Nucleic acid drug and use thereof
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Filing Date
- 2026-01-08
- Publication Date
- 2026-06-23
AI Technical Summary
Current treatments for ALS, such as riluzole, edaravone, and tofersen, have limited efficacy in slowing symptom progression, and there is a need for therapeutic agents that can provide causal treatment for ALS, as TDP-43 dysfunction is implicated in motor neuron loss.
Development of antisense oligonucleotides (ASOs) that specifically target and suppress the expression of TDP-43 splicing variant MP-13 (MP-13) mRNA, normalizing TDP-43 function and correcting abnormal localization, thereby inhibiting neuronal toxicity.
The ASOs effectively reduce MP-13 expression, potentially treating or preventing ALS, frontotemporal degeneration, and Alzheimer's disease by normalizing TDP-43 function and reducing neuronal cell death.
Abstract
Description
Nucleic acid medicines and their uses
[0001] This application is an application that benefits from the priority of Japanese Patent Application No. 2024-113370 (filing date: July 16, 2024), which is incorporated herein by reference in its entirety.
[0002] The present invention relates to methods for treating and preventing neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), and pharmaceutical compositions for use in the methods. More specifically, the present invention relates to targeting splicing variants transcribed from the TDP-43 gene. Even more specifically, the present invention relates to pharmaceutical compositions containing oligonucleotides for regulating gene expression, and to disease treatments using the same.
[0003] ALS is one of the most devastating neurodegenerative diseases, resulting in the complete loss of motor function, including respiratory function, due to motor neuron-specific loss. Currently, three drugs have been approved for the treatment of ALS in Japan, Europe, and the United States: Rilutek (brand name) (riluzole), Radicut (brand name) (edaravone), and Qalsody® (tofersen). Riluzole is a glutamate transmission inhibitor developed by Rhone-Poulenc-Rorer (now Sanofi). Glutamate is used as a neurotransmitter in approximately 70% of neurons in the mammalian central nervous system and is involved in higher brain functions. However, excess extracellular glutamate is known to be neurotoxic (excitotoxicity), and excitotoxic neuronal death is thought to be one of the causes of ALS (Non-Patent Document 1) [1]. Riluzole protects motor neurons from excitotoxicity by inhibiting glutamate release and activating glutamate transporters. Edaravone is a free radical scavenger developed by Mitsubishi Tanabe Pharma Corporation. In 1993, mutations in the SOD1 gene, a reactive oxygen decomposition enzyme, were identified as the causative gene for familial ALS, suggesting that oxidative stress caused by free radicals is involved in the onset of ALS (Non-Patent Documents 2, 3) [2, 3]. Edaravone was originally approved for the treatment of acute cerebral infarction, but clinical trials in ALS patients demonstrated its ability to slow symptom progression, leading to its approval as a novel therapeutic agent in June 2015. However, both riluzole and edaravone have limited efficacy, only slowing symptom progression. Therefore, new therapeutic agents that can provide causal treatment for ALS are needed. Tofersen is an antisense oligonucleotide drug developed by Biogen that targets the production of superoxide dismutase 1 (SOD1), and was approved for medical use in the United States on April 25, 2023. Mutations in SOD1 are associated with ALS, and tofersen acts on the SOD1 gene (Non-patent Document 4) [4].
[0004] In recent years, TAR DNA-binding protein 43 (TDP-43), a 43kDa protein, has attracted attention as a potential drug target for ALS. Arai et al. and Neumann et al. identified TDP-43 as a common component of ubiquitin-positive inclusion bodies in ALS in 2006 (Non-Patent Documents 5 and 6) [5, 6]. Furthermore, it has been shown that the RNA-binding protein TDP-43 is contained in insoluble structures found in motor neurons in over 90% of ALS patients. Furthermore, reduced TDP-43 splicing function has been detected in the brains of sporadic ALS patients, which account for the majority of ALS cases. Although the detailed molecular mechanism remains unclear, it is strongly suspected that TDP-43 dysfunction is involved in the process leading to motor neuron loss in ALS (Non-Patent Documents 7-9) [7-9]. Therefore, attempts have been made to suppress the expression of TDP-43 and inhibit its aggregation, but their effectiveness has not been proven (Non-Patent Documents 10-11, Patent Document 1) [10-12].
[0005] Patent No. 6332723
[0006] Lewerenz J & Maher P (2015). Chronic glutamate toxicity in neurodegenerative diseases. Frontiers in Neuroscience, 9, 469.Ogasawara, M, Matsubara, Y, Narisawa, K, Aoki, M, Nakamura, S, Itoyama, Y, & Abe, K (1993). Mild ALS in Japan associated with novel SOD mutations. Nature genetics, 5, 323-324.Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, Donaldson D, Goto J, O'Regan JP, Deng HX, Rahmani Z, Krizus A, McKenna-Yasek D, Cayabyab A, Gaston SM, Berger R, Tanzi RE, Halperin JJ, 2005; Herzfeldt B, Van den Bergh R, Hung WY, Bird T, Deng G, Mulder DW, Smyth C, Laing NG, Soriano E, Pericak-Vance MA, Haines J, Rouleau GA, Gusella JS, Horvitz HR & Brown RH Jr (1993). Mutations in the Cu / Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature, 362, 59-62.Cerillo, JL, & Parmar, M. (2023). Tofersen. In StatPearls. StatePearls Publishing.Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi MC, Chou TT, Bruce J, Schuck T, Grossman M, Clark CM, McCluskey LF, Miller BL, Masliah E, Mackenzie IR, Feldman H, Feiden W, Kretzschmar HA, Trojanowski JQ, & Lee VM (2006). Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science, 314, 130-133.Arai T, Hasegawa M, Akiyama H, Ikeda K, Nonaka T, Mori H, Mann D, Tsuchiya K, Yoshida M, Hashizume Y, & Oda T (2006) TDP-43 is a component of ubiquitin-positive tau-negative inclusions in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. BBRC, 351, 602-611Laferriere F, & Polymenidou M (2015). Advances and challenges in understanding the multifaceted pathogenesis of amyotrophic lateral sclerosis. Swiss medical weekly, 145.Ling SC., Polymenidou M, & Cleveland DW (2013). Converging mechanisms in ALS and FTD: disrupted RNA and protein homeostasis. Neuron, 79, 416-438.Ling JP, Pletnikova O, Troncoso JC, & Wong PC (2015).TDP-43 repression of nonconserved cryptic exons is compromised in ALS-FTD. Science, 349, 650-655.Tamaki Y, Shodai A, Morimura T, Hikiami R, Minamiyama S, Ayaki T, I Tooyama, Y Furukawa, R Takahashi & Urushitani, M. (2018). Elimination of TDP-43 inclusions linked to amyotrophic lateral sclerosis by a misfolding-specific intrabody with dual proteolytic signals. Scientific reports, 8, 1-16.Prasad A, Bharathi V, Sivalingam V, Girdhar A, & Patel BK (2019). Molecular mechanisms of TDP-43 misfolding and pathology in amyotrophic lateral sclerosis. Frontiers in molecular neuroscience, 12.
[0007] An object of the present invention is to provide a pharmaceutical composition that regulates the expression of a TDP-43 splicing variant (TDPsv), for example, a pharmaceutical composition containing an antisense oligonucleotide (ASO), and a method for preventing or treating a disease or condition using the same. Another object of the present invention is to provide an ASO that has high knockdown efficiency for TDPsv gene expression and high intracellular uptake efficiency.
[0008] Since its discovery in 2006 as a major component of ubiquitin-positive intracellular inclusions that specifically appear in ALS lesions, TDP-43 has become one of the most noteworthy proteins in the field of neurodegenerative diseases [5, 6]. The TDP-43 protein in the inclusions undergoes abnormal phosphorylation and ubiquitination, resulting in aggregation, which is known to cause cytotoxicity. Furthermore, TDP-43 protein disappears from the nucleus in cells with inclusions, suggesting that loss of TDP-43 function may also contribute to the pathogenesis of the disease. Based on these findings, neurodegenerative diseases accompanied by nuclear loss of TDP-43 protein and cytoplasmic aggregation are considered TDP-43 proteinopathies
[0013] .
[0009] The main cause of TDP-43 proteinopathy is thought to be overexpression of TDP-43, and methods to correct overexpression of TDP-43 are being actively researched. However, TDP-43 is an important gene that is thought to perform multifaceted RNA regulation, including translational control and splicing control, and its expression cannot be easily suppressed. Furthermore, since TDP-43 expression levels are self-regulated and its intracellular concentration is strictly controlled, it is thought to be difficult to control the expression level of TDP-43 itself
[0014] .
[0010] Numerous target RNAs for which TDP-43 selectively suppresses pseudoexons have been identified [9]. It has been suggested that if the functional impairment of normal TDP-43 leads to the simultaneous selection of multiple target pseudoexons, frameshifts may occur during the subsequent translation process, promoting the expression of abnormal proteins, such as toxic or dysfunctional proteins. Therefore, it is highly likely that impaired TDP-43 function will affect the RNA metabolism of multiple targets and disrupt cellular homeostasis. Most normal TDP-43 is localized in the nucleus, where it is thought to primarily regulate pseudoexon targeting and alternative splicing. In previous research, the inventors have discovered that MP-13 protein, a splicing variant of TDP-43, is retained in the nucleus in postmortem spinal motor neurons of ALS patients, and that MP-13 protein similarly inhibits the splicing function of normal TDP-43 in a dominant-negative manner (unpublished data). These findings suggest that MP-13, which has DN activity, may accumulate in the nucleus of human motor neurons, thereby inhibiting the function of normal TDP-43. Furthermore, the inventors have confirmed that overexpression of MP-13 in human iPS cell-derived neural stem cells results in significant cell toxicity (unpublished data), and believe that MP-13 is highly likely to be toxic to motor neurons, which are considered to be more vulnerable than other neurons. Based on these findings, ASOs that specifically suppress MP-13 expression, normalize the function of normal TDP-43, and correct the abnormal localization of MP-13, are believed to be potential therapeutic agents for ALS.
