NEW LACTIC ACID BACTERIA

MX431346BActive Publication Date: 2026-02-25INT N&H DENMARK APS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
MX2021010961
Authority / Receiving Office
MX · MX
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-12-06
Filing Date
2021-09-10
Publication Date
2026-02-25
Estimated Expiration
2040-03-13

AI Technical Summary

Technical Problem

Dairy manufacturers face challenges with subsequent acidification in fermented products, requiring rapid cooling to maintain pH, which is energy-intensive and limits process flexibility, and existing solutions like lactase addition or sucrose use are unsatisfactory for healthier products.

Method used

A polynucleotide encoding a β-galactosidaseFS is introduced to replace the lacZ gene in Streptococcus thermophilus, enhancing the ratio of lactose import activity to hydrolysis activity, preventing post-acidification and allowing fermentation at stable pH without cooling.

Benefits of technology

The modified strain maintains fermentation pH stability, enabling flexible manufacturing without energy-consuming cooling, while ensuring the production of healthier, additive-free fermented dairy products.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention relates to a polynucleotide comprising a lacZ gene (lacZFS) encoding a β-galactosidase characterized by a particular profile with respect to its lactose hydrolysis efficiency. The invention also relates to a strain of Streptococcus thermophilus comprising a lacZFS allele and a bacterial composition thereof, and its use for obtaining fermented milk that does not undergo subsequent acidification.
Need to check novelty before this filing date? Find Prior Art

