Methods for treating FET rearranged cancers with ATR inhibitors or CHK1 inhibitors

Abstract

The present disclosure provides methods for determining whether a cancer patient will benefit from treatment with an ATR inhibitor or CHK1 inhibitor. These methods are based on screening a cancer patient for gene rearrangements in FET. Also disclosed herein are methods for enhancing sensitivity to ATR inhibitor / CHKl inhibitor therapy in cancer patients comprising administering to the subject an effective amount of an ATM inhibitor.

Description

Atty. Dkt. No.115872-2946 METHODS FOR TREATING FET REARRANGED CANCERS WITH ATR INHIBITORS OR CHK1 INHIBITORS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No.63 / 461,863, filed April 25, 2023, the contents of which are incorporated herein by reference in their entireties. STATEMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with government support under CA008748 awarded by the National Institutes of Health. The government has certain rights in the invention. TECHNICAL FIELD

[0003] The present technology relates generally to methods for determining whether a cancer patient will benefit from treatment with an ATR inhibitor or CHK1 inhibitor. These methods are based on screening a cancer patient for gene rearrangements in FET. Also disclosed herein are methods for enhancing sensitivity to ATR inhibitor / CHK1 inhibitor therapy in cancer patients comprising administering to the subject an effective amount of an ATM inhibitor. BACKGROUND

[0004] The following description of the background of the present technology is provided simply as an aid in understanding the present technology and is not admitted to describe or constitute prior art to the present technology.

[0005] The DNA damage response (DDR) is a tightly regulated and redundant network that tailors specific repair complexes to address a diverse set of genotoxic insults. In cancer, genetic loss of certain DDR components creates tumor-specific vulnerabilities that can be therapeutically exploited1. The canonical example of DDR synthetic lethality is the use of poly-ADP ribose polymerase (PARP) inhibitors to target defective homologous recombination (HR) repair in BRCA1 / 2 mutant breast and ovarian cancers2,3. The broader applicability of DDR-directed therapies in cancers without genetic DDR alterations and whether oncogenes create vulnerabilities within DDR networks remains to be defined. SUMMARY OF THE PRESENT TECHNOLOGY

[0006] In one aspect, the present disclosure provides a method for selecting a cancer patient for treatment with an ATR inhibitor or a CHK1 inhibitor comprising detecting the presence of at least one FET fusion oncoprotein in a biological sample obtained from the 1 4868-5555-9605.1Atty. Dkt. No.115872-2946 cancer patient; and administering an effective amount of an ATR inhibitor or a CHK1 inhibitor to the cancer patient. In another aspect, the present disclosure provides a method for treating cancer in a patient in need thereof comprising administering an effective amount of an ATR inhibitor or a CHK1 inhibitor to the patient, wherein the patient comprises at least one FET fusion oncoprotein. The at least one FET fusion oncoprotein may comprise an N-terminal intrinsically disordered region (IDR) of a FET protein fused to a DNA binding domain of a transcription factor. In some embodiments, the FET protein is EWS, FUS, or TAF15. Additionally or alternatively, in certain embodiments, the transcription factor is an ETS transcription factor family gene, such as FLI1, ERG, ETV1, ETV4, and FEV. In other embodiments, the transcription factor is NFATC2, PATZ1, WT1, DDIT3, CREB1, CREB, ATF1, CREM, PBX1, PBX3, ZNF444, POU5F1, ATF1, KLF17, CREB3L1, CREB3L2, CREB3L3, CREBL1, NR4A3, SMAD3, or TFCP2. Examples of FET fusion oncoproteins include, but are not limited to, EWS-FLI1, EWS-ERG, EWS- ETV1, EWS-ETV4, EWS-FEV, FUS-FLI1, FUS-ERG, FUS-ETV1, FUS-ETV4, FUS- FEV, TAF15-FLI1, TAF15-ERG, TAF15-ETV1, TAF15-ETV4, TAF15-FEV, EWS- NFATC2, FUS-NFATC2, EWS-PATZ1, EWS-WT1, FUS-DDIT3 , EWS-DDIT3, EWS- CREB1, EWS-CREB, FUS-CREB, EWS-ATF1, FUS-ATF1, EWS-CREM, FUS-CREM, EWS-PBX1, EWS-PBX3, EWS-ZNF444, EWS-POU5F1, EWS-ATF1, EWS-KLF17, FUS- PBX1, FUS-PBX3, FUS-ZNF444, FUS-POU5F1, FUS-ATF1, FUS-KLF17, EWS- CREB3L1, FUS-CREB3L2, EWS-CREB3L2, EWS-CREB3L3, FUS-CREB3L1, EWS- CREBL1, EWSR1-NR4A3, TAF15-NR4A3, EWS-SMAD3, EWS-TFCP2 and FUS- TFCP2.

[0007] In any of the preceding embodiments of the methods disclosed herein, the at least one FET fusion oncoprotein is detected via next-generation sequencing, PCR, real- time quantitative PCR (qPCR), digital PCR (dPCR), Southern blotting, Reverse transcriptase-PCR (RT-PCR), Northern blotting, microarray, dot or slot blots, in situ hybridization, fluorescent in situ hybridization (FISH), Western blotting, enzyme-linked immunosorbent assays (ELISA), immunohistochemistry, immunofluorescence, immunoprecipitation, immunoelectrophoresis, or mass-spectrometry. Additionally or alternatively, in some embodiments, the biological sample obtained from the cancer patient comprises biopsied tumor tissue, whole blood, plasma, or serum.

