Composition for preventing, improving or treating obesity or obesity-induced inflammation comprising patulin as an active ingredient

Abstract

The present invention relates to a composition for the prevention, improvement, or treatment of obesity or obesity-induced inflammation comprising patulin as an active ingredient. A composition containing patulin as an active ingredient according to the present invention has the effect of inhibiting lipid accumulation, and can inhibit lipid accumulation by regulating sugar absorption, glycerol excretion, or LDL absorption, reducing the expression of factors related to lipogenesis or lipid synthesis such as Pparγ, Fasn, Acly, C / ebpα, Fabp4, Cd36, Dgat2, or Gpat, increasing the expression of fatty acid oxidation regulators such as PGC1α or CPT1a, and improving the volume and membrane potential of mitochondria. In addition, it can inhibit the expression of pro-inflammatory cytokines or inflammatory regulators such as IL-6, TNF-α, iNOS, or Cox-2, thereby preventing, treating, or improving obesity or obesity-induced inflammation, and can be utilized as a material for food, feed, pharmaceuticals, quasi-pharmaceuticals, etc.

Description

Technology Field

[0001] The present invention relates to a composition for the prevention, improvement, or treatment of obesity or obesity-induced inflammation comprising patulin as an active ingredient. Background Technology

[0002] Obesity is a major health problem characterized by the excessive accumulation of body fat due to an imbalance between energy storage and consumption. It is closely associated with the development of various metabolic diseases, including insulin resistance, diabetes, and cardiovascular disease. Furthermore, obesity is associated with an increase in white adipose tissue masses, which result primarily from the activation of lipogenesis and increased cytoplasmic triglyceride deposition.

[0003] Adipogenesis is a strictly regulated process in which undifferentiated preadipocytes undergo differentiation to become mature adipocytes. This process is primarily governed by a complex network of transcription factors, including CCAAT / enhancer-binding protein (C / EBP) and peroxisome proliferator-activated receptor-γ (PPAR-γ), which stimulate fatty acid synthesis and transport to promote triglyceride accumulation in mature adipocytes. When these transcription factors are activated, they can upregulate the expression of key genes involved in lipid metabolism and adipocyte function, such as fatty acid synthase (FASN), fatty acid binding protein 4 (FABP4), and ATP-citrate degradase (ACLY). Furthermore, adipocytes secrete various adipokines, including adiponectin, which are involved in insulin signaling and glucose regulation. Upregulated adipogenesis and mature adipocytes contribute to the regulation of fatty acid oxidation and glucose metabolism, thereby impairing glucose metabolism and insulin sensitivity. Therefore, the process of regulating the differentiation of adipocytes can be an effective strategy for preventing or treating metabolic diseases, including obesity.

[0004] Meanwhile, obesity is regarded as a low-grade chronic inflammatory disease due to an imbalance between pro-inflammatory stimuli and anti-inflammatory immune responses. The release of pro-inflammatory molecules from adipose tissue is a key mechanism supporting the inflammatory nature of obesity. In this process, when macrophages infiltrate adipose tissue, they are responsible for the secretion of various substances known as adipokines, including pro-inflammatory cytokines such as TNF-α and IL-6. Furthermore, the increased infiltration of immune cells, particularly macrophages, into adipose tissue interacts with adipocytes and contributes to the development of chronic low-grade inflammation. On the other hand, the ability to cope with inflammatory responses is impaired in obesity, and this chronic inflammatory state has detrimental effects on insulin resistance, dyslipidemia, hypertension, and other obesity-related metabolic abnormalities. Therefore, since the crosstalk between macrophages and adipocytes is crucial for initiating and maintaining a chronic inflammatory state in obese adipose tissue, targeting their interactions can be an effective strategy for treating obesity.

[0005] Furthermore, mitochondria play a central role in energy metabolism by generating adenosine triphosphate (ATP) for cells from food substrates such as glucose and lipids, and in addition to ATP production, they are involved in biosynthesis, including fatty acid synthesis. Mitochondria are also involved in the generation and removal of ROS, and mitochondrial dysfunction in obesity contributes to metabolic disorders and obesity-related complications. Mitochondria in obese adipose tissue are characterized by reduced mitochondrial mass and impaired oxidative capacity, and the reduced mitochondrial biosynthesis observed in obesity is additionally involved in insulin resistance and low-grade inflammation. Therefore, strategies to promote mitochondrial biosynthesis and maintain mitochondrial quality have the potential to mitigate the progression of obesity and related metabolic disorders.

[0006] Meanwhile, patulin is known to be a toxin produced by fungi, specifically Penicillium patulum ( Penicillium patulumIt was named in ). Patulin is known to induce the production of reactive oxygen species within cells, causing protein oxidation and DNA damage, and is cytotoxic, genotoxic, and carcinogenic.

[0007] Recently, research results regarding the immunomodulatory and anticancer effects of patulin have been reported, but to date, there are no research results indicating that patulin is effective in inhibiting lipid accumulation or obesity. Prior art literature

[0008] Toxicon 99 (2015) 1-5 The problem to be solved

[0009] The present invention aims to solve the aforementioned problem and other related problems.

[0010] One exemplary objective of the present invention is to provide a food composition for the prevention or improvement of obesity or obesity-induced inflammation comprising patulin as an active ingredient.

[0011] Another exemplary objective of the present invention is to provide a health functional food comprising the above food composition.

[0012] Another exemplary objective of the present invention is to provide a pharmaceutical composition for the prevention, improvement, or treatment of obesity or obesity-induced inflammation comprising patulin as an active ingredient.

[0013] Another exemplary objective of the present invention is to provide a quasi-drug composition for the prevention, improvement, or treatment of obesity or obesity-induced inflammation comprising patulin as an active ingredient.

[0014] Another exemplary objective of the present invention is to provide a feed composition for the prevention or improvement of obesity or obesity-induced inflammation comprising patulin as an active ingredient.

[0016] The technical problems to be solved according to the technical concept of the invention disclosed in this specification are not limited to those for solving the problems mentioned above, and other unmentioned problems will be clearly understood by a person skilled in the art from the description below. means of solving the problem

[0018] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below.

[0020] As one embodiment for achieving the above objective, the present invention provides a food composition for preventing or improving obesity or obesity-induced inflammation comprising patulin as an active ingredient.

[0021] In the present invention, 'patulin (4-hydroxy-4)' H -furo[3,2-c]pyran-2(6 H )-one)' means a compound having the chemical structure of Chemical Formula 1 below.

[0022] [Chemical Formula 1]

[0023]

[0024] The above patulin is a type of mycotoxin (mycotoxin) known to strongly inhibit the growth of Gram-positive and Gram-negative bacteria and to have functional properties effective locally for infectious skin diseases, and it may be obtained from biological sources known in the field of technology, or chemically synthesized or commercially available.

