Template-directed immunomodulation for cancer treatment
By administering 5'-uncapped triphosphate-modified RNA oligonucleotides complementary to tumor-specific miRNAs, the method effectively activates RIG-I in the tumor microenvironment, inducing a potent immune response against cancer.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- TRANSCODE THERAPEUTICS INC
- Filing Date
- 2021-12-29
- Publication Date
- 2026-07-08
AI Technical Summary
Current cancer treatments lack effective mechanisms to selectively activate RIG-I in the tumor microenvironment for targeted cancer therapy.
Administering therapeutically effective amounts of single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotides complementary to miRNAs highly expressed in the tumor microenvironment to activate RIG-I, inducing a tumor-specific immune response.
The method elicits a robust tumor-specific immune response, including the release of type I IFNs, DAMPs, and tumor antigens, potentially leading to complete remission and resistance to cancer recurrence.
Smart Images

Figure 0007886877000009 
Figure 0007886877000010 
Figure 0007886877000011
Abstract
Description
Technical Field
[0001] Cross - reference to related applications This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 132,315, filed on December 30, 2020. The specification of the said application is hereby incorporated by reference in its entirety into this specification.
Background Art
[0002] Background of the Invention Cancer represents a continuous and significant threat to overall human health. The use of novel mechanisms for treating cancer represents a promising means of delivering therapeutic agents that meet an ongoing and urgent need for effective cancer treatment. Recent studies have shown that systemic delivery of synthetic RIG - I (retinoic acid - inducible gene I) agonists inhibits tumor growth. RIG - I senses short double - stranded RNAs with a non - capped 5'-triphosphate moiety, a common motif typically found in viral RNAs. RIG - I is expressed in a number of cell types, including tumor cells, and serves as a promising target for cancer treatment. Accordingly, it is an object of the present disclosure to provide compositions and methods for selectively activating RIG - I in the tumor microenvironment for treating cancer. Therapeutic methods that utilize endogenous miRNAs as means for activating RIG - I provide a very promising approach for targeting the tumor microenvironment and treating various related cancers.
[0003] The compositions and methods of the present disclosure provide a method for selectively activating RIG - I in the tumor microenvironment using single - stranded 5'-non - capped triphosphate or diphosphate - modified RNA oligonucleotides complementary to miRNAs highly expressed in the tumor microenvironment compared to the non - tumor environment.
Summary of the Invention
Means for Solving the Problems
[0004] Summary of the Invention In certain embodiments, the present disclosure relates to a method for treating cancer, comprising administering to a subject a therapeutically effective amount of a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to miRNAs highly expressed in the tumor or tumor microenvironment compared to the non-tumor or non-tumor microenvironment.
[0005] In certain embodiments, the Disclosure relates to a method for selectively activating RIG-I in a tumor or tumor microenvironment, comprising administering to a subject a therapeutically effective amount of a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to a miRNA expressed in the tumor or tumor microenvironment, and the RIG-I is selectively activated in the tumor or tumor microenvironment expressing the miRNA.
[0006] In some embodiments, the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide forms a double helix with the miRNA. In some embodiments, the miRNA is an oncogenic miRNA. In some embodiments, the miRNA is a tumor-associated miRNA. In some embodiments, the double helix is not cleaved by AGO2. In some embodiments, the double helix activates RIG-I. In some embodiments, RIG-I activation is at least 5%, 10%, 15%, or 20% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation elicits a tumor-specific immune response. In some embodiments, the tumor-specific immune response includes the release of type I IFNs, DAMPs (danger-associated molecular patterns), and / or tumor antigens. In some embodiments, the method induces immunological memory against the tumor or tumor microenvironment.
[0007] In some embodiments, cancer is a solid tumor. In some embodiments, the solid tumor is selected from the group consisting of sarcomas, carcinomas, and lymphomas. In some embodiments, cancer is selected from the group consisting of bladder cancer, hematological cancer, bone cancer, brain cancer, breast cancer, colon cancer, cervical cancer, kidney cancer, esophageal cancer, liver cancer, lung cancer, thyroid cancer, skin cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, stomach cancer, uterine cancer, glioblastoma, or head and neck cancer. In some embodiments, the modified RNA oligonucleotide does not include any other modifications.
[0008] In some embodiments, the modified RNA oligonucleotide comprises at least two different modified RNA oligonucleotides. In some embodiments, the modified RNA oligonucleotide comprises at least three different modified RNA oligonucleotides. In some embodiments, the modified RNA oligonucleotide comprises at least four different modified RNA oligonucleotides. In some embodiments, the modified RNA oligonucleotide comprises at least five different modified RNA oligonucleotides. In some embodiments, the modified RNA oligonucleotide comprises up to 40 different modified RNA oligonucleotides.
[0009] In some embodiments, the modified RNA oligonucleotide further comprises a 2'-fluoro(2'-F) ribose modification. In some embodiments, the 2'-F ribose modification is located at the 10th or 11th nucleotide from the 5' end of the modified RNA oligonucleotide. In some embodiments, the modified RNA oligonucleotide does not contain a 2'-O-methyl(2'-OMe) ribose modification. In some embodiments, the modified RNA oligonucleotide does not contain an N-6-methyladenosine (m6A) modification. In some embodiments, the modified RNA oligonucleotide does not contain pseudouridine (Ψ). In some embodiments, the modified RNA oligonucleotide does not contain an N-1-methylpseudridine (mΨ) modification. In some embodiments, the modified RNA oligonucleotide does not contain a 5-methylcytidine (5mC) modification. In some embodiments, the modified RNA oligonucleotide does not contain a 5-hydroxymethylcytidine (5hmC) modification. In some embodiments, the modified RNA oligonucleotide does not contain a 5-methoxycytidine (5moC) modification.
[0010] In some embodiments, the modified RNA oligonucleotide comprises a sequence of at least 19 nucleotides in length. In some embodiments, the modified RNA oligonucleotide comprises a sequence of 15 to 30 nucleotides in length. In some embodiments, the modified RNA oligonucleotide comprises a sequence of 16 to 27 nucleotides in length. In some embodiments, the modified RNA oligonucleotide is perfectly complementary to the miRNA. In some embodiments, the modified RNA oligonucleotide competes with endogenous mRNA to bind to the miRNA. In some embodiments, the double helix contains 0 to 5 mismatched base pairs.
[0011] In some embodiments, the method includes administering a modified RNA oligonucleotide having the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the nucleic acid of SEQ ID NO: 6 is complementary to miR-21. In some embodiments, the cancer is selected from the group consisting of cancers of the breast, ovary, cervix, colon, lung, liver, brain, esophagus, prostate, pancreas, and thyroid. In some embodiments, the method includes administering a modified RNA oligonucleotide having the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid of SEQ ID NO: 1 is complementary to miR-10b. In some embodiments, the cancer is non-small cell lung cancer or cervical cancer. In some embodiments, the cancer is metastatic cancer. In some embodiments, cytosine and uracil are present at the AGO2 cleavage site. In some embodiments, the metastatic cancer is localized to the breast, lymph nodes, lungs, bones, brain, liver, ovaries, peritoneum, muscle tissue, pancreas, prostate, esophagus, colon, rectum, stomach, nasopharynx, or skin. In some embodiments, the treatment with the modified RNA oligonucleotide is monotherapy. In some embodiments, the modified RNA oligonucleotide is administered intravenously, subcutaneously, intra-arterially, intramuscularly, intraperitoneally, or locally. In some embodiments, the modified RNA oligonucleotide is administered in doses ranging from approximately 0.2 mg / kg to approximately 200 mg / kg. In some embodiments, the modified RNA oligonucleotide is administered in doses ranging from approximately 0.2 mg / kg to approximately 2.0 mg / kg. In some embodiments, the modified RNA oligonucleotide is administered in doses ranging from approximately 1.0 mg / kg to approximately 10.0 mg / kg.
[0012] In certain embodiments, the present disclosure relates to a method for treating cancer, comprising administering to a subject a therapeutically effective amount of magnetic nanoparticles comprising ferric chloride, ferrous chloride, or a combination thereof; a dextran coating; and a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to miRNAs highly expressed in the tumor or tumor microenvironment compared to the non-tumor or non-tumor microenvironment. In some embodiments, the magnetic nanoparticles have a nonlinearity index in the range of about 6 to about 40. In some embodiments, the magnetic nanoparticles have a nonlinearity index in the range of about 8 to about 14. In some embodiments, the magnetic nanoparticles contain about 0.54 g of ferric chloride and about 0.2 g of ferrous chloride. In some embodiments, the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the miRNA is an oncogenic miRNA. In some embodiments, the miRNA is a tumor-associated miRNA.
[0013] In some embodiments, the method further includes administering supportive or adjuvant therapy. In some embodiments, the adjuvant therapy includes radiotherapy, cryotherapy, and ultrasound therapy.
[0014] In some embodiments, the method includes administering an additional therapeutic agent. In some embodiments, the additional therapeutic agent includes miRNA. In some embodiments, the miRNA is complementary to a modified RNA oligonucleotide. In some embodiments, the additional therapeutic agent is selected from the group consisting of targeted therapies, chemotherapeutic agents, immunotherapies, immunogenic cell death inducers (ICDi), and siRNA therapies. In some embodiments, the method further includes surgical intervention. In some embodiments, the chemotherapeutic agent is selected from the group consisting of cyclophosphamide, mechloretamine, chlorambucil, melphalan, daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, barrubicin, paclitaxel, docetaxel, etoposide, teniposide, tafluposide, azacitidine, azathioprine, capecitabine, cytarabine, doxifluridine, fluorouracil, gemcitabine, mercaptopurine, methotrexate, thioguanine, bleomycin, carboplatin, cisplatin, oxaliplatin, all-trans retinoic acid, vinblastine, vincristine, vindesine, vinorelbine, and bevacizumab. In some embodiments, targeted therapy includes trastuzumab, giotrif, proleukin, alectinib, canas, atezolizumab, avelumab, axitinib, belimumab, bellinostat, bevacizumab, velcade, canakinumab, ceritinib, cetuximab, crizotinib, dabrafenib, daratumumab, dasatinib, denosumab, and ero. The immunotherapeutic agent is selected from the group consisting of tuzumab, enasidenib, erlotinib, gefitinib, ibrutinib, zyderig, imatinib, lenvatinib, midostaurin, necitumumab, niraparib, obinutuzumab, osimertinib, panitumumab, regorafenib, rituximab, ruxolitinib, sorafenib, tocilizumab, and trastuzumab. In some embodiments, the immunotherapeutic agent is an immune checkpoint inhibitor.In some embodiments, the immune checkpoint inhibitor is selected from the group consisting of pembrolizumab (Keytruda®), nivolumab (Opdivo®), atezolizumab (Tecentriq®), ipilimumab (Yervoy®), avelumab (Bavencio®), and durvalumab (Imfinzi®). In some embodiments, the adjuvant therapy induces miRNA expression. In some embodiments, the additional therapeutic agent induces miRNA expression. In some embodiments, the ICDi is selected from the group consisting of daunorubicin, docetaxel, doxorubicin, mitoxantrone, oxaliplatin, and paclitaxel. In some embodiments, the siRNA therapy targets PD-L1, CTLA-4, TGF-β, and / or VEGF. In some embodiments, the supportive or adjuvant therapy is administered before, concurrently with, or after the administration of the modified RNA oligonucleotide.
[0015] In certain embodiments, the disclosure relates to compositions comprising single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotides that are complementary to miRNAs highly expressed in tumor tissue compared to non-tumor tissue. In some embodiments, the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the modified RNA oligonucleotide can form a double helix with the miRNA. In some embodiments, the double helix is not cleaved by AGO2. In some embodiments, the double helix activates RIG-I. In some embodiments, the RIG-I activation is at least 5%, 10%, 15%, or 20% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation elicits a tumor-specific immune response. In some embodiments, the tumor-specific immune response includes the release of type I IFN, DAMP (danger-associated molecular pattern), and / or tumor antigens.
[0016] In some embodiments, the modified RNA oligonucleotide contains no other modifications. In some embodiments, the modified RNA oligonucleotide further includes 2'-fluoro(2'-F) ribose modification. In some embodiments, the modified RNA oligonucleotide does not include 2'-O-methyl(2'-OMe) ribose modification. In some embodiments, the modified RNA oligonucleotide does not include N-6-methyladenosine (m6A) modification. In some embodiments, the modified RNA oligonucleotide does not include pseudouridine (Ψ). In some embodiments, the modified RNA oligonucleotide does not include N-1-methylpseudridine (mΨ) modification. In some embodiments, the modified RNA oligonucleotide does not include 5-methylcytidine (5mC) modification. In some embodiments, the modified RNA oligonucleotide does not include 5-hydroxymethylcytidine (5hmC) modification. In some embodiments, the modified RNA oligonucleotide does not include 5-methoxycytidine (5moC) modification. In some embodiments, the modified RNA oligonucleotide is completely complementary to the miRNA. In some embodiments, the modified RNA oligonucleotide competes with endogenous mRNA to bind to the miRNA. In some embodiments, the double helix contains 0 to 5 mismatched base pairs. In some embodiments, the modified RNA oligonucleotide contains one of the nucleic acid sequences SEQ ID NOs: 1 to 13.
[0017] In some embodiments, modified RNA oligonucleotides are further linked to the nanoparticles. In some embodiments, the nanoparticles are magnetic nanoparticles. In some embodiments, the magnetic nanoparticles are coated with a polymer coating. In some embodiments, the polymer coating is dextran. In some embodiments, the magnetic nanoparticles comprise iron oxide and a dextran coating functionalized with one or more amine groups, the number of one or more amine groups ranging from about 5 to about 1000. In some embodiments, the iron content of the magnetic nanoparticles comprises about 50 wt% to about 100% wt of iron(III) and about 0% wt to about 50% wt of iron(II). In some embodiments, the magnetic nanoparticles contain about 5 to about 150 amino groups. In some embodiments, the magnetic nanoparticles comprise one or more such modified RNA oligonucleotides.
[0018] In certain embodiments, the disclosure relates to a composition comprising magnetic nanoparticles comprising ferric chloride, ferrous chloride, or a combination thereof; a dextran coating; and a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to miRNAs highly expressed in a tumor or tumor microenvironment compared to a non-tumor or non-tumor microenvironment. In some embodiments, the magnetic nanoparticles have a nonlinearity index in the range of about 6 to about 40. In some embodiments, the magnetic nanoparticles have a nonlinearity index in the range of about 8 to about 14. In some embodiments, the magnetic nanoparticles contain about 0.54 g of ferric chloride and about 0.2 g of ferrous chloride. In some embodiments, the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the miRNA is an oncogenic miRNA. In some embodiments, the miRNA is a tumor-associated miRNA.
[0019] In some embodiments, the magnetic nanoparticles contain two or more modified RNA oligonucleotides. In some embodiments, the two or more modified RNA oligonucleotides are complementary to different miRNAs. In some embodiments, the two or more modified RNA oligonucleotides are complementary to the same miRNA.
[0020] In certain embodiments, this disclosure relates to a pharmaceutical composition comprising a modified RNA oligonucleotide or magnetic nanoparticle disclosed herein. In some embodiments, the pharmaceutical composition further comprises a delivery agent. In some embodiments, the delivery agent is selected from the group consisting of micelles, lipid nanoparticles (LNPs), globular nucleic acids (SNAs), extracellular vesicles, synthetic vesicles, exosomes, lipidoids, liposomes, and lipoplexes. In some embodiments, the liposome is formed from a lipid bilayer. In some embodiments, the lipid bilayer comprises one or more phospholipids selected from the group consisting of phospholipids, phosphoglycerol lipids, phosphocholine lipids, and phosphoethanolamine lipids. In some embodiments, the phospholipids are PEGylated. In some embodiments, the delivery agent is a liposome or lipid nanoparticles. In some embodiments, the liposome or lipid nanoparticles further deliver an additional therapeutic agent. In some embodiments, the additional therapeutic agent is an ICDi (e.g., daunorubicin, docetaxel, doxorubicin, mitoxantrone, oxaliplatin, and paclitaxel). In some embodiments, the additional therapeutic agent is siRNA (e.g., siRNA targeting cancer-related genes). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In some embodiments, the pharmaceutical composition comprises at least one additional modified RNA oligonucleotide. In some embodiments, the modified RNA oligonucleotide is administered in doses ranging from about 0.2 mg / kg to about 200 mg / kg. In some embodiments, the modified RNA oligonucleotide is administered in doses ranging from about 0.2 mg / kg to about 2.0 mg / kg. In some embodiments, the modified RNA oligonucleotide is administered in doses ranging from about 1.0 mg / kg to about 10.0 mg / kg.
[0021] In some embodiments, single-stranded antisense RNAs are provided herein that have a 5' diphosphate (5'pp anti-miRNA or mRNA) or 5' triphosphate modification (5'ppp anti-miRNA or mRNA), preferably containing a sequence complementary to the miRNA or mRNA listed in Table 1, Table 2, or Table 3, respectively. Also provided are RIG-I agonists containing at least 10-nucleotide length 5' diphosphate (5'pp) or 5' triphosphate (5'ppp) modified RNA that is complementary to an endogenous (preferably tumor-specific) RNA sequence. In some embodiments, the nucleic acid contains at least one modified nucleotide. In some embodiments, the at least one modified nucleotide is a locked nucleotide.
[0022] In some embodiments, compositions and methods comprising specific RNA, such as 5'pp or 5'ppp anti-miRNA / mRNA for inducing an immune response against an endogenous RNA sequence, are provided herein, for example, to treat cancer and reduce the risk of developing cancer.
[0023] In some embodiments, single-stranded antisense RNA is linked to nanoparticles having a diameter of 10 nm to 30 nm and including a polymer coating.
[0024] In some embodiments, single-stranded antisense RNA is ligated to nanoparticles having a diameter of 10 nm to 30 nm and including a polymer coating. In some embodiments, the polymer coating includes dextran.
[0025] In some embodiments, single-stranded antisense RNA is covalently linked to nanoparticles at their 3' end via a chemical moiety containing a disulfide bond or thioether bond. In some embodiments, the nanoparticles are magnetic.
[0026] Also provided herein is a pharmaceutical composition comprising the single-stranded antisense RNA described herein. Further provided herein is a method for treating cancer or reducing the risk of developing cancer in a subject. The method comprises administering a therapeutically effective amount of the single-stranded antisense RNA described herein to a subject having cancer or at risk of developing cancer. In some embodiments, the cancer is selected from the group consisting of bladder cancer, blood cancer, bone cancer, brain cancer, breast cancer, colon cancer, kidney cancer, liver cancer, lung cancer, skin cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, stomach cancer, thyroid cancer, and uterine cancer.
[0027] In some embodiments, administration results in a decrease or stabilization of tumor size in the lymph nodes of the subject or a decrease in the rate of metastatic tumor growth. In some embodiments, the single-stranded antisense RNA is administered to the subject in 2 or more doses. In some embodiments, the single-stranded antisense RNA is administered to the subject at least once a week. In some embodiments, the single-stranded antisense RNA is administered to the subject by intravenous, subcutaneous, intraarterial, intramuscular, or intraperitoneal administration. In some embodiments, the subject is further administered a chemotherapeutic agent.
[0028] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials for use in the present invention are described herein; other suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Other features and advantages of the present invention will become apparent from the following detailed description and drawings, as well as from the claims. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] [Figure 1]Figure 1 is a schematic diagram of the delivery of 5' triphosphorylated antisense tsRNA to tumors and metastases using the nanoparticle delivery system described herein. The antisense tsRNA and tumor-specific tsRNA hybridize to produce 5' ppp-dsRNA, a potent RIG-I agonist. Activation of the RIG-I signaling pathway results in a type I IFN-induced immune response specific to the tumor microenvironment. This immune response is characterized by the activation of dendritic cells (DCs), natural killer cells (NKs), and macrophages. This process involves effective tumor antigen presentation by activated DCs and macrophages, as well as T cell maturation, activation, and tumor cell killing. Simultaneously, regulatory T cells (Tregs) are inhibited, reducing their immunosuppressive effect on the antitumor immune response. Importantly, a subpopulation of memory T cells is generated that induces complete immune rejection of the tumor as a foreign entity upon re-challenge. Together, these processes result in complete remission and resistance to cancer recurrence.
[0030] [Figure 2A-2B] Figure 2 provides summary data demonstrating the ability of ss-ppp-miRNA-21 to induce RIG-I activation in the human RIG-I luciferase reporter cell line HEK-Lucia®RIG-I. High RIG-I expression in cells was confirmed using Western blotting (Figure 2A). A very significant enhancement of luciferase activity was observed in RIG-I overexpressing cells compared to null cells (Figure 2B). ss-ppp-miRNA-21 at dose levels of 2 μg / mL, 4 μg / mL, and 8 μg / mL was evaluated in HEK-Lucia®RIG-I. Significant RIG-I activation was observed at all three dose levels of ss-ppp-miRNA-21 tested (Figure 2C). Dose-dependent caspase 3 / 7 activation was observed, which was more pronounced in the presence of 5'-ppp (Figure 2D). When using the ss-ppp-miRNA-21 RIG-I agonist, a dose-dependent decrease in tumor cell viability was also observed (Figure 2E). [Figure 2C-2D]Figure 2 provides summary data demonstrating the ability of ss-ppp-miRNA-21 to induce RIG-I activation in the human RIG-I luciferase reporter cell line HEK-Lucia®RIG-I. High RIG-I expression in cells was confirmed using Western blotting (Figure 2A). A very significant enhancement of luciferase activity was observed in RIG-I overexpressing cells compared to null cells (Figure 2B). ss-ppp-miRNA-21 at dose levels of 2 μg / mL, 4 μg / mL, and 8 μg / mL was evaluated in HEK-Lucia®RIG-I. Significant RIG-I activation was observed at all three dose levels of ss-ppp-miRNA-21 tested (Figure 2C). Dose-dependent caspase 3 / 7 activation was observed, which was more pronounced in the presence of 5'-ppp (Figure 2D). When using the ss-ppp-miRNA-21 RIG-I agonist, a dose-dependent decrease in tumor cell viability was also observed (Figure 2E). [Figure 2E] Figure 2 provides summary data demonstrating the ability of ss-ppp-miRNA-21 to induce RIG-I activation in the human RIG-I luciferase reporter cell line HEK-Lucia®RIG-I. High RIG-I expression in cells was confirmed using Western blotting (Figure 2A). A very significant enhancement of luciferase activity was observed in RIG-I overexpressing cells compared to null cells (Figure 2B). ss-ppp-miRNA-21 at dose levels of 2 μg / mL, 4 μg / mL, and 8 μg / mL was evaluated in HEK-Lucia®RIG-I. Significant RIG-I activation was observed at all three dose levels of ss-ppp-miRNA-21 tested (Figure 2C). Dose-dependent caspase 3 / 7 activation was observed, which was more pronounced in the presence of 5'-ppp (Figure 2D). When using the ss-ppp-miRNA-21 RIG-I agonist, a dose-dependent decrease in tumor cell viability was also observed (Figure 2E).
