requiring treatment. The method comprises the step of administering to the subject a therapeutically effective amount of a composition comprising, optionally, a viral genome having nucleic acid sequences encoding one or more siRNA molecules, TRACER AAV particles. In non-limiting examples, the siRNA molecules can silence target gene expression, inhibit target protein production, and reduce one or more symptoms of the neurological disorder in the subject, thereby therapeutically treating the subject.
[0141] In some embodiments, a composition comprising the TRACER AAV particles of the present disclosure, which include a viral genome encoding one or more siRNA molecules, comprises an AAV capsid that enables transduction enhancement of CNS cells and / or PNS cells after intravenous administration.
[0142] In some embodiments, a composition comprising the TRACER AAV particles of the present disclosure having a viral genome encoding at least one siRNA molecule is administered to the central nervous system of a target. In other embodiments, a composition comprising the TRACER AAV particles of the present disclosure is administered to a tissue of a target (e.g., the putamen, thalamus, or cortex of a target).
[0143] In one embodiment, a composition comprising TRACER AAV particles of the present disclosure, which include a viral genome having nucleic acid sequences encoding one or more siRNA molecules, is administered systemically to the central nervous system of a target. In one embodiment, systemic administration is by intravenous injection.
[0144] In one embodiment, a composition comprising the TRACER AAV particles of this disclosure, which include a viral genome having nucleic acid sequences encoding one or more siRNA molecules, is administered to the target central nervous system by intraparenchymal injection. Non-limiting examples of intraparenchymal injection include intraputamen, intracortex, intrathalamus, intrastriatum, intrahippocampus, or intrarhinal cortex.
[0145] In one embodiment, a composition comprising TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules is administered to the target central nervous system by intraparal injection and intravenous injection.
[0146] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be delivered to certain types or targeted cells, including, but not limited to, thalamic neurons, hippocampal neurons, entorhinal neurons, cortical neurons, motor neurons, sensory neurons, excitatory neurons, inhibitory neurons, sympathetic neurons, or parasympathetic neurons; glial cells including oligodendrocytes, astrocytes, and microglia; and / or other cells surrounding neurons, such as T cells.
[0147] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be delivered to neurons in the putamen, thalamus, and / or cortex.
[0148] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used as a therapy for neurological disorders.
[0149] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used as a taupathic therapy.
[0150] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used as a therapy for Alzheimer's disease.
[0151] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used as a therapy for amyotrophic lateral sclerosis.
[0152] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used as a therapy for Huntington's disease.
[0153] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used as a therapy for Parkinson's disease.
[0154] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used as a therapy for Friedreich's ataxia.
[0155] In one embodiment, administration of TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules to a subject can reduce the target protein level in the subject. The target protein level may be, but is not limited to, approximately 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100% in the subject, such as in the CNS, regions of the CNS, or specific cells of the CNS, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, It is possible to reduce levels by 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100%, or 95-100%. As a non-limiting example, TRACER AAV particles can reduce the protein level of a target protein by at least 50%. As a non-limiting example, TRACER AAV particles can reduce the protein level of a target protein by at least 40%.
[0156] In one embodiment, administration of TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules to a subject can reduce the expression of the target protein in the subject. The expression of the target protein may be reduced by approximately 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100% in the subject, such as in the CNS, regions of the CNS, or specific cells of the CNS, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, It is possible to reduce the expression by 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100%, or 95-100%. As a non-limiting example, TRACER AAV particles can reduce the expression of target proteins by at least 50%. As a non-limiting example, TRACER AAV particles can reduce the expression of target proteins by at least 40%.
[0157] In one embodiment, administration of TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules to a subject can reduce the expression of target proteins in the subject's CNS. The expression of target proteins may be reduced by approximately 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100% in the subject, such as in the subject's CNS, regions of the CNS, or specific cells of the CNS, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, It is possible to reduce the expression by 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100%, or 95-100%. As a non-limiting example, TRACER AAV particles can reduce the expression of target proteins by at least 50%. As a non-limiting example, TRACER AAV particles can reduce the expression of target proteins by at least 40%.
[0158] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used to suppress target proteins in astrocytes to treat neurological disorders. The target proteins in astrocytes can be significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25% %, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20- 40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 3 0-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%,45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60- It can be suppressed by 80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. Target proteins in astrocytes are present in 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or significantly more than 95%, with percentages ranging from 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, and 5-70%. %, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25- 40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%,35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80% It can be reduced by 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.
[0159] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used to suppress target proteins in microglia. Suppression of target proteins in microglia can be independently achieved at 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or significantly greater than 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 1 0-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20- 40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75 %, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%,45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80% It can be suppressed by 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or significantly greater than 95%, and may also be 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-8 0%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55 %, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25 ~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%,35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85 It may also be %, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.
[0160] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used to suppress target proteins in cortical neurons. Suppression of target proteins in cortical neurons can be independently and significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, and 10-20%. 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35% 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70% , 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%,45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60- It can be suppressed by 80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or significantly greater than 95%, and may also be 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5 ~80%, 5~85%, 5~90%, 5~95%, 10~20%, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 1 5-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-4 5%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%,35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 5 It may also be 0-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.
[0161] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used to suppress a target protein in hippocampal neurons. Suppression of the target protein in hippocampal neurons can be independently and significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%, including 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, and 10-20%. 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35% 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70% , 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%,45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60- It can be suppressed by 80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or significantly greater than 95%, and may also be 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5 ~80%, 5~85%, 5~90%, 5~95%, 10~20%, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 1 5-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-4 5%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%,35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 5 It may also be 0-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.
[0162] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used to suppress target proteins in DGR and / or sympathetic neurons. Suppression of target proteins in DGR and / or sympathetic neurons can be independently and significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90% %, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-9 5%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30 ~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%,45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70% It can be suppressed by 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or significantly greater than 95%, and may also be 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5- 75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45 %, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25 ~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%,35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75 It may also be %, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.
[0163] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used to suppress target proteins in sensory neurons to treat neurological disorders. The target proteins in sensory neurons can be significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%. %, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20- 40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 3 0-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%,45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60- It can be suppressed by 80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. Target proteins in sensory neurons are present in 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or significantly more than 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, and 5-70%. %, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25- 40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%,35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80% It can be suppressed by 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.
[0164] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used to suppress target proteins and reduce symptoms of a target neurological disorder. Suppression of target proteins and / or reduction of symptoms of neurological disorders can be independently achieved by significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5- 95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20 ~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 3 0-65%, 30-70%, 30-75%, 30-80%, 30-85%, 30-90%, 30-95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%,45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75 It can be reduced or suppressed by %, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.
[0165] In one embodiment, TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used to reduce declines in functional capacity and daily living activities as measured by standard assessment methods such as the Total Functional Capacity (TFC) scale, but are not limited to this.
[0166] In some embodiments, the composition is administered as a monotherapy or combination therapy for the treatment of neurological disorders. TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules can be used in combination with one or more other therapeutic agents. “In combination with” does not imply that the agonists must be administered at the same time and / or formulated to be delivered together, but such delivery methods are within the scope of this disclosure. The composition can be administered concurrently with, before, or after one or more other desired therapeutic agents or medical procedures. Generally, each agonist will be administered in a dose and / or time schedule determined for that agonist.
[0167] Therapeutic agents that can be used in combination with TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules may be small molecule compounds that are antioxidants, anti-inflammatory agents, anti-apoptotic agents, calcium regulators, anti-glutamin agonists, structural protein inhibitors, compounds involved in muscle function, and compounds involved in metal ion regulation.
[0168] Compounds tested to treat neurological disorders that can be used in combination with TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules include, but are not limited to, the following: cholinesterase inhibitors (donepezil, rivastigmine, galantamine); NMDA receptor antagonists such as memantine; antipsychotics; antidepressants; anticonvulsants (e.g., sodium valproate and levetiracetam for myoclonus); secretase inhibitors; amyloid aggregation inhibitors; copper or zinc modulators; and BACE inhibitors. Agents; tau aggregation inhibitors such as methylene blue, phenothiazine, anthraquinone, n-phenylamine, or rhodamine; microtubule stabilizers such as NAP, taxol, or paclitaxel; kinase or phosphatase inhibitors such as those targeting GSK3β (lithium) or PP2A; immunization with Aβ peptide or tau phosphoepitope; anti-tau or anti-amyloid antibodies; dopamine depletion agents (e.g., tetrabenazine for chorea); benzodiazepines (e.g., myoclonus, chorea, dysentery). Clonazepam for stonia, stiffness, and / or spasticity; amino acid precursors of dopamine (e.g., levodopa for stiffness); skeletal muscle relaxants (e.g., baclofen, tizanidine for stiffness and / or spasticity); inhibitors of acetylcholine release at neuromuscular junctions causing muscle paralysis (e.g., botulinum toxin for teeth grinding and / or dystonia); atypical neuroleptics (e.g., olanzapine and quetiapine for psychosis and / or irritability, psychosis, chorea, and Risperidone, sulpiride, and haloperidol for depression, anxiety, paranoid obsessive-compulsive behavior, and / or irritability; clozapine for treatment-resistant psychosis; aripiprazole for psychosis with marked negative symptoms); selective serotonin reuptake inhibitors (SSRIs) (e.g., citalopram, fluoxetine, paroxetine, sertraline, mirtazapine, venlafaxine for depression, anxiety, paranoid obsessive-compulsive behavior, and / or irritability); hypnotics (e.g., xopicl and / or zolpidem for altering the sleep-wake cycle);Anticonvulsants (e.g., sodium valproate and carbamazepine for mania or hypomania); and mood stabilizers (e.g., lithium for mania or hypomania).
[0169] Neurotrophic factors can be used in combination therapy with TRACER AAV particles containing a viral genome having nucleic acid sequences encoding one or more siRNA molecules for the treatment of neurological disorders. Generally, neurotrophic factors are defined as substances that promote neuronal survival, growth, differentiation, proliferation, and / or maturation, or stimulate increased neuronal activity. In some embodiments, the method further comprises the step of delivering one or more trophic factors to a subject in need of treatment. Examples of trophic factors, but not limited to, include IGF-I, GDNF, BDNF, CTNF, VEGF, coliberin, xaliprodene, thyroid-stimulating hormone-releasing hormone, and ADNF, and their variants.
