Therapeutic agent for ischemic disease

JPWO2023008555A5Pending Publication Date: 2025-06-24
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023538637
Authority / Receiving Office
JP · JP
Patent Type
Applications
Priority Date
2022-07-29
Filing Date
2022-07-29
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

Current treatments for ischemic diseases, such as cerebral infarction, are inadequate in addressing sterile inflammation caused by the release of damage-associated molecular patterns (DAMPs), leading to insufficient removal of dead cell debris and persistent inflammation, which worsens the prognosis.

Method used

The use of Apoptosis Inhibitor of Macrophage (AIM) or its fragments, which bind to DAMPs like PRDX1, HMGB1, and S100 proteins, neutralizing their biological activity, promoting their uptake by microglia and macrophages, thereby reducing sterile inflammation and enhancing phagocytic removal of dead cell debris.

Benefits of technology

AIM effectively suppresses sterile inflammation and improves the prognosis of ischemic diseases by efficiently removing dead cell debris and DAMPs from the infarcted area, reducing inflammation and improving survival rates and neurological outcomes.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention provides a therapeutic agent for ischemic diseases, the therapeutic agent comprising an apoptosis inhibitor of macrophage (AIM), an AIM fragment having a biological activity of the AIM, or a nucleic acid encoding the AIM or the AIM fragment.
Need to check novelty before this filing date? Find Prior Art

Description

Treatment for ischemic diseases

[0001] The present invention relates to a therapeutic agent for ischemic disease, and more particularly to a therapeutic agent for ischemic disease, which comprises an apoptosis inhibitor of macrophage (AIM).

[0002] Inadequate clearance of dead cells and their debris results in the release of intracellular inflammatory substances, so-called damage-associated molecular patterns (DAMPs). DAMPs are normally endogenous intracellular proteins and therefore hidden from recognition by the immune system. However, once released into the extracellular environment, they bind to pattern recognition receptors, including Toll-like receptors (TLRs) and receptors for advanced glycation end products (ADPs), primarily on immune cells, primarily macrophages, and induce the production of proinflammatory cytokines and activate innate immunity in the absence of microorganisms. This process, called sterile inflammation, frequently occurs in ischemia-reperfusion injury (IRI), trauma, or chemically induced injury (Non-Patent Document 1).

[0003] Ischemic stroke, one of the most common causes of severe disability and death worldwide, is a typical example of sterile inflammation and is now characterized as a significant complication of COVID-19 (Non-Patent Documents 2-5). There is widespread consensus that the prognosis of ischemic stroke is significantly influenced by the state of sterile inflammation in the affected brain after infarction. Because currently available treatments, such as thrombolysis and thrombectomy, do not necessarily significantly improve the prognosis of infarcted patients, post-stroke sterile inflammation has recently attracted increasing attention as a therapeutic target (Non-Patent Documents 5-7). Recent studies have shown that among various types of DAMPs, peroxiredoxin (PRDX; particularly PRDX1), high-mobility-group box 1 (HMGB1), and S100 calcium-binding proteins (S100) are significantly involved in post-infarction sterile inflammation (Non-Patent Document 8). Recently, it has been reported that during the repair process, DAMPs are taken up and removed by microglia and macrophages infiltrating the infarcted area through macrophage scavenger receptor 1 (the expression of which is regulated by MAF bZIP transcription factor B (MafB)) (Non-Patent Document 9). However, no treatment for cerebral infarction based on the removal of DAMPs has been established.

[0004] Apoptosis inhibitor of macrophage (AIM, also known as CD5 antigen-like (CD5L)) is a blood protein produced by tissue macrophages and was first identified by the present inventors as a substance that supports macrophage survival. AIM is now recognized as a molecule that induces repair processes in many diseases (Non-Patent Documents 10-12). AIM consists of three cysteine-rich domains (called SRCR domains). The third SRCR domain at the carboxy terminus contains a unique cluster of positively charged amino acids. This cluster forms a charge-based interaction with dead cells, whose surfaces are highly negatively charged due to the exposure of high levels of phosphatidylserine (Non-Patent Documents 10 and 11). AIM is efficiently internalized by phagocytes via multiple scavenger receptors, and this binding strongly enhances the phagocytosis of dead cells by phagocytes (Non-Patent Document 12). The present inventors investigated the role of AIM in the repair process of ischemic cerebral infarction, whose pathophysiology is mainly characterized by partial necrosis of brain neurons due to transient ischemia and sterile inflammation caused by DAMPs released from necrotic cells, and investigated its therapeutic role.

[0005] Zindel, J. and Kubes, P. (2020). DAMPs, PAMPs, and LAMPs in Immunity and Sterile Inflammation. Annu. Rev. Pathol. 15, 493-518.Trejo-Gabriel-Galan, J.M. (2020). Stroke as a complication and prognostic factor of COVID-19. Neurologia 35, 318-322.Oxley, T.J., Mocco, J., Majidi, S., Kellner, C.P., Shoirah, H., Singh, I.P., De Leacy, R.A., Shigematsu, T., Ladner, T.R., Yaeger, K.A. et al. (2020). Large-Vessel Stroke as a Presenting Feature of Covid-19 in the Young. N. Engl. J. Med. 382, e60 (2020).Tan, Y.K., Goh, C., Leow, A.S.T., Tambyah, P.A., Ang, A., Yap, E.S., Tu, T.M., Sharma, V.K., Yeo, L.L.L., Chan, B.P.L. et al. (2020). COVID-19 and ischemic stroke: a systematic review and meta-summary of the literature. J. Thromb. Thrombolysis 50, 587-595.Gulke, E., Gelderblom, M. and Magnus, T. (2018). Danger signals in stroke and their role on microglia activation after ischemia. Ther Adv. Neurol. Disord. 11, 1756286418774254.Chamorro, A., Dirnagl, U., Urra, X. and Planas, A.M. (2016).Neuroprotection in acute stroke: targeting excitotoxicity, oxidative and nitrosativestress, and inflammation. Lancet Neurol. 15, 869-881.Land, W.G. (2020). Use of DAMPs and SAMPs as Therapeutic Targets or Therapeutics: A Note of Caution. Mol. Diagn. Ther. 24, 251-262.Richard, S., Lapierre, V., Girerd , N., Bonnerot, M., Burkhard, P.R., Lagerstedt, L., Bracard, S., Debouverie, M., Turck, N. and Sanchez, J.-C. (2016). Diagnostic performance of peroxiredoxin 1 to determine time-of-onset of acute cerebral infarction. Sci. Rep. 6, 38300.Shichita, S., Ito, M., Morita, R., Komai, K., Noguchi, Y., Ooboshi, H., Koshida, Y., Takahashi, S., Kodama, T. & Yoshimura, A. (2017). MAFB prevents excess inflammation after ischemic stroke by accelerating clearance of damage signals through MSR1. Nat Med. 23, 723-732.Arai, S., Kitada, K., Yamazaki, T., Takai, R., Zhang, X., Tsugawa, Y., Sugisawa, R., Matsumoto, A., Mori, M., Yoshihara, Y., et al. (2016).Apoptosis inhibitor of macrophage protein enhances intraluminal debris clearance and ameliorates acute kidney injury in mice. Nat. Med. 22, 183-193.Tomita, T., Arai, S., Kitada, K., Mizuno, M., Suzuki, Y., Sakata, F., Nakano, D., Hiramoto, E., Takei, Y., Maruyama, S. et al. (2017). Apoptosis inhibitor of macrophage ameliorates fungus-induced peritoneal injury model in mice. Sci. Rep. 7, 6450. Arai, S. and Miyazaki, T. (2018). A scavenging system against internal pathogens promoted by the circulating protein apoptosis inhibitor of macrophage (AIM). Semin. Immunopathol. 40, 567-575.

[0006] An object of the present invention is to provide a novel therapeutic agent and a novel therapeutic method for ischemic diseases such as cerebral infarction.

[0007] As a result of intensive research into the above-mentioned problems, the present inventors have found that (1) AIM binds to various DAMPs (e.g., PRDX1-6, HMGB1, S100A8, S100A8 / 9, S100A9, and HSP70) in two binding modes, (2) the binding of AIM to DAMPs neutralizes the biological activity of DAMPs, (3) the binding of AIM to DAMPs allows DAMPs to be efficiently phagocytosed and removed by microglia and macrophages infiltrating into the infarct lesion, (4) as a result of (2) and (3), AIM suppresses the spread of sterile inflammation, and (5) AIM enhances the phagocytic removal of dead cell debris in the cerebral infarction area and suppresses the spread of sterile inflammation. Based on these findings, further research has led to the completion of the present invention. Specifically, the present invention is as follows.

[0008] [1] A therapeutic agent for ischemic disease, comprising an apoptosis inhibitor of macrophage (AIM), an AIM fragment having the biological activity of AIM, or a nucleic acid encoding the AIM or AIM fragment. [2] The therapeutic agent of [1], wherein the ischemic disease is selected from the group consisting of cerebral infarction, myocardial infarction, limb ischemia, pulmonary infarction, splenic infarction, intestinal infarction, and Buerger's disease. [3] A suppressor of sterile inflammation mediated by damage-associated molecular patterns (DAMPs), comprising an apoptosis inhibitor of macrophage (AIM), an AIM fragment having the biological activity of AIM, or a nucleic acid encoding the AIM or AIM fragment. [4] The suppressor of [3], wherein the DAMPs are at least one selected from the group consisting of PRDX1, PRDX2, PRDX3, PRDX4, PRDX5, PRDX6, HMGB1, S100A8, S100A8 / 9, S100A9, and HSP70. [5] A method for treating an ischemic disease, comprising administering an apoptosis inhibitor of macrophage (AIM), an AIM fragment having the biological activity of AIM, or a nucleic acid encoding the AIM or AIM fragment to a subject suffering from an ischemic disease. [6] The method for treating an ischemic disease according to [5], wherein the ischemic disease is selected from the group consisting of cerebral infarction, myocardial infarction, limb ischemia, pulmonary infarction, splenic infarction, intestinal infarction, and Buerger's disease. [7] A method for suppressing damage-associated molecular patterns (DAMPs)-mediated sterile inflammation, comprising administering an apoptosis inhibitor of macrophage (AIM), an AIM fragment having the biological activity of AIM, or a nucleic acid encoding the AIM or AIM fragment to a subject suffering from DAMPs-mediated sterile inflammation. [8] The method of suppressing described in [7], wherein the DAMPs are at least one selected from the group consisting of PRDX1, PRDX2, PRDX3, PRDX4, PRDX5, PRDX6, HMGB1, S100A8, S100A8 / 9, S100A9, and HSP70.

