mRNA drug that is less expressed in liver after being delivered to body and preparation method therefor

Abstract

An mRNA drug, which reduces expression in the liver after being delivered to the body, and a preparation method therefor. The preparation method comprises: establishing double 3'UTR in a target mRNA, and introducing a miR-122 binding site between the double 3'UTR, so as to effectively reduce the expression of the mRNA drug, which is delivered by means of LNP, in the liver, thereby realizing a specific inhibitory effect of miR-122 while retaining an enhancement effect of miR-122 on mRNA stability and translation efficiency. The mRNA drug can effectively reduce the expression of mRNA in the liver, realizing the efficient expression of the mRNA drug in non-hepatocellular targeted cells or tissues and increasing the effective non-hepatocyte tropism of the mRNA drug.

Description

mRNA drug with low expression in the liver after delivery into the body and preparation method thereof

[0001] The present invention claims priority to Chinese patent application No. 2022113297805, filed with the Patent Office of China on October 27, 2022, entitled “mRNA drug with low expression in the liver after delivery into the body and method for preparing the same”, the entire contents of which are incorporated herein by reference. Technical Field

[0002] The present invention relates to the field of biomedicine technology, and in particular to an mRNA drug capable of reducing the expression of the mRNA drug in the liver after being delivered into the body and a preparation method thereof. Background Art

[0003] Due to the impact of the novel coronavirus, mRNA has come into the spotlight as a new therapeutic agent for preventing and treating various diseases. Messenger RNA (mRNA) is the template that guides protein synthesis and is the messenger that transmits genetic information from DNA to protein. The main sequence of mature mRNA is the coding region, with non-coding regions at both the upstream 5' end and the downstream 3' end. Eukaryotic mRNA molecules also have a 5' cap and a 3' tail structure at both ends. The 5' cap structure plays an important role in the stability and translation of mRNA. It seals the 5' end to protect it from exonuclease hydrolysis. It also serves as a recognition signal for the protein synthesis system and is recognized and bound by the cap binding protein (eIF-4E), prompting the mRNA to bind to the small ribosome subunit and thus initiate the translation process. The 5' untranslated region (5'UTR) is a short sequence between the cap and the start codon of the coding region, which includes the sequence that marks the start of translation. The coding region (ORF), beginning with the start codon (AUG) and ending with the stop codon (UAG, UGA, or UAA), encodes the primary structure of a protein. The secondary structure and codon usage of the coding region can affect translation efficiency. Excessive secondary structure and rare codons can slow translation, so protein expression during genetic engineering is optimized based on the host's codon preference. The 3' untranslated region (3'UTR) is the transcribed sequence following the stop codon and also participates in translational regulation. For example, many microRNAs can bind to the 3' UTR of target gene mRNAs, downregulating their expression by degrading or inhibiting translation. Mature mRNAs typically have a 20-200 base poly(A) tail at their 3' end to protect them from exonuclease degradation. The tail structure is also associated with the translation process and its regulation. For example, polyadenylate binding protein (PABP) can bind to the tail and further interact with multiple proteins such as eIF4G, eIF4B, Paip-1, etc. to form a ring complex, participate in the translation initiation process, and also participate in the mRNA stability regulation process.

[0004] mRNA molecules are large and negatively charged, making it difficult for them to passively cross negatively charged cell membranes. In addition, RNA enzymes in the blood and tissues can rapidly degrade mRNA and induce innate immune responses. In order to achieve therapeutic effects, mRNA requires a safe, effective and stable delivery system to protect the nucleic acid from degradation in the body while delivering mRNA to specific target cells and producing sufficient protein. mRNA drug delivery systems based on lipids, polymers, dendritic molecules and natural membranes have been successfully developed and deliver mRNA to target cells. Currently, the most commonly used mRNA vaccine delivery technologies include lipid nanoparticles (LNP), cationic lipid complexes (LPX), lipid polyplexes (LPP), polymer nanoparticles (PNP), inorganic nanoparticles (INP), cationic nano emulsions (CNE), etc. With the approval of two mRNA vaccines for vaccination to prevent the new coronavirus, LNP has become the most popular delivery technology. The application of mRNA-induced transient protein expression is not only applicable in the field of vaccines for infectious diseases, but also provides new avenues for cancer vaccines, protein replacement therapy and gene editing for rare genetic diseases.