Description

NEW LACTIC ACID BACTERIA FIELD OF INVENTION The invention relates to a polynucleotide comprising a lacZ gene (lacZFS) encoding a β-galactosidase characterized by a particular profile with respect to its lactose hydrolysis efficiency. The invention also relates to a strain of Streptococcus thermophilus comprising a lacZFS allele and a bacterial composition thereof, and its use for obtaining fermented milk that does not undergo subsequent acidification. BACKGROUND OF THE INVENTION The food industry uses bacteria to improve the flavor and texture of food and animal feed. In the dairy industry, lactic acid bacteria are commonly used to, for example, acidify milk (through lactose fermentation) and to add texture to the product. For instance, lactic acid bacteria of the species Streptococcus thermophilus (S. thermophilus) are widely used, alone or in combination with other bacteria, in the production of fresh fermented dairy products such as cheese and yogurt. One of the limitations of using lactic acid bacteria in dairy technology is the subsequent acidification. Ref. 325771 refers to the production of lactic acid by lactic acid bacteria after the desired pH (required by the technology) has been reached. Therefore, to prevent this subsequent acidification, dairy manufacturers must rapidly cool the fermented product immediately after achieving the desired pH. Consequently, dairy manufacturers lack flexibility in their production process, whereas the ability to maintain the fermented product at the fermentation temperature for a period of time would be advantageous. Furthermore, the cooling step is energy-intensive, so bypassing it would offer both economic and environmental benefits. Document WO90 / 05459 describes mutated strains of Lactobacillus bulgaricus, selected based on their color phenotype in medium containing X-gal. The application reports the identification of thermoconditional L. bulgaricus mutants (blue at 37°C, but white at 4°C) and pH-sensitive L. bulgaricus mutants (blue at pH 7, but white at pH 4.5 or 5). However, WO90 / 05459 does not mention any mutations in the lacZ gene. Furthermore, WO90 / 05459 describes mutants characterized by an enzyme that has at least 90% of the activity of a natural enzyme under production conditions (processing temperature or pH), while having at least 20% of the activity of a natural enzyme under storage conditions.However, the teaching in WO90 / 05459 is insufficient with regard to any enzymatic activity, and in particular with regard to beta-galactosidase activity; indeed, as shown in examples 4 and 5 of this application, there is no accepted reference beta-galactosidase activity in strains at pH 4.5 or pH 6. Therefore, the characterization of the mutants described in WO90 / 015459 is not possible without any reference value or reference strain. WO2010 / 139765 describes a method for manufacturing a fermented dairy product using a culture with weak subsequent acidification in specific strains of Lactobacillus bulgaricus. Because the culture is characterized by weak lactic acid production at the fermentation temperature, the pH is substantially stable and the cooling step can be omitted. However, WO2010 / 139765 does not characterize the specific Lactobacillus bulgaricus strains described. Document WO2015 / 193459 proposes other solutions to address the problem of post-fermentation acidification: controlling the lactose concentration in milk before fermentation, for example, by adding lactase, which provides lactic acid bacteria that cannot hydrolyze lactose (lactose-deficient lactic acid bacteria). However, these solutions are unsatisfactory for dairy manufacturers, as they require either the addition of an exogenous enzyme (such as lactase) to the milk before fermentation, making the manufacturing process more complex and expensive, or the addition of a carbohydrate to the milk (such as sucrose), which is inconsistent with the growing demand for healthier, additive-free products. Therefore, it is necessary to provide dairy product manufacturers with the means to produce fermented products based on lactic acid bacteria, with both satisfactory results and high flexibility in the manufacturing process. SUMMARY OF THE INVENTION In one aspect, the invention relates to a polynucleotide encoding a p-galactosidaseFS, which, when inserted in place of the lacZ gene allele of strain DGCC715 (deposited in the DSMZ on February 12, 2019, accession number DSM33036), leads to a DGCC715 derivative characterized by a LacSPH4.5 to LacZpH4.5 ratio of more than 8, wherein LacSPH4.5 represents the lactose incorporation activity of LacS permease calculated by assay A at pH 4.5, and LacZpH4.5 represents the lactose hydrolysis activity of beta-galactosidase calculated by assay B at pH 4.5. Therefore, the invention relates to a polynucleotide encoding a β-galactosidaseFS, which is defined as a lacZ allele that increases the ratio of the lactose import activity of the LacS permease calculated by assay A at pH 4.5 versus the lactose hydrolysis activity of the beta-galactosidase calculated by assay B at pH 4.5 (LacSPH4.5 vs. LacZPH4.5 ratio) above 8 in a DGCC715 derivative, the DGCC715 derivative being a DGCC715 strain (deposited in the DSMZ on February 12, 2019 with accession number DSM33036), in which its lacZ gene was replaced by the polynucleotide encoding a p-galactosidaseFS. In one aspect, the invention relates to a polynucleotide comprising a portion of at least 100 nucleotides of the polynucleotide encoding a β-galactosidaseFS, wherein the nucleotide portion encompasses the codon corresponding to residue 354 of the β-galactosidaseFS. In one aspect, the invention relates to a vector comprising a polynucleotide of the invention. In one aspect, the invention relates to a strain of Streptococcus thermophilus comprising an allele of the lacZ gene which is an allele of lacZFS encoding a β-galactosidaseFS according to the invention. In one aspect, the invention relates to a bacterial composition comprising the Streptococcus thermophilus strain of the invention. In one aspect, the invention relates to a food or feed product comprising the Streptococcus thermophilus strain of the invention or the bacterial composition of the invention. In one aspect, the invention relates to a method for manufacturing a fermented product, comprising: a) inoculating a substrate with the Streptococcus thermophilus strain of the invention or the bacterial composition of the invention; and b) fermenting the inoculated substrate obtained in step a) to obtain a fermented product, preferably a fermented dairy product. In one aspect, the invention relates to the use of the Streptococcus thermophilus strain of the invention or the bacterial composition of the invention, for making a food or feed product, preferably a fermented food product, more preferably a fermented dairy product. In one aspect, the invention relates to the use of a polynucleotide or vector of the invention, to obtain a strain of Streptococcus thermophilus with a total STOP phenotype when used to ferment milk by assay C. In one aspect, the invention relates to a method for preparing a strain of Streptococcus thermophilus with a total STOP phenotype, comprising: a) providing a strain of Streptococcus thermophilus, having a LacSPH4.5 to LacZPH4.5 ratio that is less than 5, wherein LacSPH4.5 represents the lactose import activity of LacS permease calculated by assay A at pH 4.5, and LacZPH4.5 represents the lactose hydrolysis activity of beta-lactosidase calculated by assay B at pH 4.5; b) replacing the lacZ gene allele of the Streptococcus thermophilus strain of step a) with a polynucleotide of the invention, or replacing a portion of the lacZ gene allele of the Streptococcus thermophilus strain of step a) with the corresponding polynucleotide according to the invention, or modifying the lacZ gene sequence of the Streptococcus thermophilus strain of step a) to obtain a lacZFS allele with the same sequence as a polynucleotide of the invention; and c) recovering the Streptococcus thermophilus strain or strains with a total STOP phenotype when used to ferment milk by assay C. The invention thus relates to a method for preparing a Streptococcus thermophilus strain with a total STOP phenotype, comprising: a) providing a Streptococcus thermophilus strain having a ratio of the lactose import activity of the LacS permease calculated by assay A at pH 4.5 versus the lactose hydrolysis activity of beta-galactosidase calculated by assay B at pH 4.5 (LacSPH4.5 vs. LacZpH4.5 ratio) which is less than 5; b) replacing the lacZ gene allele of the Streptococcus thermophilus strain of step a) with a polynucleotide of the invention or replacing a portion of the lacZ gene allele of the Streptococcus thermophilus strain of step a) with the corresponding polynucleotide according to the invention, or modifying the lacZ gene sequence of the Streptococcus thermophilus strain of step a) to obtain a lacZFS allele with the same sequence as a polynucleotide of the invention; and c) recovering the Streptococcus thermophilus strain or strains with a total STOP phenotype when used to ferment milk by assay C. In one aspect, the invention relates to a method for identifying a lacZFS allele encoding a βgalactosidaseFS, comprising: a) inserting the lacZ allele of study in place of the lacZ gene allele of strain DGCC715 (deposited in the DSMZ on February 12, 2019, accession number DSM33036), to obtain a DGCC715 derivative; and b) determining the lactose import activity of the LacS permease by assay A at pH 4.5 (LacSPH4.5) and the lactose hydrolysis activity of the beta-galactosidase by assay B at pH 4.5 (LacZPH4.s); where a LacSPH4.5 to LacZPH4.5 ratio of more than 8 is indicative of a lacZ allele that is a lacZFS allele encoding a 3-galactosidaseFS. BRIEF DESCRIPTION OF THE FIGURES Figures 1A and 1B are graphs that represent (Figure 1A) the acidification profile in milk (pH vs. time) of the DGCC7984 strain and its two subclones DGCC12455 and DGCC12456, and (Figure 1B) the evolution of the acidification rate vs. time (mUpH / min vs. time) of the DGCC12456 strain. Figures 2A and 2B are graphs that represent (Figure 2A) the acidification profile in milk (pH vs. time) and (Figure 2B) the evolution of the acidification rate vs. time (mUpH / min vs. time) of the DGCC715 strain Figures 3A and 3B are graphs that represent (Figure 3A) the acidification profile in milk (pH vs. time) and (Figure 3B) the evolution of the acidification rate vs. time (mUpH / min vs. time) of strain 715R354C Figures 4A and 4B are graphs that represent (Figure 4A) the acidification profile in milk (pH vs. time) and (Figure 4B) the evolution of the acidification rate vs. time (mUpH / min vs. time) of the DGCC11231 strain Figures 5A and 5B are graphs that represent (Figure 5A) the acidification profile in milk (pH vs. time) and (Figure 5B) the evolution of the acidification rate vs. time (mUpH / min vs. time) of strain 112 3 1R354C Figure 6 is a graph representing the beta-galactosidase activity at pH 6 and pH 4.5 of four strains of S. thermophilus Figure 7 is a graph representing the beta-galactosidase activity at pH 6 and pH 4.5 of strain DGCC715, strain 715R354C, strain DGCC11231, strain 11231R354C and strain DGCC12456 Figure 8 is a graph representing the LacS vs LacZ ratio at pH 6 and pH 4.5 of strain DGCC715, strain 715k354°, strain DGCC11231, strain 11231R354C, and strain DGCC12456 Figure 9 is a graph that represents the difference in lactose hydrolysis efficiency between pH 6 and pH 4.5 (ΔEH) of strain DGCC715, strain 715R354C, strain DGCC11231, strain 11231R354c, and strain DGCC12456. Figures 10A and 10B are graphs that represent (Figure 10A) the viscosity measured on day 14 and (Figure 10B) the evolution of pH versus time, for a stirred yogurt made with strain DGCC12456 and packaged at a temperature of 20°C or 35°C (storage at 10°C). Figure 11 is a graph that represents the evolution of pH over time of a yogurt made with the DGCC12456 strain (normal line) and with a reference culture (dotted line) (stored at 10°C). DETAILED DESCRIPTION OF THE INVENTION General definitions Unless otherwise defined, all scientific and technical terms used herein have the same meaning as they are normally understood by an expert in the technique to which this description pertains. The description is not limited by the methods and materials described herein by way of example, and any similar or equivalent methods and materials to those described herein may be used in carrying out or testing the modalities of this description. The headings provided herein are not limitations on the different aspects or forms of this description that may be used by reference to the description as a whole. Therefore, the terms defined below are more fully defined by reference to the description as a whole. As used herein, the term polynucleotide is synonymous with the term nucleotide sequence and / or the term nucleic acid sequence. Unless otherwise stated, all nucleic acid sequences are written from left to right in the 5' to 3' orientation. The term protein, as used herein, includes proteins, polypeptides, and peptides. As used herein, the term amino acid sequence is synonymous with the term protein. In the description and claims herein, the name of the amino acid, the conventional three-letter code, or the conventional one-letter code for amino acid residues is used. It is also understood that a protein may be encoded by more than one nucleotide sequence due to the redundancy of the genetic code. Unless otherwise stated, all amino acid sequences are written from left to right in the amino-to-carboxyl orientation. In the present invention, a specific numbering of the amino acid residue positions in beta-galactosidase can be used. By aligning the amino acid sequence of a sample beta-galactosidase with the beta-galactosidase of SECTION ID NO: 2, it is possible to assign a number to an amino acid residue position in the sample beta-galactosidase that corresponds to the amino acid residue position or numbering of the amino acid sequence shown in SECTION ID NO: 2 of the present invention. Throughout this description, other definitions of terms may appear. Before describing the modalities in more detail by way of example, it should be understood that this description is not limited to the particular modalities described, as these may obviously vary. It should also be understood that the terminology used herein is solely for the purpose of describing particular modalities and is not intended to be limiting, as the scope of this description is limited only by the appended claims. It should be noted that, as used herein and in the accompanying claims, the singular forms a, one, an and the include the plural referents unless the context clearly indicates otherwise. The terms comprising, includes, and composed of, as used herein, are synonymous with including, includes, or containing, and are inclusive or open-ended and do not exclude additional, unmentioned members, elements, or steps of the method. The terms comprising, includes, and composed of also include the term consisting of. The publications discussed herein are provided solely for descriptive purposes prior to the filing date of this application. Nothing herein should be construed as an admission that such publications constitute prior art for the appended claims. The present invention surprisingly discovered that mutations that modify the flow of lactose can be used to engineer strains of Streptococcus thermophilus, which can be used to produce fermented milk that does not undergo further acidification when stored at the fermentation temperature. In one aspect, the present invention provides a method for identifying a lacZFS allele that encodes a β14 galactosidaseFS, comprising: a) inserting the lacZ allele under study in place of the lacZ gene allele from strain DGCC715, to obtain a DGCC715 derivative; and b) determine the lactose import activity of the permease LacS by assay A at pH 4.5 (LacSptu.s) and the lactose hydrolysis activity of the beta-galactosidase by assay B at pH 4.5 (LacZpH4.s) in the DGCC715 derivative from step a); where a LacSPH4.5 to LacZpH4.5 ratio of more than 8 is indicative of a lacZ allele that is a lacZFS allele encoding a p-galactosidaseFS. In one embodiment, the method further comprises determining the lactose hydrolysis activity of beta-galactosidase by assay B at pH 6 (LacZpne) on the DGCC715 derivative, and wherein a LacSPH4.5 vs LacZpH4.5 ratio of more than 8 and a LacZpns of at least 7.10-8mol / (mg of total protein extract.min) are indicative of a lacZ allele that is a lacZFS allele encoding a βgalactsidase aFS. As used herein, the expression "an allele of the lacZ gene" means the version of the lacZ gene present in a particular strain of Streptococcus thermophilus. As with most bacterial genes, the nucleotide sequence of a gene can vary, and alleles represent different sequences of the same gene. The lacZ gene of a Streptococcus thermophilus strain is understood herein to be the nucleotide sequence encoding a beta-galactosidase, located sequence down from the lacS gene encoding the lactose β-permease LacS, within the lac operon [Schroeder CJ et al., J Gen Microbiol. February 1991; 137(2):369-80]. The word beta-galactosidase is used herein interchangeably with the word β-galactosidase. An example of an allele of the lacZ gene of Streptococcus thermophilus is the lacZ gene allele of strain DGCC715 (DSM33036) as set out in SEC ID NO:1. This allele as defined in SEC ID NO:1 encodes a βgalactosidase as set out in SEC ID NO:2. An example of an allele of the lacS gene of Streptococcus thermophilus is the lacS gene allele of strain DGCC715, which is as set out in SEC ID NO:30. This allele as defined in SEC ID NO: 30 encodes a lactose-permease LacS as set out in SEC ID NO:31. lacZFS alleles that encode β-galactosidaseFS The inventors have shown that some of these lacZ alleles encode a β-galactosidase, the activity of which is largely reduced, but not zero, at pH 4.5 (as determined by assay B), when inserted in place of the lacZ gene allele (SEC ID NO:1) from strain DGCC715. By non-zero β-galactosidase activity at pH 4.5, it is understood that the β-galactosidase activity at pH 4.5 (LacZpH4.5) is detectable when determined by assay B as described herein. As shown in Examples 4 and 5 below, β-galactosidase activity in Streptococcus thermophilus strains is highly variable from strain to strain, so it is not technically appropriate to refer to β-galactosidase activity without any reference value or reference strain. Furthermore, as shown in Example 6, the reduction in β-galactosidase activity at pH 4.5 in a DGCC715-derived strain carrying a lacZFS allele, compared to the DGCC715 strain, is accompanied by an increase in LacS activity (as determined by assay A). Taken together, these results have led the inventors to characterize the reduction of β-galactosidase at pH 4.5 by means of a robust and reproducible parameter, which is the ratio of the lactose import activity of the LacS permease calculated by assay A at pH 4.5 versus the lactose hydrolysis activity of beta-galactosidase calculated by assay B at pH 4.5 (LacSPH4.5 vs. LacZPH4.s ratio). The inventors have therefore demonstrated that one of these lacZ alleles leads to a LacSPH4.5 vs. LacZpH4.5 ratio of more than 8 when inserted in place of the lacZ gene allele (SEC ID N0:l) from strain DGCC715. These lacZ alleles are hereby defined as lacZFS alleles. The protein encoded by these lacZFS alleles is hereby designated β-galactosidaseFS. In other words, one allele of lacZFS increases the ratio of the lactose import activity of the LacS permease calculated by assay A at pH 4.5 versus the lactose hydrolysis activity of the beta-galactosidase calculated by assay B at pH 4.5 (LacSPH4.5 versus LacZpw ratio).s) above 8 in a derivative of DGCC715, the derivative of DGCC715 being a DGCC715 strain (DSM33036), in which its lacZ gene was replaced by the polynucleotide encoding a p-galactosidaseFS; as defined in this application, the increase in the LacSPH4.5 to LacZpH4.5 ratio in a derivative of DGCC715 is determined by comparison with the LacSPH4.5 to LacZpH4.5 ratio of the DGCC715 strain (DSM33036). Therefore, any lacZFS allele (encoding a β-galactosidaseFS) that leads to a LacSPH4.5 to LacZpH4.5 ratio of more than 8 (as defined herein) in a DGCC715 derivative is part of the invention. Therefore, any lacZFS allele (encoding a β-galactosidaseFS) that increases the LacSPH4.5 to LacZPH4.5 ratio above 8 in a DGCC715 derivative as defined herein is part of the invention. In one embodiment, the lacZFS allele of the invention (encoding a β-galactosidaseFS) leads to a LacSPH4.5 to LacZpH4.5 ratio of more than 9 (as defined herein) in a derivative of DGCC715. In one embodiment, the lacZFS allele of the invention (encoding a β-galactosidaseFS) leads to a LacSPH4.5 to LacZpH4.5 ratio of more than 10 (as defined herein) in a derivative of DGCC715. In one embodiment, the lacZFS allele of the invention (encoding a β-galactosidaseFS) leads to a LacSPH4.5 to LacZPH4.5 ratio of more than 11 (as defined herein) in a derivative of DGCC715. In one embodiment, the lacZFS allele of the invention (encoding a β-galactosidaseFS) leads to a LacSPH4.5 to LacZpH4.5 ratio of more than 12 (as defined herein) in a derivative of DGCC715. In one embodiment, the lacZFS allele of the invention (which encodes a β-galactosidaseFS) leads to a LacSPH4.5 vs. LacZpH4.5 ratio (as defined herein) in a DGCC715 derivative selected from the group consisting of more than 9, more than 10, more than 11, and more than 12.Therefore, the lacZFS allele of the invention (which encodes a βgalactosidaseFS) increases the ratio of LacSPH4.5 to LacZPH4.5, in a DGCC715 derivative as defined herein, above a value selected from the group consisting of above 9, above 10, above 11 and above 12. As mentioned elsewhere, the βgalactosidase activity at pH 4.5 (LacZpH4.5) is not zero, i.e., it is detectable when determined by assay B; in one embodiment, and in combination with any minimum value with respect to the LacSPH4.5 to LacZPH4.5 ratio as defined herein, the lacZFS allele of the invention (which encodes a 3-galactosidaseFS) leads to a LacSPH4.5 to LacZpH4.5 ratio (as defined herein) in a DGCC715 derivative that is less than 100 (or increases the LacSPH4.5 to LacZpH4.5 ratio, in a DGCC715 derivative, to less than 100). In one embodiment, the lacZFStal allele as defined herein is further characterized (apart from the LacSPH4.5 vs. LacZpH4.5 ratio) by the fact that it encodes a βgalactosidaseFS whose activity is at least 7.1CC8mol / (mg of total protein extract.min) at pH 6 (as determined by assay B) (LacZpH6), when the lacZFS allele is inserted in place of the lacZ gene allele of strain DGCC715. Therefore, the lacZFStal allele as defined herein is further characterized (apart from the LacSPH4.5 vs. LacZPH4.s relationship) by the fact that it encodes a β-galactosidaseFS whose activity is at least 7 ICE8mol / (mg of total protein extract.min) at pH 6 (as determined by assay B) (LacZpH6) in a DGCC715 derivative, the DGCC715 derivative being a DGCC715 strain in which its lacZ gene was replaced by the lacZFS allele. In one embodiment, the lacZFS allele encodes a β-galactosidaseFS whose activity is at least 8.10~8mol / (mg of total protein extract.min) at pH 6 (LacZpne) · In one modality, the lacZFS allele encodes a β-galactosidaseFS whose activity is at least 9.1Ch8mol / (mg of total protein extract.min) at pH 6 (LacZpne). In one modality, the lacZFS allele encodes a β-galactosidaseFS whose activity is at least 1.10~7mol / (mg of total protein extract.min) at pH 6 (LacZpne). In one embodiment, the lacZFStal allele as defined herein is further characterized (apart from the ratio of LacSPH4.5 to LacZPH4.s) by the fact that it encodes a β-galactosidaseFS whose activity is selected from the group consisting of at least 7.10~8, at least 8.1CU8, at least 9.1CG8 and at least 1.10-7mol / (mg of total protein extract.min) at pH 6 (as determined by assay B) (LacZpne), when the lacZFS allele is inserted in place of the lacZ gene allele of the DGCC715 strain (i.e., in a DGCC715 derivative, the DGCC715 derivative being a DGCC715 strain in which its lacZ gene was replaced by the lacZFS allele). Therefore, in one embodiment, any allele of lacZFS (which encodes a β-galactosidaseFS) that leads to a LacSPH4.5 to LacZpH4.5 ratio of more than 8 (as defined herein) and that leads to a LacZPH6 of at least 7.10~8mol / (mg of total protein extract.min) (as defined herein), in a derivative of DGCC715, forms part of the invention. In one embodiment, the lacZFS allele of the invention (which encodes a β-galactosidaseFS) leads to a LacSPH4.5 vs. LacZPH4.5 ratio selected from the group consisting of more than 9, more than 10, more than 11, and more than 12 (as defined herein) in a DGCC715 derivative, and leads to a LacZpH6 selected from the group consisting of at least 7.10-8, at least 8.10-8, at least 9.10-8, and at least 1.10-7 mol / (mg of total protein extract.min) (as determined by assay B) in the DGCC715 derivative.In one embodiment, the lacZFS allele of the invention (encoding a 3-galactosidaseFS) leads to a LacSPH4.5 to LacZPH4.5 ratio (as defined herein) in a DGCC715 derivative that is less than 100. Therefore, any lacZFS allele (encoding a p-galactosidaseFS) that increases a LacSPH4.5 to LacZpH4.5 ratio above 8 (compared to the LacSPH4.5 to LacZpH4.5 ratio of the DGCC715 strain) and leads to a LacZPH6 of at least 7.10~8 mol / (mg of total protein extract.min) (as defined herein), in a DGCC715 derivative, forms part of the invention. In one embodiment, the lacZFS allele of the invention (which encodes a p-galactosidaseFS) increases the ratio of LacSPH4.5 to LacZpH4.5 above a value selected from the group consisting of above 9, above 10, above 11 and above 12 (as defined herein) in a DGCC715 derivative, and leads to a LacZPH6 selected from the group consisting of at least 7.10~8, at least 8.10~8, at least 9.10~8 and at least 1.10~7 mol / (mg of total protein extract.min) (as determined by assay B) in the DGCC715 derivative. In one embodiment, the lacZFS allele of the invention (encoding a βgalactosidaseFS) increases the ratio of LacSPH4.5 to LacZPH4.5 (as defined herein) in a DGCC715 derivative to less than 100. Later, non-limiting examples of βgal acts idas aFS are described. It should be noted that in the present invention, the activity of LacS and LacZ (at pH 4.5 and pH 6) are calculated by means of test A and test B, respectively, as described herein. An allele of lacZ that, when inserted in place of the lacZ gene allele of the DGCC715 strain, does not result in a LacSPH4.5 to LacZpH4.5 ratio (as defined herein) of more than 8, is not considered a lacZFS allele according to the invention. In other words, a lacZ allele that does not increase the LacSPH4.5 to LacZpH4.5 ratio (as defined herein) above 8 in a DGCC715 derivative is not considered a lacZFS allele according to the invention, the DGCC715 derivative being a DGCC715 strain in which its lacZ gene has been replaced by the lacZ allele. LacS activity, LacZ activity and their relationship The invention is based on the determination of the lactose import activity of the permease LacS and / or the determination of the lactose hydrolysis activity of beta-galactosidase, at particular pH values ​​(pH 4.5 and / or pH 6). These activities are determined in a particular strain, such as, for example, the DGCC715 strain or a derivative of DGCC715 as defined herein. The lactose import activity of LacS permease at a particular pH (pH X) is hereby designated LacSpHx. In one embodiment, this activity is determined at pH 4.5 (LacSpH4.s). In another embodiment, this activity is determined at pH 6 (LacSpHe). In a particular embodiment, the lactose import activity of LacS permease is determined at a particular pH (such as pH 4.5 or pH 6) by assay A. The lactose hydrolysis activity of beta-galactosidase at a particular pH (pH X) is hereby designated LacZpnx. In one embodiment, this activity is determined at pH 4.5 (LacZPH4.5). In another embodiment, this activity is determined at pH 6 (LacZpne). In a particular embodiment, the lactose hydrolysis activity of beta-galactosidase is determined at a particular pH (such as pH 4.5 or pH 6) by assay B. One way to determine the relationship of LacSPH4.5 to LacZPH4.5 for the identification of the lacZFS allele of the invention is to determine the lactose import activity of the LacS permease at pH 4.5 in a DGCC715 strain in which the allele of its lacZ gene has been replaced with a lacZ allele of the object of study (hereinafter referred to as the derivative of DGCC715) and determine the lactose hydrolysis activity of beta-galactosidase at pH 4.5 in the same DGCC715 derivative, and calculate the ratio of both activities. Assay A (LacS activity) Streptococcus thermophilus strains were cultured in M17 medium containing 30 g / L sucrose as the sole carbon source overnight at 37°C. Once the cells reached the stationary phase, they were transferred (at a rate of 0.05 µg OD / mL) to 1 volume of M17 medium containing 30 g / L lactose as the sole carbon source and incubated for 2 hours at 42°C. The strain cultures were centrifuged at room temperature (3500 g), the supernatant was removed, and the cells were resuspended in 0.5 volume of 4% (w / v) glycerophosphate. This washing step was performed twice. 