[0008] Also disclosed herein are methods for sensitizing a cancer patient to therapy with an ATR inhibitor or a CHK1 inhibitor comprising administering to the cancer patient an 2 4868-5555-9605.1Atty. Dkt. No.115872-2946 effective amount of an ATM inhibitor separately, sequentially or simultaneously with the ATR inhibitor or the CHK1 inhibitor. Examples of ATM inhibitors include, but are not limited to AZD-7648, AZD1390, berzosertib, KU55933, caffeine, KU-60019, AZD0156, VE-821, Camonsertib (RP-3500), Lartesertib, CP-466722, Ro 90-7501, CGK733, AZ32, ETP-46464, AZ31, A011, ATM Inhibitor-1, ATM Inhibitor-3, ATM Inhibitor-4, or ATR- IN-15.

[0009] In any of the preceding embodiments of the methods disclosed herein, the patient suffers from or is diagnosed with Ewing’s sarcoma (ES), desmoplastic small-round- cell tumors, myxoid liposarcoma, angiomatoid fibrous histiocytoma, intracranial mesenchymal tumors, primary pulmonary myxoid sarcoma, clear cell sarcomas, clear cell sarcoma-like gastrointestinal tumors, mesothelioma, myoepithelioma, sclerosing epithelioid fibrosarcoma, low-grade fibromyxoid sarcoma, extraskeletal myxoid chondrosarcoma, fibroblastic tumors, and epithelioid or spindle cell rhabdomyosarcoma.

[0010] In any and all embodiments of the methods disclosed herein, the ATR inhibitor is selected from the group consisting of elimusertib (BAY1895344), Schisandrin B, NU6027, dactolisib (NVP-BEZ235), ETP-46464, Torin 2, AZ20, Gartisertib (VX-803), berzosertib (M6620 (VX-970)), VE-821, Camonsertib, Abd110, CGK733, Garcinone C, ATR-IN-14, ATR-IN-10, ATR-IN-19, ATR-IN-15, ATR-IN-21, ATR-IN-17, ATR-IN-20, and ceralasertib (AZD6738). In any and all embodiments of the methods disclosed herein, the CHK1 inhibitor is selected from the group consisting of AZD7762, LY2603618, MK-8776 (SCH 900776), PF-00477736, LY2606368 (Prexasertib), CCT244747, CHIR-124, GNE- 783, GNE-900, PD-321852, PD-407824, SAR-020106, SB-218078, 3-alkoxyamino-5- (pyridin-2-ylamino)pyrazine-2-carbonitriles, 1-(5-chloro-2-alkoxyphenyl)-3-(5- cyanopyrazin-2-yl)ureas, S1181 and V158411. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] FIGs.1A-1F: ES cells are dependent on HR factors for survival. FIG.1A: Schematic of CRISPRi genetic screen of 7,000 cancer associated genes in ES cell line A673. FIG.1B: Volcano plot of sgRNA log2fold change (X-axis) vs −log10(p value), average of 2 biologic replicates. FIGs.1C-1E: Growth assays in dCas9 expressing ES cell lines upon introduction of 2 independent sgRNAs against BRCA1, PALB2, or control. n = 4. FIG.1F: Growth assays in ES cell line A673 with doxycycline-inducible shRNA against 3 4868-5555-9605.1Atty. Dkt. No.115872-2946 EWS-FLI1. For all panels, error bars represent ± SEM, **p < 0.01 by one-way ANOVA with post hoc Tukey’s HSD test.

[0012] FIGs.2A-2E: ES patient tumors do not display the genomic scars of HR deficiency. FIG.2A: Weight of mutational signature 3 shown for BRCA mutant, wildtype and ES tumor samples. FIG.2B: Total number of unique deletions per sample. FIG.2C: Size of MuTect deletions compared across tumor groups. FIG.2D: For all samples, deletions were first subdivided into specific base pair (bp) length bins, then the fraction of deletions with 2–6bp microhomology (MH) was plotted (Y-axis) vs. the fraction of deletions present in this bin (X-axis). FIG.2E: Breakout of the 7–28bp deletion length bin showing the distribution of deletions with microhomology (2–6bp). For all panels, *** denotes p< 0.001, ns denotes not significant by Mann-Whitney test.

[0013] FIGs.3A-3E: EWS-FLI1 impairs resection-dependent DSB repair. FIG. 3A: Schematic of DSB repair. DSBs either undergo direct repair via c-NHEJ or bidirectional end-resection to create an intermediate for HR, alt-EJ, or SSA. FIGs.3B-3E: Relative repair efficiency as measured by GFP positivity in pathway-specific DSB repair reporters for HR (DR-GFP), alt-EJ (EJ2), SSA, and c-NHEJ (EJ5) upon expression of empty vector (EV), EWS-FLI1, or siRNA gene knockdown for 72 hours. For all panels, error bars represent ± SEM, ** denotes p < 0.01 by one-way ANOVA with post hoc Tukey’s HSD test. n=4 for all panels.

[0014] FIGs.4A-4F: ATM activation and signaling is defective in ES. FIGs.4A- 4B: Western blotting (FIG.4A) and quantification (FIG.4B) after IR (5 Gy) at indicated time points in an ES cell line (A673) with doxycycline-inducible shRNA against EWS- FLI1. h denotes hours. FIG.4C: Representative Western blot upon 200 ng / ml neocarzinostatin (NCS) treatment for optimal ATR induction at indicated time points in an ES cell line A673 with doxycycline(dox)-inducible shRNA against EWS-FLI1. FIG.4D: Representative Western blot upon IR (5 Gy) at indicated time points in non-ES cancer cell line (U2OS) upon expression of EV (empty vector) or EWS-FLI1. Quantification of Western blotting in FIGs.11B–11D. FIG.4E: p-H2AX intensity by flow cytometry in non-ES (U20S) cells post-IR (5 Gy) after expression of EV or EWS-FLI1. Control experiments with ATMi treatment (KU-55933, 1μM) or shRNA against Ligase IV (LIG4), p < 0.05 for all comparisons using one-way ANOVA with post hoc Tukey’s HSD test. FIG.4F: ATR inhibitor (VE-821) dose-response curves for ES cell line A673 with dox- 4 4868-5555-9605.1Atty. Dkt. No.115872-2946 inducible shRNA against EWS-FLI1 and non-ES cell line (U2OS), p<0.05, paired t-test. For all panels, error bars represent ± SEM for at least 3 replicates for each panel.

