LACTIC ACID BACTERIA WITH REDUCED SENSITIVITY TO COS-TYPE BACTERIOPHAGES

MX431572BActive Publication Date: 2026-02-25INT N&H DENMARK APS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
MX2021009771
Authority / Receiving Office
MX · MX
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-09-24
Filing Date
2021-08-13
Publication Date
2026-02-25
Estimated Expiration
2040-02-13

AI Technical Summary

Technical Problem

Current strategies to minimize bacteriophage infection in lactic acid bacteria used in the food industry are not entirely effective, and there is a need for bacterial strains with reduced phage sensitivity to prevent contamination during fermentation processes.

Method used

Introduction of a mutation in the metAP gene encoding methionine aminopeptidase (MetAP) in Streptococcus thermophilus strains to reduce sensitivity to cos-type bacteriophages, specifically the DT1 phage, by replacing the native metAP gene with a metAPR allele that confers reduced phage susceptibility.

Benefits of technology

The metAPR allele provides stable reduction in phage sensitivity over multiple generations, enhancing the resilience of lactic acid bacteria to bacteriophage infections, thereby improving the reliability of fermentation processes.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention relates to a lactic acid bacterium, in particular a strain of the genus Streptococcus, with reduced sensitivity to cos-type bacteriophages. The invention also relates to methods for modifying these lactic acid bacteria, as well as their use for fermenting milk.
Need to check novelty before this filing date? Find Prior Art