[0005] In vivo, nanoparticles readily nonspecifically adsorb proteins, forming a biomolecular corona at the interface. This corona alters the physicochemical properties of the nanoparticles, significantly impacting their biodistribution and endocytosis. Most current mRNA / LNP delivery methods result in high liver expression upon systemic administration. Studies have shown that apolipoprotein E (ApoE) is a key component of the biomolecular corona. ApoE adsorption on the LNP surface significantly enhances the LNP's affinity for the liver, particularly hepatocytes. ApoE can trigger efficient LNP uptake by hepatocytes through lipoprotein receptor-mediated endocytosis on the hepatocyte surface. Onpattro, Alnylam Pharmaceuticals' first LNP-siRNA drug developed based on the ionizable lipid DLin-MC3-DMA, received FDA approval in August 2018. Onpattro inhibits transthyretin (TTR) expression in the liver for the treatment of polyneuropathy caused by the hereditary disease transthyretin-mediated amyloidosis. Onpattro makes good use of the liver-targeting characteristics of LNP; however, more application scenarios of mRNA drugs require non-liver-targeted mRNA delivery, especially for drugs with hepatotoxicity or systemic toxicity. While achieving local or target tissue and organ delivery expression, it is necessary to find a suitable method to eliminate mRNA delivery to the liver or block mRNA expression in the liver.

[0006] miRNAs (microRNAs) are a group of non-coding RNAs (RNAs) approximately 20 to 23 nucleotides long, encoded by the genome. They primarily act within the 3' untranslated region (UTR) of target gene mRNAs, guiding the silencing complex (RISC) to degrade the mRNA or inhibit its translation through base pairing. miRNAs are highly conserved throughout species evolution, with tissue-specific and temporal expression. They participate in various life processes during development, including cell differentiation, proliferation, and apoptosis. They determine the functional specificity of tissues and cells and are closely associated with the development and progression of numerous diseases.

[0007] miR-122 is a liver-specific miRNA, accounting for 72% of the liver's miRNA content. Under physiological conditions, miR-122 plays an important role in regulating liver cell development, inducing cell differentiation, modulating cell metabolism, and participating in liver cell stress responses. In pathological conditions, miR-122 serves as a sensitive marker for liver damage, and its dysregulation is closely associated with hepatitis C virus (HCV) and hepatocellular carcinoma (HCC). Because miR-122 is specifically and highly expressed in hepatocytes, it can be used in the optimization of mRNA 3'UTRs. By introducing a miR-122 binding site into the optimal 3'UTR sequence, the resulting mRNA is more susceptible to degradation in hepatocytes than in other cell types, thereby reducing its expression in normal hepatocytes while enhancing its effective non-hepatocyte tropism.

[0008] Currently, there has been no in-depth study on how to use microRNA-122 to reduce the expression of mRNA drugs in the liver after delivery into the body.

[0009] Summary of the Invention

[0010] Based on this, the object of the present invention is to provide an mRNA drug that reduces the expression of the mRNA drug in the liver after delivery into the body and a preparation method thereof.

[0011] The technical solutions are as follows.

[0012] The first aspect of the present invention is to provide an mRNA drug that is poorly expressed in the liver after being delivered into the body.

[0013] An mRNA drug that is expressed in small amounts in the liver after being delivered into the body comprises mRNA and a drug carrier, wherein the 3'UTR component of the mRNA comprises two identical or different 3'UTR sequences, and a miR-122 binding site is inserted between the two 3'UTR sequences.

[0014] The second aspect of the present invention is to provide a method for preparing mRNA drugs.

[0015] A method for preparing an mRNA drug comprises including two identical or different 3'UTR sequences in the 3'UTR component of the mRNA, and inserting a miR-122 binding site between the two 3'UTR sequences.

[0016] The third aspect of the present invention is to provide a method for reducing the expression of mRNA drugs in the liver after delivery to the body.

[0017] A method for reducing the expression of an mRNA drug in the liver after delivery to the body, wherein the 3'UTR component of the mRNA in the mRNA drug includes two identical or different 3'UTR sequences, and a miR-122 binding site is inserted between the connection of the two 3'UTR sequences.

[0018] The present invention mainly utilizes liver-specifically expressed miR-122 and its binding site sequence to screen the optimal miR-122 binding site insertion method in the mRNA 3'UTR, that is, to select the 3'UTR sequence and insert the miR-122 binding site in the middle of the double-copy UTR, which can achieve the specific inhibitory effect of miR-122 while retaining its enhancing effect on mRNA stability and translation efficiency. The technology described in the present invention can effectively reduce the expression of mRNA drugs in the liver and achieve efficient expression of other cells or tissues that are not targeted by mRNA drugs. Based on the above findings, the present invention provides an mRNA drug that reduces expression in the liver after delivery to the body, including inserting a miR-122 binding site in the middle of the double-copy UTR of the target mRNA, which can effectively reduce the expression of the delivered mRNA drug in the liver, and the resulting mRNA is more easily degraded in liver cells than other cell types, thereby increasing its effective non-hepatocyte properties. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1. Different UTRs based on HBB 3'UTR 122 Schematic diagram of sequence design.

[0020] Figure 2. Expression of miR-122 in several liver cancer cell lines.

[0021] Figure 3. Different HBB UTRs 122 Inhibition of responses to miR-122 mimics.