[0015] FIGs.5A-5I: Loss of native EWS phenocopies the DNA repair defects caused by EWS-FLI1. FIGs.5A-5B: Representative images and quantification of laser micro-irradiation in GFP-EWS expressing non-ES cells (U2OS) + / − EWS-FLI1 expression. n = 40 cells. FIGs.5C-5F: Relative repair efficiency in pathway-specific DSB repair reporters in U2OS cells. GFP positivity for HR (DR-GFP), alt-EJ (EJ2), SSA, and c-NHEJ (EJ5) upon siRNA knockdown of native EWS or siScramble (siSCR) control assessed at 72 hours. FIG.5G: Representative Western blot upon IR (5Gy) at indicated time points in a non-ES cell line(U2OS) after 72 hours siRNA treatment (siEWS or siSCR). Quantification of Western blotting shown in FIGs.12C-12E. FIG.5H: Proximity ligation assay (PLA) between native EWS and p-H2AX in U2OS cells upon IR (10Gy) at indicated time points. FIG.5I: p-H2AX intensity measured by flow cytometry after 5 Gy IR in U20S cells infected with shRNA against native EWS or empty vector (EV) control. p<0.05 by paired t- test. For all panels, error bars represent ± SEM, ** denotes p < 0.01 by paired t-test with at least 3 replicates for each panel.

[0016] FIGs.6A-6J: FET fusion oncoproteins are recruited to DNA DSBs. FIG. 6A: Structure schematic of FET proteins with N-terminal intrinsically disordered regions (IDR) and C-terminal Arginine-glycine-glycine (RGG) repeats, not present in FET fusion oncoproteins like EWS-FLI1. FIGs.6B-6G: Representative images and quantification of protein accumulation at laser-induced DSBs in U2OS cells expressing either GFP-EWS (FIGs.6B-6C), GFP-EWS-FLI1 (FIGs.6D-6E), or GFP-EWS-ATF1 (FIGs.6F-6G). Quantification of at least 30 cells in 3 replicates. FIGs.6H-6I: Representative Western blot upon 5 Gy IR (FIG.6H) or 200 ng / ml NCS treatment (FIG.6I) at indicated time points in CCS cell line SU-CCS-1 upon 72 hour siRNA treatment against EWS-ATF1 or Scramble (siSCR) control. Quantification in FIGs.13D-13F. FIG.6J: ATR inhibitor (VE-821) dose- response curves for CCS cell line SU-CCS-1 upon siRNA against EWS-ATF1 or siSCR, p<0.05 by paired t-test, n-3. For all panels, error bars represent ± SEM, at least 3 replicates for each panel.

[0017] FIG.7: Model of native FET proteins and EWS-FLI1 in DSB repair. Schematic of FET proteins coordinating early DSB repair responses including rapid c- NHEJ repair and slower ATM activation and resection-dependent DSB repair. In ES, 5 4868-5555-9605.1Atty. Dkt. No.115872-2946 EWS-FLI causes premature loss of native EWS resulting in impaired ATM activation / signaling and resection-dependent DSB repair.

[0018] FIGs.8A-8G: ES cells are dependent on HR factors for survival. FIG.8A: Representative crystal violet staining of 72 hour growth assay in dCas9 expressing A673 ES cells upon introduction of 2 independent sgRNAs against BRCA1, PALB2, or control. FIG.8B: Relative knockdown of each sgRNA by qPCR, n = 3. FIGs.8C-8D: Growth assays in dCas9 expressing cancer cell lines upon introduction of 2 independent sgRNAs against BRCA1, PALB2, or control, n = 4, 4. FIG.8E: Western blot of EWS-FLI1 levels in A673 with doxycycline-inducible shRNA against EWS-FLI1. FIGs.8F-8G: Volcano plot of sgRNA log2fold change relative to DMSO control (X-axis) vs -log10(p value). For all panels, * denotes p< 0.05, ** denotes p < 0.01, ns denote not significant by one-way ANOVA with post hoc Tukey’s HSD test.

[0019] FIGs.9A-9I: ES patient tumors do not display the genomic scars of HR deficiency. FIG.9A: Mutational signature breakdown for BRCA mutant (MUT) / wildtype (WT) and ES tumors. FIG.9B: Total number of unique deletions per sample. FIG.9C: Deletion length per sample. FIG.9D: Deletion size per tumor sample shown individually for MuTect and Delly deletion calls. FIG.9E: Deletion size / microhomology (MH) profile for only BRCA WT and BRCA MUT samples showing separation between the groups present in the 7-28bp and 29-45bp bins in both the fraction of events in deletion size bin (X- axis) and percentage of MH (Y-axis). FIG.9F: Graph of Fisher test significance (p value) for deletion lengths and MH status. FIG.9G: Breakout of the 29-45 base pair (bp) deletion length bin showing the fraction of deletions with 2-6 bp microhomology. FIGs.9H-9I: Signature 3 weight (FIG.9H) and 2-6bp breakpoint MH in the 7-28bp deletion bin (FIG. 9I) in ES samples subdivided by TP53 and STAG2 mutational status. ES WT are wildtype for p53 and STAG2. For all panels, *** denotes p< 0.001 by Mann-Whitney test, ns denotes not significant.