[0011] Furthermore, characteristic pathological findings of TDP-43 have been confirmed not only in ALS cases but also in dementia. In recent years, it has been suggested that approximately one-third of patients diagnosed with Alzheimer's disease may have a different form of dementia called limbic-predominant senile TDP-43 encephalopathy
[0015] . Furthermore, TDP-43 deposition has also been observed in some cases of frontotemporal degeneration [5], suggesting that TDP-43 abnormalities may also affect neurodegeneration in areas other than motor neurons. If the mechanism by which neuronal death is suppressed by correcting TDP-43 abnormalities is clarified, it could potentially lead to therapeutic treatments for not only ALS but also various diseases involving this mechanism.
[0012] The present invention is based on the above findings and includes the following aspects:
[0013] [Aspect 1] An oligonucleotide comprising a complementary region substantially complementary to at least a portion of MP-13 mRNA (SEQ ID NO: 70). [Aspect 2] The oligonucleotide according to Aspect 1, wherein the oligonucleotide comprises a complementary region substantially complementary to at least bases 778 to 783 of MP-13 mRNA (SEQ ID NO: 70). [Aspect 3] The oligonucleotide according to Aspect 1 or 2, wherein the oligonucleotide is an essentially single-stranded molecule. [Aspect 4] The oligonucleotide according to any of Aspects 1 to 3, wherein the oligonucleotide is an antisense oligonucleotide (ASO). [Aspect 5] The oligonucleotide according to any of Aspects 1 to 4, wherein the oligonucleotide is a gapmer. [Aspect 6] The oligonucleotide according to any of Aspects 1 to 5, wherein the oligonucleotide is 12 to 24 bases in length. [Aspect 7] The oligonucleotide according to any of Aspects 1 to 6, wherein the oligonucleotide is 80% or more complementary to MP-13 mRNA (SEQ ID NO: 70). [Aspect 8] The oligonucleotide according to any of Aspects 1 to 7, wherein the oligonucleotide is 100% complementary to MP-13 mRNA (SEQ ID NO: 70). [Aspect 9] The oligonucleotide according to any one of Aspects 1 to 8, wherein the oligonucleotide comprises modified nucleosides and / or modified internucleoside linkages. [Aspect 10] The oligonucleotide according to Aspect 9, wherein the modified nucleosides are bridged nucleic acids and / or 2'-modified nucleic acids. [Aspect 11] The oligonucleotide according to Aspect 10, wherein the modified nucleosides are LNA and / or 2'-MOE. [Aspect 12] The oligonucleotide according to any one of Aspects 9 to 11, wherein the modified internucleoside linkages are phosphorothioate linkages. [Aspect 13] The oligonucleotide according to any one of Aspects 9 to 12, wherein all internucleoside linkages are phosphorothioate linkages. [Aspect 14] The oligonucleotide according to any one of Aspects 9 to 13, wherein the modified internucleoside linkages are chiral-controlled. [Aspect 15] The oligonucleotide according to any one of Aspects 1 to 14, wherein one or both of the terminal hydroxyl groups of the oligonucleotide are modified.[Aspect 16] The oligonucleotide according to any one of Aspects 1 to 15, wherein a phosphate group has been added to one or both of the terminal hydroxyl groups of the oligonucleotide. [Aspect 17] The oligonucleotide according to any one of Aspects 1 to 16, wherein one or both of the terminal hydroxyl groups of the oligonucleotide are unmodified. [Aspect 18] The oligonucleotide according to any one of Aspects 1 to 17, wherein a phosphate group has not been added to one or both of the terminal hydroxyl groups of the oligonucleotide. [Aspect 19] The oligonucleotide according to any one of Aspects 1 to 18, wherein the oligonucleotide comprises any one of the sequences set forth in SEQ ID NOs: 1 to 62. [Aspect 20] The oligonucleotide according to any one of Aspects 1 to 18, wherein the oligonucleotide consists of any one of the sequences set forth in SEQ ID NOs: 1 to 62. [Aspect 21] The oligonucleotide according to any one of Aspects 1 to 18, wherein the oligonucleotide consists of a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of the sequences set forth in SEQ ID NOs: 1 to 62.[Aspect 22] 04J01-13034, 04J01-13035, 04J01-14027, 04J01-14028, 04J01-14029, 04J01-14030, 04J01-14031, 04J01-14036, 04J01-14037, 04J01-14038, 04J01-14039, 04J01-14040, 04J01-14041, 04J01-14042, 04J01-14043, 04J01-140 44, 04J01-14045, 04J01-14046, 04J01-14047, 04J01-14048, 04J01-14049, 04J01-14050, 04J01-14051, 04J01-14052 , 04J01-14053, 04J01-15032, 04J01-15033, 04J01-15054, 04J01-15055, 04J01-15056, 04J01-15057, 04J01-15058, 0 4J01-15059, 04J01-15060, 04J01-15061, 04J01-15062, 04J01-15063, 04J01-15064, 04J01-15065, 04J01-15066, 04 J01-15067, 04J01-16001, 04J01-16002, 04J01-16003, 04J01-16004, 04J01-16005, 04J01-16006, 04J01-16007, 04J0 1-16008, 04J01-16009, 04J01-16025, 04J01-16026, 04J01-16068, 04J01-16069, 04J01-16070, 04J01-16071, 04J01-16072, 04J01-16073, 04J01-16074, 04J01-16075, 04J01-16076, and 04J01-16077, or a salt thereof. [Aspect 23] A pharmaceutical composition comprising the oligonucleotide according to any one of Aspects 1 to 22, and a pharmaceutically acceptable excipient, buffer, and / or additive. [Aspect 24] The pharmaceutical composition according to Aspect 23, for use in suppressing MP-13 mRNA. [Aspect 25] The pharmaceutical composition according to Aspect 23, for use in suppressing neuronal cell death. [Aspect 26] The pharmaceutical composition according to Aspect 23, for use in treating or preventing amyotrophic lateral sclerosis.[Aspect 27] The pharmaceutical composition according to Aspect 23, for use in treating or preventing frontotemporal degeneration, dementia, or Alzheimer's disease. [Aspect 28] An siRNA comprising the oligonucleotide according to any one of Aspects 1 to 22 and a complementary strand thereof.
[0014] Figure 1 shows a comparison of the sequences of full-length TDP-43 mRNA and its splicing variant, MP-13 mRNA. Figure 2 shows the nucleotide sequence of MP-13, a splicing variant of TDP-43 (SEQ ID NO: 70). The three bases (bases 778 to 783 of MP-13) before and after the transition between TDP-43 FL and MP-13 (i.e., the portion of MP-13 where bases 870 and 1886 of TDP-43 FL are linked) are underlined. Figure 3 shows the nucleotide sequence of the human TDP-43 gene (NM_007375.4) (SEQ ID NO: 71). Figure 4 is a graph showing changes in Venus mRNA levels in MP-13-Venus / HEK293 cells following the addition of ASO in the presence of a transfection reagent. Figure 1 shows data for TDP-FL and Venus mRNA obtained by real-time PCR 48 hours after transfection. The vertical axis indicates the relative value of the mRNA level. Figure 5 is a graph showing the change in Venus mRNA level in MP-13-Venus / HEK293 cells due to the addition of ASO in the presence of a transfection reagent. Figure 1 shows data for TDP-FL and Venus mRNA obtained by real-time PCR 48 hours after transfection. The vertical axis indicates the relative value of the mRNA level. Figure 6 is a graph showing the change in Venus mRNA level in MP-13-Venus / HEK293 cells due to the addition of ASO in the presence of a transfection reagent. Figure 1 shows data for TDP-FL and Venus mRNA obtained by real-time PCR 48 hours after transfection. The vertical axis indicates the relative value of the mRNA level. Figure 7 is a graph showing changes in Venus mRNA levels in MP-13-Venus / HEK293 cells following the addition of ASO in the presence of a transfection reagent. Data for TDP-FL and Venus mRNA obtained by real-time PCR 24 and 48 hours after transfection are shown. The vertical axis indicates the relative value of the mRNA level.Figure 8 is a graph showing changes in Venus mRNA levels in MP-13-Venus / HEK293 cells following the addition of HDO-modified ASO in the presence of a transfection reagent. Data for TDP-FL and Venus mRNA obtained by real-time PCR 48 hours after transfection are shown. The vertical axis indicates relative values for mRNA levels. Figure 9 is a graph showing the inhibitory effect of MOE gapmers on MP-13 mRNA. Figure 10 is a graph showing the inhibitory effect of MP-13 siRNA.
[0015] The present inventors have developed a method for efficiently regulating the expression of MP-13 mRNA in cells using oligonucleotides. The present invention is described in detail below.
[0016] MP-13 mRNA TDP-43 is a protein consisting of 414 amino acid residues with a molecular weight of 43 kDa and containing two RNA recognition motifs (RRM1 and RRM2) of approximately 90 amino acid residues. Initially, TDP-43 was identified as a protein that binds to the TAR (Trans-activation response) region within the LTR (Long Terminal Repeat) of the HIV-1 viral genome. However, as mentioned above, TDP-43 became one of the most notable proteins in the field of neurodegenerative diseases after its discovery in 2006 as a major component of ubiquitin-positive intracellular inclusions that appear specifically at the site of ALS lesions. The TDP-43 protein in the inclusions aggregates due to abnormal phosphorylation and ubiquitination, a process known to cause cytotoxicity. Furthermore, TDP-43 protein disappears from the nucleus in cells containing inclusions, suggesting that loss of TDP-43 function may also contribute to the pathogenesis of ALS. For these reasons, neurodegenerative diseases accompanied by the loss of TDP-43 protein from the nucleus and its aggregation in the cytoplasm are considered to be TDP-43 proteinopathies. The main cause of TDP-43 proteinopathies is thought to be overexpression of TDP-43, and methods to correct overexpression of TDP-43 are being actively researched. However, TDP-43 is an important gene that is thought to perform multifaceted RNA regulation, including translational control and splicing control, and its expression cannot be easily suppressed. Furthermore, since TDP-43 expression levels are self-regulated and its intracellular concentration is strictly controlled, it is thought to be difficult to control the expression level of TDP-43 itself.