[0009] According to the present invention, it is possible to efficiently remove dead cell debris from the infarcted region of a subject while simultaneously suppressing sterile inflammation, and therefore, it is possible to treat ischemic diseases such as cerebral infarction, myocardial infarction, limb ischemia, pulmonary infarction, splenic infarction, intestinal infarction, and Buerger's disease.

[0010] Figure 1 shows AIM expression in infarcted brains. (A) Quantitative polymerase chain reaction (QPCR) analysis of AIM (cd51) mRNA levels in the brains of wild-type mice on days 1, 3, and 7 after middle cerebral artery occlusion (MCAO) using RNA isolated from whole tissue or cells separated by CD11b (macrophage / myeloid cell marker) expression. L: left lobe, non-infarcted; R: right lobe, infarcted. Values ​​relative to the mRNA levels in whole tissue before MCAO (Pre) are shown. Bars: standard deviation of the mean. Statistics: multi-way ANOVA with Bonferroni's post hoc test. p: *<0.05, **<0.01, ***<0.001 (between values ​​on different days in the left or right lobe); #<0.05, ###<0.001 (between values ​​on the same day in the left and right lobe). n=3. (B) The amount of AIM protein in the brain was analyzed by ELISA using lysates from infarcted (right lobe; R) and non-infarcted (left lobe; L) brains. Values ​​are expressed as μg AIM / mg brain. n = 4. (C) Immunohistochemistry (IHC) analysis of AIM in brain specimens from wild-type mice 7 days after MCAO. The infarcted area, which was negative for microtubule-associated protein 2 (MAP2), was stained for AIM. A portion of the striatum (red square) is shown at further magnification for AIM and MAP2 (third column from the left, red boxed area). The rightmost panel shows serial sections stained for Iba1 and AIM at a higher magnification. Iba1-positive macrophages are strongly positive for AIM. Abbreviations: ctx: cortex, st: striatum, hi: hypothalamus, th: thalamus, mb: mid brain, cb: cerebrum. Bars: 1 mm. The bar in the high-magnification coronal section panel represents 100 mm, and the bar in the rightmost IHC:Iba1 and IHC:AIM panels represents 5 mm. (D) Human brain specimens from the infarcted area were stained for AIM. Control staining using secondary antibody alone is also shown (lower panel). MAP2 was negative throughout the specimen (data not shown).Strong staining for AIM indicates AIM production in macrophages (judging from their morphology; indicated by arrows), which is consistent with the QPCR data shown in (A). Bar: 50 mm. (E) Wild-type and AIM at 7 days after MCAO. - / - Serial frozen sections from the brain were stained for oil-red O and Iba1. In wild-type mice, many Iba1-positive macrophages in the infarcted striatum were positive for oil-red O (red signal), whereas AIM - / - In mice, they were mostly negative for oil-red-O. The bars in the four panels in the left column indicate 1 mm, and the bars in the eight panels in the middle and right columns indicate 100 mm. Figure 2 shows that AIM reduces DAMP levels and suppresses inflammation in the infarct zone, thereby improving post-infarction prognosis. (A) Wild-type (AIM) mice with or without rAIM administration (0.5 mg daily from day 1 after MCAO) on days 3 and 7 after MCAO. + / + ) and AIM - / - Brain specimens from mice were stained for PRDX1, HMGB1, and S100A9, and also stained with hematoxylin to identify nuclei. Representative photographs of PRDX1 (upper panel) and MAP2 (lower panel) stained at 7 days after MCAO are shown. Bar: 500 mm. The number of PRDX1-positive signals (brown signals) within the MAP2-negative region that did not colocalize with the hematoxylin signal was counted, and the area of ​​the MAP2-negative region (mm ) was calculated. 2 ) and normalized. n=3-8. Statistics: multi-way ANOVA with Bonferroni's post hoc test. p: *<0.05; **<0.01 (comparison between AIM administration and no administration). ##<0.01 (AIM + / + vs AIM - / - ) Abbreviations: st:striatum, hi:hypothalamus, th:thalamus. (B) Two moribund and one relatively healthy AIM. - / - 100A9 staining in one mouse and one wild-type mouse on day 3. On day 3, the relatively healthy AIM - / - than mice and wild-type mice,- / - Significantly more intense signals were observed in the mouse brain. Abbreviations: st: striatum, hi: hypothalamus, th: thalamus. MCAO-induced reduction in blood flow in the middle aorta did not differ between the mice tested. Bar: 500 mm. (C) Comparison of wild-type and AIM mice with or without rAIM administration (0.5 mg daily from day 1 after MCAO) on day 4 after MCAO. - / - CD11 isolated from infarcted brain in mice + QPCR analysis of inflammatory cytokine mRNA using macrophages / myeloid cells. CD11 + The relative values ​​to those in cells are shown. n=4-6 for each. Mean ± sem is shown. Statistics: multi-way ANOVA with Bonferroni's post hoc test. *p <0.05. (D) Wild-type and AIM after MCAO. - / - , rAIM (0.5mg) administered AIM - / - Survival of wild-type mice administered rAIM (0.1 mg) or rAIM (0.1 mg). n = 38 (wild-type), 21 (AIM - / - ), 9 (wild type + rAIM administration), 12 (AIM - / - + rAIM administration). rAIM was administered intravenously daily from day 1. Statistical significance of survival for 7 days after MCAO was assessed using the generalized Wilcoxon test. p = 0.0000347 (wild-type mice vs. AIM - / - Mice; 0.0780 (AIM with rAIM administration) - / - Mice vs. AIM without rAIM administration - / - (E) Neurological scores in the four groups of mice in (D). n=17 (wild type), 11 (AIM) - / - ), 9 (wild type + rAIM administration), 6 (AIM - / - +rAIM administration). Mean ± sem is shown. Statistics: multi-way ANOVA with Bonferroni's post hoc test. p: *<0.05; ***<0.001 (wild type vs. AIM - / -), ##<0.01; ###<0.001 (wild type vs. wild type + rAIM administration), §§§<0.001 (AIM - / - vs. AIM - / - + rAIM administration). Figure 3 shows that AIM enhances the phagocytic clearance of DAMPs by binding to DAMPs and inhibits their binding to pattern recognition receptors. (A) In vitro binding assay of AIM to various DAMPs. The binding ability of various concentrations of human or mouse AIM to PRDX1, HMGB1, S100A9, and bovine serum albumin (BSA) (2 μg / mL coated on plates) as a control is shown. Assays were performed in triplicate, and the mean values ​​± SD are shown. Figure 4 shows the results of AIM binding to DAMPs. The binding activity of (B) mouse ΔSRCR3 mutant or (C) wild-type mouse AIM (20 μg / mL each) to PRDX1, HMGB1, and S100A9 in the presence of 150 mM (physiological) or 500 mM (excess) NaCl. Binding was significantly reduced in the presence of excess NaCl. (D) Binding activity of mouse wild-type AIM (20 μg / mL) or (E) mouse 2CS mutant in the presence of 50 μM TCEP to PRDX1, HMGB1, and S100A9. Similar results were obtained with human AIM (data not shown). (F) The binding activity of the recombinant mouse AIM / IgM-Fc pentamer complex to DAMPs was confirmed using the same method as in (A). Binding was reduced. (G) The binding of mouse AIM to DAMPs was dose-dependently attenuated by mouse IgM-Fc pentamer. In (B) to (G), assays were performed in triplicate, and mean values ​​are shown. Statistics: Welch's t-test (B)-(F), one-way ANOVA with Bonferroni's post hoc test, p: *<0.05, **<0.01, ***<0.001 (vs. control). (H) AIM - / -Peritoneal macrophages isolated from mice were challenged with PRDX1, HMGB1, and S100A9 in the presence or absence of rAIM on chamber slides. After 10 minutes of incubation, cells were fixed and stained for each DAMP (green), AIM (red), and nuclei (blue). Analysis was performed under a fluorescent confocal microscope. White areas indicate colocalization of DAMPs and AIM. rAIM adhesion to some dead cells was also observed (yellow arrows). Nonspecific signal (background) from the secondary antibody was observed in HMGB1 staining (orange arrows). (I) The amounts of PRDX1, HMGB1, or S100A9 present on the cell surface and within cells were determined using the software Halo and presented graphically. Values ​​are the means of three experiments (n = 4-13). Statistics: Welch's t-test. p: *<0.05, **<0.01. (J) Induction of PRDX1 aggregation by AIM (wild-type), the ΔSRCR3 mutant, and the 2CS mutant. (K) Binding of PRDX1 and S100A9 to TLR2 and binding of HMGB1 to RAGE in the presence or absence of various concentrations of rAIM. The presence of rAIM dose-dependently reduces the binding ability of PRDX1 and S100A9 to TLR2 and the binding ability of HMGB1 to RAGE. Assays were performed in triplicate, and the mean values ​​are shown. Statistics: One-way ANOVA with Bonferroni's post hoc test. p: *<0.05, **<0.01. (L) RAW264.1 mouse macrophage cells were incubated with mouse PRDX or S100A9 in the presence or absence of rAIM for 30 minutes at 37°C. Cells were then harvested, and cell lysates were analyzed for phosphorylation (indicating NFκB activation) by immunoblotting. The signal intensity was quantified and displayed graphically. Values ​​indicate the intensity of phosphorylated NFκB p65 relative to the intensity of total NFκB p65. The presence of rAIM reduced NFκB phosphorylation. Statistics: two-way ANOVA with Bonferroni's post hoc test. p: *<0.05, ***<0.001. Figure 4 shows that AIM binds to various DAMPs.The figures show the binding ability of various concentrations of human or mouse AIM to PRDXs, S100A8, S100A8 / 9, HSP70, and bovine serum albumin (BSA) (coated on the plate at 2 μg / mL) as a control. Assays were performed in triplicate, and the mean values ​​± SD are shown. Figure 5 shows that rAIM crossed the blood-brain barrier. AIM subjected to MCAO. - / - Mice were administered 0.5 mg of rAIM intravenously on day 3 after MCAO and sacrificed 1 hour after rAIM administration. Sagittal sections of the infarcted brain were stained for AIM (top) and MAP2 (bottom). The MAP2-negative infarct zone stains for AIM. Scale bar: 1 mm.

[0011] The present invention will be described in detail below.

[0012] 1. Therapeutic Agent for Ischemic Disease The present invention provides a therapeutic agent for ischemic disease (hereinafter, sometimes referred to as "the therapeutic agent of the present invention"), which comprises apoptosis inhibitor of macrophage (AIM), an AIM fragment having the biological activity of AIM, or a nucleic acid encoding the AIM or AIM fragment.

