Indirect elisa detection kit for infectious bovine rhinotracheitis virus antibodies and use thereof

NL2041212B1Active Publication Date: 2026-06-12HUAZHONG AGRI UNIV

Patent Information

Authority / Receiving Office
NL · NL
Patent Type
Patents
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2025-09-23
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

Current serological detection methods for infectious bovine rhinotracheitis (IBR) lack sensitivity and specificity, leading to missed or misdiagnoses and inefficiencies in vaccination and eradication efforts.

Method used

An indirect ELISA detection kit using a recombinant IBRV gE protein as a coating antigen, with optimized nucleotide sequence and expression in a prokaryotic system, and a method involving specific steps for sample processing and analysis to enhance sensitivity and specificity.

Benefits of technology

The kit provides a sensitive and specific diagnostic tool for IBR, enabling efficient detection and control of the disease through high-throughput testing suitable for large-scale applications.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention belongs to the technical field of biological detection, and in particular to an indirect ELISA detection kit for infectious bovine rhinotracheitis virus (IBRV) antibodies and use thereof. Based on the good antigenicity of an IBRV gE protein, the present invention endows the indirect ELISA detection kit and an indirect ELISA detection method for IBRV, established based on the IBRV gE protein, with characteristics of sensitivity, specificity, and high efficiency. The method is simple to operate, time-efficient, and cost-effective, allowing for high-throughput detection of cattle infected with IBRV, and provides a simple and effective diagnostic tool for clinical diagnosis of infectious bovine rhinotracheitis (IBR).
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[01] The present invention belongs to the technical field of biological detection, and in particular to an indirect ELISA detection kit for infectious bovine rhinotracheitis virus (IBRV) antibodies and use thereof. BACKGROUND ART

[02] Infectious bovine rhinotracheitis (IBR) is an acute, contagious disease of cattle caused by IBRV, also clinically known as "red nose disease". IBR may cause immunosuppression, latent infection, and lifelong viral carriage, leading to lifelong viral shedding in infected cattle. This makes the disease extremely difficult to control and eradication from. a herd nearly impossible. Currently, intervention measures for IBR still mainly rely on vaccination. Therefore, establishing methods that may specifically diagnose IBR at an early stage will greatly improve the efficiency of vaccination and is of great significance for the prevention and control of IBR. [O3] IBRV is a linear doublestranded DNA virus with an envelope. There are 11 types of glycosylated proteins on a surface of the envelope, and an internal capsid exhibits icosahedral symmetry. A gE gene is highly conserved in an IBRV genome, and a gE genedeleted vaccine is a commonly used IBR genedeleted vaccine at present. Establishing detection methods targeting an IBRV gE protein may screen cattle that have been immunized with the gE genedeleted vaccine and those infected with wild virus, providing an effective means for the eradication of IBR in cattle herds.

[04] Detection methods for IBR include clinical symptom examination and laboratory testing. The former, if symptoms are not typical, may easily lead to missed diagnoses and misdiagnoses, and. procedures are cumbersome. ELISA. is a commonly used serological detection method in laboratories, which has the advantages of convenience, rapidity, and high sensitivity, making it one of the important detection methods for viruses. However, a major challenge in serological diagnosis of IBR lies in limitations of sensitivity and specificity. Currently, there is a lack of an effective serological detection method for IBR. SUMMARY

[05] An object of the present invention is to provide an . The present invention establishes an indirect ELISA antibody detection method and a kit with good specificity and sensitivity using an IBRV gE protein as a coating antigen. The method is convenient to operate and allows for batch detection, providing an effective tool for the diagnosis and prevention and control of IBR.

[06] The present invention provides use of an IBRV gE protein as a coating antigen in a preparation of an ELISA detection kit for IBRV.

[07] As an implementation, the IBRV' gE protein. of the present invention is a recombinant IBRV gE protein obtained based on prokaryotic expression. As an implementation, a nucleotide sequence encoding the IBRV gE protein is shown in SEQ ID NO:2. As an implementation, the ELISA detection kit includes an indirect ELISA detection kit.