[0022] Figure 4. UTR based on AES and mtRNR1 3'UTR 122 Schematic diagram of sequence design.

[0023] Figure 5. UTR based on AES and mtRNR1 3'UTR 122 Inhibition of responses to miR-122 mimics.

[0024] Figure 6. miR-122 mimics carrying different UTRs in HepG2 and Huh7 cells 122 Figure 7. In vivo imaging results of mice intravenously injected with Fluc-2xHBB / LNP and Fluc-2xHBB1.

[0025] Figure 8. Fluc-2xHBB / LNP and Flc-2xHBB 12 Fluorescence intensity statistics of intravenously injected mice in vivo.

[0026] Figure 9. Fluc-2xHBB 122 / In vivo imaging results of mice injected intravenously and subcutaneously with LNP

[0027] Figure 10. Fluc-2xHBB 122 In vivo bioluminescence fluorescence intensity of mice injected intravenously and subcutaneously with LNP.

[0028] Figure 11. In vivo imaging results of mice injected with intratumoral injection.

[0029] Figure 12. Bioluminescence intensity statistics of mice injected intratumorally.

[0030] Figure 13. GFP-2xHBB and GFP-2xHBB 122 Schematic diagram of sequence design.

[0031] Figure 14. Transfected 293T cells and observed under a fluorescence microscope.

[0032] Figure 15. 293T cell flow cytometry statistical results.

[0033] Figure 16. Transfected CHO cells and observed under a fluorescence microscope.

[0034] Figure 17. Flow cytometric analysis results of transfected CHO cells. DETAILED DESCRIPTION

[0035] To facilitate understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the present disclosure more thorough and comprehensive.

[0036] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to manufacturer recommendations. All commonly used chemical reagents used in the examples were commercially available.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this invention pertains. The terms used in this specification are for the purpose of describing specific embodiments only and are not intended to limit the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0038] The 3'UTR region of eukaryotic organisms affects mRNA stability, microRNA-mediated degradation, and protein translation efficiency. There is an optimal length requirement for the 3'UTR, as mRNAs with longer 3'UTRs have shorter half-lives, while mRNAs with shorter 3'UTRs have lower translation efficiency. Commonly used 3'UTRs in mRNA therapy are derived from human α- and β-globins (HBA and HBB, respectively). HBB or HBA 3'UTRs have been widely used to deliver mRNA into various cell types. BioNTech used the SELEX technology to screen naturally occurring 3'UTRs and functionally determined the optimal double-copy UTR element combination (double UTR, dUTR) AES-mtRNR1 and mtRNR1-AES combination for vaccine antigen-encoding mRNA [mtRNR1 (Mitochondrially Encoded 12S RRNA, mitochondrial non-coding 12S rRNA); AES (Amino-terminal enhancer of split, a member of the transcription factor Groucho / TLE family)]. However, they found that, in fact, because the factors regulating mRNA stability are cell type-specific, there may be elements based on AES-mtRNR1 that are not superior to the conventionally used 2HBB 3'UTR.

[0039] The location and number of miRNA binding sites within the mRNA 3'UTR can affect mRNA transcriptional stability and gene delivery in specific cells. The inventors discovered that inserting the miR-122 binding site sequence into the double 3'UTR at an appropriate location (between the two 3'UTRs) effectively reduces the expression of the delivered mRNA drug in normal liver cells while preserving the 3'UTR's inherent influence on mRNA transcriptional stability. This allows for efficient expression in non-hepatocytes.

[0040] In some embodiments of the present invention, an mRNA drug that is expressed in low amounts in the liver after delivery into the body is provided, comprising mRNA and a drug carrier, wherein the 3'UTR component of the mRNA comprises two identical or different 3'UTR sequences, and a miR-122 binding site is inserted between the junction of the two 3'UTR sequences.

[0041] In some embodiments, the sequence of the miR-122 binding site is shown as SEQ ID NO.1.

[0042] In some embodiments, the 3'UTR sequence is the 3'UTR sequence of human hemoglobin β subunit or the AES element and the mtRNR1 3'UTR element.

[0043] In some embodiments, the 3'UTR sequence of the human hemoglobin β subunit is shown as SEQ ID NO.2.

[0044] In some embodiments, the AES element is shown as SEQ ID NO.9.

[0045] In some embodiments, the mtRNR1 element is shown as SEQ ID NO.13.

[0046] In some embodiments, the 3'UTR component consists of the AES element, the miR-122 binding site, and the AES element.

[0047] In some embodiments, the 3'UTR component is composed of the AES element, the miR-122 binding site, and the mtRNR1 AES element.

[0048] In some embodiments, the 3'UTR component consists of the mtRNR1AES element, the miR-122 binding site, and the mtRNR1AES element.