[0013] Ischemic diseases are diseases in which organ ischemia occurs due to occlusion or stenosis of the arteries supplying the organ, resulting in necrosis or dysfunction of the tissue due to lack of oxygen or nutrients. Ischemic diseases to be treated with the therapeutic agent of the present invention include, but are not limited to, cerebral infarction, myocardial infarction, limb ischemia, pulmonary infarction, splenic infarction, intestinal infarction, Buerger's disease, etc. In a preferred embodiment, the ischemic disease may be cerebral infarction.

[0014] Cerebral infarction is classified based on the mechanism of onset. Cerebral infarction caused by obstruction of blood flow as a result of progression of arteriosclerosis in relatively large blood vessels in the neck and brain is called "atherothrombotic cerebral infarction." Cerebral infarction caused by blockage of small blood vessels deep in the brain is called "lacunar infarction." Cerebral infarction caused by blockage of blood vessels in the brain as a result of a blood clot formed in the heart being carried to the blood vessels in the brain is called "cardiogenic cerebral embolism." The therapeutic agent of the present invention can be applied to the treatment of any type of cerebral infarction.

[0015] The AIM used in the present invention is a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 (amino acid sequence of human-derived AIM protein). AIM may be, for example, a protein isolated and purified from macrophages, which are immune cells of warm-blooded animals (e.g., humans, mice, rats, rabbits, sheep, pigs, cattle, horses, cats, dogs, monkeys, chimpanzees, birds, etc.). It may also be a protein chemically synthesized or biochemically synthesized using a cell-free translation system, or a recombinant protein produced from a transformant into which a nucleic acid containing a nucleotide sequence encoding the amino acid sequence has been introduced. It may be preferable to match the biological species from which the AIM used in the present invention is derived with the biological species of the subject suffering from the neurodegenerative disease. For example, when the therapeutic agent of the present invention is intended for use in humans, it is preferable to use human AIM.

[0016] Examples of amino acid sequences substantially identical to the amino acid sequence represented by SEQ ID NO: 1 include amino acid sequences that have an identity or similarity of about 60% or more, preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more with the amino acid sequence represented by SEQ ID NO: 1. Here, "identity" refers to the percentage (%) of identical and similar amino acid residues relative to the total number of amino acid residues in the two amino acid sequences aligned in optimal alignment using a mathematical algorithm known in the art (preferably, the algorithm can take into account the introduction of gaps into one or both of the sequences for optimal alignment). Furthermore, "similarity" refers to the percentage (%) of the number of positions containing identical or similar amino acid residues in both aligned amino acid sequences relative to the total number of amino acid residues in the two sequences. "Similar amino acids" refer to amino acids that are similar in physicochemical properties, and include, for example, amino acids classified in the same group, such as aromatic amino acids (Phe, Trp, Tyr), aliphatic amino acids (Ala, Leu, Ile, Val), polar amino acids (Gln, Asn), basic amino acids (Lys, Arg, His), acidic amino acids (Glu, Asp), amino acids with hydroxyl groups (Ser, Thr), and amino acids with small side chains (Gly, Ala, Ser, Thr, Met). Substitution with such similar amino acids is expected to have no effect on the phenotype of the protein (i.e., conservative amino acid substitutions). Specific examples of conservative amino acid substitutions are well known in the art and have been described in various publications (see, for example, Bowie et al., Science, 247: 1306-1310 (1990)).

[0017] The identity or similarity of amino acid sequences herein can be calculated using the identity or similarity calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under the following conditions (expectation value = 10; gaps allowed; matrix = BLOSUM62; filtering = OFF). Other algorithms for determining identity or similarity of amino acid sequences include, for example, the algorithm described in Karlin et al., Proc. Natl. Acad. Sci. USA, 90:5873-5877 (1993) [this algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) (Altschul et al., Nucleic Acids Res., 25:3389-3402 (1997))], the algorithm described in Needleman et al., J. Mol. Biol., 48:444-453 (1970) [this algorithm is incorporated into the GAP program in the GCG software package], the algorithm described in Myers and Miller, CABIOS, 4:11-17 (1988) [this algorithm is incorporated into the ALIGN program (version 2.0), which is part of the CGC sequence alignment software package], and the algorithm described in Pearson et al., Proc. Natl. Acad. Sci. USA, 85:2444-2448 (1988) [this algorithm is incorporated into the FASTA program in the GCG software package], and the like can also be preferably used. More preferably, an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1 is an amino acid sequence that has an identity of about 60% or more, preferably about 70% or more, even more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more with the amino acid sequence represented by SEQ ID NO: 1.

[0018] Examples of proteins comprising substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 include proteins comprising substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 and having substantially the same biological activity as that of wild-type AIM. The biological activities of wild-type AIM include, for example, endocytosis activity in macrophages (including microglia), macrophage apoptosis inhibitory activity, arteriosclerosis maintenance / promotion activity, adipocyte differentiation inhibitory activity, adipocyte lipid droplet dissolving activity, adipocyte reduction activity, CD36 binding activity, adipocyte endocytosis activity, FAS binding activity, FAS function inhibitory activity, anti-obesity activity, prophylactic or therapeutic activity for liver disease (fatty liver, NASH, cirrhosis, liver cancer), prophylactic or therapeutic activity for kidney disease (acute renal failure, chronic nephritis, chronic renal failure, nephrotic syndrome, diabetic nephropathy, nephrosclerosis, IgA nephropathy, hypertensive nephropathy, nephropathy associated with collagen disease or IgM nephropathy), etc. However, in the present invention, endocytosis activity in macrophages can be a particularly preferred indicator. This activity can be confirmed using an in vitro macrophage (or microglia) phagocytosis test, as described in detail in the Examples of this application, but is not limited thereto. Furthermore, as used herein, "substantially the same" means that the activities are qualitatively the same (e.g., physiologically or pharmacologically). Therefore, it is preferable that the activities are equivalent, but the degree of these activities (e.g., about 0.1 to about 10 times, preferably about 0.5 to about 2 times) and quantitative factors such as the molecular weight of the protein may differ. The activity can be measured according to a method known per se.

[0019] Furthermore, the AIM used in the present invention includes, for example, (1) an amino acid sequence in which one or two or more amino acids (preferably about 1 to 100, preferably about 1 to 50, more preferably about 1 to 10, particularly preferably one to several (2, 3, 4, or 5)) have been deleted from the amino acid sequence represented by SEQ ID NO: 1; (2) an amino acid sequence in which one or two or more amino acids (preferably about 1 to 100, preferably about 1 to 50, more preferably about 1 to 10, particularly preferably one to several (2, 3, 4, or 5)) have been added to the amino acid sequence represented by SEQ ID NO: 1; (3) an amino acid sequence in which one or two or more (preferably about 1 to 50, preferably about 1 to 10, more preferably one to several (2, 3, 4, or 5)) amino acids have been inserted into the amino acid sequence represented by SEQ ID NO: 1; (4) an amino acid sequence in which one or two or more (preferably about 1 to 50, preferably about 1 to 10, more preferably one to several (2, 3, 4, or 5)) amino acids in the amino acid sequence represented by SEQ ID NO: 1 have been substituted with other amino acids; or (5) a protein containing an amino acid sequence that is a combination thereof. When an amino acid sequence has been inserted, deleted, or substituted as described above, the position of the insertion, deletion, or substitution is not particularly limited, as long as the desired biological activity of the protein (e.g., endocytosis activity in macrophages (including microglia)) is maintained.

[0020] The AIM of the present invention is preferably a human AIM protein having the amino acid sequence represented by SEQ ID NO: 1 (GenBank accession number: AAD01446) or its homologue in other mammals [e.g., the mouse homologue registered in GenBank under accession number: AAD01445], and more preferably a human AIM protein consisting of the amino acid sequence represented by SEQ ID NO: 1.

[0021] In this specification, proteins and peptides are described in accordance with the convention of peptide notation, with the N-terminus (amino terminus) at the left end and the C-terminus (carboxyl terminus) at the right end. The AIM used in the present invention, including a protein comprising the amino acid sequence represented by SEQ ID NO: 1, may have a C-terminus that is any of a carboxyl group (-COOH), a carboxylate (-COO-), an amide (-CONH2), or an ester (-COOR). Here, R in the ester may be, for example, a C-terminus such as methyl, ethyl, n-propyl, isopropyl, or n-butyl. 1-6 Alkyl groups; for example, C groups such as cyclopentyl and cyclohexyl 3-8 Cycloalkyl groups such as phenyl, α-naphthyl, etc. 6-12 Aryl groups, such as phenyl-C such as benzyl and phenethyl 1-2 Alkyl group: α-naphthyl-C such as α-naphthylmethyl 1-2 C such as alkyl group 7-14 Aralkyl groups, pivaloyloxymethyl groups, etc. are used.

[0022] When the AIM used in the present invention has a carboxyl group (or carboxylate) other than at the C-terminus, the protein of the present invention also includes those in which the carboxyl group is amidated or esterified. In this case, the ester used may be, for example, the C-terminal ester described above.

[0023] Furthermore, the AIM used in the present invention has a protecting group (e.g., a C group such as a formyl group or an acetyl group) for protecting the amino group of the N-terminal amino acid residue. 1-6 C such as alkanoyl 1-6 those in which the N-terminal glutamine residue that can be generated by cleavage in vivo is pyroglutamated; those in which the substituents on the side chains of amino acids in the molecule (e.g., -OH, -SH, amino group, imidazole group, indole group, guanidino group, etc.) are protected by an appropriate protecting group (e.g., C group such as formyl group, acetyl group, etc.); 1-6 C such as alkanoyl group 1-6 These include those protected by an acyl group or other suitable glycan, or conjugated proteins such as glycoproteins to which sugar chains are attached.

[0024] As used herein, the term "AIM" refers not only to wild-type AIM but also to variants thereof having substantially the same or improved biological activity as that of wild-type AIM. Here, "substantially the same activity" has the same meaning as above. Furthermore, the measurement of "substantially the same activity" can be carried out in the same manner as in the case of AIM.