[0017] In previous research, the inventors have discovered that MP-13 protein accumulates in the nucleus of spinal motor neurons from postmortem ALS patients, and that MP-13 protein can also inhibit the splicing function of normal TDP-43 to DN. Based on these findings, it is highly likely that MP-13, which has DN activity, accumulates in the nucleus of human motor neurons, thereby inhibiting the function of normal TDP-43. Furthermore, the inventors have confirmed that overexpression of MP-13 in iPS cell-derived neural stem cells results in significant toxicity to the cells, and believe that MP-13 is highly likely to be toxic to motor neurons, which are considered to be more vulnerable than other neurons.
[0018] In other words, those skilled in the art will understand that specific inhibition of MP-13 expression normalizes the function of normal TDP-43 and corrects the abnormal localization of MP-13, thereby enabling the treatment and prevention of ALS. Accordingly, one aspect of the present disclosure relates to a method for treating or preventing ALS, which includes specifically inhibiting MP-13 expression in a subject, and to a drug that specifically inhibits MP-13 expression. In some embodiments, the drug that specifically inhibits MP-13 expression can be, for example, a nucleic acid drug, more specifically, an antisense oligonucleotide (ASO). Comparing the sequences of full-length TDP-43 mRNA (hereinafter also referred to as TDP-43 FL) and its splicing variant, MP-13 mRNA (hereinafter simply referred to as MP-13), reveals that MP-13 is missing bases 871 to 1885 of TDP-43 FL (Figure 1). Therefore, for example, by designing a nucleic acid drug (e.g., an antisense oligonucleotide, siRNA, aptamer, etc.) that targets the transition region between TDP-43 FL and MP-13 (i.e., the region in MP-13 where bases 870 and 1886 of TDP-43 FL are linked), it is possible to specifically knock down MP-13 mRNA. Thus, by using a base sequence that is present in MP-13 mRNA but not in TDP-43 FL mRNA as the target sequence, MP-13 mRNA can be specifically targeted. Thus, in some embodiments, the ASO of the present invention comprises a sequence substantially complementary to a base sequence that is present in MP-13 mRNA but not in TDP-43 FL mRNA. Furthermore, in some embodiments, the ASO of the present invention comprises a sequence substantially complementary to the region in MP-13 where bases 870 and 1886 of TDP-43 FL are linked. Furthermore, in some embodiments, the ASO of the present invention comprises a sequence that is substantially complementary to a 12-24 base sequence in MP-13 that includes bases corresponding to bases 870 and 1886 of TDP-43 FL.
[0019] Suppression of MP-13 expression can be achieved by reducing the amount of protein synthesized through transcription and translation to 75% or less, 50% or less, 40% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 3% or less compared to when the drug is not administered. One aspect of the present invention relates to a pharmaceutical composition for use in treating or preventing diseases or symptoms associated with expression of the TDP-43 gene, particularly MP-13 expression, in a subject. In certain embodiments, the target disease or symptom is a neurodegenerative disease associated with TDP-43, more specifically, amyotrophic lateral sclerosis (ALS), frontotemporal degeneration, dementia, Alzheimer's disease, etc.
[0020] The nucleotide sequences of the TDP-43 gene and its mRNA are known and can be easily obtained from databases such as GenBank. For example, the sequence of NCBI accession number NM_007375.4 ( FIG. 3 ; SEQ ID NO: 71) can be used as the mRNA sequence of the human TDP-43 gene.
[0021] Antisense Oligonucleotides (ASOs) Antisense oligonucleotides (also referred to as ASOs) refer to single-stranded oligonucleotides that have a sequence substantially complementary to at least a portion of a target nucleic acid and hybridize via Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between corresponding nucleobases. Antisense oligonucleotides can exhibit detectable or measurable antisense activity resulting from hybridization to their target nucleic acid. The mechanism by which the antisense effect is achieved includes any mechanism resulting from hybridization between an antisense oligonucleotide and a target nucleic acid; for example, the result or effect of the hybridization can be either target degradation or target occupation. In certain embodiments, antisense activity is a reduction in the amount or expression of a target nucleic acid or a reduction in the amount or expression of a protein encoded by such a target nucleic acid. For example, antisense activity, in certain embodiments, is antisense inhibition by target degradation (cleavage), which refers to a reduction in target nucleic acid levels in the presence of an antisense oligonucleotide complementary to the target nucleic acid. In particular, antisense oligonucleotides containing at least four or more consecutive DNA bases hybridize with target RNA to serve as substrates for intracellular RNase H, and can induce specific degradation (cleavage) of the target RNA. In certain embodiments, the antisense activity is the inhibition of protein binding due to steric hindrance caused by target occupation, resulting in translational repression or splicing regulation (e.g., exon skipping).
[0022] Antisense oligonucleotides are single-stranded oligomers composed primarily of deoxyribonucleosides (DNA), ribonucleosides (RNA), modified nucleosides, and nucleoside mimetics (e.g., morpholino nucleic acids, peptide nucleic acids). Chimeric antisense oligonucleotides with internal regions containing multiple nucleosides (e.g., four or more consecutive deoxyribonucleosides) that induce RNase H cleavage on both sides or external regions containing one or more nucleosides (e.g., sugar-modified nucleosides such as LNA) on one side are called gapmers. In particular, those whose external regions are entirely LNA are called LNA gapmers. Chimeric antisense oligonucleotides with an external region on only one side are also called hemigapmers. The nucleosides contained in the internal regions have chemical properties that are different from those contained in the external regions. The internal regions are sometimes called "gaps," and the external regions are sometimes called "wings." For example, a 14-base gapmer having 3-base wing regions on each of the 5' and 3' sides and an 8-base gap region may be referred to as a 3-8-3 gapmer. In certain embodiments, the antisense oligonucleotide may be a 2-10-2 gapmer, a 2-9-3 gapmer, a 3-9-2 gapmer, a 3-8-3 gapmer, a 3-7-4 gapmer, a 4-7-3 gapmer, or a 4-6-4 gapmer. In certain embodiments, the antisense oligonucleotide may be a 2-10-2 LNA gapmer, a 2-9-3 LNA gapmer, a 3-9-2 LNA gapmer, a 3-8-3 LNA gapmer, a 3-7-4 LNA gapmer, a 4-7-3 LNA gapmer, or a 4-6-4 LNA gapmer. The number of bases in the internal region (gap region) may be one or more, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases, but is not limited thereto. The number of bases in the external regions (wing regions) on the 5' and 3' sides can be, independently, 0 or more, for example, 1, 2, 3, 4, 5, or 6 bases, but is not limited thereto. The 5' and 3' wing regions may each have a different number of bases.In certain embodiments, the wing regions may be composed of the same or different sugar-modified nucleosides, and the sugar-modified nucleosides in the wing regions may be, for example, but not limited to, LNA. In some embodiments, the modification may be a 2'-MOE (2'-O-methoxyethyl) modification, and the above description of LNA also applies to MOE.
[0023] In certain embodiments, antisense oligonucleotides may contain modified nucleosides and / or modified internucleoside linkages. In certain embodiments, antisense oligonucleotides may have one or both terminal hydroxyl groups modified, for example, a phosphate group added to one or both terminal hydroxyl groups. In certain embodiments, antisense oligonucleotides may be at least 8 bases long, for example, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 bases long, but are not limited thereto. In some embodiments, ASOs of approximately 14 bases are preferably used.