[0170] In one embodiment, TRACER AAV particles encoding at least one siRNA double-stranded nucleic acid sequence targeting a gene of interest can be co-administered with TRACER AAV particles expressing neurotrophic factors such as AAV-IGF-I (e.g., Vincent et al., Neuromolecular Medicine, 2004, 6, 79-85; the entire contents of this document are incorporated herein by reference) and AAV-GDNF (e.g., Wang et al., J Neurosci., 2002, 22, 6920-6928; the entire contents of this document are incorporated herein by reference).
[0171] In one embodiment, administration of TRACER AAV particles to a subject reduces the expression of a target protein in the subject, and this reduction in target protein expression reduces the effects and / or symptoms of the subject's neurological disorder.
[0172] definition Adeno-associated virus: As used herein, the term “adeno-associated virus” or “AAV” refers to any member of the genus Dependvirus containing any particle, sequence, gene, protein, or component derived therefrom.
[0173] AAV particles: As used herein, “AAV particles” is a virus comprising a capsid and a viral genome having at least one payload region and at least one ITR. As used herein, “AAV particles of the Disclosure” is an AAV particle comprising a parent capsid sequence having at least one target-directed peptide insert. AAV particles of the Disclosure may be recombinantly produced or based on an adeno-associated virus (AAV) parent or reference sequence. AAV particles may be derived from any serotype described herein or known in the art, including serotype combinations (i.e., “pseudotype” AAV), or from various genomes (e.g., single-stranded or self-complementary). In addition, AAV particles may be replication-deficient and / or targeted. In one embodiment, AAV particles may have a target-directed peptide inserted into the capsid to enhance tropism to a desired target tissue. References to AAV particles of the Disclosure should be understood to also include their pharmaceutical compositions, even if not expressly stated.
[0174] To administer: As used herein, the term “to administer” means to provide a pharmacokinetic agent or composition. Improvement: As used herein, the terms “improvement” or “to improve” mean reducing the severity of at least one indicator of a condition or disease. For example, in the context of neurodegenerative disorders, improvement includes a reduction in neuronal loss.
[0175] Animals: As used herein, the term “animal” refers to any member of the animal kingdom. In some embodiments, “animal” refers to a human at any stage of development. In some embodiments, “animal” refers to a non-human animal at any stage of development. In certain embodiments, a non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cattle, primate, or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and nematodes. In some embodiments, an animal is a transgenic animal, a genetically modified animal, or a clone.
[0176] Antisense strand: As used herein, the terms “antisense strand,” “first strand,” or “guide strand” of an siRNA molecule refer to a strand substantially complementary to approximately 10–50 nucleotides, e.g., a compartment of approximately 15–30, 16–25, 18–23, or 19–22 nucleotides, of the mRNA of the gene targeted for silencing. The antisense strand or first strand is sufficiently complementary to the desired target mRNA sequence and to a degree sufficient to direct target-specific silencing, e.g., sufficient complementarity to trigger the disruption of the desired target mRNA by an RNAi mechanism or process.
[0177] Approximately: As used herein, the terms “approximately” or “about” applied to one or more values of interest refer to a value that is similar to the specified reference value. In certain embodiments, unless otherwise specified or it is evident from the circumstances (except where such a number would exceed 100% of the possible values), the terms “approximately” or “about” refer to a range of values that fall in either direction (greater or less) within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or lower percentages of the specified reference value.
[0178] Capsid: As used herein, the term “capsid” refers to the protein outer shell of a viral particle. Complementary and substantially complementary: As used herein, the term “complementary” refers to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide chains. Complementary polynucleotide chains can form base pairs in the Watson-Crick manner (e.g., A to T, A to U, C to G) or in any other manner that allows for the formation of double helix. As those skilled in the art will recognize, when RNA is used instead of DNA, uracil, not thymine, is the base considered complementary to adenine. However, where U is expressly stated in the context of this disclosure, its ability to substitute for T is implied unless otherwise specified. Complete or 100% complementarity refers to a situation in which each nucleotide unit of one polynucleotide chain can form a hydrogen bond with a nucleotide unit of a second polynucleotide chain. Incomplete complementarity refers to a situation in which some, but not all, nucleotide units of two chains can form hydrogen bonds with one another. For example, in two 20-decade-mers, if only two base pairs on each strand can form hydrogen bonds with one another, the polynucleotide chain exhibits 10% complementarity. In the same example, if all 18 base pairs on each strand can form hydrogen bonds with one another, the polynucleotide chain exhibits 90% complementarity. As used herein, the term “substantially complementary” means that the siRNA has sufficient sequences (e.g., in the antisense strand) to bind to the desired target mRNA and trigger RNA silencing of the target mRNA.
[0179] Regulatory elements: As used herein, “regulatory elements,” “regulatory regulatory elements,” or “regulatory sequences” refer to promoter regions, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRESs"), and enhancers, etc. These provide replication, transcription, and translation of coding sequences in recipient cells. Not all of these regulatory elements are always necessary, as long as the selected coding sequence is able to replicate, transcribe, and / or translate in a suitable host cell.
[0180] Delivery: As used herein, “delivery” means the act or manner of delivering AAV particles, compounds, substances, entities, parts, shipments, or payloads. Element: As used herein, the term “element” refers to a distinct part of an entity. In some embodiments, an element may be a polynucleotide sequence having a specific purpose, incorporated into a longer polynucleotide sequence.
[0181] Encapsulating: As used herein, the term “encapsulating” means to contain, surround, or enclose. For example, a capsid protein encapsulates a viral genome.
[0182] Genetically modified: As used herein, embodiments of the disclosure are “genetically modified” if they are designed to have features or properties that are altered from the starting point, wild type, or natural molecule, whether structural or chemical.
[0183] Effective dose: As used herein, the term “effective dose” of an agonist means an amount sufficient to produce a beneficial or desired outcome, such as a clinical outcome, and therefore the “effective dose” depends on the context in which it is applied. For example, in the context of administering an agonist to treat cancer, the effective dose of the agonist is an amount sufficient to achieve the cancer treatment as specified herein, compared, for example, to the response obtained without administering the agonist.
[0184] Expression: As used herein, “expression” of a nucleic acid sequence means one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5' cap formation, and / or 3' end processing); (3) translation of RNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein.
[0185] Features: As used herein, "features" refers to a characteristic, trait, or distinctive element. Formulation: As used herein, “Formulation” comprises at least one AAV particle (active ingredient) and excipients and / or inactive ingredients.
[0186] Fragment: As used herein, "fragment" refers to a portion. For example, an antibody fragment may include a CDR, or a heavy chain variable region, or an scFv, etc. Functional: As used herein, a “functional” biological molecule is a biological molecule in which it exhibits the properties and / or activity that characterize it.
[0187] Gene Expression: The term "gene expression" refers to the process by which a nucleic acid sequence is successfully transcribed and, in most cases, translated to produce a protein or peptide. For clarity, when "gene expression" is mentioned in reference to its measurement, it should be understood that the measurement may be of a nucleic acid transcript, such as RNA or mRNA, or of an amino acid translation product, such as polypeptide or peptide. Methods for measuring the quantity or level of RNA, mRNA, polypeptides, and peptides are well known in the art.
[0188] Homology: As used herein, the term “homology” refers to the overall relationship between polymer molecules, for example, between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polymer molecules are considered “homology” to one another if their sequences are identical or similar by at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. The term “homology” necessarily refers to a comparison between at least two sequences (polynucleotide sequences or polypeptide sequences). According to this disclosure, two polynucleotide sequences are considered homologous if the polypeptides they encode are at least about 50%, 60%, 70%, 80%, 90%, 95%, or even 99% of at least about 20 consecutive amino acids. In some embodiments, homologous polynucleotide sequences are characterized by their ability to encode at least four to five uniquely designated sequences of amino acids. For polynucleotide sequences less than 60 nucleotides in length, homology is determined by their ability to encode at least four to five uniquely designated sequences of amino acids. According to this disclosure, two protein sequences are considered homologous if the proteins are identical by at least about 50%, 60%, 70%, 80%, or 90% for at least one sequence of at least about 20 amino acids.
[0189] Identity: As used herein, the term “identity” refers to the overall relationship between polymer molecules, for example, between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules. For example, the calculation of the identity percentage of two polynucleotide sequences can be performed by aligning the two sequences for the purpose of best comparison (for example, gaps may be introduced in one or both of the first and second nucleic acid sequences for best alignment, and non-identical sequences may be ignored for the purpose of comparison). In certain embodiments, the length of the sequences aligned for comparison is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at the corresponding nucleotide positions are then compared. If the position of the first sequence is occupied by the same nucleotide as the corresponding position of the second sequence, then the molecules are identical at that position. The percentage of identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. The comparison of two sequences and the determination of their percentage of identity can be accomplished using mathematical algorithms. For example, the percentage of identity between two nucleotide sequences is given in *Computational Molecular Biology*, Lesk, AM, ed., Oxford University Press, New York, 1988; *Biocomputing: Informatics and Genome*. This can be determined using methods such as those described in Projects, edited by DW Smith, Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, edited by G. von Heinje, Academic Press, 1987; Computer Analysis of Sequence Data, Part I, edited by AM Griffin and HG Griffin, Humana Press, New Jersey, 1994; and Sequence Analysis Primer, edited by M. Gribskov and J. Devereux, M Stockton Press, New York, 1991. These documents are incorporated herein by reference in their entirety. For example, the percentage of identity between two nucleotide sequences can be determined using the algorithm of E. Meyers and W. Miller (CABIOS, 1989, 4:11-17), incorporated into the ALIGN program (version 2.0), using the PAM120 weight residue table, gap length penalty 12, and gap penalty 4. Alternatively, the percentage of identity between two nucleotide sequences can be determined using the GAP program in the GCG software package, using the NWSgapdna.CMP matrix. Methods commonly used to determine the percentage of identity between sequences, but not limited to these, include those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48:1073 (1988), which is incorporated herein by reference. Techniques for determining identity are coded into publicly available computer programs.Representative computer software for determining homology between two sequences includes, but is not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, SF et al., J. Molec. Biol., 215, 403 (1990)).
[0190] Inhibiting gene expression: As used herein, the phrase “inhibiting gene expression” means causing a reduction in the amount of gene expression products. Expression products may be RNA molecules transcribed from a gene (e.g., mRNA), or polypeptides translated from mRNA transcribed from a gene. Typically, a reduction in mRNA levels results in a reduction in the level of polypeptides translated therefrom. Expression levels can be determined using standard techniques for measuring mRNA or protein.