[0025] In the present invention, patulin comprises a pharmaceutically or food-grade acceptable salt form within the range having the same efficacy. Such salts are pharmaceutically or food-grade acceptable salts and may be basic salts or acidic salts; basic salts may be used in the form of either organic basic salts or inorganic basic salts, and may be selected from the group consisting of sodium salts, potassium salts, calcium salts, lithium salts, magnesium salts, cesium salts, aluminum salts, ammonium salts, triethylaminium salts, and pyridinium salts.

[0026] As for the types of such salts, acid addition salts formed by free acids are useful as acid salts. Inorganic and organic acids may be used as free acids; inorganic acids may include hydrochloric acid, bromic acid, sulfuric acid, sulfite, phosphoric acid, diphosphate, nitric acid, etc., and organic acids may include citric acid, acetic acid, maleic acid, malic acid, fumaric acid, glutonic acid, methanesulfonic acid, benzenesulfonic acid, camphorsulfonic acid, oxalic acid, malonic acid, glutaric acid, acetic acid, glyconic acid, succinic acid, tartaric acid, 4-toluenesulfonic acid, galacturonic acid, emvonic acid, glutamic acid, citric acid, aspartic acid, stearic acid, etc., but are not limited thereto and may include all salts formed using various inorganic and organic acids commonly used in the industry.

[0027] In the present invention, "active ingredient" refers to a component that exhibits the intended activity alone, or can exhibit activity together with a carrier that is inactive itself.

[0028] In the composition of the present invention, the active ingredient may be included in any amount (effective amount) depending on the specific use, formulation, purpose of combination, etc., as long as it can exhibit preventive or therapeutic activity against obesity or obesity-induced inflammation. The typical effective amount may be determined within the range of 0.000001 weight % to 99.9 weight %, 0.000001 weight % to 1 weight %, 0.000001 weight % to 0.001 weight %, or 0.000001 weight % to 0.000005 weight % based on the total weight of the composition. The above "effective amount" refers to the amount of the active ingredient included in the composition of the present invention that can exhibit intended functional and pharmacological effects, such as the prevention or treatment of obesity or obesity-induced inflammatory diseases, when the composition of the present invention is administered to an individual subject to the composition of the present invention during an administration period as suggested by a person skilled in the art. Such effective amounts can be determined experimentally by a person skilled in the art within the scope of ordinary ability.

[0029] The term 'obesity' in this invention refers to a state of excessive fat tissue in the body, and furthermore, may include all various complications caused by obesity.

[0030] The term 'inflammation' in the present invention refers to a protective response involving immune cells, blood vessels, and inflammatory mediators as one of the biological responses to harmful stimuli, and preferably refers to inflammation induced by obesity.

[0031] The composition of the present invention may inhibit lipid accumulation, but is not limited thereto.

[0032] The composition of the present invention may inhibit glucose absorption and low-density lipoprotein (LDL) absorption in fat cells, may promote the release of glycerol, and thereby regulate glycolipid metabolism.

[0033] The composition of the present invention can regulate lipid metabolism by regulating adipogenic or lipogenic regulators.

[0034] Specifically, the composition of the present invention may inhibit the protein expression of peroxisome proliferator-activated receptor γ (Pparγ), fatty acid synthase (FASN), or ATP citrate lyase (ACLY), which are regulators of lipogenesis or lipid synthesis, and may inhibit the gene expression of Pparγ, CCAAT / enhancer-binding protein α (C / ebpα), fatty acid binding protein 4 (Fabp4), Cd36, diacylglycerol acyltransferase 2 (Dgat2), or glycerol-3-phosphate acyltransferase (Gpat), thereby inhibiting lipid accumulation It can show preventive, remedial, or therapeutic effects on obesity.

[0035] The composition of the present invention may promote fatty acid oxidation in adipocytes. Additionally, the composition of the present invention may exhibit an effect of inhibiting fat production by increasing the expression of peroxisome proliferator-activated receptor gamma cofactor-1α (PGC-1α) and carnitine palmitoyl transferase-1 (CPT-1), which are factors regulating fatty acid oxidation, and thereby increasing fatty acid oxidation in mitochondria.

[0036] The composition of the present invention may increase the oxygen consumption rate (OCR) in adipocytes, thereby increasing mitochondrial respiration. Additionally, the composition of the present invention may increase the amount of mitochondria and mitochondrial membrane potential, thereby improving mitochondrial function and exhibiting preventive, remedial, or therapeutic effects on obesity.

[0037] The composition of the present invention can prevent, improve, or treat obesity-induced inflammation. Specifically, the composition of the present invention may inhibit the gene or protein expression of interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), inducible nitric oxide synthase (INOS), or cyclooxygenase-2 (Cox-2).

[0038] In the present invention, "prevention" refers to any act of suppressing or delaying symptoms of obesity or obesity-induced inflammation by administering the composition of the present invention, and "improvement" refers to exhibiting an effect of alleviating symptoms of obesity or obesity-induced inflammation by applying the composition of the present invention.

[0039] The aforementioned obesity-induced inflammatory symptoms may refer to various physiological changes, and in particular, may refer to complications such as insulin resistance, resulting fatty liver disease, cardiovascular disease (atherosclerosis), cardiac dysfunction (heart failure), and type 2 diabetes, but are not limited thereto.

[0040] The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food, food additives, health functional food, and animal feed, and is intended for consumption by humans or animals, including livestock. Food compositions of the above types can be prepared in various forms according to conventional methods known in the art.

[0041] The above-mentioned type of food composition can be manufactured in various forms according to conventional methods known in the art. General foods are not limited to but can be manufactured by adding the above-mentioned active ingredient to beverages (including alcoholic beverages), fruits and their processed foods (canned fruit, bottled fruit, jam, marmalade, etc.), fish, meat and its processed foods (ham, sausage, corned beef, etc.), breads and noodles (udon, buckwheat noodles, ramen, spaghetti, macaroni, etc.), fruit juices, various drinks, cookies, malt syrup, dairy products (butter, cheese, etc.), edible vegetable oils, margarine, vegetable proteins, retort foods, frozen foods, various seasonings (miso, soy sauce, sauces, etc.).

[0042] In addition, the above active ingredient may be added to capsules, tablets, pills, etc., as a nutritional supplement. In addition, as a health functional food, although not limited thereto, it may be prepared in the form of tea, juice, and drink, for example, and consumed by liquefying, granulating, encapsulating, and powdering so that it can be consumed as a health beverage. In addition, it may be prepared in the form of a composition by mixing with one or more known active ingredients known to be effective in improving obesity or obesity-induced inflammation.