[0031] [Figure 3A]Figure 3 provides summary data showing the induction of RIG-I signaling by ss-ppp-miRNA-21 agonists in HEK-Lucia® RIG-I cells transiently transfected with increasing concentrations of synthetic mature miRNA-21 mimetic. Cells were transfected with synthetic mature miRNA-21 mimetic at concentrations of 0 ng / mL, 0.3 ng / mL, 3 ng / mL, 30 ng / mL, and 300 ng / mL; highly significant induction of RIG-I signaling by ss-ppp-miRNA-21 agonists was observed in cells transfected with 30 and 300 ng / mL of synthetic mature miRNA-21 mimetic; 5'-ppp-deficient ss-miRNA-21 failed to induce detectable RIG-I activation (Figure 3A). Dose-dependent analysis of RIG-I activation as a function of miRNA-21 mimite concentration determined an EC50 of 83.4 ng / ml for miRNA-21 mimite when using ss-ppp-miRNA-21; in contrast, the calculated EC50 for 5'-ppp-deficient ss-miRNA-21 was 357.9 ng / ml (Figure 3B). Treatment of B16-F10 mouse melanoma cells with increasing concentrations of RIG-I agonists induced a dose-dependent increase in IFN-β secretion; in contrast, commercially available ds-ppp-RNA agonists failed to stimulate IFN-β secretion (Figure 3C). Caspase 3 / 7 activation as a function of miRNA-21 mimetic concentration was measured in B16-F10 mouse (muring) melanoma cells; a dose-dependent increase in caspase 3 / 7 activation was observed, and the effect was significantly higher in cells treated with ss-ppp-miRNA-21 compared to 5'-ppp-deficient ss-miRNA-21, and comparable to ds-ppp-RNA positive controls (Figure 3D). Figure 3E is a Western blot showing that cells transfected with miR-21 and treated with ss-ppp-miRNA-21 exhibited dramatic upregulation of RIG-I beyond the levels seen with ds-ppp-RNA positive control oligonucleotides.Figure 3F is a Western blot showing that increased reactivity in cells transfected with miR-21 and treated with ss-ppp-miRNA-21 was not associated with increased p65 expression, indicating that the increased reactivity specifically reflected targeted phosphorylation. [Figure 3B-3C]Figure 3 provides summary data showing the induction of RIG-I signaling by ss-ppp-miRNA-21 agonists in HEK-Lucia® RIG-I cells transiently transfected with increasing concentrations of synthetic mature miRNA-21 mimetic. Cells were transfected with synthetic mature miRNA-21 mimetic at concentrations of 0 ng / mL, 0.3 ng / mL, 3 ng / mL, 30 ng / mL, and 300 ng / mL; highly significant induction of RIG-I signaling by ss-ppp-miRNA-21 agonists was observed in cells transfected with 30 and 300 ng / mL of synthetic mature miRNA-21 mimetic; 5'-ppp-deficient ss-miRNA-21 failed to induce detectable RIG-I activation (Figure 3A). Dose-dependent analysis of RIG-I activation as a function of miRNA-21 mimite concentration determined an EC50 of 83.4 ng / ml for miRNA-21 mimite when using ss-ppp-miRNA-21; in contrast, the calculated EC50 for 5'-ppp-deficient ss-miRNA-21 was 357.9 ng / ml (Figure 3B). Treatment of B16-F10 mouse melanoma cells with increasing concentrations of RIG-I agonists induced a dose-dependent increase in IFN-β secretion; in contrast, commercially available ds-ppp-RNA agonists failed to stimulate IFN-β secretion (Figure 3C). Caspase 3 / 7 activation as a function of miRNA-21 mimetic concentration was measured in B16-F10 mouse (muring) melanoma cells; a dose-dependent increase in caspase 3 / 7 activation was observed, and the effect was significantly higher in cells treated with ss-ppp-miRNA-21 compared to 5'-ppp-deficient ss-miRNA-21, and comparable to ds-ppp-RNA positive controls (Figure 3D). Figure 3E is a Western blot showing that cells transfected with miR-21 and treated with ss-ppp-miRNA-21 exhibited dramatic upregulation of RIG-I beyond the levels seen with ds-ppp-RNA positive control oligonucleotides.Figure 3F is a Western blot showing that increased reactivity in cells transfected with miR-21 and treated with ss-ppp-miRNA-21 was not associated with increased p65 expression, indicating that the increased reactivity specifically reflected targeted phosphorylation. [Figure 3D-3E]Figure 3 provides summary data showing the induction of RIG-I signaling by ss-ppp-miRNA-21 agonists in HEK-Lucia® RIG-I cells transiently transfected with increasing concentrations of synthetic mature miRNA-21 mimetic. Cells were transfected with synthetic mature miRNA-21 mimetic at concentrations of 0 ng / mL, 0.3 ng / mL, 3 ng / mL, 30 ng / mL, and 300 ng / mL; highly significant induction of RIG-I signaling by ss-ppp-miRNA-21 agonists was observed in cells transfected with 30 and 300 ng / mL of synthetic mature miRNA-21 mimetic; 5'-ppp-deficient ss-miRNA-21 failed to induce detectable RIG-I activation (Figure 3A). Dose-dependent analysis of RIG-I activation as a function of miRNA-21 mimite concentration determined an EC50 of 83.4 ng / ml for miRNA-21 mimite when using ss-ppp-miRNA-21; in contrast, the calculated EC50 for 5'-ppp-deficient ss-miRNA-21 was 357.9 ng / ml (Figure 3B). Treatment of B16-F10 mouse melanoma cells with increasing concentrations of RIG-I agonists induced a dose-dependent increase in IFN-β secretion; in contrast, commercially available ds-ppp-RNA agonists failed to stimulate IFN-β secretion (Figure 3C). Caspase 3 / 7 activation as a function of miRNA-21 mimetic concentration was measured in B16-F10 mouse (muring) melanoma cells; a dose-dependent increase in caspase 3 / 7 activation was observed, and the effect was significantly higher in cells treated with ss-ppp-miRNA-21 compared to 5'-ppp-deficient ss-miRNA-21, and comparable to ds-ppp-RNA positive controls (Figure 3D). Figure 3E is a Western blot showing that cells transfected with miR-21 and treated with ss-ppp-miRNA-21 exhibited dramatic upregulation of RIG-I beyond the levels seen with ds-ppp-RNA positive control oligonucleotides.Figure 3F is a Western blot showing that increased reactivity in cells transfected with miR-21 and treated with ss-ppp-miRNA-21 was not associated with increased p65 expression, indicating that the increased reactivity specifically reflected targeted phosphorylation. [Figure 3F]Figure 3 provides summary data showing the induction of RIG-I signaling by ss-ppp-miRNA-21 agonists in HEK-Lucia® RIG-I cells transiently transfected with increasing concentrations of synthetic mature miRNA-21 mimetic. Cells were transfected with synthetic mature miRNA-21 mimetic at concentrations of 0 ng / mL, 0.3 ng / mL, 3 ng / mL, 30 ng / mL, and 300 ng / mL; highly significant induction of RIG-I signaling by ss-ppp-miRNA-21 agonists was observed in cells transfected with 30 and 300 ng / mL of synthetic mature miRNA-21 mimetic; 5'-ppp-deficient ss-miRNA-21 failed to induce detectable RIG-I activation (Figure 3A). Dose-dependent analysis of RIG-I activation as a function of miRNA-21 mimite concentration determined an EC50 of 83.4 ng / ml for miRNA-21 mimite when using ss-ppp-miRNA-21; in contrast, the calculated EC50 for 5'-ppp-deficient ss-miRNA-21 was 357.9 ng / ml (Figure 3B). Treatment of B16-F10 mouse melanoma cells with increasing concentrations of RIG-I agonists induced a dose-dependent increase in IFN-β secretion; in contrast, commercially available ds-ppp-RNA agonists failed to stimulate IFN-β secretion (Figure 3C). Caspase 3 / 7 activation as a function of miRNA-21 mimetic concentration was measured in B16-F10 mouse (muring) melanoma cells; a dose-dependent increase in caspase 3 / 7 activation was observed, and the effect was significantly higher in cells treated with ss-ppp-miRNA-21 compared to 5'-ppp-deficient ss-miRNA-21, and comparable to ds-ppp-RNA positive controls (Figure 3D). Figure 3E is a Western blot showing that cells transfected with miR-21 and treated with ss-ppp-miRNA-21 exhibited dramatic upregulation of RIG-I beyond the levels seen with ds-ppp-RNA positive control oligonucleotides.Figure 3F is a Western blot showing that increased reactivity in cells transfected with miR-21 and treated with ss-ppp-miRNA-21 was not associated with increased p65 expression, indicating that the increased reactivity specifically reflected targeted phosphorylation. [Modes for carrying out the invention]
[0032] Detailed explanation 1. Overview miRNA in cancer Small RNAs, such as miRNAs, exert their regulatory functions from within a ribonucleoprotein complex called RISC (RNA-induced silencing complex). The core subunit of RISC is a small RNA bound to a member of the Argonaut family of proteins. Argonauts use small RNAs as guides to identify complementary target transcripts for silencing through various mechanisms. miRNAs are generally captured by the human Argonaut 2 protein (AGO2) and can regulate gene expression by associating with AGO2 and base-pairing with complementary mRNA targets. MiRNAs captured by AGO2 act as guide RNAs to receive complementary RNA targets, hybridize with them, and form double-stranded RNA double helixes. Highly complementary RNA targets have been shown to facilitate the release of guide RNA:target RNA double helixes from AGO2.
[0033] Retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs) are important RNA sensors that mediate the transcriptional induction of type I interferons and other genes, collectively establishing an antiviral host response (Yong HY, Luo D. 2018;9:1379). RIG-I is expressed in virtually all cell types, including tumor cells, and is a promising alternative for enhancing the efficacy of ICIs (immune checkpoint inhibitors) (Heidegger S. et al., 2019. EBioMedicine. 41:146, Poeck H., et al. 2008. Nat. Med. 14:1256). Preclinical studies have shown that systemic delivery of synthetic RIG-I agonists inhibits tumor growth through a mechanism similar to that which induces the removal of virus-infected cells (Poeck H., et al. 2008. 5'-triphosphate-siRNA: turning gene silencing and Rig-I activation against melanoma. Nat. Med. 14:1256). RIG-I involvement leads to preferential tumor cell death (by endogenous or exogenous apoptosis and inflammasome-induced pyroptosis), as well as IFN-I-mediated activation of the innate and adaptive immune systems (see Figure 1 in Elion DL., et al. 2018. Oncotarget. 9:29007). RGT100, a specific RIG-I agonist, is currently in a Phase I / II clinical trial for the treatment of advanced solid tumors and lymphomas (NCT03065023) (Elion DL., et al. 2018. Oncotarget. 9:29007).
[0034] While not constrained by theory, the RIG-I pathway can be selectively activated in the cells described in the methods and compositions of this disclosure by in situ generation of 5'ppp-dsRNA following the introduction of miRNA (5'ppp anti-miRNA) or 5'ppp RNA complementary to mRNA that is specifically expressed in cancer cells (Figure 1). The same or similar selective activation of the RIG-I pathway is expected from 5'ppp-dsRNA. As a result, the antitumor immune capacity of the tumor microenvironment (TME) can be elucidated by activation of the RIG-I signaling pathway, in conjunction with the co-activation of certain tumor suppressor genes(s) simply by using single-stranded RNA.
[0035] The usefulness of RIG-I agonist triphosphate RNA for melanoma treatment has recently been validated (Helms MW. et al. 2019. Utility of the RIG-I Agonist Triphosphate RNA for Melanoma Therapy. Mol Cancer Ther. 2019;18(12):2343-2356). It should also be noted that the similarity between RIG-I's natural ligand triphosphate RNA (5'ppp-dsRNA) (and 5'pp) and small interfering RNA (siRNA) has led to the development of bifunctional siRNAs for simultaneous silencing of oncogenic or immunosuppressive targets and activation of the RIG-I signaling pathway (Poeck H., et al. 2008. Nat. Med. 14:1256, Ellermeier J. et al. 2013. 2013;73(6):1709-1720). The combined approach initiates an attack on two targets of tumor cells, showing promising results.
[0036] MicroRNAs (miRNAs) are small, non-coding RNAs that can regulate a variety of target genes. miRNAs regulate gene expression at the post-transcriptional level through base pairing with the complementary sequence of messenger RNA (mRNA). This interaction leads to gene silencing by cleavage of the mRNA strand, destabilization of the mRNA due to shortening of its poly(A) tail, or inhibition of mRNA translation into protein. miRNAs control the expression of approximately 60% of protein-coding genes and regulate cellular metabolism, proliferation, differentiation, and apoptosis (Huang Z, Shi J, Gao Y, et al. HMDD v3.0: a database for experimentally supported human microRNA-disease associations. Nucleic Acids Res. 2019;47(D1):D1013-D1017).
[0037] Under normal physiological conditions, miRNAs function in feedback mechanisms by protecting important biological processes, including cell proliferation, differentiation, and apoptosis (Reddy, KB, Cancer Cell International, 2015, 15:38). miRNAs are expressed in various organs and cells and regulate both pro-inflammatory and anti-inflammatory effects. miRNAs have been identified as important regulators of inflammatory responses in a wide range of human diseases (Tahamtan, A., et al., Front Immunol. 2018; 9: 1377).
[0038] Dysregulation of miRNA expression is associated with signs of various diseases, including cancer. More than 50% of miRNA genes have been shown to be located in cancer-related genomic regions (Di Leva, G., et al., Annu Rev Pathol. 2014; 9():287-314). MiRNA dysregulation has been shown to play a fundamental role in the onset, progression, and dissemination of several types of cancer. For example, miRNA dysregulation is known to be associated with chronic lymphocytic leukemia, and miR-15a and miR-16-1 have been shown to be downregulated or deleted in the majority of patients with chronic lymphocytic leukemia (Calin GA, et al., Proc Natl Acad Sci USA; 2002; pp. 15524-15529). Other miRNAs, such as miR-21, miR-26, and miR-29a, have been shown to be preferentially expressed in cancer cells and / or the tumor cell microenvironment (Chakraborty, C., et al., Mol Ther Nucleic Acids. 2020 Jun 5; 20: 606-620). Therefore, therapeutic methods targeting endogenous miRNAs offer a very promising approach for targeting the tumor microenvironment and treating various cancers associated with miRNA dysregulation.
[0039] RIG-I-mediated RNA-induced immunogenic cell death The pattern recognition receptor retinoic acid-inducible gene I (RIG-I) recognizes a specific molecular pattern of viral RNA for type I interferon induction. RIG-I consists of two N-terminal caspase recruitment domains (CARDs), a central RNA helicase domain, and a C-terminal RNA-binding domain. The C-terminal domain (CTD) of RIG-I recognizes the 5'-ppp group of non-self RNA, undergoes conformational changes, and induces IFN-β production (Lee, M., et al., Nucleic Acids Research, 2016, Vol. 44, No. 17). Structural and biochemical studies have shown that RIG-I CTD can bind to blunt-ended dsRNA containing 5'-ppp. Studies have shown that 5'-ppp dsRNA binds strongly to RIG-I CTD and stimulates interferon production more efficiently than 5'-OH dsRNA (Pichlmair, A., et al., 2006, Science, 314, 997-1001; Vela, A., et al., 2012, J. Biol. Chem., 287, 42564-42573).
[0040] RIG-I-like receptor ligands have been used as a promising strategy for treating solid malignancies, including melanoma, pancreatic cancer, and breast cancer, in preclinical models. A major characteristic of RIG-I is its ubiquitous expression and signaling, which, among other things, leads to IFN-I production and preferential tumor cell death, two key factors in a robust T-cell response. Despite the potential success of RIG-I approaches, the immune system is powerful and not fully understood, requiring careful optimism and thorough examination of precautions associated with innate immune activation, including the possible induction of autoimmune ontogenic triggers or cytokine "storms" that could pose a threat to patient safety. It is important to note that because RIG-I is expressed in many cells in the human body, the consequences of RIG-I activation are far-reaching and can drive symptoms such as fatigue, depression, and cognitive impairment.
[0041] This disclosure presents a strategy for mitigating potential side effects associated with RIG-I therapy by restricting RIG-I activation to the tumor microenvironment. Specifically, tumor-specific miRNAs are used as templates for the assembly of 5'ppp-dsRNA RIG-I agonists. To achieve this, the method of the present invention introduces an exogenously supplied 5'ppp single-stranded oligonucleotide (e.g., RNA) that is complementary to the miRNA. The complementary miRNA (endogenous) and the single-stranded 5'ppp oligonucleotide (e.g., RNA) (exogenous) hybridize to form a 5'ppp-dsRNA that facilitates release from AGO2. The released 5'ppp-dsRNA facilitates potent activation of RIG-I signaling. This process restricts RIG-I activation to cancer cells, essentially eliminating nonspecific immune system activation elsewhere in the body. Further levels of specificity can be achieved by coupling the exogenous single-stranded 5'ppp oligonucleotide with a nanoparticle carrier that preferentially localizes to the tumor microenvironment. As shown in Figure 1, the substitution of standard RNAi techniques for silencing target miRNA or mRNA with the 5(p)pp-anti-mRNA or -miRNA techniques described herein can improve treatment outcomes by promoting RIG-I activation that induces RIG-I signaling and cell death. In vivo, 5'(p)pp-anti-mRNA / miRNA can hybridize with target mRNA or miRNA, silencing it and leading to the formation of 5'(p)pp-ds-mRNA / -miRNA that binds to and activates the RIG-I protein, resulting in RIG-I signaling and cancer cell death.
[0042] 2.Definition The terms used herein generally have their ordinary meanings in the art, within the context of this disclosure, and in the specific context in which each term is used. Certain terms are considered below or elsewhere in the specification to provide practitioners with further guidance in describing the compositions and methods of this disclosure and the methods of preparing and using them. The scope or meaning of any term is evident from the specific context in which it is used.
[0043] "Approximately" and "about" generally refer to an acceptable degree of error in a measured quantity, taking into account the nature or accuracy of the measurement. Typically, an exemplary degree of error is within 20 percent (%) of a given value or range of values, preferably within 10 percent, and more preferably within 5 percent.
[0044] Alternatively, and especially in biological systems, the terms “about” and “approximately” may mean a value that is within one order of magnitude of a given value, preferably within five times, and more preferably within two times. Unless otherwise stated, the quantities given herein are approximations, and unless explicitly stated otherwise, the terms “about” or “approximately” can be inferred.
[0045] The terms “a” and “an” refer to multiple subjects unless the context in which the terms are used makes otherwise clear. The terms “a” (or “an”), as well as the terms “one or more” and “at least one,” are interchangeable in this specification. Furthermore, where used herein, “and / or” should be taken as each specific disclosure of two or more identified features or components, which may or may not include the other. Thus, the term “and / or” as used herein in phrases such as “A and / or B” is intended to include “A and B,” “A or B,” “A (only),” and “B (only).” Similarly, the term “and / or” as used in phrases such as “A, B, and / or C” is intended to include each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (only); B (only); and C (only).
[0046] Numerical ranges disclosed herein include the numbers that define those ranges.
[0047] The term “nucleic acid” means any single-stranded or double-stranded polynucleotide (e.g., DNA or RNA, cDNA, of semi-synthetic or synthetic origin). The term “nucleic acid” includes oligonucleotides containing at least one modified nucleotide (e.g., modifications at the base and / or modifications at the sugar) and / or modifications at the phosphodiester bond linking two nucleotides. In some embodiments, the nucleic acid may contain at least one modified ribose, such as 2'-fluoro(2'-F). In some embodiments, the nucleic acid may contain 5' uncapped triphosphate or diphosphate. Non-limiting examples of nucleic acids are described herein. Further examples of nucleic acids are known in the art.
[0048] The nucleic acids disclosed herein may include oligonucleotide sequences that do not exist in nature. Such variants will necessarily have less than 100% sequence identity or similarity to the starting molecule. In certain embodiments, the variant has, for example, a nucleic acid sequence with about 75% to less than 100%, more preferably about 80% to less than 100%, more preferably about 85% to less than 100%, more preferably about 90% to less than 100% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), and most preferably about 95% to less than 100% amino acid sequence identity or similarity to the nucleic acid sequence of the starting (e.g., naturally occurring or wild-type) oligonucleotide over the length of the variant molecule. In certain embodiments, the oligonucleotide sequence is fully complementary to the target sequence. In other words, the double-stranded region formed by the oligonucleotide and its target exhibits a fully complementary sequence (i.e., without any base pair mismatches or gaps), disregarding overhangs. In certain embodiments, the oligonucleotide and target sequence do not contain more than 0 to 5 base pair mismatches in the double-stranded region.
[0049] The tumor-specific RNAs of this disclosure may include microRNAs (miRNAs) or messenger RNAs (mRNAs). The miRNAs or mRNAs of this disclosure may include oncogenic miRNAs or mRNAs. Oncogenic miRNAs or mRNAs are miRNAs or mRNAs that are thought to be involved in or associated with tumors / multiple tumors and / or cancers.
[0050] The term "diamagnetic" is used to describe a composition that has a relative permeability of less than or equal to 1 and is repelled by a magnetic field.
[0051] The term "paramagnetic" is used to describe a composition that exhibits a magnetic moment only in the presence of an externally applied magnetic field.
[0052] The term "ferromagnetic" is used to describe a composition that is highly susceptible to magnetic fields and retains its magnetic properties (magnetic moment) even after the externally applied magnetic field has been removed.
[0053] The term "nanoparticle" refers to an object having a diameter of approximately 2 nm to approximately 200 nm (for example, 10 nm to 200 nm, 2 nm to 100 nm, 2 nm to 40 nm, 2 nm to 30 nm, 2 nm to 20 nm, 2 nm to 15 nm, 100 nm to 200 nm, and 150 nm to 200 nm). Non-limiting examples of nanoparticles include those described herein.
[0054] The term “magnetic nanoparticles” means nanoparticles that are magnetic (as defined herein) (e.g., any of the nanoparticles described herein). Non-limiting examples of magnetic nanoparticles are described herein. Further magnetic nanoparticles are known in the art.
[0055] As used herein, the terms “subject” or “patient” mean any mammal (e.g., human or veterinary subject, e.g., dog, cat, horse, cattle, goat, sheep, mouse, rat, or rabbit) to which the compositions or methods of the present disclosure can be administered, for example, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. The subject is seeking, may need, may request, is receiving, will receive, or is under the care of a trained professional for a particular disease or condition.
[0056] As used herein, the term “tumor” refers to an abnormal mass of tissue and / or cells, whether solid (e.g., as in a solid tumor) or fluid (e.g., as in a hematological malignancy) or containing any cancer cells found within the tumor, in which the growth of the mass exceeds and is in harmony with the growth of normal tissue. Tumors may be solid (e.g., lymphoma, sarcoma, or carcinoma) or non-solid (e.g., tumors of the blood, bone marrow, or lymph nodes, e.g., leukemia). Tumors may be defined as “benign” or “malignant” depending on the following characteristics: degree of cellular differentiation, including morphology and function; rate of growth; local invasion and metastasis. A “benign” tumor is well-differentiated, has characteristically slower growth than a malignant tumor, and may remain localized at the site of origin. Furthermore, in some cases, a benign tumor does not have the ability to invade, stab, or metastasize to distant sites. "Malignant" tumors are poorly differentiated (anaplastic) and may exhibit characteristically rapid growth accompanied by progressive invasion, invasiveness, and destruction of surrounding tissue. Furthermore, malignant tumors may have the ability to metastasize to distant sites. Thus, cancer cells are cells found within abnormal masses of tissue where growth is not in harmony with the growth of normal tissue.
[0057] As used herein, the term “microenvironment” means any part or area of tissue or body that has a permanent or temporary physical or chemical difference from other areas of tissue or body.
[0058] As used herein, the term “tumor microenvironment” refers to the environment in which the tumor resides, encompassing non-cellular areas within the tumor and the region immediately outside the neoplastic tissue, but not belonging to the intracellular compartments of the cancer cells themselves. It also refers to cells found within the tumor microenvironment, such as fibroblasts, endothelial cells, adipocytes, pericytes, neuroendocrine cells, or immune cells (macrophages, B cells, T cells, etc.) in the tumor microenvironment. The tumor and the tumor microenvironment are closely related and constantly interact. The tumor alters its microenvironment, and the microenvironment can influence how the tumor grows and spreads. Typically, the tumor microenvironment has a low pH in the range of 5.0–7.0, or 5.0–6.8, or 5.8–6.8, or 6.2–6.8. On the other hand, the normal physiological pH is in the range of 7.2–7.8. The tumor microenvironment is also known to have lower concentrations of glucose and other nutrients, but higher concentrations of lactate, compared to plasma. Furthermore, the tumor microenvironment can have a temperature 0.3–1°C higher than the normal physiological temperature.