1.8 mL of the cell suspension was incubated in 4% glycerophosphate for 2 minutes at 42°C. Next, 0.2 mL of lactose solution (70 g / L lactose + 0.1 M potassium phosphate buffer) was added [the pH of the lactose solution was previously adjusted to pH 4.5 or pH 6, depending on the measurement required]. The mixture was incubated for a further 3 minutes at 42°C.The reaction was stopped by filtration through a 0.22 µm filter to remove cells. The lactose in the filtered solution was then assayed by HPLC using the following protocol. The solution was diluted to 10% in water, and 10 pL were injected into an Agilent 1200 HPLC (high-performance liquid chromatography) system. Elution was performed in isocratic mode with pure water at 0.6 mL / min. Molecules were separated in 40 min on a Pb²⁺ ion-exchange column (Shodex® SP-0810, 300 mm x 8 mm x 7 µm). Sugars were detected using a refractometer. Quantification was performed by external calibration. The lactose import activity of the permease LacS is calculated as follows: LacS activity = ([lactose] initial - [lactose] 3min) / (OD x time), expressed in pmol / (uOD.min), where: - [lactose] initial is the initial concentration in pmol / mL - [lactose] 3min is the concentration in pmol / mL after 3 minutes at 42°C - OD is the bacterial density in uOD / mL - time is the duration of the experiment in minutes (in this case, 3 minutes). Assay B (LacZ activity) A fresh overnight culture of the Streptococcus thermophilus strain under test was obtained in M17 containing 30 g / L lactose and used to inoculate 10 mL of freshly prepared M17 containing 30 g / L lactose at a 1% (v / v) concentration. Cells were harvested by centrifugation (6000 g, 10 min, 4°C) after 3 hours of growth in M17 containing 30 g / L lactose at 42°C, washed in 1.5 mL of cold lysis buffer (0.1 M KPO4), and resuspended in 300 µA of cold lysis buffer was added. EDTA-free protease inhibitors complete™ (Roche, supplier reference 04693132001) were added to the lysis buffer as described by the supplier. Cells were homogenized by adding 100 mg of glass beads (150–212 µm, Sigma G1145) to 250 µl of resuspended cells and oscillating at a frequency of 30 cycles / s for 6 min in an MM200 oscillating mill (Retsch, Haan, Germany). Cell debris and glass beads were removed by centrifugation (14,000 g, 15 min, 4 °C), and the supernatant was transferred to a clean 1.5 mL centrifuge tube kept on ice. Total protein content was determined using the FLUKA Rapid Protein Quantification Kit (ref 51254). The activity of betagalactosidase in cell extracts was determined spectrophotometrically by monitoring the hydrolysis of O-nitrophenol-beta-galactoside (ONPG) into galactose and O-nitrophenol (ONP).Twenty pL of the cell extract were mixed with 135 pL of reaction buffer (100 mM NaPO4; 10 mM KCl; 1 mM MgSO4; 3 mM ONPG + 60 mM Beta Mercapto Ethanol, pH = 6). ONP production resulted in a yellow color in the tube. When the yellow color appeared, the reaction was stopped by adding 250 pL of stop buffer (1 M NazCOs). The optical density was recorded at 420 nm using a Synergy HT multidetector microplate reader (BIO-TEK). One unit of beta-galactosidase corresponds to the amount of enzyme that catalyzes the production of 1 pmol of ONP per minute under the assay conditions. Beta-galactosidase activity was calculated as follows: LacZ activity = dOD x V / [dt x 1 x ε x Qprot] , expressed in mol / (mg of total protein extract.min), where: - dOD is the variation of optical density (OD) at 420 nm between the blank and the sample being studied - V is the volume of the reaction in which the optical density is measured (in this case 250 pL) - dt = represents the duration in minutes between the addition of the 20 pL of bacterial extract and the addition of the 250 pL of stop buffer - 1 = optical path length (currently 0.73 cm) - ε = molar extinction coefficient of ONP (currently 4500 cm2 / pmol) - Qprot = amount of protein in the cuvette (in mg) Calculation of the relationship Once the LacS and LacZ activities have been calculated as defined herein, the ratio of the LacSpnx activities to LacZpHx is calculated as follows: [LacSpnx as defined herein / LacZpHx as defined herein] xl0~6. It should be noted that when a relationship is mentioned of LacSpHx versus LacZpHx, both LacS and LacZ activities are calculated on the same strain, in particular on the same DGCC715 derivative. lacZ variant allele that codes for a βgalactosidase variant An allele of lacZ, which 1) encodes β-galactosidase whose sequence has at least 95% identity with SEO ID NO:2 and 2) leads to a LacSPH4.5 to LacZPH4.5 ratio (as defined herein) of less than 5, when inserted in place of the lacZ gene allele of strain DGCC715, is hereby referred to as a variant allele of lacZ (which encodes a variant β-galactosidase). In other words, a lacZ allele that 1) encodes β-galactosidase whose sequence has at least 95% identity with SEC ID NO:2 and 2) does not increase the LacSPH4.5 to LacZpH4.5 ratio (as defined herein) to 5 or more of 5, in a DGCC715 derivative, is hereby referred to as a lacZ variant allele (encoding a β-galactosidase variant), the DGCC715 derivative being a DGCC715 strain in which its lacZ gene was replaced by the lacZ variant allele; as previously mentioned, the increase in the LacSPH4.5 to LacZPH4 ratio.5 in a DGCC715 derivative is determined by comparison with the LacSPH4.5 to LacZpH4.5 ratio of strain DGCC715 (DSM33036). The variant expression of β-galactosidase is used interchangeably with the variant expression of β-galactosidase that has at least 95% identity with SEC ID NO:2. In one embodiment, the variant lacZ allele, when inserted in place of the lacZ gene allele of strain DGCC715, leads to a LacSPH4.5 to LacZPH4.5 ratio (as defined herein) of less than 4 (or does not increase the LacSPH4.5 to LacZpH4.5 ratio to 4 or more in a DGCC715 derivative as defined herein). In another embodiment, the variant lacZ allele, when inserted in place of the lacZ gene allele of strain DGCC715, leads to a LacSPH4.5 to LacZpH4.5 ratio (as defined herein) of less than 3 (or does not increase the LacSPH4.5 to LacZpH4.5 ratio to 3 or more in a DGCC715 derivative as defined herein). In combination with any of the above modalities concerning the relationship of LacSPH4.5 to LacZpH4.5, a variant allele of lacZ is also defined as encoding a variant of β-galactosidase, the sequence of which is at least 95% identical to SEC ID NO:2. "At least 95% identical to SEC ID NO: 2" means at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%. In one modality, a variant of β-galactosidase (encoded by a variant allele of lacZ) has a sequence that is at least 96% identical to SEC ID NO: 2. In another modality, a variant of β-galactosidase (encoded by a variant allele of lacZ) has a sequence that is at least 97% identical to SEC ID NO: 2. In one modality, a variant of β-galactosidase (encoded by a variant allele of lacZ) has a sequence that is at least 98% identical to SEC ID NO: 2. In one modality, a variant of β-galactosidase (encoded by a variant allele of lacZ) has a sequence that is at least 99% identical to SEC ID NO: 2. In one embodiment, in combination with the percent identity, the size of the β-galactosidase variant is the same as that of the β-galactosidase protein as defined in SEC ID NO:2 (1026 amino acid residues); therefore, in one embodiment, a lacZ variant allele is further defined as encoding a β-galactosidase variant of 1026 amino acids. In one modality, a variant allele of lacZ is defined herein as: 1) that encodes a variant of β-galactosidase, the sequence of which is at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEC ID NO:2; and 2) when inserted in place of the lacZ gene allele of strain DGCC715, it leads to a LacSPH4.5 to LacZPH4.5 ratio (as defined herein) that is less than 5, less than 4, or less than 3. Therefore, a variant allele of lacZ is defined herein as: 1) that encodes a variant of β-galactosidase, the sequence of which is at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEC ID NO:2; and 2) that does not increase the ratio of LacSPH4.5 to LacZpH4.5 to 5 or more than 5, to 4 or more than 4, or to 3 or more than 3 in a DGCC715 derivative as defined herein. Non-limiting examples of βgalactosidase variants are described in Table 2, and their sequence is as defined in SEC ID NOs 6, 9, 12, 15, 18, 21, 24 and 27. Replacement of the lacZ gene allele in a strain of Streptococcus thermophilus (in particular strain DGCC715) Replacing the lacZ gene allele of a particular Streptococcus thermophilus strain with a lacZ allele of interest is performed using conventional molecular biology techniques and is within the capabilities of a person skilled in the technique. Generally, suitable routine methods include replacement via homologous recombination. The expression "the lacZ allele inserted in place of the lacZ gene allele" is synonymous with the expression "the lacZ gene allele is replaced by a lacZ allele under study." The expression "the lacZFS allele inserted in place of the lacZ gene allele" is synonymous with the expression "the lacZ gene allele is replaced by a lacZFS allele." Replaced (or inserted in place of) means that the β-galactosidase sequence encoded by the lacZ allele to be inserted (the lacZ allele under study) is different from the β-galactosidase sequence encoded by the lacZ gene allele of the Streptococcus thermophilus strain. Therefore, replaced (or inserted in place of) means that the coding sequence of the lacZ gene of the Streptococcus thermophilus strain (from the first nucleotide of the start codon to the last nucleotide of the stop codon) is replaced by the corresponding coding sequence of the lacZ allele under study. In the case of strain DGCC715, replaced (or inserted in place of) means that the sequence of the β-galactosidase protein encoded by the lacZ allele to be inserted (the lacZ allele under study) is different from the sequence of the β-galactosidase encoded by the lacZ gene of strain DGCC715. Therefore, replaced (or inserted in place of) means that the coding sequence of the lacZ gene of strain DGCC715 (from the first nucleotide of the start codon to the last nucleotide of the stop codon, i.e., nucleotides 1 to 3081 of SEC ID NO:1) is replaced by the corresponding coding sequence of the lacZ allele under study. A DGCC715 strain, whose lacZ gene has been replaced by a lacZ allele under study (such as a lacZFS allele or a variant lacZ allele), is hereby defined as a DGCC715 derivative. iviA / a / ¿u¿ ι / υ iu»oi DGCC715 strain The Streptococcus thermophilus strain DGCC715 was deposited by DuPont Nutrition Biosciences ApS under the Budapest Treaty with the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH (Inhoffenstr. 7B, D-38124 Braunschweig) on ​​February 12, 2019, and received deposit number DSM33036. Conditions for cultivating this strain are provided in the examples section. The applicant requests that a sample of the deposited microorganism mentioned herein may only be made available to a skilled professional until the date on which the patent is granted. The expressions strain DGCC715 and derivative of DGCC715 are used interchangeably with the expressions strain DSM33036 and derivative of DSM33036, respectively. To generate a lacZ allele of study (including a lacZFS allele) The lacZ alleles of interest (in particular, lacZFS alleles) can be generated by random or targeted mutagenesis, starting from a lacZ allele that is not a lacZFS allele, specifically from a lacZ allele encoding β-galactosidase as defined in SEC ID NO:2 (such as SEC ID NO:1) or from a variant lacZ allele as defined herein. In one modality, the lacZ alleles of interest (in particular, lacZFS alleles) are generated by random mutagenesis. In another modality, the lacZ alleles of interest (in particular, lacZFS alleles) can be generated by targeted mutagenesis. Suitable mutagenesis protocols for random or targeted mutagenesis are well known and described in the literature. The lacZ alleles of study generated in this way can be screened using the method to identify a lacZFStal allele as defined herein. p-galactosidasafS protein sequences The lacZFS allele of the invention - as part of a polynucleotide of the invention or contained in the lactic acid bacterium of the invention - may be defined, in addition to leading to a LacSPH4.5 to LacZpH4.5 ratio of more than 8 (as defined herein) (or to increase the LacSPH4.5 to LacZpH4.5 ratio to more than 8) and optionally leading to a LacZPH6 of at least 7.1CD8mol / (mg of total protein extract.min) (as defined herein), by its nucleotide sequence or by the amino acid sequence of the β-galactosidase it encodes. In one embodiment, the lacZFStal allele as defined herein encodes a p-galactosidaseFS, the sequence of which is different from SEC ID NO:2. In one embodiment, the lacZFStal allele as defined herein - as part of a polynucleotide of the invention or contained in the lactic acid bacteria of the invention - is defined by the fact that it leads to a LacSPH4.5 to LacZpH4.5 ratio of more than 8 (as defined herein) (or increases the LacSPH4.5 to LacZpH4.5 ratio to more than 8), and optionally to a LacZPH6 of at least 7.10-8 mol / (mg of total protein extract.min) (as defined herein), in a DGCC715 derivative, and encodes a β-galactosidaseFS, the sequence of which is different from SEC ID NO:2. The specific arrangements relating to the relationship of LacSPH4.5 to LacZPH4.5 and LacZPH6 described elsewhere in this application apply similarly in the present context. In one embodiment, the lacZFS allele encodes a βgalactosidaseFS comprising amino acid deletion (i.e., deletion of one or more amino acids), amino acid addition (i.e., addition of one or more amino acids), amino acid substitution (i.e., substitution of one or more amino acids), or amino acid deletion and addition (i.e., deletion and addition of one or more amino acids), with respect to a β-galactosidase selected from the group consisting of: a) a β-galactosidase having an amino acid sequence as defined in SEC ID NO:2; and b) a variant β-galactosidase protein as defined herein having at least 95% identity with SEC ID NO:2. A variant β-galactosidase protein as defined herein is encoded by a variant lacZ allele, which when inserted in place of the lacZ gene allele of strain DGCC715, leads to a LacSPH4.5 to LacZpH4.5 ratio of less than 5 (as defined herein) (or does not increase the LacSPH4.5 to LacZPH4.5 ratio to 5 or more than 5 in a DGCC715 derivative as defined herein). The particular modalities concerning the relationship of LacSPH4.5 to LacZpH4.5, the percentage of identity, and the size described elsewhere in this application within the context of the lacZ variant allele apply similarly in the present context. In one embodiment, the lacZFS allele encodes a β-galactosidaseFS comprising an amino acid deletion, with respect to a β-galactosidase selected from the group consisting of a) a β-galactosidase having an amino acid sequence as defined in SEC ID NO: 2 and b) a β-galactosidase variant as defined herein having at least 95% identity with SEC ID NO: 2; in one particular embodiment, the β-galactosidaseFS is characterized by the deletion of at least one amino acid, in particular by the deletion of 1, 2, 3, 4, or 5 amino acids. In one particular embodiment, the β-galactosidaseF5 is characterized by the deletion of one amino acid. In one particular embodiment, the β-galactosidaseFS is characterized by the deletion of 2, 3, 4, or 5 amino acids. In one particular modality, β-galactosidaseFS is characterized by the deletion of 2, 3, 4 or 5 consecutive amino acids. In one embodiment, the lacZFS allele encodes a β-galactosidaseFS comprising an amino acid addition, with respect to a β-galactosidase selected from the group consisting of a) a β-galactosidase having an amino acid sequence as defined in SEC ID NO: 2 and b) a β-galactosidase variant as defined herein having at least 95% identity with SEC ID NO: 2; in one particular embodiment, the β-galactosidaseFS is characterized by the addition of at least one amino acid, in particular by the addition of 1, 2, 3, 4, or 5 amino acids. In one particular embodiment, the β-galactosidaseFS is characterized by the addition of one amino acid. In one particular embodiment, the β-galactosidaseFS is characterized by the addition of 2, 3, 4, or 5 amino acids. In one particular modality, β-galactosidaseFS is characterized by the addition of 2, 3, 4 or 5 consecutive amino acids. In one embodiment, the lacZFS allele encodes a β-galactosidaseFS comprising an amino acid substitution, with respect to a β-galactosidase selected from the group consisting of a) a β-galactosidase having an amino acid sequence as defined in SEC ID NO: 2 and b) a β-galactosidase variant as defined herein having at least 95% identity with SEC ID NO: 2; in one particular embodiment, the β-galactosidaseFS is characterized by the substitution of at least one amino acid, in particular by the substitution of 1, 2, 3, 4, or 5 amino acids. In one particular embodiment, the β-galactosidaseFS is characterized by the substitution of one amino acid. In one particular embodiment, the β-galactosidaseFS is characterized by the substitution of 2, 3, 4, or 5 amino acids. In one particular form, βgalactosidaseFS has a length of 1026 amino acids. In one embodiment, the lacZFS allele encodes a β-galactosidaseFS, wherein the β-galactosidaseFS sequence does not comprise an arginine at position 354, wherein the amino acid sequence set out in SEC ID NO: 2 is used for numbering. In one embodiment, the lacZFS allele encodes a β-galactosidaseFS, wherein the β-galactosidaseFS sequence does not comprise an amino acid residue selected from the group consisting of arginine, histidine, glutamine, and lysine at position 354, wherein the amino acid sequence set out in SEC ID NO:2 is used for numbering. In one embodiment, the lacZFS allele encodes a β-galactosidaseFS, wherein the β-galactosidaseFS sequence does not comprise an amino acid residue selected from the group consisting of arginine, histidine, glutamine, lysine, glutamic acid, and asparagine at position 354, wherein the amino acid sequence set out in SEC ID NO:2 is used for numbering. In one embodiment, the lacZFS allele encodes a β-galactosidaseFS comprising a cisterna or an equivalent amino acid at position 354, wherein the amino acid sequence set forth in SEC ID NO: 2 is used for numbering. An equivalent amino acid is understood to be any amino acid having similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and / or the amphipathic nature of the residues, provided that the lacZFS allele encoding this 3-galactosidaseFS leads to a LacSPH4.5 to LacZpH4.5 ratio of more than 8 (as defined herein) and optionally leads to a LacZpne of at least 7.10~8 mol / (mg of total protein extract.min) (as defined herein), when inserted in place of the lacZ gene allele of strain DGCC715.In one embodiment, the lacZFS allele encodes a p-galactosidaseFS comprising an amino acid residue selected from the group consisting of cysteine, alanine, and serine at position 354, wherein the amino acid sequence set out in SEC ID NO: 2 is used for numbering. In one embodiment, the lacZFS allele encodes a βgalactosidaseFS comprising a cysteine ​​at position 354, wherein the amino acid sequence set out in SEC ID NO: 2 is used for numbering. In a particular modality of any of these modalities, β-galactosidaseFS has a length of 1026 amino acids. In one embodiment, the lacZFS allele of the invention encodes a β-galactosidaseFS, the sequence of which is at least 95% identical to, but different from, SEC ID NO:2. In one embodiment, the lacZFS allele encodes a βgalactosidaseFS, the sequence of which is at least 95% identical to, but different from, SEC ID NO:2, and does not comprise an arginine at position 354, wherein the amino acid sequence set out in SEC ID NO:2 is used for numbering. In one embodiment, the lacZFS allele encodes a βgalactosidaseFS, the sequence of which is at least 95% identical to, but different from, SEC ID NO:2, and does not comprise an amino acid residue selected from the group consisting of arginine, histidine, glutamine, and lysine at position 354, wherein the amino acid sequence set out in SEC ID NO: 2 is used for numbering. In one embodiment, the lacZFS allele encodes a βgalactosidaseFS, the sequence of which is at least 95% identical to, but different from, SEC ID NO:2, and does not comprise an amino acid residue selected from the group consisting of arginine, histidine, glutamine, lysine, glutamic acid, and asparagine at position 354, wherein the amino acid sequence set out in SEC ID NO:2 is used for numbering. In one embodiment, the lacZFS allele encodes a βgalactosidaseFS, the sequence of which is at least 95% identical to, but different from, SEC ID NO:2, and comprises a cysteine ​​or cysteine-equivalent amino acid at position 354, wherein the amino acid sequence set out in SEC ID NO:2 is used for numbering. In one embodiment, the lacZFS allele encodes a βgalactosidaseFS, the sequence of which is at least 95% identical to, but different from, SEC ID NO: 2, and comprises an amino acid residue selected from the group consisting of cysteine, alanine, and serine at position 354, wherein the amino acid sequence set out in SEC ID NO: 2 is used for numbering. In one embodiment, the lacZFS allele encodes a βgalactosidaseFS, the sequence of which is at least 95% identical to, but different from, SEC ID NO:2, and comprises a cysteine ​​at position 354, wherein the amino acid sequence set out in SEC ID NO:2 is used for numbering. In a particular modality of any of these modalities, β-galactosidaseFS has a length of 1026 amino acids. In one embodiment, the lacZFS allele encodes a βgalactosidaseFS comprising: a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but does not comprise an arginine at position 354 (SEC ID NO: 5, wherein position 354 is not an arginine); or (b) an amino acid sequence that is otherwise that of a β-galactosidase variant having at least 95% identity with SEC ID NO: 2 (β-galactosidase variant as defined herein), but which does not comprise an arginine at position 354. Non-limiting examples of βgalactosidaseFS are as defined in SEC ID NOs 7, 10, 13, 16, 19, 22, 25 and 28, wherein position 354 is not an arginine. In one embodiment, the lacZFS allele encodes an F-s βgalactosidase comprising: a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but does not comprise an amino acid residue selected from the group consisting of arginine, histidine, glutamine and lysine at position 354 (SEC ID NO: 5, wherein position 354 is not an amino acid residue selected from the group consisting of arginine, histidine, glutamine and lysine); or (b) an amino acid sequence that is otherwise that of a β-galactosidase variant having at least 95% identity with SEC ID NO:2 (β-galactosidase variant as defined herein), but which does not comprise an amino acid residue selected from the group consisting of arginine, histidine, glutamine and lysine at position 354. Non-limiting examples of β-galactosidase are as defined in SEC ID Nos. 7, 10, 13, 16, 19, 22, 25 and 28, wherein position 354 is not an amino acid residue selected from the group consisting of arginine, histidine, glutamine and lysine. In one embodiment, the lacZFS allele encodes a βgalactosidaseFS comprising: a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but does not comprise an amino acid residue selected from the group consisting of arginine, histidine, glutamine, lysine, glutamic acid and asparagine at position 354 (SEC ID NO: 5, wherein position 354 is not an amino acid residue selected from the group consisting of arginine, histidine, glutamine, lysine, glutamic acid and asparagine); or (b) an amino acid sequence that is otherwise that of a β-galactosidase variant having at least 95% identity with SEC ID NO:2 (β-galactosidase variant as defined herein), but which does not comprise an amino acid residue selected from the group consisting of arginine, histidine, glutamine, lysine, glutamic acid and asparagine at position 354. Non-limiting examples of β-galactosidases are as defined in SEC ID Nos. 7, 10, 13, 16, 19, 22, 25 and 28, wherein position 354 is not an amino acid residue selected from the group consisting of arginine, histidine, glutamine, lysine, glutamic acid and asparagine. In one embodiment, the lacZFS allele encodes a βgalactosidaseFS comprising: a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but comprising a cysteine ​​or cysteine-equivalent amino acid at position 354 (SEC ID NO: 5, wherein position 354 is a cysteine ​​or cysteine-equivalent amino acid); or (b) an amino acid sequence that is otherwise that of a β-galactosidase variant having at least 