[0049] In some embodiments, the 3'UTR component consists of the 3'UTR sequence of the human hemoglobin β subunit, the miR-122 binding site, and the 3'UTR sequence of the human hemoglobin β subunit.

[0050] In some embodiments, the drug carrier can be various carriers of known mRNA drugs, such as lipid nanoparticles (LNP), complexes and polymer nanoparticles, exosomes, biological microvesicles, etc.

[0051] In some embodiments, the mRNA drug is an mRNA vaccine.

[0052] In some examples, the present invention demonstrated through experimental data that, using a small animal in vivo imaging system, the location and intensity of bioluminescent signals in mice from different dosing groups at different imaging positions and at different times following intravenous administration were observed and analyzed. Following intravenous administration, the bioluminescent signals in each group of mice were primarily distributed in the liver, gradually weakening over time. The drug was largely metabolized and cleared in the Fluc / LNP group by 48 hours of imaging, while it was largely metabolized and cleared in the Fluc-HBB122 / LNP group by 24 hours of imaging.

[0053] Based on the analysis of luminescence signal intensity using a small animal in vivo imaging device, the imaging intensity of the animals at different times and positions was compared and analyzed. The bioluminescence signal values ​​of the Fluc / LNP group were significantly higher than those of the Fluc-HBB122 / LNP group at each time point (p < 0.05).

[0054] The in vivo imaging system was used to analyze the intensity of bioluminescent signals at different times in mice following intravenous and subcutaneous administration. The bioluminescent signals in all groups were primarily located in the liver and gradually weakened over time. In the intravenous group, the ventral fluorescence signal was similar to the lateral fluorescence signal, while in the subcutaneous group, the ventral fluorescence signal was significantly lower than the lateral fluorescence signal.

[0055] Based on the analysis of luminescence signal intensity using a small animal in vivo imaging device, imaging intensities were compared across different time periods and body positions. The bioluminescence signal in each group of mice gradually weakened over time. In the intravenous injection group, the ventral fluorescence signal was similar to the lateral fluorescence signal, while in the subcutaneous injection group, the ventral fluorescence signal was significantly lower than the lateral fluorescence signal.

[0056] Using a small animal in vivo imaging system, the location and intensity of different luminescence signals in mice were observed and analyzed 6 hours after intratumoral injection. Bioluminescence signals in each group were primarily distributed in the tumor and liver regions. The Fluc-2X HBB122 / LNP group showed lower fluorescence signals in both ventral and lateral imaging than the Fluc-2XHBB / LNP group. The Fluc-2XHBB122 / LNP group had stronger luminescence signals in the tumor and weaker signals in the liver. The Fluc-2XHBB / LNP group had stronger signals in both the tumor and liver regions, with similar luminescence signal intensities in the tumor region between the two groups.

[0057] In some embodiments, the experimental data of the present invention also found that, based on the analysis of luminescence signal intensity by a small animal in vivo imaging device, a comparative analysis of the location and intensity of different luminescence signals 6 hours after intratumoral administration in animals showed that the ventral and lateral imaging fluorescence signals of the Fluc-2X HBB122 / LNP group were lower than those of the Fluc-2XHBB / LNP group. The luminescence signal at the tumor site of the Fluc-2XHBB122 / LNP group was stronger, while the luminescence signal at the liver site was weaker. The Fluc-2XHBB / LNP group had stronger signals at both the tumor site and the liver site, and the luminescence signal intensities at the tumor sites of the two groups were the same. The luminescence signal at the liver site of the Fluc-2XHBB / LNP group was 13 times that of the Fluc-2XHBB122 / LNP group.

[0058] Observation under a fluorescence microscope showed that as the miR-122 gene content increased, the GFP expression level in 293T cells transfected with the GFP-2XHBB sequence remained unchanged, while the GFP expression level in 293T cells transfected with the GFP-2XHBB122 sequence gradually decreased.

[0059] The GFP expression level of 293T cells was detected by flow cytometry when 25 nM miR-122 gene was added. The GFP signal of 293T cells transfected with GFP-2XHBB sequence was significantly stronger than that of 293T cells transfected with GFP-2XHBB122 sequence.

[0060] Observation under a fluorescence microscope showed that as the miR-122 gene content increased, the GFP expression level in CHO-K1 cells transfected with the GFP-2XHBB sequence did not change, while the GFP expression level in CHO-K1 cells transfected with the GFP-2XHBB122 sequence gradually decreased.

[0061] The GFP expression level of CHO-K1 cells was detected by flow cytometry when different levels of miR-122 gene were added. There was no obvious change in the GFP signal of CHO-K1 cells transfected with GFP-2XHBB sequence. The GFP signal of CHO-K1 cells transfected with GFP-2XHBB122 sequence gradually weakened with the increase of miR-122 gene content.

[0062] The present invention is further described in detail below with reference to specific embodiments.