[0191] Insert: As used herein, the term “insert” may refer to the addition of a target-directed peptide sequence to a parent AAV capsid sequence. An “insertion” may result in the replacement of one or more amino acids in the parent AAV capsid sequence. Alternatively, an insertion may not result in any change to the parent AAV capsid sequence other than the addition of the target-directed peptide sequence.
[0192] Inverted terminal repeat sequence: As used herein, the term “inverted terminal repeat sequence” or “ITR” refers to a cis-modulatory element for packaging a polynucleotide sequence into a viral capsid.
[0193] Library: As used herein, the term "library" refers to a diverse collection of linear polypeptides, polynucleotides, viral particles, or viral vectors. By way of example, a library may be a DNA library or an AAV capsid library.
[0194] Neurological disease: As used herein, "neurological disease" is any disease associated with the central or peripheral nervous system and their components (e.g., neurons).
[0195] Naturally occurring: As used herein, "naturally occurring" or "wild type" means existing in nature without artificial assistance or human intervention. Open reading frame: As used herein, "open reading frame" or "ORF" refers to a sequence that does not contain a stop codon within a given reading frame.
[0196] Parent sequence: As used herein, "parent sequence" is the nucleic acid sequence or amino acid sequence from which a variant is derived. In one embodiment, the parent sequence is the sequence into which a heterologous sequence is inserted. Alternatively, the parent sequence can be considered an acceptor sequence or recipient sequence. In one embodiment, the parent sequence is an AAV capsid sequence into which a targeting sequence is inserted.
[0197] Particle: As used herein, "particle" is a virus composed of at least two components: a protein capsid and a polynucleotide sequence encapsulated within the capsid.
[0198] Patient: As used herein, "patient" refers to a subject who may seek or potentially require treatment, who requires treatment, who is receiving treatment, who is going to receive treatment, or who is receiving care for a particular disease or condition by a skilled professional.
[0199] Payload region: As used herein, "payload region" is any nucleic acid sequence (e.g., within a viral genome) that encodes one or more "payloads" of the present disclosure. By way of non-limiting example, the payload region may be a nucleic acid sequence within the viral genome of an AAV particle that encodes a payload, where the payload is an RNAi agent or a polypeptide. Payloads of the present disclosure may be, but are not limited to, peptides, polypeptides, proteins, antibodies, RNAi agents, and the like.
[0200] Peptide: As used herein, "peptide" is 50 amino acids in length or less, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.
[0201] Pharmaceutically acceptable: As used herein, the phrase "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that, within the scope of sound medical judgment, are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic response, or other problems or complications and commensurate with a reasonable risk / benefit ratio.
[0202] Prevent: As used herein, the term "prevent" or "preventing" means to partially or completely delay the onset of an infectious disease, disease, disorder, and / or condition; to partially or completely delay the onset of one or more symptoms, features, or clinical findings of a particular infectious disease, disease, disorder, and / or condition; to partially or completely delay the onset of one or more symptoms, features, or findings of a particular infectious disease, disease, disorder, and / or condition; to partially or completely delay progression from an infectious disease, particular disease, disorder, and / or condition; and / or to reduce the risk of developing a pathology associated with an infectious disease, disease, disorder, and / or condition.
[0203] Preventive: As used herein, “preventive” refers to a therapeutic or set of actions used to prevent the spread of a disease. Prevention: As used herein, “prevention” refers to measures taken to maintain health and prevent the spread of disease.
[0204] Region: As used herein, the term “region” refers to a band or area in general. In some embodiments, where a protein or protein module is referred to, a region may include a linear sequence of amino acids along the protein or protein module, or it may include a three-dimensional area, an epitope, and / or a cluster of epitopes. In some embodiments, a region includes a terminal region. As used herein, the term “terminal region” refers to a region located at the end or terminal of a given activator. When a protein is referred to, a terminal region may include the N-terminus and / or C-terminus.
[0205] In some embodiments, where a polynucleotide is referred to, the region may include a linear sequence of nucleic acids along the polynucleotide, or it may include a three-dimensional region, secondary structure, or tertiary structure. In some embodiments, the region includes a terminal region. As used herein, the term “terminal region” refers to a region located at the end or terminal of a given activator. Where a polynucleotide is referred to, the terminal region may include the 5' end and / or 3' end.
[0206] RNA or RNA molecule: As used herein, the terms “RNA” or “RNA molecule” or “ribonucleic acid molecule” refer to polymers of ribonucleotides, and the terms “DNA” or “DNA molecule” or “deoxyribonucleic acid molecule” refer to polymers of deoxyribonucleotides. DNA and RNA may be synthesized naturally, for example, by DNA replication and DNA transcription, or chemically synthesized. DNA and RNA may be single-stranded (i.e., ssRNA or ssDNA, respectively) or multi-stranded (e.g., double-stranded, i.e., dsRNA and dsDNA, respectively). As used herein, the term “mRNA” or “messenger RNA” refers to single-stranded RNA encoding an amino acid sequence of one or more polypeptide chains.
[0207] RNA interference or RNAi: As used herein, the terms “RNA interference” or “RNAi” refer to sequence-specific regulatory mechanisms mediated by RNA molecules that result in the inhibition, interference, or “silencing” of the expression of a corresponding protein-coding gene. RNAi has been observed in many types of organisms, including plants, animals, and fungi. RNAi occurs naturally in cells to remove exogenous RNA (e.g., viral RNA). Native RNAi proceeds via fragments cleaved from free dsRNA that direct the degradation mechanism towards other similar RNA sequences. RNAi is regulated by the RNA-induced silencing complex (RISC) and initiated in the cytoplasm by short-chain / small dsRNA molecules that interact with the catalytic RISC component Argonaut. dsRNA molecules can be introduced into cells exogenously. Exogenous dsRNA initiates RNAi by activating the ribonuclease protein dicer, which then binds to and cleaves the dsRNA, producing 21-25 base pair double-stranded fragments with a few unpaired overhangs at each end. These short double-stranded fragments are called small interfering RNAs (siRNAs).
[0208] RNAi agents: As used herein, the term “RNAi agent” means an RNA molecule or derivative thereof that can induce inhibition, interference, or “silencing” of the expression of a target gene and / or its protein product. RNAi agents can knock out (effectively eliminate or eliminate) or knock down (reduce or decrease) expression. RNAi agents may be, but are not limited to, dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA.
[0209] Sample: As used herein, the terms “sample” or “biological sample” refer to a subset of its tissues, cells, or component parts (for example, but not limited to, body fluids including blood, serum, mucus, lymph, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, intraamniotic umbilical cord blood, urine, vaginal fluid, and semen). A sample may further include homogenates, lysates, or extracts, or fractions or parts thereof, prepared from a whole organism or a subset of its tissues, cells, or component parts, including, but not limited to, plasma, serum, cerebrospinal fluid, lymph, outer compartments of the skin, respiratory tract, intestinal tract, and urogenital tract, tears, saliva, milk, blood cells, tumors, organs, etc. Furthermore, a sample refers to a culture medium, such as a nutrient broth or gel, which may contain cellular components such as proteins or nucleic acid molecules.
[0210] Self-complementary viral particle: As used herein, "self-complementary viral particle" is a particle consisting of at least two components: a protein capsid and a self-complementary viral genome encapsulated within the capsid.
[0211] Sense strand: As used herein, the terms “sense strand,” “second strand,” or “passenger strand” of an siRNA molecule refer to a strand complementary to the antisense strand or first strand. The antisense and sense strands of an siRNA molecule hybridize to form a double-stranded structure. As used herein, an “siRNA double-stranded structure” includes an siRNA strand that is sufficiently complementary to a compartment of approximately 10–50 nucleotides of mRNA of the gene targeted for silencing, and an siRNA strand that is sufficiently complementary to form a double-stranded structure with the other siRNA strand.
[0212] Similarity: As used herein, the term “similarity” refers to the overall relationship between polymer molecules, for example, between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. The calculation of the similarity percentage of polymer molecules to one another can be carried out in the same manner as the calculation of the identity percentage, except that the similarity percentage calculation takes into account conservative substitutions as understood in the art.
[0213] Short-chain interfering RNA or siRNA: As used herein, the terms “short-chain interfering RNA,” “small interfering RNA,” or “siRNA” refer to an RNA molecule (or RNA analog) containing about 5 to 60 nucleotides (or nucleotide analogs) capable of directing or mediating RNAi. Preferably, an siRNA molecule contains about 15 to 30 nucleotides or nucleotide analogs, e.g., about 16 to 25 nucleotides (or nucleotide analogs), about 18 to 23 nucleotides (or nucleotide analogs), about 19 to 22 nucleotides (or nucleotide analogs) (e.g., 19, 20, 21, or 22 nucleotides or nucleotide analogs), about 19 to 25 nucleotides (or nucleotide analogs), and about 19 to 24 nucleotides (or nucleotide analogs). The term “short-chain” siRNA refers to an siRNA containing 5 to 23 nucleotides, preferably 21 nucleotides (or nucleotide analogs), e.g., 19, 20, 21, or 22 nucleotides. The term "long-chain" siRNA refers to siRNA containing 24 to 60 nucleotides, preferably about 24 to 25 nucleotides, e.g., 23, 24, 25, or 26 nucleotides. Short-chain siRNA may, in some examples, contain fewer than 19 nucleotides, e.g., 16, 17, or 18 nucleotides, or even as few as 5 nucleotides. However, these shorter siRNAs shall retain their ability to mediate RNAi. Similarly, long-chain siRNA may, in some examples, contain more than 26 nucleotides, e.g., 27, 28, 29, 30, 35, 40, 45, 50, 55, or even 60 nucleotides. However, these longer siRNAs shall retain their ability to mediate RNAi or translational repression, and shall not undergo further processing of the short-chain siRNA, e.g., enzymatic processing. siRNA may be a single-stranded RNA molecule (ss-siRNA), or a double-stranded RNA molecule (ds-siRNA) containing a sense strand and an antisense strand that hybridize to form a double-stranded structure called an siRNA double helix.
[0214] Subject: As used herein, the terms “subject” or “patient” refer to any organism to which the compositions according to this disclosure can be administered, for example, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants.