[0043] In addition to the above, the health functional food of the present invention may contain various nutritional agents, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents.

[0044] In another embodiment for achieving the above objective, the present invention provides a pharmaceutical composition for the prevention, improvement, or treatment of obesity or obesity-induced inflammation comprising patulin as an active ingredient.

[0045] The above 'patulin', 'active ingredient', 'obesity', 'inflammation', 'prevention', and 'improvement' are as previously described.

[0046] In this invention, "treatment" refers to any act in which symptoms of obesity or obesity-induced inflammation are improved or beneficially altered by the administration of the composition of this invention.

[0047] The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may further comprise, for example, a carrier for oral administration or a carrier for parenteral administration. The carrier for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, etc.

[0048] In addition, the carrier for parenteral administration may include water, suitable oil, saline solution, aqueous glucose and glycol, etc. Additionally, it may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol.

[0049] The pharmaceutical composition of the present invention may be administered to mammals, including humans, by any method. For example, it may be administered orally or parenterally, and parenteral administration methods may include intravenous, intramuscular, intra-arterial, intra-central, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, local, sublingual, or rectal administration, but are not limited thereto.

[0050] The pharmaceutical composition of the present invention may be formulated into an oral or parenteral administration formulation according to the administration route described above. When formulating, it may be prepared using one or more buffers (e.g., saline or PBS (phosphate buffered saline)), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, extenders, binders, adjuvants (e.g., aluminum hydroxide), suspenders, thickeners, wetting agents, disintegrants or surfactants, diluents or excipients.

[0051] Solid dosage forms for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions, or capsules, and such solid dosage forms may be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol, maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethylcellulose, or gelatin. For example, a tablet or a sugar-coated tablet may be obtained by combining an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and processing it into a granular mixture.

[0052] In addition to simple excipients, lubricants such as magnesium striate talc are also used. Liquid formulations for oral administration include suspensions, oral liquids, emulsions, or syrups, and may contain various excipients, such as humectants, sweeteners, flavorings, or preservatives, in addition to commonly used simple diluents like water or liquid paraffin. Furthermore, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as disintegrants, and may additionally contain anticoagulants, lubricants, humectants, flavorings, emulsifiers, and preservatives.

[0053] When administered parenterally, the pharmaceutical composition of the present invention may be formulated in the form of an injectable, a transdermal agent, and a nasal inhalant with a suitable parenteral carrier according to methods known in the art. The injectable must be sterile and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for the injectable may include, but are not limited to, solvents or dispersion media comprising water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and / or vegetable oils. More preferably, suitable carriers may include Hanks' solution, Ringer's solution, PBS containing triethanolamine or sterile water for injection, isotonic solutions such as 10% ethanol, 40% propylene glycol, and 5% dextrose. To protect the injectable from microbial contamination, various antimicrobial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. may be additionally included. In addition, the above-mentioned injectable may additionally contain an isotonic agent, such as sugar or sodium chloride, in most cases.

[0054] Transdermal formulations include forms such as ointments, creams, lotions, gels, topical solutions, pastes, liniments, and aerosols. Here, 'transdermal administration' means administering a pharmaceutical composition topically to the skin so that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin.

[0055] In the case of inhalation formulations, the composition used according to the present invention can be conveniently delivered in the form of an aerosol spray from a pressurized pack or atomizer using a suitable propellant, e.g., dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas. In the case of pressurized aerosols, the dosage unit can be determined by providing a valve that delivers a metered amount. For example, gelatin capsules and cartridges used in inhalers or blowers can be formulated to contain the compound and a powder mixture of a suitable powder base, such as lactose or starch. Formulations for parenteral administration are described in the literature, which is a prescription generally known in all pharmaceutical chemistry (Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour).

[0056] The amount of the active compound in the unit dosage formulation of the pharmaceutical composition of the present invention may vary, and specifically, based on an average human weight of 70 kg, it may be adjusted to about 0.01 µg to about 1 g, 0.01 µg to about 5 mg, 0.01 µg to about 100 mg, 0.01 µg to about 5,000 µg, 0.01 µg to about 3,500 µg, etc. However, the dosage may vary depending on the requirements of humans and mammals, the severity of the disease to be treated, and the final composition of the compound used. Determining the appropriate dosage for a specific situation is the responsibility of a person skilled in the art.

[0057] The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, or biological response modifiers.

[0058] In another embodiment for achieving the above objective, the present invention provides a quasi-drug composition for the prevention, improvement, or treatment of obesity or obesity-induced inflammation comprising patulin as an active ingredient.

[0059] The above 'patulin', 'active ingredient', 'obesity', 'inflammation', 'prevention', 'improvement', and 'treatment' are as described above.

[0060] In the present invention, "quasi-drug" refers to an article used for the purpose of diagnosing, treating, alleviating, managing, or preventing diseases in humans or animals, excluding instruments, machines, or devices, and an article used for the purpose of having a pharmacological effect on the structure and function of humans or animals, excluding instruments, machines, or devices. One embodiment may include, but is not limited to, an oral formulation. The formulation method, dosage, method of use, and components of the quasi-drug may be appropriately selected from the ordinary technology known in the technical field.

[0061] The quasi-drug composition of the present invention may further include, in addition to the above components, a pharmaceutically acceptable carrier, excipient, or diluent as needed. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effects of the present invention, and may include, for example, fillers, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc.

[0062] In another embodiment for achieving the above objective, the present invention provides a feed composition for preventing or improving obesity or obesity-induced inflammation comprising patulin as an active ingredient.

[0063] The above 'patulin', 'active ingredient', 'obesity', 'inflammation', 'prevention', and 'improvement' are as previously described.

[0064] In the present invention, the term "feed" refers to any natural or artificial prescribed food, single meal, etc., for animals to eat, consume, and digest, or the ingredients of said single meal; it may be manufactured in various forms of feed known in the industry, and specifically may include, but is not limited to, concentrate feed, roughage, feed additives, feed aids, pet nutritional supplements, or special feeds.

[0065] The feed additive of the present invention corresponds to an auxiliary feed under the Feed Management Act and may additionally include mineral preparations such as sodium bicarbonate (baking soda), bentonite, magnesium oxide, and complex minerals; mineral preparations that are trace minerals such as zinc, copper, cobalt, and selenium; vitamin preparations such as carotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex; protected amino acid preparations such as methionine and lysic acid; protected fatty acid preparations such as calcium salts of fatty acids; probiotics (lactic acid bacteria preparations); probiotics such as yeast cultures and mold fermentation products; yeast preparations, etc.