[0063] Example 1

[0064] The mRNA in the present invention is synthesized by in vitro transcription using a kit. The sequence encoding Fluc is a publicly available sequence. The present invention uses mRNA encoding Fluc for in vivo mouse evaluation. During the mRNA synthesis of the present invention, in addition to introducing a miR-122 binding site into the 3'UTR, various sites of the mRNA are modified, including capping at the 5' end and adding more than 100 poly A residues to the 3' end, thereby enhancing the stability of the in vitro transcribed mRNA. The designed coding region sequence can be replaced with epitopes of different target genes as needed, making it suitable for the design of different mRNA drugs. In addition, studies have shown that modified nucleotides, such as pseudo-UTP, can replace conventional nucleotides in mRNA. This can enhance the stability of mRNA while reducing the in vivo stress response.

[0065] Example 2: Introducing miR-122 binding sites at different positions in HBB 3'UTR to observe their effects on Fluc mRNA stability

[0066] 1.1 UTR based on HBB 3'UTR 122 Sequence design and gene synthesis

[0067] To test the positional effect of miR-122 binding sites within the 3'UTR, we first considered the sequence structure and selected the 3'UTR sequence of human hemoglobin subunit beta (HBB), one of the most efficiently translated mammalian mRNA sequences. Using a firefly luciferase (Fluc) reporter gene vector, we linked different 3'UTRs to the luciferase reporter gene vector. By measuring the fluorescence intensity produced by the reaction between luciferase and substrate, we indirectly reflected gene expression and determined the effect of different 3'UTR lengths on translation efficiency. Six comparison groups were designed based on the HBB 3'UTR. The sequence design is shown in Figure 1, and the specific sequences are shown in SEQ ID NOs. 3 to 8. Plasmids were synthesized by GenScript. The template plasmid for in vitro transcription (IVT) contains T7 promoter, HBA1-5'UTR, FLuc-CDS, 3'UTR and segmented Poly(A) elements. Different 3'UTRs are inserted with SacⅠ and XhoⅠ restriction sites, and BspQⅠ is used as a linearization restriction site.

[0068] 1.2 Selecting appropriate cell lines for in vitro evaluation

[0069] Literature reports that miR-122 is specifically highly expressed in normal liver tissue and lowly expressed in tumor cells. We used q-PCR to detect the expression of endogenous miR-122 in human liver cancer cell lines HepG2 and Huh-7, and mouse liver cancer cell line HepG1-6; the liver tissue of 7-8 week old female Balb / c colon cancer CT26 subcutaneous tumor-bearing mice was used as a positive control, while the spleen and tumor of mice were used as negative controls. The results are shown in Figure 2. MiR-122 is highly expressed only in mouse liver tissue, with low expression in spleen and tumor, while miR-122 expression in human liver cancer cell lines HepG2 and Huh-7 and mouse liver cancer cell line HepG1-6 is as low as near baseline values. Therefore, HepG2, Huh-7 and HepG1-6 cell lines can all be used to evaluate different 3'UTRs in vitro. 122 For the response to miR-122, we selected Huh-7 cells with the highest transfection efficiency in subsequent in vitro evaluations.

[0070] 1.3 Cell experiments to observe different HBB UTRs 122 Responsiveness to miR-122 mimics

[0071] miR-122 has two mature forms, one of which is hsa-miR-122-5p, Accession number MIMAT0000421; the other is hsa-miR-122-3p, Accession number MIMAT000 4590. We synthesized hsa-miR-122-5p (CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGCUAGGC, SEQ ID NO. 21) as miR-122 mimics. The different plasmids shown in Figure 2 were digested (BspQⅠ) to obtain linearized templates, and then purified by IVT to obtain Fluc mRNA with different 3'UTRs. 1 μg of mRNA was co-transfected with different doses of miR-122 mimics (0-25 nM) into Huh7 cells. After 24 hours, the cells were lysed and Luciferase substrate was added. The Fluc activity was detected using a multi-label microplate reader to indicate the translation efficiency of Fluc mRNA. The expression of different UTRs was analyzed. 122 Responsiveness to miR-122.

[0072] The results are shown in Figure 3. MiR-122 mimics dose-dependently inhibited Fluc mRNA expression in all sites containing miR-122 binding sites, and showed significant differences in the position effect of HBB UTR122. From the maximum dose-response inhibition data, the HBB-122-HBB structure design was the best (46% inhibition relative to baseline), followed by HBB-HBB-122 (25%). The baseline values ​​(Fluc activity when not transfected with mimics) of both were also high, suggesting that the design scheme of placing the miR-122 binding site sequence between two 3'UTR elements has the best inhibitory effect on the effect of miR-122. This may provide an optimal 3'UTR design strategy for using miR122 to reduce the expression of mRNA drugs in the liver, and it is also of reference significance for the integration design of other miRNA binding sites in the 3'UTR.