[0215] Substantially: As used herein, the term “substantially” refers to a qualitative state that exhibits all or nearly all of the desired characteristics or properties. Those skilled in the art of biology will understand that biological and chemical phenomena are rarely, if ever, completely finished, and / or progress to completion, or achieve or avoid absolute results. Therefore, the term “substantially” is used herein to imply that a potential lack of completion is inherent in many biological and chemical phenomena.
[0216] Target-directed peptides: As used herein, “target-directed peptides” refer to peptides with a length of 3 to 20 amino acids. Such target-directed peptides can be inserted into or attached to a parent amino acid sequence to alter the properties (e.g., tropism) of the parent protein. As a non-limiting example, target-directed peptides can be inserted into AAV capsid sequences to enhance target-direction to desired cell types, tissues, organs, or organisms. It should be understood that target-directed peptides are encoded by target-directed polynucleotides, which can similarly be inserted into parent polynucleotide sequences. Therefore, “target-directed sequence” refers to a peptide sequence or polynucleotide sequence for insertion into a suitable parent sequence (amino acids or polynucleotides, respectively).
[0217] Target cell: As used herein, "target cell" or "target tissue" refers to any one or more cells of interest. Cells can be found in vitro, in vivo, in situ, or in biological tissues or organs. The organism can be an animal, preferably a mammal, more preferably a human, and most preferably a patient.
[0218] Therapeutic agent: The term "therapeutic agent" refers to any agent that, when administered to a subject, exhibits a therapeutic, diagnostic, and / or prophylactic effect and / or induces a desired biological and / or pharmacological effect.
[0219] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" is the amount of an agent to be delivered (e.g., nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, is sufficient to treat the infection, disease, disorder, and / or condition, improve their symptoms, diagnose them, prevent them, and / or delay their onset. In some embodiments, the therapeutically effective amount is provided as a single dose.
[0220] Therapeutically effective outcome: As used herein, the term "therapeutically effective outcome" means an outcome sufficient to treat an infection, disease, disorder, and / or condition, improve their symptoms, diagnose them, prevent them, and / or delay their onset in a subject suffering from or susceptible to an infection, disease, disorder, and / or condition.
[0221] To treat: As used herein, the term “to treat” means the partial or complete relief, improvement, enhancement, reduction, delay of their onset, inhibition of their progression, reduction of their severity, and / or reduction of the incidence of one or more symptoms or characteristics of a particular infection, disease, disorder, and / or condition. For example, “to treat” cancer may mean inhibiting the survival, growth, and / or spread of the tumor. Treatment may be administered to subjects who are not showing any signs of a disease, disorder, and / or condition, and / or subjects who are showing only the initial signs of a disease, disorder, and / or condition, for the purpose of reducing the risk of developing a pathology associated with the disease, disorder, and / or condition.
[0222] Vector: As used herein, the term “vector” refers to any molecule or part that transports, transduces, or otherwise acts as a carrier for a heterologous molecule. In some embodiments, the vector may be a plasmid. In some embodiments, the vector may be a virus. AAV particles are an example of a vector. The vectors of this disclosure may be recombinantly produced, based on, and / or containing, an adeno-associated virus (AAV) parent or reference sequence. The heterologous molecule may be a polynucleotide and / or a polypeptide.
[0223] Viral genome: As used herein, the terms “viral genome” or “vector genome” refer to the nucleic acid sequence encapsulated in an AAV particle. The viral genome comprises a nucleic acid sequence having at least one payload region encoding a payload and at least one ITR.
[0224] Equivalents and range Those skilled in the art will recognize, or can verify through routine experimental work, that there are many equivalents to the specific embodiments of this disclosure described herein. The scope of this disclosure is not intended to be limited to the foregoing description, but rather as set forth in the appended claims.
[0225] In the claims, articles such as “a,” “an,” and “the” may mean one or more unless shown to be contradictory or clearly evident from the context. A claim or description containing “or” between one or more members of a group is deemed satisfied if, unless shown to be contradictory or clearly evident from the context, one, more than one, or all of the group members are present in, used in, or otherwise related to a given product or process. This disclosure includes embodiments in which exactly one member of the group is present in, used in, or otherwise related to a given product or process. This disclosure includes embodiments in which more than one or all of the group members are present in, used in, or otherwise related to a given product or process.
[0226] Furthermore, it should be noted that the term “comprising” is intended to be non-exclusive and does not require that it permit the inclusion of additional elements or processes. Thus, wherever the term “comprising” is used herein, the term “consisting of” is also included and disclosed.
[0227] Where a range is indicated, the endpoints are included. Furthermore, unless otherwise indicated, or unless it is evident from the circumstances and the understanding of those skilled in the art, the values expressed as a range can be understood to be any specific value or partial range within the ranges specified in the various embodiments of this disclosure, up to one-tenth of the lower limit unit of that range, unless the circumstances explicitly indicate otherwise.
[0228] In addition, it should be understood that any particular embodiment of the Disclosure that falls within the prior art may be expressly excluded from any one or more of the claims. Such embodiments may be excluded even if the exclusion is not expressly indicated herein, as they are considered to be known to those skilled in the art. Any particular embodiment of the compositions of the Disclosure (e.g., any antibiotic, therapeutic agent, or active ingredient; any method of production; any method of use, etc.) may be excluded from any one or more claims for any reason, whether or not relating to the existence of prior art.
[0229] It should be understood that the language used is descriptive rather than restrictive, and that it may be modified within the scope of the attached claims without departing from the true scope and intent of this disclosure in its broader sense.
[0230] Although this disclosure has been described in some detail and with some specificity regarding some of the embodiments described, this disclosure is not intended to be limited to any such specific examples or embodiments or any particular embodiment, but should be interpreted by reference to the appended claims in order to provide the broadest possible interpretation of such claims in light of the prior art, and thus to effectively encompass the scope intended of this disclosure. (Note) The technical concepts that can be understood from the above embodiments and modified examples are described below. [Item 1] A method for generating a variant AAV capsid polypeptide, wherein the variant AAV capsid polypeptide exhibits at least one of improved transduction or increased cell or tissue specificity compared to the parent AAV capsid polypeptide. (a) A step of generating a library of variant AAV capsid polypeptides, wherein the library is (i) Multiple capsid polypeptides having regions of randomized sequences of 2, 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids, or (ii) Multiple capsid polypeptides derived from more than one parent AAV capsid polypeptide Processes including; (b) A method for generating an AAV vector library by cloning the capsid polypeptide of library (i) or (ii) into an AAV vector, wherein the AAV vector comprises a first promoter and a second promoter, and the second promoter drives capsid mRNA expression in the absence of helper virus co-infection. [Item 2] The method according to claim 1, wherein the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter. [Item 3] The method according to claim 1, wherein the first promoter is AAV2 P40 and the second promoter is a cell type-specific promoter. [Item 4] The method according to claim 2 or claim 3, wherein the promoter is selected from any of those listed in Table 3. [Item 5] The method according to claim 4, wherein the ubiquitous promoter or the cell-specific promoter enables the expression of the RNA encoding the capsid polypeptide. [Item 6] The method according to claim 5, further comprising the steps of recovering the RNA encoding the capsid polypeptide and sequencing the capsid polypeptide. [Item 7] The method according to claim 6, wherein the recovered capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide. [Item 8] The method according to claim 7, wherein the target cells are nerve cells, neural stem cells, astrocytes, oligodendrocytes, microglia, retinal cells, tumor cells, hematopoietic stem cells, insulin-producing beta cells, lung epithelial cells, endothelial cells, hepatocytes, skeletal muscle cells, muscle stem cells, muscle satellite cells, or cardiomyocytes. [Item 9] The method according to claim 1, wherein the AAV vector comprises a first promoter and a second promoter, the second promoter being located downstream of a capsid gene and driving its antisense RNA expression in the absence of helper virus co-infection. [Item 10] The method according to claim 9, wherein the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter. [Item 11] The method according to claim 9, wherein the first promoter is AAV2 P40 and the second promoter is a cell-specific promoter. [Item 12] The method according to claim 10 or 11, wherein the ubiquitous promoter or the cell-specific promoter enables the expression of a gene encoding a capsid polypeptide of variant AAV in the antisense direction, resulting in antisense RNA. [Item 13] The method according to claim 12, further comprising the step of recovering the antisense RNA which can be converted into RNA encoding the variant AAV capsid polypeptide used to determine the sequence of the variant AAV capsid polypeptide. [Item 14] The method according to claim 13, wherein the variant AAV capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide. [Item 15] The method according to claim 14, wherein the target cells are nerve cells, neural stem cells, astrocytes, oligodendrocytes, microglia, retinal cells, tumor cells, hematopoietic stem cells, insulin-producing beta cells, lung epithelial cells, endothelial cells, hepatocytes, skeletal muscle cells, muscle stem cells, muscle satellite cells, or cardiomyocytes.
[0231] This disclosure is further illustrated by the following non-limiting examples. [Examples]
[0232] Example 1. Proof of concept for TRACER: Promoter selection Proof-concept experiments were performed by placing the gene encoding the AAV9 peptide display capsid library under the control of either a neuron-specific synapsin promoter (SYN) or an astrocyte-specific GFAP promoter. After intravenous administration to C57BL / 6 mice, RNA was recovered from brain tissue and used for further library evolution. Next-generation sequencing (NGS) showed sequence convergence between animals after only two rounds of selection. Interestingly, several variants highly similar to the PHP.eB capsid were recovered. This suggests that our method enabled rapid selection of high-performance capsids. A subset of capsids with peptide sequences exhibiting high CNS enrichment were selected for further study. It is understood that any promoter can be selected depending on the desired orientation. Examples of such promoters are found in Table 3.
[0233] [Table 3-1]
[0234] [Table 3-2]
[0235] [Table 3-3]
[0236] Capsid pools were injected into three rodent species, followed by RNA enrichment analysis to characterize transduction efficiency and interspecific performance in neurons or astrocytes. The top-ranking capsids were then individually tested, and several variants exhibited CNS transduction similar to or higher than the PHP.eB benchmark. These results suggest that the TRACER platform enables rapid in vivo evolution of AAV capsids in non-transgenic animals with significant tropism enhancement. The following examples illustrate these findings in more detail.