[0020] FIGs.10A-10F: EWS-FLI1 impairs resection-dependent DSB repair. FIG. 10A: Gating schema for pathway-specific DSB repair reporter assays in U2OS cells using dual promoter vector expressing mTagBFP and EWS-FLI1 (or empty vector, EV), followed by introduction of mCherry-I-SceI endonuclease. GFP positivity is measured at 72 hours. FIG.10B: Representative Western blot showing EWS-FLI1 expression level in DSB repair reporter assays. FIG.10C: Western blot showing knockdown of relevant DSB repair genes. FIG.10D: Cell cycle profiles using EdU incorporation in U2OS cells + / - EWS- 6 4868-5555-9605.1Atty. Dkt. No.115872-2946 FLI1. FIG.10E: Cell cycle profiles using Propidium Iodide (PI) + / - EWS-FLI1. FIG. 10F: Analysis of published RNAseq data in A673 (ES cells) with EWS-FLI1 knockdown. Blue denotes canonical EWS-FLI1 targets, red / green denotes resection-dependent and independent DNA repair genes respectively.

[0021] FIGs.11A-11K: ATM activation and signaling is defective in ES. FIG.11A: Western blotting upon 5 Gy IR at indicated time points in an ES cell line A673 with doxycycline(dox)-inducible shRNA against EWS-FLI1. FIGs.11B-11D: Quantification of Western blotting upon IR (5 Gy) at indicated time points in a non-ES cancer cell line (U2OS) upon expression of EV (empty vector) or EWS-FLI1. FIGs.11E-11F: Western blotting upon 5 Gy IR (D) or 200 ng / ml NCS treatment (FIG.11E) at indicated time points in U2OS cells upon expression of EV or EWS-FLI1. FIG.11G: Quantification of p-ATM foci upon 5 Gy IR at indicated time points in ES cell line A673 with doxycycline(dox)- inducible shRNA against EWS-FLI1. n = 100 cells. FIG.11H: Quantification of pH2AX foci upon 5 Gy IR at indicated time points in non-ES cancer cell line (U2OS) upon EV or EWS-FLI1, n = 200 cells. FIG.11I: CHK1 inhibitor dose-response curves in A673 with dox-inducible shRNA against EWS-FLI1, p<0.05 by paired t-test, n=3. FIGs.11J-11K: ATR inhibitor (VE-821) dose-response curves for ES cell line A673 + / - RNAseH1 overexpression and confirmatory Western blot of RNAseH1 expression (FIG.11K). For all panels, error bars represent ± SEM and represent at least 3 replicates for each panel.

[0022] FIGs.12A-12H: Loss of native EWS phenocopies the DNA repair defects caused by EWS-FLI1. FIG.12A: Immunoprecipitation (IP) of FLAG-tagged EWS expressed in 293T cells + / - EWS-FLI1. FIG.12B: Representative Western blot of native EWS knockdown by siRNA in U2OS cells. FIGs.12C-12E: Quantification of Western blotting upon IR (5 Gy) at indicated time points in a non-ES cell line (U2OS) after 72-hour siRNA treatment against EWS or scramble (siSCR) control. FIGs.12F-12G: Representative Western blots upon 5 Gy IR (FIG.12F) or 200 ng / ml NCS treatment (FIG. 12G) at indicated time points in a non-ES cell line (U2OS) after 72-hour siRNA treatment against EWS or scramble control. FIG.12H: Exemplary immunostaining showing absolute pH2AX foci number before and after IR in EWS-FLI1 expressing cells. For all panels, error bars represent ± SEM for at least 3 replicates for each panel.

[0023] FIGs.13A-13G: FET fusion oncoproteins are recruited to DNA DSBs. FIG. 13A: Laser micro-irradiation of full-length GFP-FLI1, yellow box denotes laser DSB stripe. FIG.13B: Laser micro-irradiation of GFP tagged DNA binding deficient mutant (R2L2) of 7 4868-5555-9605.1Atty. Dkt. No.115872-2946 EWS-FLI1. FIG.13C: Quantification of GFP-EWS-FLI1 accumulation at laser-induced DSBs in a non-ES cell line (U2OS) upon siRNA against native EWS or scramble (siSCR) for 72 hours. n=50 cells, p<0.01 using paired t-test. FIGs.13D-13F: Quantification of Western blotting upon IR (5Gy) at indicated time points in a CCS cell line (SU-CCS-1) after 72-hour siRNA treatment against EWS-ATF1 or scramble (siSCR) control. FIG. 13G: Representative Western blots upon 5Gy IR at indicated time points in CCS cell line (SU-CCS-1) after 72-hour siRNA treatment against EWS-ATF1 or scramble (SCR) control. For all panels, error bars represent ± SEM, at least 3 replicates for each panel. DETAILED DESCRIPTION

[0024] It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present methods are described below in various levels of detail in order to provide a substantial understanding of the present technology. It is to be understood that the present disclosure is not limited to particular uses, methods, reagents, compounds, compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0025] In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, immunology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Patent No.4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir’s Handbook of Experimental Immunology. Methods to detect and measure 8 4868-5555-9605.1Atty. Dkt. No.115872-2946 levels of polypeptide gene expression products (i.e., gene translation level) are well-known in the art and include the use of polypeptide detection methods such as antibody detection and quantification techniques. (See also, Strachan & Read, Human Molecular Genetics, Second Edition. (John Wiley and Sons, Inc., NY, 1999)).