[0073] 2. Confirm that the miR-122 binding site is located in the middle of the double-copy UTR element for optimal effect

[0074] 2.1 UTR based on AES and mtRNR1 3′UTR 122 Sequence design and gene synthesis

[0075] It was previously found that the insertion of the miR-122 binding site into the middle of the double-copy HBB element has the best mRNA repression and regulation effect. To further prove that the design strategy of introducing the miR-122 binding site in the middle of the double-copy UTR element is the best, the AES and mtRNR1 3'UTR elements used by BioNTech in the new crown mRNA vaccine BNT162b were selected, and the miR-122 binding site was located between two identical or different 3'UTRs in the form of X122X, Y122Y and X122Y as experimental examples, and the miR-122 binding site was located at the end of two identical or different 3'UTRs in the form of XX122, YY122 and XY122 as comparative examples, and compared and verified by cell experiments. Referring to 1.1, a total of 9 sequences were designed as shown in Figure 4, and the specific sequences are shown in SEQ ID NO.10-NO.19. The Fluc reporter plasmid for IVT was constructed and synthesized by GenScript.

[0076] 2.2 Cell experiments observing different AES and mtRNR UTR 122 Responsiveness to miR-122 mimics

[0077] Referring to 1.3, the different mRNAs shown in Figure 4 were co-transfected with miR-122 mimics for 24 hours and then Fluc activity was analyzed; the results are shown in Figure 5. Although the baseline values ​​of Fluc did not change after different UTRs introduced miR-122 binding sites, the Fluc activity was not consistent from different UTRs. 122The inhibition rate of miR-122 mimics showed that AES-122-AES>AES-AES-122, mtRNR1-122 mtRNR1>mtRNR1-mtRNR-122, and AES-122-mtRNR1>AES-mtRNR1-122, indicating that the miR122 binding site placed in the middle of the double-copy 3'UTR element has a significantly better effect on miR-122 mimics than the terminal position. This is consistent with the results of the HBB UTR-based 122 The screening results were consistent with those of the previous studies, proving that the design strategy X122X is better than XX122, and X122Y is also better than XY122. This is also applicable to the application of 3'UTR to other miRNA binding sites in mRNA drug design.

[0078] 2.3 UTRs in different cells 122 Differential responsiveness to miR-122 mimics

[0079] 3'UTR regulates mRNA stability and translation efficiency differently in different physiological and cellular states. 122 (HBB-122-HBB, AES-122-AES, mtRNR1-122-mtRNR1 and AES-122-mtRNR1) have slightly different effects on the translational regulation of Fluc-mRNA and the response inhibition to miR-122 mimics in human liver cancer cell lines HepG2 and Huh7. As shown in Figure 6, in HepG2 cells, the Fluc-mRNA carrying HBB-122-HBB and mtRNR1-122-mtRNR1 had the highest luciferase activity and the best response to miR-122 mimics, while AES-122-mtRNR1 performed the worst; but in Huh7 cells, the four UTRs 122 The performance was similar, with AES-122-mtRNR1 even slightly better. This suggests that while the effects of 3'UTR sequences on mRNA stability and translation vary across cells, the analysis of microRNA responses to specific 3'UTR-carried microRNA binding sites is not significantly different across cells.

[0080] In summary, using the luciferase reporter gene vector, different designs of 3'UTR 122 Connected to the luciferase reporter gene vector, through in vitro cell mRNA and miR-122 mimics co-transfection experiments, the fluorescence intensity generated by the reaction of luciferase and substrate was detected to indirectly reflect the Fluc expression level and analyze the expression inhibition effect, thereby determining the optimal 3'UTR 122Design strategy. Screening results revealed that placing the miR-122 binding site in the middle of a double-copy 3'UTR element achieved the most effective specific response inhibition of miR-122. On the other hand, the choice of UTR element may need to be determined based on the specific application, but human α- and β-globin are naturally highly expressed genes and remain ideal mRNA 3'UTR choices in most cases. This is further enhanced by using a double-copy β-globin 3'UTR (2xHBB).

[0081] Example 3 In vivo experiments in mice to verify Fluc-2xHBB 122 Non-hepatocyte translation efficiency

[0082] Currently, tissue targeting of LNP is mainly limited to the liver. We used microfluidics technology to produce LNPs with a particle size of approximately 100 nm, and encapsulated Fluc mRNA carrying HBB-122-HBB or HBB-HBB 3'UTR into LNP nanoparticles. The test products were named Fluc-2xHBB 122 / LNP and Fluc-2xHBB / LNP. The Fluc-2xHBB carrying HBB-122-HBB was verified by intravenous injection (iv), subcutaneous injection (sc) and intratumoral injection (i.Tu). 122 Compared with Fluc-2xHBB / LNP, FLuc-2xHBB / LNP has the characteristic of reducing FLuc mRNA expression in the liver, which proves that inserting a miR-122 binding site in the middle of the double-copy 3'UTR can achieve increased mRNA effective non-hepatocyte delivery expression in vivo.