[0237] Example 2. Generation of an AAV vector capable of capsid mRNA expression in the absence of helper virus. To perform cell-type and transduction-limited in vivo evolution of AAV capsid libraries, we genetically engineered a capsid library system that allows the transcription of capsid mutant genes in specific cell types in the absence of helper viruses. In wild-type AAV virus, mRNA encoding capsid proteins VP1, VP2, and VP3, as well as AAP accessory proteins, is expressed via the P40 promoter located in the 3' region of the REP gene (Berns et al., 1996), which is active only in the presence of REP protein and helper virus function (Figure 1A). To enable the expression of capsid mRNA in animal tissue or cultured cells, another promoter must be inserted upstream or downstream of the CAP gene. Because the packaging capacity of the AAV capsid is limited, a portion of the REP gene must be deleted to accommodate the additional promoter insertion, and the REP gene must be provided trans in another plasmid to enable virus production. The minimum viral sequence required for high-titer AAV production was determined by introducing the CMV promoter at various positions upstream of the AAV9 CAP gene (Figure 1B). The REP protein was provided trans via a pREP2 plasmid obtained by deleting the CAP gene from a REP2-CAP2 packaging vector using EcoNI and ClaI (SEQ ID NO: 4). In a small-scale viral production test, HEK-293T cells grown in DMEM supplemented with 5% FBS and 1×pen / strep were co-transfected with 15ug of pHelper(pFdelta6) plasmid, 10ug of pREP2 plasmid, and 1ug of ITR-CMV-CAP plasmid using calcium phosphate transfection, and plated in a 15cm dish. After 72 hours, the cells were collected by scraping, pelletized by short-time centrifugation, and suspended in 1ml of buffer containing 10mM Tris and 2mM MgCl2. The cells were lysed by adding triton X-100 to a final concentration of 0.1%, and then treated with 50 U of benzonase for 1 hour.The virus derived from the supernatant was precipitated with 8% polyethylene glycol and 0.5 M NaCl, suspended in 1 ml of 10 mM TRIS-2 mM MgCl2, and combined with the cell lysates. The pooled virus was clarified by adjusting the solution to 0.5 M NaCl and centrifuging at 4,000 × g for 15 minutes, and fractionated at 40,000 prm for 3 hours on a stepwise iodixanol gradient of 15%, 25%, 40%, and 60% (Zolotukhin et al., 1999). The 40% fraction containing the purified AAV particles was collected, and the viral titer was measured by real-time PCR using a Taqman primer / probe mix specific to the 3' end of REP, which is shared across all constructs. Viral yields were significantly lower than those of the fully wild-type ITR-REP2-CAP9-ITR used as a reference (1.7%–8.8%), but the CMV-BstEII construct yielded the highest yield among all three CMV constructs. See Figure 2. The CMV-HindIII construct, in which most of the P40 promoter sequence was deleted, yielded the lowest yield (1.7% of wtAAV9). This indicates that even a robust CMV promoter cannot replace the P40 promoter without causing a significant decrease in viral yield. Following these observations, the BstEII architecture (SEQ ID NO: 5), with a minimal P40 sequence and conserved CAP mRNA splice donor, was used in all further experiments.
[0238] Next, the REP expression plasmid was enhanced by preserving the AAP reading frame together with a large portion of the capsid gene derived from the REP2-CAP9 helper vector, which may contain sequences necessary for regulating CAP transcription and / or splicing. To eliminate the vector's capsid-encoding capability, the C-terminal fragment of the capsid gene was deleted by triple cleavage with MscI restriction enzyme, followed by autoligation to obtain the pREP-AAP plasmid (Figure 3A, SEQ ID NO: 6).
[0239] The repeating portion of this construct was genetically modified by introducing stop codons immediately after the start codons of VP1, VP2, and VP3 without disrupting the amino acid sequence of the AAP reading frame on the same chain (Figure 3A). This construct was named pREP-3stop (SEQ ID NO: 7). A neuron-specific syn-CAP9 vector (SEQ ID NO: 8) was derived from the CMV9-BstEII plasmid by replacing the CMV promoter with a neuron-specific human synapsin 1 promoter.
[0240] The production efficiency of Syn-CAP9 was tested as described above using pREP plasmids, pREP-AAP plasmids, or pREP-3stop plasmids to supply REP in trans. As shown in Figure 3B, REP plasmids containing longer capsid sequences and AAP increased viral yield by approximately three times compared to pREP plasmids. Viral titers obtained with pREP-AAP or pREP-3stop vectors reached approximately 30% of wild-type AAV9. A key concern with plasmids containing long homology regions is the potential for undesirable recombination with the ITR-CAP vector, which would reconstitute the wild-type ITR-REP-CAP vector and contaminate the combinatorial library.
[0241] To assess the risk of wild-type virus rearrangement, the viral preparations obtained in Figure 3B were subjected to real-time PCR using a Taqman probe located at the N-terminus of REP. The percentage of capsids containing detectable full-length REP was less than 0.03% of wild-type virus (Figure 3C), which was even lower than the routinely detectable 0.1% non-orthodox REP-CAP packaging that occurred in most recombinant AAV preparations obtained from 293T cell transfections (Figure 3C, our unpublished observations). The pREP-3stop vector's stop codon provided an additional layer of safety against the possibility of wild-type capsid rearrangement and prevented translation of the truncated capsid protein; therefore, the 3stop plasmid was used in all subsequent studies.
[0242] Following this, the feasibility of RNA-driven biopanning in C57BL / 6 mice was tested using an AAV9 packaging vector driven by the astrocyte-specific GFabc1D promoter (SEQ ID NO: 9), which is the AAV9 capsid gene, and subsequently the CMV promoter, synapsin promoter, or later the GFAP promoter (Brenner et al., 2008) (Figure 4A). These three vectors were produced in HEK-293T cells as described above and analyzed by PAGE-silver staining. As shown in Figure 4B, all vectors showed VP1, VP2, and VP3 capsid proteins in normal ratios. This indicates that this particular promoter architecture does not disrupt the balance of capsid protein expression. Six-week-old male C57BL / 6 mice were intravenously injected with 1 e12VG per mouse and sacrificed after 28 days. In vivo DNA distribution and capsid mRNA expression were examined in brain, liver, and cardiac tissues.
[0243] Total DNA was extracted from brain, liver, and heart tissue using Qiagen DNeasy blood and tissue columns, and viral DNA was quantified by real-time PCR using a Taqman probe located in the VP3 N-terminal region. DNA abundance was normalized using a pre-designed probe that detects the single-copy transferrin receptor gene (Life Technologies ref. 4458366). Viral DNA was abundant in the liver but less abundant in the heart. There were no significant differences in DNA distribution among the three vectors (Figure 4C). RNA was extracted using the Qiagen RNeasy plus universal kit according to the manufacturer's instructions, treated with ezDNAse (Qiagen) to remove residual DNA, and superscripted. Reverse transcription was performed using IV (Life Technologies).
[0244] RNA expression was evaluated using the same VP3 probe used to quantify viral DNA and normalized using TBP as the reference RNA (Life technologies Mm01277042_m1). In the brain, the GFAP promoter allowed the most potent expression levels, while the synapsin promoter allowed expression comparable to that of the potent CMV promoter. In the liver, all promoters yielded similar expression levels, which is thought to be a result of very high copy numbers for leaky expression (Figure 4D). In the heart, the cell type specificity of the Syn promoter and GFAP promoter was evident, as they allowed only about 3% and 10% of CMV expression, respectively, despite similar in vivo distributions of their DNA.
[0245] Overall, this experiment demonstrated that mRNA derived from transduction-competent capsids could be recovered from various animal organs, including tissues with weak transduction, such as the brain. Example 3. AAV vector configuration To maximize library recovery by increasing RNA expression, various vector configurations were explored. The CMV promoter was replaced with a hybrid CMV enhancer / chicken beta-actin promoter sequence (Niwa et al., 1991), and since introns have been shown to increase mRNA processing and stability (Powell et al., 2015), a potent cytomegalovirus beta-globin hybrid intron derived from the AAV-MCS cloning vector (Stratagene) was inserted between the promoter sequence and the capsid gene. This resulted in the constructs CAG9 (SEQ ID NO: 10), SYNG9 (SEQ ID NO: 11), and GFAPG (SEQ ID NO: 12).
[0246] To avoid potential interference with the P40 promoter, we also tested an inverted vector configuration in which the helper-independent promoter was reversed and positioned downstream of the capsid gene (Figure 5A). This configuration allows for the expression of antisense capsid transcripts in animal tissues. Since most polyadenylation signals (AATAAA) are direction-dependent, we hypothesized that in reverse positioning, the native AAV capsid polyA would not terminate transcription prematurely. All constructs were co-transfected with pHelper plasmid and pREP-3 stop plasmid to generate AAV9-packaging virions, which were then used to transduce HEK-293T cells at an MOI of 1 e4 VG per cell. RNA was extracted 48 hours after transfection and reverse transcribed using the Quantitect kit (Qiagen).
[0247] PCR was performed using primers that allowed amplification of the full-length capsid or a subsequence localized near the C-terminus (Figure 5B). Overall, the presence of introns had little effect on expression from the low-activity promoters Syn and GFAP. This indicates that mRNA splicing did not alleviate promoter repression in non-permissive cells. Combinations of the CMV enhancer with the chicken beta-actin promoter and hybrid introns enabled significantly higher (>10-fold) mRNA expression compared to the CMV promoter alone (Figure 5B, C).
[0248] A comparison of endpoint PCR amplification with forward-oriented and inverted intron vectors revealed a discrepancy between full-length and partial-length capsid amplicons (Figure 5B, right lane), raising doubts about the integrity of the capsid RNA. Amplification of cDNA derived from the inverted iCAG9 genome using primers that frank the full-length capsid detected multiple low-molecular-weight bands, while the forward-oriented vector allowed amplification of a single product of the expected length (Figure 5D). Sanger sequencing of the low-molecular-weight amplicons showed that each band corresponded to an unorthodox splicing product from antisense capsid RNA.
[0249] In light of these results, a forward tandem promoter was adopted as the architecture for subsequent experiments. To avoid amplification of residual DNA present in RNA preparations, splice-specific PCR amplification was tested. Two candidate PCR primers overlapping the CMV / globin exon junction were designed and tested for amplification of cDNA (splicing) or plasmid DNA (still containing intron sequences). As shown in Figure 5E, the GloSpliceF6 primer (SEQ ID NO: 13) enabled perfectly specific amplification from cDNA without producing detectable amplicons from the plasmid DNA sequence. This primer was used in subsequent assays to confirm the absence of amplification by contaminating DNA.