[08] The present invention also provides an indirect ELISA detection kit for IBRV antibodies, including: an ELISA plate coated with an IBRV gE protein, a blocking buffer, a wash buffer, a dilution buffer, a negative control, an enzyme labeled secondary antibody, a substrate solution, and a stop solution.

[09] As an implementation, a coating concentration of the IBRV gE protein is 0.5 to 2.0 ug / well. As another implementation, the coating concentration of the IBRV gE protein is 2.0 ug / well.

[10] As an implementation, the blocking buffer includes BSA at a mass-tovolume ratio of 5%. As an implementation, the wash buffer is PBST. As an implementation, the dilution buffer is PBST. As an implementation, the enzymelabeled secondary antibody is horseradish peroxidase (HRP) conjugated goat antirabbit IgG. As an implementation, a dilution of the enzymelabeled secondary antibody is 1:10000. As an implementation, the substrate solution is TMB. As an implementation, the stop solution is sulfuric acid.

[11] The present invention provides a method for detecting IBRV for nondiagnostic purposes, including the following steps:

[12] 1) diluting an IBRV gE protein, and coating it onto the ELISA plate;

[13] 2) blocking and washing the coated ELISA plate to obtain a blocked ELISA plate;

[14] 3) diluting a test sample serum.and a negative control serum with the dilution buffer separately, and then adding them into different wells of the blocked ELISA plate for incubation and washing to obtain a primary ELISA plate;

[15] 4) diluting the enzymelabeled secondary' antibody with the dilution buffer, and then adding it into the primary ELISA plate for incubation and washing to obtain a secondary ELISA plate containing the secondary antibody;

[16] 5) adding the substrate solution into the secondary ELISA plate containing the secondary antibody for color development in the dark to obtain a colordeveloped ELISA plate; and

[17] 6) adding the stop solution to the colordeveloped ELISA plate to terminate the color development, and measuring absorbance values of the diluted sample and the negative control at OD450nm separately to determine results:

[18] when the OD450nm value of the diluted sample is Z M+3SD, the sample is determined to be positive, and when the 00450nm value of the diluted sample is < M+3SD, the sample is determined to be negative; and

[19] where M is a mean value of the negative control, and SD is a standard deviation of the negative control.

[20] As an implementation, a blocking time in step 2) is 30 to 60 min; As another implementation, the blocking time is 60 min. As an implementation, dilutions of the test sample serum and the negative control serum in step 3) are both 1:100. As an implementation, an incubation time in step 3) is 30 to 90 min. As another implementation, the incubation time in step 3) is 60 min. As an implementation, an incubation time in step 4) is 30 to 90 min. As another implementation, the incubation time in step 3) is 60 min. As an implementation, a color development time in step 5) is 5 to 10 min. As another implementation, the color development time in step 5) is 5 min.

[21] Beneficial effects:

[22] The present invention provides an indirect ELISA detection kit for IBRV antibodies and use thereof. Based on the good antigenicity of an IBRV gE protein, the present invention endows the indirect ELISA detection kit and an indirect ELISA detection method for IBRV, established based on the IBRV gE protein, with characteristics of sensitivity, specificity, and high efficiency. The method is simple to operate, timeefficient, and costeffective, allowing for highthroughput detection of cattle infected with IBRV. It is suitable for applications such as large-scale epidemiological surveys and provides a simple and effective diagnostic tool for clinical diagnosis of IBR. BRIEF DESCRIPTION OF THE DRAWINGS

[23] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings required in the embodiments will be briefly introduced below.