Description

LACTIC ACID BACTERIA WITH REDUCED SENSITIVITY TO COS-TYPE BACTERIOPHAGES FIELD OF INVENTION The present invention relates to a lactic acid bacterium with reduced sensitivity to eos-type bacteriophages. BACKGROUND OF THE INVENTION Lactic acid bacteria cultures are widely used in the food industry for the production of fermented products, including dairy products (such as yogurt, butter, and cheese), meat products, bakery products, wine, and vegetable products. Examples of lactic acid bacteria widely used in the food industry include the genera Streptococcus, Lactococcus, Lactobacillus, Leuconostoc, Pediococcus, Enterococcus, Oenococcus, and Bifidobacterium. For example, the lactic acid bacterium Streptococcus thermophilus is widely used in the dairy industry. Preparing cultures is labor-intensive, space-consuming, and requires significant equipment, and there is a considerable risk of contamination with bacteriophages (phages) during milk fermentation. The attack on bacterial cultures by bacteriophage infection and their multiplication is considered one of the main problems in the industrial use of bacterial cultures. There are many different types of phages with l? / «ηη / ίζηζ / E / γίΛΐ Ref. 324936 variable mechanisms for attacking bacteria. In addition, new strains of bacteriophages are emerging. Many different strains of bacteriophages have been discovered and isolated that can infect bacterial strains used in industry, including lactic acid bacteria species, for example, Lactococcus lactis and Streptococcus thermophilus. The strategies used in the food industry to minimize bacteriophage infection, and therefore bacterial culture failure, are not entirely effective. These strategies include the use of mixed cultures to ensure a certain level of resistance to phage attack. Additionally, the rotation of selected bacterial strains susceptible to different bacteriophages is employed. However, the rapid replacement of a bacterial strain with a resistant strain after the emergence of a new phage is generally not possible. Therefore, it has not yet been possible to eliminate phage contamination in the food industry. The lytic infection cycle of bacteriophages involves, specifically, the adsorption of the phage to the surface of the bacterial host cell, the injection of phage DNA into the cell, phage DNA replication, phage protein expression, phage assembly, and lysis of the bacterial host cell to release the newly assembled phage particles. Bacterial phage resistance mechanisms depend on host factors involved in one or more stages of the lytic cycle of phage replication and are generally classified based on the stage of the infectious cycle at which they interfere. Although numerous phage resistance mechanisms have been discovered in other bacterial species, only a few have been identified in S. thermophilus. The most dominant defense mechanisms in this species are the CRISPR-Cas systems (Barintervalou et al., 2007; Horvath et al., 2008). In this defense mechanism, the bacterial cell accumulates short sequences, called spacers, from the phage genomes, which act as a memory of previous encounters and guide the specific excision of the invading phage's DNA. Little information is available regarding other host factors involved in phage infection in this foodborne streptococcal species. There is an ongoing need in the field to provide improved bacterial strains for use in the food and feed industries, such as strains with reduced susceptibility to phages. Therefore, there is a need to identify the host factors involved in phage infection in lactic acid bacteria, for example, in the genus Streptococcus. SUMMARY OF THE INVENTION The present inventors have surprisingly discovered L? / «nn / Lznz / E / YiAi that a host gene encoding methionine aminopeptidase (MetAP protein) is implicated in phage infection and is required for the eos-type phage DT1 to complete its lytic cycle. The mutation in the metAP gene confers reduced susceptibility to eos-type phages in Streptococcus thermophilus. Complementation of the mutated strains with the metAP gene from a susceptible strain results in the restoration of the phage susceptibility phenotype. Introduction of the same mutation into a Streptococcus mutans strain also results in a reduced phage susceptibility phenotype, suggesting the broad importance of the host MetAP in phage infection.The inventors have also shown that the reduced sensitivity phenotype to eos-type phages is stable over time (at least 60 generations), confirming the stability of the metaAP mutations and the interest of lactic acid bacteria with metaAP mutations in industrial fermentation. In one aspect, the invention relates to a lactic acid bacterium comprising a metAPR allele encoding a methionine aminopeptidase protein (MetAPR protein), wherein the metAPR allele reduces sensitivity to phage DT1 when inserted in place of the metAP gene allele of the Streptococcus thermophilus SMQ-301 strain, wherein sensitivity to phage DT1 is determined by the Efficiency Plaque Formation (EPF) Assay I. L? / «ηη / ίζηζ / E / γίΛΐ Thus, the invention relates to a lactic acid bacterium comprising a metAPR allele encoding a methionine aminopeptidase protein (MetAPR protein), wherein the metAPR allele is defined as a metAP allele that reduces the sensitivity to phage DT1 of a Streptococcus thermophilus SMQ-301 derived strain, the SMQ-301 derived strain being a Streptococcus thermophilus SMQ-301 strain in which its metAP allele has been replaced by the metAPR allele, and wherein sensitivity to phage DT1 is determined by the Efficiency Plaque Formation (EOF) Assay I. In one particular modality, the lactic acid bacterium is a strain of the genus Streptococcus selected from the group consisting of a strain of Streptococcus thermophilus or a strain of Streptococcus mutans. In one aspect, the invention relates to a bacterial composition comprising the lactic acid bacteria of the invention. In one aspect, the invention relates to a food product or feed comprising the lactic acid bacteria or bacterial composition of the invention. In one aspect, the invention relates to a method for manufacturing a fermented product, comprising: a) inoculating a substrate with the lactic acid bacteria or bacterial composition of the invention, and b) fermenting the inoculated substrate obtained in step a) to obtain a product L? / «nn / Lznz / E / YiAi fermented, preferably a fermented dairy product. In one aspect, the invention relates to the use of lactic acid bacteria or the bacterial composition of the invention, to manufacture a food product or feed, preferably a fermented food product, more preferably a fermented dairy product. In one aspect, the invention relates to a polynucleotide encoding a MetAPR protein, wherein the polynucleotide reduces sensitivity to phage DT1 when inserted in place of the metAP gene allele of the Streptococcus thermophilus SMQ-301 strain, wherein sensitivity to phage DT1 is determined by the Plaque Formation Efficiency (PFE) Assay I. Therefore, the invention relates to a polynucleotide encoding a MetAPR protein, wherein the polynucleotide is a metAP allele that reduces sensitivity to phage DT1 in a Streptococcus thermophilus SMQ-301-derived strain, the SMQ-301-derived strain being a Streptococcus thermophilus SMQ-301 strain in which its metAP allele has been replaced by the metAPR allele, and wherein sensitivity to phage DT1 is determined by the Plaque Formation Efficiency (PFE) Assay I. In one aspect, the invention relates to the use of a polynucleotide of the invention, for reducing the sensitivity to at least one eos-type phage of an eos-type phage-sensitive lactic acid bacterium, wherein the sensitivity to at least one eos-type phage is determined by EOP Assay I. In one aspect, the invention relates to a method for preparing a lactic acid bacteria strain having reduced sensitivity to at least one eos-type phage, comprising: a) providing a lactic acid bacteria strain sensitive to eos-type phages; b) replacing the metaP gene allele of the eos-type phage-sensitive lactic acid bacteria strain with a polynucleotide of the invention, or modifying the metaP gene sequence of an eos-type phage-sensitive lactic acid bacteria strain to have a metaP allele with the same sequence as a polynucleotide of the invention; and c) recovering the lactic acid bacteria strain or strains having reduced sensitivity to at least one eos-type phage, wherein the sensitivity to at least one eos-type phage is determined by EOP Assay I. In one aspect, the invention relates to a method for identifying a metAPR allele encoding a metAPR protein, comprising: a) inserting the metAPR allele to be tested in place of the metAPR gene allele of the Streptococcus thermophilus SMQ-301 strain, to obtain an SMQ301-derived strain; and b) determining, by Plaque Formation Efficiency Assay I, the DT1 phage OPE in the SMQ-301-derived strain from step a), wherein a reduction in OPE of at least 4 log, at least 5 log, or at least 6 log is indicative. L? / «ηη / ίζηζ / Ε / γίΛΐ of a metAP allele which is a metAPR allele that encodes a MetAPR protein. DETAILED DESCRIPTION OF THE INVENTION General definitions Unless otherwise defined, all scientific and technical terms used herein have the same meaning that they are normally assigned by a person skilled in the art to which this description pertains. The description is not limited by the methods and materials described herein by way of example, and any similar or equivalent methods and materials to those described herein may be used in carrying out or testing the modalities of this description. The headings provided herein are not limitations on the various aspects or modalities of this description, which may be used by reference to the description as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the description as a whole. As used herein, the term polynucleotide is synonymous with the expression nucleotide sequence and / or the expression nucleic acid sequence. Unless otherwise indicated, any nucleic acid sequences are written from left to right in the L? / «nn / Lznz / E / YiAi orientation from 5' to 3'. The term protein, as used herein, includes proteins, polypeptides, and peptides. As used herein, the expression amino acid sequence is synonymous with the term protein. In this description and in the claims, the name of the amino acid, the conventional three-letter code, or the conventional one-letter code for amino acid residues is used. It is also understood that a protein may be encoded by more than one nucleotide sequence due to the degeneracy of the genetic code. Unless otherwise stated, any amino acid sequences are written from left to right in the amino-to-carboxyl orientation. In the present invention, a specific numbering of the amino acid residue positions in the MetAP protein can be used. By aligning the amino acid sequence of a sample MetAP protein with the MetAP protein of SEC ID NO: 2, it is possible to assign a number to an amino acid residue position in the sample MetAP protein that corresponds to the amino acid residue position or numbering of the amino acid sequence shown in SEC ID NO: 2 of the present invention. Throughout this description, other definitions of terms may appear. Before the modalities are described in more detail by way of example, it should be understood that this description is not limited to the modalities. L? / «nn / Lznz / E / YiAi particulars described, since, of course, these may vary. It should also be understood that the terminology used herein is for the sole purpose of describing the particular modalities, and is not intended to be limiting, since the scope of this description will be limited only by the appended claims. It should be noted that as used herein and in the accompanying claims, the singular forms a, one, an and the include the plural referents unless the context clearly indicates otherwise. The expressions comprising, includes, and composed of, as used herein, are synonymous with including, includes, or containing, and are inclusive or open-ended and do not exclude additional, unmentioned members, elements, or stages of the method. The expressions comprising, includes, and composed of also include the expression consisting of. The publications discussed herein are provided solely for descriptive purposes prior to the filing date of this application. Nothing herein should be construed as an admission that such publications constitute prior art for the claims appended hereto. The present inventors have surprisingly discovered that a host gene encoding methionine aminopeptidase L? / «ηη / ίζηζ / E / γίΛΐ (MetAP) is a bacterial host factor involved in the multiplication of eos-type phages in Streptococcus strains. In particular, the present inventors have surprisingly discovered that one allele of metAPR, which encodes a MetAPR protein, reduces the sensitivity of Streptococcus strains to at least one eos-type phage. In one aspect, the present invention provides a method for identifying a metAPR allele that encodes a MetAPR protein, comprising: a) inserting the metAP allele to be tested (candidate metAP allele) in place of the metAP gene allele of Streptococcus thermophilus SMQ-301, to obtain a strain derived from SMQ-301; and b) determine by Plaque Formation Efficiency Assay I the DT1 phage EOP in the SMQ-301 derived strain from step a), wherein a reduction in EOP of at least 4 log is indicative of a metAP allele that is a metAPR allele encoding a MetAPR protein. As used herein, the expression "an allele of the metAP gene" means the version of the metAP gene discovered in a particular lactic acid bacterium. As with most bacterial genes, the nucleotide sequence of a gene can vary, and alleles represent different sequences of the same gene. Therefore, the allele L? / «nn / Lznz / E / YiAi of the metAP gene of Streptococcus thermophilus SMQ-301 is as set forth in SEQ ID NO: 1. This allele, as defined in SEQ ID NO: 1, encodes a MetAP protein as set forth in SEQ ID NO: 2. Alleles of metAPR that encode the MetAP1* protein The inventors have demonstrated that some of these metAP alleles are capable of reducing the sensitivity of Streptococcus thermophilus SMQ-301 to phage DT1 when inserted in place of the original (i.e., native) allele of the metAP gene (SEC ID NO: 1) of SMQ-301. These metAP alleles are herein referred to as metAPR alleles. The protein encoded by these metAPR alleles is herein referred to as the MetAPR protein. Therefore, any metAPR allele (encoding a metAPR protein) that reduces the sensitivity of the SMQ301 strain to phage DT1 (as defined herein) forms part of the invention. In other words, a metAPR allele is defined as a metAPR allele that reduces the sensitivity to phage DT1 of a Streptococcus thermophilus SMQ-301-derived strain, the SMQ-301-derived strain being a Streptococcus thermophilus SMQ-301 strain in which its original metAPR allele has been replaced by the metAPR allele. In one embodiment, an allele of metAP1* is defined herein (particularly in the context of a lactic acid bacterium or a polynucleotide of the invention) as an allele of L? / «nn / Lznz / E / YiAi metAP identified using the following method: a) inserting the metAP allele to be tested (candidate metAP allele) in place of the metAP gene allele from Streptococcus thermophilus SMQ-301 (as set out in SEC ID NO: 1), to obtain an SMQ-301-derived strain; and b) determining by Plaque Formation Efficiency Assay I the DT1 phage EOP in the SMQ-301-derived strain from step a), wherein a reduction in EOP of at least 4 log is indicative of a metAP allele that is a metAPR allele encoding a MetAPR protein. The following are non-limiting examples of MetAPR proteins. One way to determine the reduction in sensitivity to bacteriophages conferred by a metAPR allele of the invention is to determine the plaque-forming efficiency (PFE) of a phage in a Streptococcus strain in which the candidate metAP allele of the invention has been inserted in place of the original allele of the metAP gene of this Streptococcus strain. In one modality, the sensitivity reduction is determined by calculating the plaque formation efficiency (PFE) in the Plaque Formation Efficiency Test I (PFE Test I) described herein. Efficacy of the Plaque Formation Test I L? / «ηη / ίζηζ / Ε / γίΛΐ One way to determine the reduced sensitivity to eos-type bacteriophage or bacteriophages conferred by a candidate metaAP allele is to determine the sensitivity of both an eos-type phage-sensitive lactic acid bacterium (referred to herein as the reference strain) and the corresponding derived lactic acid bacterium in which the allele of its metAP gene has been replaced by a candidate metaAP allele (referred to herein as the derived strain). The sensitivity to bacteriophages of a lactic acid bacterium of the invention (in particular of the genus Streptococcus, in particular of a strain of Streptococcus thermophilus) can be determined by calculating the plaque formation efficiency (PFE) in Plaque Formation Efficiency Test I (PFE Test I) described herein. The enumeration of infectious phage particles is carried out using the double agar plate overlap assay as described by Kropinski et al. 2009, referred to herein as Plaque Formation Efficiency Assay I. The method consists of infecting a surface-growing bed of bacteria on a soft agar nutrient medium. Phage infection will result in a localized, transparent or translucent zone, corresponding to the area where bacteria are destroyed or fail to grow, called a plaque. The infectious phage unit is therefore called a plaque-forming unit (PFU). Because the L? / «ηη / ίζηζ / E / γίΛΐ phage enumeration using the assay requires a minimum of 30 to a maximum of 300 phage units per plate; it may be necessary to dilute the phage suspension. For this purpose, the primary phage suspension is serially diluted 10-fold in 10 mL of M17 medium containing 5 g / L of lactose (v / v). The Plaque Formation Efficacy Trial I has the following stages: i. pre-culture each of the strains to be tested (the reference strain and its derived strain or strains to be tested as defined herein) in M17 medium containing 5 g / 1 of lactose (v / v) overnight at 37 °C; ii. Use each preculture separately to inoculate 1% (v / v) 5 ml of molten M17-CaC12 soft agar medium containing 5 g / 1 of lactose, 10 mM of CaC12 and 5 g / 1 (w / v) of agar (maintained at 47 °C in a water bath); iii. add 100 μA of the phage dilution to be tested to each of the seeded media; iv. After mixing, pour each of the mixtures onto the surface of a solid M17-CaC12 agar medium containing 5 g / 1 of lactose, 10 mM of CaCl2 and 15 g / 1 (w / v) of agar; v. After solidification of the overlay, incubate the inverted plates for 48 hours at 37 °C; vi. number the plates (on plates that have 30 to 300 plates); lj / «ηη / ίζηζ / E / γίΛΐ vil. calculate the titer of virulent phages as: the number of plates x 10 x the reciprocal of the dilution rate; and express in uf / ml; and viii. calculate the EOP of the phage in a derived strain as the titer of the phage in the derived strain to be tested divided by the titer of the phage in the reference strain (where the EOP of the reference strain is 1). In one particular embodiment, the lactic acid bacterium of the invention is a strain of the genus Streptococcus. The sensitivity to bacteriophages conferred by a candidate metaAP allele is determined by Plaque Formation Efficiency Assay I described herein, using an eos-type phage-sensitive strain of the genus Streptococcus (reference strain) and the corresponding strain derived from the genus Streptococcus in which the allele of its metaAP gene has been replaced by a candidate metaAP allele. In one particular embodiment, such lactic acid bacterium of the invention is of the species Streptococcus thermophilus. The sensitivity to bacteriophages conferred by a candidate metaAP allele is determined by the Plaque Formation Efficiency Assay I described herein, using an eos-type phage-sensitive strain of Streptococcus thermophilus (reference strain) and the corresponding derived strain of Streptococcus thermophilus in which the allele of its metaAP gene has been replaced by a candidate metaAP allele. To determine whether a candidate metAP allele is a metAP according to the invention, the Streptococcus thermophilus strain SMQ-301 is used as the reference strain, and the Streptococcus thermophilus strain obtained by inserting a candidate metAP allele in place of the metAP gene allele of the Streptococcus thermophilus strain SMQ-301 is used as a derived strain (referred to herein as an SMQ-301 derivative). Therefore, in one modality, the Plate Formation Efficiency Test I, as defined in this document, is implemented with: - the Streptococcus thermophilus strain SMQ-301 as a reference strain; the SMQ-301 strain is commercially available and used as a model organism to study phage-host interactions (Tremblay and Moineau, 1999; Labrie et al., 2015), and is available from the Félix d'Hérelle Reference Centre for Bacterial Viruses (www.phage.ulaval.ca) with the reference HER 1368; the genomic sequence of this strain is available with the accession number CP011217.1; - the Streptococcus thermophilus strain SMQ-301 in which the allele of its metAP gene has been replaced by the candidate metAP allele (SMQ-301-derived strain); therefore, the metAP gene allele of the SMQ-301-derived strain does not encode a MetAP protein as set out in SEC ID NO: 2, in particular not as set out in SEC ID NO: 1; and L? / «nn / Lznz / E / YiAi - the DT1 phage, which is commercially available (Tremblay and Moineau 1999; Labrie et al., 