95% identity with SEC ID NO:2 (β-galactosidase variant as defined herein), but comprising a cysteine ​​or cysteine-equivalent amino acid at position 354. Non-limiting examples of β-galactosidaseFS are as defined in SEC ID Nos. 7, 10, 13, 16, 19, 22, 25 and 28, wherein position 354 is a cysteine ​​or cysteine-equivalent amino acid. In one embodiment, the lacZFS allele encodes a βgalactosidaseFS comprising: a) an amino acid sequence that is otherwise as defined in SEC ID NO:2, but comprising an amino acid residue selected from the group consisting of cysteine, alanine and serine at position 354 (SEC ID NO:5, wherein position 354 is selected from the group consisting of cysteine, alanine and serine); or (b) an amino acid sequence that is otherwise that of a β-galactosidase variant having at least 95% identity with SEC ID NO:2 (β-galactosidase variant as defined herein), but comprising an amino acid residue selected from the group consisting of cysteine, alanine and serine at position 354. Non-limiting examples of p-galactosidase^5 are as defined in SEC ID NOs 7, 10, 13, 16, 19, 22, 25 and 28, wherein position 354 is an amino acid residue selected from the group consisting of cysteine, alanine and serine. In one embodiment, the lacZFS allele encodes a βgalactosidaseFS comprising: a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but comprising a cysteine ​​at position 354 (SEC ID NO: 4); in one embodiment, the lacZFSes allele as set forth in SEC ID NO: 3; or b) an amino acid sequence that is otherwise that of a β-galactosidase variant having at least 95% identity with SEC ID NO:2 (β-galactosidase variant as defined herein), but comprising a cysteine ​​at position 354. Non-limiting examples of βgalactosidaseFS are as defined in SEC ID NOs: 8, 11, 14, 17, 20, 23, 26 and 29. In one modality, the lacZFS allele encodes a βgalactosidaseFS that is obtained from a β-galactosidase having a sequence like the one shown in SEC ID NO:2, by substituting arginine for a cysteine ​​at position 354 (R354C). In one embodiment, the lacZFS allele encodes a β-galactosidaseFS obtained from a β-galactosidase variant that has at least 95% identity with SEC ID NO:2 (a β-galactosidase variant as defined herein), by substituting arginine for cysteine ​​at position 354 (R354C). In another embodiment, the lacZFS allele encodes a β-galactosidase^ obtained from a β-galactosidase variant as set out in SEC ID NO: 6, 9, 12, 15, 18, 21, 24, or 27, by substituting arginine for cysteine ​​at position 354 (R354C). In a particular modality of any of these modalities, β-galactosidaseFΞ has a length of 1026 amino acids. Amino acid numbering In this application, a specific numbering of amino acid residue positions is used for the characterization of β-galactosidase. By aligning the amino acid sequence of a β-galactosidase FSO protein or a β-galactosidase variant with the β-galactosidase protein defined in SEC ID NO:2, it is possible to assign a number to an amino acid residue position in the β-galactosidase FSO or the β-galactosidase variant, respectively, which corresponds to the amino acid residue position or numbering of the amino acid sequence shown in SEC ID NO: 2. An alternative way of describing the amino acid numbering used in this application is to say that the amino acid positions are identified by those corresponding to a particular position in the amino acid sequence shown in SEC ID NO: 2. This should not be interpreted to mean that the sequences of the present invention must include the amino acid sequence shown in SEC ID NO: 2. A person skilled in the art will readily appreciate that β-galactosidase sequences vary among different bacterial strains. The reference to the amino acid sequence shown in SEC ID NO: 2 is used merely to allow the identification of a particular amino acid location within any particular β-galactosidase. Such amino acid locations can be routinely identified using sequence alignment programs, the use of which is well known in the art. Polynucleotide of the invention In one aspect, the present invention provides a polynucleotide comprising or consisting of a lacZFS allele [encoding a β-galactosidase F·s] of the invention. In one embodiment, the polynucleotide is a lacZFS allele [encoding a β-galactosidase FS] of the invention. In one embodiment, the polynucleotide of the invention encodes a β-galactosidase FS as defined herein. In one embodiment, the size of the polynucleotide of the invention is at least 3063 nucleotides, at least 3066 nucleotides, at least 3069 nucleotides, at least 3072 nucleotides, at least 3075 nucleotides, at least 3078 nucleotides, or at least 3081 nucleotides. In one embodiment, the size of the polynucleotide of the invention is less than 5 kb or less than 4 kb.In one embodiment, the polynucleotide size varies from a selected minimum size of at least 3063 nucleotides, at least 3066 nucleotides, at least 3069 nucleotides, at least 3072 nucleotides, at least 3075 nucleotides, at least 3078 nucleotides, or at least 3081 nucleotides to a selected maximum size of 4 kb and 5 kb. In one embodiment, the polynucleotide size is 3078 or 3081 nucleotides. In one embodiment, the polynucleotide of the invention consists of a lacZFStal allele as defined herein, independently flanked on one side (at 5' and 3') or on both sides by a nucleotide region ranging from 500 bp to 1 kb. In one aspect, the present invention provides a polynucleotide comprising or consisting of a portion of at least 100 nucleotides of the polynucleotide encoding a β-galactosidaseFS as defined herein, wherein the nucleotide portion spans the codon corresponding to residue 354 of the β-galactosidaseFS. The expression "codon corresponding to residue 354 of the β-galactosidaseFS" means codon 354 of the lacZFS allele as defined herein, wherein the codon corresponds to residue 354 of the p-galactosidaseFS, wherein the amino acid sequence set forth in SECTION 2 is used for numbering. The position of codon 354 of the lacZFS allele and the position of residue 354 of p-galactosidaseFS can be easily determined by a person skilled in the technique, by aligning the portion of at least 100 nucleotides or the βgalactosidase peptide encoded by this portion of at least 100 nucleotides with SEC ID NO:1 or SEC ID NO:2 respectively.In one embodiment, the polynucleotide comprises a polynucleotide portion consisting of a lacZFS allele, wherein the nucleotide portion spans the codon corresponding to residue 354 of the encoded β-galactosidaseFS. In one embodiment, the nucleotide portion comprises or consists of at least 100 consecutive nucleotides of the polynucleotide comprising or consisting of a lacZFS allele as defined herein. In one embodiment, the nucleotide portion comprises or consists of at least 200 consecutive nucleotides of the polynucleotide comprising or consisting of a lacZFS allele. In one embodiment, the nucleotide portion comprises or consists of at least 300 consecutive nucleotides of the polynucleotide comprising or consisting of a lacZFS allele. In one embodiment, the nucleotide portion comprises or consists of at least 400 consecutive nucleotides of the polynucleotide comprising or consisting of a lacZFS allele. In one embodiment, the nucleotide portion comprises or consists of at least 500 consecutive nucleotides of the polynucleotide comprising or consisting of a lacZFS allele.In one embodiment, the nucleotide portion comprises or consists of at least 1000 consecutive nucleotides of the polynucleotide comprising or consisting of a lacZFS allele. In one embodiment, the nucleotide portion comprises or consists of at least 1500 consecutive nucleotides of the polynucleotide comprising or consisting of a lacZFS allele. In one embodiment, the nucleotide portion comprises or consists of at least 2000 consecutive nucleotides of the polynucleotide comprising or consisting of a lacZFS allele. In one embodiment, the nucleotide portion encompassing the codon corresponding to residue 354 of p-galactosidaseFS comprises or consists of a portion of at least 100 nucleotides from the polynucleotide encoding a 3-galactosidaseFS, wherein the residue corresponding to residue 354 is not an arginine. In another embodiment, the nucleotide portion encompassing the codon corresponding to residue 354 of p-galactosidaseFS comprises or consists of a portion of at least 100 nucleotides from the polynucleotide encoding a 3-galactosidaseFS, wherein the residue corresponding to residue 354 is not an amino acid residue selected from the group consisting of arginine, histidine, glutamine, and lysine.In one embodiment, the nucleotide portion encompassing the codon corresponding to residue 354 of β-galactosidaseFS comprises or consists of a portion of at least 100 nucleotides from the polynucleotide encoding a β-galactosidaseFS, wherein the residue corresponding to residue 354 is not an amino acid residue selected from the group consisting of arginine, histidine, glutamine, lysine, glutamic acid, and asparagine. In another embodiment, the nucleotide portion encompassing the codon corresponding to residue 354 of p-galactosidaseFS comprises or consists of a portion of at least 100 nucleotides from the polynucleotide encoding a β-galactosidaseFS, wherein the residue corresponding to residue 354 is a cysteine ​​or a cysteine-equivalent amino acid.In one embodiment, the nucleotide portion encompassing the codon corresponding to residue 354 of β-galactosidaseFS comprises or consists of a portion of at least 100 nucleotides from the polynucleotide encoding a β-galactosidaseFS, wherein the residue corresponding to residue 354 is a cysteine, alanine, and serine. 354 is a cysteine. In one embodiment, the nucleotide portion, encompassing the codon corresponding to residue 354 of β-galactosidaseFS, comprises or consists of a portion of at least 100 nucleotides from the polynucleotide encoding a p-galactosidaseFS, the sequence of which is at least 95% identical to, but different from, SEC ID NO: 2. In one embodiment, the nucleotide portion, encompassing the codon corresponding to residue 354 of β-galactosidaseFS, comprises or consists of a portion of at least 100 nucleotides from the polynucleotide encoding a β-galactosidaseFS, the sequence of which is at least 95% identical to, but different from, SEC ID NO: 2 and wherein the residue corresponding to residue 354 is not an arginine.In one embodiment, the nucleotide portion encompassing the codon corresponding to residue 354 of 3-galactosidaseFS comprises or consists of a portion of at least 100 nucleotides from the polynucleotide encoding a 3-galactosidaseFS, the sequence of which is at least 95% identical to, but different from, SEC ID NO: 2, and wherein the residue corresponding to residue 354 is not an amino acid residue selected from the group consisting of arginine, histidine, glutamine, and uline. In another embodiment, the nucleotide portion encompassing the codon corresponding to residue 354 of p-galactosidaseFS comprises or consists of a portion of at least 100 nucleotides from the polynucleotide encoding a 3-galactosidaseFS, the sequence of which is at least 95% identical to, but different from, the... SEC ID NO:2 and wherein the residue corresponding to residue 354 is not an amino acid residue selected from the group consisting of arginine, histidine, glutamine, lysine, glutamic acid, and asparagine. In one embodiment, the nucleotide portion, which spans the codon corresponding to residue 354 of p-galactosidaseFS, comprises or consists of a portion of at least 100 nucleotides of the polynucleotide encoding a p-galactosidaseFS, the sequence of which is at least 95% identical to, but different from, SEC ID NO: 2 and wherein the residue corresponding to residue 354 is a cisterna or an amino acid equivalent thereto.In one embodiment, the nucleotide portion encompassing the codon corresponding to residue 354 of p-galactosidaseFS comprises or consists of a portion of at least 100 nucleotides from the polynucleotide encoding a p-galactosidaseFS, the sequence of which is at least 95% identical to, but different from, SEC ID NO: 2, and wherein the residue corresponding to residue 354 is a cisterna, alanine, and serine. In one embodiment, the nucleotide portion, encompassing the codon corresponding to residue 354 of p-galactosidaseFS, comprises or consists of a portion of at least 100 nucleotides of the polynucleotide encoding a p-galactosidaseFS, the amino acid sequence of which is a) an amino acid sequence that is otherwise as defined in SEC ID NO:2, but does not comprise an arginine at position 354 (SEC ID NO:5, wherein position 354 is not an arginine); ob) an amino acid sequence that is otherwise that of a β-galactosidase variant having at least 95% identity with SEC ID NO:2 (β-galactosidase variant as defined herein), but does not comprise an arginine at position 354; In one modality, the nucleotide portion, which encompasses the codon corresponding to residue 354 of β-galactosidaseFΞ,comprises or consists of a portion of at least 100 nucleotides of the polynucleotide encoding a β-ρηΐηοόοείόηεη^3 as defined in SEC ID Nos. 7, 10, 13, 16, 19, 22, 25 or 28, wherein position 354 is not an arginine. In one embodiment, the nucleotide portion, encompassing the codon corresponding to residue 354 of β-galactosidaseFS, comprises or consists of a portion of at least 100 nucleotides of the polynucleotide encoding a β-ρη1ηοόθ3ίόη3ηE5, the amino acid sequence of which is (a) an amino acid sequence that is otherwise as defined in SEC ID NO:2, but does not comprise an amino acid residue selected from the group consisting of arginine, histidine, glutamine, and lysine at position 354 (SEC ID NO:5, wherein position 354 is not an amino acid residue selected from the group consisting of arginine, histidine,glutamine and Usine); ob) an amino acid sequence that is otherwise that of a β-galactosidase variant having at least 95% identity with SEC ID NO: 2 (β-galactosidase variant as defined herein), but not comprising an amino acid residue selected from the group consisting of arginine, histidine, glutamine and lysine at position 354; In one embodiment, the nucleotide portion encompassing the codon corresponding to residue 354 of β-galactosidaseFS comprises or consists of a portion of at least 100 nucleotides from the polynucleotide encoding a β-galactosidaseFS as defined in SEC ID Nos. 7, 10, 13, 16, 19, 22, 25, or 28, wherein position 354 is not an amino acid residue selected from the group consisting of arginine, histidine, glutamine, and lysine. In one embodiment, the nucleotide portion encompassing the codon corresponding to residue 354 of β-galactosidaseFS,comprises or consists of a portion of at least 100 nucleotides of the polynucleotide encoding a β-galactosidaseFS, the amino acid sequence of which is a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but does not comprise an amino acid residue selected from the group consisting of arginine, histidine, glutamine, lysine, glutamic acid and asparagine at position 354 (SEC ID NO: 5, wherein position 354 is not an amino acid residue selected from the group consisting of arginine, histidine, glutamine, lysine, glutamic acid and asparagine); ob) an amino acid sequence that is otherwise that of a β-galactosidase variant that has at least 95% identity with SEC ID NO:2 (β-galactosidase variant as defined herein), but that does not comprise an amino acid residue selected from the group consisting of arginine, histidine, glutamine, lysine,glutamic acid and asparagine at position 354; in one embodiment, the nucleotide portion, spanning the codon corresponding to residue 354 of the βgalactosidaseFS, comprises or consists of a portion of at least 100 nucleotides of the polynucleotide encoding a βgalactosidaseFS as defined in SEC ID Nos. 7, 10, 13, 16, 19, 22, 25 or 28, wherein position 354 is not an amino acid residue selected from the group consisting of arginine, histidine, glutamine, lysine, glutamic acid and asparagine. In one embodiment, the nucleotide portion, encompassing the codon corresponding to residue 354 of β-galactosidaseFS, comprises or consists of a portion of at least 100 nucleotides of the polynucleotide encoding a β-galactosidaseFS, the amino acid sequence of which is (a) an amino acid sequence that is otherwise as defined in SEC ID NO:2, but comprising a cysteine ​​or an equivalent amino acid at position 354 (SEC ID NO:5,wherein position 354 is a cysteine ​​or an amino acid equivalent thereto; ob) an amino acid sequence that is otherwise that of a β-galactosidase variant having at least 95% identity with SEC ID NO:2 (β-galactosidase variant as defined herein), but comprising a cysteine ​​or an amino acid equivalent thereto at position 354; in one embodiment, the nucleotide portion, spanning the codon corresponding to residue 354 of the β-galactosidaseFS, comprises or consists of a portion of at least 100 nucleotides from the polynucleotide encoding a β-galactosidase^5 as defined in SEC ID Nos. 7, 10, 13, 16, 19, 22, 25 or 28, wherein position 354 is a cysteine ​​or an amino acid equivalent thereto. In one embodiment, the nucleotide portion, encompassing the codon corresponding to residue 354 of βgalactosidaseFS, comprises or consists of a portion of at least 100 nucleotides of the polynucleotide encoding a βgalactosidaseFS,whose amino acid sequence is a) an amino acid sequence that is otherwise as defined in SEC ID NO:2, but comprising an amino acid residue selected from the group consisting of cysteine, alanine and serine at position 354 (SEC ID NO:5, wherein position 354 is selected from the group consisting of cysteine, alanine and serine); ob) an amino acid sequence that is otherwise that of a β-galactosidase variant having at least 95% identity with SEC ID NO: 2 (β-galactosidase variant as defined herein), but comprising an amino acid residue selected from the group consisting of cysteine, alanine and serine at position 354; In one embodiment, the nucleotide portion, encompassing the codon corresponding to residue 354 of β-galactosidaseFS, comprises or consists of a portion of at least 100 nucleotides of the polynucleotide encoding a β-galactosidaseStal as defined in SEC ID Nos. 7, 10, 13, 16, 19, 22,25 or 28, wherein position 354 is an amino acid residue selected from the group consisting of cysteine, alanine, and serine. In one embodiment, the nucleotide portion, spanning the codon corresponding to residue 354 of p-galactosidaseFS, comprises or consists of a portion of at least 100 nucleotides from the polynucleotide encoding a β-galactosidaseFS, the amino acid sequence of which is (a) an amino acid sequence that is otherwise as defined in SEC ID NO:2, but comprising a cysteine ​​at position 354 (SEC ID NO:4); (b) an amino acid sequence that is otherwise that of a β-galactosidase variant having at least 95% identity with SEC ID NO:2 (β-galactosidase variant as defined herein), but comprising a cysteine ​​at position 354; In one modality, the nucleotide portion, which encompasses the codon corresponding to residue 354 of βgalactosidaseFS,comprises or consists of a portion of at least 100 nucleotides of the polynucleotide encoding a βgalactosidaseFStal as defined in SEC ID NOs: 8, 11, κ, c 14, 17, 20, 23, 26 and 29. In one embodiment, the nucleotide portion, which spans the codon corresponding to residue 354 of β-galactosidaseFS, comprises or consists of a portion of at least 100 nucleotides of the polynucleotide encoding a β-galactosidaseFS obtained from a β-galactosidase having a sequence as set out in SEC ID NO:2, by substituting arginine for a cysteine ​​at position 354 (R354C). In one embodiment, the nucleotide portion, encompassing the codon corresponding to residue 354 of β-galactosidaseFS, comprises or consists of a portion of at least 100 nucleotides of the polynucleotide encoding a β-galactosidaseFS obtained from a β-galactosidase variant having at least 95% identity with SEC ID NO: 2 (β-galactosidase variant as defined herein), by substituting arginine for a cysteine ​​at position 354 (R354C).In one embodiment, the nucleotide portion, encompassing the codon corresponding to residue 354 of βgalactosidaseFS, comprises or consists of a portion of at least 100 nucleotides of the polynucleotide encoding a βgalactosidaseFS obtained from a βgalactosidase variant as set out in SEC ID NO: 6, 9, 12, 15, 18, 21, 24 or 27, by substituting arginine for a cysteine ​​at position 354 (R354C). Normally, the polynucleotide covered by the scope of the present invention is prepared using recombinant DNA techniques (i.e., recombinant DNA), such as those described herein. However, in an alternative embodiment of the invention, the polynucleotide could be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers MH et al., (1980) Nuc Acida Res Symp Ser 215-23 and Horn T et al., (1980) Nuc Acids Res Symp Ser 225-232). A polynucleotide encoding a lacZFStal protein, as defined herein, can be identified, isolated, and / or purified from any lactic acid bacteria. Various methods for the identification, isolation, and / or purification of polynucleotides are well known in the art. As an example, PCR amplification techniques can be used to prepare more copies of a polynucleotide once a suitable polynucleotide has been identified and / or isolated and / or purified. As a further example, a genome library can be constructed using chromosomal DNA from lactic acid bacteria that produce p-galactosidase FS5. Based on the p-galactosidase FS sequence, oligonucleotide probes can be synthesized and used to identify clones encoding the protein from the genome library prepared from lactic acid bacteria. Alternatively, the polynucleotide of the invention can be prepared synthetically by established standard methods, e.g., the phosphoraamidet method described by Beucage SL et al., 1981, Tetrahedron Letters 22:1859-1869, or the method described by Matthes et al., 1984, EMBO J., 3:801-805. In the phosphoraamidet method, oligonucleotides, e.g., are synthesized in an automated DNA synthesizer, purified, hybridized, ligated, and cloned into appropriate vectors. The polynucleotide can be prepared by polymerase chain reaction (PCR) using specific primers, for example, as described in US document 4,683,202 or in Saiki RK et al., 1988, Science, 239:487-491. The polynucleotides and nucleic acids covered by the present invention can be substantially isolated or purified. Substantially isolated or purified means that the polynucleotides are substantially or essentially free of components normally associated with the polynucleotide in its natural state. Such components include other cellular material, culture media for recombinant production, and various chemicals used in the chemical synthesis of nucleic acids. An isolated polynucleotide or nucleic acid is normally free of nucleic acid sequences that flank the nucleic acid of interest in the genomic DNA of the organism from which the nucleic acid originated (such as the coding sequences present at the 5' or 3' ends). However, the molecule may include some additional bases or residues that do not negatively affect the basic characteristics of the composition. Vector The invention also relates to a vector comprising the polynucleotide of the invention. In one embodiment, this vector is a plasmid. In one embodiment, the vector contains one or more selection marker genes, such as a gene that confers antibiotic resistance, e.g., resistance to ampicillin, kanamycin, chloramphenicol, or tetracycline. In another embodiment, the vector comprises a nucleotide sequence that enables the vector to replicate in the host cell. Examples of such sequences are the origins of replication of the plasmids pUC19, pACYC177, pUBl10, pE194, pAMBl, and pIJ702. A vector of the invention can be used to genomodify a lactic acid bacterium of the invention. Streptococcus thermophilus strain comprising a polynucleotide of the invention The invention relates to a strain of Streptococcus thermophilus comprising a polynucleotide comprising or consisting of a lacZFS allele [encoding a β-galactosidaseFS] of the invention. In one embodiment, the Streptococcus thermophilus strain comprises a lacZFS allele [encoding a β-galactosidaseFS] of the invention. To avoid any doubt, the species Streptococcus thermophilus should be understood as a strain of Streptococcus salivarius subsp. thermophilus. In one embodiment, the Streptococcus thermophilus strain of the invention is a galactose-negative strain of Streptococcus thermophilus. The term "galactose-negative" refers to a Streptococcus thermophilus strain that is unable to grow on galactose as the sole carbohydrate source, particularly in M17 medium supplemented with 2% galactose. In one particular embodiment, the galactose-negative phenotype is determined by inoculating an overnight culture of the S. thermophilus strain under study at 1% into M17 broth containing 2% galactose and incubating for 20 hours at 37°C, wherein a pH of 6 or higher at the end of the incubation period is indicative of a galactose-negative phenotype. As described herein, the phrase "comprising a polynucleotide comprising or consisting of a lacZFS allele" means that the only allele of the lacZ gene contained in the genome of the Streptococcus thermophilus strain is a lacZFS allele. In one embodiment, the Streptococcus thermophilus strain of the invention comprises, as the only allele of its lacZ gene, a polynucleotide comprising or consisting of a lacZFS allele of the invention. It is not contemplated that the Streptococcus thermophilus strain of the invention comprises multiple alleles of the lacZ gene. Such a strain of Streptococcus thermophilus can be genomodified by: a) the replacement of the allele of its lacZ gene by a polynucleotide comprising or consisting of a lacZFS allele of the invention; or (b) the replacement of a portion of the lacZ gene allele by a corresponding polynucleotide comprising or consisting of a portion of at least 100 nucleotides of the polynucleotide encoding a p-galactosidaseFS as defined herein, wherein the nucleotide portion spans the codon corresponding to residue 354 of p-galactosidaseFS. By corresponding polynucleotide, we mean the same portion of the lacZ allele that spans the codon corresponding to residue 354 of 3-galactosidaseFS. The replacement can be performed using conventional techniques such as those defined herein. In one embodiment, the Streptococcus thermophilus of the invention (comprising a lacZFS allele) is further characterized by its ability, when evaluated by the assay C, leading to an acidification slope between pH 6 and 5.3 of at least -0.005 UpH / min. In one mode, the acidification slope between pH 6 and 5.3 is at least -0.006 UpH / min. In one mode, the acidification slope between pH 6 and 5.3 is at least -0.007 UpH / min. In one mode, the acidification slope between pH 6 and 5.3 is at least 0.008 UpH / min. In one mode, the acidification slope between pH 6 and 5.3 is at least -0.009 UpH / min. In one mode, the acidification slope between pH 6 and 5.3 is at least -0.01 UpH / min. In one mode, the acidification slope between pH 6 and 5.3 is at least -0.02 UpH / min. In