[0025] Examples of AIM variants include, but are not limited to, the following. The mutant human AIM of the present invention preferably comprises any one of the following amino acid sequences (1b) to (5b): (1b) an amino acid sequence in which the cysteine ​​at amino acid number 191 in the amino acid sequence represented by SEQ ID NO: 1 is substituted with serine. (2b) an amino acid sequence in which the cysteine ​​at amino acid number 300 in the amino acid sequence represented by SEQ ID NO: 1 is substituted with serine. (3b) an amino acid sequence in which the cysteine ​​at amino acid number 191 in the amino acid sequence represented by SEQ ID NO: 1 is substituted with serine and the cysteine ​​at amino acid number 300 in the amino acid sequence represented by SEQ ID NO: 1 is substituted with serine. (4b) an amino acid sequence that is substantially identical to any one of the amino acid sequences (1b) to (3b), in which the cysteine ​​and the substituted serine present in any one of the amino acid sequences (1b) to (3b) are retained. (5b) An amino acid sequence comprising one or more amino acid deletions, additions, insertions, or substitutions, or a combination thereof, at positions other than the cysteine ​​and the substituted serine present in any one of the amino acid sequences (1b) to (3b). Variants of AIM having equivalent or improved functions to wild-type recombinant AIM may be those disclosed in Japanese Patent Application No. 2017-220733, etc.

[0026] Furthermore, as a component of the therapeutic agent of the present invention, not only AIM but also an AIM fragment having the biological activity of AIM can be used. Whether or not an AIM fragment has the biological activity of wild-type AIM can be determined by the method described above.

[0027] For example, because the intact AIM protein contains three cysteine-rich scavenger-receptor cysteine-rich (SRCR) domains, each of the SRCR domains can be used as an example of an AIM fragment having substantially the same biological activity as that of wild-type AIM. More specifically, for example, of the amino acid sequence represented by SEQ ID NO: 1, partial amino acid sequences containing the SRCR1 domain (amino acid numbers 24 to 125 in the amino acid sequence represented by SEQ ID NO: 1), the SRCR2 domain (amino acid numbers 138 to 239 in the amino acid sequence represented by SEQ ID NO: 1), or the SRCR3 domain (amino acid numbers 244 to 346 in the amino acid sequence represented by SEQ ID NO: 1) or partial amino acid sequences containing any combination of the SRCR domains can be used as AIM fragments. The size of an AIM fragment having substantially the same biological activity as that of wild-type AIM is not particularly limited as long as it contains the above-mentioned functional domain, but examples thereof include those containing preferably a partial amino acid sequence of 50 or more, more preferably a partial amino acid sequence of 100 or more, and even more preferably a partial amino acid sequence of 200 or more. The partial amino acid sequence may be a single contiguous partial amino acid sequence, or may be a combination of multiple discontinuous partial amino acid sequences.

[0028] The AIM fragment used in the present invention has a C-terminus that is a carboxyl group (-COOH), a carboxylate (-COO - ), amide (-CONH2), or ester (-COOR). Here, examples of R in the ester include those similar to those described above for AIM. When the partial peptide of the present invention has a carboxyl group (or carboxylate) other than at the C-terminus, the partial peptide of the present invention also includes those in which the carboxyl group is amidated or esterified. In this case, for example, the same ester as the C-terminal ester is used.

[0029] Furthermore, the AIM fragments used in the present invention also include, like the AIM described above, those in which the amino group of the N-terminal amino acid residue is protected with a protecting group, those in which the N-terminal glutamine residue is pyroglutamated, those in which substituents on the side chains of amino acids in the molecule are protected with appropriate protecting groups, and conjugated peptides such as so-called glycopeptides to which sugar chains are bound.

[0030] The AIM (including AIM fragments) used in the present invention may be in the form of a salt. For example, a salt with a physiologically acceptable acid (e.g., inorganic acid, organic acid) or base (e.g., alkali metal salt) is used, with physiologically acceptable acid addition salts being particularly preferred. Examples of such salts include salts with inorganic acids (e.g., hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and salts with organic acids (e.g., acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid).

[0031] AIM can be produced from mammalian macrophages by a publicly known protein purification method. Specifically, mammalian macrophages are homogenized, and cell debris is removed by low-speed centrifugation. The supernatant is then centrifuged at high speed to precipitate a cell membrane-containing fraction, which is then subjected to chromatography such as reverse-phase chromatography, ion-exchange chromatography, or affinity chromatography to prepare AIM or a salt thereof.

[0032] AIM (including AIM fragments) can also be produced according to known peptide synthesis methods. The peptide synthesis method may be, for example, either solid-phase synthesis or liquid-phase synthesis. The target protein can be produced by condensing a partial peptide or amino acid that can constitute AIM with the remaining portion, and if the product has a protecting group, removing the protecting group. Here, the condensation and removal of the protecting group are carried out according to known methods, for example, the methods described in (1) and (2) below. (1) M. Bodanszky and M.A. Ondetti, Peptide Synthesis, Interscience Publishers, New York (1966) (2) Schroeder and Luebke, The Peptide, Academic Press, New York (1965)

[0033] The AIM thus obtained can be purified and isolated by known purification methods, such as solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization, and combinations thereof.

[0034] When AIM obtained by the above method is in a free form, the free form can be converted into an appropriate salt by a known method or a method similar thereto. Conversely, when AIM is obtained as a salt, the salt can be converted into the free form or another salt by a known method or a method similar thereto.

[0035] Furthermore, AIM can also be produced by culturing a transformant containing a nucleic acid encoding it, and isolating and purifying AIM from the resulting culture. The nucleic acid encoding AIM or an AIM fragment may be DNA or RNA, or may be a DNA / RNA chimera. DNA is preferred. Furthermore, the nucleic acid may be double-stranded or single-stranded. If double-stranded, it may be double-stranded DNA, double-stranded RNA, or a DNA:RNA hybrid. If single-stranded, it may be the sense strand (i.e., coding strand) or the antisense strand (i.e., non-coding strand).

[0036] DNA encoding AIM (including AIM fragments) includes genomic DNA, cDNA derived from macrophages of warm-blooded animals (e.g., humans, cows, monkeys, horses, pigs, sheep, goats, dogs, cats, guinea pigs, rats, mice, rabbits, hamsters, birds, etc.), synthetic DNA, etc. Genomic DNA encoding AIM or an AIM fragment can be used in any cell of the above animals [e.g., hepatocytes, splenocytes, nerve cells, glial cells, pancreatic β cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, goblet cells, endothelial cells, smooth muscle cells, fibroblasts, fibrocytes, muscle cells, adipocytes, immune cells (e.g., macrophages, T cells, B cells, natural killer cells, mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary gland cells, hepatocytes or stromal cells, or cells of these cells]. progenitor cells, stem cells, or cancer cells, etc.] or any tissue in which such cells exist [for example, brain, brain regions (e.g., olfactory bulb, amygdala, basal ganglia, hippocampus, thalamus, hypothalamus, cerebral cortex, medulla oblongata, cerebellum), spinal cord, pituitary gland, stomach, pancreas, kidney, liver, gonads, thyroid gland, gallbladder, bone marrow, adrenal gland, skin, lung, digestive tract (e.g., large intestine, small intestine), blood vessels, heart, thymus, spleen, submandibular gland, peripheral blood, prostate, testis, ovary, placenta, uterus, bone, joint, adipose tissue (e.g., brown adipose tissue, white adipose tissue), skeletal muscle, etc.] as a template, and polymerase cDNA encoding AIM or an AIM fragment can also be directly amplified by PCR and reverse transcriptase-PCR (hereinafter abbreviated as "RT-PCR") using total RNA or mRNA fractions prepared from macrophages as templates, respectively. Alternatively, genomic DNA and cDNA encoding AIM or its peptide fragments can be cloned, respectively, by colony or plaque hybridization, PCR, or the like from genomic DNA libraries and cDNA libraries prepared by inserting the above-mentioned genomic DNA and total RNA or mRNA fragments into appropriate vectors.The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid, etc.

[0037] Examples of nucleic acids encoding AIM include nucleic acids containing a nucleotide sequence identical or substantially identical to the nucleotide sequence represented by SEQ ID NO: 2. Examples of nucleic acids containing a nucleotide sequence substantially identical to the nucleotide sequence represented by SEQ ID NO: 2 include nucleic acids containing a nucleotide sequence having at least about 60%, preferably at least about 70%, more preferably at least about 80%, and particularly preferably at least about 90% identity or similarity to the nucleotide sequence represented by SEQ ID NO: 2, and encoding a protein having substantially the same activity as the aforementioned AIM. In one embodiment, a nucleic acid containing a nucleotide sequence substantially identical to the nucleotide sequence represented by SEQ ID NO: 2 is a nucleic acid containing a nucleotide sequence having at least about 60%, preferably at least about 70%, more preferably at least about 80%, and particularly preferably at least about 90% identity to the nucleotide sequence represented by SEQ ID NO: 2, and encoding a protein having substantially the same activity as the aforementioned AIM. Nucleic acids encoding AIM also include nucleic acid sequences that have been codon-optimized for the purpose of increasing expression efficiency in target organisms.

[0038] The identity or similarity of base sequences herein can be calculated using the identity or similarity calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under the following conditions (expectation value = 10; gaps allowed; filtering = ON; match score = 1; mismatch score = -3). Other preferred examples of algorithms for determining the identity or similarity of base sequences include the amino acid sequence homology calculation algorithms described above.

[0039] The nucleic acid encoding AIM is preferably a nucleic acid containing a base sequence encoding the human AIM protein shown in SEQ ID NO: 2 (GenBank accession number: AF011429) or its homolog in other mammals [e.g., the mouse homolog registered in GenBank under accession number: AF011428, etc.].

[0040] Furthermore, nucleic acids encoding AIM or AIM fragments having the biological activity of AIM can also be used as components of the therapeutic agents of the present invention.

[0041] The nucleic acid encoding AIM or an AIM fragment used in the present invention may be any nucleic acid, as long as it contains a nucleotide sequence encoding a peptide comprising an amino acid sequence identical or substantially identical to a portion of the amino acid sequence represented by SEQ ID NO: 1. Specifically, examples of nucleic acids encoding AIM fragments include (1) nucleic acids comprising a partial nucleotide sequence of the nucleotide sequence represented by SEQ ID NO: 2, or (2) nucleic acids comprising a nucleotide sequence having about 60% or more, preferably about 70% or more, more preferably about 80% or more, and particularly preferably about 90% or more identity or similarity to a nucleic acid comprising a partial nucleotide sequence of the nucleotide sequence represented by SEQ ID NO: 2, and encoding a protein having substantially the same activity as the aforementioned AIM.

[0042] Nucleic acids encoding AIM or AIM fragments can be amplified by PCR using synthetic DNA primers containing a portion of the nucleotide sequence encoding the AIM or AIM fragment, or cloned by hybridizing DNA incorporated into an appropriate expression vector with a labeled DNA fragment or synthetic DNA encoding a portion or the entire region of AIM. Hybridization can be performed according to a method known per se or a method equivalent thereto, such as the method described in Molecular Cloning, 2nd Edition (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). When using a commercially available library, hybridization can be performed according to the method described in the accompanying instruction manual. Hybridization can be performed preferably under stringent conditions.