[0059] The term "non-tumor microenvironment" refers to the microenvironment in areas other than tumors.
[0060] The term “metastasis” refers to the migration of cancer cells present in a primary tumor to secondary, non-adjacent tissues within a subject. Non-limiting examples of metastasis include metastasis from a primary tumor to lymph nodes (e.g., regional lymph nodes), bone tissue, lung tissue, liver tissue, and / or brain tissue. The term metastasis also includes the migration of metastatic cancer cells found in lymph nodes to secondary tissues (e.g., bone tissue, liver tissue, or brain tissue). In some non-limiting embodiments, the cancer cells present in the primary tumor are breast cancer cells, colon cancer cells, kidney cancer cells, lung cancer cells, skin cancer cells, ovarian cancer cells, pancreatic cancer cells, prostate cancer cells, rectal cancer cells, gastric cancer cells, thyroid cancer cells, or uterine cancer cells. Further embodiments and examples of metastasis are known in the art or are described herein.
[0061] The term "primary tumor" refers to a tumor located in an anatomical site where tumor progression began, progressed, and resulted in a cancerous mass. In some embodiments, physicians may not be able to clearly identify the location of the primary tumor in a subject.
[0062] The term "metastatic tumor" refers to a tumor in a subject that originates from tumor cells that have metastasized from a primary tumor in that subject. In some embodiments, the physician may not be able to clearly identify the location of the primary tumor in the subject.
[0063] Preferred methods and materials are described herein, but similar or equivalent methods and materials may also be used in the implementation or testing of the methods and compositions of this disclosure. All publications, patent applications, patents and other references referenced herein are incorporated by reference in their entirety.
[0064] 3. Endogenous tumor-specific RNA Compositions and methods for inducing an immune response by endogenous tumor-specific RNA are described herein. In some embodiments, the disclosure provides a method for treating cancer comprising administering a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to endogenous tumor-specific RNA highly expressed in tumor cells compared to non-tumor cells. In some embodiments, the disclosure provides a method for selectively activating RIG-I in tumor cells comprising administering a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to endogenous tumor-specific RNA, wherein the tumor-specific RNA is specific to tumor cells, and RIG-I is selectively activated in tumor cells that highly express the tumor-specific RNA. The endogenous tumor-specific RNA of the disclosure can be selected from miRNA or mRNA. The endogenous tumor-specific RNA of the disclosure can be further selected from oncogenic miRNA or oncogenic mRNA. Oncogenic miRNAs or mRNAs are miRNAs or mRNAs that are thought to be involved in cancer.
[0065] miRNAs have been shown to be components in many cancers, and they can offer new means for cancer treatment. The miRNAs of the methods and compositions of this disclosure include, but are not limited to, miR-9;miR-10b;miR-17;miR-18;miR-19b;miR-21;miR-26a;miR-29a;miR-92a;miR-106b / 93;miR-125b;miR-130a;miR-155;miR-181a;miR-200s;miR-210;miR-210-3p;miR-221;miR-222;miR-221 / 222;miR-335;miR-498;miR-504;miR-1810;miR-1908;miR-224 / 452; and miR-181 / 340. A complete list including sequences is available in OncomiRDB (Wang et al. Bioinformatics. 2014;30(15):2237-2238;mircancer.ecu.edu / browse.jsp;US20150004221A1); see also Tables 1 and 2).
[0066] One example of such a miRNA is miR-10b. Upregulation of miR-10b has been shown to be responsible for the migration and invasion of metastatic tumor cells as well as the viability of these cells (Tian Y., et al., J. Biol. Chem. 2010; 285:7986-7994). Analysis of miR-10b levels in 40 human esophageal cancer samples and their paired normal adjacent tissues showed elevated miR-10b expression in 95% (38 out of 40) of the sampled cancer tissues (Tian Y., et al., J. Biol. Chem. 2010; 285:7986-7994). Many other miRNAs also play a role in oncology, which is a related target; these, and other miRNAs, represent a potential new class of targets for therapeutic inhibition (Nguyen DD, Chang S. Int J Mol Sci. 2017;19(1):65). For example, miR-21 has been shown to be involved in a wide range of cancer cells and tissues, not limited to glioblastoma, breast cancer, colorectal cancer, lung cancer, pancreatic cancer, skin cancer, liver cancer, gastric cancer, cervical cancer, and thyroid cancer, as well as various lymphomas, hematopoietic cancers, and neuroblastoma. miR-21 is a prime example of a single miRNA that targets multiple oncogenic signaling cascades and causes overall dysregulation of the gene expression network in cancer cells (Pan, X., et al., Cancer Biol. Ther. 2010; 10:1224-1232).Increased miR-21 expression has been shown to target various essential tumor suppressor factors, including phosphatases and tensin homologs (PTEN), PDCD4, RECK, and TPM1, facilitating cell proliferation, survival, metastasis, and the acquisition of chemoresistance phenotypes (Meng, F., et al., Gastroenterology. 2007; 133:647-658; Peralta-Zaragoza O., et al., BMC Cancer. 2016; 16:215; Zhang, X., et al., BMC Cancer. 2016;16:86; Reis ST., et al., BMC Urol. 2012;12:14; Zhu S., et al., J. Biol. Chem. 2007;282:14328-14336).
[0067] miR-155 is epigenetically regulated by BRCA1 and is overexpressed in breast, ovarian, and lung cancers. miR-155 has been investigated as a potential biomarker for B-cell cancers. Overexpression of miR-155 blocks B-cell differentiation by downregulating the SHIP1 and C / EBPβ genes, resulting in improved cell survival due to activation of the PI3K-Akt and MAPK pathways. In other cancers, such as gliomas, overexpression of miR-155 promotes tumorigenesis through a negative correlation with caudal homeobox 1 protein (CDX1) expression in glioma tissue.
[0068] miR-210 is a well-supported miRNA involved in various aspects of cancer development, progression, and metastasis. Increased miR-210 expression has been observed in bone-metastatic and non-bone-metastatic prostate cancer tissues. Expression was found to be elevated in bone-metastatic prostate cancer tissue compared to non-bone-metastatic prostate cancer tissue, and it was shown to promote epithelial-mesenchymal transition and bone metastasis of prostate cancer cells via the NF-κB signaling pathway (Ren D., et al., Mol Cancer. 2017; 16: 117). Other miRNAs, such as miRNA-221, have been found to be upregulated in breast cancer, glioma, hepatocellular carcinoma, pancreatic adenocarcinoma, melanoma, chronic lymphocytic leukemia, and papillary thyroid carcinoma (Brognara E., et al., Int J Oncol. 2012 Dec;41(6):2119-27).
[0069] In some embodiments, the disclosure provides a method for treating cancer, comprising administering a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to endogenous tumor-specific RNA highly expressed in tumor cells compared to non-tumor cells. In some embodiments, the disclosure provides a method for selectively activating RIG-I in tumor cells, comprising administering a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to endogenous tumor-specific RNA, the tumor-specific RNA is specific to tumor cells, and RIG-I is selectively activated in tumor cells that highly express the tumor-specific RNA. In some embodiments, the endogenous tumor-specific RNA is an oncogenic miRNA. In some embodiments, the endogenous tumor-specific RNA is not an oncogenic miRNA.
[0070] In some embodiments, the endogenous tumor-specific RNA is a miRNA selected from the group consisting of miR-9;miR-10b;miR-17;miR-18;miR-19b;miR-21;miR-26a;miR-29a;miR-92a;miR-106b / 93;miR-125b;miR-130a;miR-155;miR-181a;miR-200s;miR-210;miR-210-3p;miR-221;miR-222;miR-221 / 222;miR-335;miR-498;miR-504;miR-1810;miR-1908;miR-224 / 452; and miR-181 / 340. In some embodiments, the endogenous tumor-specific RNA is miR-9. In some embodiments, the endogenous tumor-specific RNA is miR-10b. In some embodiments, the endogenous tumor-specific RNA is miR-17. In some embodiments, the endogenous tumor-specific RNA is miR-18. In some embodiments, the endogenous tumor-specific RNA is miR-19b. In some embodiments, the endogenous tumor-specific RNA is miR-21. In some embodiments, the endogenous tumor-specific RNA is miR-26a. In some embodiments, the endogenous tumor-specific RNA is miR-29a. In some embodiments, the endogenous tumor-specific RNA is miR-92a. In some embodiments, the endogenous tumor-specific RNA is miR-106b / 93. In some embodiments, the endogenous tumor-specific RNA is miR-125b. In some embodiments, the endogenous tumor-specific RNA is miR-130a. In some embodiments, the endogenous tumor-specific RNA is miR-155. In some embodiments, the endogenous tumor-specific RNA is miR-181a. In some embodiments, the endogenous tumor-specific RNA is miR-200s. In some embodiments, the endogenous tumor-specific RNA is miR-210. In some embodiments, the endogenous tumor-specific RNA is miR-210-3p. In some embodiments, the endogenous tumor-specific RNA is miR-221. In some embodiments, the endogenous tumor-specific RNA is miR-222. In some embodiments, the endogenous tumor-specific RNA is miR-221 / 222.In some embodiments, the endogenous tumor-specific RNA is miR-335. In some embodiments, the endogenous tumor-specific RNA is miR-498. In some embodiments, the endogenous tumor-specific RNA is miR-504. In some embodiments, the endogenous tumor-specific RNA is miR-1810. In some embodiments, the endogenous tumor-specific RNA is miR-1908. In some embodiments, the endogenous tumor-specific RNA is miR-224 / 452. In some embodiments, the endogenous tumor-specific RNA is miR-181 / 340.
[0071] In preferred embodiments of this disclosure, the endogenous tumor-specific RNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the endogenous tumor-specific RNA is miR10b. In some embodiments, the endogenous tumor-specific RNA is miR17. In some embodiments, the endogenous tumor-specific RNA is miR18a. In some embodiments, the endogenous tumor-specific RNA is miR18b. In some embodiments, the endogenous tumor-specific RNA is miR19b. In some embodiments, the endogenous tumor-specific RNA is miR21. In some embodiments, the endogenous tumor-specific RNA is miR26a. In some embodiments, the endogenous tumor-specific RNA is miR29a. In some embodiments, the endogenous tumor-specific RNA is miR92a-1. In some embodiments, the endogenous tumor-specific RNA is miR92a-2. In some embodiments, the endogenous tumor-specific RNA is miR155. In some embodiments, the endogenous tumor-specific RNA is miR210. In some embodiments, the endogenous tumor-specific RNA is miR22.
[0072] In some embodiments, the endogenous tumor-specific RNA highly expressed in tumor cells is selected from the group consisting of miR-9;miR-10b;miR-17;miR-18;miR-19b;miR-21;miR-26a;miR-29a;miR-92a;miR-106b / 93;miR-125b;miR-130a;miR-155;miR-181a;miR-200s;miR-210;miR-210-3p;miR-221;miR-222;miR-221 / 222;miR-335;miR-498;miR-504;miR-1810;miR-1908;miR-224 / 452; and miR-181 / 340. In some embodiments, tumor cells are associated with bone and non-bone metastatic cancers, breast cancer, glioma, hepatocellular carcinoma, pancreatic adenocarcinoma, melanoma, chronic lymphocytic leukemia, papillary thyroid carcinoma, glioblastoma, colorectal cancer, lung cancer, kidney cancer, pancreatic cancer, skin cancer, liver cancer, stomach cancer, cervical cancer, thyroid cancer, lymphoma, hematopoietic cancer, neuroblastoma, acute myeloid leukemia, esophageal cancer, osteosarcoma, B-cell lymphoma, lymphocytic leukemia, ovarian cancer, oral cancer, bladder cancer, adenoid cystic carcinoma, undifferentiated thyroid cancer, astrocytoma, meningioma, and retinoblastoma.
[0073] In some embodiments, tumor cells are associated with bone metastasis cancer. In some embodiments, tumor cells are associated with non-bone metastasis cancer. In some embodiments, tumor cells are associated with breast cancer. In some embodiments, tumor cells are associated with glioma. In some embodiments, tumor cells are associated with hepatocellular carcinoma. In some embodiments, tumor cells are associated with pancreatic adenocarcinoma. In some embodiments, tumor cells are associated with melanoma. In some embodiments, tumor cells are associated with chronic lymphocytic leukemia. In some embodiments, tumor cells are associated with papillary thyroid carcinoma. In some embodiments, tumor cells are associated with glioblastoma. In some embodiments, tumor cells are associated with colorectal cancer. In some embodiments, tumor cells are associated with lung cancer. In some embodiments, tumor cells are associated with kidney cancer. In some embodiments, tumor cells are associated with pancreatic cancer. In some embodiments, tumor cells are associated with skin cancer. In some embodiments, tumor cells are associated with liver cancer. In some embodiments, tumor cells are associated with stomach cancer. In some embodiments, tumor cells are associated with cervical cancer. In some embodiments, tumor cells are associated with thyroid cancer. In some embodiments, tumor cells are associated with lymphoma. In some embodiments, tumor cells are associated with hematopoietic cancer. In some embodiments, tumor cells are associated with neuroblastoma. In some embodiments, tumor cells are associated with acute myeloid leukemia. In some embodiments, tumor cells are associated with esophageal cancer. In some embodiments, tumor cells are associated with osteosarcoma. In some embodiments, tumor cells are associated with B-cell lymphoma. In some embodiments, tumor cells are associated with lymphocytic leukemia. In some embodiments, tumor cells are associated with ovarian cancer. In some embodiments, tumor cells are associated with oral cancer. In some embodiments, tumor cells are associated with bladder cancer. In some embodiments, tumor cells are associated with adenoid cystic carcinoma. In some embodiments, tumor cells are associated with undifferentiated thyroid cancer. In some embodiments, tumor cells are associated with astrocytoma. In some embodiments, tumor cells are associated with meningioma. In some embodiments, tumor cells are associated with retinoblastoma.
[0074] Numerous web-based tools are available for identifying microRNAs involved in human cancer. For a review, see Mar-Aguilar F, Rodriguez-Padilla C, Resendez-Perez D. Web-based tools for microRNAs involved in human cancer, Oncol Lett. 2016;11(6):3563-3570. Databases can be mined for miRNAs associated with specific types of cancer, or simultaneously for the behavior of specific miRNAs in different malignancies, and sequences of specific miRNAs can be easily retrieved from various databases. For example, miRCancer (mircancer.ecu.edu) is a database that stores records of the association between miRNAs and cancers collected through data mining. We analyzed the titles and abstracts of 26,414 publications (2016) and devised a rule-based method for finding complete sentences or phrases containing names of miRNAs and cancer types, and any expressive terms. The results of this data mining process were then manually corroborated. miRCancer holds over 3,764 miRNA-cancer-related records from 2,611 publications, representing 236 miRNA expression profiles derived from 176 human cancers. miRCancer is freely accessible online, and the database can be searched by miRNA name, cancer type, or a combination of both (Xie B, Ding Q, Han H, Wu D. miRCancer: a microRNA-cancer association database constructed by text mining on literature. Bioinformatics. 2013;29(5):638-644).
[0075] For example, database mining (December 16, 2020) revealed that miR-10b upmodulates 20 types of cancer, including acute myeloid leukemia, bladder cancer, colorectal cancer, endometrial cancer, esophageal cancer, esophageal squamous cell carcinoma, gastric cancer, glioblastoma, glioma, hepatocellular carcinoma, lung cancer, malignant melanoma, medulloblastoma, nasopharyngeal cancer, non-small cell lung cancer, oral cancer, osteosarcoma, pancreatic cancer, and pancreatic ductal adenocarcinoma. Similarly, hsa-miR-101, hsa-miR-106a, hsa-miR-106b, hsa-miR-10b, hsa-miR-1207-5p, hsa-miR-1228, hsa-miR-1229, hsa-m iR-1246, hsa-miR-125a, hsa-miR-125b, hsa-miR-1307-3p, hsa-miR-135a, hsa-miR-140, hsa-miR-141, hsa-miR-150, hs a-miR-150-5p, hsa-miR-153, hsa-miR-155, hsa-miR-17, hsa-miR-17-5p, hsa-miR-181a, hsa-miR-181b, hsa-miR-181b- 3p, hsa-miR-182, hsa-miR-182-5p, hsa-miR-183, hsa-miR-183-5p, hsa-miR-18a, hsa-miR-18b, hsa-miR-191, hsa-miR- 1915-3p, hsa-miR-196a, hsa-miR-197, hsa-miR-19a, hsa-miR-19b, hsa-miR-200a, hsa-miR-200a-3p, hsa-miR-200b, hs a-miR-200c, hsa-miR-203, hsa-miR-205, hsa-miR-205-5p, hsa-miR-206, hsa-miR-20a, hsa-miR-20b, hsa-miR-21, hsa- miR-214-3p, hsa-miR-217, hsa-miR-221, hsa-miR-222, hsa-miR-223, hsa-miR-224, hsa-miR-224-5p, hsa-miR-23a, hsa -miR-23b, hsa-miR-24, hsa-miR-24-2-5p, hsa-miR-24-3p, hsa-miR-27a, hsa-miR-27b, hsa-miR-29a, hsa-miR-301a-3p,hsa-miR-3136-3p, hsa-miR-3188, hsa-miR-32, hsa-miR-330-3p, hsa-miR-346, hsa-miR-3646, hs a-miR-370, hsa-miR-372, hsa-miR-372-3p, hsa-miR-373, hsa-miR-374a, hsa-miR-376b, hsa-miR- 378, hsa-miR-423, hsa-miR-429, hsa-miR-4469, hsa-miR-449a, hsa-miR-4513, hsa-miR-4530, hsa -miR-4732-5p, hsa-miR-494, hsa-miR-495, hsa-miR-498, hsa-miR-5003-3p, hsa-miR-503, hsa-mi R-503-3p, hsa-miR-510, hsa-miR-520c, hsa-miR-520e, hsa-miR-520g, hsa-miR-526b, hsa-miR-54 4a, hsa-miR-645, hsa-miR-655, hsa-miR-660-5p, hsa-miR-665, hsa-miR-675, hsa-miR-761, hsa-m More than 100 miRNAs, including miR-10b, have been found to be associated with breast cancer, including iR-762, hsa-miR-9, hsa-miR-92a, hsa-miR-92a-3p, hsa-miR-93, hsa-miR-93-5p, hsa-miR-937, hsa-miR-944, hsa-miR-96, and hsa-miR-96-5p.
[0076] The miR-10b sequence or any desired sequence can be retrieved from miRbase, a microRNA database (mirbase.org / ): >hsa-miR-10b-5p MIMAT0000254 UACCCUGUAGAACCGAAUUUGUG >hsa-miR-10b-3p MIMAT0004556 ACAGAUUCGAUUCUAGGGGAAU.
[0077] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]
[0078] [Table 2]
[0079] The methods and compositions of this disclosure can be extended to other RNA targets, such as mRNA encoding proteins that promote cancer development. In some embodiments, this disclosure provides a method for treating cancer, comprising administering a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to endogenous tumor-specific RNA that is highly expressed in tumor cells compared to non-tumor cells. In some embodiments, this disclosure provides a method for selectively activating RIG-I in tumor cells, comprising administering a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to endogenous tumor-specific RNA, wherein the tumor-specific RNA is specific to tumor cells, and RIG-I is selectively activated in tumor cells that highly express the tumor-specific RNA. In some embodiments, the endogenous tumor-specific RNA is mRNA. In some embodiments, the endogenous tumor-specific RNA is mRNA. In some embodiments, the endogenous tumor-specific RNA is not mRNA.
[0080] Several mRNAs are thought to be involved in cancer. All or part of the antisense strand of mRNA containing a poly(A) tail can be generated from a DNA template by in vitro transcription and modified with 5'(p)pp. The 5'(p)pp-anti-mRNA sequence can be optimized to contain sequence elements that increase RNA stability. Anti-mRNA can be formulated with lipids to obtain RNA-lipid nanoparticle formulations. In vivo, 5'(p)pp-anti-mRNA can hybridize with target mRNA, silencing it and leading to the formation of 5'(p)pp-ds-mRNA that binds to and activates the RIG-I protein, resulting in RIG-I signaling and cancer cell death. See Table 3 for a list of exemplary mRNA transcripts.
[0081] [Table 3-1] [Table 3-2]
[0082] For example, the well-known cancer therapeutic target, Survivin (also known as BIRC5), can be targeted using this method. Survivin, a multi-regulator of the cell cycle and apoptosis, is overexpressed in all human cancers but is low in normal tissues. Increased expression has been detected in 90% of primary breast cancers and correlates with poor clinical outcomes. Furthermore, increased Survivin levels have been shown to be significantly associated with negative hormone receptor status. Importantly, high levels of Survivin have been detected in other cancers, such as pancreatic cancer, where they correlate with both cell proliferation and apoptosis, suggesting a potentially ubiquitous role for this anti-apoptotic marker. Given the potential value of reducing or neutralizing Survivin expression as a means of overcoming chemoresistance, the RNA interference (RNAi) process can prove valuable. In fact, RNAi-mediated downregulation of BIRC5 has shown promise in vitro in acute lymphoblastic leukemia, lung cancer, and cervical cancer, as well as in vivo in breast cancer (Ghosh SK, Yigit MV, Uchida M, et al. Sequence-dependent combination therapy with doxorubicin and a survivin-specific small interfering RNA nanodrug demonstrates efficacy in models of adenocarcinoma. Int J Cancer. 2014;134(7):1758-1766). Sequence-dependent combination therapy with doxorubicin and a survivin-specific small interfering RNA nanodrug demonstrate efficacy in models of adenocarcinoma.
[0083] The use of current 5(p)pp-anti-mRNA techniques as an alternative to standard siRNA techniques for silencing survivors can improve treatment outcomes by promoting RIG-I signaling and RIG-I activation that induces cell death.
[0084] 4. Oligonucleotides and oligonucleotide modifications In certain embodiments, the Disclosure provides methods and compositions comprising a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to endogenous tumor-specific RNA that is highly expressed in tumor cells compared to non-tumor cells. In certain embodiments, the Disclosure provides methods and compositions comprising a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence that is complementary to endogenous tumor-specific RNA.
[0085] Exogenous RNAs containing 5' triphosphate (ppp) have been shown to induce immunogenic cell death in different tumor entities (Elion, DL., et al Cancer Res. 2018 Nov 1; 78(21):6183-6195; Besch, R., et al, J Clin Investig. 2009;119:2399-411; Duewell, P., et al., Cell Death Differ. 2014;21:1825-37; Kuber, K., et al., Cancer Res. 2010;70:5293-304). 5' diphosphate (5'pp) or 5' triphosphate (5'ppp) modifications may be referred to herein as 5'pp and 5'ppp anti-miRNA / mRNA, respectively. 5'-ppp-RNA has been shown to induce cytokine release and promote adaptive cellular immune responses against tumor cells, along with direct sensing of viral RNA by immune cells (Poeck, H., et al., Nat Med. 2008 Nov; 14(11):1256-63). The pattern recognition receptor RIG-I can bind to blunt-terminated dsRNA containing uncapped 5'ppp or 5'pp. As disclosed herein, uncapped refers to RNA lacking a 5' cap structure consisting of 7-methylguanosine triphosphate linked to the 5' end of mRNA by a 5'→5' triphosphate bond. This disclosure provides a method for selectively activating RIG-I in tumor cells, comprising administering a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to endogenous tumor-specific RNA. This disclosure also provides single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotides that are complementary to miRNAs highly expressed in tumor tissue compared to non-tumor tissue. The 5' triphosphate structure is shown below: [ka]
[0086] In preferred embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes an uncapped 5' triphosphate.