[24] FIG. 1 shows a secondary structure analysis of an IBRV gE protein;

[25] FIG. 2 shows a B cell epitope analysis of an IBRV gE protein;

[26] FIG. 3 shows PCR amplification results of an IBRV gE target gene fragment and a pET32a vector;

[27] FIG. 4 shows SDSPAGE results of a pET32agE recombinant protein induced by IPTG at different concentrations for 14 h under culture conditions of 16°C and 120 r / min;

[28] FIG. 5 shows SDS-PAGE results of a pET32agE recombinant protein induced by IPTG at different concentrations for 14 h under culture conditions of 25°C and 120 r / min;

[29] FIG. 6 shows SDS-PAGE results of a pET32agE recombinant protein induced by IPTG at different concentrations for 6 h under culture conditions of 37°C and 200 r / min;

[30] FIG. 7 shows solubility analysis results of a pET32a- gE recombinant protein, where lane 1 represents a supernatant protein and lane 2 represents a pellet protein;

[31] FIG. 8 shows Western blot identification results of a pET32agE recombinant protein; and

[32] FIG. 9 shows a gE antibody titer in serum prepared from New Zealand white rabbits immunized with a pET32agE recombinant protein. DETAILED DESCRIPTION OF THE EMBODIMENTS

[33] In order to further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[34] Biological materials and experimental reagent materials used in the following embodiments:

[35] 1. Sources of biological materials

[36] Antibody positive sera of IBRV, bovine viral diarrhea virus (BVDV), Pasteurella, and other related viruses and strains were purchased from China Institute of Veterinary Drug Control. 96 standard negative samples for IBR were purchased from the China Institute of Veterinary Drug Control. 83 yak serum samples were collected in Tibet and stored in our laboratory.

[37] 2. Experimental reagent materials

[38] DL2000 Plus DNA Marker (MD10101) and 1kb DNA Ladder (SM816100) were purchased from Nanjing Vazyme Biotech Co., Ltd. and Beijing Genesand Biotech Co., Ltd., respectively. ColorMixed Protein Marker 180 (RM19001) was purchased from ABclonal Technology Co., Ltd. Competent Escherichia coli DH5d and. BL21 (DE3) were purchased. front Nanjing' Vazyme Biotech Co., Ltd. Horseradish peroxidase (HRP)conjugated rabbit antibovine IgG was purchased from ABcam. Fast cloning kit was purchased from Nanjing Vazyme Biotech Co., Ltd. PBS was purchased from Biosharp. Agarose was purchased from Biofrox. Coomassie brilliant blue R250, IPTG, ELISA coating buffer (1X), ELISA stop solution, and TMB substrate solution were all purchased from. Beijing Solarbio Science&Technology Co., Ltd. Female New Zealand white rabbits were purchased from Laboratory Animal Center of Huazhong Agricultural University and were raised and used in experiments strictly in accordance with animal ethics requirements. gE antibody kit was purchased from BioStone Animal Health Technology (Guangzhou) Co., Ltd., with product number Cat No: 1007405 (5X96 wells).

[39] Example 1

[40] Codon optimization of gE gene, primer design, and construction of recombinant plasmid

[41] Based on the nucleotide sequence of IBRV gE (MK035760.1) in GenBank, sequence alignment and homology analysis were performed 'using the DNA. STAR. software to obtain a target sequence with high homology. The IBRV gE protein was analyzed and predicted using the DNA STAR Protean software and. the BepiPred. prediction tool. Gene fragments with strong hydrophilicity, major antigens, and no transmembrane regions or signal peptides were selected. The results are shown in FIGS. 1 and 2. A fragment spanning 157 to 415 aa was identified as having good hydrophilicity, hydrophobicity, and antigenicity, with a high likelihood of forming an epitope. Based on the results, the final truncated nucleotide sequence is shown as SEQ ID NO:1, with the specific sequence as follows:

[42] 5' GTGTACTTCCTGTACGACCGGCTCATCGGCGACGCCGGCGACGAGGAGACGCAGTTGG CGCTGACGCTGCAGGTCGCGACGGCCGGCGCGCAGGGCGCCGCGCGGGACGAGGAGAG GGAACCAGCGACCGGGCCCACCCCCGGCCCGCCGCCCCACCGCACGACGACACGCGCG CCCCCGCGGCGGCACGGCGCGCGCTTCCGCGTGCTGCCGTACCACTCCCACGTATACA CCCCGGGCGATTCCTTTCTGCTATCGGTGCGTCTGCAGTCTGAGTTTTTCGACGAGGC TCCCTTCTCGGCCAGCATCGACTGGTACTTCCTGCGGACGGCCGGCGACTGCGCGCTC ATCCGCATATACGAGACGTGCATCTTCCACCCCGAGGCACCGGCCTGCCTGCACCCCG CCGACGCGCAGTGCAGCTTCGCGTCGCCGTACCGCTCCGAGACCGTGTACAGCCGGCT GTACGAGCAGTGCCGCCCGGACCCTGCCGGTCGCTGGCCGCACGAGTGCGAGGGCGCC GCGTACGCGGCGCCCGTTGCGCACCTGCGTCCCGCCAATAACAGCGTAGACCTGGTCT TTGACGACGCGCCGGCTGCGGCCTCCGGGCTTTACGTCTTTGTGCTGCAGTACAACGG CCACGTGGAAGCTTGGGACTACAGCCTAGTCGTTACTTCGGACCGTTTGGTGCGCGCG GTCACCGACCACACGCGCCCCGAGGCCGCAGCCGCCGACGCTCCCGAGCCAGGCCCAC CGCTCACCAGCGAGCCGGCGGGCGCGCCCACCGGGCCCGCGCCCTGGCTTGTGGTGCT GGTGGGCGCGCTTGGACTCGCGGGACTGGTGGGCATCGCAGCCCTCGCCGTTCGGGTG TGCGCGCGCCGCGCAAGCCAGAAGCGCACCTACGACATCCTCAACCCCTTCGGGCCCG TATACACCAGCTTGCCGACCAACGAGCCGCTCGACGTGGTGGTGCCAGTTAGCGACGA CGAATTTTCCCTCGACGAAGACTCTTTTGCGGATGACGACAGCGACGATGACGGGCCC GCTAGCAACCCCCCTGCGGATGCCTACGACCTCGCCGGCGCCCCAGAGCCAACTAGCG GGTTTGCGCGAGCCCCCGCCAACGGCACGCGCTCGAGTCGCTCTGGGTTCAAAGTTTG GTTTAGGGACCCGCTTGAAGACGATGCCGCGCCAGCGCGGACCCCGGCCGCACCAGAT TACACCGTGGTAGCAGCGCGACTCAAG-3'.

[43] The nucleotide sequence of the selected gE gene (SEQ ID NO:1) was codonoptimized for expression in a prokaryotic expression system, specifically tailored to a codon bias of Escherichia coli (performed by Tsingke Biotechnology Co., Ltd). The optimized nucleotide sequence of the gE gene is shown as SEQ ID NO:2, with the specific sequence as follows:

[44] 5' GGATCCGTTTATTTTCTGTATGATCGCCTGATTGGTGATGCGGGTGATGAAGAAACCC AGCTGGCACTGACCCTGCAGGTTGCAACCGCTGGTGCACAGGGTGCAGCACGTGATGA AGAACGTGAACCGGCAACTGGCCCGACCCCTGGTCCTCCTCCTCATCGTACAACCACC CGTGCTCCGCCTCGTCGTCATGGTGCACGTTTTCGTGTTCTGCCGTATCATTCTCATG TTTATACCCCGGGTGATTCATTTCTGCTGTCAGTTCGTCTGCAGTCTGAATTTTTCGA TGAAGCACCTTTTAGTGCAAGCATTGATTGGTATTTTCTGCGTACCGCAGGTGATTGT GCACTGATTCGTATTTATGAAACCTGTATTTTTCATCCGGAAGCACCGGCATGTCTGC ATCCGGCAGATGCACAGTGTAGCTTTGCCAGCCCGTATCGTAGCGAAACCGTTTATTC TCGTCTGTATGAACAGTGTCGTCCTGATCCGGCAGGTCGTTGGCCTCATGAATGTGAA GGTGCAGCATATGCAGCACCGGTGGCCCATCTGCGTCCTGCAAATAATTCAGTTGATC TGGTTTTTGATGATGCACCGGCAGCAGCAAGCGGTCTGTATGTTTTTGTTCTGCAGTA TAATGGTCATGTTGAAGCATGGGATTATAGCCTGGTTGTTACCTCTGATCGTCTGGTT CGTGCGGTTACCGATCATACCCGTCCGGAAGCAGCAGCAGCGGATGCACCTGAACCAG GTCCACCTCTGACAAGTGAACCGGCGGGTGCACCTACCGGTCCTGCACCTTGGCTGGT TGTACTGGTTGGCGCGCTGGGTCTGGCAGGTCTGGTTGGTATTGCAGCACTGGCGGTT CGTGTTTGTGCCCGTCGTGCAAGCCAGAAACGTACCTATGATATTCTGAACCCGTTTG GTCCGGTTTATACAAGTCTGCCTACCAATGAACCTCTGGATGTTGTTGTTCCTGTTAG CGATGATGAATTTAGCCTGGATGAAGATAGCTTTGCAGATGATGATAGCGATGATGAT GGTCCGGCAAGCAATCCGCCGGCAGATGCCTATGATCTGGCAGGTGCACCGGAACCGA CAAGCGGTTTTGCCCGTGCACCGGCAAATGGTACGCGTAGTAGCCGTAGCGGTTTTAA AGTTTGGTTTCGTGATCCGCTGGAAGATGATGCCGCACCTGCACGTACCCCTGCAGCA CCTGATTATACGGTTGTTGCAGCACGTCTGAAACTCGAG-3' (1257 bp).

[45] Amplification primers were designed using the SnapGene software. An upstream. primer sequence is 5'-GTGTACTTCCTGTACGACCG-3' (SEQ ID NO:3), and a downstream primer sequence is 5CTTGAGTCGCGCTGCTACCA3 (SEQ ID NO:4). Using the optimized DNA sequence as a template, a target fragment was amplified by PCR. A PCR reaction system includes 1 uL of each upstream and downstream primer, 12.5 uL of 2XPhanta Max Master Mix enzyme, 2 uL of template, and ddH2O was added to a final volume of 25 uL. PCR amplification conditions were as follows: 95°C for 3 min; followed by 35 cycles of 95°C for 15 s, 58°C for 15 s, and 72°C for 30 s; and a final extension at 72°C for 5 min. The resulting PCR product of the target gene was analyzed by 1% agarose gel electrophoresis at 120 V for 30 min. A target band. of approximately 1257 bp was successfully amplified, which matched the expected size, as shown in A of FIG. 3.

[46] Empty'pET-32a was amplified.by PCR using the following primer sequences: upstream primer F: 5'-CTCGAGCACCACCACCACCACCACTGAG-3' (SEQ ID NO:5) and downstream primer R: 5'GCGGCCGCAAGCTTGTCGACGG3 (SEQ ID NO:6). An amplification system and procedures were the same as those used for the target fragment amplification. The PCR product of the empty pET32a vector was analyzed by 1% agarose gel electrophoresis at 120 V for 30 min. Results are shown in B of FIG. 3, which depict a successfully amplified target band of approximately 5899 bp.

[47] Concentrations of a purified empty pET32a vector and the target fragment were measured. The purified empty pET 32a vector and the target fragment were then ligated using a one-step cloning kit. After a recombination reaction was completed, a ligation. product. was transformed. into DH5d competent cells. After 12 to 16 h, single colonies were picked for shakeflask culture, and bacterial cultures were subjected. to sequencing verification. Plasmids were extracted from correctly sequenced bacterial cultures and then transformed into BL21 (DE3) competent cells. Colonies transformed into BL21 (DE3) competent cells were picked, cultured in shake flasks, and sequenced for identification. Correctly sequenced recombinant plasmid was designated as pET32agE.