[0066] Concentrated feeds include, but are not limited to, seed grains such as wheat, oats, and corn; bran, which is a byproduct obtained by refining grains and includes rice bran, wheat bran, and barley bran; oilseed meal, which is a byproduct obtained by extracting oil from soybeans, rapeseed, sesame, flaxseed, and coconut; residues such as residual starch, which is the main component of starch residue remaining after removing starch from sweet potatoes and potatoes; fish meal, fish residue; fish soluble, which is a concentrated fresh liquid obtained from fish; meat meal; blood meal; feather meal; skim milk powder; dried whey, which is the residue obtained when making cheese from milk or casein from skim milk; yeast, Chlorella, and seaweed. Roughage includes raw grass feeds such as wild grass, pasture grass, and green cuts; root vegetables such as feed turnips, feed beets, and a type of turnip called lutea bearger; silage, which is a stored feed made by filling a silo with raw grass, green cut crops, and grains and fermenting them with lactic acid; hay made by cutting and drying wild grass and pasture grass; straw of livestock breeding crops; and leaves of legumes, but is not limited thereto. Special feeds include mineral feeds such as oyster shells and rock salt; urea feeds such as urea or its derivatives such as diuretic isobutane; feed additives, which are substances added in trace amounts to compound feed to supplement components that are prone to being deficient when only natural feed ingredients are mixed, or to improve the shelf life of the feed; and dietary supplements, but are not limited thereto.

[0067] The feed composition of the present invention may further include ingredients added to conventional feeds. Examples of ingredients added to such feeds may include cereal powder, meat powder, and legumes. In the above, the cereal powder may be one or more selected from rice flour, wheat flour, barley flour, and corn flour. In the above, the meat powder may be powdered meat powder obtained by selecting one or more selected from chicken, beef, pork, and ostrich meat. In the above, the legumes may be one or more selected from soybeans, kidney beans, peas, and black beans.

[0068] The feed composition of the present invention may include one or more selected from nutrients and minerals in addition to the cereal powder, meat powder, and legumes, which are components added to conventional feeds mentioned above, in order to increase the nutritional value of the feed, and may include one or more selected from antifungal agents, antioxidants, anticoagulants, emulsifiers, and binders to prevent deterioration of feed quality.

[0069] The feed or feed additive of the present invention can be applied to the diets of a number of animals, including mammals, poultry, and fish. Effects of the invention

[0071] A composition containing patulin as an active ingredient according to the present invention has the effect of inhibiting lipid accumulation, and can inhibit lipid accumulation by regulating sugar absorption, glycerol excretion, or LDL absorption, reducing the expression of factors related to lipogenesis or lipid synthesis such as Pparγ, Fasn, Acly, C / ebpα, Fabp4, Cd36, Dgat2, or Gpat, increasing the expression of fatty acid oxidation regulators such as PGC1α or CPT1a, and improving the volume and membrane potential of mitochondria. In addition, it can inhibit the expression of pro-inflammatory cytokines or inflammatory regulators such as IL-6, TNF-α, iNOS, or Cox-2, thereby preventing, treating, or improving obesity or obesity-induced inflammation, and can be utilized as a material for food, feed, pharmaceuticals, quasi-pharmaceuticals, etc. Brief explanation of the drawing

[0072] Figure 1 shows the results of confirming changes in cell viability in 3T3-L1 pre-adipocytes and mature adipocytes by treatment with different concentrations of patulin. Figures 2A and 2B show the results of confirming the change in the degree of Oil Red O staining according to 3T3-L1 adipocyte differentiation (MDI treatment) and treatment with different concentrations of patulin. Figure 2C shows the results of confirming the change in the amount of triglycerides according to the differentiation of 3T3-L1 adipocytes and treatment with different concentrations of patulin. Figure 3 shows the results of measuring changes in glucose uptake (A), glycerol release (B), and LDL uptake (C) according to treatment with different concentrations of patulin in mature 3T3-L1 adipocytes. Figures 4A and 4B show the results of measuring changes in the expression levels of PPARγ, FASN, and ACLY proteins according to 3T3-L1 adipocyte differentiation and treatment with patulin at different concentrations. Figure 4C shows the results of measuring changes in the expression levels of Pparγ, C / ebpα, Fabp4, Cd36, Dgat, and Gpat genes according to 3T3-L1 adipocyte differentiation and treatment with patulin at different concentrations. Figures 5A and 5B show the results of measuring changes in the protein expression level of PGC-1α according to 3T3-L1 adipocyte differentiation and treatment with patulin at different concentrations. Figures 5C and 5D show the results of measuring changes in mRNA expression levels of Pgc-1α and Cpt1a according to 3T3-L1 adipocyte differentiation and treatment with patulin at different concentrations. Figure 6 shows the results of measuring changes in oxygen consumption rate (OCR) (A, B), mitochondrial volume (C, D), and mitochondrial membrane potential (E, F) following treatment with patulin in mature 3T3-L1 adipocytes. Figure 7 shows flow cytometry data showing changes in mitochondrial volume (Mitotracker green) and mitochondrial membrane potential (Mitotracker red) following treatment with patulin in mature 3T3-L1 adipocytes. Figure 8 shows the results of confirming the change in cell viability in RAW 264.7 cells by treatment with different concentrations of patulin. Figures 9A and 9B show the results of measuring changes in mRNA expression levels of IL-6(A) and TNF-α(B) by treatment with patulin at different concentrations in LPS-treated RAW 264.7 cells. Figures 9C and 9D show the results of measuring the changes in the production of IL-6(C) and TNF-α(D) by treatment with patulin at different concentrations in LPS-treated RAW 264.7 cells. Figure 10 shows the results of measuring the mRNA expression levels of inos (A) and Cox-2 (B) and the changes in nitric oxide (NO) production (C) in LPS-treated RAW 264.7 cells by treatment with patulin at different concentrations. Figures 11A and 11B show the results of measuring changes in OCR (A) and ATP production (B) in RAW 264.7 cells following LPS treatment. Figures 11C to 11E show the results of measuring the change in ATP production (C) and change in OCR (D, E) by treatment with different concentrations of patulin in LPS-treated RAW 264.7 cells. Figure 12 shows the results of measuring changes in intracellular ROS (A) and mitochondrial volume (B) according to treatment with different concentrations of patulin in LPS-treated RAW 264.7 cells. Specific details for implementing the invention

[0073] The present invention will be explained in more detail below through the following examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.