[0026] The prevailing model is that Ewing’s Sarcoma (ES) belongs to a family of “BRCA-like” tumors that are functionally deficient in BRCA1 (due to sequestration of BRCA1 protein by RNA-DNA hybrid structures known as R-loops) and therefore defective in HR double-strand break (DSB) repair10. However, both xenograft studies8and clinical trials in ES patients11failed to demonstrate any benefit for PARP inhibitor monotherapy, in stark contrast to the impressive clinical responses seen across HR deficient BRCA mutant and BRCA-like cancers12,13. Thus, the precise nature of the DNA repair defect in ES remains uncertain.

[0027] The present disclosure explores the role of the oncogenic fusion protein EWS- FLI1 in regulating the DNA damage response in ES. The Examples herein identify functional ATM deficiency as the principal DNA damage response (DDR) lesion in ES cells and define the mechanistic basis for EWS-FLI1 mediated DNA repair defects in ES. The present Examples demonstrate how FET oncoproteins create tumor-specific vulnerabilities within the DDR network. Definitions

[0028] Before describing the disclosed embodiments in detail, it is to be understood that the present disclosure is not limited to particular compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0029] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. As used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise. For example, reference to “a cell” includes a combination of two or more cells, and the like. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical chemistry and nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art. 9 4868-5555-9605.1Atty. Dkt. No.115872-2946

[0030] It is understood that embodiments of the present application described herein include “consisting of” and / or “consisting essentially of” embodiments.

[0031] As used herein, reference to “not” a value or parameter generally means and describes “other than” a value or parameter. For example, the method is not used to treat cancer of type X means the method is used to treat cancer of types other than X.

[0032] As used herein, the term “about” in reference to a number is generally taken to include numbers that fall within a range of 1%, 5%, or 10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).

[0033] The term “adapter” refers to a short, chemically synthesized, nucleic acid sequence which can be used to ligate to the end of a nucleic acid sequence in order to facilitate attachment to another molecule. The adapter can be single-stranded or double-stranded. An adapter can incorporate a short (typically less than 50 base pairs) sequence useful for PCR amplification or sequencing.

[0034] As used herein, the “administration” of an agent or drug to a subject includes any route of introducing or delivering to a subject a compound to perform its intended function. Administration can be carried out by any suitable route, including but not limited to, orally, intranasally, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), rectally, intrathecally, intratumorally or topically. Administration includes self-administration and the administration by another.

[0035] As used herein, the terms “amplify” or “amplification” with respect to nucleic acid sequences, refer to methods that increase the representation of a population of nucleic acid sequences in a sample. Nucleic acid amplification methods are well known to the skilled artisan and include ligase chain reaction (LCR), ligase detection reaction (LDR), ligation followed by Q-replicase amplification, PCR, primer extension, strand displacement amplification (SDA), hyperbranched strand displacement amplification, multiple displacement amplification (MDA), nucleic acid strand-based amplification (NASBA), two- step multiplexed amplifications, rolling circle amplification (RCA), recombinase- polymerase amplification (RPA)(TwistDx, Cambridge, UK), transcription mediated amplification, signal mediated amplification of RNA technology, loop-mediated isothermal amplification of DNA, helicase-dependent amplification, single primer isothermal amplification, and self- sustained sequence replication (3SR), including multiplex versions 10 4868-5555-9605.1Atty. Dkt. No.115872-2946 or combinations thereof. Copies of a particular nucleic acid sequence generated in vitro in an amplification reaction are called “amplicons” or “amplification products.”

[0036] The terms “cancer” or “tumor” are used interchangeably and refer to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain characteristic morphological features. Cancer cells are often in the form of a tumor, but such cells can exist alone within an animal, or can be a non-tumorigenic cancer cell. As used herein, the term “cancer” includes premalignant, as well as malignant cancers.

[0037] The terms “complementary” or “complementarity” as used herein with reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) refer to the base-pairing rules. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3’ end of the other, is in “antiparallel association.” For example, the sequence “5'-A-G-T-3’” is complementary to the sequence “3’-T-C-A-5.” Certain bases not commonly found in naturally-occurring nucleic acids may be included in the nucleic acids described herein. These include, for example, inosine, 7- deazaguanine, Locked Nucleic Acids (LNA), and Peptide Nucleic Acids (PNA). Complementarity need not be perfect; stable duplexes may contain mismatched base pairs, degenerative, or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. A complement sequence can also be an RNA sequence complementary to the DNA sequence or its complement sequence, and can also be a cDNA.

[0038] As used herein, a "control" is an alternative sample used in an experiment for comparison purpose. A control can be "positive" or "negative." For example, where the purpose of the experiment is to determine a correlation of the efficacy of a therapeutic agent for the treatment for a particular type of disease, a positive control (a compound or composition known to exhibit the desired therapeutic effect) and a negative control (a subject or a sample that does not receive the therapy or receives a placebo) are typically employed. 11 4868-5555-9605.1Atty. Dkt. No.115872-2946

[0039] A “control nucleic acid sample” or “reference nucleic acid sample” as used herein, refers to nucleic acid molecules from a control or reference sample. In certain embodiments, the reference or control nucleic acid sample is a wild type or a non-mutated DNA or RNA sequence. In certain embodiments, the reference nucleic acid sample is purified or isolated (e.g., it is removed from its natural state). In other embodiments, the reference nucleic acid sample is from a non-tumor sample, e.g., a blood control, a normal adjacent tumor (NAT), or any other non-cancerous sample from the same or a different subject.