one mode, the acidification slope between pH 6 and 5.3 is at least -0.03 UpH / min. In one mode, the acidification slope between pH 6 and 5.3 is at least -0.04 UpH / min. In one mode, the acidification slope between pH 6 and 5.3 is at least -0.05 UpH / min.In one mode, the acidification slope between pH 6 and 5.3 is selected from the group of at least -0.005, -0.006, -0.007, -0.008, -0.009, -0.01, -0.02, -0.03, -0.04 and -0.05 UpH / min. Test C (acidification kinetics in milk) Le Petit Vendéen UHT semi-skimmed milk (yogurt milk), containing 3% (w / v) milk powder (BBA, Lactalis), previously pasteurized for 10 min at 90 °C to 1% (v / v, approximately 10⁷ CFU / ml), was inoculated with a culture of the test strain of S. thermophilus (resuspended cells without carbohydrates in M17 from an overnight culture grown in M17 supplemented with 3% sucrose). Flasks of inoculated milk were incubated statically in a water bath at 43 °C (start of the fermentation experiment) for 24 h to obtain fermented milk. The acidification properties of the S. thermophilus strains were evaluated by recording the pH over time during milk fermentation. pH was monitored for 24 hours using the CINAC system (Alliance Instruments, France; Mettler pH 405 DPAS SC electrode, Toledo, Spain) as previously described. pH was measured and recorded every 5 minutes.Using CINAC v2.07 software, the following descriptors have been calculated:. the slope between pH 6.0 and pH 5.3 (UpH / minute) [Slope pH6-5.3]; - the time corresponding to Vmax (where Vraáxes is the maximum speed obtained during the fermentation experiment; Tvmax), time (in minutes) calculated from the beginning of the fermentation experiment; - the stopping pH corresponding to the pH value at V0, V0 corresponding to a rate that becomes conclusively undetectable, i.e., below 0.1 mupH / minute (0.0001 UpH / min); by becomes conclusively undetectable, it is understood that the rate remains below 0.1 mUpH / min for the remainder of the test time C (i.e., up to 24 hours at fermentation temperature); and - the time corresponding to pHDE stop (TpHDE stop) [thus, the time corresponding to V0, calculated from the beginning of the fermentation experiment]. In one embodiment, in conjunction with or independently of the acidification slope determined by test C, the Streptococcus thermophilus of the invention (comprising a lacZFS allele) is further characterized by its texturizing properties. Therefore, the Streptococcus thermophilus of the invention can be characterized by the shear stress value it generates when used to obtain fermented milk, as determined by test D (i.e., at a shear rate of 350 s⁻¹). In one embodiment, the shear stress value generated in fermented milk obtained with a Streptococcus thermophilus of the invention, as determined by test D, is at least 60, at least 120, at least 180, or at least 240 Pa. In one embodiment, the shear stress value generated in fermented milk obtained with a Streptococcus thermophilus of the invention, as determined by test D, is minus 60, minus 120, minus 180, or minus 240 Pa. In one embodiment, the shear stress value generated in fermented milk obtained with a Streptococcus thermophilus of the invention, as determined by test D, is either at least 60 or at least 120 and less than 180 or less than 240 Pa. In one embodiment, the shear stress value generated in a fermented milk obtained with a Streptococcus thermophilus of the invention, as determined by test D, is within a selected range from the group consisting of 0 to 59 Pa, 60 to 119 Pa, 120 to 179 Pa, 180 to 239 Pa, and 240 to 300 Pa. For reference, the shear stress generated in fermented milk obtained with strain DGCC715 (DSM33036) was determined using assay D and found to be within the range of 0–59 Pa. For further reference, the shear stress generated in fermented milk obtained with strain DGCC7710 (deposited as DSM28255) was determined using assay D and found to be within the range of 120–179 Pa, more specifically approximately 150–115 Pa. Streptococcus thermophilus strain DGCC7710 was deposited by Danisco Deutschland GmbH in accordance with the Treaty of Budapest at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH (Inhoffenstr. 7B, D-38124 Braunschweig) on ​​January 14, 2010. 2014, and has received the accession number DSM28255.This document confirms that the depositor, Danisco Deutschland GmbH (Busch-JohannsenStrasse 1, D-25899 Niebüll, Germany), has authorized the applicant (DuPont Nutrition Biosciences ApS) to refer to the biological material deposited in this application. The applicant requests that a sample of the deposited microorganism mentioned herein may only be made available to an expert until the date on which the patent is granted. Essay D Strain inoculum preparation: 1.8 ml of a stock culture stored at -80°C are inoculated into 100 ml of a large-scale starter medium in a 250 ml flask and incubated for 18 h at 37°C. The large-scale starter medium is obtained by adding 10% high-temperature skimmed milk powder (Lactalis BBA) to water and stirring for 30 minutes at room temperature; then, the medium is heat-treated for 20 min at 120°C. Milk preparation: 93% (w / w) of commercial fresh milk [Candia, lait frais de montagne Grand Lait entier: 3.6% fat, 3.2% protein] and 7% (w / w) sucrose are mixed; the mixture is heat-treated at 90°C for 10 min in a water bath. Just before inoculation of the strain, 1 g / 100 L (w / v) of sodium formate is added. Fermentation: The strain inoculum is added at 1% (v / v) to the milk, and the inoculated milk is poured into a 125 ml yogurt jar and incubated at 43°C until a pH of 4.6 is reached (pH is monitored using a CINAC system; Alliance Instruments, France; Mettler pH 405 DPAS SC electrode, Toledo, Spain). The fermented milk is then slowly cooled in a well-ventilated cold incubator to 6°C. Samples are stored for 7 days at 6°C. Before determining the shear strength, the sample temperature is increased to 8°C, and the samples are stirred 5 times per 5 seconds (1 revolution = 1 s) using a spoon. A 5-minute settling time (equilibration time) is applied immediately before the measurement. The sample's shear strength is evaluated using a rheometer (MCR Compact Modular Rheometer, type 302, Anton Paar GmbH, Germany) equipped with the CC27 coaxial measuring system (DIN 53019 and ISO 3219) and the C-PTD200-SN81154777 Peltier system. The viscometry test is performed with a shear rate ramp that varies from 0.1 s⁻¹ to 350 s⁻¹ at 31 points and from 350 s⁻¹ to 0.1 s⁻¹ at 31 points. The shear strength is recorded continuously. A logarithmic variable measurement point duration setting is used, with an initial value of the ascending curve set to 10s and a final value set to 3s, and an initial value of the descending curve set to 3s and a final value set to 10s.The shear stress value at 350s-1 is selected on the ascending curve to characterize the texturizing properties of the S. thermophilus strain of the invention. The inventors have demonstrated that Streptococcus thermophilus strains comprising a lacZFS allele of the invention can be used not only to ferment milk within an industrially acceptable timeframe but also to obtain fermented milk that does not undergo post-fermentation acidification. The inventors have positively demonstrated that these Streptococcus thermophilus strains (comprising a lacZFS allele of the invention) can therefore be defined in terms of the LacSPH4.5 to LacZpH4.5 ratio as defined herein, and the LacSPH6 to LacZpH6 ratio as defined herein in this strain. In fact, the ratio of LacSPH6 to LacZpH6 represents the ability of the strain of the invention to use lactose and, therefore, to acidify milk (lactic acid production) at the beginning of the manufacturing process to the desired pH, while the ratio of LacSPH4.5 to LacZpH4.5 represents the ability of this same strain to use lactose less efficiently and, therefore, not to produce lactic acid when the desired pH is reached. Thus, the inventors have shown that the formula (I) described herein can be used to characterize strains that exhibit acidification kinetics in milk without subsequent acidification. In one embodiment, the Streptococcus thermophilus of the invention (comprising a lacZFS allele) is further characterized by a difference in hydrolysis efficiency of imported lactose (EHph6 - EHph4.5) that is less than -0.5, calculated using the following formula (I): (1) ΔΕΗ = ΙηΓLacSpH6' - In LacSpH4 5 . ^-3C^pH4.5. formula (I) wherein, LacSpne and LacSPH4.5 represent the lactose import activity of the permease LacS calculated by assay A at pH 6 and pH 4.5 respectively, and LacZpne and LacZPH4.5 represent the lactose hydrolysis activity of beta-galactosidase calculated by assay B at pH 6 and pH 4.5 respectively. Therefore, a ΔEH as defined herein that is less than -0.5 means that the hydrolysis efficiency of imported lactose at pH 4.5 (EHph4.s) [(i.e., the import of lactose into bacteria by the LacS permease followed by the hydrolysis of lactose by betagalactosidase)] is greatly reduced compared to that at pH 6 (EHpH6). In one embodiment, the Streptococcus thermophilus of the invention (comprising an allele of lacZ?5} is characterized by a ΔEH [as calculated by formula (I)] that is selected from the group consisting of less than -0.6, less than -0.7, less than -0.8, less than -0.9, less than -1, less than -1.1, less than -1.2, less than -1.3, less than -1.4 and less than -1.5. In contrast, a slightly positive, around 0, or slightly negative ΔEH means that the hydrolysis efficiency of imported lactose is as effective at pH 4.5 as at pH 6. Such a ΔEH is characteristic of Streptococcus thermophilus strains that, when used to ferment milk, lead to fermented milk that undergoes subsequent acidification. It is also part of the invention that the Streptococcus thermophilus strain defined herein (comprising a lacZFS allele according to the invention) is further characterized by its ability to ferment milk for an industrially acceptable time, resulting in fermented milk that does not undergo post-fermentation acidification. This ability is defined herein as a complete STOP phenotype and can be determined by assay C as defined herein. Therefore, the total STOP phenotype is characterized by the fact that when the strain of the invention is inoculated onto a milk substrate and fermented according to assay C, the milk is fermented such that the pH of the fermented milk stops between 4 and 4.8 (pHDE stop), and the time between Tvmax and TpHDE stop is less than 600 minutes. In one embodiment, the time between Tvmax and TpHDE stop is less than 550 minutes. In one embodiment, individually or in combination with the time between Vmax and V0, the stopping pH obtained using a strain of the invention by means of test C is between 4 and 4.6. In one embodiment, the stopping pH obtained using a strain of the invention by means of test C is between 4 and 4.5. In one embodiment, the stopping pH obtained using a strain of the invention by means of test C is between 4 and 4.4. In one embodiment, the total STOP phenotype is characterized by the fact that when the strain of the invention is inoculated onto a milk substrate and fermented according to assay C, the milk is fermented such that the pH of the fermented milk stops between a selected range from the group consisting of between 4 and 4.8, between 4 and 4.6, between 4 and 4.5, and between 4 and 4.4, and the time between Tvmax and TrHε stop is selected from the group consisting of less than 600 minutes, less than 550 minutes, and less than 500 minutes. Therefore, once the pH stops significantly quickly, the fermented dairy product can be kept at the fermentation temperature for at least 24 hours, without the pH of the fermented product decreasing (which provides high flexibility in the manufacturing process). In a particular embodiment, the Streptococcus thermophilus strain of the invention as defined herein, as its lacZ gene, an allele of lacZFS encoding a βgalactosidaseFStal as defined in SEC ID NO: 4, in particular an allele of lacZFStal as defined in SEC ID NO: 3. In one particular embodiment, the Streptococcus thermophilus strain of the invention as defined herein, as its lacZ gene, an allele of lacZFS encoding a β75 galactosidaseFS having at least 95% identity with SEC ID NO: 2, but comprising a cysteine ​​at position 354. In one particular embodiment, the Streptococcus thermophilus strain of the invention as defined herein carries, as its lacZ gene, an allele of lacZFS encoding a β-galactosidaseFS, the amino acid sequence of which is otherwise that of a β-galactosidase variant having at least 95% identity with SEC ID NO:2 (β-galactosidase variant as defined herein), but comprising a cysteine ​​at position 354. In one particular embodiment, the Streptococcus thermophilus strain of the invention carries, as its lacZ gene, an allele of lacZFS encoding a β-galactosidaseFS as defined in SEC ID Nos: 8, 11, 14, 17, 20, 23, 26 or 29. In one particular embodiment, the invention relates to a strain of Streptococcus thermophilus corresponding to the DGCC7984 strain of Streptococcus thermophilus, the lacZ gene of which has been replaced by a lacZFS allele encoding a β-galactosidase FStal as defined in SEC ID NO: 4, in particular by a lacZFStal allele as defined in SEC ID NO: 3. The DGCC7984 strain of Streptococcus thermophilus has been deposited by Danisco Deutschland GmbH pursuant to the Treaty of Budapest at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH (Inhoffenstr. 7B, D76 38124 Braunschweig), on January 14, 2014, and has been assigned accession number DSM28257. It is hereby confirmed that the depositor, Danisco Deutschland GmbH (Busch-JohannsenStrasse 1, D-25899 Niebüll, Germany), has authorized the Applicant (DuPont Nutrition Biosciences ApS) to refer to the biological material deposited in this application. The Applicant requests that a sample of the deposited microorganism referred to herein may only be made available to an expert until the date on which the patent is granted. The expression "strain DGCC7 984" is used interchangeably with the expression "strain DSM28257". Use and methods based on the polynucleotide or vector of the invention In one embodiment, the invention relates to the use of a polynucleotide or vector of the invention to obtain a strain of Streptococcus thermophilus with a total STOP phenotype when used to ferment milk by assay C. Therefore, the polynucleotide or vector is used so that the resulting Streptococcus thermophilus strain comprises a lacZFS allele as the only lacZ gene in its genome. In one embodiment, the polynucleotide or vector is used so that the lacZ gene allele or part thereof in the Streptococcus thermophilus strain is replaced by the polynucleotide of the invention; the replacement can be carried out using conventional techniques as defined herein. In one aspect, the invention relates to a method for preparing a strain of Streptococcus thermophilus with a total STOP phenotype, comprising: a) provide a strain of Streptococcus thermophilus having a ratio of LacS permease lactose import activity calculated by assay A at pH 4.5 to beta-galactosidase lactose hydrolysis activity calculated by assay B at pH 4.5 (LacSPH4.5 vs LacZpH4.5) that is less than 5; b) replacing the lacZ gene of the Streptococcus thermophilus strain with a polynucleotide (comprising or consisting of a lacZFS allele) of the invention; and c) recover the strain or strains of Streptococcus thermophilus with a total STOP phenotype when used to ferment milk by assay C. In one embodiment, step b) consists of replacing the lacZ gene of the Streptococcus thermophilus strain with a polynucleotide consisting of a lacZFS allele of the invention. In one aspect, the invention relates to a method for preparing a strain of Streptococcus thermophilus with a total STOP phenotype, comprising: a) provide a strain of Streptococcus thermophilus having a ratio of LacS permease lactose import activity calculated by assay A at pH 4.5 to beta-galactosidase lactose hydrolysis activity calculated by assay B at pH 4.5 (LacSPH4.5 vs LacZpH4.5) that is less than 5; (b) replacing a portion of the lacZ gene of the Streptococcus thermophilus strain with a corresponding polynucleotide comprising or consisting of a portion of at least 100 nucleotides from the polynucleotide encoding a p-galactosidaseFS as defined herein, wherein the nucleotide portion spans the codon corresponding to residue 354 of p-galactosidaseFS. The corresponding polynucleotide means the same portion of the lacZ allele that spans the codon corresponding to residue 354 of p-galactosidaseFS; and c) recover the strain or strains of Streptococcus thermophilus with a total STOP phenotype when used to ferment milk by assay C. In one aspect, the invention relates to a method for preparing a strain of Streptococcus thermophilus with a total STOP phenotype, comprising: a) provide a strain of Streptococcus thermophilus having a ratio of LacS permease lactose import activity calculated by assay A at pH 4.5 to beta-galactosidase lactose hydrolysis activity calculated by assay B at pH 4.5 (LacSPH4.5 vs LacZPH4.5) that is less than 5; b) modifying the lacZ gene of the Streptococcus thermophilus strain to have the same sequence as an allele of lacZFS of the invention; and c) recover the lactic strain or strains of Streptococcus thermophilus with a total STOP phenotype when used to ferment milk by assay C. In one modality, any of the methods described herein for preparing a strain of Streptococcus thermophilus with a total STOP phenotype is implemented in a medium containing lactose as the only source of carbohydrates. Within the use or methods of the invention, the LacSPH4.5 to LacZpH4.5 ratio is determined as described herein. In one embodiment, the Streptococcus thermophilus strain of step a) has a LacSPH4.5 to LacZPH4.5 ratio of less than 5. In one embodiment, the Streptococcus thermophilus strain of step a) has a LacSPH4.5 to LacZpH4.5 ratio of less than 4. In one embodiment, the Streptococcus thermophilus strain of step a) has a LacSPH4.5 to LacZPH4.5 ratio of less than 3. In one embodiment, the Streptococcus thermophilus strain of step a) is further characterized by its ability, when evaluated by assay C, to induce an acidification slope between pH 6 and 5.3 of at least -0.005 UpH / min. In one embodiment, the acidification slope between pH 6 and 5.3 is at least -0.006 UpH / min. In one embodiment, the acidification slope between pH 6 and 5.3 is at least -0.007 UpH / min. In one embodiment, the acidification slope between pH 6 and 5.3 is at least -0.008 UpH / min. In one embodiment, the acidification slope between pH 6 and 5.3 is at least 0.009 UpH / min. In one embodiment, the acidification slope between pH 6 and 5.3 is at least -0.01 UpH / min. In one mode, the acidification slope between pH 6 and 5.3 is at least -0.02 UpH / min. In one mode, the acidification slope between pH 6 and 5.3 is at least -0.03 UpH / min. In one mode, the acidification slope between pH 6 and 5.3 is at least -0.04 UpH / min. In one embodiment, the acidification slope between pH 6 and 5.3 is at least -0.05 UpH / min. In one embodiment, the Streptococcus thermophilus strain of step a) is further characterized by its ability, when evaluated by assay C, to lead to an acidification slope between pH 6 and 4.5 that is selected from the group of at least -0.005, -0.006, -0.007, -0.008, -0.009, -0.01, -0.02, -0.03, -0.04 and -0.05 UpH / min. In a further aspect, the invention relates to a strain of Streptococcus thermophilus obtained by using or using the method of the invention. In one further aspect, the invention provides a strain of Streptococcus thermophilus according to the invention produced by the method of the invention. Bacterial composition The invention also relates to a bacterial composition comprising or consisting of at least one, preferably one, strain of Streptococcus thermophilus of the invention. In one embodiment, the bacterial composition is a pure culture, i.e., it comprises or consists of a single strain of Streptococcus thermophilus of the invention. In another embodiment, the bacterial composition is a mixed culture, i.e., it comprises or consists of the strain or strains of Streptococcus thermophilus of the invention and at least one different microorganism, in particular at least one different bacterial strain.At least one different bacterial strain means 1 or more, and in particular 1, 2, 3, 4 or 5 strains. In one embodiment of any bacterial composition defined herein, whether as a pure or mixed culture, the bacterial composition further comprises an acceptable food component, such as sugars (sucrose, trehalose), maltodextrin, or minerals. In one particular embodiment, the bacterial composition defined herein does not comprise lactose. In one embodiment, a bacterial composition of the invention comprises or consists of the Streptococcus thermophilus strain or strains of the invention, and one or more additional lactic acid bacteria from species selected from the group consisting of a Lactococcus species, a Streptococcus species, a Lactobacillus species including Lactobacillus acidophilus, an Enterococcus species, a Pediococcus species, a Leuconostoc species, a Bifidobacterium species, and an Oenococcus species, or any combination thereof. The Lactococcus species include Lactococcus lactis, which includes Lactococcus lactis subsp. lactis, Lactococcus lactis subsp. cremoris, and Lactococcus lactis subsp. lactis biovar diacetylactis. The Bifidobacterium species include Bifidobacterium animalis, in particular Bifidobacterium animalis subsp. lactis. Other species of lactic acid bacteria include Leuconostoc sp., Streptococcus thermophilus, Lactobacillus delbrueckii subsp. bulgaricus y Lactobacillus helvetícus. In one embodiment, the bacterial composition comprises or consists of the Streptococcus thermophilus strain(s) of the invention, and at least one strain of Streptococcus thermophilus, different from the Streptococcus thermophilus strain(s) of the invention, and / or at least one strain of the Lactobacillus species, and / or any combination thereof. In a particular embodiment, the bacterial composition comprises or consists of the Streptococcus thermophilus strain(s) of the invention, one or more strains of the Lactobacillus delbrueckii subsp. bulgaricus species, and / or one or more strains of the Lactobacillus helveticus species, and / or any combination thereof, and optionally at least one strain of Streptococcus thermophilus, different from the Streptococcus thermophilus strain(s) of the invention.In one particular embodiment, the bacterial composition comprises or consists of the Streptococcus thermophilus strain or strains of the invention, at least one strain of the Streptococcus thermophilus species different from the Streptococcus thermophilus strain or strains of the invention, and a strain of the Lactobacillus delbrueckii subsp. bulgaricus species. In another particular embodiment, the bacterial composition comprises or consists of the Streptococcus thermophilus strain or strains of the invention, and a strain of the Lactobacillus delbrueckii subsp. bulgaricus species. In one embodiment, the bacterial composition comprises or consists of the Streptococcus thermophilus strain or strains of the invention, a Lactococcus lactis subsp. lactis and / or a Lactococcus lactis subsp. cremoris. In a particular modality of any bacterial composition defined herein, whether as a pure or mixed culture, the bacterial composition further comprises at least one probiotic strain such as Bifidobacterium animalia subsp. lactis, Lactobacillus acidophilus, Lactobacillus paracasei or Lactobacillus casei. In one particular embodiment, the bacterial composition, whether as a pure or mixed culture as defined above, is in frozen, dried, freeze-dried, liquid, or solid form, in the form of granules or frozen pellets, or as a powder or dry powder. In one particular embodiment, the bacterial composition of the invention is in a frozen form or in the form of granules or frozen pellets, particularly contained in one or more boxes or sachets. In another embodiment, the bacterial composition as defined herein is in powder form, such as a dry or freeze-dried powder, particularly contained in one or more boxes or sachets.In one particular embodiment, the bacterial composition of the invention, whether as a pure culture or a mixed culture as defined above, and regardless of the format (frozen, dried, lyophilized, liquid, or solid, in the form of granules or frozen granules, or in a powder or dry powder), comprises the Streptococcus thermophilus strain or strains of the invention at a concentration in the range of 10⁵ to 10¹² CFU (colony-forming units) per gram (CFU / g) of the bacterial composition. In one particular embodiment, the concentration of the Streptococcus thermophilus strain or strains within the bacterial composition of the invention is in the range of 10⁷ to 10¹² CFU per gram of the bacterial composition and, in particular, at least 10⁷, at least 10a, at least 10⁹, at least 10¹⁰, or at least 10¹¹ CFU / g of the bacterial composition.In one particular embodiment, when in the form of a frozen or dried concentrate, the concentration of the Streptococcus thermophilus strain or strains of the invention - as a pure culture or as a mixed culture - within the bacterial composition is in the range of 10aa to 1012ufe / g of frozen concentrate or dried concentrate, and more preferably at least 108, at least 109, at least 1010, at least 1011 or at least 1012ufe / g of frozen concentrate or dried concentrate. Product manufacturing using the Streptococcus thermophilus strain of the invention In a further aspect, a method is provided for manufacturing a fermented product comprising: a) inoculating a substrate with the Streptococcus thermophilus strain or bacterial composition according to the invention, and b) fermenting the inoculated substrate to obtain a fermented product. In one particular embodiment, the strain or strains of The Streptococcus thermophilus of the invention is inoculated as a bacterial composition as defined herein, such as a pure culture or a mixed culture. Preferably, the substrate is a milk substrate, more preferably milk. Milk substrate refers to milk of animal and / or plant origin. In one particular embodiment, the milk substrate is of animal origin, specifically from any mammal, such as cow, goat, sheep, buffalo, zebra, horse, donkey, or camel, and the like. The milk may be in its native state, reconstituted milk, skimmed milk, or milk supplemented with compounds necessary for bacterial growth or for the subsequent processing of the fermented milk. Preferably, the milk substrate comprises solid elements. Preferably, the solid elements comprise or consist of fruits, chocolate products, or cereals. Preferably, the fermented product is a fermented dairy product. The present invention also provides in an additional aspect the use of the Streptococcus thermophilus strain or bacterial composition according to the present invention to manufacture a food