[0075] Example 1. Confirmation of the lipid accumulation inhibitory effect of patulin

[0076] 1.1. Experimental Materials and Methods

[0077] 1.1.1. Substances and Reagents

[0078] Patulin was purchased from MedChem Express (#HY-N6779, Monmouth Junction, NJ, USA). 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) and other reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA), and antibodies against PPARγ (16643-1-AP, Proteintech, Chicago, IL, USA), FASN (#sc-48357, Santa Cruz Biotechnology, CA, USA), ACLY (#15421-1-AP, Proteintech), PGC1α (#PA1-31202, Invitrogen, Carlsbad, CA, USA), α / β-tubulin (#2148, Cell Signaling Technology, Danvers, MA, USA) and β-actin (#sc-47778, Santa Cruz Biotechnology) were used for Western blotting.

[0080] 1.1.2. Cell Culture

[0081] The 3T3-L1 cell line was purchased from ATCC (American Type Culture Collection, Manassas, VA, USA). Cells were cultured in high-glucose DMEM (Dulbecco's Modified Eagle's Medium) medium (Welgene, Gyeongsan, Korea) with 10% Bovine Calf Serum (BCS) (Welgene) and 1% penicillin-streptomycin (10,000 U / ml) (Gibco, Carlsbad, CA, USA) at 37°C and 5% CO2.

[0082] To induce differentiation, confluent cells were cultured for 2 days in DMEM containing 10% Fetal Bovine Serum (FBS) (Welgene) and MDI (0.5 mM IBMX, 1 μM DEX, and 10 μg / mL insulin). The medium was replaced daily with DMEM containing 10% FBS and 10 μg / ml insulin. During adipogenesis, cells were treated with or without patulin for 8 days.

[0083] RAW 264.7 cell lines were purchased from ATCC and cultured in high-glucose DMEM medium with 10% FBS and 1% penicillin-streptomycin (10,000 U / ml). Acute inflammatory responses were induced in cells by treating them with 500 ng / ml lipopolysaccharide (LPS) for 24 hours with or without patulin.

[0085] 1.1.3. Cell Viability Analysis

[0086] Cell viability was measured using the MTT assay. 3T3-L1 cells were placed in 2×10 well plates. 4Cells were seeded at a concentration of cells / mL. To confirm the toxicity of patulin on preadipocytes, patulin was added to each well of DMEM medium containing 10% BCS and cultured for 48 hours. To evaluate the toxicity of PAT on mature adipocytes, 3T3-L1 cells were differentiated into mature adipocytes. Subsequently, cells were treated with various concentrations of patulin every 2 days, and fresh medium containing insulin was replaced. MTT solution (0.5 mg / ml) was added, and the cells were cultured for 4 hours. After removing the medium, insoluble formazan crystals were dissolved in 100 μl of DMSO. Absorbance was measured at 570 nm using a microplate reader (Molecular Devices, Sunnyvale, CA, USA).

[0088] 1.1.4. ORO Staining

[0089] Lipid accumulation was analyzed by Oil Red O (ORO, Sigma-Aldrich) staining. Cells were placed in 5×10⁶ wells of a 24-well cell culture plate. 4 Cells were seeded at a cell / well density and differentiation was induced. Differentiated cells were washed twice with DPBS (Dulbecco's Phosphate Buffered Saline, Welgene) and fixed in 3.7% formaldehyde solution (Biosesang, Yongin, Korea) at room temperature for 15 minutes. Fixed cells were washed with 60% isopropanol (Ducksan, Ansan, Korea) and stained with ORO solution at room temperature for 20 minutes. After removing residual solution, the plates were washed with distilled water and dried. Cell lipid droplets were imaged using an Olympus IX73 optical microscope (Olympus, PA, USA). After microscopic observation, the stained ORO was eluted with 100% isopropanol, and lipid content was quantified by measuring absorbance at 500 nm using a microplate reader (Molecular Devices).

[0091] 1.1.5. Triglyceride Measurement

[0092] Triglyceride (TG) levels were analyzed using a Triglyceride (TG) Analysis Kit (#ab65336, Abcam, Cambridge, MA, USA) according to the manufacturer's instructions. Cells were washed with DPBS and resuspended in a 5% NP-40 / ddH2O solution. TG was dissolved by heating and cooling the sample three times. Then, lipase was used to convert TG into glycerol and fatty acids. The sample was centrifuged at 15,000 rpm for 3 minutes, and the dissolved TG was collected. Absorbance was measured at 570 nm using a Microplate Reader (Molecular Devices), and individual values ​​were normalized by the number of cells per well.

[0094] 1.1.6. Statistical Analysis

[0095] All experiments were performed at least three times, and data were expressed as mean ± standard deviation (SD). Statistical significance was determined using Tukey's post hoc test and one-way analysis of variance (ANOVA) for multiple comparisons using Prism software (GraphPad Soft-ware, San Diego, CA, USA). Significant differences were indicated by different letters, and a p-value of < 0.05 was considered statistically significant.

[0097] 1.2. Confirmation of Patulin's Toxicity to Adipocytes

[0098] To determine the effect of patulin (PAT) on the cell viability of adipocytes, 3T3-L1 preadipocytes and mature adipocytes were exposed to media containing patulin at various concentrations (0.2 to 10 μM).

[0099] As shown in Figure 1, treatment with patulin did not show a significant effect compared to the untreated group at concentrations of 10 μM or less. Based on these results, the effect of patulin on lipid accumulation during adipocyte differentiation at concentrations of 1 or 5 μM was investigated.

[0101] 1.3. Confirmation of the lipid accumulation inhibitory effect of patulin

[0102] Adipocyte maturation is governed by insulin signaling, which promotes the absorption of glucose and free fatty acids, resulting in the accumulation of triglycerides (TG). Therefore, ORO staining was performed to visualize lipid droplets, and the effect of patulin on lipid accumulation in adipocytes was investigated.

[0103] As a result, staining intensity was significantly higher in the differentiated group treated with MDI compared to the undifferentiated group, indicating increased lipid accumulation during adipocyte differentiation. Meanwhile, it was confirmed that ORO staining intensity decreased in a concentration-dependent manner upon treatment with patulin (Figs. 2A, B). Furthermore, it was confirmed that the increased TG content in differentiated 3T3-L1 cells decreased in a concentration-dependent manner upon treatment with patulin (Fig. 2C).

[0104] These results indicate that patulin can effectively inhibit lipid accumulation without affecting cell viability during the differentiation of 3T3-L1 preadipocytes.

[0106] Example 2. Confirmation of the mechanism of patulin's inhibition of lipid accumulation

[0107] 2.1. Experimental Method

[0108] 2.1.1. Measurement of Glycolipid Metabolism

[0109] Glucose concentration was measured using a glucose analysis kit (#ab136955, Abcam). The amount of glucose remaining in the medium was monitored. The reaction mixture was incubated in the medium with glucose, and glucose concentration was evaluated by measuring the absorbance at 450 nm.