[0043] Highly stringent conditions include, for example, a hybridization reaction in 6xSSC (sodium chloride / sodium citrate) at 45°C, followed by one or more washes in 0.2xSSC / 0.1% SDS at 65°C. Those skilled in the art can easily adjust the stringency to a desired level by appropriately changing the salt concentration of the hybridization solution, the temperature of the hybridization reaction, the probe concentration, the probe length, the number of mismatches, the hybridization reaction time, the salt concentration of the washing solution, the washing temperature, etc. Furthermore, when using a commercially available library, hybridization can be performed according to the method described in the instructions attached to the library.

[0044] The nucleic acid encoding AIM or an AIM fragment may be operably linked to an expression vector or the like having a promoter that exerts brain-specific expression. By delivering an expression vector containing a nucleic acid encoding AIM or an AIM fragment into the brain, AIM or an AIM fragment can be expressed in a brain-specific manner. Brain-specific promoters include, but are not limited to, SCG10, GFAP promoter, synapsin 1 promoter, tubulin α1 promoter, calcium / calmodulin-dependent protein kinase II promoter, neuron-specific enolase promoter, PDGF (platelet-derived growth factor beta)-β chain promoter, etc.

[0045] In a preferred embodiment, a nucleic acid encoding AIM or an AIM fragment may be carried by a viral vector. Suitable viral vectors include, but are not limited to, adeno-associated viruses, adenoviruses, lentiviruses, and Sendai viruses. Considering use in gene therapy, adeno-associated viruses are preferred because they can express introduced genes for a long period of time and are derived from non-pathogenic viruses, making them highly safe. The serotype of the adeno-associated virus is not particularly limited as long as the desired effects of the present invention are achieved, and any of serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 may be used. In one embodiment of the present invention, when treating cerebral infarction, serotypes 1, 2, 5, 9, and 10 are preferred, particularly in view of their high expression efficiency in neural tissue (see WO2005 / 033321 for various AAV serotypes). Furthermore, AAV5 is preferred from the viewpoint of high expression efficiency, and serotype 9 (AAV9) is more preferred from the viewpoint of its ability to efficiently penetrate the blood-brain barrier (Iwata N et al., Sci Rep. 2013;3:1472). The viral vectors used in the present invention also include their derivatives. Examples of viral vector derivatives include those with modified capsids. Particular examples of AAV derivatives include, but are not limited to, those disclosed in WO2012 / 057363.

[0046] When loading a nucleic acid encoding AIM or an AIM fragment into a viral vector, it is preferable to use a brain-specific promoter to control the expression of the nucleic acid encoding AIM or an AIM fragment, so that the AIM or AIM fragment is specifically expressed in the target brain. Examples of such brain-specific promoters include, but are not limited to, SCG10, GFAP promoter, synapsin 1 promoter, tubulin α1 promoter, calcium / calmodulin-dependent protein kinase II promoter, neuron-specific enolase promoter, and PDGF (platelet-derived growth factor beta)-β chain promoter. In addition to the promoter, known sequences such as a Poly A addition signal, Kozak consensus sequence, tag sequence, linker sequence, and NLS may also be loaded into the viral vector together with the nucleic acid encoding AIM or an AIM fragment, depending on the purpose.

[0047] A viral vector containing a nucleic acid encoding AIM or an AIM fragment can be prepared by a known method. Briefly, a viral expression plasmid vector is prepared by inserting a nucleic acid encoding AIM or an AIM fragment and, if necessary, a nucleic acid having a desired function (e.g., a brain-specific promoter, etc.), and this is transfected into appropriate host cells to transiently produce a viral vector containing the polynucleotide of the present invention, which can then be recovered.

[0048] For example, when preparing an AAV vector, a vector plasmid is first prepared by retaining the ITRs at both ends of the wild-type AAV genome sequence and inserting a nucleic acid encoding AIM or an AIM fragment in place of the DNA encoding the remaining Rep and capsid proteins. Meanwhile, the DNA encoding the Rep and capsid proteins required for viral particle formation is inserted into a separate plasmid. Furthermore, a plasmid containing genes (E1A, E1B, E2A, VA, and E4orf6) responsible for the adenovirus helper function required for AAV replication is prepared as an adenovirus helper plasmid. Cotransfection of these three plasmids into host cells results in the production of recombinant AAV (i.e., an AAV vector) in the cells. It is preferable to use host cells (e.g., 293 cells) capable of supplying some of the gene products (proteins) of the genes responsible for the helper function. When such cells are used, it is not necessary to incorporate genes encoding proteins that can be supplied by the host cell into the adenovirus helper plasmid. Since the produced AAV vector is present in the nucleus, the host cells are frozen and thawed to recover the vector, and the desired AAV vector is prepared by separating and purifying it using cesium chloride density gradient ultracentrifugation or column methods.

[0049] When the therapeutic agent of the present invention is used to treat or prevent ischemic disease in a subject, the route of administration is not particularly limited as long as the AIM protein, which serves as the active ingredient, is delivered to the affected area. Preferred routes of administration include, but are not limited to, intravenous administration, intraarterial administration, subcutaneous administration, and intraperitoneal administration.

[0050] In one embodiment, when the active ingredient of the therapeutic agent of the present invention is an AIM protein or a functional fragment thereof (hereinafter, sometimes referred to as "AIM protein, etc.") and the ischemic disease is cerebral infarction, it is generally known that the AIM protein, etc., does not penetrate the blood-brain barrier (BBB). However, as demonstrated in the following examples, the BBB is temporarily and partially disrupted at the onset of cerebral infarction, allowing the AIM protein, etc., to be delivered to the site of cerebral infarction by intravenous administration. When the BBB is functional, for example, a pinhole may be drilled in the subject's skull and the therapeutic agent of the present invention may be directly introduced into brain tissue by a method known per se, such as microinjection. Alternatively, the AIM protein can be delivered into the brain by encapsulating the AIM protein in a liposome modified to be permeable to the blood-brain barrier and administering this to the subject by intravenous administration, etc. Furthermore, when the component contained in the therapeutic agent of the present invention is a nucleic acid encoding an AIM protein, the nucleic acid encoding an AIM protein can be delivered into the brain by a method such as directly introducing the therapeutic agent of the present invention through a pinhole created in the subject's skull or by a method using the liposomes described above.

[0051] When a component of the therapeutic agent of the present invention is a viral vector carrying a nucleic acid encoding AIM, a pinhole can be drilled in the subject's skull and the therapeutic agent of the present invention can be directly introduced into brain tissue via the pinhole by a method known per se, such as microinjection. Furthermore, as described above, the use of AAV9 is highly preferred because it allows AIM to be expressed specifically in the subject's brain simply by injecting the therapeutic agent of the present invention into the circulating blood, without drilling a pinhole in the subject's skull. That is, in embodiments using a means capable of penetrating the blood-brain barrier, such as liposomes or AAV9, the therapeutic agent of the present invention can be administered parenterally, for example, intravenously, intraarterially, subcutaneously, or intraperitoneally.

[0052] When the therapeutic agent of the present invention is formulated for parenteral administration, it can be formulated, for example, as an injection, suppository, etc. Injections may include dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, and drip infusion injections. Such injections can be prepared according to known methods. For example, injections can be prepared by dissolving, suspending, or emulsifying components such as AIM, a nucleic acid encoding AIM, and / or a virus carrying a nucleic acid encoding AIM in a sterile aqueous or oily liquid typically used for injections. Examples of aqueous solutions for injection include physiological saline, isotonic solutions containing glucose and other adjuvants, and the like, which may be used in combination with an appropriate solubilizing agent, such as alcohol (e.g., ethanol), polyalcohol (e.g., propylene glycol, polyethylene glycol), or nonionic surfactant (e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)), etc. As the oily liquid, for example, sesame oil, soybean oil, etc. can be used, and a solubilizing agent such as benzyl benzoate, benzyl alcohol, etc. can be used in combination. The prepared injection solution is preferably filled into a suitable ampule.

[0053] The amount of the therapeutic agent of the present invention to be administered to a subject is not particularly limited as long as it is a therapeutically effective amount, and may be optimized as appropriate depending on the type and form of the active ingredient, the age and weight of the subject, the administration schedule, the administration method, etc.

[0054] The timing of administering the therapeutic agent of the present invention to a subject is not particularly limited as long as it can treat ischemic disease. Examples of the timing of administering the therapeutic agent of the present invention include, but are not limited to, immediately after the onset of ischemic disease, or within 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 24 hours, 36 hours, 48 ​​hours, 72 hours, 96 hours, or 120 hours after the onset of ischemic disease.

[0055] The therapeutic agent of the present invention can also be used in combination with other therapeutic agents for treating ischemic diseases. For example, the therapeutic agent of the present invention may be used in combination with thrombolytic agents (t-PA, urokinase, etc.), anticoagulants (heparin, argatroban, etc.), antiplatelet agents (sodium ozagrel, aspirin, etc.), cerebroprotectants (edaravone, etc.), and anticerebral edema agents (glycerol, mannitol, etc.), which are used in the treatment of infarction.

[0056] By administering the therapeutic agent of the present invention to a subject suffering from an ischemic disease, AIM or an AIM fragment is delivered to or expressed in the infarcted region of the subject. The AIM or AIM fragment in the infarct binds to dead cell debris and / or DAMPs present in the infarct, promoting the removal of the dead cell debris and suppressing the spread of sterile inflammation. As a result, it becomes possible to treat the ischemic disease in the subject.

[0057] In this specification, "treatment" of a disease includes not only curing the disease, but also remission of the disease and improvement in the severity of the disease.

[0058] 2. Inhibitor of Sterile Inflammation The present invention also provides an inhibitor of sterile inflammation mediated by damage-associated molecular patterns (DAMPs), which comprises an apoptosis inhibitor of macrophage (AIM), an AIM fragment having the biological activity of AIM, or a nucleic acid encoding the AIM or AIM fragment (hereinafter, sometimes referred to as the "inhibitor of the present invention").

[0059] The AIM etc. that serves as the active ingredient in the inhibitor of the present invention is the same as in "1. Therapeutic agent for ischemic disease." The amount of AIM etc. contained in the inhibitor of the present invention is not particularly limited, as long as it is an amount that can suppress sterile inflammation in a subject.