[0250] Next, the tandem construct was tested for the potential interference of the P40 promoter with cell-specific promoters located upstream. To this end, two sets of AAV genomes were tested for transgene mRNA expression in HEK-293T cells. A set of transgenes that did not have a P40 sequence and had the GFP gene located immediately downstream of the CAG, SYNG, or GFAPG promoter were tested and compared to a library construct in which the AAV9 capsid was located downstream of the P40 promoter (Figure 6A). All genomes were packaged into AAV9 capsids. These were used to infect HEK-293T cells at an MOI of 1e4VG per cell. RNA was extracted 48 hours after infection, and transgene RNA was quantified using a Taqman primer / probe mix specific to the spliced globin-exon junctions. As shown in Figure 6B, expression from the CAG promoter was similar for both the GFP and P40-CAP9 constructs (half as high for p40-CAP9, but within the tolerance of the AAV titration). Expression from the synapsin promoter was dramatically lower for both constructs, and even lower for GFAP-driven mRNA (Figure 6B). This was expected, as HEK-293T cells are not tolerant of synapsin promoter or GFAP promoter expression. Overall, this experiment confirmed that the presence of the P40 sequence does not alter the cell type specificity of the synapsin promoter or GFAP promoter.
[0251] This novel platform was named TRACER (Tropism Redirection of AAV by Cell type-specific Expression of RNA). The TRACER platform solves the problems of standard methods, including transduction and cell type limitation (Figure 7). The TRACER system is well-suited for capsid discovery using target-directed peptide libraries. Screening of such libraries can be performed as outlined in Figure 8.
[0252] Several variants of AAV vectors encoding a capsid as payload have been taught herein, but one reference design is shown in Figure 9B and Figures 12A and 12B.
[0253] Further advantages of the TRACER platform relate to the nature of the viral pool and the fact that RNA is recovered only from fully transduced cells (Figure 10). Consequently, capsid discovery can be accelerated to yield cell and / or tissue-specific tropism (Figure 11).
[0254] Example 4. Production of a peptide display library and cloning-free amplification. Several peptide display capsid libraries were generated by inserting seven consecutive randomized amino acids into the surface-exposed hypervariable loop VIII region of AAV5, AAV6, or AAV-DJ8 capsids (Figures 13 and 39) and AAV9 (Figure 14). In the case of the AAV9 library, two additional libraries had modified residues at positions -2, -1, and +1 of the insert to match the flanking sequence of the highly neurotrophic PHP.eB vector (Chan et al., 2018). To facilitate the insertion of various loops and prevent contamination by wild-type capsids, a deletion shuttle vector was generated in which the C-terminal region of the capsid gene located between loop VIII and the stop codon was deleted and replaced with a unique BsrGI restriction site (Figures 15A, B). Degenerate primers containing randomized NNK (K=T or G) sequences capable of encoding all amino acids were synthesized by IDT, and these were used to amplify the missing capsid fragments using gBlock (IDT) double-stranded linear DNA as a template (SEQ ID NOs. 14, 15, 16, 17). A linear PCR template was preferred over a plasmid to completely prevent the possibility of plasmid carryover contamination in the PCR reaction. An amplicon containing a random library sequence (500 ng) was inserted into a shuttle plasmid linearized with BsrGI (2 ug) over 30 minutes at 50°C using 100 ul of NEBuilder HiFi DNA Assembly Master Mix (NEB). Unassembled linear templates were eliminated by adding 5 ul of T5 exonuclease to the reactant and digesting at 37°C for 30 minutes. The entire reaction was purified with DNA Clean and Concentrator-5 and quantified with nanodrop to estimate assembly efficiency. This method makes it possible to routinely recover 0.5 to 1 ug of assembly material.
[0255] The gBlock template was genetically engineered by introducing silent mutations to remove specific restriction sites, enabling selective removal of wild-type viral contaminants from the library via restriction enzyme treatment. For example, the AAV9 gBlock was genetically engineered to remove the BamHI and AfeI sites present in the parent sequence (SEQ ID NO: 17).
[0256] Example 5. Cloning-free amplification Transformation of assembled library DNA into competent bacteria represents a major bottleneck in library diversity, as even highly competent strains rarely exceed 1e7–1e8 colonies per transformation. For comparison, a 100-nanogram 6-kilobase plasmid contains 1.5e10 DNA molecules. Therefore, bacterial transformation randomly eliminates more than 99% of the DNA species in a given pool. Thus, we developed a cloning-free method that bypasses the bacterial transformation bottleneck while enabling >100-fold amplification of Gibson-assembled DNA (Figure 16). We optimized a protocol based on rolling circle amplification, thereby enabling unbiased exponential amplification of the circular DNA template with an extremely low error rate (Hutchinson et al., 2005). One problem with rolling circle amplification is the production of very large (averaging about 70 kilobases) highly branched concatemers that must be cleaved into monomers for efficient cell transfection. This process can be achieved in several ways, for example, by generating an open-ended linear template using restriction enzymes (Hutchinson et al., 2005; Huovinen, 2012), or by generating a self-lygated circular template using CRE-Lox recombination (Huovinen et al., 2011). However, open-ended DNA is sensitive to degradation by cytoplasmic exonucleases, and the CRE recombination method showed relatively low efficiency (our unpublished observations). Therefore, we propose TelN protelomerase (Rybchin et al.), an enzyme that catalyzes the formation of closed-ended linear "dogbone" DNA monomers (Heinrich et al., 2002), which are highly suitable for mammalian cell transfection. We selected an alternative monomer degradation method based on the use of (al.), 1999).
[0257] Therefore, in order to obtain the following plasmid, the protelomerase recognition sequence TATCAGCACACAATTGCCCATTATACGC * GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO: 176) was introduced outside both ITRs of all BsrGI shuttle vectors used for capsid library insertion (asterisks illustrate the locations where the two complementary strands are covalently linked to each other): TelN-Syn9-BsrGI (SEQ ID NO: 18), TelN-GFAP9-BsrGI (SEQ ID NO: 19), TelN-Syn5-BsrGI (SEQ ID NO: 20), TelN-GFAP5-BsrGI (SEQ ID NO: 21), TelN-Syn6-BsrGI (SEQ ID NO: 22), TelN-GFAP6-BsrGI (SEQ ID NO: 23), TelN-SynDJ8-BsrGI (SEQ ID NO: 24), TelN-GFAPDJ8-BsrGI (SEQ ID NO: 25). Several methods for rolling circle amplification were tested, and the TruePrime technique (Expedeon), which relies on primer-free amplification (Picher et al., 2016), yielded the best results (high yield and low nonspecific amplification).
[0258] In short, the entire column-purified reaction assembly was used in a 900 µl TruePrime reaction according to the manufacturer's instructions and incubated overnight at 30°C. The following day, the rolling circle reaction product was incubated at 65°C for 10 minutes to inactivate the enzymes, and then diluted five-fold with 50 µl of 1 × thermoPol buffer containing protelomerase (NEB) to make 4.5 ml of reaction solution. After 1 hour at 30°C, the reaction was heat-treated at 70°C for 10 minutes to inactivate the protelomerases, and 4.5 µl aliquots were electrophoresed on an agarose gel. The entire reaction product was then purified using multiple (10–12) Qiagen QiaPrep 2.0 columns according to the manufacturer's instructions. A typical yield obtained by this method was 160–180 µl of DNA, which represents a >100-fold amplification of the starting material (typically 0.5–1 µl) and provides sufficient DNA for transfection of 200 cell culture dishes (Figure 16).
[0259] The composition of all libraries was tested by next-generation sequencing using the Illumina NextSeq sequencing platform to estimate the number of variants and final contamination by wild-type viruses. Amplicons were generated by PCR with Q5 polymerase (NEB) using primers containing the Illumina TruSeq adapter and index barcode. Amplicons were obtained by low-cycle PCR amplification (15 cycles). They were electrophoresed on 3% agarose gel and purified using Zymo gel extraction reagent. Libraries were quantified using nanodrops, pooled into equimolar mixes, and requantified using the KAPA library quantification kit according to the manufacturer's instructions. Libraries were mixed with 20–40% PhiX control library to increase sequence diversity.
[0260] All DNA libraries generated by rolling circles exhibited high sequence diversity (typically >1e8 unique variants, exceeding the limits of NextSeq sequencing). In comparison, plasmid libraries generated by bacterial transformation rarely exceed 1–2e7 variants.
[0261] Example 6. Prevention and / or reduction of contamination In another embodiment, a primer / vector system was developed to completely prevent contamination of AAV9 libraries with wild-type viruses that may be recovered from environmental contaminants or naturally infected primate tissues. This was achieved by introducing the maximum number of silent mutations into the sequence surrounding the library insertion site and the sequence immediately preceding the CAP stop codon used for PCR amplification (Figure 17). These libraries showed extremely low detection rates of wild-type AAV9 by NGS (<2 AAV9 reads per 5e7 total reads). This suggests that modifying the codons surrounding the library amplification and cloning sites is a highly efficient method for preserving libraries from environmental or experimental contaminants.
[0262] Libraries were produced as previously described by calcium phosphate transfection of HEK-293T cells, dual iodixanol gradient fractionation, and membrane ultrafiltration using a 100,000 Da MWCO Amicon-15 membrane (Millipore), quantified by real-time PCR, and aliquots were used for NGS amplicon generation and NextSeq sequencing. The diversity of the viral library was significantly lower than that of the DNA library (typically about 1–2e7 unique variants) and showed very strong counterselection of variants containing stop codons (from 20% in the DNA library to about 1% in the viral library). This revealed a very high rate of cis-packaging, as observed in previous studies (Nonnenmacher et al., 2014).