or feed product, preferably a fermented dairy product. The invention also relates to a fermented dairy product obtained using the lactic acid bacteria strain or bacterial composition of the invention, particularly obtained or obtainable by the method of the invention. Therefore, the invention relates to a fermented dairy product comprising the Streptococcus thermophilus strain or strains of the invention. In one particular embodiment, the fermented dairy food product of the invention is fresh fermented milk. The Streptococcus thermophilus strain or bacterial composition according to the invention is advantageously useful in various dairy applications (as particular modalities of a method for manufacturing a fermented product described herein). In one aspect, the Streptococcus thermophilus strain or bacterial composition according to the invention is useful in the manufacture of stirred yogurt. The manufacture of stirred yogurt comprises fermenting a milk substrate previously inoculated with the Streptococcus thermophilus strain or bacterial composition according to the invention, optionally storing the stirred yogurt in a storage tank, and finally packaging the stirred yogurt into containers. This process involves cooling the stirred yogurt between the end of fermentation (i.e., once the desired pH has been reached) and the packaging step in order to stop further acidification of the stirred yogurt, so that the stirred yogurt is packaged at a temperature between 15 and 22°C.Since this cooling step is time-consuming and resource-intensive (energy-intensive), yogurt manufacturers seek to package stirred yogurt at a higher temperature. Packaging at a higher temperature also has the advantage of improving the texture of the stirred yogurt in the containers (see Example 8). However, packaging at a higher temperature is not acceptable for yogurt manufacturers with currently commercially available bacterial compositions, as the stirred yogurt has been shown to be too acidic. The Streptococcus thermophilus strain or bacterial composition according to the invention overcomes this problem, allowing yogurt manufacturers to package stirred yogurt at a higher temperature while still obtaining a product with an acceptable pH. This can be achieved either by cooling the stirred yogurt to a temperature above 22°C or by bypassing the cooling step altogether.Therefore, the invention also relates to the use of the Streptococcus thermophilus strain or bacterial composition according to the invention in the manufacture of stirred yogurt. In one particular embodiment, the invention also relates to the use of the Streptococcus thermophilus strain or bacterial composition according to the invention in the manufacture of stirred yogurt, wherein the packaging step of the stirred yogurt is carried out at a temperature of at least 23°C. The invention also relates to a process for manufacturing stirred yogurt comprising (a) fermenting a milk substrate, in particular milk, inoculated with the Streptococcus thermophilus strain or bacterial composition according to the invention, to obtain a stirred yogurt (with a pH of 4.2 to 4.7, more preferably 4.45 to 4.7).6), (b) cooling the stirred yogurt and (c) packaging the stirred yogurt, wherein the cooling and packaging temperature is at least 23°C (the cooling and packaging temperature being the same temperature). "At least 23°C" in the context of the cooling and packaging temperature means at least 24°C, at least 25°C, at least 26°C, at least 27°C, at least 28°C, at least 29°C, at least 30°C, at least 31°C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C and at least 40°C. In one particular embodiment, the cooling and packaging temperature is equal to or lower than the fermentation temperature (i.e., normally less than 43°C). In one particular modality, the cooling and packaging temperature is at least 23°C and is equal to or less than 43°C.As shown in Example 8, packaging at a temperature of 35°C provides a pH over time similar to that of stirred yogurt packaged at 20°C, while simultaneously improving the texture of the stirred yogurt. The invention also relates to a process for manufacturing stirred yogurt comprising (a) fermenting a milk substrate, in particular milk, with the Streptococcus thermophilus strain or bacterial composition according to the invention, to obtain stirred yogurt (with a pH of 4.2 to 4.7, more preferably 4.45 to 4.6) and (b) packaging this stirred yogurt, wherein the process does not include any cooling step between the end of fermentation and packaging. In this embodiment, the cooling and packaging temperature is the same as the fermentation temperature (i.e., typically 42-43°C).In one embodiment, the process for making stirred yogurt as described herein further comprises transferring the containers to a cold storage room (i.e., less than 8°C). In another aspect, the Streptococcus thermophilus strain or bacterial composition according to the invention is useful in the manufacture of firm yogurt. The manufacture of firm yogurt involves cooling the containers holding the firm yogurt once the desired pH is reached (with a pH of 4.2 to 4.7, more preferably 4.45 to 4.6; considered the end of fermentation) to stop further acidification of the product. This cooling step is carried out in a cooling room (also called a cooling chamber or cooling tunnel) before transferring the containers to a cold storage room (i.e., below 8°C). With conventional starter cultures, it is important to stop further growth quickly after fermentation, meaning that a temperature of approximately 35°C must be reached within 30 minutes of the end of fermentation, and 18–20°C after a further 30–40 minutes.Typically, the total cooling time is approximately 65–70 minutes for small containers and approximately 80–90 minutes for large containers. Since this cooling step is time-consuming and resource-intensive (energy-intensive), yogurt manufacturers seek to reduce the time spent in the cooling room. However, reducing this time is not acceptable for yogurt manufacturers using currently available bacterial compositions, as the resulting yogurt products have been shown to be too acidic. The Streptococcus thermophilus strain or bacterial composition according to the invention overcomes this problem by allowing yogurt manufacturers to adjust the cooling time to reach a temperature of 1820°C while still obtaining a product with an acceptable pH.In one particular embodiment, the invention relates to the use of the Streptococcus thermophilus strain or bacterial composition according to the invention in the manufacture of firm yogurt, wherein the time required for a firm yogurt contained in a container to reach a temperature of 1820°C (starting from the end of fermentation) is increased compared to a time of 65-70 minutes for small containers (defined herein as having a size of 0.1 to 0.2 kg) and a time of 80-90 minutes for large containers (defined herein as having a size of 0.4 to 0.6 kg). In one particular embodiment, the time required for a firm yogurt contained in a container to reach a temperature of 1820°C is at least 100 minutes, at least 120 minutes, at least 180 minutes, or at least 240 minutes. This can be achieved in various ways that provide high flexibility to dairy manufacturers, e.g.The invention relates to a process for manufacturing firm yogurt comprising: (a) packaging a milk substrate, in particular milk, inoculated with the Streptococcus thermophilus strain or bacterial composition according to the invention into containers; (b) fermenting the inoculated milk substrate (contained in the containers) to obtain a firm yogurt (with a pH of 4.2 to 4.7, more preferably 4.45 to 4.6); and (c) manipulating the containers so that the time required for the firm yogurt in the containers to reach a temperature of 18-20°C is at least 100 minutes, at least 120 minutes, at least 180 minutes, or at least 240 minutes.In one particular embodiment, the process for manufacturing firm yogurt as described herein further comprises d) transferring the containers to a cold storage room (i.e., below 8°C). In one embodiment, the invention relates to a process for manufacturing firm yogurt comprising a) packaging a milk substrate, in particular milk, inoculated with the Streptococcus thermophilus strain or bacterial composition according to the invention into containers, and b) fermenting the inoculated milk substrate to obtain firm yogurt (with a pH of 4.2 to 4.7, more preferably 4.45 to 4.6), wherein the process does not include a cooling step in a cooling room. In one particular embodiment, the process for manufacturing firm yogurt as described herein further comprises c) transferring the containers to a cold storage room (i.e., below 8°C).In one embodiment, the invention relates to a process for manufacturing firm yogurt comprising: a) packaging a milk substrate, in particular milk, inoculated with the Streptococcus thermophilus strain or bacterial composition according to the invention into containers; b) fermenting the inoculated milk substrate to obtain a firm yogurt (with a pH of 4.2 to 4.7, more preferably 4.45 to 4.6); c) keeping the firm yogurt in the containers at room temperature (i.e., above 20°C) for at least 30 minutes, at least 45 minutes, or at least 60 minutes after the end of fermentation; and d) incubating the containers in a cooling chamber so that the firm yogurt contained in the container reaches a temperature of 18-20°C. In another aspect, the Streptococcus thermophilus strain or bacterial composition according to the invention is useful in the storage of fermented milk, such as stirred and set yogurt. At the end of the manufacturing process (which includes packaging and cooling), the fermented milks are stored in a cold storage room at a temperature that is normally below 8°C, until distribution. As shown in Example 9, yogurt made with a strain of the invention stored at 10°C maintains a stable pH for up to 45 days (stable, meaning a pH variation of less than 0.1 units). Therefore, the invention also relates to a process for manufacturing and storing fermented milk, comprising: a) fermenting a milk substrate, in particular milk, with the Streptococcus thermophilus strain or bacterial composition according to the invention, to obtain fermented milk (with a pH of 4.2 to 4.7, more preferably 4.2).45 to 4.6), b) optionally cooling the fermented milk to a temperature of 1820°C, and c) storing the containers containing the fermented milk, the packaging step occurring either before or after the fermentation step, but before the optional cooling step, wherein storage is carried out at a temperature greater than 8°C; in one embodiment, storage is carried out at a temperature equal to or greater than 10°C, and optionally less than 20°C, preferably less than 15°C. In one particular embodiment, the storage time at a temperature greater than 8°C (preferably at a temperature equal to or greater than 10°C, and optionally less than 20°C, preferably less than 15°C) is less than 24 hours. Product According to the present invention, any product prepared from, containing, or comprising a strain of Streptococcus thermophilus or bacterial composition of the invention is contemplated. Suitable products include, but are not limited to, a food or feed product. These include, but are not limited to, fruits, pulses, forage crops and vegetables, including derived products, grains and grain-derived products, dairy foods and dairy-derived products, meat, poultry, and seafood. Preferably, the feed or feed product is a dairy, meat, or cereal product. The term "food" is used in a broad sense and includes animal feed, food products, food ingredients, food supplements, and functional foods. In this document, the term "food" is used in a broad sense—encompassing food for humans as well as food for animals (i.e., animal feed). In a preferred aspect, food is for human consumption. As used herein, the term food ingredient includes a formulation that is added or may be added to food and includes formulations that can be used at low levels in a wide variety of products that require, for example, acidification or emulsification. As used herein, the term functional food means a food that is capable of providing not only a nutritional effect and / or a satisfactory taste, but is also capable of providing an additional health benefit to consumers. Although there is no legal definition of a functional food, most stakeholders in this area agree that they are foods marketed as having specific health effects. The Streptococcus thermophilus strain of the present invention can be - or can be added to - a food ingredient, a food supplement, or a functional food. The food can be found in the form of a solution or as a solid - depending on the use and / or the method of application and / or the method of administration. The Streptococcus thermophilus strain of the present invention can be used in the preparation of food products such as confectionery products, dairy products, meat products, poultry products, fish products, or bakery products. For example, the Streptococcus thermophilus strain can be used as an ingredient to prepare soft drinks, fruit juice, or a beverage comprising whey protein, teas, cocoa drinks, dairy drinks and drinks with lactic acid bacteria, yogurt, liquid yogurt, and wine. Preferably, a food as described herein is a dairy product. More preferably, a dairy product as described herein is one or more of the following: yogurt, cheese (such as sour curd, hard cheese, semi-hard cheese, cottage cheese), whey, quark, sour cream, kefir, a fermented whey-based beverage, kumis, a dairy beverage, a yogurt beverage, fermented milk, ripened cream, cheese, fresh cheese, milk, a dairy product concentrate, processed cheese, a cream dessert, or infant formula. Preferably, a food as described herein is a fermented food product. More preferably, a food as described herein is a fermented dairy product—such as fermented milk, yogurt, cream, ripened cream, cheese, fresh cheese, milk drink, processed cheese, cream dessert, cottage cheese, yogurt drink, dairy concentrate, or infant formula. Preferably, the dairy product according to the invention comprises milk of animal and / or vegetable origin. Milk is understood to mean milk of animal origin, particularly from any mammal such as cows, goats, sheep, buffalo, zebras, horses, donkeys, camels, and the like. The term milk also applies to what is commonly called plant-based milk, that is, extracts of plant matter, whether processed or unprocessed, such as leguminous plants (soybeans, chickpeas, lentils, and the like) or oilseeds (rapeseed, soybeans, sesame, cottonseed, and the like). This extract contains proteins in solution or colloidal suspension, which can be coagulated by chemical action, acid fermentation, and / or heat. Finally, the word milk also denotes mixtures of animal and plant-based milks. In one embodiment, the term milk means commercial UHT milk supplemented with 3% (w / w) of semi-skimmed milk powder pasteurized by heating for 10 min + / - 1 min at 90 °C + / - 0.2 °C. In the field of dairy applications, the use of fermented milk, such as yogurt, made with the Streptococcus thermophilus strain or bacterial composition according to the invention is advantageous when mixed with warm flavors (such as coffee or chocolate flavors); in fact, not only the high pH of the yogurt obtained with the strain of the invention but also the stability of this pH (without subsequent acidification) suppresses the perception of acidity in the final product and improves its smoothness; these advantages make the use of warm flavors, such as coffee or chocolate flavors, compatible with the manufacture of flavored yogurt.In another embodiment, the Streptococcus thermophilus strain or bacterial composition according to the invention is advantageous when used for the manufacture of Ryazhenka-type products (Eastern Europe), also called brown yogurts (Asian countries) (fermentation of overcooked milks that develop aromatic notes of caramel); in fact, conventional starter cultures that develop an acidic yogurt note are not compatible with this type of fermented milk product. Percentage of identity of a β-galactosidase An identity percentage of at least 95% with SEC ID NO: 2 means an identity percentage selected from the group consisting of at least 95%, at least 96%, at least 97%, at least 98%, and at least 99%. In one modality, although the sequence of β-galactosidase is different from SEC ID NO:2, the size of the β-galactosidase variant is the same as β-galactosidase as defined in SEC ID NO:2 (1026 amino acid residues). Sequence comparisons can be performed visually or, more commonly, with the help of readily available sequence comparison software. These software programs, available free of charge or for commercial purposes, can calculate the similarity or identity values ​​between two or more sequences. A percentage of identity can be calculated along aligned and contiguous sequences; that is, one sequence is aligned with respect to another sequence, and each amino acid in one sequence is directly compared to the amino acid in the other. 100 corresponding residues in the other sequence, one residue at a time. This is called a gapless alignment. Typically, such gapless alignments are carried out only along a relatively short number of residues. Although this is a very simple and consistent method, it does not take into account that, for example, in a pair of otherwise identical sequences, an insertion or deletion will cause the amino acid residues down the sequence to be left out of the alignment, potentially leading to a large reduction in identity when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that account for possible insertions and deletions without unduly penalizing the overall identity score. This is achieved by inserting gaps in the sequence alignment to try to maximize local identity.These more complex methods assign gap penalties to each gap that occurs in the alignment so that, for the same number of identical amino acids, an alignment of sequences with the fewest possible gaps—reflecting a closer relationship between the two sequences being compared—will achieve a higher score than one with many gaps. Typically, affine gap costs are used, which assign a relatively high cost to the existence of a gap and a smaller penalty for each subsequent residue within the gap (penalty per gap). 101 gap extension). This is the most frequently used gap scoring system. Obviously, high gap penalties will produce optimized alignments with fewer gaps. Most alignment programs allow modification of gap penalties. However, it is possible to use the default values ​​when using such software for sequence comparisons, because these default values ​​have been adjusted to provide relevant results in most cases. Therefore, calculating the maximum percent identity requires, first and foremost, producing an optimal alignment that takes gap penalties into account. A suitable software program for performing such an alignment is Vector NTI (Invitrogen Corp.). An example of software that can perform sequence comparisons includes, but is not limited to, the BLAST package (see Ausubel et al.)., 1999, Short Protocols in Molecular Biology, 4th Ed - Chapter 18). Although the quality of the alignment can be measured in terms of identity, the alignment process itself is not typically based on an all-or-nothing pairwise comparison. Instead, a graded similarity scoring matrix is ​​generally used, assigning scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a frequently used matrix is ​​the BLOSUM62 matrix—the default matrix for 102 the BLAST program suite. Generally, Vector NTI programs use either the public default values ​​or a custom comparison table if supplied (see the user manual for details). Alternatively, the similarity percentage can be calculated using the multiple alignment function in Vector NTI (Invitrogen Corp.), based on an algorithm analogous to CLUSTAL (Higgins DG and Sharp PM (1988), Gene 73(1), 237-244). Once the software has produced an optimal alignment, it is possible to calculate a sequence similarity percentage, preferably a sequence identity percentage. The software typically performs this task as part of the sequence comparison and generates a numerical result. In one modality, the degree of identity with respect to a protein (amino acid) sequence is determined along at least 50 contiguous amino acids, at least 100 contiguous amino acids, at least 150 contiguous amino acids, at least 200 contiguous amino acids, or at least 250 contiguous amino acids. In one modality, the degree of identity with respect to an amino acid or protein sequence can be determined throughout the entire sequence of the SEC ID NO: 2. In one modality, the sequences [sequence of the βgalactosidase to be compared and the SEC ID NO: 2] are aligned using a global alignment program and the identity of The 103 sequence is calculated by identifying the number of exact matches identified by the program divided by the length of the β-galactosidase sequence to be compared. In one modality, the degree of sequence identity between the β-galactosidase sequence to be compared and SEC ID NO: 2 is determined by: 1) aligning the two sequences using any suitable alignment program using the default scoring matrix and default gap penalties, 2) identifying the number of exact matches, where an exact match is where the alignment program has identified an identical amino acid in the two aligned sequences at a given position in the alignment, and 3) dividing the number of exact matches by the length of the β-galactosidase sequence to be compared. In one mode, the global alignment program is selected from the group consisting of CLUSTAL and BLAST, in particular CLUSTAL, using the default parameters, and the sequence identity is calculated by identifying the number of exact matches identified by the program divided by the length of the sequence in question. In one mode, the global alignment program is CLUSTAL using the default parameters, and sequence identity is determined with the BioEdit software (http: / / www.mbio.ncsu.edu / BioEdit / bioedit.html) [by selecting the 104 Sequence drop-down menu, then selecting the Pairwise Alignment submenu and then selecting the Calculate identity / similarity for two sequences menu option]. General Recombinant DNA Methodology Techniques Unless otherwise indicated, the present invention employs conventional techniques of biochemistry, molecular biology, microbiology, and recombinant DNA, which are within the capabilities of a person skilled in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, E.F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, second edition, books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F.M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, chapters 9, 13, and 16, John Wiley & Sons, New York, NY); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; M.J. Gait (Editorial), 1984, Oligonucleotide Synthesis: A Practical Approach, Irl Press; and, DMJ Lilley and JEDahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press. Each of these general texts is incorporated herein by reference. The invention will now be further described by means of Examples, which are intended to assist a person skilled in the art in carrying out the invention and are not intended to be used for practical purposes. 105 object in no way limiting the scope of the invention. MATERIALS AND METHODS Strains and growing conditions The S. thermophilus (ST) strains described in this application were cultured at 37 °C in M17 broth (Oxoid, supplier reference CM0817) supplemented with 30 g / L lactose and, if necessary, with the addition of 15 g / L of Type A bacteriological agar (Biokar, supplier reference no. A1010HA), or at 43 °C in milk (Le Petit Vendéen UHT semi-skimmed milk + 3% Lactalis BBA milk powder). The autoclaved M17 broth was supplemented with lactose, sucrose, galactose, or glucose filtered through a 0.2 µm filter. Frozen stock solutions of ST strains were obtained by halving in M17 with 50% glycerol an overnight culture grown in M17 broth supplemented with 30 g / L sucrose and stored at -20 °C. Transfer of the lacZ allele from strain DGCC12456 to the genome of 2 other S. thermophilus strains A 1198 bp PCR product carrying the lacZ gene from strain DGCC12456 was obtained using the primers lacZ F5 (5'GTAACTTCGTAGGATACAGTG-3') and lacZ_R6 (5'-CAGAGTTACCCATTGTGTGC3'). The PCR product was then purified using the QIAquick PCR Purification Kit (Qiagen) and eluted in deoxyribonuclease-free water. The concentration of the PCR product was determined using a NanoDrop 2000 spectrophotometer. 106 (Thermo Scientific, Wilmington, NA). The size and purity of the PCR product were verified using the QIAxcel® capillary gel electrophoresis system (Qiagen, Hilden, Germany). Strains DGCC715 and DGCC11231 were transformed with the 1198 bp PCR product by natural competition according to Dandoy et al. (2011). Mutants with their lacZ gene replaced by the lacZ allele from strain DGCC12456 were selected (the presence of the lacZ allele from strain DGCC12456 was confirmed by sequencing). Verification by sequencing of the presence of the lacZ allele of DGCC12456 PCR amplification of the βgalactosidase gene was performed using the primers lacS_Fl (5' GTAACTTCGTAGGATACAGTG-3') and lacZ_R7 (5'CAGAGTTACCCATTGTGTGC-3') [incubation step at 98 °C, 5 min, followed by 33 cycles of 98 °C, 45 s; 58 °C, 30 s; 68 °C, 3 min, with a final extension step at 72 °C, 7 min]. The 1198 bp PCR product was then treated with Illustra™ ExoProStar™ according to the manufacturer's instructions (GE Healthcare). Sequencing reactions were performed using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Life Technologies) according to the manufacturer's instructions using an AB3500 instrument (Applied BiosystemsTM) and the primers listed in Table 1. 107 Table 1: List of primers used for amplification and sequencing of the lacZ fragment used for transformation Primers Sequence 5'---3' SEC ID lacS_Fl CTTGACTGCAGCTGAACTC SEC ID NO 32 lacZ_R7 CTC GAC TACAAAG T TAAC TGG SEC ID NO 33 lacZ_R6 CAGAGTTACCCATTGTGTGC SEC ID NO 34 qLacZ_R4 AGGTTGGCTTCATCGATAAC SEC ID NO 35 qLacZ F1 CATCACCTTCTGTAACGATGC SEC ID NO 36 LacZ_F5 G TAAC TTCG TAG PRICE TG SEC ID NO LacS activity [assay A] Streptococcus thermophilus strains were grown in medium Cells were incubated overnight at 37°C in M17 medium containing 30 g / L of sucrose as the sole carbon source. Once the cells reached the stationary phase, they were transferred (at a rate of 0.05 µgDO / mL) to 1 volume of M17 medium containing 30 g / L of lactose as the sole carbon source and incubated for 2 hours at 42°C. The strain cultures were centrifuged at room temperature (3500 g), the supernatant was removed, and the cells were resuspended in 0.5 volume of 4% (w / v) glycerophosphate. This washing step was performed twice. 