[0110] Glycerol release from mature 3T3-L1 cells was quantified using a glycerol analysis kit (#MAK117, Sigma-Aldrich). The amount of glycerol released into the medium was measured by reacting with the reaction mixture, and the absorbance was measured at 570 nm.

[0111] Low-density lipoprotein (LDL) uptake was measured using an LDL uptake assay kit (#10011125, Cayman Chemicals, MI, USA). Cells were seeded on black plates and LDL-DyLigh TM The solution was stained for 24 hours in a serum-free medium. After removing the reaction medium, the images were examined using a fluorescence microscope, and the fluorescence intensity was quantified using Image J.

[0113] 2.1.2. Protein Analysis

[0114] Cells were washed with DPBS and lysed using lysis buffer (Cell Signaling Technology) containing a protease and phosphatase inhibitor cocktail (Roche, Basel, Switzerland). The lysates were centrifuged, and equal amounts of protein lysates mixed with 5X SDS-PAGE reading buffer (Biosesang) were separated by SDS-PAGE and transferred to a PVDF (Polyvinylidene fluoride) membrane (Bio-Rad, California, USA). After blocking the membrane with blocking buffer, the cells were incubated overnight with the primary antibody. The membrane was then blocked with TBST (Tris Buffered Saline with Tween). ®It was washed with 20) and incubated with a secondary antibody for 1 hour. Proteins were detected using chemiluminescence on a chemiluminescent substrate (Thermo Fisher Scientific, Sunnyvale, CA, USA), and quantitative analysis of fluorescence was performed using Image J.

[0116] 2.1.3. RNA Analysis Methods

[0117] Total RNA was extracted from the cell pellet using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Reverse transcription and removal of genomic DNA were performed using the cDNA reverse transcription kit (TOYOBO CO., LTD., Osaka, Japan). To perform quantitative real-time polymerase chain reaction (qRT-PCR), an equal amount of cDNA was mixed with Faststart Universal SYBR Green Master (Roche).

[0118] PCR reactions were performed on the CFX Connect™ Real-Time PCR detection system (Bio-Rad) under the following conditions:

[0119] 10 minutes at 95℃ and 40 cycles of 20 seconds at 95℃, 30 seconds at 55℃, and 30 seconds at 72℃

[0120] The primers used in the above RT-qPCR are as shown in Table 1 below, and the relative mRNA expression levels of the target gene were normalized using the △△Ct method based on the expression levels of the housekeeping gene (RPLP0, β-actin, GAPDH, or Eef2) as a control.

[0121] Gene Direction Sequence (5'-3') Sequence number Pparγ forward GCGGGCTGAGAAGTCACGTT 1 reverse CCATCACGGAGAGGTCCACA 2 C / ebpα forward TACCGAGTAGGGGGAGCA 3 reverse TCATTTTTCTCACGGGGCC 4 Fasn forward AGAAGCCATGTGGGGAAGATT 5 reverse AGCAGGGACAGGACAAGACAA 6 Acly forward CTTGGGCCGGAACAAAA 7 reverse GCCGAGGTGGTGCAGAT 8 Fabp4 forward GGGAACCTGGAAGCTTGTCT 9 reverse ACTCTCTGACCGGATGGTGA 10 Cd36 forward GTGCAAAACCCAGATGACGT 11 reverse TCCAACAGACAGTGAAGGCT 12 Dgat1 forward GGCCCAAGGTAGAAGAGGAC 13 reverse GATCAGCATCACCACACACC 14 Gpat forward GTAGTTGAACTCCTCCGACA 15 reverse ATCCACTACCACTGAGAGGA 16 Pgc1α forward AAGTGGTGTAGCGACCAATCG 17 reverse AATGAGGGCAATCCGTCTTCA 18 Cpt1a forward CTCCGCCTGAGCCATGAAG 19 reverse CACCAGTGATGCCATTCT 20 Gapdh forward AGTATGACTCCACTCACGGCAAAT 31 reverse GTCTCGCTCCTGGAAGATGGT 32 β -actin forward GGCTGTATTCCCCTCCATCG 33 reverse CCAGTTGGTAACAATGCCATGT 34 Eef2 forward CGGGACACGGCTCTTAACAT 35 reverse CTTCCTGGAGGCACTTACCC 36

[0123] 2.1.4. Measurement of Mitochondrial Respiration

[0124] The oxygen consumption rate (OCR) in real time was measured using an extracellular flux analyzer (Seahorse XF, Agilent Technologies, Palo Alto, CA, USA). Cells were seeded into XF cell culture plates and differentiated as described above. Then, prior to measurement, the medium was replaced with XF analysis medium (pH 7.4), and the plates were incubated for 1 hour in a CO2-free incubator at 37°C.

[0125] Subsequently, the cells underwent a Mito Stress test according to the manufacturer's instructions using unbuffered basic medium (#103575-100, Agilent Technologies, XF DMEM, pH 7.4, 40 mM glucose, 1 mM pyruvate, 2 mM glutamine).

[0126] Cellular oxygen consumption was measured before and after the addition of oligomycin (1.5 μM), carbonyl cyanide 4-trifluoromethoxy phenylhydrazone (FCCP; 1.0 μM), and antimycin A / rotenone (1.0 μM). OCR was monitored using an extracellular flux analyzer in three cycles of mixing (150 sec), waiting (120 sec), and measurement (210 sec). This cycle was repeated after each injection. Mitochondrial respiration was determined by subtracting the non-mitochondrial OCR from the OCR after FCCP treatment. ATP production was determined by subtracting the OCR after oligomycin treatment from the baseline OCR. Mitochondrial respiration data were normalized to the control group data.

[0128] 2.1.5. Mitochondrial Staining

[0129] Fixed cells in 200nM MitoTracker in DPBS TM Green FM (Invitrogen) or 500nM MitoTracker TMIncubated with Red CMXRos (Invitrogen) at 37°C for 15 minutes. After washing with PBS, the nuclei were stained with DAPI for 5 minutes. Subsequently, fluorescence images were examined using a fluorescence microscope, and the fluorescence intensity and membrane potential of the mitochondrial mass were calculated using Image J.

[0131] 2.2. Confirmation of the Effects of Patulin on Glycolipid Metabolism

[0132] To determine the mechanism of the effect of patulin on lipid accumulation in mature 3T3-L1 cells, changes in glycolipid metabolism following patulin treatment were examined, specifically changes in glucose uptake, glycerol release, and LDL uptake.

[0133] Culture media were collected in the presence of 1 or 5 μM patulin, and the amounts of glucose and glycerol were quantified. As a result, it was confirmed that glucose uptake was significantly inhibited by patulin in a concentration-dependent manner, which was indicated by the higher glucose content in the culture media treated with patulin compared to the untreated group (Fig. 3A). Meanwhile, treatment with patulin significantly increased the concentration of glycerol in the culture media (Fig. 3B), and when the degree of LDL uptake in mature adipocytes under patulin treatment was evaluated, it was confirmed that the degree of LDL uptake was downregulated in a concentration-dependent manner by the treated patulin compared to the untreated group (Fig. 3C).