2015) and available at the Félix d'Hérelle Reference Centre for Bacterial Viruses, with the reference HER 368; the genomic sequence of this phage is available with the accession number NC_002072.2. As defined herein, a candidate metaAP allele is considered to be a metAPR allele according to the invention, when the candidate metaAP allele reduces sensitivity to phage DT1 when inserted in place of the metAP gene allele of the Streptococcus thermophilus strain SMQ301, wherein sensitivity to phage DT1 is determined by the Efficiency Plaque Formation (EPF) Assay I. Therefore, a candidate metaAP allele is considered to be a metAPR allele according to the invention, when the candidate metaAP allele reduces the sensitivity to phage DT1 of a Streptococcus thermophilus SMQ-301 derived strain, the SMQ-301 derived strain being a Streptococcus thermophilus SMQ301 strain in which its original metAP allele has been replaced by the metAPR allele, and wherein sensitivity to phage DT1 is determined by the Efficiency Plaque Formation (EPF) Assay I. It should be noted that the insertion of a candidate metaP allele (including a metaP allele of the invention or a variant metaP allele as defined herein) in place of the original allele of the Streptococcus thermophilus SMQ-301 metaP allele should result in an SMQ301-derived strain that can be tested by the Efficiency Plaque Formation (EPF) Assay I. Any metaP allele whose sequence renders the application of the EPF Assay I and the determination of susceptibility to DT1 impossible is not considered a metaP allele as defined herein. Reduction of sensitivity to phage DT1 by the Plaque Formation Efficiency (PFE) Assay I means a reduction in PFE of at least 4 log. In one embodiment, the reduction in PFE is at least 5 log. In one embodiment, the reduction in PFE is at least 6 log. In one embodiment, the reduction in PFE is at least 7 log. In one embodiment, the reduction in PFE is at least 8 log. In one embodiment, a metAP allele is considered to be a metAPR allele according to the invention when the reduction in PFE is selected from the group consisting of a reduction in PFE of at least 4 log, at least 5 log, at least 6 log, at least 7 log, and at least 8 log, wherein sensitivity to phage DT1 is determined by the Plaque Formation Efficiency (PFE) Assay I.Therefore, a candidate metaAP allele is considered to be a metAPR allele according to the invention when the candidate metaAP allele reduces the sensitivity to phage DT1 of a Streptococcus thermophilus SMQ-301 derived strain by at least 4 log, the SMQ-301 derived strain being a Streptococcus thermophilus SMQ-301 strain in which its metAP allele has been replaced by the metAPR allele, and wherein the sensitivity to phage DT1 is determined by the Efficiency Plaque Formation (EPF) Assay I (i.e., compared to the Streptococcus thermophilus SMQ-301 strain). Conversely, a candidate metaP allele that, when inserted in place of the metaP gene allele of the Streptococcus thermophilus SMQ-301 strain, does not reduce the EOP by at least 4 log, wherein sensitivity to phage DT1 is determined by the Plaque Formation Efficiency (EOP) Assay I, is not considered a metaP allele according to the invention. Therefore, a candidate metaAP allele that does not reduce the plaque formation efficiency (PFE) of phage DT1 in a Streptococcus thermophilus SMQ-301-derived strain by at least 4 log, the SMQ-301-derived strain being a Streptococcus thermophilus SMQ-301 strain in which its metaAP allele has been replaced by the candidate metaAP allele, and wherein sensitivity to phage DT1 is determined by Plaque Formation Efficiency (PFE) Assay I, is not considered a metAPR allele according to the invention. The expression "reduce sensitivity" or "reduce EOP" is defined according to assay I, i.e., by determining the EOP of phage DT1 in the Streptococcus thermophilus SMQ-301 derived strain and comparing it with the EOP of phage DT1 in the Streptococcus thermophilus SMQ-301 strain. Variant allele of metAP that encodes a variant protein L? / «ηη / ίζηζ / Ε / γίΛΐ MetAP A candidate metaP allele that 1) encodes a metaP protein whose sequence has at least 80% identity with SEC ID NO: 2, and 2) does not reduce plaque formation efficiency (PFE) or reduces PFE by less than 3 log, wherein sensitivity to phage DT1 is determined by Plaque Formation Efficiency (PFE) Assay I, is referred to herein as the variant metaP allele (encoding a variant metaP protein). The expression “variant metaP protein” is used interchangeably with the expression “variant metaP protein having at least 80% identity with SEC ID NO: 2”. In one embodiment, a variant allele of metAP, when inserted in place of the metAP gene allele of the Streptococcus thermophilus SMQ-301 strain, reduces plaque formation efficiency (PFE) by less than 3 log, where sensitivity to phage DT1 is determined by Plaque Formation Efficiency (PFE) Assay I. Therefore, a variant allele of metAP reduces the PFE of phage DT1 in a strain derived from Streptococcus thermophilus SMQ-301 by less than 3 log, the SMQ-301-derived strain being a Streptococcus thermophilus SMQ-301 strain in which its metAP allele has been replaced by the variant allele of metAP, and where sensitivity to phage DT1 is determined by Plaque Formation Efficiency (PFE) Assay I. In one embodiment, the reduction in PFE is less than 3 log. In one modality, the reduction in EOP is less than 2 log. In one L? / «ηη / ίζηζ / Ε / γίΛΐ to SEC ID NO: 2. In one modality, a variant MetAP protein (encoded by a variant allele of metAP) has a sequence that is at least 85% identical to SEC ID NO: 2. In one modality, a variant MetAP protein (encoded by a variant allele of metAP) has a sequence that is at least 90% identical to SEC ID NO: 2. In one modality, a variant MetAP protein (encoded by a variant allele of metAP) has a sequence that is at least 95% identical to SEC ID NO: 2. In one modality, a variant MetAP protein (encoded by a variant allele of metAP) has a sequence that is at least 96% identical to SEC ID NO: 2. In one modality, a variant MetAP protein (encoded by a variant allele of metAP) has a sequence that is at least 97% identical to SEC ID NO: 2.In one modality, a variant MetAP protein (encoded by a variant allele of metAP) has a sequence that is at least 98% identical to SEC ID NO: 2. In one modality, a variant MetAP protein (encoded by a variant allele of metAP) has a sequence that is at least 99% identical to SEC ID NO: 2. In one embodiment, in combination with the percent identity, the size of the variant MetAP protein is the same as that of the MetAP protein as defined in SEC ID NO: 2 (286 amino acid residues); therefore, in one embodiment, a variant allele of MetAP is further defined as encoding a 286-amino-acid variant MetAP protein L? / «ηη / ίζηζ / Ε / γίΛΐ amino acids. In one modality, a variant allele of metAP is defined herein as: 1) that encodes a variant protein MetAP, the sequence of which is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEC ID NO: 2; and 2) that when inserted in place of the allele of the metAP gene of the Streptococcus thermophilus SMQ-301 strain, it reduces the EOP to less than 3 log or less than 2 log, where sensitivity to phage DT1 is determined by the Plaque Formation Efficiency (EOP) Assay I. Therefore, a variant allele of metAP is defined herein as: 1) that encodes a variant protein MetAP, the sequence of which is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEC ID NO: 2; and 2) reducing the DT1 phage EOP in a Streptococcus thermophilus SMQ-301 derived strain by less than 3 log, the SMQ-301 derived strain being a Streptococcus thermophilus SMQ-301 strain in which its metAP allele has been replaced by the metAP variant allele, and wherein sensitivity to DT1 phage is determined by the Plaque Formation Efficiency (PFE) Assay I, L? / «nn / Lznz / E / YiAi In one modality, a variant allele of metAP is defined herein as: 1) that encodes a variant MetAP protein, the sequence of which is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEC ID NO: 2; and 2) that when inserted in place of the allele of the metAP gene of the Streptococcus thermophilus SMQ-301 strain, it leads to the same EOP, where sensitivity to phage DT1 is determined by the Plaque Formation Efficiency (EOP) Assay I. Therefore, a variant allele of metAP is also defined herein as: 1) that encodes a variant MetAP protein, the sequence of which is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEC ID NO: 2; and 2) leads to the same DT1 phage EOP in a Streptococcus thermophilus SMQ-301-derived strain as that of DT1 phage in the Streptococcus thermophilus SMQ-301 strain, the SMQ-301-derived strain being a Streptococcus thermophilus SMQ301 strain in which its metAP allele has been replaced by the metAP variant allele, and wherein sensitivity to DT1 phage is determined by the Efficiency Formation Assay I L? / «ηη / ίζηζ / Ε / γίΛΐ Plates (EOP). The metaAP variant alleles as defined herein can be readily identified by a person skilled in the art from Streptococcus thermophilus strains that are known or can be characterized as sensitive to phage DT1 (where sensitivity to phage DT1 is determined by EOP Assay I). The expression itself, or reduced EOP of less than 3 log or less than 2 log, is defined according to assay I, i.e., by determining the EOP of phage DT1 in the Streptococcus thermophilus SMQ-301 derived strain and comparing it with the EOP of phage DT1 in the Streptococcus thermophilus SMQ-301 strain. Replacement of the allele of the metaAP gene in a lactic acid bacterium (particularly the SMQ-301 strain) Replacing the metaP allele of a reference lactic acid bacterium (specifically a strain of the genus Streptococcus, and more specifically Streptococcus thermophilus) with a metaP allele (such as a candidate or variant metaP allele) is performed using conventional molecular biology techniques and is within the capabilities of a skilled practitioner. Generally, appropriate routine methods include replacement via homologous recombination. The expression "the allele of the metAP gene inserted in place of the allele of the metAP gene" is synonymous with the expression "the allele of the metAP gene is replaced by an allele of metAP" (such as an allele of metAP). L? / «ηη / ίζηζ / Ε / γίΛΐ of candidate metAP or a variant allele of metAP). The expression metAP allele inserted in place of the metAP gene allele is synonymous with the expression metAP gene allele is replaced by a metAPR allele. Replaced (or inserted in place) means that the MetAP protein sequence encoded by the metAP allele to be inserted (in particular a candidate metAP allele or a metAP variant allele) is different from the MetAP protein sequence encoded by the metAP gene allele of the original strain (such as a reference strain). Therefore, replaced (or inserted in place) means that the coding sequence of the metAP gene of the original strain (from the first nucleotide of the start codon to the last nucleotide of the stop codon) is replaced by the corresponding coding sequence of the metAP allele (in particular the candidate metAP allele or the metAP variant allele). In the case of strain SMQ-301, "replaced" (or "inserted in place") means that the sequence of the MetAP protein encoded by the metAP allele to be inserted (in particular a candidate metAP allele or a variant metAP allele) is different from the sequence of the MetAP protein encoded by the original metAP gene of strain SMQ-301. Therefore, "replaced" (or "inserted in place") means that the coding sequence of the metAP gene of strain SMQ-301 (from the first nucleotide of the start codon to the last) is different. L? / «ηη / ίζηζ / Ε / γίΛΐ nucleotide of the stop codon, i.e., nucleotides 1 to 861 of the SEC ID NO: 1) is replaced by the corresponding coding sequence of the metAP allele (in particular the candidate metAP allele or the metAP variant allele). To generate a candidate metaAP allele Candidate metAP alleles can be generated by random or targeted mutagenesis, starting from a metAP allele that is not a metAPR allele, in particular from a metAP allele encoding the MetAP protein as defined in SEC ID NO: 2 (such as SEC ID NO: 1) or from a variant metAP allele as defined herein. In one embodiment, candidate metAP alleles are generated by random mutagenesis. In another embodiment, candidate metAP alleles can be generated by targeted mutagenesis. Suitable mutagenesis protocols for random or targeted mutagenesis are described in the Materials and Methods section below. Candidate metAP alleles can also be generated by subjecting a Streptococcus thermophilus bacterium, whose metAP gene allele is not a metAPR allele (such as strain SMQ-301), to exposure to phage DT1. A suitable protocol for exposing a strain to a phage is described in the Materials and Methods section below. In one modality, to decrease the number of genetic events leading to reduced sensitivity to phages due to CRISPR-Cas systems (and thus to increase the number of genetic events linked to metAP mutation), it is possible to inhibit or decrease the efficiency of CRISPR-Cas systems using phages carrying one or more anti-CRISPR genes (acr genes) (document WO2018 / 197495). Candidate metAP alleles generated in this way can be screened using the method for identifying a metAP allele as defined herein. In one aspect, the present invention provides a lactic acid bacterium comprising a metAPR allele (encoding a MetAPR protein), wherein the metAPR allele reduces sensitivity to phage DT1 when inserted in place of the metAP gene allele of the Streptococcus thermophilus strain SMQ-301, wherein sensitivity to phage DT1 is determined by the Efficiency Plaque Formation (EPF) Assay I.Therefore, the invention relates to a lactic acid bacterium comprising a metAPR allele encoding a methionine aminopeptidase protein (MetAPR protein), wherein the metAPR allele is defined as a metAP allele that reduces the sensitivity to phage DT1 of a Streptococcus thermophilus SMQ-301 derived strain, the SMQ-301 derived strain being a Streptococcus thermophilus SMQ301 strain in which its (original) metAP allele has been replaced by the metAPR allele, and wherein sensitivity to phage DT1 is determined by Formation Efficiency Assay I. L? / «nn / Lznz / E / YiAi of Plaque Formation Efficiency (PFE). The metAPR allele as generated, as screened, and / or as defined herein. The expression that reduces sensitivity to phage DT1 is as defined herein for the definition of the metAPR allele. In particular, and as defined herein, the reduction in sensitivity to phage DT1 linked to the metAPR allele of the invention is at least 4 log, as determined by Plaque Formation Efficiency (PFE) Assay I. It is important to note that the expression comprising a metAPR allele means that the only allele of the metAP gene contained in the genome of the lactic acid bacterium (LAB) is a metAPR allele. Therefore, the metAP gene allele of the LAB of the invention is a metAPR allele as defined herein. It is not contemplated that the LAB of the invention comprises multiple alleles of the metAP gene. In one embodiment, the LAB of the invention comprises, as the only allele of its metAP gene, a metAPR allele that reduces sensitivity to phage DT1 when inserted in place of the metAP gene allele of the Streptococcus thermophilus SMQ-301 strain, wherein sensitivity to phage DT1 is determined by the Plaque Formation Efficiency (PFE) Assay I.Therefore, the BAL of the invention comprises, as the only allele of its metAP gene, a metAPR allele that reduces the sensitivity to phage DT1 of a Streptococcus thermophilus SMQ-301 derived strain, the SMQ-301 derived strain being a Streptococcus thermophilus SMQ-301 strain in which its metAP allele has been replaced by the metAPR allele, and wherein sensitivity to phage DT1 is determined by the Efficiency Plaque Formation (EPF) Assay I. In one aspect, the present invention provides a polynucleotide encoding a MetAPR protein, wherein the polynucleotide reduces sensitivity to phage DT1 when inserted in place of the metAP gene allele of the Streptococcus thermophilus strain SMQ-301, wherein sensitivity to phage DT1 is determined by the Plaque Formation Efficiency (PFE) Assay I. Therefore, the invention provides a polynucleotide encoding a MetAPR protein, wherein the polynucleotide is a metAP allele that reduces sensitivity to phage DT1 in a Streptococcus thermophilus SMQ-301-derived strain, the SMQ-301-derived strain being a Streptococcus thermophilus SMQ-301 strain in which its metAP allele has been replaced by the metAPR allele, and wherein sensitivity to phage DT1 is determined by the Plaque Formation Efficiency (PFE) Assay I. In one embodiment, the polynucleotide consists of an allele of metAPR as defined herein.The polynucleotide comprises or consists of a metAPR allele, as generated, as screened, and / or as defined herein. Expression reduces sensitivity to phage DT1 as described. L? / «nn / Lznz / E / YiAi defines in this document for the definition of the metAPR allele. In particular and as defined in this document, the reduction of sensitivity to phage DT1 linked to the metAPR allele of the invention is at least 4 log, as determined by the Efficiency Plaque Formation (EPF) Assay I. MetAPR protein sequences The metAPR allele of the invention, as part of a polynucleotide of the invention or contained in the lactic acid bacterium of the invention, can be defined by its nucleotide sequence or by the amino acid sequence of the MetAPR protein it encodes, in addition to its ability to reduce sensitivity to phage DT1, in particular its ability to reduce sensitivity to phage DT1 of a Streptococcus thermophilus SMQ-301 derived strain (as determined herein by EOP Assay I). In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid deletion, an amino acid addition, an amino acid substitution, or an amino acid deletion and addition, with respect to a MetAP protein selected from the group consisting of: a) a MetAP protein having an amino acid sequence as defined in SEO ID NO: 2; and b) a variant MetAP protein as defined herein having at least 80% identity with SEC ID NO: 2. A variant MetAP protein as defined herein is encoded by a variant allele of metAP, which when inserted in place of the metAP gene allele of Streptococcus thermophilus strain SMQ-301, does not reduce EOF or reduces EOF by less than 3 log, wherein sensitivity to phage DT1 is determined by the Plaque Formation Efficiency (PFE) Assay I.A variant MetAP protein as defined herein is encoded by a variant allele of metAP, which reduces the plaque formation efficiency (PFE) of phage DT1 in a Streptococcus thermophilus SMQ-301-derived strain by less than 3 log or leads to the same PFE of phage DT1 in a Streptococcus thermophilus SMQ301-derived strain, the SMQ-301-derived strain being a Streptococcus thermophilus SMQ-301 strain in which its metAP allele has been replaced by the variant allele of metAP, and wherein sensitivity to phage DT1 is determined by the Plaque Formation Efficiency (PFE) Assay I. In one modality, the metAPR allele encodes a MetAPR protein whose sequence has at least 80% identity with SEC ID NO: 2 (but is different from SEC ID NO: 2). In particular modalities with respect to EOP, the percentage of identity and size described elsewhere in this application in the context of the metAP variant protein apply similarly in the context of MetAPR proteins. In one modality, the metAPR allele encodes a protein MetAPR comprising an amino acid deletion, with respect to a MetAP protein selected from the group consisting of a) a MetAP protein having an amino acid sequence as defined in SEC ID NO: 2 and b) a MetAP variant protein as defined herein having at least 80% identity with SEC ID NO: 2; in one particular embodiment, the MetAPR protein is characterized by the deletion of at least one amino acid, in particular by the deletion of 1, 2, 3, 4, or 5 amino acids. In one particular embodiment, the MetAPR protein is characterized by the deletion of one amino acid. In one particular embodiment, the MetAPR protein is characterized by the deletion of 2, 3, 4, or 5 amino acids. In one particular embodiment, the MetAPR protein is characterized by the deletion of 2, 3, 4, or 5 consecutive amino acids. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid addition, with respect to a MetAP protein selected from the group consisting of a) a MetAP protein having an amino acid sequence as defined in SEC ID NO: 2 and b) a MetAP variant protein as defined herein having at least 80% identity with SEC ID NO: 2; in one particular embodiment, the MetAPR protein is characterized by the addition of at least one amino acid, in particular by the addition of 1, 2, 3, 4, or 5 amino acids. In one particular embodiment, the MetAPR protein is characterized by the addition of one amino acid. L? / «nn / Lznz / E / YiAi In one particular form, the MetAPR protein is characterized by the addition of 2, 3, 4, or 5 consecutive amino acids. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid substitution with respect to a MetAP protein selected from the group consisting of a) a MetAP protein having an amino acid sequence as defined in SEC ID NO: 2 and b) a variant MetAP protein as defined herein having at least 80% identity with SEC ID NO: 2; in one particular embodiment, the MetAPR protein is characterized by the substitution of at least one amino acid, in particular by the substitution of 1, 2, 3, 4, or 5 amino acids. In one particular embodiment, the MetAPR protein is characterized by the substitution of one amino acid. In one particular embodiment, the MetAPR protein is characterized by the substitution of 2, 3, 4, or 5 amino acids. In one embodiment, the metAPR allele encodes a MetAPR protein, wherein the MetAPR protein sequence does not comprise an amino acid selected from the group consisting of glutamine at position 57, leucine at position 153, alanine at position 168, histidine at position 206, valine at position 228, and proline at position 233, wherein the amino acid sequence established in the L? / «ηη / ίζηζ / Ε / γίΛΐ SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein, wherein the MetAPR protein sequence does not comprise a glutamine at position 57, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein, wherein the MetAPR protein sequence does not comprise a leucine at position 153, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein, wherein the MetAPR protein sequence does not comprise an alanine at position 168, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein, wherein the MetAPR protein sequence does not comprise a histidine at position 206, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein, wherein the MetAPR protein sequence does not comprise a valine at position 228, wherein the amino acid sequence established in SEC ID NO: 2 is used for the L? / «nn / Lznz / E / YiAi numbering. In one embodiment, the metAPR allele encodes a MetAPR protein, wherein the MetAPR protein sequence does not comprise a proline at position 233, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In any of these modalities, the size of the MetAPRes protein is the same as that of the MetAP protein as defined in SEC ID NO: 2 (286 amino acid residues). In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid selected from the group consisting of a lysine or lysine equivalent amino acid at position 57, a proline or proline equivalent amino acid at position 153, a glutamic acid or glutamic equivalent amino acid at position 168, a glutamine or glutamic equivalent amino acid at position 206, an aspartic acid or aspartic equivalent amino acid at position 228, a glutamine or glutamic equivalent amino acid at position 233, and a leucine or leucine equivalent amino acid at position 233, wherein the amino acid sequence set out in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising a lysine or equivalent amino acid at position 57, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising a proline or proline-equivalent amino acid at position 153, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising glutamic acid or an equivalent amino acid at position 168, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising a glutamine or equivalent amino acid at position 206, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an aspartic acid or an equivalent amino acid at position 228, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising a glutamine or equivalent amino acid at position 233, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising a leucine or equivalent amino acid at position 233, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In any of these modalities, the size of the MetAPRes protein is the same as that of the MetAP protein as defined in SEC ID NO: 2 (286 amino acid residues). In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid selected from the group consisting of a lysine at position 57, a proline at position 153, a glutamic acid at position 168, a glutamine at position 206, an aspartic acid at position 228, a glutamine at position 233, and a leucine at position 233, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising a lysine at position 57, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising a proline at position 153, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising a glutamic acid at position 168, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising a glutamine at position 206, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an aspartic acid at position 228, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising a glutamine at position 233, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising a leucine at position 233, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In any of these modalities, the size of the MetAPRes protein is the same as that of the MetAP protein as defined in SEC ID NO: 2 (286 amino acid residues). In one embodiment, the metAPR allele encodes a MetAPR protein comprising: L? / «nn / Lznz / E / YiAi a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but does not comprise an amino acid selected from the group consisting of a glutamine at position 57, a leucine at position 153, an alanine at position 168, a histidine at position 206, a valine at position 228 and a proline at position 233; these metAPR alleles encode the MetAPRtal proteins as set out in SEC ID NO: 5 to 10, respectively; b) an amino acid sequence having 80% identity with SEC ID NO: 2 and not comprising an amino acid selected from the group consisting of a glutamine at position 57, a leucine at position 153, an alanine at position 168, a histidine at position 206, a valine at position 228 and a proline at position 233; or c) an amino acid sequence that is otherwise that of a MetAP variant protein having at least 80% identity with SEC ID NO: 2 (MetAP variant protein as defined herein), but not comprising an amino acid selected from the group consisting of a glutamine at position 57, a leucine at position 153, an alanine at position 168, a histidine at position 206, a valine at position 228 and a proline at position 233. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but does not comprise a glutamine at position 57 (SEC ID NO: 5), comprising an amino acid sequence that has 80% identity with SEC ID NO: 2 and does not comprise a glutamine at position 57, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein that has at least 80% identity with SEC ID NO: 2 but does not comprise a glutamine at position 57. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but does not comprise a leucine at position 153 (SEC ID NO: 6), comprising an amino acid sequence that has 80% identity with SEC ID NO: 2 and does not comprise a leucine at position 153, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein that has at least 80% identity with SEC ID NO: 2 but does not comprise a leucine at position 153. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but does not comprise an alanine at position 168 (SEC ID NO: 7), comprising an amino acid sequence that has 80% identity with SEC ID NO: 2 and does not comprise an alanine at position 168, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein that has at least 80% identity with SEC ID NO: 2 but does not comprise an alanine at position 168. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but does not comprise a histidine at position 206 (SEC ID NO: 8), comprising an amino acid sequence that has 80% identity with SEC ID NO: 2 and does not comprise a histidine at position 206, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein that has at least 80% identity with SEC ID NO: 2 but does not comprise a histidine at position 206. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but does not comprise a valine at position 228 (SEC ID NO: 9), comprising an amino acid sequence that has 80% identity with SEC ID NO: 2 and does not comprise a valine at position 228, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein that has at least 80% identity with SEC ID NO: 2 but does not comprise a valine at position 228. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but does not comprise a proline at position 233 (SEC ID NO: 10), comprising an amino acid sequence that has 80% identity with SEC ID NO: 2 and does not comprise a proline at position 233, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein that has at least 80% identity with SEC ID NO: 2, but does not comprise a proline at position 233. In any of these modalities, the size of the MetAPRes protein is the same as that of the MetAP protein as defined in SEC ID NO: 2 (286 amino acid residues). In one embodiment, the metAPR allele encodes a MetAPR protein comprising: a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but comprising an amino acid substitution selected from the group consisting of a lysine or equivalent amino acid at position 57, a proline or equivalent amino acid at position 153, a glutamic acid or equivalent amino acid at position 168, a glutamine or equivalent amino acid at position 206, an aspartic acid or equivalent amino acid at position 228, a glutamine or equivalent amino acid at position 233 and a leucine or equivalent amino acid at position 233; (b) an amino acid sequence having 80% identity with SEC ID NO: 2 and comprising an amino acid residue selected from the group consisting of a leucine or equivalent amino acid at position 57, a proline or equivalent amino acid at position 153, a glutamic acid or equivalent amino acid at position 168, a glutamine or equivalent amino acid at position 206, an aspartic acid or equivalent amino acid at position 228, a glutamine or equivalent amino acid at position 233, and a leucine or equivalent amino acid at position 233; or c) an amino acid sequence that is otherwise that of a MetAP variant protein having at least 80% identity with SEC ID NO: 2 (MetAP variant protein as defined herein), but comprising an amino acid substitution selected from the group consisting of a Ucine or equivalent amino acid at position 57, a proline or equivalent amino acid at position 153, a glutamic acid or equivalent amino acid at position 168, a glutamine or equivalent amino acid at position 206, an aspartic acid or equivalent amino acid at position 228, a glutamine or equivalent amino acid at position 233 and a leucine or equivalent amino acid at position 233. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a lysine or an equivalent amino acid therein at position 57, comprising an amino acid sequence that has 80% identity with SEC ID NO: 2 and comprising a lysine or an equivalent amino acid therein at position 57, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising a lysine or an equivalent amino acid therein at position 57. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a proline or proline-equivalent amino acid at position 153, comprising an amino acid sequence having 80% identity with SEC ID NO: 2 and comprising a proline or proline-equivalent amino acid at position 153, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising a proline or proline-equivalent amino acid at position 153. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a glutamic acid or an equivalent amino acid at position 168, comprising an amino acid sequence having 80% identity with SEC ID NO: 2 and comprising a glutamic acid or an equivalent amino acid at position 168, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising a glutamic acid or an equivalent amino acid at position 168. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a glutamine or equivalent amino acid at position 206, comprising an amino acid sequence having 80% identity with SEC ID NO: 2 and comprising a glutamine or equivalent amino acid at position 206, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising a glutamine or equivalent amino acid at position 206. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising an aspartic acid or an equivalent amino acid L? / «nn / Lznz / E / YiAi itself at position 228, comprising an amino acid sequence having 80% identity with SEC ID NO: 2 and comprising aspartic acid or an equivalent amino acid at position 228, or comprising an amino acid sequence that is otherwise that of a MetAP variant protein having at least 80% identity with SEC ID NO: 2, but comprising aspartic acid or an equivalent amino acid at position 228. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a glutamine or equivalent amino acid at position 233, comprising an amino acid sequence having 80% identity with SEC ID NO: 2 and comprising a glutamine or equivalent amino acid at position 233, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising a glutamine or equivalent amino acid at position 233. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a leucine or equivalent amino acid at position 233, comprising an amino acid sequence L? / «nn / Lznz / E / YiAi having 80% identity with SEC ID NO: 2 and comprising a leucine or an equivalent amino acid at position 233, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising a leucine or an equivalent amino acid at position 233. In any of these modalities, the size of the MetAPRes protein is the same as that of the MetAP protein as defined in SEC ID NO: 2 (286 amino acid residues). In one embodiment, the metAPR allele encodes a MetAPR protein comprising: a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but comprising an amino acid substitution selected from the group consisting of a glutamine at position 206, a lysine at position 57, a proline at position 153, a glutamic acid at position 168, an aspartic acid at position 228, a glutamine at position 233 and a leucine at position 233; these metAPR alleles encode the MetAPR proteins as set out in SEC ID NO: 4 and 11 to 16 respectively; b) an amino acid sequence having 80% identity with SEC ID NO: 2 and comprising an amino acid residue selected from the group consisting of a glutamine at position 206, a lysine at position 57, L? / «nn / Lznz / E / YiAi a proline at position 153, a glutamic acid at position 168, an aspartic acid at position 228, a glutamine at position 233 and a leucine at position 233; or c) an amino acid sequence that is otherwise that of a MetAP variant protein having at least 80% identity with SEC ID NO: 2 (MetAP variant protein as defined herein), but comprising an amino acid substitution selected from the group consisting of a lysine at position 57, a proline at position 153, a glutamic acid at position 168, a glutamine at position 206, an aspartic acid at position 228, a glutamine at position 233 and a leucine at position 233. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a lysine at position 57 (SEC ID NO: 11), comprising an amino acid sequence having 80% identity with SEC ID NO: 2 and comprising a lysine at position 57, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising a lysine at position 57. In one modality, the metAPR allele encodes a protein L? / «nn / Lznz / E / YiAi MetAPR comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a proline at position 153 (SEC ID NO: 12), comprising an amino acid sequence having 80% identity with SEC ID NO: 2 and comprising a proline at position 153, or comprising an amino acid sequence that is otherwise that of a MetAP variant protein having at least 80% identity with SEC ID NO: 2, but comprising a proline at position 153. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a glutamic acid at position 168 (SEC ID NO: 13), comprising an amino acid sequence that has 80% identity with SEC ID NO: 2 and comprising a glutamic acid at position 168, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising a glutamic acid at position 168. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a glutamine at position 206 (SEC ID NO: 4), comprising an amino acid sequence having 80% identity with SEC ID NO: 2 and comprising a glutamine at position 206, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising a glutamine at position 206. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising an aspartic acid at position 228 (SEC ID NO: 14), comprising an amino acid sequence having 80% identity with SEC ID NO: 2 and comprising an aspartic acid at position 228, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising an aspartic acid at position 228. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a glutamine at position 233 (SEC ID NO: 15), comprising an amino acid sequence having 80% identity with SEC ID NO: 2 and comprising a glutamine at position 233, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising a glutamine at position 233. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a leucine at position 233 (SEC ID NO: 16), comprising an amino acid sequence that has 80% identity with SEC ID NO: 2 and comprising a leucine at position 233, or comprising an amino acid sequence that is otherwise that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising a leucine at position 233. In any of these modalities, the size of the MetAPRes protein is the same as that of the MetAP protein as defined in SEC ID NO: 2 (286 amino acid residues). In one embodiment, the metAPR allele encodes a MetAPR protein obtained from a MetAP protein having a sequence as set out in SEC ID NO: 2, by an amino acid substitution selected from the group consisting of Q57K, L153P, A168E, H206Q, V228D, P233Q, and P233L. In another embodiment, the metAPR allele encodes a MetAPR protein obtained from a variant MetAP protein having at least 80% identity with SEC ID NO: 2, by an amino acid substitution selected from the group consisting of Q57K, L153P, A168E, H206Q, V228D, P233Q, and L157K. P233L. In one embodiment, the metAPR allele encodes a MetAPR protein that is obtained from a MetAP protein having a sequence as set out in SEC ID NO: 2 or from a variant MetAP protein as defined herein that has at least 80% identity with SEC ID NO: 2, by Q57K substitution. In one embodiment, the metAPR allele encodes a MetAPR protein that is obtained from a MetAP protein having a sequence as set out in SEC ID NO: 2 or from a variant MetAP protein as defined herein that has at least 80% identity with SEC ID NO: 2, by L153P substitution. In one embodiment, the metAPR allele encodes a MetAPR protein that is obtained from a MetAP protein having a sequence as set out in SEC ID NO: 2 or from a variant MetAP protein as defined herein that has at least 80% identity with SEC ID NO: 2, by A168E substitution. In one embodiment, the metAPR allele encodes a MetAPR protein that is obtained from a MetAP protein having a sequence as set out in SEC ID NO: 2 or from a variant MetAP protein as defined herein that has at least 80% identity with SEC ID NO: 2, by H206Q substitution. In one form, the metAPR allele encodes a protein MetAPR obtained from a MetAP protein having a sequence as set out in SEC ID NO: 2 or from a variant MetAP protein as defined herein having at least 80% identity with SEC ID NO: 2, by substitution V228D. In one embodiment, the metAPR allele encodes a MetAPR protein that is obtained from a MetAP protein having a sequence as set out in SEC ID NO: 2 or from a variant MetAP protein as defined herein that has at least 80% identity with SEC ID NO: 2, by P233Q substitution. In one embodiment, the metAPR allele encodes a MetAPR protein that is obtained from a MetAP protein having a sequence as set out in SEC ID NO: 2 or from a variant MetAP protein as defined herein that has at least 80% identity with SEC ID NO: 2, by P233L substitution. In any of these modalities, the size of the MetAPRes protein is the same as that of the MetAP protein as defined in SEC ID NO: 2 (286 amino acid residues). In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is truncated in its last quarter. The last quarter is understood to be the C-terminal portion of the MetAP protein comprising residues 215 to 286, where the amino acid sequence The amino acid sequence established in SEC ID NO: 2 is used for numbering. Therefore, in one embodiment, the metAPR allele encodes a MetAPR protein comprising a stop codon in a residue from residue 215 to residue 286, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising a stop codon in a residue from residue 226 to residue 286, wherein the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is truncated at its last quarter, wherein the MetAPR protein sequence has at least 80% identity with the corresponding portion of SEC ID NO: 2. By corresponding portion, the percentage of identity is understood to be calculated based on the alignment of the two sequences for the same amino acid range, starting from residue 1 to the stop codon position (for example, if the protein is truncated at position 226, the 80% identity of the MetAPR protein with SEC ID NO: 2 is calculated based on the alignment of the two sequences for residues 1 to 226). At least 80% identity with the corresponding portion of SEC ID NO: 2 is understood to mean at least 85%, at least 90%, at least 95%, at least 96%, etc. L? / «ηη / ίζηζ / E / γίΛΐ less than 97%, at least 98% and at least 99% with the corresponding part of SEC ID NO: 2. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a stop codon in its last quarter. In one modality, the stop codon is the result of an insertion and / or deletion of one or more nucleotides. In one embodiment, the stop codon results from a nucleotide substitution; in another embodiment, the metAPR allele encodes a MetAPR protein truncated at position 226 (i.e., possessing a stop codon at position 226), where the amino acid sequence established in SEC ID NO: 2 is used for numbering. In one embodiment, codon 226 of the metAPR allele TGA. In one embodiment, the metAPR allele encodes a MetAPR protein comprising an amino acid sequence that is otherwise as defined in SEC ID NO: 2 but comprising a stop codon at position 226 (SEC ID NO: 17), comprising an amino acid sequence having 80% identity with SEC ID NO: 2 and comprising a stop codon at position 226, or comprising an amino acid sequence that is otherwise that of a MetAP variant protein having at least 80% identity with SEC ID NO: 2 (MetAP variant protein as defined herein). L? / «nn / Lznz / E / YiAi document), but comprising a stop codon at position 226. In one embodiment, the metAPR allele encodes a MetAPR protein derived from a MetAP protein having a sequence as set forth in SEC ID NO: 2, wherein the glycine at position 226 is replaced by a stop codon. In another embodiment, the metAPR allele encodes a MetAPR protein derived from a variant MetAP protein as defined herein that has at least 80% identity with SEC ID NO: 2, wherein the glycine at position 226 is replaced by a stop codon. Amino acid numbering In the present invention, a specific numbering of amino acid residue positions is used for the characterization of the MetAP protein of the present invention. By aligning the amino acid sequence of a candidate MetAP protein, a MetAPRo protein, or a MetAP variant protein with the MetAP protein defined in SECTION 2, it is possible to assign a number to an amino acid residue position in the candidate MetAP protein, the MetAPRo protein, or the MetAP variant protein, respectively, that corresponds to the amino acid residue position or numbering in the amino acid sequence shown in SECTION 2. L? / «ηη / ίζηζ / Ε / γίΛΐ An alternative way of describing the amino acid numbering used in this application is to say that the amino acid positions are identified by those corresponding to a particular position in the amino acid sequence shown in SEC ID NO: 2. This should not be interpreted to mean that the sequences of the present invention must include the amino acid sequence shown in SEC ID NO: 2. A person skilled in the art will readily appreciate that the sequences of the MetAP protein vary among different bacterial strains. The reference to the amino acid sequence shown in SEC ID NO: 2 is used merely to allow the identification of a particular amino acid location within any particular MetAP protein. Such amino acid locations can be routinely identified using sequence alignment programs, the use of which is well known in the art. Lactic acid bacteria As used herein, the expression lactic acid bacteria or lactic acid bacteria” or LAB refers to Gram-positive bacteria that ferment sugars to produce exclusively or predominantly lactic acid. In one aspect, the present invention provides a lactic acid bacterium comprising a metAPR allele of the invention. In another aspect, the present invention provides a lactic acid bacterium comprising a polynucleotide of L? / «ηη / ίζηζ / Ε / γίΛΐ the invention. The most industrially useful lactic acid bacteria belong to the genera Streptococcus, Lactococcus, Lactobacillus, Leuconostoc, Pediococcus, Enterococcus, Oenococcus, and Bifidobacterium. Therefore, in some applications, it is preferable to select the lactic acid bacteria from this group of genera. In one embodiment, the lactic acid bacteria of the invention is of the genus Streptococcus. In one embodiment, the lactic acid bacteria of the invention is of the species Streptococcus thermophilus or Streptococcus mutans. In one embodiment, the lactic acid bacteria of the invention is of the species Streptococcus thermophilus. In one embodiment, the lactic acid bacterium of the invention can be modified to comprise a metAPR allele of the invention as described herein. As described above, comprising a metAPR allele means that the only allele of the metAP gene contained in the LAB genome is a metAPR allele. In one embodiment, the lactic acid bacterium of the invention comprises, as the only allele of its metAP gene, a metAPR allele of the invention. Such lactic acid bacteria can be modified by replacing the original allele of its metAP gene with a metAPR allele of the invention; the replacement can be made using conventional techniques as defined herein. In another form, the lactic acid bacteria can L? / «nn / Lznz / E / YiAi can be modified by a method comprising: a) exposing a parental BAL strain sensitive to an eos-type phage (reference strain) by means of the eos-type phage; b) select strains that have reduced sensitivity to the eos-type phage, wherein sensitivity to the eos-type phage is determined by the Plaque Formation Efficiency (PFE) Assay I; c) select from among the strains that have reduced sensitivity to the eos-type phage identified in step b), the strains that have a metAP allele whose sequence is different from the metAP allele of the parental BAL strain; and d) verify that the metAP allele of the strains identified in step c) is a metAPRtal allele as defined herein. A suitable protocol for exposing a strain to a phage in step a) is described in the Materials and Methods section. Reduced sensitivity (step b) is determined by the Plaque Formation Efficiency (PFE) Assay I, as defined herein, using the parental LAB strain as a reference strain. In one particular modality, reduced sensitivity is characterized by a reduction in PFE of at least 4 log, at least 5 log, at least 6 log, at least 7 log, or at least 8 log, when determined by PFE Assay I. The sequence difference between the metaP gene of the lj strains identified in step b) and the metaP gene of the parental strain can be determined by any conventional methods, such as DNA sequencing.In one particular modality, the verification step d) is carried out using a method to identify a metAPR allele that encodes a MetAPR protein as defined herein. In one embodiment, the method also comprises an additional step [step bl], between step b) and step c), which consists of comparing the CRISPR locus(s) of the strains identified in step b) and of the parental BAL strain, and selecting the strains whose CRISPR locus(s) have not been modified compared to the corresponding CRISPR locus(s) of the parental BAL strain. The comparison of CRISPR loci can be carried out by comparing the length of the CRISPR locus(s) or by sequencing the CRISPR locus(s). Step c) is then carried out on the strains selected by step bl). Bacteriophage As used herein, the term bacteriophage has its conventional meaning as understood in the art, namely, a virus that selectively infects bacteria. Many bacteriophages are specific to a particular genus, species, or strain of bacteria. The term bacteriophage is synonymous with the term phage. The definition of eos-type phages is technically based on the presence of a specific sequence (eos site) required for phage DNA packaging. Therefore, eos-type phages incorporate cohesive sticky ends into their genomes (eos site), unlike pac-type phages, which employ a DNA packaging system called headful and can thus incorporate additional redundant DNA into their genomes (pac site). Eos-type phages are known to infect bacterial species, including lactic acid bacteria, and can be identified based on their DNA packaging strategy or through genetic or genomic analyses. In S. thermophilus, eos and pac type phages (family Siphoviridae) are detailed in Le Marrec et al. (1997). A representative eos-type phage that infects Streptococcus thermophilus strains is phage DT1 (described herein). A representative eos-type phage that infects Streptococcus mutans strains is phage M102AD, described in Delisle et al. (2012). Phage M102AD is available from the Félix d'Hérelle Reference Center for Bacterial Viruses, under the reference HER503. The host strain for this phage is Streptococcus mutans HER1503, which is available from the Félix d'Hérelle Reference Center for Bacterial Viruses. L? / «ηη / ίζηζ / Ε / γίΛΐ reference HER1503. Polynucleotide In a further aspect, the present invention provides a polynucleotide comprising or consisting of a metAPR allele [encoding a MetAPR protein] of the invention. In one embodiment, the polynucleotide is a metAPR allele [encoding a MetAPR protein] of the invention. In one embodiment, the size of the polynucleotide of the invention is at least 843 nucleotides, at least 846 nucleotides, at least 849 nucleotides, at least 852 nucleotides, at least 855 nucleotides, at least 858 nucleotides, or at least 861 nucleotides. In another embodiment, the size of the polynucleotide of the invention is less than 3 kb, less than 2 kb, or less than 1 kb. In yet another embodiment, the size of the polynucleotide ranges from a minimum size selected from the group consisting of at least 843 nucleotides, at least 846 nucleotides, at least 849 nucleotides, at least 852 nucleotides, at least 855 nucleotides, at least 858 nucleotides, and at least 861 nucleotides to a maximum size selected from the group consisting of 1 kb, 2 kb, and 3 kb. In one form, the polynucleotide size is 858 or 861 nucleotides. In one embodiment, the polynucleotide of the invention consists of a metAPRtal allele as defined herein, independently flanked on one side (at the 5' and 3' ends) or on both sides by a nucleotide region that varies L? / «nn / Lznz / E / YiAi from 500 bp to 1 kb. Typically, the polynucleotide covered by the scope of the present invention is prepared using recombinant DNA techniques (i.e., recombinant DNA), as described herein. However, in an alternative embodiment of the invention, the polynucleotide could be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers MH et al., (1980) Nuc Acids Res Syrop Ser 215-23 and Horn T et al., (1980) Nuc Acids Res Symp Ser 225-232). A polynucleotide encoding a MetAPRtal protein, as defined herein, can be identified, isolated, and / or purified from any lactic acid bacteria. Various methods for the identification, isolation, and / or purification of polynucleotides are well known in the art. As an example, PCR amplification techniques can be used to prepare more copies of a polynucleotide once a suitable polynucleotide has been identified and / or isolated and / or purified. As a further example, a genomic DNA library can be constructed using chromosomal DNA from lactic acid bacteria that produce the MetAPR protein. Based on the MetAPR protein sequence, oligonucleotide probes can be synthesized and used to identify clones encoding the protein from the L? / «nn / Lznz / E / YiAi genomic library prepared from lactic acid bacteria. Alternatively, the polynucleotide encoding the MetAPR protein of the invention can be prepared synthetically using established conventional methods, for example, the phosphoramidite method described by Beucage SL et al., 1981, Tetrahedron Letters 22:1859-1869, or the method described by Matthes et al., 1984, EMBO J., 3:801-805. In the phosphoramidite method, oligonucleotides are synthesized, for example, in an automated DNA synthesizer, purified, hybridized, ligated, and cloned into appropriate vectors. The polynucleotide can be prepared by polymerase chain reaction (PCR) using specific primers, for example, as described in US document 4,683,202 or in Saiki RK et al., 1988, Science, 239:487-491. The polynucleotides and nucleic acids covered by the present invention can be substantially isolated or purified. Substantially isolated or purified means that the polynucleotides are substantially or essentially free of components normally found in association with the polynucleotide in its natural state. These components include other cellular material, recombinant production culture media, and various chemicals used in the chemical synthesis of nucleic acids. An isolated polynucleotide or nucleic acid is L? / «nn / Lznz / E / YiAi is usually free of nucleic acid sequences flanking the nucleic acid of interest in the genomic DNA of the organism from which the nucleic acid was derived (such as coding sequences present at the 5' or 3' ends). However, the molecule may include some additional bases or residues that do not adversely affect the basic characteristics of the composition. Vector The invention also relates to a vector comprising the polynucleotide of the invention. In one embodiment, this vector is a plasmid. In one embodiment, the vector contains one or more selection marker genes, such as a gene that confers antibiotic resistance, for example, resistance to ampicillin, kanamycin, chloramphenicol, or tetracycline. In another embodiment, the vector comprises a nucleotide sequence that allows the vector to replicate in the host cell. Examples of such sequences are the origins of replication of the plasmids pUC19, pACYC177, pUBl10, pE194, pAMBl, and pIJ702. A vector of the invention can be used to modify a lactic acid bacterium of the invention. Use and methods based on the polynucleotide or vector of the invention In one modality The invention relates to the use of a polynucleotide or vector of the invention to reduce the sensitivity of an eos-sensitive lactic acid bacterium to at least one eos-type phage. The lactic acid bacterium of the invention is not intended to comprise multiple alleles of the metAP gene. Therefore, the polynucleotide or vector is used such that the resulting lactic acid bacterium comprises in its genome one metAPR allele of the metAP gene. In one embodiment, the polynucleotide or vector is used such that the metAP gene allele of the original lactic acid bacterium is replaced by the polynucleotide of the invention; the replacement can be carried out using conventional techniques as defined herein. In one aspect, the invention relates to a method for preparing a strain of lactic acid bacteria having reduced sensitivity to at least one eos-type phage, comprising: a) provide a strain of lactic acid bacteria sensitive to eos-type phages (reference strain); b) replacing the metAP gene of the eos-type phage-sensitive lactic acid bacteria strain with a polynucleotide of the invention; and c) recover the strain or strains of lactic acid bacteria that have reduced sensitivity to at least one eos-type phage. L? / «ηη / ίζηζ / Ε / γίΛΐ In one embodiment, step b) consists of replacing the metAP gene of the eos-type phage-sensitive lactic acid bacteria strain with a polynucleotide consisting of a metAPR allele of the invention. In one aspect, the invention relates to a method for preparing a strain of lactic acid bacteria having reduced sensitivity to at least one eos-type phage, comprising: a) provide a strain of lactic acid bacteria sensitive to eos-type phages (reference strain); b) modifying the metAP gene of a strain of eos-type phage-sensitive lactic acid bacteria to have the same sequence as an allele of metAPR of the invention; and c) recover the strain or strains of lactic acid bacteria that have reduced sensitivity to at least one eos-type phage. In one of these two methods, the lactic acid bacteria is of the genus Streptococcus. In another method, the lactic acid bacteria is of the species Streptococcus thermophilus or Streptococcus mutans. In yet another method, the lactic acid bacteria is of the species Streptococcus thermophilus. Within the use or methods of the invention, the sensitivity of the lactic acid bacteria to the bacteriophage can be determined by calculating the plaque formation efficiency (PFE) in Plaque Formation Efficiency Assay I described in the L? / «ηη / ίζηζ / Ε / γίΛΐ present document. Reduction in sensitivity to eos-type phages is defined as a reduction in the EOP of at least 4 log, as determined by the EOP Assay I. In one modality, the reduction in EOP is at least 5 log. In one modality, the reduction in EOP is at least 6 log. In one modality, the reduction in EOP is at least 7 log. In one modality, the reduction in EOP is at least 8 log. Lactic acid bacteria comprising a polynucleotide of the invention The invention relates to a lactic acid bacterium comprising a polynucleotide of the invention. In an additional aspect, the invention relates to a lactic acid bacterium obtained by the use of the method of the invention. In one further aspect, the invention provides a lactic acid bacterium according to the invention produced by the method of the invention. The definition provided above in the lactic acid bacteria section applies similarly in this document. In one form, the lactic acid bacteria belongs to the genus Streptococcus. In another form, the lactic acid bacteria belongs to the species Streptococcus thermophilus or Streptococcus mutans. In yet another form, the lactic acid bacteria belongs to the LJ / Ann / Lznz / E / YIAI species Streptococcus thermophilus. In one embodiment, the lactic acid bacterium of the invention can be modified to comprise a polynucleotide of the invention. It is not contemplated that the lactic acid bacterium of the invention comprises multiple alleles of the metAP gene. In one embodiment, the lactic acid bacterium of the invention comprises, as the sole allele of its metAP gene, a polynucleotide of the invention. Such lactic acid bacteria can be modified by replacing the original allele of its metAP gene with a polynucleotide of the invention; the replacement can be performed using conventional techniques as defined herein. In one embodiment, the lactic acid bacterium of the invention is modified by a method for preparing a lactic acid bacterium strain as described herein. Bacterial composition The invention also relates to a bacterial composition comprising or consisting of at least one, preferably one, strain of lactic acid bacteria of the invention. In one particular embodiment, the lactic acid bacteria is Streptococcus thermophilus. In one embodiment, the bacterial composition is a pure culture, i.e., it comprises or consists of a single strain of lactic acid bacteria of the invention. In another embodiment, the bacterial composition is a mixed culture, i.e., it comprises or consists of the strain or strains of lactic acid bacteria of the invention and at least one other strain. L? / «ηη / ίζηζ / E / γίΛΐ bacterial. In one embodiment, the bacterial composition is a pure culture, i.e., it comprises or consists of a single strain of Streptococcus thermophilus of the invention. In another embodiment, the bacterial composition is a mixed culture, i.e., it comprises or consists of the strain or strains of Streptococcus thermophilus of the invention and at least one other bacterial strain. By at least one other bacterial strain, we mean one or more, and in particular, one, two, three, four, or five strains. Therefore, in one embodiment, a bacterial composition of the invention comprises or consists of the lactic acid bacteria strain or strains of the invention, such as the Streptococcus thermophilus strain or strains, and one or more additional lactic acid bacteria of the species selected from the group consisting of a Lactococcus species, a Streptococcus species, a Lactobacillus species including Lactobacillus acidophilus, an Enterococcus species, a Pediococcus species, a Leuconostoc species, a Bifidobacterium species, and an Oenococcus species, or any combination thereof. The Lactococcus species includes Lactococcus lactis, including Lactococcus lactis subsp. lactis, Lactococcus lactis subsp. cremoris, and Lactococcus lactis subsp. lactis biovar diacetylactis. Bifidobacterium species include Bifidobacterium animalis, in particular Bifidobacterium animalis subsp lactis.Other species of lactic acid bacteria include Leuconostoc sp., Streptococcus thermophilus, Lactobacillus delbrueckii subsp. bulgaricus, and Lactobacillus helveticus. In one embodiment, the bacterial composition comprises or consists of the Streptococcus thermophilus strain(s) of the invention, and at least one strain of Streptococcus thermophilus, different from the Streptococcus thermophilus strain(s) of the invention, and / or at least one strain of the Lactobacillus species, and / or any combination thereof. In a particular embodiment, the bacterial composition comprises or consists of the Streptococcus thermophilus strain(s) of the invention, one or more strains of the Lactobacillus delbrueckii subsp. bulgaricus species, and / or one or more strains of the Lactobacillus helvéticas species, and / or any combination thereof, and optionally at least one strain of Streptococcus thermophilus, different from the Streptococcus thermophilus strain(s) of the invention.In one particular embodiment, the bacterial composition comprises or consists of the Streptococcus thermophilus strain or strains of the invention, at least one strain of the Streptococcus thermophilus species different from the Streptococcus thermophilus strain or strains of the invention, and a strain of the Lactobacillus delbrueckii subsp. bulgaricus species. In another particular embodiment, the bacterial composition comprises or consists of the Streptococcus thermophilus strain or strains of the invention, and a strain of the... L? / «ηη / ίζηζ / Ε / γίΛΐ species Lactobacillus delbrueckii subsp. bulgaricus. In one embodiment, the bacterial composition comprises or consists of the lactic acid bacteria strain(s) of the invention, a Lactococcus lactis subsp. lactis and / or a Lactococcus lactis subsp. cremoris. In one embodiment, the bacterial composition comprises or consists of the Streptococcus thermophilus strain(s) of the invention, a Lactococcus lactis subsp. lactis and / or a Lactococcus lactis subsp. cremoris. In a particular modality of any bacterial composition defined herein, whether as a pure or mixed culture, the bacterial composition further comprises at least one probiotic strain such as Bifidobacterium animalis subsp. lactis, Lactobacillus acidophilus, Lactobacillus paracasei, or Lactobacillus casei. In one particular embodiment, the bacterial composition, whether as a pure or mixed culture as defined above, is in frozen, dried, freeze-dried, liquid, or solid form, in the form of granules or frozen pellets, or as a powder or dry powder. In one particular embodiment, the bacterial composition of the invention is in a frozen form or in the form of granules or frozen pellets, in particular, contained in one or more boxes or sachets. In another embodiment, the bacterial composition as defined herein is in powder form, such as a powder L7 / Ann / Lznz / E / YIAI dry or freeze-dried, in particular, contained in one or more boxes or sachets. In one particular embodiment, the bacterial