[0087] In some embodiments of the methods and compositions disclosed herein, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to the miRNA. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to the endogenous miRNA. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a sequence complementary to an oncogenic miRNA selected from the group consisting of miR-9;miR-10b;miR-17;miR-18;miR-19b;miR-21;miR-26a;miR-29a;miR-92a;miR-106b / 93;miR-125b;miR-130a;miR-155;miR-181a;miR-200s;miR-210;miR-210-3p;miR-221;miR-222;miR-221 / 222;miR-335;miR-498;miR-504;miR-1810;miR-1908;miR-224 / 452; and miR-181 / 340. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-10b. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-17. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-18. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-19b. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-21. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-26a.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-29a. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-92a. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-106b / 93. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-125b. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-130a. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-155. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-181a. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-200s. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-210. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-210-3p. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-221. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-222. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-221 / 222. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a sequence complementary to miR-335.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-498. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-504. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-1810. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-1908. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-224 / 452. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR-181 / 340.
[0088] In preferred embodiments of this disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes sequences complementary to miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR10b. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR17. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR18a. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR18b. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR19b. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR21. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR26a. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR29a. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR92a-1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR92a-2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR155. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a sequence complementary to miR210.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a sequence complementary to miR22.
[0089] In some embodiments of the methods and compositions disclosed herein, a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide forms a double helix with a miRNA. In preferred embodiments, the double helix includes a 5' blunt end. In some embodiments, a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide forms a double helix with a miRNA selected from the group consisting of miR-9;miR-10b;miR-17;miR-18;miR-19b;miR-21;miR-26a;miR-29a;miR-92a;miR-106b / 93;miR-125b;miR-130a;miR-155;miR-181a;miR-200s;miR-210;miR-210-3p;miR-221;miR-222;miR-221 / 222;miR-335;miR-498;miR-504;miR-1810;miR-1908;miR-224 / 452; and miR-181 / 340. In preferred embodiments, a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide forms a double helix with a miRNA selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide can form a double helix with the miRNA, and the double-stranded portion of the oligonucleotide is complementary to at least 10 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 11 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 12 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 13 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 14 consecutive nucleotides in the miRNA.In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 15 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 16 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 17 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 18 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 19 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 20 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 21 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 22 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 23 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 24 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 25 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 26 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 27 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 28 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 29 consecutive nucleotides in the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 30 consecutive nucleotides in the miRNA.In some embodiments, the double-stranded portion of the oligonucleotide is at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or at least 100% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 50% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 60% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 70% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 75% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 80% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 85% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 90% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 95% complementary to the miRNA. In preferred embodiments, the double-stranded portion of the oligonucleotide is at least 100% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide contains 0 to 5 mismatched base pairs. In some embodiments, the double-stranded portion of the oligonucleotide contains fewer than 5 mismatched base pairs. In some embodiments, the double-stranded portion of the oligonucleotide contains fewer than 4 mismatched base pairs. In some embodiments, the double-stranded portion of the oligonucleotide contains fewer than 3 mismatched base pairs. In some embodiments, the double-stranded portion of the oligonucleotide contains fewer than 2 mismatched base pairs. In some embodiments, the double-stranded portion of the oligonucleotide contains fewer than 1 mismatched base pair. In preferred embodiments, the double-stranded portion of the oligonucleotide does not contain any mismatched base pairs.
[0090] In some embodiments of the methods and compositions disclosed herein, single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotides can form a double helix with miRNA and compete with endogenous mRNA to bind to the miRNA. In some embodiments, the double helix is not cleaved by AGO2. In some embodiments, the double helix activates RIG-I. In some embodiments, RIG-I activation is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, or 200% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 20% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 25% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 30% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 35% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 40% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 45% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 45% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 50% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 55% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 60% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide.In some embodiments, RIG-I activation is at least 65% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 70% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 75% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 80% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 85% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 90% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 95% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 100% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 110% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 120% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 130% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 140% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 150% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation is at least 200% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In preferred embodiments, RIG-I activation elicits a tumor-specific immune response.
[0091] Oligonucleotides of the methods and compositions provided herein may include modifications. As disclosed herein, modifications may include chemical modifications, additions, deletions, substitutions, or manipulations of the nucleic acid phosphate backbone, nucleic acid sugars, nucleic acid bases, and / or the 5' or 3' end of the oligonucleotide. Oligonucleotides, particularly those in or implemented as therapeutic agents, are generally modified on the phosphate backbone and / or ribose sugars to increase nuclease resistance and enhance affinity to target RNA. Phosphothioate (PS) backbone modifications replace non-crosslinked oxygen atoms with sulfur atoms, extending the half-life of oligonucleotides in plasma from minutes to days. Enhanced protein binding has also been reported for oligonucleotides with PS modifications compared to those with phosphodiester (PO) bonds. Further improvements in the nuclease stability and binding affinity of oligonucleotides to target RNA can be achieved by 2'-ribose modifications such as 2'-O-methyl, 2'-fluoro(2'-F), 2'-O-methoxyethyl(2'-MOE), 2',4'-restricted 2'-O-ethyl(cEt), and locked nucleic acid (LNA). The position of the 2' modification within the oligonucleotide sequence may further influence protein-oligonucleotide interactions. In certain embodiments, the disclosure provides methods and compositions comprising single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotides, wherein the oligonucleotide is complementary to endogenous tumor-specific RNA that is highly expressed in tumor cells compared to non-tumor cells. In certain embodiments, the disclosure provides methods and compositions comprising single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotides, wherein the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotides comprises sequences that are complementary to endogenous tumor-specific RNA. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes other modifications. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide does not include any other modifications.
[0092] In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide further comprises a 2'-fluoro(2'-F) ribose modification. In some embodiments, the 2'-F ribose modification is present when the corresponding base is cytosine or uracil. In some embodiments, the 2'-F ribose modification is present at the 10th or 11th nucleotide from the 5' end of the modified RNA oligonucleotide. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide further comprises a phosphorothioate (PS) backbone modification. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide further comprises a 2'-fluoro(2'-F) ribose modification and a phosphorothioate (PS) backbone modification.
[0093] In preferred embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide is free from any other modifications. In preferred embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide is free from any other modifications selected from the group consisting of 2'-O-methyl(2'-OMe) ribose modification, N-6-methyladenosine (m6A), pseudouridine (Ψ), N-1-methylpseudridine (mΨ), N-1-methylpseudridine (mΨ), 5-methylcytidine (5mC), 5-hydroxymethylcytidine (5hmC), or 5-methoxycytidine (5moC). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide is free from 2'-O-methyl(2'-OMe) ribose modification. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide does not contain N-6-methyladenosine (m6A). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide does not contain pseudouridine (Ψ). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide does not contain N-1-methylpseudridine (mΨ). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide does not contain 5-methylcytidine (5mC). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide does not contain 5-hydroxymethylcytidine (5hmC). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide does not contain 5-methoxycytidine (5moC).
[0094] In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes one or more modifications. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes one or more modifications selected from the group consisting of phosphorothioate (PS) backbone modification, 2'-O-methyl (2'-OMe) ribose modification, N-6-methyladenosine (m6A), pseudouridine (Ψ), N-1-methylpseudridine (mΨ), N-1-methylpseudridine (mΨ), 5-methylcytidine (5mC), 5-hydroxymethylcytidine (5hmC), or 5-methoxycytidine (5moC). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes 2'-O-methyl (2'-OMe) ribose modification. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains N-6-methyladenosine (m6A). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains pseudouridine (Ψ). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains N-1-methylpseudridine (mΨ). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains 5-methylcytidine (5mC). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains 5-hydroxymethylcytidine (5hmC). In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains 5-methoxycytidine (5moC).
[0095] In some embodiments of the methods and compositions disclosed herein, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence that is at least 10 nucleotides long. In some embodiments, the oligonucleotide comprises a sequence that is at least 15 nucleotides long. In some embodiments, the oligonucleotide comprises a sequence that is at least 16 nucleotides long. In some embodiments, the oligonucleotide comprises a sequence that is at least 17 nucleotides long. In some embodiments, the oligonucleotide comprises a sequence that is at least 18 nucleotides long. In some embodiments, the oligonucleotide comprises a sequence that is at least 19 nucleotides long. In some embodiments, the oligonucleotide comprises a sequence that is at least 20 nucleotides long. In some embodiments, the oligonucleotide comprises a sequence that is at least 21 nucleotides long. In some embodiments, the oligonucleotide comprises a sequence that is at least 22 nucleotides long. In some embodiments, the oligonucleotide comprises a sequence that is at least 23 nucleotides long. In some embodiments, the oligonucleotide comprises a sequence that is at least 24 nucleotides long. In some embodiments, the oligonucleotide comprises a sequence that is at least 25 nucleotides long. In some embodiments, the oligonucleotide comprises a sequence that is at least 26 nucleotides long. In some embodiments, the oligonucleotide comprises a sequence that is at least 27 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is at least 28 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is at least 29 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is at least 30 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is at least 50 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is 15 to 50 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is 15 to 30 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is 15 to 29 nucleotides long.In some embodiments, the oligonucleotide includes a sequence that is 15 to 28 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is 15 to 27 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is 15 to 26 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is 15 to 25 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is 16 to 50 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is 16 to 30 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is 16 to 29 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is 16 to 28 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is 16 to 27 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is 16 to 26 nucleotides long. In some embodiments, the oligonucleotide includes a sequence that is 16 to 25 nucleotides long.
[0096] 5'pp and 5'ppp anti-miRNA / mRNAs contain a sequence complementary to at least 10 consecutive nucleotides (e.g., at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23) within the miRNA or mRNA. Examples of miRNAs include, for example, miR-9;miR-10b;miR-21;miR-106b / 93;miR-125b;miR-130a;miR-155;miR-181a;miR-200s;miR-210-3p;miR-221 / 222;miR-335;miR-498;miR-504;miR-1810;miR-1908;miR-224 / 452; or miR-181 / 340 (see, for example, Table 1 in Nguyen and Chang, Int J Mol Sci. 2017;19(1):65) and those listed in Tables 1 and 2 of this specification. Examples of mRNAs include those listed in Table 2 of this specification.
[0097] In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to a nucleic acid sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to a nucleic acid sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to a nucleic acid sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to a nucleic acid sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 90% identical to a nucleic acid sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 97% identical to a nucleic acid sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to a nucleic acid sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to a nucleic acid sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to a nucleic acid sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13.
[0098] In some embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 1.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide consists of a nucleic acid sequence identical to the nucleic acid sequence selected from SEQ ID NO: 1.
[0099] In some embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% i% identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 2.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide consists of a nucleic acid sequence identical to the nucleic acid sequence selected from SEQ ID NO: 2.
[0100] In some embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 3.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide consists of a nucleic acid sequence identical to the nucleic acid sequence selected from SEQ ID NO: 3.
[0101] In some embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 4.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 4.
[0102] In some embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 5.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide consists of a nucleic acid sequence identical to the nucleic acid sequence selected from SEQ ID NO: 5.
[0103] In some embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 6.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 6.
[0104] In some embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 7.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide consists of a nucleic acid sequence identical to the nucleic acid sequence selected from SEQ ID NO: 7.
[0105] In some embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 8.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 8.
[0106] In some embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 9.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide consists of a nucleic acid sequence identical to the nucleic acid sequence selected from SEQ ID NO: 9.
[0107] In some embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 10.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 10.
[0108] In some embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 11.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide consists of a nucleic acid sequence identical to the nucleic acid sequence selected from SEQ ID NO: 11.
[0109] In some embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 12.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide consists of a nucleic acid sequence identical to a nucleic acid sequence selected from SEQ ID NO: 12.
[0110] In some embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide. In certain embodiments, the methods and compositions of the Disclosure include a single-stranded 5' uncapped diphosphate-modified RNA oligonucleotide. In preferred embodiments of the Disclosure, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 75% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide includes a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a nucleic acid sequence that is 100% identical to the nucleic acid sequence of SEQ ID NO: 13.In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide consists of a nucleic acid sequence identical to the nucleic acid sequence selected from SEQ ID NO: 13.
[0111] Antisense oligonucleotides (ASOs) Antisense oligonucleotides (ASOs) are small, single-stranded nucleic acids (typically at least 8 or 10 nt and up to about 30 nt for miRNAs, or much longer for full-length mRNA antisense RNAs) that bind to their target RNA sequences within cells, mediating gene silencing. ASO-based strategies target disease sources at the RNA level rather than targeting downstream processes involved in protein production. Proteins are produced by decoding information conserved in messenger RNA (mRNA). Abnormal protein production, associated with several destructive diseases and disorders, can be regulated by targeting mRNA through the action of non-coding RNAs (ncRNAs). Among ncRNAs, microRNAs (miRNAs), transfer RNA-derived small RNAs, pseudogenes, PIWI-interacting RNAs, long ncRNAs (lncRNAs), and circular RNAs have been identified as regulators of biological function through the modulation of gene expression. Therefore, antisense strategies involving the targeting of ncRNAs, including premRNA, mRNA, or miRNAs, can alter the production of disease-causing proteins for therapeutic intervention.
[0112] Unlike protein targeting based on small molecules, antisense drugs exert their effects through Watson-Crick base pairing rules with target RNA sequences. This principle of Watson-Crick molecular recognition brings greater freedom to RNA-based drug design in the antisense field and accelerates its development. However, during ASO design, necessary modifications to optimize binding affinity can improve nuclease resistance and consider in vivo delivery. Several generations of designs have existed with attempts to develop AMOs with high binding affinity, high specificity, and extended functionality (Ochoa S, Milam VT. Modified Nucleic Acids: Expanding the Capabilities of Functional Oligonucleotides. Molecules. 2020;25(20):4659).
[0113] RNA nucleotides can be chemically modified with the backbone, nucleic acid bases, ribose sugars, and 2'-ribose substitutions. See Figure 3 in Roberts, TC, Langer, R. & Wood, MJA Advances in oligonucleotide drug delivery. Nat Rev Drug Discov 19, 673-694 (2020).
[0114] In some ASOs (often referred to as first-generation), the phosphate backbone linking the nucleotides is modified. One of the non-crosslinking oxygen atoms in the phosphodiester bond is replaced by a sulfur, methyl, or amine group, producing phosphorothioates (PS), methyl phosphonates, and phosphoramidates, respectively. These modifications are not equivalent and each has its own specific characteristics. PS oligonucleotides are highly representative of this first generation and are the most widely used. These chemical modifications improve stability by increasing the ASO's resistance to nucleases, and a certain goal is to extend the half-life of the ASO. PS modifications change the half-life from minutes to days. Importantly, these modifications activate RNAseH, a ubiquitously expressed enzyme that cleaves RNA strands in DNA-RNA double helixes. Thus, RNAseH can degrade target mRNA within the ASO / mRNA complex, limiting the synthesis of the encoded protein. Unfortunately, biologically active modified ASOs (PS) are highly toxic, particularly due to their non-specific binding to proteins. This has led researchers to develop a new generation of ASOs that are less toxic and more specific.
[0115] Another class of ASOs (sometimes referred to as second-generation ASOs) is characterized by alkyl modification at the 2' position of ribose. The introduction of an oxygenated group results in the formation of 2'-O-methyl (2'-OME) and 2'-O-methoxyethyl (2'-MOE) nucleotides. These ASOs are less toxic than PS and have a slightly higher affinity for their targets. However, these modifications are incompatible with the recruitment and subsequent cleavage of RNAseH. The antisense effect of this type of ASO is likely due to steric blockade of translation. Such modifications are potentially interesting when the target RNA must not be degraded.
[0116] Further classes of ASOs (sometimes referred to as third-generation ASOs) are more heterogeneous, involving numerous modifications aimed at improving binding affinity, nuclease resistance, and pharmacokinetic profiles. The most common modifications include locked nucleic acids (LNAs), where a methylene bridge connects the 2'-oxygen and 4'-carbon of ribose; phosphorodiamidate morpholino oligomers (PMOs), where ribose is replaced by a morpholine moiety and the phosphodiester bond is replaced by a phosphorodiamidate bond; and peptide nucleic acids (PNAs), where the ribose-phosphate skeleton is replaced by a polyamide skeleton consisting of repeating N-(2-aminothyl)glycine units linked to a base. (Papargyri N, Pontoppidan M, Andersen MR, Koch T, Hagedorn PH. Chemical Diversity of Locked Nucleic Acid-Modified Antisense Oligonucleotides Allows Optimization of Pharmaceutical Properties. Mol Ther Nucleic Acids.) (2020;19:706-717). These last two structures are uncharged and bind to plasma proteins with lower affinity than charged ASOs, increasing their distribution and removal in urine. The removed fraction represents approximately 10–30% of the administered amount and has been shown to contribute to tissue accumulation. These modifications result in high stability but do not induce RNAseH recruitment. This third-generation ASO forms a stable hybrid with its target mRNA, thereby inhibiting its processing or translation.
[0117] The structural constraints on LNA modifications imposed by connecting crosslinks, and those of their methylated analogs (known as "restricted ethyl": cET), have created new opportunities in chemotherapeutic agents. Tricyclo-DNA (tcDNA) belongs to this class of structurally restricted DNA analogs with enhanced binding properties. While they do not induce RNAseH activity, they exhibit increased stability and improved cellular uptake, providing them with substantial therapeutic benefits that surpass the ASOs mentioned above.
[0118] As previously highlighted, ASOs carrying most second and third-generation chemical modifications do not induce RNAseH activity. However, RNAseH activity can be restored by inserting a series of unmodified or PS-DNA cleavage-sensitive sequences between a pair of non-RNAseH-sensitive sequences at the end of the ASO. The resulting structure is known as a "gapmer" (see, e.g., Quemener, Wiley Interdiscip Rev RNA. 2020;11(5):e1594).
[0119] Overall, such diversity in chemical modifications, along with the structure of ASOs, provides considerable freedom for adapting therapeutic approaches according to selected targets and mechanisms of action. Recent approvals by the U.S. Food and Drug Administration (FDA) of several nucleic acid-based drugs have further stimulated interest in antisense research. Currently, numerous antisense drug candidates are in clinical trials to treat cardiovascular, metabolic, endocrine, neurological, neuromuscular, inflammatory, and infectious diseases.
[0120] In some embodiments, the antisense oligo comprises one or more modifications in the base, 2' position, skeleton / phosphate, or ribose, for example, as known in the art or as described herein, provided that the modifications do not inhibit interaction with RIG-I helicase.
[0121] Anti-miRNA oligonucleotides (AMOs) As described above, microRNAs control many physiological functions by strictly regulating gene expression. Because they are important regulators, they are also associated with disease. Therefore, inhibiting their activity can be an effective therapeutic strategy. AMOs are ASOs that have a sequence complementary to targeted endogenous miRNAs, forming stable, high-affinity bindings. Similar to ASOs, they can be synthesized using various chemical characteristics as described above. These synthetically designed molecules are used to neutralize the function of microRNAs (miRNAs) in cells for desired responses through steric barrier mechanisms and hybridization to miRNAs. In particular, it is essential that AMOs bind with high affinity to the miRNA "seed region," which extends 2-8 bases from the 5' end of the miRNA.
[0122] 5. Treatment Method In part, the present disclosure relates to a method for treating cancer, comprising administering a therapeutically effective amount of a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to endogenous tumor-specific RNA (tsRNA) that is highly expressed in tumor cells compared to non-tumor cells. In some embodiments, the present disclosure relates to a method for selectively activating RIG-I in tumor cells, comprising administering a therapeutically effective amount of a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide contains a sequence complementary to endogenous tumor-specific RNA (tsRNA), and RIG-I is selectively activated in tumor cells that highly express tumor-specific RNA. In some embodiments, RNA is mRNA. In some embodiments, RNA is miRNA. In some embodiments, miRNA is selected from the group consisting of SEQ ID NOs: 1 to 13.
[0123] As used herein, terms such as “treatment,” “to treat,” and “to alleviate” generally mean obtaining a desired pharmacokinetic and / or physiological effect, and may also be used to refer to improving, alleviating, and / or reducing the severity of one or more clinical complications of the treated condition (e.g., cancer). The effect may be prophylactic in terms of completely or partially delaying the onset or recurrence of the disease, condition, or complications, and / or therapeutic in terms of partial or complete cure of the disease or condition and / or adverse effects resulting from the disease or condition. As used herein, “treatment” encompasses any treatment of a disease or condition in a mammal, in particular, a human. As used herein, a therapeutic agent that “prevents” a disorder or condition means a compound that, in a statistical sample, reduces the occurrence of the disorder or condition in the treated sample compared to an untreated control sample, or delays the onset of the disease or condition compared to an untreated control sample.
[0124] Generally, the treatment or prevention of the diseases or conditions described herein (e.g., cancer) is achieved by administering one or more 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure in an “effective dose.” An effective dose of a drug means the dose required to achieve the desired therapeutic or preventive outcome and that is effective over a period of time. The “therapeutic effective dose” of a drug of this disclosure may vary depending on factors such as the individual’s disease state, age, sex, and weight, as well as the drug’s ability to elicit the desired response in the individual. A “preventive effective dose” means the dose required to achieve the desired preventive outcome and that is effective over a period of time.
[0125] In certain embodiments, this disclosure envisions the use of one or more 5'pp or 5'ppp ssRNA oligonucleotides in combination with one or more additional active agents or other supporting therapies to treat or prevent a disease or condition (e.g., cancer). As used herein, “in combination with,” “combined with,” “in conjunction with,” or “joint administration” means any form of administration in which the additional active agent or supporting therapy (e.g., second, third, fourth, etc.) remains effective in the body (e.g., multiple compounds are effective simultaneously in the patient over some period of time, and may include synergistic effects of these compounds). Efficacy does not have to correlate with measurable concentrations of the agent in blood, serum, or plasma. For example, different therapeutic compounds may be administered in the same formulation or in different formulations, simultaneously or sequentially, and on different schedules. Thus, subjects receiving such treatment may benefit from the combined effects of different active agents or therapeutic agents. One or more 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure may be administered concurrently with, before, or after, one or more other additional agents or supporting therapies, such as those disclosed herein. Generally, each active agent or therapy is administered in a dose and / or time schedule determined for that particular agent. Specific combinations for use in a regimen should take into account the compatibility of the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure with the additional active agents or therapy and / or the desired effect.
[0126] Methods described herein include methods for treating cancer, comprising administering a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to a miRNA or mRNA highly expressed in tumor cells compared to non-tumor cells. While not intended to be constrained by theory, single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotides form a double helix with tumor-specific RNA, thereby eliciting a tumor-specific immune response via the RIG-I signaling pathway. Therefore, methods for treating cancer are provided herein, which, if necessary, involve combining the inhibition of miRNA or mRNA (e.g., the use of a 5'pp or 5'ppp ssRNA oligonucleotide complementary to endogenous miR21) with RIG-I-mediated immune activation against tumor cells. In some embodiments, the endogenously expressed mRNA or miRNA is oncogenic. In some embodiments, the endogenously expressed mRNA or miRNA is tumor-specific. As used herein, “tumor-specific RNA” refers to RNA (e.g., miRNA or mRNA) that is highly expressed in tumor cells compared to non-tumor cells.