[0024] In a specific embodiment, the antisense oligonucleotide of the present invention is selected from the group consisting of 04J01-13034, 04J01-13035, 04J01-14027, 04J01-14028, 04J01-14029, 04J01-14030, 04J01-14031, 04J01-14036, 04J01-14037, 04J01-14038, 04J01-14039, 04J01-14040, 04J01-14041, 04J01-14042, 04J01-14043, 04J01-14044, 04J01-14045, 04J01-14046, 04J01-14047, 04J01-14048, 04J01-14049, 04J01-14050, 04J01-14051 , 04J01-14052, 04J01-14053, 04J01-15032, 04J01-15033, 04J01-15054, 04J01-15055, 04J01-15056, 04J01-15057, 04J01-1505 8, 04J01-15059, 04J01-15060, 04J01-15061, 04J01-15062, 04J01-15063, 04J01-15064, 04J01-15065, 04J01-15066, 04J01-15 067, 04J01-16001, 04J01-16002, 04J01-16003, 04J01-16004, 04J01-16005, 04J01-16006, 04J01-16007, 04J01-16008, 04J01-1 The antisense oligonucleotides may be any of the following: 04J01-16025, 04J01-16026, 04J01-16068, 04J01-16069, 04J01-16070, 04J01-16071, 04J01-16072, 04J01-16073, 04J01-16074, 04J01-16075, 04J01-16076, and 04J01-16077, or oligonucleotides having the same base sequence as these oligonucleotides but different modifications. These antisense oligonucleotides are 14-16 bases long and contain a base sequence complementary to bases 778 to 783 of MP-13 mRNA (SEQ ID NO:70).Thus, the antisense oligonucleotide of the present invention may be, for example, a 14- to 16-base oligonucleotide complementary to the nucleotide sequence ranging from bases 767 to 794 of MP-13 mRNA (SEQ ID NO: 70). The antisense oligonucleotide of the present invention may be, for example, an oligonucleotide consisting of a sequence complementary to bases 773 to 787 of SEQ ID NO: 70, an oligonucleotide consisting of a sequence complementary to bases 773 to 786 of SEQ ID NO: 70, or an oligonucleotide consisting of a sequence complementary to bases 773 to 788 of SEQ ID NO: 70. Furthermore, the antisense oligonucleotide of the present invention may have a sequence that has 80% or more, 85% or more, 90% or more, 95% or more, 86% or more, 97% or more, 98% or more, or 99% or more percent identity to the sequence of the above-described oligonucleotide. The antisense oligonucleotide of the present invention may also be in the form of a pharmaceutically acceptable salt, a prodrug, a pharmaceutically acceptable salt of such a prodrug, or another bioequivalent. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
[0025] The ASO of the present invention can be produced by known chemical synthesis methods or enzymatic transcription methods. Examples of known chemical synthesis methods include the phosphoramidite method, phosphorothioate method, and phosphotriester method. For example, ASO can be synthesized using an ABI3900 high-throughput nucleic acid synthesizer (manufactured by Applied Biosystems), an NTS H-6 nucleic acid synthesizer (manufactured by Nippon Techno Service), or an Oligolot 10 nucleic acid synthesizer (manufactured by GE Healthcare). Examples of enzymatic transcription methods include transcription using an RNA polymerase such as T7, T3, or SP6 RNA polymerase, using a plasmid or DNA having the desired base sequence as a template. The ASO produced by the synthesis or transcription method is then purified by HPLC or other methods. For example, during HPLC purification, the ASO is eluted from a column using a mixed solution of triethylammonium acetate (TEAA) or hexylammonium acetate (HAA) and acetonitrile. The eluted solution is then dialyzed for 10 hours against distilled water in an amount 1000 times the elution volume, and the dialyzed solution is freeze-dried and stored frozen until use, at which point it is dissolved in distilled water to a final concentration of about 100 μM.
[0026] The nucleic acid used in the ASO of the present invention may be any molecule formed by polymerizing nucleosides or molecules with equivalent functions to nucleosides via internucleoside bonds. Nucleosides are a type of compound in which a base (nucleobase) is bound to a sugar. Bases include purine bases such as adenine and guanine, pyrimidine bases such as thymine, cytosine, and uracil, nicotinamide, and dimethylisoalloxazine. Representative nucleosides include adenosine, thymidine, guanosine, cytidine, and uridine. A nucleotide is a substance in which a phosphate group is bound to a nucleoside. Examples of oligonucleotides (also called polynucleotides) include RNA, which is a polymer of ribonucleotides; DNA, which is a polymer of deoxyribonucleotides; a mixed polymer of RNA and DNA; and a nucleotide polymer containing modified nucleosides. Natural DNA and RNA have phosphodiester bonds as internucleoside bonds. The nucleic acid used in the ASO of the present invention may be modified. The positions of nucleic acid modifications include the sugar moiety, backbone (linkage) moiety, nucleic acid base (base) moiety, and 3' or 5' terminal moiety. The ASO used in the present invention may also include morpholino nucleic acids and peptide nucleic acids.
[0027] Modified Nucleosides Examples of modified nucleosides include ribonucleosides, deoxyribonucleosides, and RNA or DNA molecules modified to improve or stabilize nuclease resistance, increase affinity with complementary nucleic acids, increase cell permeability, or facilitate visualization, compared to RNA or DNA. Examples include sugar-modified nucleosides such as 2'-MOE, LNA, and ENA. The ASO of the present invention may contain, for example, a modified nucleic acid molecule disclosed in Khvorova & Watts (Nature Biotechnology 35, 238-248 (2017) doi:10.1038 / nbt.3765).
[0028] A modified sugar refers to a sugar having a substitution and / or any change from a natural sugar moiety (i.e., the sugar moiety found in DNA (2'-H) or RNA (2'-OH)), and a sugar-modified nucleoside refers to a modified nucleoside containing a modified sugar. The sugar-modified nucleoside may be any nucleoside in which any chemical structural substance has been added to or substituted for a part or all of the chemical structure of the sugar of the nucleoside, and examples thereof include modified nucleosides substituted with 2'-O-methylribose, modified nucleosides substituted with 2'-O-propylribose, modified nucleosides substituted with 2'-methoxyethoxyribose, modified nucleosides substituted with 2'-O-methoxyethylribose, modified nucleosides substituted with 2'-O-[2-(guanidium)ethyl]ribose, modified nucleosides substituted with 2'-O-fluororibose, bridged nucleic acids (BNAs) that have two cyclic structures by introducing a bridged structure into the sugar moiety, more specifically, locked nucleic acids (LNAs) in which the oxygen atom at the 2' position and the carbon atom at the 4' position are bridged via a methylene, and ethylene-bridged artificial nucleic acids (Ethylene-bridged artificial nucleic acids). Examples include bridged nucleic acid (ENA) [Nucleic Acid Research, 32, e175 (2004)], and further examples include peptide nucleic acid (PNA) [Acc. Chem. Res., 32, 624 (1999)], oxypeptide nucleic acid (OPNA) [J. Am. Chem. Soc., 123, 4653 (2001)], and peptide ribonucleic acid (PRNA) [J. Am. Chem. Soc., 122, 6900 (2000)].
[0029] The 2'-O-methyl (2'-OMe) modification of RNA (2'-OMe-RNA) is a naturally occurring modification that enhances the binding affinity and nuclease resistance of modified oligonucleotides while reducing their immunostimulatory potential. 2'-O-Methoxyethyl (2'-MOE) modification further enhances nuclease resistance compared to the 2'-OMe modification and significantly increases the binding affinity (ΔTm) of the modified nucleotide. 2'-Fluoro (2'-F) modification of RNA (2'-F-RNA) can also be used to increase the affinity of oligonucleotides. Other 2'-modified nucleic acids include AmNA, GuNA, scpBNA, 5'-CP, 2'-O-MCE, 2'-O-MOCE, 2'-O-DMCE, 2'-O-CE, 4'-C-OMe-2'-F, 2'-F-ANA, and the 2'-modified derivatives of Sekine et al. (Patent No. 5194256, JP 2015-020994 A).
[0030] Locked nucleic acid (LNA), which links the 2' oxygen and 4' carbon of ribose, significantly increases binding affinity. In LNA, the 2' oxygen and 4' carbon of the ribose sugar of RNA are fixed in a ring structure. This modification increases specificity, affinity, and half-life, enabling effective delivery to target tissues with lower toxicity. However, oligomers longer than approximately 8 nucleotides fully modified with LNA are known to tend to aggregate, and are generally used in combination with DNA or other sugar-modified nucleic acids.
[0031] The methylated analog of LNA, cEt, is also useful as LNA. Tricyclo-DNA (tcDNA) is a constrained nucleotide based on a three-ring backbone.
[0032] Other examples of modified nucleosides include those in which an atom (e.g., hydrogen atom, oxygen atom) or functional group (e.g., hydroxyl group, amino group) in the base portion of a nucleic acid is substituted with another atom (e.g., hydrogen atom, sulfur atom), functional group (e.g., amino group), or alkyl group having 1 to 6 carbon atoms, or those protected with a protecting group (e.g., methyl group or acyl group), and molecules in which another chemical substance such as a lipid, phospholipid, phenazine, folate, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, or dye is added to a nucleoside.
[0033] Modified nucleobases (or modified bases) include any nucleobase other than adenine, cytosine, guanine, thymine, or uracil, such as 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, 5-iodocytosine, N4-methylcytosine, 5-fluorouracil, 5-bromouracil, 5-iodouracil, 2-thiothymine, N6-methyladenine, 8-bromoadenine, N2-methylguanine, 8-bromoguanine, and inosine. For example, oligonucleotides having the sequences of SEQ ID NOs: 1-62 may have at least one cytosine substituted with 5-methylcytosine, and in some embodiments, all cytosines may be substituted with 5-methylcytosine.
[0034] Internucleoside Linkage Natural DNA and RNA have phosphodiester bonds as internucleoside linkages. In one embodiment of the present invention, the internucleoside linkage may be modified. A modified internucleoside linkage refers to an internucleoside linkage that has been substituted or has any change from a naturally occurring internucleoside linkage (i.e., a phosphodiester linkage), and includes an internucleoside linkage that contains a phosphorus atom and an internucleoside linkage that does not contain a phosphorus atom. The modified internucleoside linkage may be one in which any chemical substance is added to or substituted for part or all of the chemical structure of the phosphate diester bond of a nucleotide, and examples thereof include a modified internucleoside linkage substituted with a phosphorothioate linkage, a modified internucleoside linkage substituted with an N3'-P5' phosphoamidate linkage, etc. Other modified internucleoside linkages include (S C5’ R p )-α, β-CNA, PMO, etc.
[0035] Representative phosphorus-containing internucleoside linkages include, for example, phosphodiester linkages, phosphorothioate linkages (also called thiophosphate linkages), phosphorodithioate linkages, phosphotriester linkages, as well as methylphosphonate linkages, methylthiophosphonate linkages, boranophosphate linkages, and phosphoramidate linkages.
[0036] Phosphorothioate (PS) linkages, one of the major internucleoside linkage modifications, help protect oligonucleotides from degradation by nucleases. While PS modifications were originally incorporated into oligonucleotides to confer nuclease resistance, this modification also has a significant impact on oligonucleotide transport and uptake. By altering the charge of ASOs, PS increases binding to receptor sites and plasma proteins, increasing the amount of ASO that reaches target tissues. Heparin-binding proteins are one of the highest affinity targets for phosphorothioate-modified oligonucleotides. Appropriate binding by plasma proteins prevents rapid clearance from the blood by the renal system, facilitating optimal delivery.