[0134] These results indicate that patulin can regulate glycolipid metabolism by inhibiting the absorption of glucose and LDL in mature adipocytes and promoting the release of glycerol.

[0136] 2.3. Confirmation of effects on the expression of lipid metabolism-related factors

[0137] To investigate the effects of patulin on the expression of adipogenic and lipogenic regulatory factors, the mRNA or protein expression levels of Pparγ, Fasn, Acly, C / ebpα, FABP4, Cd36, Dgat, and Gpat, which are factors related to adipogenesis or lipogenesis, were analyzed via immunoblotting.

[0138] As shown in Figure 4, the protein expression levels of PPARγ, FASN, and ACLY significantly increased when 3T3-L1 preadipocytes were differentiated into mature adipocytes following MDI treatment, and the expression levels of these proteins decreased in a concentration-dependent manner upon treatment with patulin (Figures 4A, B). In addition, treatment with patulin significantly inhibited the mRNA expression levels of major adipogenesis / lipid synthesis genes, Pparγ, C / ebpα, Fabp4, Cd36, Dgat, and Gpat, which were increased upon differentiation into mature adipocytes, in a concentration-dependent manner (Figure 4C).

[0139] These results suggest that patulin exhibits an inhibitory effect on the expression of lipogenesis and lipid synthesis genes.

[0141] 2.4. Confirmation of Effects on Fatty Acid Oxidation

[0142] To investigate the effects of patulin on fatty acid oxidation (FAO), the protein expression level of peroxisome proliferator-activated receptor gamma cofactor-1α (PGC-1α), a factor regulating fatty acid oxidation, was analyzed, and the mRNA levels of PGC-1α and carnitine palmitoyl transferase-1 (CPT-1) were analyzed using RT-qPCR.

[0143] During the differentiation of 3T3-L1 adipocytes, both protein and mRNA expression levels of PGC-1α decreased. However, when treated with 1 or 5 μM patulin (especially 5 μM), it was confirmed that the expression level of PGC-1α significantly increased. Furthermore, at the same concentration, treatment with patulin significantly increased the expression level of the Cpt-1a gene compared to differentiated adipocytes not treated with patulin (Fig. 5).

[0144] These results suggest that the inhibitory effect of patulin on lipogenesis is attributed to the promotion of such fatty acid oxidation.

[0146] 2.5. Confirmation of effects on mitochondrial function in adipocytes

[0147] PGC-1α plays a pivotal role in mitochondrial metabolism by promoting mitochondrial biosynthesis and bioenergetic generation. Therefore, the effect of patulin treatment on mitochondrial respiration in mature 3T3-L1 adipocytes was confirmed by measuring the oxygen consumption rate (OCR) using Seahorse analysis.

[0148] Cells treated with 5 μM patulin exhibited significantly higher OCR levels compared to the untreated group (Fig. 6A, B). To further evaluate the effect of patulin on mitochondrial strength, staining was performed to visualize changes in mitochondrial quantity and membrane potential (Mito tracker Green - mitochondrial quantity, Mito tracker Red CMXRos - mitochondrial membrane potential). As a result, it was confirmed that patulin-treated cells stained more strongly green, indicating an increase in mitochondrial quantity in mature adipocytes compared to the untreated group (Fig. 6C, D). Additionally, it was confirmed that patulin treatment increased the mitochondrial membrane potential in differentiated adipocytes (Fig. 6E, F). These observations were further reinforced by flow cytometry data showing that patulin treatment increased not only mitochondrial quantity but also mitochondrial membrane potential (Fig. 7).

[0149] Synthesizing these analysis results, it appears that patulin has a positive effect on mitochondrial function by improving both the quantity and quality of mitochondria in mature adipocytes.

[0151] Example 3. Confirmation of the effect of patulin on inflammation-induced macrophages

[0152] 3.1. Experimental Method

[0153] 3.1.1. RNA Analysis Methods

[0154] Total RNA was extracted from the cell pellet using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Reverse transcription and removal of genomic DNA were performed using the cDNA reverse transcription kit (TOYOBO CO., LTD., Osaka, Japan). To perform quantitative real-time polymerase chain reaction (qRT-PCR), an equal amount of cDNA was mixed with Faststart Universal SYBR Green Master (Roche).

[0155] PCR reactions were performed on the CFX Connect™ Real-Time PCR detection system (Bio-Rad) under the following conditions:

[0156] 10 minutes at 95℃ and 40 cycles of 20 seconds at 95℃, 30 seconds at 55℃, and 30 seconds at 72℃

[0157] The primers used in the above RT-qPCR are as shown in Table 2 below, and the relative mRNA expression levels of the target genes were normalized using the △△Ct method based on the expression levels of housekeeping genes (RPLP0, β-actin, GAPDH, or Eef2) as a control.

[0159] Gene Direction Sequence (5'-3') Sequence number Il-6 forward CAAAGCCAGAGTCCTTCAGA 21 reverse TTGGTCCTTAGCCACTCCTT 22 Tnf-α forward AGCCCACGTCGTAGCAAACCAC 23 reverse AGGTACAACCCATCGGCTGGCA 24 inos forward CCTGTGTTCCACCAGGAGAT 25 reverse CCCTGGCTAGTGCTTCAGAC 26 Cox-2 forward TGACCCCCAAGGCTCAAAT 27 reverse GAACCCAGGTCCTCGCTTATG 28 Rplp0 forward AGGTCCTCCTTGGTGAAC 29 reverse GTGCTGATGGGCAAGAAC 30 Gapdh forward AGTATGACTCCACTCACGGCAAAT 31 reverse GTCTCGCTCCTGGAAGATGGT 32 β -actin forward GGCTGTATTCCCCTCCATCG 33 reverse CCAGTTGGTAACAATGCCATGT 34 Eef2 forward CGGGACACGGCTCTTAACAT 35 reverse CTTCCTGGAGGCACTTACCC 36

[0161] 3.1.2. Quantification of Pro-inflammatory Cytokines and Nitric Oxide (NO)

[0162] Enzyme-linked immunosorbent assay (ELISA) was performed to quantify the amounts of the pro-inflammatory cytokines IL-6 and TNF-α in RAW 264.7 cell culture medium. Sandwich ELISA was performed using the BD OptEIA™ ELISA kit (BD biosciences, San Jose, CA, USA) according to the manufacturer's instructions. Specific antibodies for each cytokine were coated onto 96-well immunoplates (SPL Life sciences, Gyeonggi-do, Korea) and incubated overnight at 4°C. After washing away excess antibodies, an assay diluent was added to inhibit non-specific binding. Then, each cytokine standard and cell culture supernatant were added to the wells at specified concentrations. After the incubation and washing steps, the captured cytokines were further incubated with a mixture of biotin-binding detection antibodies and streptavidin-horsehead peroxidase conjugate (sAv-HRP). Then, the enzyme reaction was initiated by adding the provided substrate solution and stopped by adding a stopping solution (1M H3PO4). Afterward, the absorbance was measured at 450 nm using a microplate reader, and a standard curve was used to determine the cytokine concentration expressed in ng / mL.