1.8 mL of the cell suspension was incubated in 4% glycerophosphate for 2 minutes at 42°C. Next, 0.2 mL of lactose solution (70 g / L lactose + 0.1 M potassium phosphate buffer) was added [the pH of the lactose solution was previously adjusted to [pH 4.5 to pH 6, depending on the required measurement]. The mixture was incubated for an additional 3 minutes at 42°C. The reaction was stopped by filtration through a 0.22 µm filter to remove cells. The lactose in the filtered solution was then assayed by HPLC using the following protocol. The solution was diluted to 10% in water, and 10 pL were injected into an Agilent 1200 HPLC (high-performance liquid chromatography) system. Elution was performed in isocratic mode with pure water at 0.6 mL / min. Molecules were separated in 40 min on a Pb2+ ion-exchange column (Shodex® SP-0810 300 mm x 8 mm x 7 µm). Sugars were detected using a refractometer. Quantification was performed by external calibration. The lactose import activity of the permease LacS is calculated as follows: LacS activity = ([lactose] initial - [lactose] 3min) / (OD x time), expressed in pmol / (uOD.min), where: - [lactose] initial is the initial concentration in pmol / mL - [lactose] 3min is the concentration in pmol / mL after 3 minutes at 42°C - OD is the bacterial density in uOD / mL - time is the duration of the experiment in minutes (in this case, 3 minutes). LacZ activity [assay B] A fresh overnight culture of the Streptococcus thermophilus strain under test was obtained in M17 that M17, containing 30 g / L lactose, was used to inoculate 1% (v / v) 10 mL of freshly prepared M17 containing 30 g / L lactose. Cells were harvested by centrifugation (6000 g, 10 min, 4°C) after 3 hours of growth in M17 containing 30 g / L lactose at 42°C, washed in 1.5 mL of cold lysis buffer (0.1 M KPO4), and resuspended in 300 μA of cold lysis buffer. EDTA-free protease inhibitors complete™ (Roche, supplier reference 04693132001) were added to the lysis buffer as described by the supplier. Cells were homogenized by adding 100 mg of glass beads (150–212 pm, Sigma G1145) to 250 μA of resuspended cells and oscillating at a frequency of 30 cycles / s for 6 min in an MM200 oscillating mill (Retsch, Haan, Germany). Cell debris and glass beads were removed by centrifugation (14,000 g, 15 min, 4 °C), and the supernatant was transferred to a 1-inch centrifuge tube.5 mL of clean, ice-kept sample were used. Total protein content was determined using the FLUKA Rapid Protein Quantification Kit (ref 51254). Beta-galactosidase activity in cell extracts was determined spectrophotometrically by monitoring the hydrolysis of O-nitrophenol-beta-galactoside (ONPG) to galactose and O-nitrophenol (ONP). Twenty pL of cell extract were mixed with 135 pL of reaction buffer (100 mM NaPO4; 10 mM KCl; 1 mM MgSO4; 3 mM ONPG + Beta). 110 Mercapto-Ethanol 60 mM, pH = 6). ONP production resulted in a yellow color in the tube. When the yellow color appeared, the reaction was stopped by adding 250 pL of stop buffer (1 M Na₂CO₃). The optical density was recorded at 420 nm using a Synergy HT multidetector microplate reader (BIO-TEK). One unit of beta-galactosidase corresponds to the amount of enzyme that catalyzes the production of 1 pmol of ONP per minute under the assay conditions. Beta-galactosidase activity was calculated as follows: LacZ activity = dOD x V / [dt x 1 x ε x Qprot] , expressed in mol / (mg of total protein extract.min), where: - dOD is the variation of the optical density (OD) at 420 nm between the blank and the sample studied - V is the volume of the reaction in which the optical density is measured (in this case 250 pL) - dt = represents the duration in minutes between the addition of the 20 pL of bacterial extract and the addition of the 250 pL of stop buffer - 1 = optical path length (currently 0.73 cm) - ε = molar extinction coefficient of ONP (currently 4500 cm2 / pmol) - Qprot = amount of protein in the cuvette (in mg) Milk acidification behavior [trial C] The acidification properties of the 111 strains of S. thermophilus were tested, recording the pH over time during milk fermentation as follows: Le Petit Vendéen UHT semi-skimmed milk (yogurt milk) containing 3% (w / v) milk powder (BBA, Lactalis), previously pasteurized for 10 min at 90 °C, was inoculated to 1% (v / v, approximately 107 CFU / ml) with a culture of the S. thermophilus strain under test (resuspended cells without carbohydrates in M17 from an overnight culture grown in supplemental M17 with 3% sucrose). The inoculated milk flasks were incubated statically in a water bath at 43 °C for 24 h. The pH was monitored during incubation using the CINAC system (Alliance Instruments, France; Mettler pH 405 DPAS SC electrode, Toledo, Spain) as previously described. The pH was measured and recorded every 5 minutes. RESULTS Example 1: Isolation of a Streptococcus thermophilus exhibiting a total kick phenotype. Dilutions of a culture of the DGCC7984 strain were plated onto the surface of agar plates containing M17 supplemented with 5 g / L sucrose. After incubation for 48 hours at 37°C, two isolated colonies of the DGCC7984 strain were selected and propagated for 24 hours in M17 supplemented with 20 g / L sucrose at 37°C. These two subclones of the DGCC7984 strain were named DGCC12455 and DGCC12456. The 112 Acidification properties of strains DGCC12455 and DGCC12456 were determined as follows: the two strains were inoculated into M17 broth supplemented with 30 g / L lactose and then incubated overnight at 37°C. The cultures were washed (v / v) in tryptone-salt solution (1 g / L tryptone, 8.5 g / L NaCl) as follows: the cultures were centrifuged at 4000 rpm for 5 minutes; the pellets were resuspended in 10 mL of tryptone-salt solution. The washed cultures were inoculated at 1% (v / v) into 100 mL of UHT semi-skimmed milk containing 3% (w / v) milk powder and pasteurized at 90°C for 10 minutes. The flasks were incubated in a water bath at 43°C, and the pH was measured and recorded online using a CINAC system (Figure 1A). The slope between pH 6.0 and pH 5.3 (-UpH / minute) represents the rate between pH 6 and pH 5.3, was calculated (as the slope of the linear model that is deduced from the evolution of pH as a function of time (ApH / ntime) for a pH value between 6 and 5.3). In addition, the pHDE stopping value corresponding to the pH value at V0 was determined (corresponding to a rate that becomes conclusively undetectable, i.e., below 0.1 mupH / minutes (0.0001 UpH / min)). The acidification of milk by DGCC12455 and DGCC7984 was similar throughout the entire kinetics. In contrast, DGCC12456 exhibited a distinct acidification profile (Figure 1A). In fact, after approximately 600 min of fermentation with DGCC12456, the pH iviA / a / zuz ι / u iu»oi The pH of strain 113 tended to stabilize around 4.37 and remained unchanged until the end of the fermentation time (stopped pH = 4.37), whereas with strains DGCC12455 and DGCC7984, the pH continued to decrease after 600 min of fermentation, reaching values ​​around 4.1 and 4.2 at the end. This peculiar acidification profile with pH stabilization was termed the total stop phenotype. However, despite this unusual kinetics at the end of fermentation, the acidification rate between pH 6 and 5.3 was 106 mU / min, which is an expected acidification rate in industrial dairy fermentation. Example 2: Identification of a genetic difference in the lacZ gene of DGCC12456 The genomes of strains DGCC7984 and DGCC12456 were sequenced and compared. Among other differences, a variation was identified between the two strains in the lacZ gene. The lacZ gene is described (van den Bogaard et al., 2000; Vaughan et al., 2001) as encoding β-galactosidase, an enzyme responsible for the hydrolysis of lactose into glucose and galactose. In the DGCC12456 genome, a C base was replaced by a T base at position 1060 of the lacZ gene, leading to a non-conservative amino acid change, the substitution of an arginine for a cysteine, at position 354 (R354C substitution) of the β-galactosidase enzyme. Therefore, DGCC7984 has a lacZ allele that encodes a β-galactosidase whose sequence is as follows: 114 as defined in SEC ID NO: 2, while strain DGCC12456 has a lacZ allele that encodes a β-galactosidase whose sequence is as defined in SEC ID NO: 4. In contrast, sequencing the lacZ gene of strain DGCC12455 revealed that its lacZ sequence was identical to that of DGCC7984 (i.e., it encoded a β-galactosidase whose sequence is as defined in SEC ID NO: 2). Taken together, these results suggested that the mutation in the lacZ gene may be responsible for the peculiar acidification profile of DGCC12456. To investigate this hypothesis further, the β-galactosidases encoded by the lacZ gene of other S. thermophilus strains were compared. The R354C substitution present in DGCC12456 was not detected in any of the β-galactosidase sequences of the other S. thermophilus strains, confirming that this substitution is unique to DGCC12456. Most of the S. thermophilus strains evaluated carry a lacZ allele encoding a β-galactosidase whose sequence is as defined in SEC ID NO:2. In some S. thermophilus strains, amino acid differences have been identified compared to SEC ID NO:2. These identified amino acid differences were conservative substitutions and have led to the identification of 8 different β-galactosidase variant types (as defined herein), whose sequence is as defined in SEC ID NO: 6, 9, 12, 15, 18, 21, 115 and 27 [variants 1 to 8 - Table 2]. Table 2: Comparative analysis of amino acid sequences of β-galactosidases encoded by S. thermophilus strains. Amino acid position numbering is performed according to SEC ID NO: 2. * indicates position 354, which differs from SEC ID NO: 4 Amino acid position (SEQ ID N0:2 used for numbering) % similarity SEQ ID Type 35 237 339 354* 542 714 777 951 955 999 1002 DGCC7984 EAVRYEVAATA 100% 2 Variant 1 ATVRYEVAATA 99.7% 6 Variant 2 EAVRYEIAA ss 99.7 % 9 Variant 3 EAVRYEVAA s A 99.9 % 12 Variant 4 EAVRYKVAATA 99.9 % 15 Variant 5 EAVRFEVAATA 99.9 % 18 Variant 6 EAVRYEVSATA 99.9 % 21 Variant 7 ETIRYEVAATA 99.8 % 24 Variant 8 EAVRYEVAVTA 99.9% 27 DGCC12456 EAVCYEVAATA 99.9% 4 Example 3: Comparison of the acidification profile of S. thermophilus strains DGCC715 and DGCC11231, and their derivatives encoding a β-galactosidase with the sequence SEC ID NO:4 instead of SEC ID NO:2 (R354C substitution). Derivatives of strains DGCC715 and DGCC11231, designated 715R354C and H231R354C, respectively, were constructed. The lacZ gene from DGCC12456 (which encodes a β-galactosidase with a cysteine ​​(C) at position 354) was inserted in place of the lacZ gene from strains DGCC715 and DGCC11231. In practice, the lacZ gene was amplified by POR from DNA of DGCC12456. 116 Competent cells from DGCC715 or DGCC11231 were prepared and transformed with the amplified DNA. The transformants were verified by sequencing. The ability of the S. thermophilus strains DGCC715, DGCC11231, 715R354C, and H231R354C to ferment milk was evaluated as described in the Materials and Methods section [Test C]. The pH was recorded over time using a CINAC apparatus, and the results are presented in Figures 2A, 3A, 4A, and 5A. The following descriptors were calculated (Table 3): the slope between pH 6.0 and pH 5.3 (UpH / minute) [pH6-5.3 slope]; and the pHDE corresponding to the pH value at V0 [corresponding to a rate that becomes conclusively undetectable, i.e., below 0.1 mupH / minute (0.0001 UpH / min)]. Table 3: Descriptors of milk acidification kinetics by DGCC715, DGCC11231 and their constructed derivatives calculated from the acidification curves Strain Pending pH 6 - 5.3 (io-4 UpH / min) Stop pH DGCC715 109 4.19 7 1 5R354C 117 4.38 DGCC11231 130 4.10 H231RS54C 149 4.27 117 The results indicated that the acidification profile of the 715^3540 and H231R354C derivatives (see Figures 3A and 5A) differed from that of their respective parent strains (Figures 2A and 4A, respectively) due to pH stabilization after 10 to 12 h of incubation. pH stabilization (pHDE) occurred around pH 4.27 for 11231R354C and pH 4.38 for 715R354C, while the parent strains continued to acidify the milk after 12 hours of incubation, reaching pH values ​​of 4.19 and 4.10, respectively, at the end of the incubation period. The results also indicated that, despite the substitution of an arginine with a cysteine ​​at position 354 of β-galactosidase, the acidification slope between pH 6.0 and 5.3 was not negatively affected. Consequently, the resulting derivatives remained suitable for carrying out dairy fermentation in industrial facilities. A second set of descriptors was also considered to characterize the total STOP phenotype. This second set of descriptors was also determined for strain DGCC12456. For this purpose, the evolution of the rate (acidification rate) was calculated as a function of time, and the results are presented in Figures 1B, 2B, 3B, 4B, and 5B. From these curves, the following descriptors were determined (Table 4): - the time to the maximum speed obtained during 118 the fermentation experiment (Tvmax), calculated time (in minutes) from the beginning of the fermentation experiment; - the time to pHDEparada (TpHDEparada) [the time to reach V0 as defined above], time calculated (in minutes) from the start of the fermentation experiment; - the time difference between TpHDE stop and Tvmax (in minutes). Table 4: Descriptors of the fermentation rate kinetics by DGCC715, DGCC11231 and their constructed derivatives and DGCC12456 calculated from the rate curves Strain Tvmax TpHüE STOP Δ time between Tvmax and TpHDE STOP DGCC715 95 790 695 7 ]_ 5R354C 115 525 410 DGCC11231 105 945 840 112 31R3S4C 115 595 480 DGCC12456 160 610 450 The results showed that the time difference between TpHEEparada and Tvmax was 410 and 480 minutes for the 715R354C and 11231R354C derivatives, respectively, compared to 695 and 840 minutes for their respective parent strains (Table 4). The results also showed that the DGCC12456 strain has the same profile as the 715R354C and 11231R354C derivatives. These results indicated that the time difference between TpHEEparada and Tvmax was 410 and 480 minutes for the 715R354C and 11231R354C derivatives. The stop and Tvmax times of the 715R354C and H231R354C derivatives were significantly decreased compared to their respective parent strains (a difference of 285 and 360 minutes, respectively). These data reflect the ability of the 715R354C and H231R354C derivatives, when used to ferment milk, to achieve a stabilized pH (pHDE stop), which is higher, in a shorter time (from Tvmax). These results confirmed that the R354C substitution in the β-galactosidase of DGCC12456 is responsible for the total stop phenotype. Therefore, strains carrying a lacZ allele that codes for a β-galactosidase with a cysteine ​​at position 354 offer the possibility of producing fermented milks not only by reaching their desired pH (pHDE stopped) in an industrially acceptable time (around 600 minutes), but also by stabilizing their pH at the fermentation temperature for up to 24 hours. In contrast, the parent strains continue to acidify milk for up to 700 to 800 minutes at a lower pH, making it necessary to stop the fermentation process with a cooling step before the pH drops too low. Example 4: Beta-galactosidase activities at pH 6 and pH 4.5 for a variety of S. thermophilus strains The β-galactosidase activities at pH 4.5 and pH 6 of a variety of S. thermophilus strains carrying a lacZ allele encoding a β-galactosidase as defined in SEC ID NO:2 were determined by assay B 120 (as defined in the Materials and Methods). The results are represented in Figure 6. First, these data showed that for a specific strain, its β-galactosidase activity at pH 4.5 is always lower than its β-galactosidase activity at pH 6.0, which means that β-galactosidase activity decreases with decreasing pH. Furthermore, these data showed significant variability in β-galactosidase activity among strains carrying the same lacZ allele, not only at pH 6.0 [from 9.93 x 10⁻⁸ to 1.74 x 10⁻⁷ mol / (mg of total protein extract.min)] but also at pH 4.5 [from 6.7 x 10⁻⁸ to 1.15 x 10⁻⁷ mol / (mg of total protein extract.min)]. This variability can be explained by the strain-specific gene pool. These data raised doubts about whether β-galactosidase activity alone (at pH 4.5 and / or pH 6) can be used as a reliable descriptor to characterize the strains of the invention (which have a complete STOP phenotype). Example 5: Comparison of beta-galactose activity at pH 6 and pH 4.5 of S. thermophilus strains 715 and ST11231, their derivatives 715R354C and 11231R354C, and strain DGCC12456 Following the identification of the R354C substitution in β-galactosidase and its role in the peculiar milk acidification kinetics by DGCC12456 (total STOP phenotype), the activity of β-galactosidase at pH 6 and pH 121 4.5% of strains DGCC715, DGCC11231, their respective constructed derivatives, and DGCC12456, was determined by assay B (as defined in the Materials and Methods). The results are represented in Figure 7. These data confirmed that the β-galactosidase activity at pH 4.5 of strains carrying a lacZ allele that encodes a β-galactosidase as defined in SEC ID NO: 4 (cysteine ​​at position 354) is lower than the β-galactosidase activity at pH 6.0. It is worth noting that the difference in β-galactosidase activity between pH 6 and pH 4.5 is more significant for strains carrying a lacZ allele encoding a β-galactosidase as defined in SEC ID NO: 4 than for strains carrying a lacZ allele encoding a β-galactosidase as defined in SEC ID NO: 2. Therefore, the β-galactosidase activities at pH 4.5 of strains carrying a lacZ allele encoding a β-galactosidase as defined in SEC ID NO: 4 were lower than those of strains carrying a lacZ allele encoding a β-galactosidase as defined in SEC ID NO: 2. However, the variability in βgalactosidase activity at pH 4.5 existing among strains carrying the same lacZ allele [from 1.65xlCD8 to 3.94xl0~8mol / (mg of total protein extract.min)] for strains carrying a lacZ allele that encodes a β-galactosidase as defined in the SEC 122 ID NO:4] confirmed that β-galactosidase activity, even at pH4.5, cannot be used as the sole parameter to better characterize strains of the invention that have a total STOP phenotype Example 6: Investigation of lactose-permease (LacS) activity In S. thermophilus, the lacZ gene is part of the lac operon (along with the lacS gene that encodes a lactose · −permease), and both the lactose · −permease and the β-galactosidase participate in the catabolism of lactose (importing lactose (LacS) and then hydrolyzing it into glucose and galactose (lacZ)). The LacS activities at pH 6.0 and pH 4.5 of strains DGCC715, DGCC11231, their respective derivatives, and strains DGCC7984 and DGCC12456 were determined using assay A (as defined in the Materials and Methods). The results are presented in Table 5 (along with the β-galactosidase activity determined in Example 4). Table 5: LacS activity, LacZ activity and ratio at pH 4.5 and pH 6 of DGCC715, DGCC11231, and their constructed derivatives, and strains DGCC7984 and DGCC12456 i Q«m η / ι ζηζ / E / γ Strain LacS Activity (pmol / uDO.min) LacZ Activity (mol / mg of total protein extract.min) LacS / LacZ Ratio x10s pH6 pH4.5 pH 6 pH4.5 pH 6 pH4.5 DGCC715 0.3696 0.1532 1.17x107 8.48x10-8 3.16 1.81 715R354C 0.2846 0.5036 8.36x10-8 3.68x10-8 3.40 13.70 123 DGCC11231 0.7686 0.3347 9.93x10-8 6.70x10-8 7.74 5.00 11231R354C 0.5567 0.9075 8.23x10-8 3.94x10-8 6.77 23.05 DGCC7984 0.4574 0.2943 2.10x107 1.11 x107 2.18 2.66 DGCC12456 0.4568 0.4529 1.20 x107 1.65x10-8 3.82 27.49 Although lactose ·-permease (LacS) activities at pH 4.5 were reduced compared to pH 6.0 for strains encoding a β-galactosidase as defined in SEC ID NO: 2, these activities increased (715R354C and 11231R354C) or remained unchanged (DGCC12456) for strains encoding a β-galactosidase as defined in SEC ID NO: 4. It is hypothesized that to compensate for a decrease in lactose hydrolysis by β-galactosidaseFS, lactose ·-permease imports more lactose. Therefore, the LacS to LacZ ratio (LacS / LacZ, representing the efficiency of a strain to hydrolyze imported lactose = EH) at pH 4.5 and pH 6 was calculated (as defined herein), and is provided in Table 5 and Figure 8. Strains carrying the lacZ allele encoding a β-galactosidase as defined in SEC ID NO: 2 exhibited LacS / LacZ ratios of similar or slightly reduced values ​​at pH 4.5 compared to pH 6.0. In contrast, these ratios increased significantly at pH 4.5 compared to pH 6.0 for strains carrying a lacZ allele encoding a β124 galactosidase as defined in SEC ID NO: 4. These results reflect a decrease in the efficiency of the strains of the invention in utilizing lactose from the medium (i.e., in hydrolyzing imported lactose) at pH 4.5 compared to strains carrying the lacZ allele encoding a βgalactosidase as defined in SEC ID NO: 2. The difference between the LacS / LacZ ratio at pH 4.5 of strains carrying a lacZ allele encoding a β-galactosidase as defined in SEC ID NO: 2 and the ratio of strains carrying a lacZ allele encoding a β-galactosidase as defined in SEC ID NO: 4 is highly significant, so that this parameter can be reliably used to characterize the strains of the invention. The LacS / LacZ ratios at pH 4.5 of the DGCC715 strain and its derivative have been shown to be sufficiently discriminatory to use the DGCC715 strain for the purpose of identifying additional lacZ alleles that encode a βgalactosidase according to the invention (lacZFS alleles). Example 7: Hydrolysis efficiency of imported lactose (EH) from S. thermophilus strains 715 and ST11231, their derivatives 715R354C and 11231R354C, and strain DGCC12456 Finally, the inventors have determined an additional descriptor that represents the overall behavior of the S. thermophilus strain of the invention with respect to κ metabolism c 125 of lactose during the entire milk fermentation process. Thus, the following formula (I) was developed, which represents the difference in hydrolysis efficiency of imported lactose between pH 6.0 and pH 4.5 (EHphs - EHph4.5): (ί)ΔΕΗ-Ιη LacSpH6 -ln LacSpH45 LacZpH4 5 In this formula, a ΔEH value around 0 or slightly positive or slightly negative means that the hydrolysis efficiency of imported lactose is similar at pH 6.0 and pH 4.5 (i.e., that the hydrolysis efficiency does not depend on pH). Conversely, a significantly negative ΔEH value means that the hydrolysis efficiency of imported lactose is lower at pH 4.5 than at pH 6.0 (i.e., that the hydrolysis efficiency decreases significantly with decreasing pH). This formula was applied to calculate the ΔEH for strains DGCC715, DGCC11231, their respective derivatives and DGCC12456, based on the β-galactosidase activity and lactose η-permease activities reported in Table 5. The results are presented in Figure 9. As shown in Figure 9, and as expected, the two S. thermophilus strains carrying a lacZ allele encoding a β-galactosidase as defined in SEC ID NO: 2 have a slightly positive ΔEH value (0.44 and 0.56). In contrast, the S. thermophilus strains 126 carriers of a lacZ allele encoding a β-galactosidase as defined in SEC ID NO: 4 have a ΔEH value that is significantly negative (from -1.23 to -1.97). In addition to the LacS to LacZ ratio at pH 4.5 defined above, the ΔEH value as defined by formula (I) is a reliable parameter, which allows characterization of the strains of the invention that have a total STOP phenotype. Example 8: Impact of packaging temperature during the manufacture of stirred yogurt A stirred yogurt was prepared by inoculating a milk substrate (3.9% protein, 1.5% fat, and 6% sucrose) with the previously described strain DGCC12456 (at least 10⁷ CFU / ml) and Lactobacillus bulgaricus (approximately 10³ CFU / ml), and incubating the inoculated milk at 43°C until pH 4.60 was reached. The yogurt was then stirred. The stirred yogurt was subsequently cooled and packaged at either 20°C or 35°C, and then stored at 10°C for the duration of its shelf life (45 days). The pH was measured during the storage period using a portable single-probe pH meter. Viscosity was determined on day 14 (after the end of fermentation) using a Brookfield DV-I™ Prime viscometer (AMETEK Brookfield) with an S-05 spindle and a speed of 10 rpm; after 30 seconds, the 127 viscosity value (in centipoise; cP) . As shown in Figure 10A, and as expected, packaging at 35°C resulted in the highest temperature stirred yogurt on day 14 compared to packaging at 20°C (Figure 10A). Interestingly, the pH of the stirred yogurt remained at a high level for at least 45 days regardless of the packaging temperature (Figure 10B). These results confirm that a strain of Streptococcus thermophilus of the invention having a total STOP phenotype is of high interest to manufacturers of stirred yogurt, as it allows for improved texture of stirred yogurt by increasing the packaging temperature without compromising the pH during storage. Example 9: subsequent acidification of yogurt at 10°C Yogurt was prepared by inoculating a milk substrate (3.9% protein and 1.5% fat; no added sugar) with either (A) the previously described strain DGCC12456 (at least 10⁷ CFU / ml) and Lactobacillus bulgaricus (approximately 10³ CFU / ml) or (B) a reference starter culture with high post-acidification control behavior consisting of Streptococcus thermophilus and Lactobacillus bulgaricus strains (the same L. bulgaricus strain as composition A) and incubating the inoculated milk at 43°C until pH 4.60 was reached. Immediately thereafter, the yogurt was cooled to 22°C and then stored at 10°C throughout its shelf life. 128 (45 days). The pH was measured during the storage time using a portable single-probe pH meter. As shown in Figure 11, both cultures exhibited a relatively high pH during storage. The reference starter culture showed a rapid pH decrease to 4.34 by day 14, followed by pH stability from day 14 to day 45 (dashed line). In contrast, the culture comprising strain DGCC12456 maintained a stable pH throughout storage from day 1 to day 45 (pH between 4.48 and 4.5) (solid line). These results confirm that a Streptococcus thermophilus strain of the invention having a total STOP phenotype is of high interest to fermented milk manufacturers, as it allows fermented milk products to be stored at a higher temperature than that of a conventional cold room (usually less than 8°C), without affecting the pH. Taken together, the Streptococcus thermophilus strain of the invention offers yogurt and fermented milk manufacturers new possibilities for improving their processes and reducing their costs, for example, by taking advantage of pH stability at fermentation temperature for up to 24 hours in the manufacture of firm yogurt, and by taking advantage of both improved texture and pH stability when packaged at 129 high temperature in the manufacture of stirred yogurt or taking advantage of pH stability at 10°C for at least 45 days in the storage of your fermented milks. It is hereby stated that, as of this date, the best method known to the applicant for putting the aforementioned invention into practice is the one that is clear from the present description of the invention.