[0037] In some embodiments, the ASO of the invention comprises at least one modified internucleotide linkage, e.g., 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the total number of internucleotide linkages are modified internucleotide linkages. In one embodiment of the invention, an ASO is used in which all internucleotide linkages are modified internucleotide linkages (e.g., phosphorothioate linkages).
[0038] Phosphorothioate bonds have a stereogenic center at the phosphorus atom, and fully modified oligonucleotides usually have 2 n-1 A mixture of diastereomers (e.g., a 14-mer phosphorothioate oligonucleotide is a mixture of 2 diastereomers) 13 (It is a mixture of diastereomers.) p and R p Diastereomeric bonds are known to exhibit different properties. p The diastereomer is S p Although they are less nuclease resistant than diastereomers, they bind to complementary strands with higher affinity. In the ASO of the present invention, chiral control may be performed during synthesis of the modified internucleoside linkages, so that synthesis is controlled so that a specific phosphorothioate linkage becomes a specific diastereomer.
[0039] Oligonucleotides / Terminally Modified Oligonucleotides Linked with Ligands, etc. Examples of molecules in which another chemical substance is attached to a nucleic acid include 5'-polyamine-attached derivatives, cholesterol-attached derivatives, lipid-attached derivatives, fatty acid-attached derivatives, steroid-attached derivatives, bile acid-attached derivatives, vitamin-attached derivatives, Cy5-attached derivatives, Cy3-attached derivatives, 6-FAM-attached derivatives, biotin-attached derivatives, and derivatives by Kitade et al. (PCT / JP2007 / 000087, PCT / JP2016 / 59398). The site at which the ligand, etc. is attached can be the end (5'-end or 3'-end) of the oligonucleotide and / or the interior of the oligonucleotide. The ligand, etc., may be indirectly bound to the ASO to which the ligand, etc., is attached via hybridization with an oligonucleotide complementary to the ASO (WO2013 / 089283A1). In some embodiments, the ligand may be an antibody, peptide, or aptamer.
[0040] ASO and cholesterol can be linked via triethylene glycol (TEG), for example, as shown below.
[0041]
[0042] Known examples of terminal modifications include GalNAc-linked oligonucleotides and PUFA-linked oligonucleotides. Linking GalNAc to the terminus can increase the efficiency of oligonucleotide delivery to the liver. ASOs used in the present invention may be directly or indirectly linked to a ligand such as GalNAc.
[0043] Short oligonucleotides tend to be delivered primarily to the kidney, while long oligomers tend to be delivered primarily to the liver. Short oligonucleotides tend to bind less to plasma proteins, resulting in a shorter half-life in plasma, but they can be constructed into multimers using a cleavable linker or the like. The ASO used in the present invention may be linked to another ASO using a cleavable linker or the like.
[0044] The ASO of the present invention may have a phosphate group added to the 5'-end and / or 3'-end. Other terminal modifications include E-VP, methylphosphonate, phosphorothioate, and C-methyl analogs, which are known to enhance the stability of oligonucleotides. The ASO used in the present invention may contain these terminal modifications.
[0045] ASO Sequence Design ASO sequences can be designed based on the base sequence of the target gene. Methods for designing ASO sequences are known to those skilled in the art, and numerous ASOs have been designed and their activities evaluated. ASO sequences may be determined taking into account the secondary or tertiary structure of the target RNA. The present inventors use a proprietary algorithm named MobyDick (trademark) for sequencing.
[0046] Regarding nucleic acid structure prediction, the following references may be referred to: - Markham, N.R. & Zuker, M. (2005) DINAMElt web server for nucleic acid melting prediction. Nucleic Acids Res., 33, W577-W581; - Markham, N.R. & Zuker, M. (2008) UNAFold: software for nucleic acid folding and hybridization. In Keith, J.M., editor, Bioinformatics, Volume II. Structure, Function and Applications, number 453 in Methods in Molecular Biology, chapter 1, pages 3-31. Humana Press, Totowa, NJ. ISBN 978-1-60327-428-9.
[0047] In addition, when determining the sequence, not only the knockdown efficiency of the target gene but also toxicity, off-target effects, commonality between species, stability, intracellular uptake efficiency, and other factors can be taken into consideration.
[0048] Complementarity to Target Sequence The antisense oligonucleotides (ASOs) of the present invention can be substantially identical to any one of SEQ ID NOs: 1 to 62. Here, "substantially identical" does not necessarily mean that the oligonucleotide is completely (100%) identical to the target sequence, but rather has 80% or more identity. In certain embodiments, the oligonucleotide may have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1 to 62. Identity values can be calculated as described in WO 2016 / 027747 (the contents of which are incorporated herein by reference). Inhibition of expression or activity by an ASO refers to a reduction or prevention of expression or activity, and does not necessarily mean that expression or activity is completely eliminated.
[0049] One aspect of the present invention relates to a pharmaceutical composition for inhibiting the expression of MP-13 in cells, comprising as an active ingredient an oligonucleotide comprising a complementary region substantially complementary to at least a portion of an mRNA encoding MP-13, wherein the oligonucleotide is an antisense oligonucleotide consisting of a sequence substantially identical to any one of SEQ ID NOs: 1 to 62. Here, "substantially complementary" does not necessarily mean that the oligonucleotide is perfectly (100%) complementary to the target sequence, but rather means that it has 80% or more, for example, 85%, 90%, 95%, 98%, or 99% complementarity. The oligonucleotide may be an oligonucleotide consisting of a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1 to 62. In a specific embodiment, the oligonucleotide consists of a sequence 100% identical to any one of SEQ ID NOs: 1 to 62. In certain embodiments, the oligonucleotide may have additional sequences 5' and / or 3' to the region of complementarity.
[0050] Techniques for designing, preparing, and using antisense oligonucleotides are well known to those skilled in the art, and reference may be made, for example, to WO2016 / 027747 (the contents of which are incorporated herein by reference).
[0051] Oligonucleotide Delivery Oligonucleotides can be delivered to cells using DDS tools such as transfection reagents, liposomes, vectors, nanomicelles, and complementary nucleic acids. In some embodiments of the present invention, antisense oligonucleotides are essentially single-stranded molecules. Essentially single-stranded here means that the oligonucleotide may temporarily form a double strand with a separate complementary nucleic acid during the delivery or formulation process. When an oligonucleotide hybridizes to a target RNA to exert its antisense effect, it acts in the form of a single-stranded oligonucleotide, and ultimately forms a double strand with the target RNA and the ASO. In some embodiments of the present invention, oligonucleotides having the sequences of SEQ ID NOs: 1 to 62 can also be used as part of siRNA.
[0052] Hybrid ASOs International Publication No. 2013 / 089283 and Nishina et al., Nature Communications volume 6, Article number: 7969 (2015) describe that double-stranded oligonucleotides (also called HDOs) containing RNA oligonucleotides complementary to ASOs are delivered and accumulated in the liver more efficiently than ASOs, and suppress target gene expression in the liver. International Publication No. 2015 / 105083 describes ASOs in which a GalNAc derivative is linked to an HDO via a linker, and describes that the use of such antisense oligonucleotides suppresses target gene expression more efficiently than tocopherol (Toc)-modified oligonucleotides. Furthermore, International Publication No. 2017 / 13112 describes that single-stranded oligonucleotides in which a complementary oligonucleotide is linked to an ASO to form an intramolecular duplex exhibit antisense effects equal to or greater than those of double-stranded oligonucleotides. Thus, in some embodiments of the present invention, the ASO may form a duplex with a nucleic acid strand complementary thereto. Also, in some embodiments of the present invention, the ASO may be linked to a nucleic acid strand complementary thereto, and a double-stranded portion may be formed by intramolecular self-annealing. Furthermore, in some embodiments of the present invention, a ligand such as tocopherol (Toc) or GalNAc may be linked to the nucleic acid region complementary to the ASO. Furthermore, in some embodiments, the oligonucleotides disclosed herein may be used as part of an siRNA duplex.
[0053] Although antisense nucleic acids can be formulated alone, they are usually mixed with one or more pharmacologically acceptable carriers and administered as pharmaceutical preparations prepared by any method well known in the art of pharmaceuticals. A pharmaceutical composition may contain a mixture of multiple ASOs with different sequences.
[0054] The subject of administration includes humans or non-human animals, for example, non-human mammals. The route of administration is preferably the most effective for treatment, and can be oral administration or parenteral administration such as oral, intratracheal, rectal, subcutaneous, intramuscular, intravenous, intrathecal, and transdermal administration, preferably intrathecal administration.
[0055] Formulations suitable for oral administration include emulsions, syrups, capsules, tablets, powders, granules, etc. Liquid preparations such as emulsions and syrups can be produced using additives such as water, sugars such as sucrose, sorbitol, and fructose, glycols such as polyethylene glycol and propylene glycol, oils such as sesame oil, olive oil, and soybean oil, preservatives such as p-hydroxybenzoic acid esters, and flavors such as strawberry flavor and peppermint. Capsules, tablets, powders, and granules can be produced using additives such as excipients such as lactose, glucose, sucrose, and mannitol, disintegrating agents such as starch and sodium alginate, lubricants such as magnesium stearate and talc, binders such as polyvinyl alcohol, hydroxypropyl cellulose, and gelatin, surfactants such as fatty acid esters, and plasticizers such as glycerin.
[0056] Formulations suitable for parenteral administration include injections, suppositories, and sprays. Injections are prepared using carriers such as salt solutions, glucose solutions, or mixtures of both. Suppositories are prepared using carriers such as cocoa butter, hydrogenated fats, or carboxylic acids. Sprays are prepared using carriers that do not irritate the recipient's oral and respiratory mucosa and disperse the active ingredient into fine particles for easy absorption.