[0163] The concentration of NO produced in RAW 264.7 macrophages was quantified by colorimetric analysis using Promega Griess reagent (Madison, WI, USA) according to the manufacturer's instructions. Each cell culture supernatant was mixed with 100 μL of mixed Griess reagent in a 96-well microplate and reacted at room temperature for 10 minutes. Then, the absorbance was measured at 540 nm and compared to a standard curve set with a sodium nitrite standard to determine the NO concentration.

[0165] 3.1.3. Intracellular ROS Quantification

[0166] Intracellular ROS levels were quantified by 2',7'-dichlorofluorescin diacetate (DCFDA) flow cytometry. After treating with LPS with or without patulin for 24 hours, RAW 264.7 cells were further cultured with 20 μM DCFDA solution (#ab113851, Abcam) for 30 minutes in a 37°C, 5% CO2 incubator. Then, the cells were pelleted and washed twice with PBS, after which the mean fluorescence intensity (MFI) was measured using a CytoFLEX™ flow cytometer (Beckman Coulter, Brea, CA, USA).

[0168] 3.2. Confirmation of Effects of Pro-Proliferative Cytokines on Macrophages

[0169] Macrophages are important immune cells involved in chronic inflammation associated with obesity. In addition to the anti-lipogenic effect on 3T3-L1 adipocytes, the role of patulin in regulating the immune response in mouse RAW 264.7 macrophages was further confirmed.

[0170] First, it was confirmed by the MTT assay that patulin did not exhibit cytotoxicity in RAW 264.7 cells at concentrations of 2 μM or less (Fig. 8).

[0171] In addition, under an LPS-induced inflammatory environment, patulin significantly inhibited the transcription of the pro-inflammatory cytokines TNF-α and IL-6 in a concentration-dependent manner (Fig. 9A, B). Furthermore, it was confirmed that the production of IL-6 and TNF-α, which was increased by LPS treatment, was significantly reduced in a concentration-dependent manner by patulin treatment compared to the untreated group (Fig. 9C, D).

[0172] These results indicate that patulin reduces the production of pro-inflammatory cytokines in LPS-induced macrophages.

[0174] 3.3. Confirmation of the effect on the production of inflammatory regulatory factors in macrophages

[0175] To determine the effects of patulin on inflammatory mediators, the effects on mRNA expression levels and nitric oxide (NO) production of inducible nitric oxide synthase (INOS) and cyclooxygenase-2 (Cox-2), which are inflammatory mediators, were examined.

[0176] As a result, both inos and Cox-2 genes were significantly upregulated in response to LPS stimulation, and it was confirmed that their mRNA expression levels decreased in a concentration-dependent manner upon patulin treatment (Fig. 10A, B). In addition, while the production of NO, a byproduct of inos, significantly increased under LPS treatment, it was confirmed that it was inhibited in a concentration-dependent manner upon patulin treatment compared to the untreated group (Fig. 10C).

[0177] These results suggest that patulin has the effect of improving the inflammatory response by inhibiting the production of pro-inflammatory cytokines and regulatory factors in LPS-induced macrophages.

[0179] 3.4. Confirmation of effects on mitochondrial function in macrophages

[0180] The mitochondrial energy metabolism phenotype of macrophages plays a crucial role in shaping their function and immune phenotype. Therefore, the effect of patulin on mitochondrial respiration in macrophages was investigated by measuring OCR.

[0181] First, when macrophages were stimulated with LPS, mitochondrial respiration (OCR) and ATP production decreased significantly (Fig. 11A, B). However, interestingly, treatment with patulin increased both ATP production (Fig. 11C) and mitochondrial respiration (Fig. 11D, E).

[0182] In addition, intracellular ROS production and mitochondrial volume were measured via flow cytometry. As a result, exposure to LPS significantly increased intracellular ROS production, but treatment with patulin effectively reduced ROS production in a dose-dependent manner (Fig. 12A). Similarly, patulin significantly increased mitochondrial volume compared to the LPS-induced group (Fig. 12B).

[0183] These results suggest that the enhancement of mitochondrial bioenergy may contribute to patulin's effect in preventing obesity-induced inflammation.

[0185] From the foregoing description, those skilled in the art to which the present invention pertains will understand that the present invention may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

Claim 1 A food composition for preventing or improving obesity containing patulin as an active ingredient. Claim 2 A food composition according to claim 1, wherein the patulin inhibits lipid accumulation. Claim 3 A food composition according to claim 1, wherein the patulin inhibits the protein expression of PPARγ, FASN, or ACLY. Claim 4 A food composition according to claim 1, wherein the patulin inhibits the gene expression of Pparγ, C / ebpα, Fabp4, Cd36, Dgat2 or Gpat. Claim 5 A food composition according to claim 1, wherein the patulin increases the expression of PGC1α or CPT1a. Claim 6 A food composition according to claim 1, wherein the patulin inhibits the expression of IL-6, TNF-α, iNOS, or Cox-2. Claim 7 A health functional food comprising a food composition of any one of paragraphs 1 to 6. Claim 8 A pharmaceutical composition for the prevention, improvement, or treatment of obesity containing patulin as an active ingredient. Claim 9 A pharmaceutical composition according to claim 8, wherein the patulin inhibits lipid accumulation. Claim 10 A pharmaceutical composition according to claim 8, wherein the patulin inhibits the protein expression of PPARγ, FASN, or ACLY. Claim 11 A pharmaceutical composition according to claim 8, wherein the patulin inhibits the gene expression of Pparγ, C / ebpα, Fabp4, Cd36, Dgat2 or Gpat. Claim 12 A pharmaceutical composition according to claim 8, wherein the patulin increases the expression of PGC1α or CPT1a. Claim 13 A pharmaceutical composition according to claim 8, wherein the patulin inhibits the expression of IL-6, TNF-α, iNOS, or Cox-2. Claim 14 A quasi-drug composition for preventing or improving obesity containing patulin as an active ingredient. Claim 15 A feed composition for preventing or improving obesity containing patulin as an active ingredient.

Images