[48] Example 2

[49] Optimization of induction conditions for recombinant protein expression

[50] BL21 (DE3) competent cells containing the pET32agE plasmid were inoculated at a 1% ratio into LB medium containing Amp. Three culture temperatures (16°C, 25°C, and 37°C) were set, with eight IPTG concentration gradients (0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, and 1.4 mmol / L) for each temperature, resulting in a total of 24 treatments. A negative control strain was also conducted simultaneously. For the 16°C and 25°C treatments, a shaker was set at 120 r / min for 14 h of induction, while for the 37°C treatment, the shaker was set at 200 r / min for 6 h of induction. IPTG was added to all treatments when ODO reached 0.6 to 0.8. After induction, bacterial cultures were centrifuged. at 10,000 r / min for 1. min, supernatant was discarded, and bacterial pellets were resuspended in 1 mL of PBS, followed by centrifugation at 12,000 rpm for 1 minute to discard the supernatant again. Pellets were then resuspended in 80 uL of PBS, mixed with 20 uL of 5X protein loading buffer, and boiled for 10 to 15 min. SDS-PAGE electrophoresis was performed, followed by Coomassie brilliant blue staining for analysis.

[51] Resolving' gel and stacking' gel for SDSPAGE were prepared as follows:

[52] (1) 10% resolving gel: 1.9 mL of dngO, 1.7 mL of 30% acrylamide, 1.3 mL of 1.5 M Tris-HCl (pH 8.8), 0.05 mL of 10% SDS, 0.05 mL of 10% APS, and 0.002 mL of TEMED.

[53] (2) 5% stacking gel: 1.4 mL of ddHzo, 0.33 mL of 30% acrylamide, 0.25 mL of 0.5 M TrisHCl (pH 6.8), 0.02 mL of 10% SDS, 0.02 mL of 10% Aps, and 0.002 mL of TEMED.

[54] A. theoretical molecular. weight of the recombinant protein is approximately 75.41 kDa. The induction expression of' the recombinant protein was compared. under different culture temperatures and various IPTG concentrations. SDS- PAGE results for the three temperature gradients (16°C, 25°C, and 37°C) are shown in FIGS. 4, 5, and 6, respectively. The results indicate that optimal conditions for protein expression were: induction at 16°C with shaking at 120 r / min for 14 h at an IPTG concentration of 0.2 mmol / L.

[55] Example 3

[56] Recombinant protein solubility analysis and large scale purification

[57] Induction was carried out under the optimal conditions described in Example 2. All bacterial cultures were centrifuged at 6000 r / min for 15 min, and supernatant was discarded. Bacterial cells were then resuspended in 20 mL of sterile PBS. The resuspended bacterial culture was disrupted using a highpressure homogenizer, with a disruption pressure adjusted to about 900 bar and a flow rate adjusted to about 30 L / h, until the bacterial culture became clear. The disrupted. bacterial culture was then centrifuged at 8000 r / min for 20 min, and supernatant was collected. The resulting supernatant was crude protein. The pellet was resuspended again in 20 mL of PBS and thoroughly mixed using a pipette to observe the protein expression within the pellet. All samples were properly labeled.

[58] Results of recombinant protein solubility analysis are shown in FIG. 7, and protein expression may be seen in both the supernatant and the pellet.

[59] The purification of a target protein in the supernatant was carried out using a NiNTA affinity column. Purification steps were as follows:

[60] (1) The NiNTA column, which had been stored in a 20% ethanol solution, was taken out and flushed with PBS for 0.5 h to remove the ethanol inside the column and to compact packing materials within the NiNTA column.

[61] (2) Filtered crude protein solution was loaded onto the NiNTA column, with a flow rate controlled at 5 mL / min, and the sample was reloaded once.

[62] (3) Elution was performed using elution buffers containing different concentrations of imidazole, and eluted peak fractions were collected.

[63] (4) After imidazole elution, the column was rinsed with PBS for 10 min, followed by sealing the NiNTA column with 20% ethanol and storing it in a refrigerator at 4°C for future use.