composition of the invention, whether in the form of a pure culture or a mixed culture as defined above, and regardless of the format (frozen, dried, lyophilized, liquid, or solid, in the form of granules or frozen granules, or in a powder or dry powder), comprises the lactic acid bacteria strain or strains of the invention at a concentration in the range of 10⁵ to 10¹² CFU (colony-forming units) per gram (CFU / g) of the bacterial composition. In one particular embodiment, the concentration of the lactic acid bacteria strain or strains within the bacterial composition of the invention is in the range of 10⁷ to 10¹² CFU per gram of the bacterial composition, and, in particular, at least 10⁷, at least 10⁸, at least 10⁹, at least 10¹⁰, or at least 10¹¹ CFU / g of the bacterial composition.In one particular embodiment, when in the form of a frozen or dried concentrate, the concentration of the lactic acid bacteria strain or strains of the invention, in the form of a pure culture or in the form of a mixed culture, within the bacterial composition is in the range of 108 to 1012ufe / g of frozen concentrate or dried concentrate, and more preferably at least 108, at least 109, at least 1010, at least 1011 or at least 1012ufe / g of frozen concentrate or dried concentrate. In one particular embodiment, the bacterial composition of the invention, whether in the form of a pure culture or a mixed culture as defined above, and regardless of the format (frozen, dried, lyophilized, liquid, or solid, in the form of granules or frozen granules, or in a powder or dry powder), comprises the Streptococcus thermophilus strain or strains of the invention at a concentration in the range of 10⁵ to 10¹² CFU (colony-forming units) per gram of the bacterial composition. In one particular embodiment, the concentration of the Streptococcus thermophilus strain or strains within the bacterial composition of the invention is in the range of 10⁷ to 10¹² CFU per gram of the bacterial composition and, in particular, at least 10⁷, at least 10⁸, at least 10⁹, at least 10¹⁰, or at least 10¹¹ CFU / g of the bacterial composition.In a particular embodiment, when in the form of a frozen or dried concentrate, the concentration of the strain or strains of Streptococcus thermophilus, in the form of a pure culture or in the form of a mixed culture, in the bacterial composition is in the range of 108 to 1012ufe / g of frozen concentrate or dried concentrate, and more preferably at least 108, at least 109, at least 1010, at least 1011 or at least 1012ufe / g of frozen concentrate or dried concentrate. In any modality, whatever the number and nature of the strains, the format of the composition and the L? / «ηη / ίζηζ / Ε / γίΛΐ concentration of the strain or strains, the bacterial composition further comprises a component acceptable for feeding. In a further aspect, a method for manufacturing a fermented product is provided, comprising: a) inoculating a substrate with the lactic acid bacteria or bacterial composition according to the invention, and b) fermenting the inoculated substrate to obtain a fermented product. In one particular embodiment, the lactic acid bacteria strain or strains of the invention are inoculated in the form of a bacterial composition as defined herein, such as a pure culture or a mixed culture. Preferably, the substrate is a milk substrate, more preferably milk. "Milk substrate" means milk of animal and / or vegetable origin. In one particular embodiment, the milk substrate is of animal origin, specifically from any mammal, such as a cow, goat, sheep, buffalo, zebra, horse, donkey, or camel, and the like.The milk may be in its native state, reconstituted milk, skimmed milk, or milk supplemented with compounds necessary for bacterial growth or for further processing of the fermented milk. Preferably, the milk substrate comprises solid elements. Preferably, the solid elements comprise or consist of fruits, chocolate products, or cereals. Preferably, the fermented product is a fermented dairy product. Therefore, in a particular embodiment, the... The invention also provides a method for manufacturing a fermented dairy product, comprising: a) inoculating a milk-type substrate with the Streptococcus thermophilus strain or bacterial composition of the invention and b) fermenting the inoculated milk substrate to obtain a fermented dairy product. The present invention also provides, in an additional aspect, the use of the lactic acid bacteria or bacterial composition according to the present invention to manufacture a food product or feed, preferably a fermented dairy product. The invention also relates to a fermented dairy product obtained using the lactic acid bacteria strain or bacterial composition of the invention, particularly obtained or obtainable by the method of the invention. Therefore, the invention relates to a fermented dairy product comprising the lactic acid bacteria strain or strains of the invention. Preferably, the fermented dairy product comprises the Streptococcus thermophilus strain or strains of the invention. In one particular embodiment, the fermented dairy food product of the invention is fresh fermented milk. Product Any product that is prepared from, contains, or comprises a lactic acid bacterium or bacterial composition L? / «nn / Lznz / E / YiAi of the invention is contemplated in accordance with the present invention. Suitable products include, but are not limited to, a food product or feed. These include, but are not limited to, fruits, pulses, forage crops and vegetables, including derived products, grains and grain-derived products, dairy foods and dairy-derived products, meat, poultry, and seafood. Preferably, the feed product is a dairy, meat, or cereal product. The term "food" is used in a broad sense and includes feed, food products, food ingredients, food supplements, and functional foods. In this document, the term "food" is used in a broad sense and encompasses both food for human consumption and feed (i.e., animal feed). In a preferred aspect, food is for human consumption. As used herein, the term food ingredient includes a formulation that is added or may be added to food and includes formulations that can be used at low levels in a wide variety of products that require, for example, acidification or emulsification. As used herein, the term functional food refers to a food that is capable of providing not only a satisfactory nutritional effect and / or flavor, but is also capable of delivering an additional health benefit to consumers. Although there is no legal definition of a functional food, most stakeholders in this area agree that they are foods marketed as having specific health effects. The lactic acid bacteria of the present invention can be, or can be added to, a food ingredient, a food supplement, or a functional food. The food may be in the form of a solution or as a solid, depending on the use and / or the method of application and / or the method of administration. The lactic acid bacteria of the present invention can be used in the preparation of food products such as confectionery products, dairy products, meat products, poultry products, fish products or bakery products. For example, the bacteria can be used as an ingredient to prepare soft drinks, fruit juice or a beverage comprising whey protein, teas, cocoa drinks, dairy drinks and lactic acid bacteria drinks, yogurt, drinkable yogurt and wine. Preferably, a food as described herein is a dairy product. More preferably, a dairy product as described herein is one or more of the following: yogurt, cheese (such as cottage cheese, hard cheese, semi-hard cheese, or cottage cheese), whey, quark, sour cream, kefir, fermented whey-based beverage, koumiss, dairy beverage, yogurt beverage, fermented milk, ripened cream, cheese, fresh cheese, milk, dairy product concentrate, processed cheese, cream dessert, or infant formula. Preferably, a food as described herein is a fermented food product. More preferably, a food as described herein is a fermented dairy product, such as fermented milk, yogurt, cream, ripened cream, cheese, fresh cheese, a dairy beverage, processed cheese, a cream dessert, cottage cheese, a yogurt drink, a dairy concentrate, or infant formula. Preferably, the dairy product according to the invention comprises milk of animal and / or vegetable origin. Milk is understood to mean milk of animal origin, specifically from any mammal such as cows, goats, sheep, buffalo, zebras, horses, donkeys, camels, and similar animals. The term "milk" also applies to what is commonly called plant-based milk, that is, extracts of treated or untreated plant matter, such as legumes (soybeans, chickpeas, lentils, and similar plants) or oilseeds (rapeseed, soybeans, sesame, cottonseed, and similar plants). This extract contains proteins in solution or colloidal suspension, which can be coagulated by chemical action, acid fermentation, and / or heat. Finally, the word "milk" also refers to mixtures of animal and plant-based milks. In one embodiment, the term milk refers to commercial UHT milk supplemented with 3% (w / w) of semi-skimmed milk powder pasteurized by heating for 10 min + / - 1 min at 90 °C + / - 0.2 °C. Amino acid equivalents in the sequence of the MetAPR proteins of the invention In one embodiment, the MetAPR proteins of the invention are characterized by comprising an amino acid selected from the group consisting of a lysine or equivalent amino acid at position 57, a proline or equivalent amino acid at position 153, a glutamic acid or equivalent amino acid at position 168, a glutamine or equivalent amino acid at position 206, an aspartic acid or equivalent amino acid at position 228, a glutamine or equivalent amino acid at position 233, and a leucine or equivalent amino acid at position 233. An equivalent amino acid of the same means any amino acid that has similarity in terms of polarity, charge, solubility, hydrophobicity, hydrophilicity and / or the amphipathic nature of the residues, provided that the metAPR allele encoding this MetAPR protein reduces sensitivity to phage DT1 (as defined herein), when inserted in place of the metAP gene allele of the Streptococcus thermophilus strain SMQ-301, wherein sensitivity to phage DT1 is determined by the Efficiency Plaque Formation (EPF) Assay I. In one modality, an amino acid equivalent to lysine is selected from the group consisting of glutamic acid, aspartic acid, and arginine. In one modality, an amino acid equivalent to proline is selected from the group consisting of alanine and chitin. In one modality, an amino acid equivalent to glutamic acid is selected from the group consisting of aspartic acid and lysine. In one modality, an amino acid equivalent to glutamine is selected from the group consisting of asparagine and serine. In one modality, an amino acid equivalent to aspartic acid is selected from the group consisting of glutamic acid and lysine. In one modality, an amino acid equivalent to a leucine is selected from the group consisting of methionine, valine, isoleucine, and phenylalanine. Percentage of identity of the MetAP protein The alleles of metAP, which 1) encode a MetAP protein L? / «ηη / ίζηζ / E / γίΛΐ whose sequence has at least 80% identity with SEC ID NO: 2, and 2) do not reduce EOP or reduce EOP by less than 3 log, wherein sensitivity to phage DT1 is determined by Plaque Formation Efficiency (EOP) Assay I, are defined herein as metAP variant alleles (encoding metAP variant proteins). A percentage of identity of at least 80% with SEC ID NO: 2 means a percentage of identity selected from the group consisting of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99%. In one modality, although the sequence of the variant MetAP protein is different from SEC ID NO: 2, the size of the variant MetAP protein is the same as that of the MetAP protein as defined in SEC ID NO: 2 (286 amino acid residues). The metAP alleles, which 1) encode a MetAP protein whose sequence has at least 80% identity with SEC ID NO: 2, and 2) reduce the sensitivity to DT1 phage of a Streptococcus thermophilus SMQ-301-derived strain by at least 4 log [the SMQ-301-derived strain being a Streptococcus thermophilus SMQ-301 strain in which its metAP allele has been replaced by a metAP allele], wherein sensitivity to DT1 phage is determined by the Efficiency Plaque Formation (EPF) Assay I, are defined herein as metAPR alleles (which encode MetAPR proteins). An identity percentage of at least 80% with SEC ID NO: 2 means an identity percentage selected from the group consisting of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99%.In one modality, although the sequence of the MetAPRes protein is different from SEC ID NO: 2, the size of the MetAPRes protein is the same as that of the MetAP protein as defined in SEC ID NO: 2 (286 amino acid residues). Sequence comparisons can be performed visually or, more commonly, with the help of readily available sequence comparison software. These software programs, available commercially or free of charge, can calculate the similarity or identity values ​​between two or more sequences. A percentage of identity can be calculated on aligned and contiguous sequences; that is, one sequence is aligned with respect to another sequence, and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called gapless alignment. Typically, such gapless alignments are performed only along a relatively short number of residues. Although this method is very simple and consistent, it fails to consider that, for example, in another pair of otherwise identical sequences, an insertion or deletion will cause downstream amino acid residues to be excluded from the alignment, potentially resulting in a significant reduction in identity when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that account for possible insertions and deletions without excessively penalizing the overall identity score. This is achieved by inserting gaps into the sequence alignment to try to maximize local identity.These more complex methods assign gap penalties to each gap that occurs during alignment. Therefore, for the same number of identical amino acids, a sequence alignment with the fewest possible gaps (reflecting a closer relationship between the two sequences being compared) will achieve a higher score than one with many gaps. Affine gap costs are commonly used, assigning a relatively high cost to the existence of a gap and a smaller penalty for each subsequent residue within the gap (gap extension penalty). This is the most common gap scoring system. Obviously, high gap penalties will produce optimized alignments with fewer gaps. Most alignment programs allow modification of gap penalties. However, it is possible to use the default values ​​when using such software for sequence comparisons, as these default values ​​have been adjusted to provide relevant results in most cases. Therefore, calculating the maximum percent identity requires, first and foremost, producing an optimal alignment that takes into account gap penalties. A suitable software program for performing alignment is Vector NTI (Invitrogen Corp.). An example of software that can perform sequence comparisons includes, but is not limited to, the BLAST package (see Ausubel et al., 1999, Short Protocol in Molecular Biology, 4th Ed. Chapter 18). Although alignment quality can be measured in terms of identity, the alignment process itself is not usually based on an all-or-nothing pairwise comparison. Instead, a graded similarity scoring matrix is ​​generally used, assigning scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a commonly used matrix is ​​the BLOSUM62 matrix (the default matrix for the BLAST suite of programs). Vector NTI programs generally use the public default values ​​or a custom symbol comparison table if one is supplied (see the user manual for details). Alternatively, the percentage of similarity can be calculated using the multiple alignment function in Vector NTI (Invitrogen Corp.), which is based on an algorithm analogous to CLUSTAL (Higgins DG and Sharp PM (1988), Gene 73(1), 237-244). Once the software has produced an optimal alignment, it is possible to calculate a sequence similarity percentage, preferably a sequence identity percentage. The software program typically performs this as part of the sequence comparison and generates a numerical result. In one modality, the degree of identity with respect to a protein (amino acid) sequence is determined over at least 50 contiguous amino acids, at least 100 contiguous amino acids, at least 150 contiguous amino acids, at least 200 contiguous amino acids, or at least 250 contiguous amino acids. In one modality, the degree of identity with respect to an amino acid or protein sequence can be determined over the entire sequence of the SEC ID NO: 2. In one modality, the sequences [a candidate sequence of a variant protein MetAPRy the SEC ID NO: 2] are aligned using a global alignment program and the sequence identity is calculated by identifying the number of exact matches identified by the program divided by the length of the candidate sequence. In one modality, the degree of sequence identity between a candidate sequence of a variant MetAPRy protein and SEC ID NO: 2 is determined by: 1) aligning the two sequences using any suitable alignment program, using the scoring matrix and the default gap penalties, 2) identifying the number of exact matches, where an exact match is when the alignment program has identified an identical amino acid in the two aligned sequences at a given position in the alignment, and 3) dividing the number of exact matches by the length of the candidate sequence. In one mode, the global alignment program is selected from the group consisting of CLUSTAL and BLAST, in particular CLUSTAL, using the default parameters, and the sequence identity is calculated by identifying the number of exact matches identified by the program divided by the length of the sequence in question. In one approach, the global alignment program is CLUSTAL using the default parameters, and sequence identity is determined using BioEdit software (http: / / www.mbio.ncsu.edu / BioEdit / bioedit.html) [by selecting the Sequence drop-down menu, then selecting the Pairwise Alignment submenu, and then selecting the Calculate Identity / Similarity for Two Sequences menu option]. General recombinant DNA methodology techniques The present invention employs, unless otherwise indicated, conventional techniques of biochemistry and biology. L? / «nn / Lznz / E / YiAi molecular, microbiology, and recombinant DNA, which are within the capabilities of an expert in the technique. Such techniques are explained in the bibliography. See, for example, J. Sambrook, E.F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, second edition, books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F.M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, chapters 9, 13, and 16, John Wiley & Sons, New York, NY); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; M.J. Gait (Editor), 1984, Polynucleotide Synthesis: A Practical Approach, Irl Press; and DMJ Lilley and JE Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press. Each of these general texts is incorporated into this document by reference. The invention will now be further described by way of Examples, which are intended to assist a person skilled in the art in carrying out the invention and are not intended in any way to limit the scope of the invention. EXAMPLES Materials and methods Bacterial growth and phage propagation The bacterial strains, phages, and plasmids are listed in Table 1. S. thermophilus was cultured at 37 °C or 42 °C in M17 medium (Oxoid, Nepean) supplemented with 0.5% lactose (LM17). When necessary, chloramphenicol (Sigma, Oakville) was added to a final concentration of 5 pg / ml for the growth and selection of S. thermophilus strains containing pNZ123 (De Vos et al. 1987) and derivatives. Agar (LabMat, Quebec) was added to a final concentration of 1% for solid medium. Escherichia coli was cultured with shaking at 37 °C in Luria broth (LB) supplemented with 30 pg / ml kanamycin and 20 pg / ml chloramphenicol for selection. Streptococcus mutans HER1503 was cultured at 37 °C and 5% CO2 in Brain-Heart Infusion (BHI, Difeo), supplemented with 10 pg / ml chloramphenicol when pNZ123+ cells were selected. Phages were propagated as previously described (Hynes et al., 2017). Isolation of bacteriophage-insensitive mutants Bacteriophage-insensitive (BI) mutants were isolated using the soft agar overlap assay as previously described (Hynes et al., 2017). Briefly, the wild-type host S. thermophilus SMQ-301 was exposed to phage DT1. The bacterial host was cultured on LM17 at 42 °C until the optical density at 600 nm (DChoonm) reached 0.6. Then, 300 μA of the culture was added to 3 mL of molten LM17 soft agar supplemented with calcium chloride (10 mM), and phage DT1 was added to achieve a multiplicity of infection (MDI) of 0.1. The plates were incubated at 42 °C for L? / «ηη / ίζηζ / Ε / γίΛΐ h. The resulting colonies were streaked onto 1% LM17 + agar and screened for spacer acquisition at the CR1 and CR3 loci using the CR1dir and CR1-invLargo primers for the CR1 locus and the CR3-dir and CR3-inv primers for the CR3 locus (Hynes et al., 2017). When spacer acquisition was not detected in CRISPR arrays, the MIBs were preserved for genomic sequencing. L? / «nn / Lznz / E / YiAi Table 1. Plasmids, bacterial strains and phages used in the examples. Plasmids pNZ123 Vector lanzadera de E. col!, L. lactis and S. thermophilus pNZ123:meMP pNZ123 with the metAP