[0040] “Detecting” as used herein refers to determining the presence of a mutation or alteration in a nucleic acid of interest in a sample. Detection does not require the method to provide 100% sensitivity. Analysis of nucleic acid markers can be performed using techniques known in the art including, but not limited to, sequence analysis, and electrophoretic analysis. Non-limiting examples of sequence analysis include Maxam- Gilbert sequencing, Sanger sequencing, capillary array DNA sequencing, thermal cycle sequencing (Sears et al., Biotechniques, 13:626-633 (1992)), solid-phase sequencing (Zimmerman et al., Methods Mol. Cell Biol, 3:39-42 (1992)), sequencing with mass spectrometry such as matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF / MS; Fu et al., Nat. Biotechnol, 16:381-384 (1998)), and sequencing by hybridization. Chee et al., Science, 274:610-614 (1996); Drmanac et al., Science, 260:1649-1652 (1993); Drmanac et al., Nat. Biotechnol, 16:54-58 (1998). Non- limiting examples of electrophoretic analysis include slab gel electrophoresis such as agarose or polyacrylamide gel electrophoresis, capillary electrophoresis, and denaturing gradient gel electrophoresis. Additionally, next generation sequencing methods can be performed using commercially available kits and instruments from companies such as the Life Technologies / Ion Torrent PGM or Proton, the Illumina HiSEQ or MiSEQ, and the Roche / 454 next generation sequencing system.

[0041] “Detectable label” as used herein refers to a molecule or a compound or a group of molecules or a group of compounds used to identify a nucleic acid or protein of interest. In some embodiments, the detectable label may be detected directly. In other embodiments, the detectable label may be a part of a binding pair, which can then be subsequently detected. Signals from the detectable label may be detected by various means and will depend on the nature of the detectable label. Detectable labels may be isotopes, fluorescent moieties, colored substances, and the like. Examples of means to detect detectable labels 12 4868-5555-9605.1Atty. Dkt. No.115872-2946 include but are not limited to spectroscopic, photochemical, biochemical, immunochemical, electromagnetic, radiochemical, or chemical means, such as fluorescence, chemifluorescence, or chemiluminescence, or any other appropriate means.

[0042] As used herein, the term “effective amount” refers to a quantity sufficient to achieve a desired therapeutic and / or prophylactic effect, e.g., an amount which results in the prevention of, or a decrease in a disease or condition described herein or one or more signs or symptoms associated with a disease or condition described herein. In the context of therapeutic or prophylactic applications, the amount of a composition administered to the subject will vary depending on the composition, the degree, type, and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. The compositions can also be administered in combination with one or more additional therapeutic compounds. In the methods described herein, the therapeutic compositions may be administered to a subject having one or more signs or symptoms of a disease or condition described herein. As used herein, a "therapeutically effective amount" of a composition refers to composition levels in which the physiological effects of a disease or condition are ameliorated or eliminated. A therapeutically effective amount can be given in one or more administrations.

[0043] As used herein, “expression” includes one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and / or other modifications of the translation product, if required for proper expression and function.

[0044] As used herein, the term “gene” means a segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that control expression. Specifically, a gene refers to a DNA sequence that comprises regulatory and coding sequences necessary for the production of an RNA, which may have a non-coding function (e.g., a ribosomal or transfer RNA) or which may include a polypeptide or a polypeptide precursor. The RNA or polypeptide may be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained. Although a sequence of the nucleic acids may be shown in the form of DNA, a person of ordinary skill in the art 13 4868-5555-9605.1Atty. Dkt. No.115872-2946 recognizes that the corresponding RNA sequence will have a similar sequence with the thymine being replaced by uracil, i.e., "T" is replaced with "U."

[0045] The term “hybridize” as used herein refers to a process where two substantially complementary nucleic acid strands (at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, at least about 75%, or at least about 90% complementary) anneal to each other under appropriately stringent conditions to form a duplex or heteroduplex through formation of hydrogen bonds between complementary base pairs. Hybridizations are typically and preferably conducted with probe-length nucleic acid molecules, preferably 15-100 nucleotides in length, more preferably 18-50 nucleotides in length. Nucleic acid hybridization techniques are well known in the art. See, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementarity between the nucleic acids, stringency of the conditions involved, and the thermal melting point (Tm) of the formed hybrid. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences having at least a desired level of complementarity will stably hybridize, while those having lower complementarity will not. For examples of hybridization conditions and parameters, see, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y.; Ausubel, F. M. et al.1994, Current Protocols in Molecular Biology, John Wiley & Sons, Secaucus, N.J. In some embodiments, specific hybridization occurs under stringent hybridization conditions. An oligonucleotide or polynucleotide (e.g., a probe or a primer) that is specific for a target nucleic acid will “hybridize” to the target nucleic acid under suitable conditions.

[0046] As used herein, the term “library” refers to a collection of nucleic acid sequences, e.g., a collection of nucleic acids derived from whole genomic, subgenomic fragments, cDNA, cDNA fragments, RNA, RNA fragments, ctDNA, cfDNA, or a combination thereof. In one embodiment, a portion or all of the library nucleic acid sequences comprises an adapter sequence. The adapter sequence can be located at one or both ends. The adapter sequence can be useful, e.g., for a sequencing method (e.g., an NGS method), for amplification, for reverse transcription, or for cloning into a vector.

[0047] The library can comprise a collection of nucleic acid sequences, e.g., a target nucleic acid sequence (e.g., a tumor nucleic acid sequence), a reference nucleic acid sequence, or a 14 4868-5555-9605.1Atty. Dkt. No.115872-2946 combination thereof. In some embodiments, the nucleic acid sequences of the library can be derived from a single subject. In other embodiments, a library can comprise nucleic acid sequences from more than one subject (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30 or more subjects). In some embodiments, two or more libraries from different subjects can be combined to form a library having nucleic acid sequences from more than one subject.