[0060] When the active ingredient of the inhibitor of the present invention is an AIM protein or a functional fragment thereof, it binds to DAMPs, thereby neutralizing the biological activity of the DAMPs and / or efficiently phagocytosing the DAMPs by microglia / macrophages, thereby suppressing the spread of inflammation. Examples of DAMPs to which AIM or a functional fragment thereof bind include, but are not limited to, PRDX1, PRDX2, PRDX3, PRDX4, PRDX5, PRDX6, HMGB1, S100A8, S100A8 / 9, S100A9, and HSP70. When the active ingredient of the inhibitor of the present invention is a nucleic acid encoding AIM or a functional fragment thereof, the AIM or functional fragment thereof encoded by the nucleic acid is translated in cells to produce the AIM protein or a functional fragment thereof, thereby achieving the desired effect.

[0061] The subject to which the inhibitor of the present invention is administered is not particularly limited as long as it is a subject to which DAMP-mediated sterile inflammation may occur. Examples of subjects to which the inhibitor of the present invention is administered include, but are not limited to, warm-blooded animals (e.g., humans, mice, rats, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, chimpanzees, birds, etc.). In one embodiment, the subject is a human.

[0062] The timing of administering the inhibitor of the present invention to a subject is not particularly limited as long as the desired effect can be obtained. Examples of the timing of administering the inhibitor of the present invention to a subject include, but are not limited to, immediately after the onset of inflammation, or within 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 24 hours, 36 hours, 48 ​​hours, 72 hours, 96 hours, or 120 hours after the onset of inflammation.

[0063] The therapeutic agent of the present invention can also be used in combination with other anti-inflammatory agents for sterile inflammation.

[0064] 3. Method for Treating Ischemic Disease The present invention also provides a method for treating an ischemic disease (hereinafter, sometimes referred to as the "therapeutic method of the present invention"), which comprises administering to a subject suffering from an ischemic disease apoptosis inhibitor of macrophage (AIM), an AIM fragment having the biological activity of AIM, or a nucleic acid encoding the AIM or AIM fragment.

[0065] The therapeutic method of the present invention is achieved by administering the therapeutic agent of the present invention to a subject suffering from an ischemic disease. The AIM, etc., subjects to be administered, timing of administration, etc. in the therapeutic method of the present invention are the same as those in "1. Therapeutic agent for ischemic disease."

[0066] 4. Method for suppressing sterile inflammation The present invention provides a method for suppressing sterile inflammation mediated by damage-associated molecular patterns (DAMPs) (hereinafter, sometimes referred to as the "suppression method of the present invention"), which comprises administering an apoptosis inhibitor of macrophage (AIM), an AIM fragment having the biological activity of AIM, or a nucleic acid encoding the AIM or AIM fragment to a subject experiencing sterile inflammation mediated by DAMPs.

[0067] The suppression method of the present invention is achieved by administering the suppressor of the present invention to a subject who has developed DAMP-mediated sterile inflammation. The AIMs, subjects, and timing of administration in the suppression method of the present invention are the same as those in "2. Suppressor of Sterile Inflammation."

[0068] The present invention will be explained in more detail in the following examples, but the present invention is not limited to these examples in any way.

[0069] [Experimental Procedure] Mice AIM on a pure C57BL / 6 background - / -To generate mice, two types of pX335 vectors (Addgene, MA, USA) carrying either 5'-caccgaacaatggagccatggccc-3' (SEQ ID NO: 3) or 5'-caccggtgagtgtccctgcttctg-3' (SEQ ID NO: 4) were microinjected into the pronuclei of fertilized eggs from C57BL / 6 mice, and the resulting two-cell embryos were then implanted into the uterus of pseudopregnant female mice. Genomic DNA isolated from the tails of the offspring was examined for deletions involving the cd51 (AIM) locus by PCR and sequencing. AIM with the appropriate deletion in the first ATG region was identified. - / - The mouse strains were bred and used in this experiment. Mice were maintained under specific pathogen-free conditions at the University of Tokyo. Lysm-Cre transgenic mice and MafB flox / flox Macrophage-specific MafB-deficient mice, obtained by crossbreeding, were maintained under semi-SPF conditions at the University of Tsukuba. All animal experiments were performed in strict accordance with the recommendations of the NIH Guide for the Care and Use of Laboratory Animals. This protocol was approved by the University of Tokyo Animal Experiment Ethics Committee (Permit Number: P10-143). All surgical procedures were performed under pentobarbital sodium anesthesia, and every effort was made to minimize suffering.

[0070] Induction of Ischemic Stroke (MCAO) Male mice aged 8–14 weeks and weighing 20–25 g were used for MCAO. Following the procedure described by Shichita et al. (2017, Non-Patent Document 9), a silicone rubber-coated nylon monofilament (Doccol) was inserted laterally into the middle cerebral artery under anesthesia (isoflurane; Pfizer) for 45 minutes. During the MCAO procedure, cerebral blood flow was monitored using laser Doppler flowmetry (OMEGA). Mice showing a 70% or greater reduction in cerebral blood flow in the temporal lobe were used in this experiment.

[0071] Antibodies and reagents. The antibodies and reagents used in histological experiments are as follows: Primary antibodies: AIM (rab2 rabbit polyclonal for IHC of mouse and human brain specimens); #35 (for mouse AIM ELISA) and #6 (for human AIM ELISA) produced in our laboratory; some are available commercially from Transgenic Inc.), HMGB1 (clone GT383, Gene-Tex, LA, USA), PRDX1 (rabbit polyclonal antibody, Abcam, Cambridge, UK), S100A9 (AF2065, R&D systems, NE, USA), Doublecortin (Dcx; chicken polyclonal antibody, ab153668, Abcam, Cambridge, UK), Iba1 (goat polyclonal antibody, Abcam, Cambridge, UK), biotinylated 6xHis tag (D291-6, MBL, Japan), NF-κB p65 (D14E12, Cell signaling technology), phospho-NF-κB p65 (93H1, Cell signaling technology), and CD11b microbeads (clone: ​​M1 / 70.15.11.5, Miltenyi Biotec. Bergisch gladbach, Germany). Secondary antibodies and related reagents: Alexa fluor 488 or 594 conjugated anti-rabbit or rat IgG (Molecular Probes), anti-human IgG-Fc-HRP (A80-104P, Bethyl Laboratories, Inc.), Streptavidin-Alexa fluor 488 (Molecular Probes), Streptavidin-HRP (554066, BD Pharmingen), DAPI or Hoechst 33342 (Molecular Probes), G-Block (Genostaff, Tokyo, Japan), and HISTOFINE Simple Stain Mouse MAX-PO® (for nuclei; NICHIREI, Japan).The specimens were analyzed using a confocal microscope: FV10i-DOC and a research slide scanner: SLIDEVIEW VS200 (Olympus, Tokyo).

[0072] DAMPs and related proteins The HA-tagged mouse PRDXs used in the binding assay were generated in our laboratory. They were produced in HEK293T cells and then purified from cell lysates using an anti-HA antibody column. Other DAMPs and related proteins were purchased from: mouse PRDX1-His (RPF757Mu01, USCN), human PRDX1-His (NBC118543, Novus Biologics), mouse S100A8 (9877-S8-050, R&D Systems), mouse S100A9 (2065-S9-050, R&D Systems), mouse S100A8 / A9 (8916-S8-050, R&D Systems), human S100A8 (9876-S8-050, R&D Systems), human S100A9 (9254-S9-050, R&D Systems), human S100A8 / A9 (8226-S8-050, R&D Systems), mouse HSP70-A1 (low endotoxin; ADI-ESP-502-D, Enzo), human HSP70 (Endotoxin free; SPR-117A, StressMarq), human HMGB1 (1690-HMB-050, R&D Systems), mouse TLR2-Fc (1530-TR, R&D Systems), human RAGE-Fc (1145-RG, R&D Systems).

[0073] CD11b isolated from brain +Single-cell isolation of brain tissue: Mice were deeply anesthetized with isoflurane and transcardially infused with 1x phosphate-buffered saline (PBS) to remove blood. Brain tissue was excised, and the infarcted and non-infarcted brains were cut into small pieces. The pieces were then treated with an enzyme solution containing 2.5 U / mL collagenase D, 8.5 U / mL dispase, 25 mg / mL DNase I, and Complete Mini (Roche; Basel, Switzerland) in 1x HBSS at 37°C for 1 hour. The digested tissue was passed multiple times through an 18 G needle, filtered through a 70 μm strainer (Miltenyi Biotec, Bergisch Gladbach, Germany), and then centrifuged at 400 g for 15 minutes at 4°C. The cell pellet was resuspended in 35% Percoll in PBS and centrifuged at 800 g for 45 minutes at 4°C. The pellet was resuspended in 0.5% fetal bovine serum (FBS) in PBS. + Cells were isolated using CD11b microbeads (Miltenyi Biotec, Bergisch gladbach, Germany) according to the manufacturer's protocol.

[0074] AIM ELISA. All ELISA assays were performed in duplicate. Mouse AIM in brain tissue lysates was measured by ELISA using two different rat anti-mouse AIM monoclonal antibodies (rat IgG, clone #35; produced in our laboratory). The inter-assay coefficient of variation for mouse AIM, assessed using C57BL / 6 mouse serum, was 4.8%, and the inter-assay coefficient of variation was always less than 4.1%. The lower limit of quantitation, assessed using recombinant AIM protein as a standard, was 0.0625 ng / ml for mouse AIM.

[0075] The 2CS mutant AIM protein was generated by substituting cysteine ​​at position 194 in mouse AIM with serine (TGC to TCC in the nucleotide sequence). The ΔSRCR3 mutant was generated by deleting the amino acids from aspartic acid at position 242 to valine at position 352 in the SRCR3 domain.

[0076] Purification of rAIM. CHO-S cells were transfected with the pcDNA3.1-mAIM plasmid and cultured in CD Forti CHO medium (Invitrogen, CA) for 3 days. rAIM was purified from the culture supernatant using a rat anti-mouse AIM monoclonal antibody (prepared in-house) conjugated to Protein G Sepharose (GE Healthcare Life Sciences, PA). Bound protein was eluted with 0.1 M Glycin-HCl, pH 3.0, and neutralized with 1 M Tris-HCl, pH 8.5. Protein was concentrated using Amicon Ultra filter concentrators (Millipore, MA) as needed and stored in PBS at -80°C. Endotoxin levels were measured using a chromogenic LAL endotoxin detection system (Genscript, NJ) according to the manufacturer's protocol. Protein concentration was determined by the BCA (bicinchoninic acid) assay (Pierce, Rockford, IL) according to the manufacturer's protocol. Recombinant AIM / IgM-Fc and IgM-Fc proteins were produced as previously described (Hiramoto et al., (2018), The IgM pentamer is an asymmetric pentagon with an open groove that binds the AIM protein. Sci. Adv. 4, eaau1199.).