[0127] In vivo, miRNAs often exert regulatory functions within the RNA-induced silencing complex (RISC). The core subunit of RISC is a miRNA bound to AGO2 (a member of the Argonaut family of proteins). The miRNAs within the RISC complex include double-stranded miRNAs, where one RNA strand is a miRNA-guide that directs the complex to the target mRNA, and the other RNA strand is a passenger strand that is removed from the complex and degraded. AGO2 uses the miRNA-guide to identify complementary target transcripts for repression.
[0128] In some embodiments, a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide forms a double helix with endogenous tumor-specific RNA. In some embodiments, the endogenous tumor-specific RNA is selected from miRNA or mRNA. In some embodiments, the miRNA or mRNA is carcinogenic. In some embodiments, the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide forms a double helix with miRNA. In some embodiments, the double helix is not cleaved by AGO2. In some embodiments, the double helix is released by AGO2. In some embodiments, the double helix contains 0 to 5 mismatched base pairs.
[0129] In some embodiments, the double helix activates RIG-I. In some embodiments, RIG-I activation is at least 5%, 10%, 15%, or 20% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, RIG-I activation elicits a tumor-specific immune response. In some embodiments, single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotides compete with endogenous mRNA for binding to miRNA.
[0130] The methods disclosed herein include treatment of cancer, including abnormal apoptosis or differentiation process disorders, e.g., cell proliferation disorders or cell differentiation disorders, e.g., solid tumors and hematopoietic carcinomas. In certain embodiments, the methods relate to dual treatment methods, comprising a combination of tumor-specific immune activation and inhibition of miRNA or mRNA. The methods can also be used to reduce the risk of developing abnormal apoptosis or differentiation process disorders by inducing an immune response that targets developing cancer cells. In some embodiments, the disorders are solid tumors, e.g., breast cancer, prostate cancer, pancreatic cancer, brain cancer, liver cancer, lung cancer, kidney cancer, skin cancer, or colon cancer. Generally, the methods involve administering a therapeutically effective dose of the treatment described herein to a subject in need of such treatment, or a subject determined to require such treatment. In some embodiments, the methods involve administering a therapeutically effective dose of a treatment comprising, for example, a 5'pp or 5'ppp ssRNA oligonucleotide (e.g., RNA oligonucleotides used herein) linked to nanoparticles. In some embodiments, the nanoparticles are magnetic nanoparticles.
[0131] When used in this context, “to treat” means to improve at least one symptom of a disorder associated with an abnormal apoptosis or differentiation process. For example, treatment may result in a reduction in tumor size or growth rate. Administration of therapeutically effective doses of the compounds described herein for the treatment of a condition associated with an abnormal apoptosis or differentiation process (e.g., cancer) results in, among other things, a reduction in tumor size or growth rate, a reduction in the risk or frequency of recurrence, a delay in recurrence, a reduction in metastasis, an increase in survival rate, and / or a decrease in morbidity and mortality.
[0132] Examples of disorders of cell proliferation and / or differentiation include cancer, e.g., carcinoma, sarcoma, metastatic disorders, or hematopoietic neoplasm disorders, e.g., leukemia. Metastatic tumors can arise from a number of primary tumor types, including, but are not limited to, those originating from the prostate, colon, lung, breast, and liver.
[0133] As used herein, the terms “cancer,” “hyperproliferative,” and “neoplastic” refer to abnormal conditions or states characterized by the growth of cells that have the capacity for autonomous growth, i.e., rapidly proliferating cells. Hyperproliferative and neoplastic conditions can be classified as either pathogenic, i.e., characterizing or constituting a condition, or nonpathogenic, i.e., deviations from normal that are not associated with a condition. This term means that it includes all types of cancerous growth or carcinogenic processes, metastatic tissue, or malignantly transformed cells, tissues, or organs, regardless of histopathological type or invasive stage. “Pathogenic hyperproliferative” cells occur in conditions characterized by malignant tumor growth. An example of nonpathogenic hyperproliferative cells is the proliferation of cells associated with wound repair.
[0134] The term “cancer” or “neoplasm” includes malignant tumors of various organ systems, such as the bladder, bones, lungs, kidneys, breasts, thyroid, lymph nodes, gastrointestinal tract, and urogenital tract, as well as adenocarcinomas, including many colon cancers, renal cell carcinoma, prostate cancer and / or testicular cancers, non-small cell lung cancer, small intestine cancer, and esophageal cancer. Other types of cancer include, but are not limited to, biliary tract cancer, brain cancer, breast cancer, cervical cancer, choriocarcinoma, colon cancer, endometrial cancer, esophageal cancer, gastric cancer, glioblastoma, carcinoma in situ, leukemia, lymphoma, liver cancer, lung cancer, melanoma, myeloma, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, and kidney cancer. In certain embodiments, the cancer is selected from hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia, chronic myeloid leukemia, non-Hodgkin lymphoma, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, renal cell carcinoma, prostate cancer, bladder cell carcinoma, breast cancer, ovarian cancer, non-small cell lung cancer, small cell lung cancer, hepatocellular carcinoma, basal cell carcinoma, colon cancer, cervical dysplasia, and Kaposi's sarcoma (AIDS-related and non-AIDS-related).
[0135] The term “cancer” is as recognized in the art and refers to malignant tumors of epithelial or endocrine tissue, including cancers of the respiratory system, gastrointestinal system, urogenital system, testicular cancer, breast cancer, prostate cancer, endocrine system cancer, and melanoma. In some embodiments, the disease is renal cancer or melanoma. Exemplary cancers include those that form from the tissues of the cervix, lungs, prostate, breast, head and neck, colon, and ovaries. The term also includes carcinosarcoma, which includes, for example, malignant tumors composed of cancerous and sarcomatous tissues. “Adenocarcinoma” refers to cancer originating from glandular tissue, or cancer in which tumor cells form recognizable glandular structures.
[0136] The term "sarcoma" is recognized in this technical field and refers to a malignant tumor of mesenchymal origin.
[0137] Further examples of proliferative disorders include hematopoietic neoplasms. As used herein, the term “hematopoietic neoplasm” includes diseases involving hematopoietic hyperplasia / neoplasmic cells arising from, for example, myeloid, lymphoid, or erythroid cells, or their progenitor cells. Preferably, the disease arises from poorly differentiated acute leukemias, such as erythroblastic leukemia and acute megakaryoblastic leukemia. Further exemplary myeloid disorders include, but are not limited to, acute promyelocytic leukemia (APML), acute myeloid leukemia (AML), and chronic myeloid leukemia (CML) (as outlined in Vaickus, L. (1991) Crit Rev. in Oncol. / Hemotol. 11:267-97); and, but are not limited to, lymphoid malignancies such as acute lymphoblastic leukemia (ALL), including lineage B ALL and lineage T ALL, chronic lymphocytic leukemia (CLL), prolymphocytic leukemia (PLL), hairy cell leukemia (HLL), and Waldenström macroglobulinemia (WM). Further forms of malignant lymphoma include, but are not limited to, non-Hodgkin lymphoma and its variants, peripheral T-cell lymphoma, adult T-cell leukemia / lymphoma (ATL), cutaneous T-cell lymphoma (CTCL), large granular lymphocyte leukemia (LGF), Hodgkin's disease, and Reed-Sternberg's disease.
[0138] In some embodiments of the methods described herein, a 5'pp or 5'ppp ssRNA oligonucleotide (e.g., RNA oligonucleotide as used herein) is administered to a subject diagnosed with cancer (e.g., primary or metastatic cancer). In some embodiments, the subject has breast cancer (e.g., metastatic breast cancer). In some non-limiting embodiments, the subject is male or female, adult, adolescent, or child. In some embodiments, the subject has one or more symptoms of cancer or metastatic cancer (e.g., metastatic cancer in the lymph nodes). In some embodiments, the subject has severe or advanced-stage cancer (e.g., primary or metastatic cancer). In some embodiments, the subject has a metastatic tumor present in at least one lymph node. In some embodiments, the subject has previously undergone breast-conserving surgery (lymphectomy) and / or mastectomy.
[0139] RIG-I receptor activated immune response As previously described, RIG-I is a cytoplasmic nucleic acid that senses pattern recognition receptors (PRRs) of the innate immune system. It is essential for recognizing RNA structures (such as viruses) using its 5' triphosphate signature. RIG-I activation can be programmed as an immune response against cancer. Importantly, tumor cell death induced by RIG-I has been shown to build immunological memory, meaning that once the body's immune system is activated, the body becomes immune and rejects tumors as "foreign."
[0140] In some embodiments, this disclosure envisions a method for selectively activating RIG-I in tumor cells, comprising administering a therapeutically effective amount of a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to endogenous tumor-specific RNA (tsRNA), and RIG-I is selectively activated in tumor cells that highly express the tumor-specific RNA. While not wishing to be constrained by theory, if the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide forms a double helix with the tumor-specific RNA, thereby eliciting a tumor-specific immune response via the RIG-I signaling pathway, the immune system is selectively activated in cancer cells. In some embodiments, administration of a 5'pp or 5'ppp ssRNA oligonucleotide induces an antiviral response, particularly a type I IFN response. In some embodiments, the type I IFN response is an IFN-α response. In some embodiments, RIG-I activation elicits a tumor-specific immune response (e.g., a response to tumor cells highly expressing tumor-specific RNA). In some embodiments, the tumor-specific immune response includes the release of type I IFN, DAMP (danger-associated molecular pattern), and / or tumor antigens. In some embodiments, the method induces immunological memory against the tumor cells.
[0141] In some embodiments, administration of 5'pp or 5'ppp ssRNA oligonucleotides induces apoptosis in tumor cells. In some embodiments, administration of 5'pp or 5'ppp ssRNA oligonucleotides (a) induces an antiviral response, particularly a type I IFN response, and (b) downregulates tumor-specific RNA (e.g., miRNA21) in vertebrates, particularly mammals. This application further provides the use of at least one 5'pp or 5'ppp ssRNA oligonucleotide for the preparation of pharmaceutical compositions for inducing apoptosis in tumor cells in vertebrates, particularly mammals.
[0142] Methods and / or compositions for inducing a tumor-specific immune response by administration of 5'ppp or 5'ppp ssRNA oligonucleotides, thereby activating the body's immune system to produce a desired treatment response (e.g., dealing with and / or creating antitumor immunological memory in animals) are described herein. While we do not wish to be constrained by theory, as shown in Figure 1, the RIG-I pathway is selectively activated in cancer cells by the in situ generation of 5'ppp-dsRNA following the introduction of a 5'ppp ssRNA oligonucleotide complementary to miRNA or mRNA specifically expressed in cancer cells; the same, or similar, is expected from 5'ppp-ssRNA. Consequently, the antitumor immune capacity of the tumor microenvironment (TME) can be elucidated by activation of the RIG-I signaling pathway, in conjunction with the co-activation of certain tumor suppressor genes(s) by simply using single-stranded RNA.
[0143] 6. Pharmaceutical composition and dosage form In any of the methods described herein, a 5'pp or 5'ppp ssRNA oligonucleotide (e.g., RNA oligonucleotide used herein) may be administered by a healthcare professional (e.g., a physician, physician's assistant, nurse, or laboratory or clinic staff), the subject (i.e., self-administered), or a friend or family member of the subject. Administration may be carried out in a clinical setting (e.g., a clinic or hospital), an assisted living facility, or a pharmacy.
[0144] In some embodiments of any of the methods described herein, the subject is administered a composition containing at least one (e.g., 1, 2, 3, or 4) of the 5'pp or 5'ppp ssRNA oligonucleotides described herein (e.g., RNA oligonucleotides used herein) in at least 1 (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30) doses. In any of the methods described herein, at least one magnetic particle or pharmaceutical composition (e.g., any of the magnetic particles or pharmaceutical compositions described herein) may be administered to the subject intravenously, intra-arterially, subcutaneously, intraperitoneally, or intramuscularly. In some embodiments, at least one magnetic particle or pharmaceutical composition is administered (injected) directly into the lymph nodes of the subject.
[0145] In some embodiments of the methods described herein, the subject is administered a composition containing at least one (e.g., 1, 2, 3, or 4) of the 5'pp or 5'ppp ssRNA oligonucleotides described herein (e.g., RNA oligonucleotides used herein) in at least one (e.g., 1, 2, 3, or 4) doses. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the Disclosure are administered in a dose range of 0.2 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the Disclosure are administered in a dose range of 0.3 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the Disclosure are administered in a dose range of 0.4 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 0.5 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 0.6 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 0.7 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 0.8 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 0.9 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 1 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 2 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 3 mg / kg to 200 mg / kg.In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 4 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 5 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 6 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 7 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 8 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 9 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 10 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 20 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 30 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 40 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 50 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 60 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 70 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 80 mg / kg to 200 mg / kg.In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 90 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 100 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 110 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 120 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 130 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 140 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 150 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 160 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 170 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 180 mg / kg to 200 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered in a dose range of 190 mg / kg to 200 mg / kg.
[0146] In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 0.2 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 0.3 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 0.4 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 0.5 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 0.6 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 0.7 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 0.8 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 0.9 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 1 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 2 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 3 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 4 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 5 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 6 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 7 mg / kg.In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 8 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 9 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 10 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 20 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 30 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 40 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 50 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 60 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 70 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 80 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 90 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 100 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 110 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 120 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 130 mg / kg.In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 140 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 150 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 160 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 170 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 180 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 190 mg / kg. In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered at a dose of at least 200 mg / kg.
[0147] In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the Disclosure are administered once daily. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the Disclosure are administered twice daily. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the Disclosure are administered once weekly. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the Disclosure are administered twice weekly. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the Disclosure are administered three times weekly. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the Disclosure are administered every two weeks. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the Disclosure are administered every three weeks. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of the Disclosure are administered every four weeks. In certain embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides of this disclosure are administered monthly.
[0148] In any of the embodiments of the methods described herein, the subject is administered a composition containing at least one (e.g., 1, 2, 3, or 4) of the 5'pp or 5'ppp ssRNA oligonucleotides described herein (e.g., RNA oligonucleotides used herein) in at least 1 (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30) doses. In certain embodiments, the modified RNA oligonucleotide contains up to 40 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 39 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 38 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 37 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 36 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 35 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 34 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 33 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 32 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 31 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 30 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 29 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 28 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 27 different modified RNA oligonucleotides.In certain embodiments, the modified RNA oligonucleotide contains up to 26 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 25 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 24 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 23 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 22 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 21 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 20 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 19 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 18 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 17 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 16 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 15 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 14 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 13 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 12 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 11 different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to 10 different modified RNA oligonucleotides.In certain embodiments, the modified RNA oligonucleotide contains up to nine different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to eight different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to seven different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to six different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to five different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to four different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to three different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains up to two different modified RNA oligonucleotides. In certain embodiments, the modified RNA oligonucleotide contains one modified RNA oligonucleotide.
[0149] In some embodiments of any of the methods described herein, the subject is administered a composition containing at least one (e.g., 1, 2, 3, or 4) of the 5'pp or 5'ppp ssRNA oligonucleotides described herein (e.g., RNA oligonucleotides used herein) in at least 1 (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30) doses. In any of the methods described herein, at least one magnetic particle or pharmaceutical composition (e.g., any of the magnetic particles or pharmaceutical compositions described herein) may be administered to the subject intravenously, intra-arterially, subcutaneously, intraperitoneally, or intramuscularly. In some embodiments, at least one magnetic particle or pharmaceutical composition is administered (injected) directly into the lymph nodes of the subject. In some embodiments, the magnetic nanoparticles contain 1 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 2 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 3 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 4 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 5 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 6 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 7 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 8 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 9 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 10 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 11 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 12 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 13 to up to 40 different modified RNA oligonucleotides.In some embodiments, the magnetic nanoparticles contain 14 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 15 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 16 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 17 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 18 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 19 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 20 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 21 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 22 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 23 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 24 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 25 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 26 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 27 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 28 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 29 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 30 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 31 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 32 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 33 to up to 40 different modified RNA oligonucleotides.In some embodiments, the magnetic nanoparticles contain 34 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 35 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 36 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 37 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 38 to up to 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain 39 to up to 40 different modified RNA oligonucleotides.
[0150] In some embodiments, the magnetic nanoparticles contain at least 40 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 39 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 38 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 37 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 36 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 35 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 34 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 33 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 32 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 31 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 30 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 29 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 28 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 27 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 26 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 25 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 24 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 23 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 22 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 21 different modified RNA oligonucleotides.In some embodiments, the magnetic nanoparticles contain at least 20 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 19 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 18 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 17 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 16 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 15 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 14 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 13 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 12 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 11 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 10 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 9 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 8 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least 7 different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least six different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least five different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least four different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least four different modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles contain at least three different modified RNA oligonucleotides. In some embodiments, they contain at least two different modified RNA oligonucleotides.
[0151] In some embodiments, a pharmaceutical composition comprising at least one of the above-described 5'pp or 5'ppp ssRNA oligonucleotides and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition further comprises an agent that facilitates the delivery of the oligonucleotide to cells, in particular to the cytosol of the cells. In some embodiments, the delivery agent is an agent described herein (e.g., micelles, lipid nanoparticles (LNPs), globular nucleic acids (SNAs), extracellular vesicles, synthetic vesicles, exosomes, lipidoids, liposomes, and lipoplexes).
[0152] The pharmaceutical composition may further contain other agents, such as oligonucleotide stabilizers. Examples of stabilizers include proteins that complex with oligonucleotides to form iRNPs, chelating agents such as EDTA, salts, and RNase inhibitors.
[0153] In certain embodiments, a pharmaceutical composition, in particular a pharmaceutical composition comprising a 5'pp or 5'ppp ssRNA oligonucleotide as described herein, further comprises one or more pharmaceutically active therapeutic agents. Examples of pharmaceutically active agents include immunostimulants, antivirals, antibiotics, antifungals, antiparasitic agents, antitumor agents, cytokines, chemokines, growth factors, anti-angiogenic factors, chemotherapeutic agents, antibodies, and gene silencing agents. Preferably, the pharmaceutically active agents are selected from the group consisting of immunostimulants, antivirals, and antitumor agents. More than one pharmaceutically active agent may belong to the same or different categories.
[0154] In certain embodiments, the pharmaceutical composition, in particular the pharmaceutical composition comprising a 5'pp or 5'ppp ssRNA oligonucleotide as described herein, further comprises an antigen, an antiviral vaccine, an antibacterial vaccine, and / or an antitumor vaccine, wherein the vaccine may be prophylactic and / or therapeutic.
[0155] In certain embodiments, a pharmaceutical composition, in particular a pharmaceutical composition comprising a 5'pp or 5'ppp ssRNA oligonucleotide as described herein, further comprises a retinoid acid, IFN-α and / or IFN-β. Although not bound by any theory, the retinoid acid, IFN-α and / or IFN-β may sensitize cells for IFN-α production, possibly by upregulating RIG-I expression.
[0156] A pharmaceutical composition can be formulated in any manner suitable for its therapeutic application, including the intended route of administration, mode of delivery, and desired dosage. Those skilled in the art can formulate an optimal pharmaceutical composition in accordance with the common general knowledge in the art.
[0157] Pharmaceutical compositions can be formulated for immediate release, controlled release, timed release, sustained release, extended release, or continuous release.
[0158] The pharmaceutical composition may be administered by any route known in the art, including, but not limited to, topical, enteral, and parenteral routes, provided that it is compatible with its intended application. Topical administration includes, but is not limited to, transdermal, inhalation, intranasal, vaginal, enema, eye drops, and ear drops. Enteral administration includes, but is not limited to, oral, rectal, and nutrient tube administration. Parenteral administration includes, but is not limited to, intravenous, intra-arterial, intramuscular, intracardiac, subcutaneous, intraosseous, intrathecal, intraperitoneal, transdermal, transmucosal, and inhalation administration. The pharmaceutical composition may be used for prophylactic and / or therapeutic purposes.
[0159] A person skilled in the art can easily determine the optimal dosage, frequency, timing, and route of administration based on factors such as the disease or condition to be treated, the severity of the disease or condition, the patient's age, sex, and physical condition, and whether or not there have been previous treatments.
[0160] In some embodiments, subjects are administered at least one 5'pp or 5'ppp ssRNA oligonucleotide (e.g., RNA oligonucleotides used herein) or a pharmaceutical composition (e.g., either a 5'pp or 5'ppp ssRNA oligonucleotide or a pharmaceutical composition described herein) and at least one additional therapeutic agent. At least one additional therapeutic agent is a chemotherapeutic agent (e.g., cyclophosphamide, mechloretamine, chlorambucil, melphalan, daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, barurubicin, paclitaxel, docetaxel, etoposide, teniposide, tafluposide, azacitidine, azathioprine, capecitabine, cytarabine, doxifluridine, fluorouracil, gemcitabine, mercaptopurine, methotrexate, thioguanine, bleomycin, carboplatin, cisplatin, oxaliplatin, bortezomib, carfilzomib, salinosporamide A, all-trans retinoic acid, vinblastine, vincristine, vin It may also be analgesics (e.g., decine and vinorelbine) and / or analgesics (e.g., acetaminophen, diclofenac, diflunisal, etodolac, fenoprofen, flurbiprofen, ibuprofen, indomethacin, ketoprofen, ketorolac, meclofenamete, mefenamic acid, meloxicam, nabumetone, naproxen, oxaprozine, phenylbutazone, piroxicam, sulindac, tolmetine, celecoxib, buprenorphine, butorphanol, codeine, hydrocodone, hydromorphone, levorphanol, meperidine, methadone, morphine, nalbufine, oxycodone, oxymorphone, pentazocine, propoxifen, and tramadol).
[0161] In some embodiments, at least one additional therapeutic agent is an immunogenic cell death inducer (ICDi) (e.g., daunorubicin, docetaxel, doxorubicin, mitoxantrone, oxaliplatin, and paclitaxel). In some embodiments, at least one additional therapeutic agent is an siRNA therapy. In some embodiments, the siRNA therapy targets cancer-associated genes (e.g., PD-L1, CTLA-4, TGF-β, and / or VEGF).
[0162] In some embodiments, at least one additional therapeutic agent is targeted therapy. Targeted therapy is the basis of precision medicine, a form of medicine that uses information about human genes and proteins to prevent, diagnose, and treat diseases. Such therapeutic agents are sometimes called “molecularly targeted drugs” or similar names. The process of discovering them is often called “rational drug design.” This concept is sometimes called “personalized medicine.”
[0163] Molecularly targeted drugs interact with specific target molecules, or structurally related sets of target molecules, along a pathway, and thus modulate the endpoint effects of that pathway, such as disease-related processes, and thus obtain therapeutic benefits.
[0164] Molecularly targeted drugs may be small molecules or biopharmaceuticals, typically antibodies. They can be useful alone or in combination with other therapeutic agents and methods.
[0165] Because they target specific molecules or sets of related molecules and are typically designed to minimize their interactions with other molecules, targeted therapies may have fewer adverse side effects. Broadly speaking, targeted cancer drugs block cancer growth and spread by interacting with specific molecules or sets of structurally related molecules (collectively, “molecular targets”) that are involved in the growth, progression, suppression or elimination of cancer, or its spread. Such molecular targets may include, for example, but are not limited to, proteins or genes involved in one or more cellular functions, including signaling, gene expression modulation, induction or suppression of apoptosis, inhibition of angiogenesis, or immune system modulation.
[0166] Targeted therapeutic monoclonal antibodies (mAbs) and targeted small molecules are used as treatments for cancer. They are used as monotherapy or in combination with other conventional therapeutic modalities, especially when the disease under treatment is refractory to treatment using only conventional techniques. In some embodiments, at least one additional therapeutic agent is a molecularly targeted therapy. In some embodiments, the molecularly targeted therapy is trastuzumab, giotrif, proleukin, alectinib, canas, atezolizumab, avelumab, axitinib, belimumab, bellinostat, bevacizumab, velcade, canakinumab, ceritinib, cetuximab, crizotinib, dabrafenib, daratumumab, dasatinib, denosumab, etc. The drug is selected from the group consisting of lotuzumab, enasidenib, erlotinib, gefitinib, ibrutinib, zyderig, imatinib, lenvatinib, midostaurin, necitumumab, niraparib, obinutuzumab, osimertinib, panitumumab, regorafenib, rituximab, ruxolitinib, sorafenib, tocilizumab, and trastuzumab.