Claims

1. A polynucleotide encoding a p-galactosidaseFS, characterized in that it is defined as a lacZ allele that increases the ratio of the lacS permease lactose import activity calculated by assay A at pH 4.5 to the beta-galactosidase lactose hydrolysis activity calculated by assay B at pH 4.5 (LacSPH4.5 vs. LacZpH4.5 ratio) above 8 in a DGCC715 derivative, the DGCC715 derivative being a DGCC715 strain (deposited in the DSMZ on February 12, 2019, accession number DSM33036), wherein its lacZ gene was replaced by the polynucleotide encoding a p-galactosidaseFS.

2. The polynucleotide according to claim 1, characterized in that the ratio of LacSPH4.5 to LacZpH4.5 increases to more than 10 or more than 12.

3. The polynucleotide according to claim 1 or 2, characterized in that the lactose hydrolysis activity of beta-galactosidase calculated by assay B at pH 6 (LacZpne) in the DGCC715 derivative is at least 7.10~8 mol / (mg of total protein extract.min).

4. The polynucleotide according to any one of claims 1 to 3, characterized in that it encodes a β-galactosidaseFS comprising an amino acid deletion, an amino acid addition, an amino acid substitution, or an amino acid deletion and addition, with respect to a β-galactosidase selected from the group consisting of: a) a β-galactosidase having an amino acid sequence as defined in SEC ID NO:2; (yb) a β-galactosidase variant comprising an amino acid sequence having at least 95% identity with SEC ID NO:2, encoded by a variant allele of lacZ that does not increase the ratio of LacSPH4.5 to LacZpH4.5 in a DGCC715 derivative to 5 or more of 5, the DGCC715 derivative being a DGCC715 strain in which its lacZ gene was replaced by the variant allele of lacZ.

5. The polynucleotide according to any of claims 1 to 4, characterized in that the β-galactosidaseFS sequence comprises or consists of an amino acid sequence having at least 95% identity with SEC ID NO:

2.

6. The polynucleotide according to any of claims 1 to 5, characterized in that the β-galactosidaseFS sequence does not comprise an arginine at position 354, in particular it comprises a cysteine ​​or an equivalent amino acid at position 354.

7. The polynucleotide according to any one of claims 1 to 6, characterized in that the β-galactosidaseFS sequence comprises: a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but does not comprise an arginine at position 354; b) an amino acid sequence that has at least 95% identity with SEC ID NO: 2 and does not comprise an arginine at position 354; c) an amino acid sequence that is otherwise as defined as that of a variant protein β-galactosidase that has at least 95% identity with SEC ID NO: 2, but does not comprise an arginine at position 354.

8. The polynucleotide according to any one of claims 1 to 7, characterized in that the β-galactosidaseFS sequence comprises: a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but comprising a cysteine ​​or an equivalent amino acid at position 354; b) an amino acid sequence having at least 95% identity with SEC ID NO: 2 and comprising a cysteine ​​or an equivalent amino acid at position 354; c) an amino acid sequence that is otherwise as defined as that of a variant protein of β-galactosidase having at least 95% identity with SEC ID NO: 2, but comprising a cysteine ​​or an equivalent amino acid at position 354.

9. A polynucleotide characterized in that it comprises a portion of at least 100 nucleotides of the polynucleotide according to any of claims 5 to 8, wherein the nucleotide portion spans the codon corresponding to residue 354 of 3-galactosidaseFS.

10. A strain of Streptococcus thermophilus, characterized in that it comprises an allele of the lacZ gene that is an allele of lacZFS encoding a p-galactosidaseFS according to any one of claims 1 to 8.

11. A strain of Streptococcus thermophilus according to claim 10, characterized in that when evaluated by assay C, it leads to an acidification slope between pH 6 and 5.3 of at least -0.005 UpH / min, in particular at least -0.01 UpH / min.

12. A strain of Streptococcus thermophilus according to claim 10 or 11, characterized in that it has a difference in hydrolysis efficiency (ΔEH) of imported lactose that is less than -0.5 calculated by the following formula (I): (1) ΔEH = In LacSpH6 - In LacSpH4-5 _lacZpH6_ LacZpH45_ formula (I) wherein, LacSPH6 and LacSpM.s represent the lactose import activity of the permease LacS calculated by assay A at pH 6 and pH 4.5 respectively, and LacZpne and LacZPH4.5 represent the lactose hydrolysis activity of the beta-galactosidase calculated by assay B at pH 6 and pH 4.5 respectively.

13. A bacterial composition characterized in that it comprises the Streptococcus thermophilus strain according to any one of claims 10 to 12, and optionally one or more additional lactic acid bacteria selected from the group consisting of Streptococcus, Lactococcus, Lactobacillus, Leuconostoc, Pediococcus, Enterococcus, Oenococcus, and Bifidobacterium.

14. A food or feed product, characterized in that it comprises the Streptococcus thermophilus strain according to any of claims 10 to 12 or the bacterial composition according to claim 13, in particular a dairy, meat or cereal food or feed product, in particular a fermented dairy food product.

15. A method for manufacturing a fermented product, characterized in that it comprises: a) inoculating a substrate with the Streptococcus thermophilus strain according to any of claims 10 to 12 or the bacterial composition according to claim 13; and b) fermenting the inoculated substrate obtained in step a) to obtain a fermented product, preferably a fermented dairy product.

16. A method according to claim 15 for manufacturing stirred yogurt, characterized in that it comprises: a) fermenting a milk substrate, in particular milk, inoculated with the Streptococcus thermophilus strain according to any of claims 10 to 12 or the bacterial composition according to claim 13, to obtain a stirred yogurt, preferably with a pH of 4.2 to 4.7, more preferably 4.45 to 4.6; b) cooling the stirred yogurt; c) packaging the stirred yogurt; and d) optionally, transferring the packages from step c) to a cold storage room; where the cooling and packaging temperature is at least 24°C, at least 25°C, at least 26°C, at least 27°C, at least 28°C, at least 29°C, at least 30°C, at least 31°C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C or at least 40°C.

17. A method according to claim 15 for manufacturing stirred yogurt, characterized in that it comprises: a) fermenting a milk substrate, in particular milk, inoculated with the Streptococcus thermophilus strain 136 according to any of claims 10 to 12 or the bacterial composition according to claim 13, to obtain a stirred yogurt, preferably with a pH of 4.2 to 4.7, more preferably 4.45 to 4.6; b) packaging the stirred yogurt; and c) optionally, transferring the packages from step b) to a cold storage room; wherein the process does not comprise any cooling step between the end of fermentation and packaging.

18. A method according to claim 15 for manufacturing firm yogurt, characterized in that it comprises: a) packaging a milk substrate, in particular milk, inoculated with the Streptococcus thermophilus strain or bacterial composition according to the invention in containers; b) fermenting the inoculated milk substrate to obtain a firm yogurt, preferably with a pH of 4.2 to 4.7, more preferably 4.45 to 4.6; c) optionally, directly transferring the containers from step b) to a cold storage room, wherein the process does not comprise a cooling step in a cooling room after the fermentation step b).

19. Use of the Streptococcus thermophilus strain according to any of claims 10 to 12 or the bacterial composition according to claim 137 13, for manufacturing a food or feed product, preferably a fermented food product, more preferably a fermented dairy product.

20. Use of a polynucleotide according to any of claims 1 to 9, to obtain a strain of Streptococcus thermophilus with a total STOP phenotype when used to ferment milk by assay C.

21. A method for preparing a Streptococcus thermophilus strain with a total STOP phenotype, characterized in that it comprises: a) providing a Streptococcus thermophilus strain having a ratio of the lactose import activity of the permease LacS calculated by assay A at pH 4.5 versus the lactose hydrolysis activity of the beta-galactosidase calculated by assay B at pH 4.5 (LacSPH4.5 ratio versus LacZpH4.5 ratio).5) which is less than 5; b) replacing the lacZ gene allele of the Streptococcus thermophilus strain of step a) with a polynucleotide according to any one of claims 1 to 8, or replacing a portion of the lacZ gene allele of the Streptococcus thermophilus strain of step a) with the corresponding polynucleotide according to claim 9, or modifying the lacZ gene sequence of the Streptococcus thermophilus strain of step a) to have a lacZFS allele with the same sequence as a polynucleotide according to any one of claims 1 to 8; i) recovering the Streptococcus thermophilus strain or strains with a total STOP phenotype when used to ferment milk by assay C.

22. The method according to claim 21, characterized in that the Streptococcus thermophilus strain of step a) is further characterized by its ability, when evaluated by assay C, to lead to an acidification slope between pH 6 and 5.3 of at least -0.01 UpH / min.

23. A method for identifying a lacZFS allele encoding a β-galactosidase73, characterized in that it comprises: a) inserting the lacZ allele of study in place of the lacZ gene allele from strain DGCC715 (deposited in the DSMZ on February 12, 2019, accession number DSM33036), to obtain a DGCC715 derivative; and b) determining the lactose import activity of the LacS permease by assay A at pH 4.5 (LacSPH4.s) and the lactose hydrolysis activity of the beta-galactosidase by assay B at pH 4.5 (LacZpH4.5); where a LacSPH4.5 to LacZPH4.5 ratio of more than 8 is indicative of a lacZ allele that is a lacZFS allele that encodes a β-galactosidase73.

24. The method according to claim 23, characterized in that it further comprises determining the lactose hydrolysis activity of beta-galactosidase by assay B at pH 6 (LacZPH6) in the derivative of DGCC715, and wherein a LacSPH4.5 vs. LacZPH4.5 ratio of more than 8 and a LacZPH6 of at least 7.10~8 mol / (mg of total protein extract.min) are indicative of a lacZ allele that is a lacZFS allele encoding a p-galactosidaseFS.