[0077] Evaluation of AIM binding efficiency to DAMPs. 96-well ELISA plates were coated overnight at 4°C with DAMPs and control proteins dissolved in bicarbonate buffer (0.1 M NaHCO3 / Na2CO3, pH 9.6) at 2 μg / mL, unless otherwise specified. After washing the plates four times with Tris-buffered saline-tween (TBS-T), they were coated with blocking buffer (1% Casein / TBS) for 2 h at room temperature. After washing with TBS-T, AIM dissolved at various concentrations in dilution buffer (0.2% Casein / TBS / 2 mM CaCl2) was added to the wells, and the plates were incubated for 1 h at room temperature. After washing five times with TBS-T / 2 mM CaCl2, biotinylated anti-mouse or human AIM antibodies (mouse clone #35, human clone #7) were added to the wells and incubated for 1 h at room temperature. After washing four times with TBS-T / 2 mM CaCl2, streptavidin-HRP diluted in 0.2% casein / TBS / 2 mM CaCl2 was added to the wells and incubated for 1 hour at room temperature. After washing four times with TBS-T / 2 mM CaCl2, TMB was added and incubated for 10-25 minutes at room temperature. The reaction was stopped by adding 1 N H2SO4, and the absorbance was analyzed at OD 450 nm using a multiplex plate reader.

[0078] In vitro evaluation of DAMP capture by macrophages AIM - / -Peritoneal macrophages isolated from mice were plated on Lab-Tek II chamber slides (NalgeNunk) and cultured for 2 hours to allow macrophages to attack the slides. The cells were incubated with 10 μg / mL of DAMPs (mouse PRDX1-His, human PRDX1-His, human HMGB1, or mouse S100A9) with or without mouse or human rAIM (100 μg / mL) at 37°C for 10 minutes. For mouse PRDX1, the 2CS mutant or ΔSRCR3 mutant was also used. Each ligand and AIM were immunostained with antibodies against His (mouse and human PRDX1), HMGB1, or S100A9, followed by a fluorescently conjugated secondary antibody. Nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI). Cells were analyzed under a fluorescent confocal microscope.

[0079] NFκB activation assay. RAW264.1 cells were incubated in 96-well cell culture plates with mouse S100A9 or RPDX (5 μg / mL) dissolved in DMEM + 0.1% FBS in the presence or absence of mouse AIM (10 μg / mL) for 30 minutes at 37°C. After washing with PBS, the cells were lysed in SDS-containing loading buffer, boiled, and loaded onto an SDS-PAGE gel. NFκB phosphorylation was then analyzed by immunoblotting using an anti-phospho-NFκB p65 antibody (3033S, Cell Signaling Technology, Inc.). Total NFκB was also analyzed using an anti-NFκB antibody (8242S, Cell Signaling Technology, Inc.).

[0080] Histological examination: AIM detection and other IHC in infarcted brains. Brain tissue was excised, fixed in 4% PFA in PBS for 24 hours, and then embedded in paraffin. Six-μm-thick sections were immunostained by incubation with rabbit anti-AIM polyclonal antibody (Rab2; available for human and mouse AIM) followed by HITOFINE simple stain mouse MAX-PO® (NICHIREI, Japan) for 30 minutes. After staining with diaminobenzidine tetrahydrochloride (DAB), sections were counterstained with hematoxylin. To block autofluorescence, slides were incubated for 25 minutes in 0.5% Sudan Black B (199664-25G, SIGMA-ALDRICH) diluted in 70% ethanol before immunostaining. For DAMP staining, sections were immunostained with rabbit anti-PRDX1 polyclonal antibody (ab41906), mouse anti-HMGB1 monoclonal antibody (GTX628834), or goat anti-S100A9 polyclonal antibody (AF2065) followed by HISTOFINE simple stain mouse MAX-PO (R, M, or G) for 30 minutes. For MAP2 and Iba1 detection, sections were immunostained with mouse anti-MAP2 monoclonal antibody (M9942) or goat anti-Iba1 polyclonal antibody (ab5076) followed by HISTOFINE simple stain mouse MAX-PO (M or G) for 30 minutes. Before incubation with the primary antibody, sections were treated with each condition for antigen retrieval. S100A9, HMGB1, and MAP2: Boiled in Tris / EDTA buffer (pH 9.0) containing 0.05% Tween-20 for 20 minutes. PRDX1: 20 μg ProK in PBS for 20 minutes at 37°C. Iba1: Boiled in citrate buffer (10 mM, pH 6.0) containing 0.05% Tween-20 for 20 minutes. After staining with DAB, sections were counterstained with hematoxylin. Oil red-O staining: Brain tissue was fixed in 4% paraformaldehyde (PFA) in PBS for 24 hours and in 30% sucrose for 24-48 hours, then frozen with OCT compound.Ten-μm sections were stained with Oil Red-O solution (MUTO OURE CHEMICALS CO., LTD; Tokyo, Japan). Histological data for human brain AIM were purchased from Genostaff Co. Ltd. (Tokyo, Japan). Genostaff Co. Ltd.'s data were obtained by staining serial sections for human AIM and MAP2 using commercially available paraffin blocks of brain tissue from human cerebral infarction patients purchased from Funakoshi Co. Ltd. (Japan).

[0081] Quantification of DAMPs in the brain. DAMP-DAB staining images were acquired using a VS200 slide scanner (OLYMPUS, Germany) equipped with a 20x objective and digitally recorded. Digital image analysis was performed using commercially available software, HALO (IndicaLabs, Corrales, NM, USA). DAB and hematoxylin signals were detected using object colocalization-based algorithms, and the amount of extracellular DAMPs was estimated by subtracting the DAB signal colocalized with hematoxylin from the total DAB signal.

[0082] Neurological Score. Behavioral assessments were performed every 24 hours after MCAO. Neurological impairment was scored as previously described (Jiang et al., 2005. Chlortetracycline and demeclocycline inhibit calpains and protect mouse neurons against glutamate toxicity and cerebral ischemia. J. Biol. Chem. 280, 33811-33818). The following criteria were used: 0 (normal); 1 (weak circling movement with or without inconsistent curling when the tail was raised, <50% attempts to curl to the contralateral side); 2 (weak, consistent curling, >50% attempts to curl to the contralateral side); 3 (strong, immediate, consistent curling, mouse maintained curled position for 1-2 seconds or more, nose nearly reaching the tail); 4 (extreme curling, barrel progression, lack of walking or righting reflex); 5 (coma or moribund).

[0083] Statistical Analysis Data were analyzed using BellCurve for Excel (Social Survey Research Information Co., Ltd.) and are presented as mean ± SD unless otherwise specified. All data were analyzed using two-tailed tests. Paired results were evaluated using Welch's t-test. Comparisons between multiple groups were analyzed using one-way or multi-way ANOVA with Bonferroni's post hoc test. For Kaplan-Meier curves, P values ​​were determined using the Generalized Wilcoxon test. Unless otherwise specified, significance codes are as explained in the figure briefs.

[0084] Quantitative PCR assay Quantitative evaluation of mRNA was performed using the QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific). T The oligonucleotide sequences used are listed below.

[0085] Name Sequence (5'→3') f-GAPDH AGAACATCATCCCTGCATTC (SEQ ID NO: 5) r-GAPDH CACATTGGGGGTAGGAACAC (SEQ ID NO: 6) f-mAIMGAGGACACATGGATGGAATGT (SEQ ID NO: 7) r-mAIMACCCTTGTGTAGCACCTCCA (SEQ ID NO: 8) f-IL1B CAGGCAGGCAGTATCACTCA (SEQ ID NO: 9) r-IL1B AGGCCACAGGTATTTTGTCG (SEQ ID NO: 10) f-IL6 ATGGATGCTACCAAACTGGAT (SEQ ID NO: 11) r-IL6 TGAAGGACTCTGGCTTTGTCT (SEQ ID NO: 12) f-TNFA CTTCTGTCTACTGAACTTCGGG (SEQ ID NO: 13) r-TNFA TGATCTGAGTGTGAGGGTCTG (SEQ ID NO: 14) f-IL23 CAACTTCACACCTCCCTAC (SEQ ID NO: 15) r-IL23 CCACTGCTGACTAGAACT (SEQ ID NO: 16) f-MCP1 CATCCACGTGTTGGCTCA (SEQ ID NO: 17) r-MCP1 GATCATCTTGCTGGTGAATGAGT (SEQ ID NO: 18) f-CD11b CAATAGCCAGCCTCAGTGCC (SEQ ID NO: 19) r-CD11b GAGCCCAGGGGAGAAGTGG (SEQ ID NO: 20) f-beta-actin CTAAGGCCAACCGTGAAAAG (SEQ ID NO: 21) r-beta-actin ACCAGAGGCATACAGGGACA (SEQ ID NO: 22) f-18SrRNA CGCCGCTAGAGGTGAAATTCT (SEQ ID NO: 23) r-18SrRNA CATTCTTGGCAAATGCTTTCG (SEQ ID NO: 24)

[0086] Example 1: Increase in Brain AIM after Ischemic Stroke. AIM (=CD51) mRNA expression was not detected in healthy mouse brains. However, in the brains of mice induced with unilateral infarction by transient middle cerebral artery occlusion (MCAO), a significant increase in AIM mRNA expression was observed in the infarcted side by quantitative PCR (QPCR) (Figure 1A). Furthermore, analysis of CD11b-positive and -negative cells, a cell surface marker for macrophage-lineage cells, isolated from the infarcted side revealed that the increased AIM mRNA in the infarcted side was expressed by CD11b-positive microglia and macrophages infiltrating the infarct lesion (Figure 1A). When brain tissue lysed 7 days after MCAO was used for evaluation by enzyme-linked immunosorbent assay (ELISA), no increase in AIM protein was observed in the non-infarcted side, but up to 250 ng of AIM protein was present per mg of brain tissue in the infarcted side (Figure 1B). Increased AIM expression in the infarcted brain was assessed by immunohistochemistry (IHC). At 7 days after MCAO, AIM staining was strong in the microtubule-associated protein 2 (MAP2)-negative infarcted neuronal cell area (Fig. 1C). Such accumulation of AIM in the infarcted area was also observed in the brains of human patients with cerebral infarction (Fig. 1D). Under high magnification, Iba1-positive macrophage-like cells (indicated by arrows) in both mouse and human brains were strongly stained for AIM (Fig. 1C, 1D), supporting the QPCR results in Fig. 1A showing increased AIM mRNA expression in CD11b-positive macrophage-lineage cells. Iba1-positive macrophages infiltrating the infarcted area (MAP2-negative) were strongly stained with oil-red-O, indicating that they were actively phagocytosing dead cell debris (Fig. 1E). In contrast, AIM-deficient (AIM) brains after MCAO showed a significant increase in AIM mRNA expression. - / - In ) mice, Iba1-positive macrophages in the infarcted area were mostly oil-red-O-negative, indicating that they were unable to phagocytose dead cell debris (Fig. 1E), suggesting that AIM contributes to the phagocytic clearance of dead cell debris in the infarcted area.