[0167] In some embodiments, at least one additional therapeutic agent is an immunotherapy. As used herein, the term “immunotherapy” means a compound, composition or treatment that indirectly or directly enhances, stimulates or increases the body’s immune response to cancer cells and / or reduces the side effects of other anticancer treatments. Immunotherapy is therefore a treatment that directly or indirectly stimulates or enhances the immune system’s response to cancer cells and / or reduces the side effects that may be caused by other anticancer agents. Immunotherapy is also referred to in the art as immunogenic therapy, biological therapy, bioresponse modulator therapy and biotherapy. Examples of common immunotherapeutic agents known in the art include, but are not limited to, cytokines, cancer vaccines, monoclonal antibodies and non-cytokine adjuvants. Alternatively, an immunotherapy treatment may consist of administering a target amount of immune cells (such as T cells, NK cells, dendritic cells, or B cells).
[0168] Immunotherapeutic agents may be nonspecific, meaning they may boost the immune system as a whole to make the human body more effective in fighting the growth and / or spread of cancer cells, or they may be specific, meaning they may target cancer cells themselves, and immunotherapy regimens may combine the use of nonspecific and specific immunotherapeutic agents.
[0169] Nonspecific immunotherapies are substances that stimulate or indirectly improve the immune system. Nonspecific immunotherapies have been used alone as the primary treatment for cancer, and in addition to primary treatment, where they function as adjuvants to enhance the effectiveness of other treatments (e.g., cancer vaccines). In the latter context, nonspecific immunotherapies can also function to reduce side effects of other treatments, such as myelosuppression induced by certain chemotherapy agents. Nonspecific immunotherapies can act on important immune system cells, eliciting secondary responses such as increased production of cytokines and immunoglobulins. Alternatively, the drug itself may contain cytokines. Nonspecific immunotherapies are generally classified as cytokines or non-cytokine adjuvants.
[0170] In some embodiments, the immunotherapy is selected from the group consisting of pembrolizumab (Keytruda®), nivolumab (Opdivo®), atezolizumab (Tecentriq®), ipilimumab (Yervoy®), avelumab (Bavencio®), and durvalumab (Imfinzi®). In some embodiments, the subject has previously received or is currently receiving anti-PD-1, anti-PD-L1, or anti-CTLA4 therapy. Alternatively, either method may further include administering an effective dose of anti-PD-1, anti-PD-L1, or anti-CTLA4 therapy to the subject. In some examples, the anti-PD-1, anti-PD-L1, or anti-CTLA4 therapy may include anti-PD-1, anti-PD-L1, or anti-CTLA4 antibodies, respectively. Examples of anti-PD-1 antibodies include pembrolizumab, nivolumab, and AMP-224, or their antigen-binding fragments. Examples of anti-CTLA-4 antibodies include ipilimumab and tremelimumab, or their antigen-binding fragments. Examples of anti-PD-L1 antibodies include durvalumab, atezolizumab, and avelumab, or their antigen-binding fragments.
[0171] In some embodiments, at least one additional therapeutic agent and at least one 5'pp or 5'ppp ssRNA oligonucleotide (e.g., RNA oligonucleotides used herein) are administered in the same composition (e.g., the same pharmaceutical composition). "At least one" means that one or more 5'pp or 5'ppp ssRNA oligonucleotides of the same or different oligonucleotides may be used together.
[0172] In some embodiments, at least one additional therapeutic agent and at least one 5'pp or 5'ppp ssRNA oligonucleotide are administered to the subject using different routes of administration (e.g., at least one additional therapeutic agent delivered by oral administration and at least one 5'pp or 5'ppp ssRNA oligonucleotide delivered by intravenous administration).
[0173] In any of the methods described herein, at least one 5'pp or 5'ppp ssRNA oligonucleotide or pharmaceutical composition (e.g., any of the 5'pp or 5'ppp ssRNA oligonucleotides or pharmaceutical compositions described herein) and, optionally, at least one additional therapeutic agent may be administered to a subject at least once per week (e.g., once, twice, three, or four times per week, once daily, twice daily, or three times daily). In some embodiments, at least two different 5'pp or 5'ppp ssRNA oligonucleotides are administered in the same composition (e.g., a liquid composition). In some embodiments, at least one 5'pp or 5'ppp ssRNA oligonucleotide and at least one additional therapeutic agent are administered in the same composition (e.g., a liquid composition). In some embodiments, at least one 5'pp or 5'ppp ssRNA oligonucleotide and at least one additional therapeutic agent are administered in two different compositions (e.g., a liquid composition containing at least one 5'pp or 5'ppp ssRNA oligonucleotide and a solid oral composition containing at least one additional therapeutic agent). In some embodiments, at least one additional therapeutic agent is administered as a pill, tablet, or capsule. In some embodiments, at least one additional therapeutic agent is administered as a sustained-release oral formulation.
[0174] In some embodiments, one or more additional therapeutic agents may be administered to the subject before administering at least one 5'pp or 5'ppp ssRNA oligonucleotide or pharmaceutical composition (e.g., any of the 5'pp or 5'ppp ssRNA oligonucleotides or pharmaceutical compositions described herein). In some embodiments, one or more additional therapeutic agents may be administered to the subject after administering at least one 5'pp or 5'ppp ssRNA oligonucleotide or pharmaceutical composition (e.g., any of the magnetic particles or pharmaceutical compositions described herein). In some embodiments, one or more additional therapeutic agents and at least one 5'pp or 5'ppp ssRNA oligonucleotide or pharmaceutical composition (e.g., any of the 5'pp or 5'ppp ssRNA oligonucleotides or pharmaceutical compositions described herein) are administered to the subject such that there is an overlap in the biological activity periods of one or more additional therapeutic agents and at least one 5'pp or 5'ppp ssRNA oligonucleotide (e.g., any of the 5'pp or 5'ppp ssRNA oligonucleotides described herein) in the subject.
[0175] In some embodiments, subjects may be administered at least one 5'pp or 5'ppp ssRNA oligonucleotide or pharmaceutical composition (e.g., any of the 5'pp or 5'ppp ssRNA oligonucleotides or pharmaceutical compositions described herein) over a long period of time (e.g., over at least one week, two weeks, three weeks, one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, twelve months, one year, two years, three years, four years, five years, or ten years). A knowledgeable healthcare professional may determine the length of the treatment period using any of the methods described herein for diagnosing or tracking the effectiveness of the treatment (e.g., using the methods described above and methods known in the art). Where applicable, a knowledgeable healthcare professional may change (e.g., increase or decrease) the identity and number of 5'pp or 5'ppp ssRNA oligonucleotides (and / or one or more additional therapeutic agents) administered to a subject, and may adjust (e.g., increase or decrease) the dose or frequency of administration of at least one 5'pp or 5'ppp ssRNA oligonucleotide (and / or one or more additional therapeutic agents) to the subject based on an assessment of the effectiveness of the treatment (e.g., using either the method described herein or a method known in the art). A knowledgeable healthcare professional may further determine when the treatment should be discontinued (e.g., when the subject's symptoms have significantly decreased).
[0176] 7.Delivery 5'pp or 5'ppp ssRNA oligonucleotides (e.g., RNA oligonucleotides used herein) can be delivered in vivo or ex vivo to host cells or subjects using a variety of known and suitable methods available in the art. Delivery systems, including lipoplexes, liposomes, lipid nanoparticles (LNPs), globular nucleic acids (SNAs), nanoparticles, and other methods known in the art, as provided herein, can be used for the delivery of 5'pp or 5'ppp ssRNA oligonucleotides.
[0177] Various delivery systems (e.g., liposomes, nanoparticles) containing 5'pp or 5'ppp ssRNA oligonucleotides can be administered to organisms in vivo for delivery to cells, or ex vivo to cells or cell cultures. Administration is by any route commonly used to introduce a molecule into blood, fluids, or final contact with cells, but is not limited to injection, infusion, topical application, and electroporation. Preferred methods for administering such oligonucleotides are available and well known to those skilled in the art.
[0178] Oligonucleotide delivery strategies The field of oligonucleotide therapy has seen remarkable progress in recent years. However, the effective delivery of oligonucleotides to their intracellular sites of action remains a major challenge. The biological basis of oligonucleotide delivery includes the properties of various tissue barriers and the mechanisms of oligonucleotide uptake and intracellular transport. Current methods for enhancing oligonucleotide delivery include molecular-scale targeted ligand-oligonucleotide conjugates, lipid and polymer-based nanoparticles, globular nucleic acids (inorganic nanoparticles coated with nucleic acids), micelles, extracellular vesicles, synthetic vesicles, exosomes, lipidoids, antibody conjugates, and small molecules that improve oligonucleotide delivery. The advantages and disadvantages of these methods are placed within the context of the underlying basic biology. Some of these delivery methods are described in more detail below.
[0179] Lipoplex, liposomes, and lipid nanoparticles Lipid-containing formulations are one of the most common methods for enhancing nucleic acid delivery. Mixing polyanionic nucleic acid drugs with lipids results in the condensation of nucleic acids into nanoparticles that have a more favorable surface charge and are large enough (approximately 100 nm in diameter) to induce uptake by endocytosis. Lipoplexes are the result of direct electrostatic interactions between polyanionic nucleic acids and cationic lipids and are typically a heterogeneous population of relatively unstable complexes. Lipoplex formulations must be prepared immediately before use and have been successfully used for topical delivery applications. In contrast, liposomes contain a lipid bilayer in which the nucleic acid drug resides in an encapsulated aqueous space. Liposomes are more complex (typically composed of cationic or fusion lipids [which promote endosomal escape] and cholesterol PEGylated lipids), exhibit more consistent physical properties, and show higher stability than lipoplexes. For example, some lipid nanoparticles (LNPs), also known as stable nucleic acid lipid particles, are liposomes containing ionizable lipids, phosphatidylcholine, cholesterol, and PEG-lipid conjugates in specified ratios, and have been successfully used in multiple applications. Landmark examples include siRNA-mediated silencing of hepatitis B virus and APOB in preclinical animal studies, and more recently, the approval of patisirane, an siRNA delivered as an LNP formulation. Encapsulation of the nucleic acid cargo provides a means of protection from nuclease digestion in circulation and in endosomes. Furthermore, ionizable LNPs also associate with APOE, further facilitating hepatic uptake via LDLR-mediated endocytosis. Similarly, LNPs containing lipidoid or lipid-like materials have demonstrated robust siRNA-mediated silencing in rodents and non-human primates.
[0180] Lipid nanoparticles (LNPs) are a well-known means for the delivery of nucleotide cargoes and can be used for the delivery of 5'pp or 5'ppp ssRNA oligonucleotides disclosed herein. A drawback of LNPs is that their delivery is primarily limited to the liver and reticuloendothelial system, because the sinusoidal capillary epithelium in this tissue provides sufficiently large space to allow these relatively large nanoparticles to enter. However, local delivery of LNPs has been used to successfully deliver siRNA to the CNS after intraventricular injection. Conversely, larger nanoparticles are advantageous because they essentially make renal filtration impossible, allowing for the delivery of higher payloads.
[0181] In some embodiments, methods for delivering 5'pp or 5'ppp ssRNA oligonucleotides disclosed herein to host cells or subjects are provided herein, wherein the 5'pp or 5'ppp ssRNA oligonucleotides are delivered via LNPs. In some embodiments, the LNPs comprise biodegradable ionizable lipids. In some embodiments, the LNPs comprise (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate, or another ionizable lipid. For example, see PCT / US2018 / 053559, WO / 2017 / 173054, WO2015 / 095340, and WO2014 / 136086, and the lipids in the references provided therein. In some embodiments, the terms cationic and ionizable in the context of LNP lipids are interchangeable, for example, ionizable lipids are cationic depending on pH.
[0182] In some embodiments, the 5'pp or 5'ppp ssRNA oligonucleotides disclosed herein are formulated in lipid nanoparticles or administered via lipid nanoparticles; see, for example, WO / 2017 / 173054, the entire contents of which are incorporated herein by reference. Any of the 5'pp or 5'ppp ssRNA oligonucleotides described herein can be delivered by LNPs. In some examples, the lipid component includes biodegradable ionizable lipids, cholesterol, DSPC, and PEG-DMG.
[0183] Spherical nucleic acid (SNA) An alternative nanoparticle-based delivery strategy is the SNA method. SNA particles consist of hydrophobic core nanoparticles (containing gold, silica, or various other materials) decorated with hydrophilic oligonucleotides (e.g., ASO, siRNA, and immunostimulatory oligonucleotides) densely packed on their surface by thiol bonds. In contrast to other nanoparticle designs, oligonucleotides bound to SNAs spread radially outward from the core structure. Due to steric hindrance, high local salt concentrations, and interactions with the corona protein, the oligonucleotides are somewhat protected from nucleolysis while exposed.
[0184] nanoparticles In some embodiments, 5'pp or 5'ppp ssRNA oligonucleotides are linked to or conjugated to nanoparticles, for example, as described in WO2013 / 016126. In some embodiments, the nanoparticles have a diameter of about 2 nm to about 200 nm (e.g., about 10 nm to about 30 nm, about 5 nm to about 25 nm, about 10 nm to about 25 nm, about 15 nm to about 25 nm, about 20 nm to about 25 nm, about 25 nm to about 50 nm, about 50 nm to about 200 nm, about 70 nm to about 200 nm, about 80 nm to about 200 nm, about 100 nm to about 200 nm, about 140 nm to about 200 nm, and about 150 nm to about 200 nm) and contain a polymer coating.
[0185] In some embodiments, the nanoparticles provided herein may be spherical, elliptical, or amorphous. In some embodiments, the nanoparticles provided herein may have a diameter (between any two points on the outer surface of the nanoparticle) of about 2 nm to about 200 nm (e.g., about 10 nm to about 200 nm, about 2 nm to about 30 nm, about 5 nm to about 25 nm, about 10 nm to about 25 nm, about 15 nm to about 25 nm, about 20 nm to about 25 nm, about 50 nm to about 200 nm, about 70 nm to about 200 nm, about 80 nm to about 200 nm, about 100 nm to about 200 nm, about 140 nm to about 200 nm, and about 150 nm to about 200 nm). In some embodiments, nanoparticles having a diameter of about 2 nm to about 30 nm localize to the target lymph node. In some embodiments, nanoparticles having a diameter of about 40 nm to about 200 nm localize to the liver.
[0186] In some embodiments, the nanoparticles described herein do not contain magnetic materials. In some embodiments, the nanoparticles may partially contain a core containing a polymer (e.g., poly(lactic acid-coglycolic acid)). Those skilled in the art will understand that nanoparticles can be prepared using any number of materials known in the art, including, but not limited to, rubber (e.g., acacia, guar), chitosan, gelatin, sodium alginate, and albumin. Further polymers that can be used to produce the nanoparticles described herein are known in the art. For example, polymers that can be used to generate nanoparticles include, but are not limited to, cellulosic polymers, poly(2-hydroxyethyl methacrylate), poly(N-vinylpyrrolidone), poly(methyl methacrylate), poly(vinyl alcohol), poly(acrylic acid), polyacrylamide, poly(ethylene-co-vinyl acetate), poly(ethylene glycol), poly(methacrylic acid), polylactide (PLA), polyglycolide (PGA), poly(lactide-co-glycolide) (PLGA), polyacryl anhydride, polyorthoester, polycyanoacrylate, and polycaprolactone.
[0187] Those skilled in the art will understand that the materials used in the composition of nanoparticles, the methods for preparing and coating the nanoparticles, and the methods for controlling the size of the nanoparticles may vary substantially. However, these methods are well known to those skilled in the art. Important issues include the biodegradability, toxicity profile, and pharmacokinetics / pharmacodynamics of nanoparticles. The composition and / or size of nanoparticles are important determinants of their biological fate. For example, larger nanoparticles are typically taken up and broken down by the liver, while smaller nanoparticles (less than 30 nm in diameter) typically circulate for long periods (sometimes with half-lives in the blood exceeding 24 hours in humans) and accumulate in the interstitial tissue of organs with highly permeable vascular systems, such as lymph nodes and tumors.
[0188] Magnetic nanoparticles In some embodiments, the nanoparticles may be magnetic (e.g., containing a core of magnetic material). In some embodiments, magnetic nanoparticles include ferric chloride, ferrous chloride, or a combination thereof, and dextran coatings. In some embodiments, the magnetic nanoparticles contain a mixture of two or more different nanoparticle compositions described herein. In some embodiments, the composition contains at least one magnetic nanoparticle having a tunable surface functionalization and at least one magnetic nanoparticle having a tunable magnetic property.
[0189] In some embodiments, any of the nanoparticles described herein may contain a core of a magnetic material (e.g., therapeutic magnetic nanoparticles). In some embodiments, the magnetic material or particles may contain diamagnetic, paramagnetic, superparamagnetic, or ferromagnetic materials that respond to a magnetic field. Non-limiting examples of therapeutic magnetic nanoparticles include cores of magnetic materials containing magnetite; ferrites (e.g., manganese, cobalt, and nickel ferrites); metal oxides selected from the group of Fe(II) oxides and hematite, as well as metal alloys thereof. The core of the magnetic material can be formed by converting a metal salt to a metal oxide using methods known in the art (e.g., Kieslich et al., Inorg. Chem. 2011). In some embodiments, the nanoparticles contain cyclodextrin gold or quantum dots. Non-limiting examples of methods that can be used to generate therapeutic magnetic nanoparticles are described in Medarova et al., Methods Mol. Biol. 555:1-13, 2009; and Medarova et al., Nature Protocols 1:429-431, 2006. Further magnetic materials and methods for producing magnetic materials are known in the art. In some embodiments of the methods described herein, the location or localization of therapeutic magnetic nanoparticles can be imaged in a target (e.g., imaged in a target after administration of one or more doses of therapeutic magnetic nanoparticles).
[0190] In some embodiments, magnetic nanoparticles can be functionalized with one or more amine groups. In some embodiments, the functionalization occurs on the surface of the magnetic nanoparticles. In some embodiments, one or more amine groups are covalently bonded to a dextran coating. In some embodiments, one or more amine groups substitute for one or more hydroxyl groups in the dextran coating. In some embodiments, the number of one or more amine groups can be adjusted based on the concentration of ferric chloride, ferrous chloride, or a combination thereof. In some embodiments, the nanoparticle composition contains about 5 to about 1000 amine groups. In some embodiments, the nanoparticle composition contains about 5-25, 25-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750, 750-800, 800-850, 850-900, 900-950, or 950-1000 amine groups.
[0191] In some embodiments, the magnetic nanoparticles may contain a core of a magnetic material (e.g., ferric chloride and / or ferrous chloride). In some embodiments, the magnetic nanoparticles contain about 0.60 g to about 0.70 g of ferric chloride and about 0.3 g to about 0.5 g of ferrous chloride. In some embodiments, the magnetic nanoparticles containing about 0.60 g to about 0.70 g of ferric chloride and about 0.3 g to about 0.5 g of ferrous chloride are functionalized with about 5 to 150 amine groups. In some embodiments, the magnetic nanoparticles containing about 0.65 g of ferric chloride and about 0.4 g of ferrous chloride are functionalized with about 60 to 90 amine groups. In some embodiments, the magnetic nanoparticles containing about 0.65 g of ferric chloride and about 0.4 g of ferrous chloride are functionalized with about 5 to 150 amine groups. In some embodiments, magnetic nanoparticles containing about 0.65 g of ferric chloride and about 0.4 g of ferrous chloride are functionalized with about 1 to 150 amine groups. In some embodiments, magnetic nanoparticles containing about 0.65 g of ferric chloride and about 0.4 g of ferrous chloride are functionalized with at least about 1 to 10 amine groups, 10 to 20 amine groups, about 20 to 30 amine groups, about 30 to 40 amine groups, about 40 to 50 amine groups, about 50 to 60 amine groups, about 60 to 70 amine groups, about 70 to 80 amine groups, about 80 to 90 amine groups, about 90 to 100 amine groups, about 100 to 110 amine groups, about 110 to 120 amine groups, about 120 to 130 amine groups, about 130 to 140 amine groups, or about 140 to 150 amine groups.
[0192] In some embodiments, the magnetic nanoparticles contain about 1 g to about 1.4 g of ferric chloride. In some embodiments, magnetic nanoparticles containing about 1 g to about 1.4 g of ferric chloride are functionalized with about 246 to 500 amine groups. In some embodiments, magnetic nanoparticles containing about 1.2 g of ferric chloride are functionalized with about 246 to 500 amine groups. In some embodiments, magnetic nanoparticles functionalized with about 246 to 500 amine groups do not contain ferric chloride. In some embodiments, magnetic nanoparticles containing about 1.2 g of ferric chloride are functionalized with about 200 to 600 amine groups. In some embodiments, magnetic nanoparticles containing about 1.2 g of ferric chloride are functionalized with at least about 200-250 amine groups, 250-300 amine groups, about 300-350 amine groups, about 350-400 amine groups, about 400-450 amine groups, about 450-500 amine groups, about 500-550 amine groups, about 550-600 amine groups, or more amine groups.
[0193] Therefore, in some embodiments, the number of amine groups conjugated to the dextran coating can be fine-tuned by controlling the concentrations of ferric chloride and ferrous chloride used to prepare the magnetic nanoparticles.
[0194] In some embodiments, the magnetic nanoparticles include magnetic nanoparticles having a magnetic intensity that can be adjusted based on the concentration of ferric chloride, ferrous chloride, or a combination thereof.
[0195] In some embodiments, magnetic nanoparticles contain about 0.1% to about 99.9% ferric ions and about 99.9% to about 0.1% ferrous ions per MNP, relative to the total iron. In some embodiments, magnetic nanoparticles containing about 60% to about 80% ferric chloride and about 20% to about 40% ferrous chloride have stronger magnetic properties than nanoparticle compositions having a ferrous chloride content of more than about 80%. In some embodiments, magnetic nanoparticles containing about 70% ferric ions and about 30% ferrous ions have stronger magnetic properties than magnetic nanoparticles having a ferrous ion content of more than about 30%.
[0196] In some embodiments, the magnetic nanoparticles have a nonlinearity index (NLI) in the range of about 6 to about 40. In some embodiments, the magnetic nanoparticles have an NLI in the range of about 6 to about 70. In some embodiments, the magnetic nanoparticles have an NLI in the range of about 8.5 to about 14.8. In some embodiments, the magnetic nanoparticles have an NLI in the range of about 8 to about 14. In some embodiments, the magnetic nanoparticles have an NLI of about 6. In some embodiments, the magnetic nanoparticles have an NLI of about 8. In some embodiments, the magnetic nanoparticles have an NLI of about 14. In some embodiments, the magnetic nanoparticles have an NLI of about 67. In some embodiments, magnetic nanoparticles have an NLI in the range of 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, 20-30, 30-40, 40-50, 50-60, or 60-70. In some embodiments, magnetic nanoparticles containing about 0.54 g of ferric chloride and about 0.2 g of ferrous chloride have an NLI in the range of about 8.5 to about 14.8. In some embodiments, magnetic nanoparticles containing about 0.54 g of ferric chloride and about 0.2 g of ferrous chloride have an NLI of about 12. In some embodiments, the magnetic intensity of magnetic nanoparticles can be quantified by measuring the nonlinearity index (NLI) using magnetic particle spectroscopy as described in WO2021 / 113829.