[0057] Specific examples of carriers include lactose, glycerin, liposomes, nanomicelles, etc. Depending on the properties of the nucleic acid and the carrier used in the present invention, formulations such as aerosols and dry powders are possible. Furthermore, the components exemplified as additives for oral preparations can also be added to these parenteral preparations.
[0058] The dosage or frequency of administration varies depending on the desired therapeutic effect, administration method, treatment period, age, body weight, etc., but is, for example, 10 μg / kg to 100 mg / kg per day for an adult.
[0059] One embodiment of the present invention relates to a pharmaceutical composition for use in treating or preventing a disease or condition in a patient, comprising an approximately 14-20 mer oligonucleotide (ASO). The patient may be a human or a non-human animal. As used herein, a reference to an approximately 14 mer is understood to include a range of at least one base before and after the reference, i.e., 13 mer, 14 mer, and 15 mer, and a reference to an approximately 20 mer is understood to include 19 mer, 20 mer, and 21 mer. In some embodiments, a 14 mer ASO is preferably used.
[0060] One embodiment of the present invention relates to a pharmaceutical composition for the treatment or prevention of a disease or condition, or a pharmaceutical composition for use in the treatment or prevention of a disease or condition, comprising an ASO comprising or consisting of any of the following sequences: 04J01-13034, 04J01-13035, 04J01-14027, 04J01-14028, 04J01-14029, 04J01-14030, 04J01-14031, 04J01-14036 , 04J01-14037, 04J01-14038, 04J01-14039, 04J01-14040, 04J01-14041, 04J01-14042, 04J01-14043, 04J01-14044, 04J01-14045 , 04J01-14046, 04J01-14047, 04J01-14048, 04J01-14049, 04J01-14050, 04J01-14051, 04J01-14052, 04J01-14053, 04J01-15032, 04J01-15033, 04J01-15054, 04J01-15055, 04J01-15056, 04J01-15057, 04J01-15058, 04J01-15059, 04J01-15060, 04J01-15061, 04J01-15062, 04J01-15063, 04J01-15064, 04J01-15065, 04J01-15066, 04J01-15067, 04J01-16001, 04J01-16002, 04J01-16003, 0 4J01-16004, 04J01-16005, 04J01-16006, 04J01-16007, 04J01-16008, 04J01-16009, 04J01-16025, 04J01-16026, 04J01-16068, 04J01-16069, 04J01-16070, 04J01-16071, 04J01-16072, 04J01-16073, 04J01-16074, 04J01-16075, 04J01-16076, and 04J01-16077. Pharmaceutical compositions may also include oligonucleotides having the same base sequence as these oligonucleotides but different modifications.In certain embodiments, the disease or condition may be a neurodegenerative disease associated with TDP-43, more specifically, amyotrophic lateral sclerosis (ALS), frontotemporal degeneration, dementia, Alzheimer's disease, and the like.
[0061] Uses in the manufacture of medicaments and methods of treatment One aspect of the present invention relates to the use of about 14-20 mer oligonucleotides (ASOs) in the manufacture of medicaments for use in treating or preventing a disease or disorder in a patient. In some embodiments, 14 mer ASOs are preferred.
[0062] Another aspect of the present invention relates to a method for treating or preventing a disease or disorder in a patient, the method comprising administering to the patient an approximately 14-20 mer oligonucleotide (ASO). In some embodiments, a 14 mer ASO is preferably used.
[0063] Furthermore, one embodiment of the present invention relates to a method for treating or preventing a neurodegenerative disease associated with TDP-43 in a patient, more specifically, amyotrophic lateral sclerosis (ALS), frontotemporal degeneration, dementia, Alzheimer's disease, etc., the method comprising the step of administering to the patient an oligonucleotide comprising or consisting of any of the sequences selected from the following: 04J01-13034, 04J01-13035, 04J01-14027, 04J01-14028, 04J01-14029, 04J 01-14030, 04J01-14031, 04J01-14036, 04J01-14037, 04J01-14038, 04J01-14039, 04J01-14040, 04J01-14041, 04J01-14042, 04J01-140 43, 04J01-14044, 04J01-14045, 04J01-14046, 04J01-14047, 04J01-14048, 04J01-14049, 04J01-14050, 04J01-14051, 04J01-14052, 04J 01-14053, 04J01-15032, 04J01-15033, 04J01-15054, 04J01-15055, 04J01-15056, 04J01-15057, 04J01-15058, 04J01-15059, 04J01-150 60, 04J01-15061, 04J01-15062, 04J01-15063, 04J01-15064, 04J01-15065, 04J01-15066, 04J01-15067, 04J01-16001, 04J01-16002, 04J 01-16003, 04J01-16004, 04J01-16005, 04J01-16006, 04J01-16007, 04J01-16008, 04J01-16009, 04J01-16025, 04J01-16026, 04J01-16068, 04J01-16069, 04J01-16070, 04J01-16071, 04J01-16072, 04J01-16073, 04J01-16074, 04J01-16075, 04J01-16076, and 04J01-16077. Oligonucleotides having the same base sequences as these oligonucleotides but different modifications may also be used in the method.One aspect of the present invention relates specifically to a method for treating or preventing amyotrophic lateral sclerosis (ALS) in a patient.
[0064] Furthermore, some aspects of the present invention relate to pharmaceutical compositions for use in suppressing MP-13 mRNA and pharmaceutical compositions for use in suppressing neuronal cell death. Inhibiting MP-13 mRNA in vivo or ex vivo can have beneficial effects on cells. It will be understood by those skilled in the art that suppressing neuronal cell death in vivo can also enable the treatment or prevention of diseases such as neurodegenerative disorders.
[0065] Some aspects of the present disclosure relate to siRNAs capable of specifically suppressing MP-13 expression in a subject. siRNAs generally consist of double-stranded oligonucleotides of 21-23 base pairs, with a two-base overhang at the 3' end. One strand (the guide strand) is used to pair with the target mRNA in the RISC complex, while the other complementary strand (the passenger strand) is degraded. Thus, in some aspects of the present disclosure, the guide strand of the siRNA may contain a sequence identical to that of an antisense oligonucleotide of the present disclosure. In some aspects of the present disclosure, the siRNA may comprise a sequence of SEQ ID NO: 92-115. Those skilled in the art will appreciate that details regarding nucleic acid modification, delivery, pharmaceutical compositions, uses in pharmaceutical manufacturing, and therapeutic methods, as described with respect to ASOs, also apply to the siRNAs of the present disclosure.
[0066] The present invention will be specifically explained below by showing examples, but the present invention is not limited by these examples.
[0067] Example 1: Design and synthesis of an ASO targeting MP-13. Comparing the sequences of full-length TDP-43 mRNA (hereinafter also referred to as TDP-43 FL) and its splicing variant, MP-13 mRNA (hereinafter simply referred to as MP-13), it is found that MP-13 lacks bases 871 to 1885 of TDP-43 FL (Figure 1). The base sequence of the MP-13 gene is shown in Figure 2 (SEQ ID NO: 70). To design an ASO targeting MP-13 mRNA, an ASO (04J01 series) complementary to the transition region between TDP-43 FL and MP-13 (i.e., the region in MP-13 where bases 870 and 1886 of TDP-43 FL are linked) was designed. The sequence of the designed ASO is as follows:
[0068]
[0069] In the table above, capital letters represent LNA and lowercase letters represent DNA. "5" indicates 5-methyl-C LNA. All internucleoside linkages are phosphorothioate. The underlined bases correspond to the complementary portions of bases from position 1886 onwards in TDP-43 FL. The design utilized human transcript NM_007375.4 (SEQ ID NO: 71, Figure 3) registered in the NCBI Refseq collection. Synthesis was outsourced to GeneDesign, Inc.
[0070] Example 2: First Screening of the 04J01 Series The ASO designed in Example 1 was transfected (hereinafter also referred to as TF) into MP-13-Venus / HEK293 cells at a final concentration of 100 nM. MP-13-Venus / HEK293 cells are a cell line in which a gene encoding a fusion protein of MP-13 and Venus fluorescent protein has been integrated into the genome to enable stable expression. These cells stably express mRNA in which Venus mRNA is fused to the CDS downstream of MP-13 mRNA, making it possible to measure the inhibitory effect of ASO targeting MP-13 based on Venus mRNA levels. Transfection was performed using Lipofectamine® 3000 according to the accompanying protocol. Forty-eight hours after transfection, cells were harvested and total RNA was extracted. The TDP-43 FL mRNA and Venus mRNA levels contained in the extracted total RNA were measured using real-time PCR. qPCR was performed using TaqMan Gene Expression Assay (Thermo Fisher, 4331182) (Venus: Assay ID Mr03989638_mr, ACTB: Assay ID Hs01060665_g1). Primers and probes were designed as follows to measure the expression level of TDP-43 mRNA: hsTDP-full-length Forward: TTTGTTCAGTGTGGAGTATATTCAGCA (SEQ ID NO: 67) hsTDP-full-length Reverse: AACCACTCAATATTTCAACCTTTCATG A (SEQ ID NO: 68) hsTDP-full-length Probe: AAAAAGGAAGAGCTAAAGGA (Fluorescent dye: FAM) A (SEQ ID NO: 69)
[0071] The results are shown in Figure 4 and Table 2. The measurement results are shown as relative levels, with Mock set to 1. NTS1 is a negative control.
[0072]
[0073] As shown in Figure 4 and Table 2, 04J01-16001 to 007 reduced venus mRNA by approximately 60% to 70%. 008 and 009 showed little inhibitory effect on venus mRNA. 003 and 004 reduced TDP-43 FL mRNA by approximately 40%. 001, 002, and 005 to 007 showed a reduction of approximately 20% to 30%, while 008 and 009 showed little inhibitory effect.