gen as established in the SEC ID NO: 1, cloned on the Xbal site pNZ123:MetAPH2°6Q pNZ123 with the metAPH206Q gen (SEC ID NO: 3) cloned on the Xbal site pNZ123:MetAPSmut pNZ123 with the metAPde gen S. mutans HER 1503, cloned on the Xbal site Cepas bacterianas S. thermophilus SMQ-3011 Cepa hospedadora de phagos de type eos DT1 y MD2; S. thermophilus SMQ-1039 S. thermophilus SMQ-301 :MetAPH206Q S. thermophilus SMQ-1040 S. thermophilus SMQ-1039 + pNZ123:meMP S. thermophilus DGCC7710 Cepa hospedadora de fagos pac 858,2972, D3288,4259, D4752, D4754 and D939 and eos-type phages D5691, D5913, D6037, D6215 S. thermophilus SMQ-1041 S. thermophilus DGCC7710 + pNZ123:meMP S. thermophilus SMQ-1042 S. thermophilus SMQ-1041 + pNZ123:meMP S. thermophilus DGCC7796 Host strain of eos-type phages D4090, D5821, D4807 and pac-type phages D2765, D4274, D5787, D5876 S. thermophilus SMQ-1041 S. thermophilus DGCC: thermophilus SMQ-1042 S. thermophilus SMQ-1041 + pNZ123:mefAP S. thermophilus DGCC782 Host strain of eos-type phages N1032, N1117, N1119, N1169, N1358, N382. thermophilus DGCC782:MetAPH206Q S. thermophilus SMQ-1044 S. thermophilus SMQ-1043 + pNZ123:meMP S. mutans HER 1503 Eos-type phage host strain M102AD (metAP allele as defined in SEC ID NO: 18). mutans HER 1503 mapjnut S. mutans HER 1503:MetAPH206Q (allele of metAP as defined in the SEC ID NO: 20) S. mutans HER 1503 mm+m eos DT11,MD2 Host S. thermophilus SMQ-301; D2765, D4274, D5787 M5876, Host S. thermophilus DGCC7796 D5691, D5913, D6037, D6215 Host S. thermophilus.S. thermophilus DGCC7710 N1032, N1117, N1119, N1169, N1358, N3782 Host S. thermophilus DGCC782 pac-type phages 858, 2972, 4259, D939, D3288, D4752, D4754 Host S. thermophilus DGCC7710 D4090, D4807, D5821 Host S. thermophilus DGCC7796 eos-type phage of S. mutans M102AD Host S. mutans HER 1503. lj / «ηη / ίζηζ / Ε / γίΛΐ 1. SMQ-301 and the DT1 phage are available at the Félix d'Hérelle Reference Centre for Bacterial Viruses, with the reference HER 1368 and HER 368, respectively. Isolation, sequencing and bioinformatics analysis of DNA Genomic DNA from MIBs was extracted as previously described (Bissonnette et al., 2000). Genomes were sequenced using the Illumina MiSeq platform. Libraries were prepared using the Nextera XT DNA Sample Preparation Kit according to the manufacturer's instructions and sequenced using MiSeq regents (2 x 250 nt paired end). Average coverage ranged from 6.8 to 80.1 times. Reads obtained for the genomes of nine MIBs were aligned to the S. thermophilus SMQ-301 genome (Labrie et al., 2015) using Novoalign (http: / / www.novocraft.com) with default settings. Mutations were extracted from the alignment file using SAMTools (Li et al., 2009). Internal Python scripts were used to map the mutation in the bacterial genome and translated into protein sequences. Mutations with the highest scores provided by SAMTools were considered first. Trials of supplemented The S. thermophilus strain SMQ-301:MetAPH206Q was supplemented with the metAP allele as described in SEC ID NO: 1 (metAP allele of SMQ-301). First, the metAP lj / «ηη / ίζηζ / E / γίΛΐ allele as described in SEC ID NO: 1 was cloned into pNZ123 using the Gibson assembly. The pNZ123 vector was linearized with Xbal (Roche) according to the manufacturer's instructions. The insert was amplified with primers SJL154 and SJL155 using high-fidelity DNA polymerase Q5 (NEB). Both primers had 30-nt extensions that complemented the 3' and 5' ends, respectively, of the linearized vector. An insert-to-vector ratio of 3:1 was used for assembly. The master mix for the Gibson assembly was prepared as described above (Gibson et al., 2009). The resulting build was transformed into E.Neb5a coli were cultured according to the manufacturer's instructions, and clones were selected on LB medium supplemented with 1% agar and 25 pg / ml chloramphenicol. One clone was confirmed by Sanger sequencing (ABI 3730x1) at the Genome Sequencing and Genotyping Platform of the CHUL Center. Plasmid DNA was extracted using a QIAprep Spin Miniprep kit (Qiagen) and transformed into S. thermophilus (Hynes et al., 2017). Clones were selected by spreading the transformation mixture on LM17 medium supplemented with 1% agar and 5 pg / ml chloramphenicol. Targeted and random mutagenesis The metAP allele with the desired mutation was amplified by PCR using primers SJL128 and SJL130 (Table 2). At least 10 PCR reactions of 50 pl were performed for each The L? / «ηη / ίζηζ / E / γίΛΐ mutation was present in the screened clone. The sequence of the SJL154 and SJL155 primers used for screening the transformants is listed in Table 2. For random mutagenesis, the same protocol was used as for directed mutagenesis, with the sole exception that the present inventors added MnSCg (10 μM final) and used the DT1 phage for the selection of resistant clones. L? / «nn / Lznz / E / YiAi Table 2. List of primers (*: described in Hynes et al. 2017) Primer Sequence 5'-3' Function SJL128 TCAATCTACTCAAGGTATGAATCA Natural transformation of metAP SJL130 GTCAGTAGTAGTGGTCAAGA SJL150 AGTTCCTGATAGGTCGCATT Mutation detection in metAP CAGCAGCGGCCTGGTGCCGCGCGGCAGCCAAATGAT Cloning of metAP enpNZ123 TACACTGAAATCAGCACGTG SJL155 GCCGGATCTCAGTGGTGGTGGTGGTGGTGCTTAATA AGTTCTTTCTTCCCCTTGAG SJL160 ATTACAGCTCCAGGATCCAGCTGACTGATTGATTGATTGATT Cloning of mutated metAP from S. mutans enpNZ123 SJL161 ATTGGGTTCTTCCTGCATGGTTGG SJL162 CCAACCATGCAGGAAGAACCCAAT SJL163 GAAAATATGCACTCGAGAAGCTTGAGCTCTCCGAAGG TGGACAACATA4GCCM_1GCATA5 GAATTCGAATTCAAAGGCTGTTGTGACAGCAA Cloning of S. mutans metAP into pNZ123 CM_146 CTCGAGCTCGAGTTAATAAGTCCCTTCTTGACCC CR1-dir* TGCTGAGACAACCTAGTCTCTC Locus Screening CR1 CR1- invLong * TAAACAGAGCCTCCCTATCC CR3-dir* CTGAGATTAATAGTGCGATTACG Locus Screening CR3 CR3-inv* GCTGGATATTCGTATAACATGTC Directed mutagenesis of metAP in Streptococcus mutans The metAP gene allele was amplified from S. mutans HER1503 using two sets of primers containing the desired mutation (MetAPH206Q). The two sets of primers (SJL160 and SJL161, as well as SJL162 and SJL163) generated two overlapping amplicons, with the mutation in the overlapping region. The two fragments were purified using the QIAquick PCR purification kit (Qiagen) and fused by Gibson assembly (Gibson et al., 2009). PCR was then performed on the Gibson assembly sample using primers SJL160 and SJL163 to amplify the fused fragments. After purification using the QIAquick PCR purification kit, the mutated metAP amplicon was transformed into S. mutans HER1503 by natural transformation. The competition-stimulating peptide (CSP) ordered from Biomatik was added to 500 μA of an exponentially growing S. mutans culture (DOeoonm of 0.1) at a concentration of 1 μM along with 1 pg of purified mutated metAP amplicon (Dufour et al., 2011). The culture was incubated overnight at 37 °C with 5% CO2, then mixed with the virulent phage M102AD on ICC supplemented with 0.7% agar and plated on ICC supplemented with 1% agar. The metAP allele in the surviving derivative was amplified by PCR using primers SJL160 and SJL163 and sequenced to confirm the presence of the mutation. For the complementation of the MIB S. mutans HER1503:MetAPH206Q, the metAP allele from S. mutans HER1503 was cloned into pNZ123. pNZ123 was linearized using Xhol and EcoRI to remove the 24 base pairs between the two sites, and the resulting plasmid was purified using the QIAquick Gel Extraction Kit (Qiagen). The metAP allele was amplified from S. mutans HER1503 using primers CM_145 and CM_146 to generate the gene, flanked by Xhol and EcoRI restriction sites. The PCR sample was purified using the QIAgen PCR Purification Kit, cleaved using Xhol and EcoRI, and ligated into the linearized pNZ123 using T4 DNA ligase. The insert-to-vector molar ratio used during ligation was 3:1. The bound plasmid was transformed into E. coll NEB5a according to the manufacturer's instructions and plated onto solid LB medium supplemented with chloramphenicol 25 pg / ml.Amplification of the metAP allele using primers CM_145 and CM_146 and sequencing confirmed the cloned sequence in the complementation plasmid. The plasmid DNA was extracted. L? / «ηη / ίζηζ / Ε / γίΛΐ 100 using a QIAprep Spin Miniprep kit and transformed into S. mutans HER1503:MetAPH206Q. The strain was cultured on ICC until reaching a DOgoonm of 0.1, a 500 µA aliquot was exposed to 1 µM PEC and transformed with 1 pg of the complementation plasmid. After an incubation period of 2.5 hours at 37 °C with 5% CO2, the culture was plateped on ICC + 1% agar supplemented with 10 pg / ml chloramphenicol. Mutation stability assay To test the stability of the H206Q mutation, the present inventors inoculated (1%) the S. thermophilus strains SMQ-301 and DGCC7796 and their respective mutants [SMQ301:MetAPH206Q and DGCC7796:MetAPH206Q] into 10 ml of M17 medium (Nutri-Bact) and into reconstituted milk (10% skimmed dry milk). The strains were incubated at 42 °C during the day. A 1% inoculum was then transferred to fresh medium or milk and incubated at 37 °C overnight. After 9 transfers (5 days, 4 nights) corresponding to approximately 60 generations, the present inventors randomly selected 10 colonies from each of the four strains and tested them for sensitivity to phage DT1 (eos) for S. thermophilus SMQ-301 and S. thermophilus SMQ301:MetAPH206Q, and to phages D4090 (eos) and D4274 (pac) for S. thermophilus DGCC7796 and S. thermophilus DGCC7796:MetAPH206Q. Sequencing of the metAP and CR1 genes was performed on the colonies. L? / «nn / Lznz / E / YiAi 101 SMQ-301 and SMQ-301:MetAPH206Q with the primers SJL128 / SJL130 and CRl-dir / CRl-inv to confirm the presence of the mutation after transfers and the identity of the strain. Example 1 A mutation in the gene that codes for methionine aminopeptidase reduces sensitivity to phages. Several S. thermophilus SMQ-301 MIBs with reduced sensitivity to phage DT1 were isolated according to the protocol described earlier in the section titled Isolation of bacteriophage-insensitive mutants. Over 95% of the MIBs had acquired novel spacers targeting the DT1 phage genome at their CRISPR loci. Nine SMQ-301 MIBs that had not acquired novel spacers were selected, based on the hypothesis that they had a mutation elsewhere in the bacterial genome conferring reduced sensitivity to DT1 phage. The genomes of these nine non-CRISPR MIBs were sequenced. By comparing these sequences with the S. thermophilus SMQ-301 genome (Labrie et al., 2015), several mutations were discovered. Although many of these mutations could potentially be involved in phage infection, the same mutation (T->G) occurred at position 618 of the metaAP gene in three of the nine MIBs.This gene encodes methionine aminopeptidase (MetAP), and the mutation induces an amino acid substitution from histidine to glutamine at position 206 in the MetAP protein (H206Q). LJ / Ann / Lznz / E / YIAI 102 BLAST searches indicated that this histidine is conserved in all analyzed MetAP protein sequences. Although the S. thermophilus MetAP protein has not been previously studied, it shares 89% identity and 96% similarity with the Streptococcus pneumoniae TIGR4 MetAP protein, which has been characterized, even at the structural level (PDB 4KM3) (Arya et al. 2013). Example 2 A mutation in the metAP gene reduces phage sensitivity in S. thermophilus To confirm that the reduced phage sensitivity was due to the MetAPH206Q mutation, and not to other mutations in the genome, the allele encoding the MetAPH206Q protein was amplified and transformed into S. thermophilus SMQ-301 using natural competition. Although phage selection is highly efficient, it drastically increases the likelihood of selecting for CRISPR MIBs, as well as for other mutations that confer reduced phage sensitivity. Instead, a PCR strategy was designed to detect transformants that integrated the PCR product with the mutation into their genome, in the absence of phage selection. SJL150 primers were used in combination with SJL151, each carrying the desired mutation at its 3' end, to specifically detect the mutation in the bacterial genome. To avoid false positives due to the possible presence of residual linear DNA from the transformation process, L? / «ηη / ίζηζ / Ε / γίΛΐ From 103 of the bacterial cytoplasm, a primer was designed that matched the flanking genomic region of the transformed DNA fragment. A total of 282 clones were screened to determine the integration of the metAP H206Q allele, and four clones positive for the desired MetAPH206Q mutation were obtained. One of these clones, S. thermophilus SMQ301:MetAPH206Q, was randomly selected, and its phage susceptibility was determined using the EOP I assay. No plaques were observed in bacterial culture with various dilutions of the phage assay, indicating a very high phage resistance phenotype (EOP 10⁻⁸, Table 3). Using various experimental conditions, attempts were made to isolate phage mutants that overcame the effect of MetAP H206Q, but these were unsuccessful.The incubation temperature was varied, anaerobic conditions were used, different concentrations of glycine were added to the medium to weaken the bacterial cell wall, the agar was replaced by different concentrations of agarose, and rescue experiments were attempted in liquid media, but still no DT1 phage derivatives capable of propagating in the MIB SMQ-301 :MetAPH206Q were obtained. 104 Table 3. Effect of S. thermophilus metaAP mutations on phage plaque formation efficiency L? / «nn / Lznz / E / YiAi Strain + pNZ123 (EOP) S. thermophilus SMQ-301 1 S. thermophilus SMQ-301 MIB #2 1.7x10-8 S. thermophilus SMQ-301 MIB #3 1.7x10'8 S. thermophilus SMQ-301 MIB #5 1.7x10-8 S. thermophilus SMQ-301 :MetAPH206Q 1.7x10-8 Example 3 When supplemented with the SMQ-301 metaAP gene allele, it restores sensitivity to phages. The SMQ-301 metAP gene allele was cloned into the pNZ123 shuttle expression vector. The resulting construct was transformed into S. thermophilus SMQ-301:MetAPH20SQ to complement the trans mutation. Sensitivity to phage DT1 was restored for two of the three pNZ123:MetAP-complemented MIBs (Table 4), confirming that the MetAPH206Q substitution was responsible for the phage phenotype. Notably, for one MIB (no. 3), sensitivity to phage DT1 was not fully restored (EOP = 0.02), suggesting that mutations in one or more other genes are likely involved in phage DT1 resistance (Table 4). The mutated metAP gene was also cloned into pNZ123 and transformed into S. thermophilus SMQ-301. There were no differences in EOP between the strain with pNZ123 compared to the strain with pNZ123:MetAPH206Q, suggesting 105 that the mutation does not produce a dominant phenotype. Table 4. Effect of complementation of mutations of S. thermophilus MetAP on phage plaque formation efficiency L? / «ηη / ίζηζ / Ε / γίΛΐ Strain+ pNZ123:meMP (EOP) S. thermophilus SMQ-301 1 S. thermophilus SMQ-301 MIB #2 1.7 S. thermophilus SMQ-301 MIB #3 0.02 S. thermophilus SMQ-301 MIB #5 2.4 S. thermophilus SMQ-301 :MetAPH206Q 1 Example 4 The MetAP H206Q replacement has a broad range against eos-type phages To determine whether the resistance provided by the MetAPH206Q substitution is phage-dependent, the eos-type phage MD2, which is also capable of infecting SMQ-301, was tested. Phage MD2 was also severely inhibited by MetAPH206Q. To demonstrate that this mutation is not strain-dependent, MetAPH206Q was introduced into several strains of S. thermophilus using site-directed mutagenesis. The mutation was introduced into the S. thermophilus strain DGCC782, which is sensitive to the eos-type phages N1032, N1117, N1119, N1169, N1358, and N3782. The mutation was also introduced into the S. thermophilus strain DGCC7710, which is sensitive to eos-type phages, specifically D5691, D5913, D6037, and D6215, and to several pac-type phages, specifically 858, 2972, 106 D3288, 4259, D4752, D4754 and D939. Finally, the mutation was introduced into S. thermophilus DGCC7796, which is sensitive to several eos-type phages, specifically D4090, D5821, D4807 and D6179, and several pac-type phages, specifically D2765, D4274, D5787 and D5876. Although the mutation was less effective against eos-type phages infecting S. thermophilus DGCC7710 (EOF 10⁻⁵), it conferred resistance against all tested eos-type phages. Introducing the metAPH206Q allele into S. thermophilus DGCC7796 and DGCC782 led to an EOF reduction of at least 10⁻⁶, corresponding to the limit of detection (lysis zone at the 10⁻¹ dilution). Furthermore, no mutant phage could be recovered in these assays. On the other hand, none of the tested pac-type phages of S. thermophilus were affected by the mutation, suggesting that MetAP is not important for the replication of phages in this group. To determine whether the MetAP mutation would reduce susceptibility to another bacterial species, the allele encoding the MetAP^20 protein was introduced into the S. mutans HER1503 strain, which is susceptible to the eos-type phage M102AD (Delisle et al., 2012). The S. mutans HER1503 metAP gene is the same length (861 bp) as the S. thermophilus SMQ-301 metAP gene. The two metAP genes share 74% identity, while the two methionine aminopeptidases (MetAP protein) share 85% identity. The histidine moiety found in L? / «nn / Lznz / E / YiAi Position 206 is present in S. mutans. Insertion of the allele encoding the MetAPH206Q protein into the S. mutans genome (instead of the original metAP allele) resulted in reduced sensitivity to phage M102AD (EOP). <lxl0-7, Tabla 5). La complementación de la cepa mutada con el alelo de metAP original restableció el fenotipo de sensibilidad a fagos (Tabla 5) . En conjunto, estos datos sugieren un papel relativamente amplio de MetAP en la replicación de fagos. him? / «ηη / ίζηζ / Ε / γίΛΐ Table 5. Effect of S. mutans MetAP mutations on phage weakening efficiency (ND = Not determined) Strain + pNZ123 (EOP) Strain + pNZ123:MetAPSmut (EOP) S. mutans HER 1503 1 ND S. mufans HER 1503:MetAPH2°6Q <1x10-7 1.1 Example 5 Other mutations in MetAP reduce sensitivity to phage DT1 To determine whether other mutations in the metAP gene could reduce sensitivity to phage DT1, an error-prone POR amplification approach was used. The resulting PCR products were transformed into S. thermophilus SMQ-301 using natural competition. Since no antibiotic resistance marker was introduced, phage DT1 was used to select the clones. The transformation assay with the positive control (MetAPH206Q) resulted in significantly more MIB than with the negative control (no DNA). The gene encoding the 108 MetAP protein mutants had a mutation in the metAP gene resulting in the substitution of an amino acid. For 6 of these mutants, the original amino acid was replaced by another amino acid (Q57K, L153P, A168E, V228D, P233Q, and P233L). For another mutant, the original amino acid was replaced by a stop codon (G226*) (Table 6). The sensitivity to phage DT1 of these 7 mutants was retested and all of them had reduced sensitivity to phage DT1, with an EOF below IxlO-6. The resistant strains were supplemented with pNZ123:MetAP and, as observed previously, MetAP as established in SEC ID NO: 2 restored the phage sensitivity phenotype, confirming that any of these 7 mutations in the MetAP protein reduces sensitivity to eos-type phages. L? / «nn / Lznz / E / YiAi Table 6. Random mutagenesis of the S. thermophilus metaAP gene (* represents a stop codon) MIB Mutation Codon change Amino acid change EOP EOP after complementation MetAP_S7 C169A CAG>AAG Q57K <1.1 o-6 5.10-1 MetAP_S45 T458C CTT>CCT L153P <1.10-6 1.10° MetAP_S11 C503A GCG>GAG A168E <1.10-6 3.10-3 MetAP_R22 T683A GTC>GAC V228D <1.10-6 1.10-1 MetAP_S21 G676T GGA>TGA G226* <1.10-6 3.10-1 MetAP_S32 C698A CCA>CAA P233Q <1.10-6 7.10-1 MetAP_S36 C698T CCA>CTA P233L <1.10-6 6.10-2 109 Example 6 The MetAPH206Q mutation is stable. One of the important characteristics for industrial fermentation is the stability of the phage resistance phenotype. Therefore, the present inventors verified the stability of the MetAPH206Qa mutation over 60 generations of S. thermophilus SMQ-301 and DGCC7796, as well as their mutants in milk and LM17. Although all selected colonies of the wild-type strains remained phage-sensitive, all 10 colonies of each mutant remained phage-resistant, indicating that the MetAPH206Qa mutation is stable. Conclusion This paper demonstrates that reduced sensitivity to eos-type phages can be acquired through mutations in the metAP gene of S. thermophilus and S. mutans. However, none of the identified mutations in the metAP gene reduce sensitivity to pac-type phages. Finally, the inability to isolate phage mutants that overcome the MetAP H206Q substitution confirms that the mutation can confer a robust resistance phenotype. All publications mentioned in the preceding description are incorporated herein by reference. Various modifications and variations of the described methods and systems of the invention will be evident to those skilled in the art. L? / «nn / Lznz / E / YiAi 110 the technique without departing from the scope and spirit of the invention. Although the invention has been described in relation to specific preferred embodiments, it should be understood that the claimed invention should not be unduly limited to those specific embodiments. Indeed, various modifications of the described modes for carrying out the invention, which are obvious to those skilled in molecular biology or related fields, are intended to fall within the scope of the following claims. It is hereby stated that, as of this date, the best method known to the applicant for putting the aforementioned invention into practice is the one that is clear from the present description of the invention.