[0197] In some embodiments, the magnetic nanoparticles contain about 80% to about 100% ferric chloride and about 20% to about 0% ferrous chloride. In some embodiments, magnetic nanoparticles containing about 0% to about 50% ferric chloride and about 100% to about 50% ferrous chloride have weaker magnetic properties than magnetic nanoparticles with less than about 0.4 g of ferrous chloride. In some embodiments, magnetic nanoparticles containing about 0.54 g of ferric chloride and about 0.4 g of ferrous chloride have weaker magnetic properties than magnetic nanoparticles with less than about 0.2 g of ferrous chloride. In some embodiments, magnetic nanoparticles containing about 0.54 g of ferric chloride and about 0.4 g of ferrous chloride have an NLI in the range of about 50 to about 120. In some embodiments, magnetic nanoparticles containing about 0.54 g of ferric chloride and about 0.4 g of ferrous chloride have an NLI of about 67.
[0198] Therefore, in some embodiments, the magnetic properties (e.g., magnetic intensity) of the magnetic nanoparticles can be fine-tuned by controlling the concentrations of ferric chloride and ferrous chloride used to prepare the magnetic nanoparticles.
[0199] In some embodiments, the magnetic nanoparticles have an iron concentration in the range of about 8 mM to about 217 mM. In some embodiments, the magnetic nanoparticles have iron concentrations in the range of about 8 mM to about 15 mM, about 15 mM to about 25 mM, about 25 mM to about 50 mM, 50 mM to about 60 mM, about 60 mM to about 70 mM, about 70 mM to about 80 mM, about 80 mM to about 90 mM, about 90 mM to about 100 mM, about 100 mM to about 110 mM, about 110 mM to about 120 mM, and about 120 mM. It has iron concentrations in the range of approximately 130mM, 130mM to 140mM, 140mM to 150mM, 150mM to 160mM, 160mM to 170mM, 170mM to 180mM, 180mM to 190mM, 190mM to 200mM, 200mM to 210mM, and 210mM to 220mM.
[0200] In some embodiments, the magnetic nanoparticles have an iron concentration in the range of about 1 mg / mL to about 25 mg / mL. In some embodiments, the magnetic nanoparticles have an iron concentration in the range of about 1 mg / mL to about 5 mg / mL, about 5 mg / mL to about 10 mg / mL, about 10 mg / mL to about 15 mg / mL, about 15 mg / mL to about 20 mg / mL, or about 20 mg / mL to about 25 mg / mL.
[0201] In some embodiments, magnetic nanoparticles are used to deliver a composition containing at least one (e.g., one, two, three, or four) of the 5'pp or 5'ppp ssRNA oligonucleotides described herein (e.g., RNA oligonucleotides used herein). “At least one” means that one or more 5'pp or 5'ppp ssRNA oligonucleotides of the same or different oligonucleotides may be used together. In some embodiments, magnetic nanoparticles deliver one 5'pp or 5'ppp ssRNA oligonucleotide. In some embodiments, magnetic nanoparticles deliver two 5'pp or 5'ppp ssRNA oligonucleotides. In some embodiments, magnetic nanoparticles deliver three 5'pp or 5'ppp ssRNA oligonucleotides. In some embodiments, magnetic nanoparticles deliver four 5'pp or 5'ppp ssRNA oligonucleotides. In some embodiments, magnetic nanoparticles deliver five 5'pp or 5'ppp ssRNA oligonucleotides.
[0202] Nanoparticle polymer coating In some embodiments, the nanoparticles described herein include a polymer coating across a core magnetic material (e.g., across the surface of the magnetic material). The polymer material may be suitable for binding or coupling one or more bioagents (e.g., any of the nucleic acids, fluorophores, or targeted peptides described herein). One or more bioagents (e.g., nucleic acids, fluorophores, or targeted peptides) can be immobilized on the polymer coating by chemical coupling (covalent bonding).
[0203] In some embodiments, nanoparticles are formed by a method that includes coating a core of magnetic material with a polymer that is relatively stable in water. In some embodiments, nanoparticles are formed by a method that includes coating a magnetic material with a polymer or absorbing a magnetic material into a thermoplastic polymer resin having reducing groups. The coatings may also be applied to magnetic materials using the methods described in U.S. Patents No. 5,834,121, 5,395,688, 5,356,713, 5,318,797, 5,283,079, 5,232,789, 5,091,206, 4,965,007, 4,774,265, 4,770,183, 4,654,267, 4,554,088, 4,490,436, 4,336,173, and 4,421,660; and WO10 / 111066 (each of which disclosures are incorporated herein by reference).
[0204] Methods for synthesizing iron oxide nanoparticles include, for example, physical and chemical methods. For instance, iron oxide can be prepared by coprecipitation of Fe2+ and Fe3+ salts in an aqueous solution. The resulting core consists of magnetite (Fe3O4), maghemite (γ-Fe2O3), or a mixture of the two. The anionic salt contents in the aqueous solution (chloride, nitrate, sulfate, etc.), the Fe2+ and Fe3+ ratio, pH, and ionic strength all play a role in controlling the size. It is important to prevent oxidation of the synthesized nanoparticles and protect their magnetic properties by carrying out the reaction in an oxygen-free environment under an inert gas such as nitrogen or argon. To prevent aggregation of iron oxide nanoparticles into microparticles, a coating material can be added during the coprecipitation process. Those skilled in the art will understand that any number of surface coating materials known in the art, such as synthetic and natural polymers like polyethylene glycol (PEG), dextran, polyvinylpyrrolidone (PVP), fatty acids, polypeptides, chitosan, and / or gelatin, can be used to stabilize iron oxide nanoparticles.
[0205] For example, U.S. Patent No. 4,421,660 describes how polymer-coated particles of inorganic materials are conventionally prepared by (1) treating an inorganic solid with an acid, a combination of acid and base, an alcohol, or a polymer solution; (2) dispersing additional polymerizable monomers in an aqueous dispersion of the treated inorganic solid; and (3) subjecting the resulting dispersion to emulsion polymerization conditions (col. 1, lines 21-27). U.S. Patent No. 4,421,660 also discloses a method for coating inorganic nanoparticles with a polymer, comprising the steps of (1) emulsifying a hydrophobic emulsion polymerizable monomer in an aqueous colloidal dispersion of individual particles of an inorganic solid; and (2) subjecting the resulting emulsion to emulsion polymerization conditions to form a stable, fluid aqueous colloidal dispersion of inorganic solid particles dispersed in a polymer matrix of hydrophobic monomers insoluble in water (col. 1, lines 42-50).
[0206] Alternatively, polymer-coated magnetic materials that meet the size requirements can be commercially obtained. Examples of commercially available ultra-small superparamagnetic iron oxide nanoparticles include NC100150 Injection (Nycomed Amersham, Amersham Health) and Ferumoxytol (AMAG Pharmaceuticals, Inc.).
[0207] Suitable polymers that can be used to coat the core of magnetic materials include, but are not limited to, polystyrene, polyacrylamide, polyether urethane, polysulfone, polyvinyl chloride, polyethylene, and fluorinated or chlorinated polymers such as polypropylene, polycarbonates, and polyesters. Further examples of polymers that can be used to coat the core of magnetic materials include polyolefins, such as polybutadiene, polydichlorobutadiene, polyisoprene, polychloroprene, halogenated polyvinylidene, polyvinylidene carbonate, and polyfluorinated ethylene. Several copolymers containing styrene / butadiene, alpha-methylstyrene / dimethylsiloxane, or other polysiloxanes can also be used to coat the core of magnetic materials (e.g., polydimethylsiloxane, polyphenylmethylsiloxane, and polytrifluoropropylmethylsiloxane). Further polymers that can be used to coat the core of magnetic materials include polyalpha-acrylonitrile copolymers, alkyd or terpenoid resins, and polyacrylonitrile or acrylonitrile-containing polymers such as polyalkylene polysulfonates. In some embodiments, the polymer coating is dextran. [Examples]
[0208] The present invention is described herein in general terms and is included merely to illustrate certain embodiments of the invention and is not intended to limit the invention, and will be more readily understood by referring to the following examples.
[0209] (Example 1) Design, synthesis, and testing of RNA oligonucleotides In this example, a miRNA inhibitor is designed to be perfectly complementary to its target miRNA, including a diphosphate (pp) or triphosphate (ppp) modification at the 5' end for a potent agonist response, and a thio-MC6-D modification at the 3' end for conjugation to magnetic nanoparticles (MN) for delivery. The 5'pp or 5'ppp modification is omitted for the control oligonucleotide. A blunt-ended double-stranded structure is generated by annealing the 5'pp or 5'ppp-anti-miRNA-3'-thio-MC6-D with a complementary miRNA, which can also be conjugated to an MN. All custom RNA oligonucleotides are synthesized using known methods.
[0210] Synthesis and Characterization of Nanoconjugates The procedure is adapted from the publication (Medarova Z. et al., 2016. Controlling RNA Expression in Cancer Using Iron Oxide Nanoparticles Detectable by MRI and In Vivo Optical Imaging. Methods Mol Biol. 2016;1372:163-179) and can be briefly summarized below. Disulfides on oligonucleotides are activated with 3% Tris(2-carboxyethyl)phosphine hydrochloride (TCEP, Thermo Scientific Co., Rockford, IL), purified by ammonium acetate / ethanol precipitation, and then conjugated to nanoparticles. Amineralized magnetic nanoparticles are synthesized. Nanoparticles with a size of 20+ nm are used for conjugation to oligonucleotides. Magnetic nanoparticles are sequentially conjugated to the heterobifunctional linker N-succinimidyl 3-[2-pyridyldithio]-propionic acid (SPDP; Thermo Scientific Co., Rockford, IL) and the activated oligonucleotides. In short, SPDP is dissolved in anhydrous DMSO and incubated with magnetic nanoparticles. The 3'-thioMC6 of the oligonucleotide is activated by 3% TCEP treatment in nuclease-free PBS, releasing the thiol. The oligonucleotide is purified using ammonium acetate / ethanol precipitation. After TCEP activation and purification, the oligonucleotide is dissolved in water and incubated overnight with SPDP-modified magnetic nanoparticles. The number of oligonucleotides per magnetic nanoparticle is determined by electrophoresis.
[0211] (Example 2) Protein expression and purification Full-length human RIG-I was cloned into E. coli and expressed in a recombinant form with a His-SUMO tag as reported (Kwok J. et al. 2014. Expression, purification, crystallization and preliminary X-ray analysis of full-length human RIG-I. Acta Crystallogr F Struct Biol Commun. 70(Pt 2):248-251). Protein expression and purification were adapted and modified from the published procedure as summarized below (Rawling DC. et al. 2020. Small-Molecule Antagonists of the RIG-I Innate Immune Receptor. ACS Chemical Biology. 15(2):311-317). The RIG-I expression plasmid is transformed into Rosetta II (DE3) E. coli cells (Novagen) using 150 ng / 25 uL of commercially available cell stock and grown in LB medium supplemented with 50 mM potassium phosphate pH 7.4 and 1% glycerol. Expression is induced by adding isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM. After growing the cells at 16°C for 24 hours, they are harvested by centrifugation and resuspended in lysis buffer (20 mM potassium phosphate pH 7.4, 500 mM NaCl, 10% glycerol, 5 mM β-mercaptoethanol (βME)) to a final volume of 50 ml, and frozen at -80°C. For lysis, the frozen pellet is thawed at room temperature and then resuspended in an additional 200 ml of lysis buffer per 4 L of pellet. Cells are lysed by pass-through or selection via a microfluidizer at 15,000 psi, and the lysate is clarified by ultracentrifugation at 100,000 × g for 30 min. The soluble lysate is incubated on 2.5 ml of Ni-NTA beads (Qiagen), washed with a lysis buffer containing an additional 40 mM imidazole, and then eluted with Ni elution buffer (25 mM HEPES pH 8.0, 150 mM NaCl, 220 mM imidazole, 10% glycerol, 5 mM βME).The eluted protein was bound to a HiTrap Heparin HP column (GE Biosciences), washed with a buffer containing 150 mM NaCl, and eluted stepwise with 0.65 M NaCl. The SUMO tag was then removed by incubation with SUMO protease at 4°C for 2 hours. Finally, the monomer protein was collected by passing it through a HiPrep 16 / 60 Superdex 200 column (GE Biosciences) in gel filtration buffer (25 mM MOPS pH 7.4, 300 mM NaCl, 5% glycerol, 5 mM βME). The peak fraction was concentrated to 10–20 μM using a millipore centrifuge with a 50 kD molecular weight cutoff.
[0212] (Example 3) In vitro testing of RIG-I activation using 5'pp or 5'ppp-ds-miRNA mimetic compounds. The ATP / NADH coupled assay for ATPase activity is based on a reaction in which the regeneration of hydrolyzed ATP is coupled with the oxidation of NADH. After each cycle of ATP hydrolysis, a regeneration system consisting of phosphoenolpyruvate (PEP) and pyruvate kinase (PK) converts one molecule of PEP to pyruvate when ADP is converted back to ATP. Pyruvate is then converted to lactate by lactate dehydrogenase (LDH), resulting in the oxidation of one molecule of NADH. This assay measures the rate of decrease in NADH absorbance at 340 nm, which is proportional to the rate of steady-state ATP hydrolysis. Steady-state ATP regeneration allows for monitoring of the ATP hydrolysis rate throughout the entire assay. A 96-well microplate format reader allows for simultaneous analysis of up to 96 samples. RIG-I is an ATP-dependent RNA helicase. Binding and activation by 5'pp or 5'ppp-ds-miRNA mimetic confers ATPase activity to this protein. Enzyme assays can be conveniently used to test and / or screen for agonists or antagonists for the RIG-I receptor.
[0213] An exemplary procedure for the NADH-coupled ATPase assay is described below (Rawling DC. et al. 2020. Small-Molecule Antagonists of the RIG-I Innate Immune Receptor. ACS Chemical Biology. 15(2):311-317). For the NADH-coupled assay, the RIG-I protein is diluted in ATPase assay buffer (25 mM MOPS pH 7.4, 150 mM KCl, 2 mM DTT) to a final concentration of 10 nM for the initial compound, and then to 20 nM to visualize more potent inhibitors. In this case, RIG-I is activated with the desired RNA oligo or control, which is added to a final concentration of 250 nM. A conjugation assay mixture consisting of 1 mM NADH, 100 U / ml lactate dehydrogenase, 500 U / ml pyruvate kinase, and 2.5 mM phosphoenolpyruvate is added to the sample. Incubate the sample in RT for at least 1 hour. Initiate the reaction by adding a 1:1 ATP / MgCl2 mix to a final concentration of 5 mM.
[0214] RNA agonist-induced RIG-I activation is evaluated by measuring type I interferon using cell-based reporter gene assays based on readily available cell lines. Commercially available cell lines developed for reporter gene assays responsive to IFN exposure are increasingly available. These cells produce soluble gene products that can be readily quantified using multi-well plate spectrophotometers or illuminometers.
[0215] InvivoGen HEK-Lucia®RIG-I cells were generated from HEK-Lucia®Null cells, which are HEK293-derived cells that stably express the secreted Lucia luciferase reporter gene. This reporter gene is under the control of an IFN-inducible ISG54 promoter enhanced by a multimer IFN-stimulated response element (ISRE). HEK-Lucia®RIG-I cells stably express high levels of human RIG-I and respond strongly to cytosolic double-stranded RNAs with uncapped 5'-triphosphate ends, such as 3p-hpRNA and 5'ppp or 5'ppp-dsRNA. The role of RIG-I can be tested by monitoring IRF-inducible Lucia luciferase activity using HEK-Lucia®RIG-I and HEK-Lucia®Null cells. The level of IRF-inducible Lucia in cell culture supernatant can be easily monitored using QUANTI-Luc®, a Lucia luciferase detection reagent (also from InvivoGen). Transfection agents such as LyoVec® (InvivoGen) can be used to achieve RIG-I stimulation using naked 5'pp or 5'ppp-dsRNA or controls that need to be delivered into the cytoplasm.
[0216] (Example 4) Animal models Orthotopic models feature tissue-specific tumor implantation that is easily monitored using living imaging techniques, creating a disease-associated tumor microenvironment (TME) for better bridging to clinical practice. Orthotopic models include the dissemination of tumor cell lines into corresponding tissues in animal models. This strategy allows the inventors to evaluate tumor development in a relevant environment and assess its effectiveness in preclinical tumor models that mimic disease processes in humans. With orthotopic models, disease progression is monitored by various methods, including clinical signs, survival study designs, and imaging platforms with both in vivo and ex vivo capabilities. Examples of study designs are described below.
[0217] Exemplary metastatic breast cancer cell lines that can be used include MDA-MB-231-GFP, 4T1 (American Type Culture Collection (ATCC), Manassas, VA, USA) and MDA-MB-231-luc-D3H2LN (Caliper Life Sciences, Hopkinton, MA, USA). These cell lines are used as recommended by the supplier. Human breast cancer MDA-MB-231-luc-D3H2LN cell line (Caliper Life Sciences) is orthotopically implanted into 6-week-old female nude mice (nu / nu or NIH III nude). In this model, the orthotopically implanted tumor progresses from localized disease to lymph node metastasis within 4 weeks after tumor inoculation. Tumor cells express luciferase and can be detected by non-invasive bioluminescence imaging for correlational analysis of tumor burden. All animal experiments are conducted in accordance with facility guidelines and approved by the Subcommittee on Research Animal Care (SRAC).
[0218] Prevention of metastasis: Inject 2 × 10⁶ MDA-MB-231-luc-D3H2LN cells (Caliper) into the upper right mammary fat pad of 6-week-old nu / nu mice. Use the animals in experiments 14 days after tumor implantation.
[0219] Arrest of metastasis: Inject 2 × 10⁶ MDA-MB-231-luc-D3H2LN cells (Caliper) into the left inferior mammary fat pad of 6-week-old NIH III nude mice. Use the animals in experiments 28 days after tumor implantation. Treatment with MN-5'pp or MN-5'ppp-anti-miR10b and MN-5'pp- or MN-5'ppp-scr-miR includes systemic administration via tail vein at a dose of 10 mg Fe / kg once weekly for 4 weeks.
[0220] (Example 5) Design of template-specific RIG-I agonist, ss-pppmiRNA-21 The template-specific RIG-I agonist, ss-ppp-miRNA-21, efficiently stimulates RIG-I in melanoma cells and induces apoptosis. The ability of ss-ppp-miRNA-21 to induce RIG-I activation was tested in the human RIG-I luciferase reporter cell line, HEK-Lucia®RIG-I. This commercially available cell line stably expresses high levels of human RIG-I and secreted Lucia luciferase reporter genes. These reporter genes are regulated by an IFN-inducible ISG54 promoter enhanced by a multimer IFN-stimulated response element (ISRE). The role of RIG-I can be tested by monitoring IRF-inducible Lucia luciferase activity using HEK-Lucia®RIG-I and HEK-Lucia®Null control cells. High RIG-I expression in cells was confirmed using Western blotting (Figure 2A). The discrimination sensitivity of HEK-Lucia®RIG-I and HEK-Lucia®Null control cells was examined using a commercially available conventional RIG-I agonist consisting of a 5' triphosphate double-stranded RNA 19-mer (ds-ppp-RNA). A very significant enhancement of luciferase activity was observed in RIG-I overexpressing cells compared to null cells (Figure 2B).
[0221] The ability of the template-specific RIG-I agonist ss-ppp-miRNA-21 to activate RIG-I was evaluated. HEK-Lucia®RIG-I and HEK-Lucia®Null control cells were treated with single-stranded oligonucleotides identical to those of our RIG-I agonist, except that they lacked ss-ppp-miRNA-21 and 5'-ppp. Significant RIG-I activation was observed at all three dose levels of ss-ppp-miRNA-21 tested (Figure 2C). Given the strict requirements for RNA double-strand formation for RIG-I activation, these results support the template-directed mechanism of RIG-I agonism, particularly since the miR-21 complement of the single-stranded RNA oligonucleotide was not exogenously supplied. Interestingly, moderate RIG-I activation was present even in the absence of 5'-ppp (Figure 2C).
[0222] Once it was established that ss-ppp-miRNA-21 could induce RIG-I in HEK-Lucia reporter cells overexpressing RIG-I, the applicant conducted experiments to determine whether template-specific RIG-I agonists could mediate the activation of pro-apoptotic signaling in the B16-F10 melanoma cell line. B16-F10 melanoma cells express miR-21 and have been used to test endogenous RIG-I signaling along with cell death as an endpoint (Bek et al., 2019). Caspase-3 / 7 activation was measured in B16-F10 melanoma cells treated with ss-ppp-miRNA-21 or 5'-ppp-deficient ss-miRNA-21. Dose-dependent caspase-3 / 7 activation was observed, which was more pronounced in the presence of 5'-ppp (Figure 2D). When using the ss-ppp-miRNA-21 RIG-I agonist, a dose-dependent decrease in tumor cell viability was also observed (Figure 2E). This decrease in tumor cell viability was significantly greater than that observed when using 5'-ppp-deficient ss-miRNA-21.
[0223] RIG-I agonism mediated by ss-ppp-miRNA-21 is template-dependent. To further investigate the template dependence of observed RIG-I activation with ss-ppp-miRNA-21, HEK-Lucia® RIG-I cells were transiently transfected with increasing concentrations of synthetic mature miRNA-21 mimetic. A highly significant induction of RIG-I signaling by the ss-ppp-miRNA-21 agonist was observed in cells transfected with 30 and 300 ng / ml of synthetic mature miRNA-21 mimetic (Figure 3A). Surprisingly, the induction of RIG-I signaling by the ss-ppp-miRNA-21 agonist was observed in a culture of only 10,000 cells. The level of activation by ss-ppp-miRNA-21 was similar to that observed with commercially available ds-ppp-RNA positive control oligonucleotides (Figure 3A). 5'-ppp-deficient ss-miRNA-21 failed to induce detectable RIG-I activation (Figure 3A). Furthermore, dose-dependence analysis of RIG-I activation as a function of miRNA-21 mimetic concentration revealed that the EC50 of 83.4 ng / ml miRNA-21 mimetic was determined when ss-ppp-miRNA-21 was used. In contrast, the calculated EC50 when 5'-ppp-deficient ss-miRNA-21 was used was 357.9 ng / ml (Figure 3B).
[0224] The ability of template-specific ss-ppp-miRNA-21 agonists to induce an IFN-I response was evaluated in B16-F10 mouse melanoma cells. Treatment with increasing concentrations of the RIG-I agonist induced a dose-dependent increase in IFN-β secretion. This effect was amplified in cells transfected with mature miR-21 mimics, suggesting template-specific enhancement of IFN-β stimulation by the agonist. In contrast, commercially available ds-ppp-RNA agonists failed to stimulate IFN-β secretion (Figure 3C).
[0225] We measured caspase 3 / 7 activation as a function of miRNA-21 mimetic concentration to determine its consistency with known mechanisms of apoptosis induction by intracellular RIG-I signaling in tumor cells transiently transfected with miRNA-21 mimetic. Surprisingly, a dose-dependent increase in caspase 3 / 7 activation was observed, and its effect was significantly higher in cells treated with ss-ppp-miRNA-21 compared to 5'-ppp-deficient ss-miRNA-21, and comparable to that of ds-ppp-RNA positive controls (Figure 3D).
[0226] In addition to RIG-I activation, we assessed RIG-I expression levels to determine if there was evidence of RIG-I upregulation in B16-F10 cells treated with ss-ppp-miRNA-21. Low levels of RIG-I were detected in B16-F10 cells. However, in cells transfected with miR-21 and treated with ss-ppp-miRNA-21, there was dramatic upregulation of RIG-I beyond the levels observed with ds-ppp-RNA-positive control oligonucleotides (Figure 3E).