[0048] A “library nucleic acid sequence” refers to a nucleic acid molecule, e.g., a DNA, RNA, or a combination thereof, that is a member of a library. Typically, a library nucleic acid sequence is a DNA molecule, e.g., genomic DNA or cDNA. In some embodiments, a library nucleic acid sequence is fragmented, e.g., sheared or enzymatically prepared, genomic DNA. In certain embodiments, the library nucleic acid sequences comprise sequence from a subject and sequence not derived from the subject, e.g., adapter sequence, a primer sequence, or other sequences that allow for identification, e.g., “barcode” sequences.

[0049] The term “multiplex PCR” as used herein refers to amplification of two or more PCR products or amplicons which are each primed using a distinct primer pair.

[0050] As used herein, a “mutation” of a gene or gene product (e.g., a marker gene or gene product) refers to the presence of an alteration or alterations within the gene or gene product, which affects the quantity or activity of the gene or gene product, as compared to the normal or wild-type gene. The genetic alteration can result in changes in the quantity, structure, and / or activity of the gene or gene product in a cancer tissue or cancer cell, as compared to its quantity, structure, and / or activity, in a normal or healthy tissue or cell (e.g., a control). For example, a mutation which is associated with cancer, or predictive of responsiveness to ATR inhibitors, can have an altered nucleotide sequence, amino acid sequence, chromosomal translocation, intra-chromosomal inversion, copy number, expression level, protein level, protein activity, in a cancer tissue or cancer cell, as compared to a normal, healthy tissue or cell. Exemplary mutations include, but are not limited to, point mutations (e.g., silent, missense, or nonsense), deletions, insertions, inversions, linking mutations, duplications, translocations, gene fusions, inter- and intra- chromosomal rearrangements. Mutations can be present in the coding or non-coding region of the gene.

[0051] “Next-generation sequencing or NGS” as used herein, refers to any sequencing method that determines the nucleotide sequence of either individual nucleic acid molecules 15 4868-5555-9605.1Atty. Dkt. No.115872-2946 (e.g., in single molecule sequencing) or clonally expanded proxies for individual nucleic acid molecules in a high throughput parallel fashion (e.g., greater than 103, 104, 105or more molecules are sequenced simultaneously). In one embodiment, the relative abundance of the nucleic acid species in the library can be estimated by counting the relative number of occurrences of their cognate sequences in the data generated by the sequencing experiment. Next generation sequencing methods are known in the art, and are described, e.g., in Metzker, M. Nature Biotechnology Reviews 11:31-46 (2010).

[0052] As used herein, “oligonucleotide” refers to a molecule that has a sequence of nucleic acid bases on a backbone comprised mainly of identical monomer units at defined intervals. The bases are arranged on the backbone in such a way that they can bind with a nucleic acid having a sequence of bases that are complementary to the bases of the oligonucleotide. The most common oligonucleotides have a backbone of sugar phosphate units. A distinction may be made between oligodeoxyribonucleotides that do not have a hydroxyl group at the 2' position and oligoribonucleotides that have a hydroxyl group at the 2' position. Oligonucleotides may also include derivatives, in which the hydrogen of the hydroxyl group is replaced with organic groups, e.g., an allyl group. Oligonucleotides of the method which function as primers or probes are generally at least about 10-15 nucleotides long and more preferably at least about 15 to 25 nucleotides long, although shorter or longer oligonucleotides may be used in the method. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including, for example, chemical synthesis, DNA replication, restriction endonuclease digestion of plasmids or phage DNA, reverse transcription, PCR, or a combination thereof. The oligonucleotide may be modified e.g., by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides.

[0053] As used herein, by “pharmaceutically acceptable” or “pharmacologically compatible” is meant a material that is not biologically or otherwise undesirable, e.g., the material may be incorporated into a pharmaceutical composition administered to a patient without causing any significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained. Pharmaceutically acceptable carriers or excipients have preferably met the required standards of toxicological and manufacturing testing and / or are included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug administration. 16 4868-5555-9605.1Atty. Dkt. No.115872-2946

[0054] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are a non-naturally occurring amino acid, e.g., an amino acid analog. The terms encompass amino acid chains of any length, including full length proteins, wherein the amino acid residues are linked by covalent peptide bonds.

[0055] As used herein, “prevention” or “preventing” of a disorder or condition refers to a compound that, in a statistical sample, reduces the occurrence of the disorder or condition in the treated sample relative to an untreated control sample, or delays the onset of one or more symptoms of the disorder or condition relative to the untreated control sample.

[0056] As used herein, the term “primer” refers to an oligonucleotide, which is capable of acting as a point of initiation of nucleic acid sequence synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a target nucleic acid strand is induced, i.e., in the presence of different nucleotide triphosphates and a polymerase in an appropriate buffer (“buffer” includes pH, ionic strength, cofactors etc.) and at a suitable temperature. One or more of the nucleotides of the primer can be modified for instance by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides. A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5′ end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. The term primer as used herein includes all forms of primers that may be synthesized including peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate modified primers, labeled primers, and the like. The term “forward primer” as used herein means a primer that anneals to the anti-sense strand of dsDNA. A “reverse primer” anneals to the sense-strand of dsDNA.

[0057] As used herein, “primer pair” refers to a forward and reverse primer pair (i.e., a left and right primer pair) that can be used together to amplify a given region of a nucleic acid of interest.