[0083] 3.1 Intravenous route

[0084] Female BALB / c mice aged 7-8 weeks were divided into two groups according to their body weight: BB / LNP group, Fluc-2xHBB group 122 Each mouse was injected intravenously and the bioluminescent signals in the ventral and lateral directions of the mouse were observed using an in vivo imaging system.

[0085] The results are shown in Figure 7. 4 hours after drug injection, the bioluminescent signals of mice in each group were mainly distributed in the liver area and gradually weakened over time. The fluorescent signal of the Fluc-2xHBB / LNP group basically disappeared at 48 hours, and the Fluc-2xHBB 122 / LNP group fluorescence signal duration <24h; 122 The bioluminescent signal value of the Fluc-2xHBB / LNP group was significantly lower than that of the Fluc-2xHBB / LNP group at each time point (p<0.001) (Figure 8).122 / LNP group delivered Fluc mRNA stability cultivated land, carrying 2xHBB 122 It effectively reduces the expression of mRNA in the liver, making mRNA drugs more easily degraded in liver cells.

[0086] 3.2 Subcutaneous injection

[0087] 7-8 week old female BALB / c mice were divided into two groups according to body weight: Fluc-2xHBB 122 / LNP(iv) group, Fluc-2xHBB 122 / LNP (sc) group (n=3), the dosage of each group was 10 μg / mouse, and the bioluminescent signals in the ventral direction and the subcutaneous administration side of the mice were observed using a small animal living imaging device at 4h, 8h, and 24h after administration.

[0088] The results are shown in Figure 9. 4 hours after administration, the bioluminescent signals of mice in each group were mainly distributed in the liver area, and the signals gradually decayed over time. 122 The ventral imaging fluorescence signal of the / LNP(iv) group was close to the lateral imaging fluorescence signal, and the Fluc-2xHBB 122 The fluorescence signal of the ventral imaging of the / LNP(sc) group was significantly lower than that of the lateral imaging (Figure 10). Because ventral imaging can fully expose the fluorescence signal of the liver, Fluc-HBB 122 The signal in the liver was significantly reduced after subcutaneous injection of Fluc-2xHBB, but the signal at the injection site was higher and the fluorescence signal lasted for more than 24 hours. 122 / LNP can effectively reduce the expression of mRNA drugs in the liver when injected subcutaneously.

[0089] 3.3 Intratumoral injection

[0090] A subcutaneous MC38 tumor-bearing model was established in 7-8 week old female C57BL / 6 mice. 3 The patients were divided into two groups according to the tumor volume and intratumorally injected: Fluc-2xHBB / LNP group Fluc-2xHBB 122 / LNP group (n=3), the dosage of each group was 5μg / mouse, and in vivo imaging was performed 6 hours after administration. The bioluminescent signals in the ventral direction and the subcutaneous administration side of the mice were observed using a small animal in vivo imaging device, and the tumors and livers of the mice were imaged in vitro.

[0091] The results are shown in Figure 11. 6 hours after administration, the bioluminescent signals of mice in each group were mainly distributed in the tumor and liver areas. 122The ventral and lateral fluorescence signals of the Fluc-2xHBB / LNP group were lower than those of the Fluc-2xHBB / LNP group. 122 The luminescence signal of the tumor site in the Fluc-2xHBB / LNP group was stronger, and the luminescence signal of the liver site was weaker; the luminescence signal of the Fluc-2xHBB / LNP group was stronger in both the tumor site and the liver site. The luminescence signal intensities of the tumor sites in the two groups were the same, but the luminescence signal of the liver site in the Fluc-2xHBB / LNP group was weaker. 122 The results showed that the serum creatinine level in the 1:100 nmol / LNP group was 13 times that of the 1:100 nmol / LNP group ( FIG12 ).

[0092] It can be seen that under the intratumoral administration method, compared with the Fluc-2xHBB / LNP group, the Fluc-2xHBB 122 The / LNP group can greatly reduce the expression of the delivered mRNA drug in the liver, while not affecting the expression of the mRNA drug in the tumor site.

[0093] 3.4. Synthetic GFP-2xHBB in normal cell lines 122 Sequence verification

[0094] Previously, we used a luciferase (Fluc) reporter gene vector to screen the optimal UTR in human hepatoma cell lines. 122 and confirmed by in vivo imaging of mice with 2xHBB 122 It can reduce the expression of mRNA drugs in the liver without affecting the expression of the injection site (subcutaneous injection point and tumor). In addition, we used the green fluorescent protein gene GFP to 122 The miR-122 mRNA was connected to a GFP gene vector (Figure 13) and transfected into normal cell lines 293T and CHO cells. Fluorescence microscopy imaging or flow cytometric analysis were used to effectively determine the negative regulatory effect of miR-122 binding sites on GFP mRNA mediated by 3'UTR.