[64] Purified and collected protein samples were subjected to SDSPAGE, and then transferred onto a PVDF membrane at a constant voltage of 70 \] for 90 min. After washing the membrane three times with TBST, it was blocked with 5% skimmed. milk powder at room. temperature for 1. h. After washing three times with TBST, the membrane was incubated with a mouse antiHIStag primary antibody at 4°C overnight. After washing three times with TBST, the membrane was incubated with an HRPconjugated goat antimouse secondary antibody at room. temperature for 2 h. The membrane was developed using an ECL substrate solution and imaged using a chemiluminescent imaging system. for documentation and analysis.

[65] The successfully identified protein samples were placed into a dialysis bag and dialyzed at 4°C for approximately 24 h, with a dialysis buffer being changed every 2 to 3 h. After completion of dialysis, concentration was performed using sucrose at low temperature until an appropriate volume was reached. A protein concentration was then measured and calculated according to instructions provided in a BCA protein assay kit.

[66] After purification of the supernatant using the Ni NTA column, the resulting recombinant protein was subjected to Western Blot analysis for identification, with results shown in FIG. 8. Correctly identified recombinant protein was then dialyzed and concentrated, and its protein concentration was measured to be 1.98 mg / mL.

[67] Example 4

[68] Immunogenicity validation of the recombinant protein

[69] Purified protein was used to immunize 6weekold New Zealand rabbits (n=3, with 500 ug of recombinant protein injected per rabbit), while control groups (n=3) were injected with PBS. Immunization schedule: A second immunization was conducted 14 days after an initial immunization. Blood samples were collected before immunization, 7 days after the initial immunization, 14 days after the initial immunization, and 7 days after the second immunization. The following indirect ELISA method was used to detect antibody titers:

[70] (1) In a 96well plate, the purified. recombinant protein was used as a coating antigen (2 ug / well) and coated overnight at 4°C.

[71] (2) Coating buffer was discarded, and the plate was washed four times with PBST for 3 min each. The plate was blocked by adding PBST containing 5% BSA at 37°C for 60 min.

[72] (3) The blocking buffer was discarded, and the plate was washed. four times with PBST. Rabbit serunl (primary antibody) was diluted 1:50 in PBST and added to each well, followed by incubation at 37°C for 60 min.

[73] (4) The primary antibody was discarded, and the plate was washed four times with PBST. HRPconjugated goat anti rabbit IgG was diluted 1:5000 in PBST and added to each well, followed by incubation at 37°C for 60 min.

[74] (5) The secondary antibody was discarded, and the plate was washed four times with PBST. TMB substrate solution was added to each. well and incubated. at room temperature in the dark for 5 min. Stop solution was added, and 00450nm value was measured using a microplate reader.

[75] Experimental results are shown in FIG. 9. The titer was significantly higher than that of other groups 7 days after the second immunization, confirming that the recombinant protein was immunogenic and suitable for vaccine development.

[76] Example 5

[77] Establishment of indirect ELISA methodoptimal reaction system

[78] Recombinant protein was diluted. in ELISA. coating buffer at concentrations of 0.5 ug / well, 1.0 ug / well, and 2.0 ug / well for coating. Sera were diluted at 1:100, 1:500, 1:1000, and 1:1500 for primary antibody incubation. HRP conjugated rabbit antibovine IgG was diluted at ratios of 1:2500, 1:5000, 1:10000, and 1:15000 for secondary antibody incubation. A threelevel, threefactor orthogonal experiment was conducted for an antigen, standard positive and negative sera, and an enzymelabeled secondary antibody. Meanwhile, a blank control was set up. After operating according to basic steps of ELISA (i.e., the steps described in Example 4), the OD450Hm value was measured, and data analysis was conducted. The optimal antigen coating concentration, the optimal serum dilution, and the optimal secondary antibody dilution were determined based on principles that the OD450Hm value of positive serum (P value) is around 1.0, the 00450nm value of negative serum (N value) is around 0.1, and the P / N ratio is maximized. Results are shown in Table 1.