[0074] Example 3: Design and synthesis of ASO targeting MP-13 Based on the sequence of 04J01-16006, an ASO was designed by shortening the number of bases to 14-mer. The sequence of the designed ASO is as follows:
[0075]
[0076] In the above table, capital letters represent LNA and lowercase letters represent DNA. "5" indicates 5-methyl-C LNA. All internucleoside linkages are phosphorothioate linkages. The underlined bases correspond to the complementary portions of bases from position 1886 onwards in TDP-43 FL.
[0077] Example 4: Evaluation of ASO transfection targeting MP-13 The ASO designed in Example 3 was transfected into MP-13-Venus / HEK293 cells at a final concentration of 100 nM. Transfection was performed using Lipofectamine® 3000 according to the attached protocol. 48 hours after transfection, the cells were harvested and total RNA was extracted. The TDP-43 FL mRNA and Venus mRNA levels contained in the extracted total RNA were measured using real-time PCR. The results are shown in Figure 5 and Table 4. The measurement results are shown as relative levels, with mock set to 1. NTS1 is a negative control.
[0078]
[0079] As shown in Figure 5 and Table 4, ASOs were designed based on the sequence of 04J01-16006, shortening the number of bases to a 14-mer. As a result, 04J01-14027 reduced Venus mRNA levels to the same extent as 006. 028 and 029 reduced Venus mRNA slightly more than 006. 030 and 031 either had a weaker inhibitory effect than 006 or showed almost no inhibitory effect. In this experiment, no ASOs had a significant effect on TDP-43 FL mRNA levels.
[0080] Example 5: Fine tuning based on 04J01-14028 Fine tuning was performed based on the sequence of 04J01-14028. The sequence of the designed ASO is as follows:
[0081]
[0082] In the above table, capital letters represent LNA and lowercase letters represent DNA. "5" indicates 5-methyl-C LNA. The underlined bases in 14041 to 14044 represent mismatches with the target. The underlined base in 14046 represents a 2'-OMe modification. The underlined base in 14047 represents a 2'-F modification. The underlined base in 14048 represents a 2'-MOE modification. All internucleoside linkages are phosphorothioate.
[0083] Example 6: Evaluation of transfection of modified ASO with 04J01-14028 as the base sequence The ASO designed in Example 5 was transfected into MP-13-Venus / HEK293 cells at a final concentration of 100 nM. Transfection was performed using Lipofectamine® 3000 according to the accompanying protocol. 48 hours after transfection, the cells were harvested and total RNA was extracted. The TDP-43 FL mRNA and Venus mRNA levels contained in the extracted total RNA were measured using real-time PCR. The results are shown in Figure 6 and Table 6. The measurement results are shown as relative levels, with mock set to 1. NTS1 is a negative control.
[0084]
[0085] As shown in Figure 6 and Table 6, compared to 04J01-14028, 032, which had a chain length extended on the 5'-side, had a similar inhibitory effect, but 033, which had a chain length extended on the 3'-side, had a slightly weaker inhibitory effect. When the chain length was increased to 13-mer, the inhibitory effect was significantly weakened. When the number of LNAs positioned at both ends of the ASO was changed, the inhibitory effect was significantly lost except for the original 2-10-2 type gapmer and the 3-8-3 type gapmer. When mismatches were introduced within the chain length of the ASO, the inhibitory effect was weakened. The inhibitory effect of cholesterol-conjugated ASO was almost the same. When modified nucleic acids other than LNAs (046 to 048) were positioned at both ends of the ASO, almost no inhibitory effect was observed.
[0086] Example 7: Second fine tuning of ASO targeting MP-13 mRNA Based on the sequence of 04J01-14028, modifications were made to the chain length, number of LNAs, and cholesterol addition. The sequence of the designed ASO is as follows:
[0087]
[0088]
[0089] In the table above, capital letters indicate RNA or sugar-modified nucleic acids, and lowercase letters indicate DNA. "5" represents 5-methylcytidine. The parentheses in each nucleotide indicate a modification at the 2' position of the ribose, with L representing LNA, M representing 2'OMe, and F representing 2'F. For example, G (L) represents an LNA-type guanosine. The accent circle conflex "^" between bases (also known as a caret or hat) indicates that the internucleoside bond is a phosphorothioate bond.
[0090] Example 8: Evaluation of transfection of ASO targeting MP-13 The ASO designed in Example 7 was transfected into MP-13-Venus / HEK293 cells at a final concentration of 100 nM. Transfection was performed using Lipofectamine® 3000 according to the attached protocol. 48 hours after transfection, the cells were harvested and total RNA was extracted. The TDP-43 FL mRNA and Venus mRNA levels contained in the extracted total RNA were measured using real-time PCR. The results are shown in Figure 7 and Table 9. The measurement results are shown as relative levels, with mock set to 1. NTS1 is a negative control.
[0091]
[0092] As shown in Figure 7 and Table 9, under TF conditions, ASOs without cholesterol tended to exhibit a stronger inhibitory effect. It is thought that cholesterol either inhibits TF or affects some stage of the inhibitory activity (e.g., hybridization to the target, RNase H1 recognition, cleavage activity, recycling efficiency, etc.). Regarding chain length, for the same number of LNAs, longer chain lengths tended to have a stronger inhibitory effect. Regarding the number of LNAs, no significant change in inhibitory effect was observed in the case of 14-mers. For 15-mers, when one base was extended on the 5'-side (of the 028 sequence), the number of LNAs had little effect, but when one base was extended on the 3'-side, the inhibitory effect of 3-9-3 was greater than that of 2-11-2. For 16-mers, the inhibitory effect tended to weaken as the number of LNAs increased. The ASO with the strongest inhibitory effect under TF conditions was 04J01-16006 (J1-6), with an inhibition rate of 88%.
[0093] Example 9: Evaluation of activity of HDO-modified ASOs For 04J01-14028, 04J01-14045, 04J01-15033, 04J01-15062, 04J01-15032, 04J01-15055, 04J01-16006, and 04J01-16069, sense strand RNA was synthesized and annealed to modify the ASOs (Table 10). In Table 10, "N" represents RNA, "n" represents DNA, "5" represents 5-methylcytosine, "(L)" represents LNA, "^" represents phosphorothioate (PS) bond, and "cho" represents cholesterol.
[0094]
[0095] Equimolar amounts of ASO and the corresponding ssRNA were mixed and heated at 85°C for 5 minutes, then gradually cooled to room temperature to allow annealing and HDO conversion. HEK293 / MP-13-Venus cells were transfected with the HDO ASO at a final concentration of 100 nM, and the inhibitory effect was measured 48 hours later. The results are shown in Figure 8 and Table 11. The measurement results are shown as relative levels, with mock defined as 1. As shown in Figure 8 and Table 11, the HDO ASO had a similar inhibitory effect to single-stranded ASO. Even the HDO ASO had little effect on TDP-43 FL.
[0096]
[0097] Example 10: MOE Gapmer
[0098] In Table 12 (MOE gapmer sequences targeting MP-13 mRNA), capital letters indicate RNA or sugar-modified nucleic acids, and lowercase letters indicate DNA. "5" represents 5-methylcytidine. The parentheses in each nucleotide indicate a modification at the 2' position of the ribose, and (m) represents 2'-O-(2-methoxyethyl) (=MOE). The accent circle conflex "^" between bases (also called a caret or hat) indicates that the internucleoside bond is a phosphorothioate bond. The sequence (SEQ ID NOS: 74, 79, 84, and 89) in which the transition between TDP-43 and MP-13 is at the center of the ASO was designated as position 0, and the hybridization positions shifted one base 5' toward the target were designated as positions -1 and -2, and those shifted one base 5' toward the target were designated as positions -2. Similarly, the hybridization position was shifted by one base to the 3' side of the target, designated +1, and by two bases, designated +2. HEK293 / MP-13-Venus cells were transfected with the above ASO at a final concentration of 100 nM, and the inhibitory effect was measured 48 hours later. The results are shown in Figure 9 and Table 13 (Inhibitory effect of MOE gapmers on MP-13 mRNA). The measurement results are shown as relative levels, with mock designated as 1. As shown in Figure 9 and Table 13, ASOs designed at positions -1 or 0 tended to exhibit strong inhibitory effects. In particular, the 18-mer and 20-mer (SEQ ID NOs: 83, 84, 88, and 89) exhibited an inhibitory effect of approximately 60%.
[0099]
[0100] Example 11: siRNA In Table 14 (sequences of siRNA targeting MP-13 mRNA), all bases are 2'-OMe, and all internucleoside linkages are phosphorothioate. The sequence (SEQ ID NOs: 104 and 105) in which the transition site between TDP-43 and MP-13 is at the central base of the ASO was designated as position 0, and hybridization positions -1 to -6 were designed by shifting the hybridization position 5' toward the target. Similarly, hybridization positions +1 to +5 were designed by shifting the hybridization position 3' toward the target. HEK293 / MP-13-Venus cells were transfected with the above siRNA at a final concentration of 100 nM, and the inhibitory effect was measured 48 hours later. The results are shown in Figure 10 and Table 15 (Inhibitory effect of MP-13 siRNA). The measurement results are shown relative to the mock level (1). As shown in FIG. 10 and Table 15, none of the siRNAs designed this time showed much inhibitory effect, regardless of the designed site.
[0101]
[0102] While preferred embodiments of the present invention are described herein, it will be apparent to those skilled in the art that such embodiments are provided for illustrative purposes only, and that various modifications, changes, and substitutions may be made by those skilled in the art without departing from the invention. It should be understood that various alternative embodiments of the invention described herein may be used in practicing the invention. Furthermore, the contents of all publications, including patents and patent applications, referenced in this specification should be construed as being incorporated by reference as if expressly set forth herein.