Claims

Having described the invention as above, the following claims are claimed as property:

1. A strain of the genus Streptococcus selected from the group consisting of a strain of Streptococcus thermophilus or a strain of Streptococcus mutans, characterized in that it comprises a metAPR allele encoding a methionine aminopeptidase protein (MetAPR protein), wherein the metAPR allele is defined as a metAP allele that reduces the sensitivity to phage DT1 of a Streptococcus thermophilus SMQ-301 derived strain, the SMQ-301 derived strain being a Streptococcus thermophilus SMQ-301 strain in which its metAP allele has been replaced by the metAPR allele, and wherein sensitivity to phage DT1 is determined by the Efficiency Plaque Formation (EPF) Assay I.

2. The strain according to claim 1, characterized in that it comprises, as the only allele of its metAP gene, the metAPR allele.

3. A polynucleotide encoding a MetAPR protein, characterized in that the polynucleotide is a metAP allele that reduces the sensitivity to phage DT1 of a Streptococcus thermophilus SMQ-301-derived strain, the SMQ-301-derived strain being a Streptococcus thermophilus SMQ-301 strain in which its metAP allele has been replaced by the metAPR allele, and 112 wherein sensitivity to phage DT1 is determined by the Efficiency Plaque Formation (EPF) Assay I.

4. The strain according to claim 1 or 2 or the polynucleotide according to claim 3, characterized in that the reduction of sensitivity to phage DT1 is characterized by a reduction of the EOP of at least 4 log, at least 5 log or at least 6 log.

5. The strain according to any of claims 1, 2 and 4, or the polynucleotide according to claim 3 or 4, characterized in that the metAPR allele encodes a MetAPR protein comprising an amino acid deletion, an amino acid addition, an amino acid substitution or an amino acid deletion and addition, with respect to a MetAP protein selected from the group consisting of: a) a MetAP protein having an amino acid sequence as defined in SEC ID NO: 2;(b) a MetAP variant protein comprising an amino acid sequence having at least 80 % identity with the SEC ID NO: 2 encoded by a metAP allele, which does not reduce the EOP of phage DT1 in a strain derived from Streptococcus thermophilus SMQ-301, whereas it is derived from a strain derived from SMQ-30 Streptococcus thermophilus strain SMQ-301 in which its metAP allele has been replaced by the metAP allele encoding the MetAP variant protein and in which phage sensitivity L? / «ηη / ίζηζ / Ε / γίΛΐ 113 DT1 is determined by the Plaque Formation Efficiency (EOP) Assay I;(c) a variant MetAP protein comprising an amino acid sequence having at least 80% identity with the sequence ID NO: 2 encoded by a metAP allele, which reduces the plaque formation efficiency (PFE) of phage DT1 in a Streptococcus thermophilus SMQ-301-derived strain by less than 3 log, the SMQ-301-derived strain being a Streptococcus thermophilus SMQ301 strain in which its metAP allele has been replaced by the metAP allele encoding the variant MetAP protein, and wherein sensitivity to phage DT1 is determined by Plaque Formation Efficiency (PFE) Assay I.

6. The strain according to any of claims 1, 2, 4 and 5, or the polynucleotide according to claims 3 to 5, characterized in that the MetAPR protein comprises or consists of an amino acid sequence having at least 80% identity with SEC ID NO:

2.

7. The strain according to any of claims 1, 2 and 4 to 6, or the polynucleotide according to any of claims 3 to 6, characterized in that the MetAPR protein sequence does not comprise an amino acid selected from the group consisting of a glutamine at position 57, a leucine at position 153, an alanine at position 168, a histidine at position 206, a valine at position 228 and a proline at position 233, wherein the amino acid sequence set out in SEC ID NO: 2 is used for numbering.

8. The strain according to any of claims 1, 2 and 4 to 7, or the polynucleotide according to any of claims 3 to 7, characterized in that the MetAPR protein sequence comprises an amino acid selected from the group consisting of a lysine at position 57, a proline at position 153, a glutamic acid at position 168, a glutamine at position 206, an aspartic acid at position 228, a glutamine at position 233 and a leucine at position 233, wherein the amino acid sequence set out in SEC ID NO: 2 is used for numbering.

9. The strain according to any one of claims 1, 2 and 4 to 8, or the polynucleotide according to any one of claims 3 to 8, characterized in that the MetAPR protein comprises or consists of: a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but does not comprise an amino acid selected from the group consisting of a glutamine at position 57, a leucine at position 153, an alanine at position 168, a histidine at position 115-206, a valine at position 228 and a proline at position 233; b) an amino acid sequence having at least 80% identity with SEC ID NO: 2 and does not comprise an amino acid selected from the group consisting of a glutamine at position 57, a leucine at position 153, an alanine at position 168, a histidine at position 206, a valine at position 228 and a proline at position 233;c) an amino acid sequence that is otherwise as defined as that of a MetAP variant protein having at least 80% identity with SEC ID NO: 2, but not comprising an amino acid selected from the group consisting of a glutamine at position 57, a leucine at position 153, an alanine at position 168, a histidine at position 206, a valine at position 228 and a proline at position 233; d) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but comprising an amino acid substitution selected from the group consisting of a lysine at position 57, a proline at position 153, a glutamic acid at position 168, a glutamine at position 206, an aspartic acid at position 228, a glutamine at position 233 and a leucine at position 233;e) an amino acid sequence having at least 80% identity with SEC ID NO: 2 and comprising an amino acid substitution selected from the group consisting of a lysine at position 57, a proline at position 153, a glutamic acid at position 168, a glutamine at position 206, an aspartic acid at position 228, a glutamine at position 233 and a leucine at position 233; of) an amino acid sequence that is otherwise as defined as that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising an amino acid substitution selected from the group consisting of a lysine at position 57, a proline at position 153, a glutamic acid at position 168, a glutamine at position 206, an aspartic acid at position 228, a glutamine at position 233, and a leucine at position 233.

10. The strain according to any one of claims 1, 2 and 4 to 9, or the polynucleotide according to any one of claims 3 to 9, and characterized in that the MetAPR protein comprises or consists of: a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but does not comprise an amino acid selected from the group consisting of a glutamine at position 57, a leucine at position 153, an alanine at position 168, a histidine at position 117-206, a valine at position 228 and a proline at position 233;(ob) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but comprising an amino acid substitution selected from the group consisting of a leucine at position 57, a proline at position 153, a glutamic acid at position 168, a glutamine at position 206, an aspartic acid at position 228, a glutamine at position 233 and a leucine at position 233.; 11. The strain according to any of claims 1, 2 and 4 to 6 or the polynucleotide according to any of claims 3 to 6, characterized in that the MetAPR protein is truncated in its last quarter, preferably at position 226, wherein the amino acid sequence set out in SEC ID NO: 2 is used for numbering.

12. The strain according to any one of claims 1, 2, 4 to 6 and 11 or the polynucleotide according to any one of claims 3 to 6 and 11, characterized in that the MetAPR protein comprises or consists of an amino acid sequence selected from the group consisting of: a) an amino acid sequence that is otherwise as defined in SEC ID NO: 2, but comprising a stop codon L7 / Ann / Lznz / E / YIAI 118 at position 226; b) an amino acid sequence having at least 80% identity with SEC ID NO: 2 and comprising a stop codon at position 226; and c) an amino acid sequence that is otherwise as defined as that of a variant MetAP protein having at least 80% identity with SEC ID NO: 2, but comprising a stop codon at position 226.

13. A bacterial composition characterized in that it comprises the strain according to any one of claims 1, 2 and 4 to 12, and optionally one or more additional lactic acid bacteria selected from the group consisting of Streptococcus, Lactococcus, Lactobacillus, Leuconostoc, Pediococcus, Enterococcus, Oenococcus and Bifidobacterium.

14. A food product or feed characterized in that it comprises the strain according to any of claims 1, 2 and 4 to 12 or the bacterial composition according to claim 13, in particular a dairy, meat or cereal food product or feed, more particularly a fermented dairy product.

15. A method for manufacturing a fermented product, characterized in that it comprises: a) inoculating a substrate, preferably a dairy substrate, with the strain according to any of claims 1, 2 and 4 to 12 or the bacterial composition according to claim 13; and b) fermenting the inoculated substrate obtained in step a) to obtain a fermented product, preferably a fermented dairy product.

16. Use of the strain according to any of claims 1, 2 and 4 to 12 or the bacterial composition according to claim 13, for manufacturing a food product or feed, preferably a fermented food product, more preferably a fermented dairy product.

17. Use of the polynucleotide according to any of claims 3 to 12 or of a vector comprising the polynucleotide according to any of claims 3 to 12, for reducing the sensitivity to at least one eos-type phage of a bacterium of the genus Streptococcus, in particular a strain of Streptococcus thermophilus or a strain of Streptococcus mutans, sensitive to eos-type phages, wherein the sensitivity to at least one eos-type phage is determined by EOP Assay I.

18. A method for preparing a bacterium of the genus Streptococcus, in particular a strain of Streptococcus thermophilus or a strain of Streptococcus mutans, having reduced sensitivity to at least one eos-type phage, characterized in that it comprises: a) providing a bacterium of the genus Streptococcus L? / «ηη / ίζηζ / E / γίΛΐ 120 sensitive to eos-type phages; b) replacing the allele of the metAP gene of the bacterium of the genus Streptococcus sensitive to eos-type phages with a polynucleotide according to any one of claims 3 to 12, or modifying the sequence of the metAP gene of the bacterium of the genus Streptococcus sensitive to eos-type phages so that it has a metAP allele with the same sequence as a polynucleotide according to any one of claims 3 to 12;(yc) recover the bacterium or bacteria of the genus Streptococcus that have reduced sensitivity to at least one eos-type phage, wherein sensitivity to at least one eos-type phage is determined by EOF Assay I.; 19. The use according to claim 17 or the method according to claim 18, characterized in that the sensitivity reduction is characterized by a reduction of the EOP of at least 4 log, at least 5 log or at least 6 log.

20. A lactic acid bacterium characterized in that it is obtained by the method according to claim 18 or 19.

21. A method for identifying a metAPR allele encoding a MetAPR protein, characterized in that it comprises: a) inserting a metAP allele to be tested in place of the metAP gene allele of the Streptococcus thermophilus L? / «nn / Lznz / E / YiAi 121 SMQ-301 strain, to obtain an SMQ-301-derived strain; and b) determining by Plaque Formation Efficiency Assay I the DT1 phage OPE in the SMQ-301-derived strain of step a), wherein a reduction in OPE of at least 4 log, at least 5 log, or at least 6 log is indicative of a metAP allele that is a metAPR allele encoding a MetAPR protein.