[0263] Example 7. In vivo selection of an AAV9 library for mouse brain transduction. Next, we developed RNA-driven library selection to increase brain transduction in the mouse model. The AAV9 library generated as described above was intravenously injected into male C57BL / 6 mice at a dose of 2e12VG per mouse. Two groups of mice were injected with a single SYN-driven or GFAP-driven library derived from wild-type AAV9 flanking sequences, while the other two groups received pooled libraries containing flanking sequences from wild-type and PHP.eB (Figure 18). After one month, RNA was extracted from 200 mg of brain tissue corresponding to an entire hemisphere using the RNeasy Universal Plus procedure (Qiagen). To minimize the possibility of RNA contamination during sampling, the entire RNA preparation (approximately 200 ug) was subjected to mRNA enrichment using Oligotex beads (Qiagen) as recommended by the manufacturer. Subsequently, the entire enriched mRNA preparation (approximately 5 ug, equivalent to 2% of total RNA) was subjected to the following sequence:
[0264] [ka]
[0265] The cDNA was reverse transcribed using a library-specific primer containing (CAP stop codon is underlined) in a 40 μl Superscript IV reaction (Life Technologies) (Figure 19). The entire pool of cDNA was then amplified in a 500 μl PCR reaction for 30 cycles with an annealing temperature of 55°C and extension for 2 minutes, using the Q5 master mix, GloSpliceF6 forward primer, and CAP9-specific reverse primer:
[0266] [ka]
[0267] The amplicons were assembled using the (CAP stop codon is underlined) method. This method made it possible to recover a large number of amplicons from all brain samples (Figure 20). Next, the full-length capsid amplicons were used as templates for NGS library generation and cloned into P1 DNA libraries using the exact same assembly and cloning-free procedure for the next round of biopanning. NGS analysis performed on the PCR amplicons showed that library diversity decreased to approximately 1 / 25th (from 1e7 to 4e5) after the first round of biopanning in both the syn-driven and GFAP-driven libraries (Figure 21). The number of first-passage variants (P1) recovered was too large to show any significant sequence convergence at this point, and there was little overlap between the compositions of the pools recovered from individual animals. Therefore, a second round of selection was performed. After the second biopanning (P2), the total number of unique variants decreased further by 1 / 4 to 1 / 5, to <1e5 peptides. Importantly, some of the libraries recovered after the first round of biopanning showed significant counts of wild-type AAV9 and AAV-PHP.eB sequences, likely derived from environmental contaminants. These later served as useful benchmarks in the second round of enrichment.
[0268] After recovering the RNA and amplifying it by PCR, systematic enrichment analysis by NGS was performed by calculating the P2 / P1 read ratio and comparing it to the P2 / P1 ratio of AAV9 or PHPeB. As shown in Figure 22, Table 4, Figure 23, and Table 5, several capsids showed higher enrichment ratios than the benchmark PHP.eB in both syn-driven and GFAP-driven libraries, and sequence convergence was evident, as represented by consensus sequence generation.
[0269] [Table 4-1]
[0270] [Table 4-2]
[0271] [Table 5-1]
[0272] [Table 5-2]
[0273] [Table 5-3]
[0274] Importantly, this suggests strong sequence convergence even between different animals, and that selection was efficient after only two passages. Figures 24 and 25 provide estimates of brain / liver specificity in the GFAP-AAV9 peptide library candidate.
[0275] Example 8. Multiplexing Selection For final multiplexed in vivo screening by pooling individual variants into an equimolar library, a subpopulation of variants with promising properties (but not limited to, enrichment coefficient in more than one mouse, liver targeting, high counting, etc.) can be selected as shown in Figure 26, and then an equimolar primer pool encoding all heptomers can be synthesized (microchip solid-phase synthesis, up to 3,800 primers per chip). A limited diversity library can be produced that includes internal controls such as PHP.N, PHP.B, wild-type AAV9 (wtAAV9), and / or any other serotypes, including those taught herein. Mice are injected, and then RNA enrichment is compared to the internal controls in a manner similar to the barcoding studies known in the art and described herein.
[0276] Example 9. Codon optimization Codon variants can be used to improve data strength when using synthesized libraries. A list of various amino acid NNK codons, NNM codons, and the most preferred NNM codon in mammals is provided in Table 6. In Table 6, * This means that the NNM codon is not available. ** This means "avoid homopolymeric elongation if possible."
[0277] [Table 6]
[0278] To have a balanced library, it is recommended to establish a list of potential candidates and then, using Table 6, establish a pooled primer library containing all peptide variants encoded by NNK codons (originals derived from the library) and non-NNK codons (highest variability). If similar behavior is observed between two variants of the same peptide, this will enhance the analysis of that peptide. In addition, it is recommended to select the most preferred NNM codon (M=A or C).
[0279] Example 10. Library Generation We selected the top 330 peptide variants from SYN-driven and GFAP-driven libraries that showed enhanced performance compared to the parent AAV9. De novo libraries were generated by pooled primer synthesis of all 330 peptide sequences, plus AAV9, AAV-PHP.B, and AAV-PHP.eB controls (Table 7). To eliminate potential artifacts due to the DNA sequence and increase assay robustness, each peptide variant was encoded by two different DNA sequences: one encoding all amino acids with NNK codons (identical to the original library), and the other using NNM codons (M=C or A, Table 6) whenever possible.
[0280] [Table 7-1]
[0281] [Table 7-2]
[0282] [Table 7-3]
[0283] [Table 7-4]
[0284] Table 7-5
[0285] Table 7-6
[0286] Table 7-7
[0287] Table 7-8
[0288] Table 7-9
[0289] Table 7-10
[0290] Table 7-11
[0291] Table 7-12
[0292] Table 7-13
[0293] Table 7-14
[0294] Table 7-15
[0295] Table 7-16
[0296] Table 7-17
[0297] Table 7-18
[0298] Table 7-19
[0299] Table 7-20
[0300] Table 7-21
[0301] Table 7-22
[0302] Table 7-23
[0303] The primer pool was produced by Twist Biosciences using solid-phase synthesis. Using these, a balanced library of 666 nucleotide variants was generated by PCR amplification of the CAP C-terminus and Gibson assembly as shown in Figure 27. The 666 primers were supplied at 1 fmole each, totaling 0.6 pmole (normal PCR requires approximately 25 pmole of primers). Primer-free amplification against the capsid gBlock template was performed over 10 cycles. Forward and reverse primers were added, followed by an additional 10, 15, or 20 PCR cycles. The constructs were then cloned into AAV9 backbone plasmids by Gibson / RCA (as with a normal library).
[0304] NGS analysis of SYN-driven and GFAP-driven AAV libraries produced from pooled DNA showed good correlations between codon variants of each peptide, suggesting that the DNA sequence itself had little effect on virus production (Figures 28 and 29). The pooled synthetic libraries were intravenously injected into C57BL / 6 mice (5e11VG per mouse, N=9), BALB / C mice (5e11VG per mouse, N=6), and rats (5e12VG per rat, N=6). One month after survival, RNA was extracted from brain and spinal cord, and DNA was extracted from liver and heart tissue samples for in vivo distribution analysis (Figure 30). Since synapsin promoters and GFAP promoters are not sufficiently active in non-CNS tissues, DNA was analyzed instead of RNA in peripheral organs. C57BL / 6 mouse analysis was the initial focus because this was the mouse strain in which library evolution was performed.
[0305] The enrichment score for each capsid was determined by NGS analysis and defined as the ratio of reads per million (RPM) in the target tissue to the RPM in the inoculum. An example of the analysis performed on the control capsid is shown in Figure 31A. As expected from published data, the PHP.B and PHP.eB (also known as PHP.N) capsids enabled significantly higher RNA expression in neurons compared to the AAV9 parental capsid (8-fold and 25-fold, respectively). Very high correlations existed between codon variants of each peptide species in each animal (r=0.92, 0.93, and 0.95), confirming the robustness of the NGS assay (Figures 31B-31D).
[0306] Examples of enrichment analysis are shown in Figures 32A–36. 333 capsid variants were ranked by the average brain enrichment score of all animals, and individual enrichment values are shown on a color scale. As indicated by the position of the reference capsid, the group of novel variants showed higher enrichment scores than the PHP.eB benchmark capsid in both neurons (Syn-driven) and astrocytes (GFAP-driven). Interestingly, many variants showed different enrichment scores in neurons and astrocytes, as indicated by the moderate level of correlation between Syn-driven RNA and GFAP-driven RNA. This suggests that certain capsids exhibit enhanced tropism towards neurons, while others exhibit enhanced tropism towards astrocytes (Figure 33).
[0307] The group of 38 capsids exhibited potentially interesting properties based on their tropism towards neurons, astrocytes, or both (Tables 8A and 8B) (Figure 38), showing strong consensus peptide sequence similarity, with the similarity differing between neuron-targeted and astrocyte-targeted variants (Figures 45–45C and 46A–46B).
[0308] [Table 8]
[0309] [Table 9-1]
[0310] [Table 9-2]
[0311] [Table 9-3]
[0312] Example 11. Phylogenetic grouping Phylogenetic grouping of peptide sequences demonstrated a clear correlation between sequence homology clusters and capsid phenotypes (Figure 37). For example, the necaper variant containing the sequence DGTxxxPFK / R (SEQ ID NO: 1181) exhibited similar behavior to the PHP.eB capsid (high transduction of both neurons and astrocytes), while the variant containing the sequence DGTxxxYDS / A (SEQ ID NO: 1182) showed preference for neuronal transduction. In contrast, peptides containing the consensus DGTxxxxGW (SEQ ID NO: 1183) or CGTxxxPPR / K (SEQ ID NO: 1184) showed higher tropism towards astrocytes.
[0313] Example 12. Capsid Test Capsid variants representing distinct sequence clusters (highlighted in Figure 37B) were selected for individual transduction analysis in C57BL / 6 mice. Each capsid was produced as a recombinant AAV packaging a self-complementary EGFP transgene driven by a ubiquitous promoter (Figure 49A, B). A group of mice (N=3) were intravenously injected with 6e10VG, and transduction efficiency was assessed by quantifying EGFP mRNA in brain, spinal cord, and liver tissues one month later. EGFP mRNA expression was normalized using mouse TBP as a housekeeping gene, and the in vivo distribution of DNA was normalized relative to the single-copy mouse TfR gene (Figures 50A-50C). Reverse transcription was performed using the Quantitect kit and included DNA removal. All capsid variants showed significant improvements in brain and spinal cord mRNA expression compared to the parental AAV9 capsid, with three of the seven variants (9P16, 9P31, and 9P35) exhibiting similar or higher transduction than the PHP.eB benchmark capsid (Figure 49C, Table 10). Viral DNA in vivo distribution showed very strong tropism for 9P31 and 9P35 to the brain and spinal cord, but all variants showed a 40-260-fold increase in in vivo distribution compared to AAV9 (Figure 49D, Table 10).