[0095] 3.4 Transfection of 293T cells

[0096] Referring to the above method, IVT obtained GFP-2xHBB and GFP-2xHBB shown in Figure 13 122 mRNA, 1 μg mRNA was co-transfected with 5nM, 10nM, and 25nM miR-122 mimics into 293T cells using nucleic acid transfection reagents. Fluorescence microscopy showed that as the amount of miR-122 mimics increased, the GFP fluorescence intensity in the 293T cells transfected with GFP-2xHBB mRNA did not change significantly, while that in the 293T cells transfected with GFP-2xHBB 122The GFP intensity of 293T cells with mRNA gradually decreased with the increase of miR-122 mimics content (Figure 14). The GFP expression level (MFI, mean fluorescence intensity) of 293T cells was detected by flow cytometry when 25nM miR-122 mimics were added. 122 The expression of GFP-2xHBB transfected cells was significantly lower than that of GFP-2xHBB transfected cells ( FIG. 15 ).

[0097] 5.4.2 Transfection of CHO cells

[0098] GFP-2xHBB and GFP-2xHBB 122 The results of transfection of CHO cells with different doses of miR-122 mimics were consistent with those of transfection of 293T cells. As shown in Figure 16, fluorescence microscopy showed that as the content of miR-122 mimics increased, the transfection of GFP-2xHBB 122 The GFP fluorescence intensity of CHO cells transfected with GFP-2xXHBB mRNA gradually decreased, while the GFP fluorescence intensity of CHO cells transfected with GFP-2xXHBB mRNA did not change significantly. 122 The GFP signal of CHO cells transfected with GFP-2xHBB mRNA gradually decreased with the increase of miR-122 mimics content, while there was no obvious change in CHO cells transfected with GFP-2xHBB mRNA.

[0099] The above-mentioned in vitro cell experiments based on the GFP gene demonstrated that the introduction of a miR-122 binding site in the middle position of the double-copy HBB 3'UTR could effectively reduce the expression of mRNA drugs in cells containing a large amount of miR-122.

[0100] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. An mRNA drug that is less expressed in the liver after being delivered to the body, wherein, It includes mRNA and a drug carrier. The 3'UTR component of the mRNA includes sequences of two identical or different 3’UTRs, and a miR-122 binding site is inserted between the connections of the two 3’UTR sequences.

2. The mRNA drug according to claim 1, wherein The sequence of the miR-122 binding site is as shown in SEQ ID NO.

1.

3. The mRNA drug according to claim 1, wherein The 3’UTR sequence is selected from the 3'UTR sequence of human hemoglobin beta subunit, AES element, and mtRNR1 3’UTR element.

4. The mRNA drug according to claim 3, wherein, The 3'UTR sequence of the human hemoglobin beta subunit is as shown in SEQ ID NO.

2.

5. The mRNA drug according to claim 3, wherein, The AES element is as shown in SEQ ID NO.

9.

6. The mRNA drug according to claim 3, wherein, The mtRNR1 element is as shown in SEQ ID NO.

13.

7. The mRNA drug according to any one of claims 1-6, wherein, The 3'UTR component is composed of the AES element, the miR-122 binding site, and the AES element.

8. The mRNA drug according to any one of claims 1-6, wherein, The 3'UTR component is composed of the AES element, the miR-122 binding site, and the mtRNR1 AES element.

9. The mRNA drug according to any one of claims 1-6, wherein, The 3'UTR component is composed of the mtRNR1 AES element, the miR-122 binding site, and the mtRNR1 AES element.

10. The mRNA drug according to any one of claims 1-6, wherein, The 3'UTR component is composed of the 3'UTR sequence of the human hemoglobin beta subunit, the miR-122 binding site, and the 3'UTR sequence of the human hemoglobin beta subunit.

11. The mRNA drug according to any one of claims 1-6, wherein, The drug carrier is a lipid nanoparticle, complex, polymer nanoparticle, exosome, or biomicrovesicle.

12. The mRNA drug according to any one of claims 1-6, wherein, The mRNA drug is an mRNA vaccine.

13. A method for preparing an mRNA drug, wherein, It includes the following steps: In the 3'UTR component of the mRNA, include sequences of two identical or different 3’UTRs, and insert a miR-122 binding site between the connections of the two 3’UTR sequences.

14. A method for reducing the low expression of an mRNA drug in the liver after delivery to the body, wherein, In the 3'UTR component of the mRNA in the mRNA drug, include sequences of two identical or different 3’UTRs, and insert a miR-122 binding site between the connections of the two 3’UTR sequences.

Images