[0103] References 1) Lewerenz J & Maher P (2015). Chronic glutamate toxicity in neurodegenerative diseases. Frontiers in neuroscience, 9, 469. 2) Ogasawara, M, Matsubara, Y, Narisawa, K, Aoki, M, Nakamura, S, Itoyama, Y, & Abe, K (1993). Mild ALS in Japan associated with novel SOD mutations. Nature Genetics, 5, 323-324. 3) Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, Donaldson D, Goto J, O'Regan JP, Deng HX, Rahmani Z, Krizus A, McKenna-Yasek D, Cayabyab A, Gaston SM, Berger R, Tanzi RE, Halperin JJ, Herzfeldt B, Van den Bergh R, Hung WY , Bird T , Deng G , Mulder DW , Smyth C , Laing NG , Soriano E , Pericak-Vance MA , Haines J , Rouleau GA , Gusella JS , Horvitz HR & Brown RH Jr (1993). Mutations in the Cu / Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature, 362, 59-62. 4) Cerillo, JL, & Parmar, M. (2023). Tofersen. In StatPearls. StatePearls Publishing.5) Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi MC, Chou TT, Bruce J, Schuck T, Grossman M, Clark CM, McCluskey LF, Miller BL, Masliah E, Mackenzie IR, Feldman H, Feiden W, Kretzschmar HA, Trojanowski JQ, & Lee VM (2006). Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science, 314, 130-133. 6) Arai T, Hasegawa M, Akiyama H, Ikeda K, Nonaka T, Mori H, Mann D, Tsuchiya K, Yoshida M, Hashizume Y, & Oda T (2006) TDP-43 is a component of ubiquitin-positive tau-negative inclusions in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. BBRC, 351, 602-611 7) Laferriere F, & Polymenidou M (2015). Advances and challenges in understanding the multifaceted pathogenesis of amyotrophic lateral sclerosis. Swiss medical weekly, 145. 8) Ling SC., Polymenidou M, & Cleveland DW (2013). Converging mechanisms in ALS and FTD: disrupted RNA and protein homeostasis. Neuron, 79, 416-438.9) Ling JP, Pletnikova O, Troncoso JC, & Wong PC (2015). TDP-43 repression of nonconserved cryptic exons is compromised in ALS-FTD. Science, 349, 650-655. 10) Tamaki Y, Shodai A, Morimura T, Hikiami R, Minamiyama S, Ayaki T, Tooyama I, Furukawa Y, Takahashi R, Urushitani M. (2018). Elimination of TDP-43 inclusions linked to amyotrophic lateral sclerosis by a misfolding-specific intrabody with dual proteolytic signals. Scientific reports, 8, 1-16. 11) Method for screening compounds for treating and / or preventing diseases associated with the accumulation of TDP-43 aggregates, Patent No. 6332723 (P6332723) 12) Prasad A, Bharathi V, Sivalingam V, Girdhar A, & Patel BK (2019). Molecular mechanisms of TDP-43 misfolding and pathology in amyotrophic lateral sclerosis. Frontiers in molecular neuroscience, 12. 13) Scotter EL, Chen HJ, & Shaw CE (2015). TDP-43 proteinopathy and ALS: insights into disease mechanisms and therapeutic targets. Neurotherapeutics, 12, 352-363.14) Koyama A, Sugai A, Kato T, Ishihara T, Shiga A, Toyoshima Y, Koyama M, Konno T, Hirokawa S, Yokoseki A, Nishizawa M, Kakita A, Takahashi H, Onodera O (2016). Increased cytoplasmic TARDBP mRNA in affected spinal motor neurons in ALS caused by abnormal autoregulation of TDP-43. Nucleic acids research, 44, 5820-5836. 15) Nelson PT, Dickson DW, Trojanowski JQ, Jack CR, Boyle PA, Arfanakis K, Rademakers R, Alafuzoff I, Attems J, Brayne C, Coyle-Gilchrist ITS, Chui HC, Fardo DW, Flanagan ME, Halliday G, Hokkanen SRK, Hunter S, Jicha GA, Katsumata Y, Kawas CH, Keene CD, Kovacs GG, Kukull WA, Levey AI, Makkinejad N, Montine TJ, Murayama S, Murray ME, Nag S, Rissman RA, Seeley WW, Sperling RA, White Iii CL, Yu L & Schneider JA (2019) Limbic-predominant age-related TDP-43 encephalopathy (LATE): consensus working group report. Brain, 142, 1503–1527.
[0104] The present inventors have identified oligonucleotides that suppress the mRNA of MP-13, a splicing variant (TDPsv) of TDP-43. These oligonucleotides can be used to reduce the amount of MP-13 mRNA and suppress protein expression. These oligonucleotides may be useful for the treatment or prevention of neurodegenerative diseases associated with TDP-43, more specifically, amyotrophic lateral sclerosis (ALS), frontotemporal degeneration, dementia, Alzheimer's disease, and the like.
Claims
1. An oligonucleotide comprising a complementarity region substantially complementary to at least a portion of MP-13 mRNA (SEQ ID NO: 70) that does not significantly suppress the expression of full-length TDP-43 mRNA, wherein the oligonucleotide comprises a complementarity region substantially complementary to at least the 778th to 783rd bases of MP-13 mRNA (SEQ ID NO: 70).
2. The oligonucleotide according to claim 1, wherein the oligonucleotide is essentially a single-stranded molecule.
3. The oligonucleotide according to claim 1, wherein the oligonucleotide is an antisense oligonucleotide (ASO).
4. The oligonucleotide according to claim 1, wherein the oligonucleotide is a gapmer.
5. The oligonucleotide according to claim 1, wherein the oligonucleotide has a length of 12 to 24 base pairs.
6. The oligonucleotide according to claim 1, wherein the oligonucleotide is 80% or more complementary to MP-13 mRNA (SEQ ID NO: 70).
7. The oligonucleotide according to claim 1, wherein the oligonucleotide is 100% complementary to MP-13 mRNA (SEQ ID NO: 70).
8. The oligonucleotide according to claim 1, wherein the oligonucleotide comprises a modified nucleoside and / or a modified nucleoside bond.
9. The oligonucleotide according to claim 8, wherein the modified nucleoside is a cross-linked nucleic acid and / or a 2'-modified nucleic acid.
10. The oligonucleotide according to claim 9, wherein the modified nucleoside is LNA and / or 2'-MOE.
11. The oligonucleotide according to any one of claims 8 to 10, wherein the bond between the modified nucleosides is a phosphorothioate bond.
12. The oligonucleotide according to any one of claims 8 to 11, wherein all internucleoside bonds are phosphorothioate bonds.
13. The oligonucleotide according to any one of claims 8 to 12, wherein the bond between modified nucleosides is chirally controlled.
14. The oligonucleotide according to claim 1, wherein one or both of the terminal hydroxyl groups of the oligonucleotide are modified.
15. The oligonucleotide according to claim 1, wherein a phosphate group is added to one or both of the terminal hydroxyl groups of the oligonucleotide.
16. The oligonucleotide according to claim 1, wherein one or both of the terminal hydroxyl groups of the oligonucleotide are not modified.
17. The oligonucleotide according to claim 1, wherein one or both of the terminal hydroxyl groups of the oligonucleotide are not to which a phosphate group is attached.
18. The oligonucleotide according to claim 1, wherein the oligonucleotide comprises one sequence from sequence number 1 to sequence number 62.
19. The oligonucleotide according to claim 1, wherein the oligonucleotide consists of one sequence from sequence number 1 to sequence number 62.
20. The oligonucleotide according to claim 1, wherein the oligonucleotide consists of a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one sequence from Sequence ID No. 1 to Sequence ID No.
62.
21. Oligonucleotides, or salts thereof, that do not significantly suppress the expression of full-length TDP-43 mRNA, and include 04J01-13034, 04J01-13035, 04J01-14027, 04J01-14028, 04J01-14029, 04J01-14030, 04J01-14031, 04J01-14036, 04J01-14037, 04J01-14038, 04J01-14039, 04J01-14040, 04J01-14041, and 04J01-14 042, 04J01-14043, 04J01-14044, 04J01-14045, 04J01-14046, 04J01-14047, 04J01-14048, 04J01-14049, 04J01-14050, 04 J01-14051, 04J01-14052, 04J01-14053, 04J01-15032, 04J01-15033, 04J01-15054, 04J01-15055, 04J01-15056, 04J01-15 057, 04J01-15058, 04J01-15059, 04J01-15060, 04J01-15061, 04J01-15062, 04J01-15063, 04J01-15064, 04J01-15065, 04 J01-15066, 04J01-15067, 04J01-16001, 04J01-16002, 04J01-16003, 04J01-16004, 04J01-16005, 04J01-16006, 04J01-16 Oligonucleotides, or salts thereof, selected from the group consisting of 007, 04J01-16008, 04J01-16009, 04J01-16025, 04J01-16026, 04J01-16068, 04J01-16069, 04J01-16070, 04J01-16071, 04J01-16072, 04J01-16073, 04J01-16074, 04J01-16075, 04J01-16076, and 04J01-16077.
22. A pharmaceutical composition comprising an oligonucleotide according to claim 1 or 21 and a pharmaceutically acceptable excipient, buffer, and / or additive, for not significantly suppressing the expression of full-length TDP-43 mRNA.
23. The pharmaceutical composition according to claim 22 for use in suppressing MP-13 mRNA.
24. A pharmaceutical composition according to claim 22 for use in suppressing neuronal cell death.
25. The pharmaceutical composition according to claim 22, for use in the treatment or prevention of amyotrophic lateral sclerosis.
26. The pharmaceutical composition according to claim 22, for use in the treatment or prevention of frontotemporal degeneration, dementia, or Alzheimer's disease.