[0314] By labeling with neuronal NeuN markers, expected cell tropism was tested using NGS screening (Figure 51). In the cortex, the top capsids in GFAP screening primarily showed GFP expression in NeuN-negative cells with glial morphological features. Conversely, the top capsids in SYN screening showed very high transduction of NeuN-positive cells, and the bispecific capsids 9P08 and 9P16, which ranked highly in both assays, showed mixed cell preference with multiple NeuN+ cells and glial cells.
[0315] Furthermore, cell tropism was tested using mouse brain microvascular EC (mBMVEC) binding to AAV9. The results are shown in Table 9.
[0316] [Table 10]
[0317] Fluorescent EGFP expression in whole brain, cerebellum, cortex, and hippocampal tissues reveals transduction patterns across the entire spectrum and demonstrates tissue-specific capsid recognition (Figures 52-56).
[0318] Liver transduction, measured by mRNA expression and whole-tissue GFP expression, showed that several variants performed better than AAV9. This was unexpected in light of the NGS results. Some variants, such as 9P08 or 9P23, showed relative liver targeting detargeting compared to AAV9 (Figures 57A-57B).
[0319] [Table 11]
[0320] Example 13. Multirodent test (interspecies) The efficacy of 333 capsid variants in CNS transduction was tested in other rodent strains or species (Figure 47). Controlled comparisons of neuronal and astrocyte transduction in C57BL / 6 mice, BALB / C mice, and rats showed significant differences between the two mouse strains in enrichment scores for multiple variants, and even more pronounced differences between mice and rats (Figures 48A–48C). Surprisingly, the most efficient capsid for rat brain transduction was parental AAV9. This suggests that directed evolutionary "bottleneck" capsid variants perform better in a given species, in contrast to the versatility of wild-type AAV capsids.
[0321] Correlation analysis showed that some capsids shared high CNS transduction between C57BL / 6 mice and BALB / C mice, while other capsids were limited to only one strain (Figure 48B).
[0322] Interestingly, PHP.B and PHP.eB capsids showed poor brain phenotype in BALB / C mice, consistent with a recent publication (Hordeaux et al., 2018). Focusing on capsids that showed a >10-fold increase in brain phenotype, 62 variants showed improvement only in C57BL / 6 mice, 28 variants showed improvement only in BALB / C mice, and 30 variants showed improved brain phenotype in both strains (Table 11). Consensus sequence analysis showed a "C57BL / 6 signature" that was closely similar to the PHP.eB peptide (DGTxxxPFR (SEQ ID NO: 1185)), while the BALB / C signature showed a different consensus (DGTxxxxGW (SEQ ID NO: 1183)). This suggests that different cellular receptors were used (Figure 48C).
[0323] [Table 12-1]
[0324] [Table 12-2]
[0325] [Table 12-3]
[0326] [Table 12-4]
[0327] [Table 12-5]
[0328] Furthermore, the effectiveness of CNS transduction of 333 capsid variants was compared in C57BL / 6 mouse BMVEC and human BMVEC (Figures 58A and 58B). Example 14. Genetic manipulation of an NGS-driven selection system for full-length capsid variants. We genetically engineered a barcode system to enable enrichment studies using full capsid length modification. The TRACER platform described herein was initially developed for use with peptide display libraries. While randomized peptide sequences themselves can be used for Illumina NGS analysis due to their short size, Illumina sequencing techniques are typically not capable of sequencing more than 300 consecutive bases. Therefore, our platform cannot be used for NGS analysis of full-length capsid variants, such as those generated by DNA shuffling techniques or error-prone PCR.
[0329] We designed an alternative RNA-driven platform for full-length capsid libraries in which a unique molecular identified (UMI) is positioned outside the capsid gene and can be used for NGS enrichment analysis (Figures 59A-59C). Once variants with desired characteristics are identified by UMI enrichment analysis of animal tissue, the UMI sequence should enable highly specific recovery of full-length capsids from the starting material with minimal error. For this system to be effective, it should have one or more of the following characteristics: 1) the UMI should be transcribed under the control of a cell-type specific promoter; 2) the UMI should not interfere with capsid expression or splicing during virus production; 3) the UMI should be short enough for Illumina NGS sequencing (typically less than 60 nt for standard single-ended 75 nt sequencing); and 4) the UMI should enable sequence-specific recovery of the desired full-length capsid from the start DNA / virus library with minimal error.
[0330] To address these characteristics, 1) UMI was placed in the transcription region of the capsid library (i.e., any location between the transcription start site and the polyadenylation signal), 2) UMI was placed at various positions in the AAV intron (which is hardly spliced in the absence of helper function) or between the capsid stop codon and the polyadenylation signal, 3) the UMI cassette consisted of two randomized 21nt sequences separated by a 15nt spacer, with a total length of 57nt, allowing for the addition of 18 nucleotides for primer annealing, and 4) the UMI randomized sequences were formed as an NSW triplet (N=A,T,G,C;S=G,C;W=A,T) to prevent large variability in annealing temperature with amplified primers, avoid homopolymeric elongation, and prevent the formation of an intermediate poly-A signal (AATAAA).
[0331] Importantly, the UMI cassette contained two random sequences in series. The first sequence (outermost) was used to design matching capsid recovery primers, and the second sequence (innermost) was used to confirm the identity of the capsid amplicon after cloning. This method should make it possible to eliminate all clones containing nonspecific amplification products. In an alternative embodiment, the innermost sequence could also be used to design nested PCR primers to increase amplification specificity (Figures 59A-59C).
[0332] To test the impact on viral viability and titer, several insertion sites of tandem barcodes were explored. A series of constructs were genetically engineered to insert barcodes into the AAV introns of the CAG9 plasmid (Figure 60A). Since the AAV introns are spliced during viral production, the presence of barcodes should have minimal impact on yield. Conversely, because AAV splicing is highly ineffective in the absence of helper function (Mouw et al., 2000), the barcode sequence would be conserved in RNA recovered from animal tissue. All intron barcode constructs were tested for their ability to produce high-titer AAV offspring by co-transfecting them with pHelper plasmids and pREP3stop plasmids. All constructs enabled high-titer AAV production ranging from 50% to 80% of non-barcoded CAG9 viruses (Figure 60B).
[0333] RNA splicing analysis of transfected cells showed that the rate of AAV intron splicing differed slightly between constructs, and that inserting the intron barcode after the conserved intervening sequence downstream of the splice donor was more efficient (Figure 58C, upper panel).
[0334] Globin intron splicing was 100% effective under all test conditions (Figure 60C, lower panel). As expected, AAV intron splicing was almost undetectable in the absence of helper function.
[0335] An alternative platform in which a tandem barcode was placed between the capsid stop codon and the polyadenylation signal was tested (Figure 59B). The titer produced by the 3' barcoded construct was identical to that of the non-barcoded CAG9 construct.
[0336] Overall, the external barcoding of full-length capsids enables highly efficient AAV production, and the novel tandem barcoding platform allows for highly reliable NGS-driven sequence-specific recovery from library preparations.
[0337] [Table 13-1]
[0338] [Table 13-2]
[0339] [Table 13-3]
[0340] [Table 13-4]
[0341] [Table 13-5]
[0342] [Table 13-6]
[0343] [Table 13-7]
[0344] [Table 13-8]
[0345] [Table 13-9]
[0346] Table 13-10
[0347] Table 13-11
[0348] Table 13-12
[0349] Table 13-13
[0350] Table 13-14
[0351] Table 13-15
[0352] Table 13-16
[0353] Table 13-17
[0354] Table 13-18
[0355] Table 13-19
[0356] Table 13-20
[0357] Table 13-21
[0358] Table 13-22
[0359] Table 13-23
[0360] Table 13-24
[0361] Table 13-25
[0362] Table 13-26
[0363] Table 13-27
[0364] Table 13-28
[0365] References
[0366] Table 14-1
[0367] Table 14-2
Claims
1. A variant adeno-associated virus serotype 9 (AAV9) capsid polypeptide, Containing the amino acid sequence of SEQ ID NO: 134, A variant AAV9 capsid polypeptide wherein the amino acid sequence is located within loop VIII of the variant AAV9 capsid polypeptide.
2. The variant AAV9 capsid polypeptide according to claim 1, wherein the amino acid sequence is located immediately after a position selected from positions 586 to 592 of the variant AAV9 capsid polypeptide numbered according to Sequence ID No.
2.
3. The variant AAV9 capsid polypeptide according to claim 1 or 2, wherein the variant AAV9 capsid polypeptide further comprises the amino acid sequence of SEQ ID NO: 2, or an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO:
2.
4. The variant AAV9 capsid polypeptide according to claim 1 or 2, wherein the variant AAV9 capsid polypeptide further comprises the amino acid sequence of SEQ ID NO: 3, or an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO:
3.
5. Adeno-associated virus (AAV) particles comprising a variant AAV9 capsid polypeptide and a viral genome according to any one of claims 1 to 4.
6. The AAV particle according to claim 5, wherein the viral genome encodes one or more siRNA molecules.
7. A pharmaceutical composition comprising the AAV particles described in claim 5 or 6.
8. AAV particles according to claim 5 or 6, or a pharmaceutical composition according to claim 7, for use in delivering a payload.
9. AAV particles according to claim 5 or 6, or a pharmaceutical composition according to claim 7, for use in the treatment of neurological disorders in the subject.
10. The AAV particles or pharmaceutical composition according to claim 9, wherein the neurological disease is Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Parkinson's disease, or Huntington's disease.
11. The AAV particles or pharmaceutical composition according to any one of claims 8 to 10, wherein the AAV particles or pharmaceutical composition are formulated for intravenous administration.
12. Use of AAV particles according to claim 5 or 6 or the pharmaceutical composition according to claim 7 in the manufacture of a pharmaceutical for the delivery of a payload.
13. Use of AAV particles according to claim 5 or 6 or the pharmaceutical composition according to claim 7 in the manufacture of a pharmaceutical for the treatment of neurological disorders in a subject.
14. The use according to claim 13, wherein the neurological disorder is Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Parkinson's disease, or Huntington's disease.
15. The use according to any one of claims 12 to 14, wherein the AAV particles or pharmaceutical composition are formulated for intravenous administration.