[0087] [Example 2] AIM reduces DAMP-induced brain inflammation after infarction and improves the prognosis of cerebral infarction. IHC analysis of brains that had developed infarction due to MCAO revealed that AIM - / - The amount of extracellular PRDX1 (not co-localized with the cell body or nucleus) in the infarcted area of ​​mice was significantly higher than that of wild-type mice. Furthermore, immediately after MCAO, 0.5 mg of rAIM was administered intravenously once a day to each mouse, and the amount of extracellular PRDX1 in the infarcted area of ​​mice was significantly higher than that of wild-type and AIM mice. - / - PRDX1 was reduced in both the cerebral cortex and the cerebral cortex (Fig. 2A). The blood-brain barrier (BBB) ​​is known to be transiently and partially disrupted during the acute phase of ischemic stroke (55. Zou, R. et al. (2015). Electroacupuncture pretreatment attenuates blood-brain barrier disruption following cerebral ischemia / reperfusion. Mol. Med. Rep. 12, 2027-2034.; Choi, KH et al. (2016). Overexpression of caveolin-1 attenuates brain edema by inhibiting tight junction degradation. Oncotarget. 7, 67857-67867.). In fact, when 0.5 mg of rAIM was intravenously administered to AIM- / - mice 3 days after MCAO, the infarcted brain tissue was extensively stained with anti-AIM antibodies, indicating that the administered rAIM crossed the BBB (Fig. 5). The correlation between the decrease in PRDX1 and the amount of AIM in the brain was clear on days 3 and 7 after MCAO (Fig. 2A, graph). - / - Mice rapidly deteriorated and died before day 3 after MCAO. The infarcted area just before death (days 2 to 3) contained significantly higher amounts of S100A9 (Fig. 2B). - / -In mice, a large amount of DAMPs accumulates in the brain, causing death. However, wild-type mice did not die before day 3. The expression levels of inflammatory cytokine mRNA in CD11b-positive macrophages infiltrating the infarcted brain were significantly increased by rAIM administration. - / - The inflammatory response in the infarcted area was reduced in both wild-type and non-wild-type mice (Fig. 2C). This suggests that AIM reduces inflammation in the infarcted area. - / - No significant difference was observed in the expression levels of inflammatory cytokine mRNA in macrophages in the infarcted area between wild-type and wild-type mice (Fig. 2C). This is thought to be because AIM levels in the brain had not yet increased before day 7 in wild-type mice (Fig. 1A). Correlating with the amount of DAMPs in the brain and the inflammatory state, mortality on day 7 after MCAO was significantly associated with AIM levels. - / - Although the mortality rate was significantly higher in rAIM mice than in wild-type mice, daily intravenous administration of 0.5 mg of rAIM per mouse significantly reduced the mortality rate (Fig. 2D). None of the wild-type mice administered a relatively small amount of rAIM (0.1 mg per mouse) died after MCAO (Fig. 2D). Similar to the improvement in survival rate, the neurological symptoms (hemiplegia) after infarction were significantly reduced with AIM. - / - Although the condition was more severe in the BRCA1 mice than in the wild-type mice, administration of rAIM improved the condition again (Figure 2E). These results suggest that intravenous administration of rAIM during the acute phase of infarction significantly improves prognosis. In other words, AIM expressed in the brain or administered intravenously to the infarct lesion promotes the removal of dead cell debris and DAMPs in the infarct lesion, reduces inflammation in the brain after infarction, and improves prognosis.

[0088] Example 3: AIM enhanced phagocytic clearance of DAMPs and neutralized them through direct binding. To test this hypothesis regarding the action of AIM, the present inventors first used an ELISA system to confirm whether AIM directly binds to DAMPs, as well as to dead cell debris. As shown in Figures 3A and 4, AIM bound to PRDX1, S100A9, and HMGB1, as well as many other DAMPs, in a dose-dependent manner. Since most DAMPs are negatively charged (Uchida et al., 2014. Natural antibodies as a sensor of electronegative damage-associated molecular patterns (DAMPs). Free Radic. Biol. Med. 72, 156-161; Knoop et al., 2018. Specific Interactions Measured by AFM on Living Cells between Peroxiredoxin-5 and TLR4: Relevance for Mechanisms of Innate Immunity. Cell Chem. Biol. 25, 550-559.e3), AIM may bind to DAMPs via charge interactions, similar to the binding of AIM to dead cell debris (Arai et al., 2016; Tomita et al., 2017). To confirm this possibility, we examined the binding of DAMPs to a mutant mouse AIM (ΔSRCR3) lacking the carboxy-terminal region of AIM, which contains a cluster of positively charged surface amino acids. As expected, ΔSRCR3 showed no substantial binding to any DAMPs (Fig. 3B). In addition, the binding between AIM and DAMPs was significantly reduced when charge interactions were inhibited in the presence of a high dose of NaCl (Fig. 3C). Furthermore, the binding of AIM to DAMPs was inhibited in the presence of the reducing agent Tris(2-carboxyethyl)phosphine (TCEP) (Fig. 3D), suggesting the additional involvement of disulfide bonds.The lone cysteine ​​residue in the SRCR2 domain of AIM is the only amino acid residue available for disulfide bond formation with other molecules (Miyazaki et al., (1999), Increased susceptibility of thymocytes to apoptosis in mice lacking AIM, a novel murine macrophage-derived soluble factor belonging to the scavenger receptor cysteine-rich domain superfamily. J. Exp. Med. 189, 413-422; Hiramoto et al., (2018) (as mentioned above)). Therefore, it is highly likely that this cysteine ​​residue forms disulfide bonds with DAMPs. To test this possibility, we generated another mouse AIM mutant (2CS) in which the cysteine ​​was replaced with serine and evaluated its binding to DAMPs. As shown in Figure 3E, the 2CS mutant lost its ability to bind to all identified DAMPs. Therefore, AIM appears to stably bind to DAMPs through two independent binding modes: charge interaction and disulfide bond formation. These two binding sites are also used for the binding of AIM to IgM pentamers, as previously reported by the inventors (Hiramoto et al., (2018) (supra)). This suggests that AIM loses its ability to bind to DAMPs when bound to IgM pentamers. In fact, the AIM-IgM pentamer complex showed almost no binding to DAMPs (Figure 3F). Furthermore, AIM-free IgM pentamers dose-dependently inhibited AIM binding to DAMPs (Figure 3G). Thus, binding to IgM pentamers functionally inactivates AIM in DAMP binding. Furthermore, the present inventors evaluated under a fluorescence microscope whether the capture and uptake of PRDX1, HMGB1, and S100A9 by macrophages in vitro was inhibited in the presence of rAIM.As shown in Figure 3H, added rAIM strongly colocalized with all DAMPs, confirming the binding data obtained by ELISA (Figure 3A). Furthermore, the amounts of PRDX1, HMGB1, and S100A9 present on the cell surface and intracellularly were significantly increased in the presence of rAIM, suggesting that rAIM promotes the capture and uptake of DAMPs by macrophages (Figure 3I). Interestingly, AIM binding strongly induced PRDX1 aggregation (Figure 3J), reminiscent of AIM-induced bacterial aggregation (Sarrias et al., (2005). A role for human Sp alpha as a pattern recognition receptor. J. Biol. Chem. 280, 35391-35398). Larger molecules are known to be more easily internalized by phagocytes (Aderem & Underhill, (1999). Mechanisms of Phagocytosis in Macrophages. Annu. Rev. Immunol. 17, 593-623; Sarrias et al., (2005) (supra); Canton et al., Scavenger receptors in homeostasis and immunity. Nat. Rev. Immunol. 13, 621-634). Therefore, AIM-induced aggregation of PRDX1 is advantageous for phagocytosis. The ΔSRCR3 AIM mutant and the 2CS AIM mutant (Fig. 3B and 3E), which do not bind to DAMPs, did not induce PRDX1 aggregation (Fig. 3J). Furthermore, AIM binding itself inhibited the binding of PRDX1 and HMGB1 to TLR2 and RAGE, as assessed by an ELISA-based assay (Fig. 3K). These results suggest that the binding of AIM to DAMPs not only enhances DAMP uptake by phagocytes but also competitively blocks the charge-dependent interaction of DAMPs with TLRs and RAGE, resulting in an overall reduction in the inflammatory activity of DAMPs.As an actual experimental example, as shown in FIG. 3L, the NFκB activation ability of PRDX and S100 in macrophage cells was significantly reduced by the addition of rAIM.

[0089] As the experimental results described above show, AIM suppresses inflammatory responses by phagocytosis and neutralization of various DAMPs in the infarcted area caused by ischemia, and promotes efficient removal of dead cell debris, thereby enabling the treatment of cerebral infarction. It is clear that this mechanism of action of AIM can be applied not only to the treatment of cerebral infarction, but also to the treatment of ischemic diseases such as myocardial infarction. Therefore, the present invention can be used as a therapeutic agent for ischemic diseases.

[0090] According to the present invention, ischemic diseases including cerebral infarction can be treated, and therefore the present invention is extremely useful in the medical field.

[0091] This application is based on patent application No. 2021-125789 filed in Japan (filing date: July 30, 2021), the contents of which are incorporated in their entirety herein.

Claims

Claim 1 A therapeutic agent for ischemic diseases, comprising Apoptosis inhibitor of macrophage (AIM), an AIM fragment having the biological activity of AIM, or a nucleic acid encoding the AIM or AIM fragment. Claim 2 The therapeutic agent according to claim 1, wherein the ischemic disease is selected from the group consisting of cerebral infarction, myocardial infarction, limb ischemia, pulmonary infarction, splenic infarction, intestinal infarction, and Buerger's disease. Claim 3 An inhibitor of sterile inflammation mediated by Damage-associated molecular patterns (DAMPs), comprising Apoptosis inhibitor of macrophage (AIM), an AIM fragment having the biological activity of AIM, or a nucleic acid encoding the AIM or AIM fragment. Claim 4 The inhibitor according to claim 3, wherein the DAMPs is at least one selected from the group consisting of PRDX1, PRDX2, PRDX3, PRDX4, PRDX5, PRDX6, HMGB1, S100A8, S100A8 / 9, S100A9, and HSP70.