[0227] One mechanism of immune activation by RIG-I agonism involves activation of the NF-κB signaling pathway. In our study, phosphorylation of the NF-κB subunit p65 at S536 was analyzed to measure NF-κB transactivation. Potent phospho-P65 reactivity was observed in lysates derived from B16-F10 cells treated with ss-ppp-miRNA-21, and this potent reactivity was further amplified when the cells were also transfected with a miR-21 mimetic. The increased reactivity was not associated with increased p65 expression, indicating that the increased reactivity specifically reflected targeted phosphorylation (Figure 3F). This surprising finding further supports the mechanism for effective template-dependent immune stimulation by ss-ppp-miRNA-21.
[0228] While specific embodiments of the subject matter have been considered, the above specification is illustrative and not limiting. Many variations will be apparent to those skilled in the art upon further examination of this specification and the following claims. The full scope of the invention should be determined by referring to the claims together with the full scope of their equivalents, and the specification together with such variations. In certain embodiments, for example, the following are provided: (Item 1) A method for treating cancer, comprising administering to a subject a therapeutically effective amount of a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the oligonucleotide is complementary to miRNAs highly expressed in the tumor or tumor microenvironment compared to the non-tumor or non-tumor microenvironment. (Item 2) A method for selectively activating RIG-I in a tumor or tumor microenvironment, comprising administering to a subject a therapeutically effective amount of a single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to a miRNA expressed in the tumor or tumor microenvironment, and the RIG-I is selectively activated in the tumor or tumor microenvironment expressing the miRNA.3. (Item 3) The method according to item 1 or 2, wherein the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. (Item 4) The method according to any one of items 1 to 3, wherein the single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotide forms a double helix with the miRNA. (Item 5) The method according to any one of items 1 to 4, wherein the miRNA is an oncogenic miRNA. (Item 6) The method according to any one of items 1 to 4, wherein the miRNA is a tumor-associated miRNA. (Item 7) The method according to any one of items 1 to 6, wherein the double hemisphere is not cleaved by AGO2. (Item 8) The method according to any one of items 1 to 7, wherein the double helix activates RIG-I. (Item 9) The method according to any one of items 2 to 8, wherein RIG-I activation is at least 5%, 10%, 15%, or 20% greater than activation by the corresponding unmodified monophosphate RNA oligonucleotide. (Item 10) The method according to any one of items 2 to 9, wherein the RIG-I activation induces a tumor-specific immune response. (Item 11) The method according to item 10, wherein the tumor-specific immune response includes the release of type I IFN, DAMP (danger-associated molecular pattern), and / or tumor antigens. (Item 12) The method according to any one of items 1 to 11, for inducing immunological memory against the tumor or tumor microenvironment. (Item 13) The method according to any one of items 1 to 12, wherein the cancer is a solid tumor. (Item 14) The method according to item 13, wherein the solid tumor is selected from the group consisting of sarcoma, carcinoma, and lymphoma. (Item 15) The method according to any one of items 1 to 12, wherein the cancer is a non-solid tumor. (Item 16) The method according to item 15, wherein the non-solid tumor is selected from the group consisting of leukemia, myeloma, and lymphoma. (Item 17) The method according to any one of items 1 to 13, wherein the cancer is selected from the group consisting of bladder cancer, blood cancer, bone cancer, brain cancer, breast cancer, colon cancer, cervical cancer, kidney cancer, esophageal cancer, liver cancer, lung cancer, thyroid cancer, skin cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, stomach cancer, uterine cancer, glioblastoma, or head and neck cancer. Item 16. The method according to any one of items 1 to 15, wherein the modified RNA oligonucleotide contains no other modifications. (Item 18) The method according to any one of items 1 to 17, wherein the modified RNA oligonucleotide comprises at least two different modified RNA oligonucleotides. (Item 19) The method according to any one of items 1 to 17, wherein the modified RNA oligonucleotide comprises at least three different modified RNA oligonucleotides. (Item 20) The method according to any one of items 1 to 17, wherein the modified RNA oligonucleotide comprises at least four different modified RNA oligonucleotides. (Item 21) The method according to any one of items 1 to 17, wherein the modified RNA oligonucleotide comprises at least five different modified RNA oligonucleotides. (Item 22) The method according to any one of items 1 to 17, wherein the modified RNA oligonucleotide comprises up to 40 different modified RNA oligonucleotides. (Item 23) The method according to any one of items 1 to 22, wherein the modified RNA oligonucleotide further comprises a 2'-fluoro(2'-F) ribose modification. (Item 24) The method according to item 23, wherein the 2'-F ribose modification is located at the 10th or 11th nucleotide from the 5' end of the modified RNA oligonucleotide. (Item 25) The method according to any one of items 1 to 24, wherein the modified RNA oligonucleotide does not contain a 2'-O-methyl(2'-OMe) ribose modification. (Item 26) The method according to any one of items 1 to 25, wherein the modified RNA oligonucleotide does not contain N-6-methyladenosine (m6A) modification. (Item 27) The method according to any one of items 1 to 26, wherein the modified RNA oligonucleotide does not contain pseudouridine (Ψ). (Item 28) The method according to any one of items 1 to 27, wherein the modified RNA oligonucleotide does not contain N-1-methylpseudridine (mΨ) modification. (Item 29) The method according to any one of items 1 to 28, wherein the modified RNA oligonucleotide does not contain 5-methylcytidine (5mC) modification. (Item 30) The method according to any one of items 1 to 29, wherein the modified RNA oligonucleotide does not contain 5-hydroxymethylcytidine (5hmC) modification. (Item 31) The method according to any one of items 1 to 30, wherein the modified RNA oligonucleotide does not contain 5-methoxycytidine (5moC) modification. (Item 32) The method according to any one of items 1 to 31, wherein the modified RNA oligonucleotide comprises a sequence having a length of at least 19 nucleotides. (Item 33) The method according to any one of items 1 to 31, wherein the modified RNA oligonucleotide comprises a sequence having a length of 15 to 30 nucleotides. (Item 34) The method according to any one of items 1 to 31, wherein the modified RNA oligonucleotide comprises a sequence having a length of 16 to 27 nucleotides. (Item 35) The method according to any one of items 1 to 34, wherein the modified RNA oligonucleotide is completely complementary to the miRNA. (Item 36) The method according to any one of items 1 to 35, wherein the modified RNA oligonucleotide competes with endogenous mRNA to bind to the miRNA. (Item 37) The method according to any one of items 1 to 35, wherein the double helix contains 0 to 5 mismatched base pairs. (Item 38) The method according to any one of items 1 to 37, comprising administering a modified RNA oligonucleotide having the nucleic acid sequence of SEQ ID NO: 6. (Item 39) The method described in item 38, wherein the nucleic acid of sequence number 6 is complementary to miR-21. (Item 40) The method according to item 38 or 39, wherein the cancer is selected from the group consisting of cancers of the breast, ovaries, cervix, colon, lung, liver, brain, esophagus, prostate, pancreas, and thyroid. (Item 41) The method according to any one of items 1 to 37, comprising administering a modified RNA oligonucleotide having the nucleic acid sequence of SEQ ID NO: 1. (Item 42) The method described in item 41, wherein the nucleic acid of sequence number 1 is complementary to miR-10b. (Item 43) The method according to item 41 or 42, wherein the cancer is non-small cell lung cancer or cervical cancer. (Item 44) The method described in item 43, wherein the cancer is metastatic cancer. (Item 45) The method according to any one of items 41 to 44, wherein cytosine and uracil are present at the AGO2 cleavage site. (Item 46) The method according to item 45, wherein the metastatic cancer is localized in the breast, lymph nodes, lungs, bones, brain, liver, ovaries, peritoneum, muscle tissue, pancreas, prostate, esophagus, colon, rectum, stomach, nasopharynx, or skin. (Item 47) The method according to any one of items 1 to 46, wherein the treatment using the modified RNA oligonucleotide is monotherapy. (Item 48) The method according to any one of items 1 to 47, wherein the modified RNA oligonucleotide is administered by intravenous, subcutaneous, intra-arterial, intramuscular, intraperitoneal, or local administration. (Item 49) The method according to any one of items 1 to 48, wherein the modified RNA oligonucleotide is administered in a dose of approximately 0.2 mg / kg to approximately 200 mg / kg. (Item 50) The method according to any one of items 1 to 48, wherein the modified RNA oligonucleotide is administered in a dose of approximately 0.2 mg / kg to approximately 2.0 mg / kg. (Item 51) The method according to any one of items 1 to 48, wherein the modified RNA oligonucleotide is administered in a dose of approximately 1.0 mg / kg to approximately 10.0 mg / kg. (Item 52) A method for treating cancer, and for the subject, Ferric chloride, ferrous chloride, or a combination thereof; Dextran coating; and Single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotides The procedure involves administering a therapeutically effective amount of magnetic nanoparticles containing, A method wherein the oligonucleotide is complementary to miRNAs that are highly expressed in a tumor or tumor microenvironment compared to a non-tumor or non-tumor microenvironment. (Item 53) The method according to item 52, wherein the magnetic nanoparticles have a nonlinearity index in the range of about 6 to about 40. (Item 54) The method according to item 52 or 53, wherein the magnetic nanoparticles have a nonlinearity index in the range of about 8 to about 14. (Item 55) The method according to any one of items 52 to 54, wherein the magnetic nanoparticles comprise about 0.54 g of ferric chloride and about 0.2 g of ferrous chloride. (Item 56) The method according to any one of items 52 to 55, wherein the magnetic nanoparticles comprise at least two different modified RNA oligonucleotides. (Item 57) The method according to any one of items 52 to 55, wherein the magnetic nanoparticles comprise at least three different modified RNA oligonucleotides. (Item 58) The method according to any one of items 52 to 55, wherein the magnetic nanoparticles comprise at least four different modified RNA oligonucleotides. (Item 59) The method according to any one of items 52 to 55, wherein the magnetic nanoparticles comprise at least five different modified RNA oligonucleotides. (Item 60) The method according to any one of items 52 to 55, wherein the magnetic nanoparticles comprise up to 40 different modified RNA oligonucleotides. (Item 61) The method according to any one of items 52 to 60, wherein the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. (Item 62) The method according to any one of items 52 to 61, wherein the miRNA is an oncogenic miRNA. (Item 63) The method according to any one of items 52 to 61, wherein the miRNA is a tumor-associated miRNA. (Item 64) The method according to any one of items 1 to 63, further comprising administering supportive or adjuvant therapy. (Item 65) The method according to item 64, wherein the adjunctive therapy includes radiotherapy, cryotherapy, and ultrasound therapy. (Item 66) The method according to item 64 or 65, including administering additional therapeutic agents. (Item 67) The method according to any one of items 64 to 66, wherein the additional therapeutic agent comprises miRNA. (Item 68) The method according to any one of items 64 to 66, wherein the miRNA described in item 67 is complementary to the modified RNA oligonucleotide. (Item 69) The method according to item 66, wherein the additional therapeutic agent is selected from the group consisting of targeted therapies, chemotherapeutic agents, immunotherapeutic agents, immunogenic cell death inducers (ICDi), and siRNA therapies. (Item 70) The method described in item 69, further including surgical procedures. (Item 71) The method according to item 69, wherein the chemotherapeutic agent is selected from the group consisting of cyclophosphamide, mechloretamine, chlorambucil, melphalan, daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, barrubicin, paclitaxel, docetaxel, etoposide, teniposide, tafluposide, azacitidine, azathioprine, capecitabine, cytarabine, doxifluridine, fluorouracil, gemcitabine, mercaptopurine, methotrexate, thioguanine, bleomycin, carboplatin, cisplatin, oxaliplatin, all-trans retinoic acid, vinblastine, vincristine, vindesine, vinorelbine, and bevacizumab. (Item 72) The targeted therapies mentioned above include trastuzumab, giotrif, proleukin, alectinib, campas, atezolizumab, avelumab, axitinib, belimumab, bellinostat, bevacizumab, velcade, canakinumab, ceritinib, cetuximab, crizotinib, dabrafenib, daratumumab, dasatinib, denosumab, elotuzumab, and enasideni. The method according to item 69, selected from the group consisting of erlotinib, gefitinib, ibrutinib, zyderig, imatinib, lenvatinib, midostaurin, necitumumab, niraparib, obinutuzumab, osimertinib, panitumumab, regorafenib, rituximab, ruxolitinib, sorafenib, tocilizumab, and trastuzumab. (Item 73) The method according to item 69, wherein the immunotherapy agent is an immune checkpoint inhibitor. (Item 74) The method according to item 73, wherein the immune checkpoint inhibitor is selected from the group consisting of pembrolizumab (Keytruda®), nivolumab (Opdivo®), atezolizumab (Tecentriq®), ipilimumab (Yervoy®), avelumab (Bavencio®), and durvalumab (Imfinzi®). (Item 75) The method according to any one of items 64 to 74, wherein the adjunctive therapy induces the expression of the miRNA. (Item 76) The method according to any one of items 66 to 73, wherein the additional therapeutic agent induces the expression of the miRNA. (Item 77) The method according to item 73, wherein the ICDi is selected from the group consisting of daunorubicin, docetaxel, doxorubicin, mitoxantrone, oxaliplatin, and paclitaxel. (Item 78) The method according to item 73, wherein the siRNA therapy targets PD-L1, CTLA-4, TGF-β, and / or VEGF. (Item 79) The method according to any one of items 64 to 78, wherein the supportive or adjuvant therapy is administered before, simultaneously with, or after the administration of the modified RNA oligonucleotide. (Item 80) Single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotides that are complementary to miRNAs highly expressed in tumor tissue compared to non-tumor tissue. (Item 81) The modified RNA oligonucleotide described in item 80, wherein the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. (Item 82) A modified RNA oligonucleotide as described in item 80 or 81, which can form a double helix with the miRNA. (Item 83) A modified RNA oligonucleotide according to any one of items 80 to 82, wherein the double hemisphere is not cleaved by AGO2. (Item 84) A modified RNA oligonucleotide according to any one of items 80 to 83, wherein the double helix activates RIG-I. (Item 85) The modified RNA oligonucleotide described in item 84, wherein the RIG-I activation is at least 5%, 10%, 15%, or 20% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. (Item 86) The modified RNA oligonucleotide described in item 84 or 85, wherein the RIG-I activation elicits a tumor-specific immune response. (Item 87) The modified RNA oligonucleotide described in item 86, wherein the tumor-specific immune response includes the release of type I IFN, DAMP (danger-associated molecular pattern), and / or tumor antigen. (Item 88) A modified RNA oligonucleotide as described in any one of items 80 to 87, without any other modifications. (Item 89) A modified RNA oligonucleotide as described in any one of items 80 to 88, further comprising a 2'-fluoro(2'-F) ribose modification. (Item 90) Modified RNA oligonucleotides as described in any one of items 80 to 89, which do not contain 2'-O-methyl(2'-OMe) ribose modification. (Item 91) Modified RNA oligonucleotides described in any one of items 80 to 90, which do not contain N-6-methyladenosine (m6A) modification. (Item 92) A modified RNA oligonucleotide, free from pseudouridine (Ψ), as described in any one of items 80 to 91. (Item 93) Modified RNA oligonucleotides described in any one of items 80 to 92, which do not contain N-1-methylpseuduridine (mΨ) modification. (Item 94) Modified RNA oligonucleotides as described in any one of items 80 to 92, which do not contain 5-methylcytidine (5mC) modification. (Item 95) Modified RNA oligonucleotides as described in any one of items 80 to 94, which do not contain 5-hydroxymethylcytidine (5hmC) modification. (Item 96) Modified RNA oligonucleotides as described in any one of items 80 to 95, which do not contain 5-methoxycytidine (5moC) modification. (Item 97) A modified RNA oligonucleotide, as described in any one of items 80 to 96, which is completely complementary to the aforementioned miRNA. (Item 98) A modified RNA oligonucleotide according to any one of items 80 to 97, which competes with endogenous mRNA to bind to the miRNA. (Item 99) The modified RNA oligonucleotide described in any one of items 82 to 98, wherein the double helix contains 0 to 5 mismatched base pairs. (Item 100) A modified RNA oligonucleotide, as described in any one of items 80 to 99, containing one nucleic acid sequence from sequence numbers 1 to 13. (Item 101) Modified RNA oligonucleotides, further linked to the nanoparticles, as described in any one of items 80 to 100. (Item 102) The modified RNA oligonucleotide described in item 101, wherein the nanoparticles are magnetic nanoparticles. (Item 103) The modified RNA oligonucleotide described in item 102, wherein the magnetic nanoparticles are coated with a polymer coating. (Item 104) The modified RNA oligonucleotide described in item 103, wherein the polymer coating is dextran. (Item 105) The modified RNA oligonucleotide according to any one of items 102 to 104, wherein the magnetic nanoparticles comprise an iron oxide and a dextran coating functionalized with one or more amine groups, the number of the one or more amine groups ranging from about 5 to about 1000. (Item 106) A modified RNA oligonucleotide according to any one of items 102 to 105, wherein the iron content of the magnetic nanoparticles comprises approximately 50 wt to approximately 100 wt of iron(III) and approximately 0 wt to approximately 50 wt of iron(II). (Item 107) The magnetic nanoparticles contain approximately 5 to approximately 150 amino groups, and the modified RNA oligonucleotide is as described in any one of items 102 to 106. (Item 108) A modified RNA oligonucleotide as described in any one of items 102 to 107, wherein the magnetic nanoparticle comprises one or more such modified RNA oligonucleotides. (Item 109) Ferric chloride, ferrous chloride, or a combination thereof; Dextran coating; and Single-stranded 5' uncapped triphosphate or diphosphate-modified RNA oligonucleotides Magnetic nanoparticles comprising the alkyl group wherein the alkyl group is complementary to miRNAs that are highly expressed in tumors or tumor microenvironments compared to non-tumor or non-tumor microenvironments. (Item 110) Magnetic nanoparticles as described in item 109, having a nonlinearity index in the range of approximately 6 to approximately 40. (Item 111) Magnetic nanoparticles as described in item 109 or 110, having a nonlinearity index in the range of approximately 8 to approximately 14. (Item 112) Magnetic nanoparticles as described in any one of items 109 to 111, comprising approximately 0.54 g of ferric chloride and approximately 0.2 g of ferrous chloride. (Item 113) Magnetic nanoparticles according to any one of items 109 to 112, wherein the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. (Item 114) Magnetic nanoparticles according to any one of items 109 to 113, wherein the miRNA is a carcinogenic miRNA. (Item 115) Magnetic nanoparticles according to any one of items 109 to 113, wherein the miRNA is a tumor-associated miRNA. (Item 116) Magnetic nanoparticles according to any one of items 109 to 115, comprising two or more modified RNA oligonucleotides. (Item 117) The magnetic nanoparticles described in item 116, wherein the two or more modified RNA oligonucleotides are complementary to different miRNAs. (Item 118) The magnetic nanoparticles described in item 116, wherein the two or more modified RNA oligonucleotides are complementary to the same miRNA. (Item 119) A pharmaceutical composition comprising a modified RNA oligonucleotide as described in any one of items 80 to 108 or magnetic nanoparticles as described in any one of items 109 to 118. (Item 120) The pharmaceutical composition according to item 119, further comprising a delivery agent. (Item 121) The pharmaceutical composition according to item 120, wherein the delivery agent is selected from the group consisting of micelles, lipid nanoparticles (LNPs), globular nucleic acids (SNAs), extracellular vesicles, synthetic vesicles, exosomes, lipidoids, liposomes, and lipoplexes. (Item 122) The pharmaceutical composition according to item 121, wherein the liposomes are formed from a lipid bilayer. (Item 123) The pharmaceutical composition according to item 122, wherein the lipid bilayer comprises one or more phospholipids selected from the group consisting of phospholipids, phosphoglycerol lipids, phosphocholine lipids, and phosphoethanolamine lipids. (Item 124) The pharmaceutical composition according to item 123, wherein the phospholipid is PEGylated. (Item 125) The pharmaceutical composition according to item 121, wherein the delivery agent is a liposome or lipid nanoparticles. (Item 126) The pharmaceutical composition according to item 125, wherein the liposomes or lipid nanoparticles further deliver additional therapeutic agents. (Item 127) The pharmaceutical composition according to item 126, wherein the additional therapeutic agent is an ICDi (e.g., daunorubicin, docetaxel, doxorubicin, mitoxantrone, oxaliplatin, and paclitaxel). (Item 128) The pharmaceutical composition according to item 126, wherein the additional therapeutic agent is siRNA (for example, siRNA targeting cancer-related genes). (Item 129) The pharmaceutical composition according to item 126, wherein the additional therapeutic agent is a chemotherapeutic agent. (Item 130) A pharmaceutical composition according to any one of items 119 to 129, comprising at least one additional modified RNA oligonucleotide. (Item 131) A pharmaceutical composition according to any one of items 119 to 130, wherein the modified RNA oligonucleotide is administered in a dose of approximately 0.2 mg / kg to approximately 200 mg / kg. (Item 132) A pharmaceutical composition according to any one of items 119 to 130, wherein the modified RNA oligonucleotide is administered in a dose of approximately 0.2 mg / kg to approximately 2.0 mg / kg. (Item 133) A pharmaceutical composition according to any one of items 119 to 130, wherein the modified RNA oligonucleotide is administered in a dose of approximately 1.0 mg / kg to approximately 10.0 mg / kg.
Claims
1. A composition for treating cancer in a subject, wherein the composition comprises a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide, and the modified RNA oligonucleotide comprises the nucleic acid sequence of SEQ ID NO:
6.
2. The composition according to claim 1, wherein RIG-I is selectively activated in a tumor or tumor microenvironment expressing miR21.
3. The composition according to claim 1, wherein the cancer is selected from the group consisting of cancers of the breast, ovary, cervix, colon, lung, liver, brain, esophagus, prostate, pancreas, and thyroid.
4. The composition according to claim 3, wherein the cancer is non-small cell lung cancer or cervical cancer.
5. A composition for treating cancer in a subject, wherein the composition comprises magnetic nanoparticles, and the magnetic nanoparticles are Iron oxide; Dextran coating; and It contains a single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide, A composition wherein the oligonucleotide comprises the nucleic acid sequence of SEQ ID NO:
6.
6. A single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide comprising the nucleic acid sequence of Sequence ID No.
6.
7. The modified RNA oligonucleotide according to claim 6, which can form a double helix with miR21.
8. A modified RNA oligonucleotide according to claim 6 or 7, further linked to a nanoparticle.
9. The modified RNA oligonucleotide according to claim 8, wherein the nanoparticles are magnetic nanoparticles.
10. The modified RNA oligonucleotide according to claim 9, wherein the magnetic nanoparticles are coated with a polymer coating.
11. The modified RNA oligonucleotide according to claim 10, wherein the polymer coating is dextran.
12. The modified RNA oligonucleotide according to any one of claims 9 to 11, wherein the magnetic nanoparticles comprise iron oxide and a dextran coating functionalized with one or more amine groups, the number of the one or more amine groups being in the range of 5 to 1000.
13. Iron oxide; Dextran coating; and Single-stranded 5' uncapped triphosphate-modified RNA oligonucleotide Magnetic nanoparticles comprising the oligonucleotide, wherein the oligonucleotide comprises the nucleic acid sequence of SEQ ID NO:
6.
14. A pharmaceutical composition comprising a modified RNA oligonucleotide according to any one of claims 6 to 12 or magnetic nanoparticles according to claim 13.
15. The pharmaceutical composition according to claim 14, further comprising a delivery agent selected from the group consisting of micelles, lipid nanoparticles (LNPs), globular nucleic acids (SNAs), extracellular vesicles, synthetic vesicles, exosomes, lipidoids, liposomes, and lipoplexes.