[0058] “Probe” as used herein refers to nucleic acid that interacts with a target nucleic acid via hybridization. A probe may be fully complementary to a target nucleic acid sequence or partially complementary. The level of complementarity will depend on many factors based, in general, on the function of the probe. A probe or probes can be used, for 17 4868-5555-9605.1Atty. Dkt. No.115872-2946 example to detect the presence or absence of a mutation or alteration in a nucleic acid sequence by virtue of the sequence characteristics of the target. Probes can be labeled or unlabeled, or modified in any of a number of ways well known in the art. A probe may specifically hybridize to a target nucleic acid. Probes may be DNA, RNA or a RNA / DNA hybrid. Probes may be oligonucleotides, artificial chromosomes, fragmented artificial chromosome, genomic nucleic acid, fragmented genomic nucleic acid, RNA, recombinant nucleic acid, fragmented recombinant nucleic acid, peptide nucleic acid (PNA), locked nucleic acid, oligomer of cyclic heterocycles, or conjugates of nucleic acid. Probes may comprise modified nucleobases, modified sugar moieties, and modified internucleotide linkages. A probe may be used to detect the presence or absence of a target nucleic acid. Probes are typically at least about 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 100 nucleotides or more in length.

[0059] As used herein, a “sample” refers to a substance that is being assayed for the presence of a mutation or alteration in a nucleic acid of interest. Processing methods to release or otherwise make available a nucleic acid for detection are well known in the art and may include steps of nucleic acid manipulation. A biological sample may be a body fluid or a tissue sample. In some cases, a biological sample may consist of or comprise blood, plasma, sera, urine, feces, epidermal sample, vaginal sample, skin sample, cheek swab, sperm, amniotic fluid, cultured cells, bone marrow sample, tumor biopsies, aspirate and / or chorionic villi, cultured cells, and the like. Fresh, fixed or frozen tissues may also be used. In one embodiment, the sample is preserved as a frozen sample or as formaldehyde- or paraformaldehyde-fixed paraffin-embedded (FFPE) tissue preparation. For example, the sample can be embedded in a matrix, e.g., an FFPE block or a frozen sample. Whole blood samples of about 0.5 to 5 ml collected with EDTA, ACD or heparin as anti-coagulant are suitable.

[0060] The term “sensitivity,” as used herein in reference to the methods of the present technology, is a measure of the ability of a method to detect a preselected sequence variant in a heterogeneous population of sequences. A method has a sensitivity of S % for variants of F % if, given a sample in which the preselected sequence variant is present as at least F % of the sequences in the sample, the method can detect the preselected sequence at a preselected confidence of C %, S % of the time. By way of example, a method has a sensitivity of 90% for variants of 5% if, given a sample in which the preselected variant sequence is present as at least 5% of the sequences in the sample, the method can detect the 18 4868-5555-9605.1Atty. Dkt. No.115872-2946 preselected sequence at a preselected confidence of 99%, 9 out of 10 times (F=5%; C=99%; S=90%).

[0061] As used herein, the term “separate” therapeutic use refers to an administration of at least two active ingredients at the same time or at substantially the same time by different routes.

[0062] As used herein, the term “sequential” therapeutic use refers to administration of at least two active ingredients at different times, the administration route being identical or different. More particularly, sequential use refers to the whole administration of one of the active ingredients before administration of the other or others commences. It is thus possible to administer one of the active ingredients over several minutes, hours, or days before administering the other active ingredient or ingredients. There is no simultaneous treatment in this case.

[0063] As used herein, the term “simultaneous” therapeutic use refers to the administration of at least two active ingredients by the same route and at the same time or at substantially the same time.

[0064] The term “specific” as used herein in reference to an oligonucleotide primer means that the nucleotide sequence of the primer has at least 12 bases of sequence identity with a portion of the nucleic acid to be amplified when the oligonucleotide and the nucleic acid are aligned. An oligonucleotide primer that is specific for a nucleic acid is one that, under the stringent hybridization or washing conditions, is capable of hybridizing to the target of interest and not substantially hybridizing to nucleic acids which are not of interest. Higher levels of sequence identity are preferred and include at least 75%, at least 80%, at least 85%, at least 90%, at least 95% and more preferably at least 98% sequence identity.

[0065] “Specificity,” as used herein, is a measure of the ability of a method to distinguish a truly occurring preselected sequence variant from sequencing artifacts or other closely related sequences. It is the ability to avoid false positive detections. False positive detections can arise from errors introduced into the sequence of interest during sample preparation, sequencing error, or inadvertent sequencing of closely related sequences like pseudo-genes or members of a gene family. A method has a specificity of X % if, when applied to a sample set of NTotalsequences, in which XTruesequences are truly variant and XNot true are not truly variant, the method selects at least X % of the not truly variant as not variant. E.g., a method has a specificity of 90% if, when applied to a sample set of 1,000 19 4868-5555-9605.1Atty. Dkt. No.115872-2946 sequences, in which 500 sequences are truly variant and 500 are not truly variant, the method selects 90% of the 500 not truly variant sequences as not variant. Exemplary specificities include 90, 95, 98, and 99%.

[0066] The term “stringent hybridization conditions” as used herein refers to hybridization conditions at least as stringent as the following: hybridization in 50% formamide, 5xSSC, 50 mM NaH2PO4, pH 6.8, 0.5% SDS, 0.1 mg / mL sonicated salmon sperm DNA, and 5x Denhart's solution at 42oC. overnight; washing with 2x SSC, 0.1% SDS at 45oC; and washing with 0.2x SSC, 0.1% SDS at 45oC. In another example, stringent hybridization conditions should not allow for hybridization of two nucleic acids which differ over a stretch of 20 contiguous nucleotides by more than two bases.

[0067] As used herein, the terms “subject”, “patient”, or “individual” can be an individual organism, a vertebrate, a mammal, or a human. In some embodiments, the subject, patient or individual is a human.

[0068] As used herein, the terms “target sequence” and “target nucleic acid sequence” refer to a specific nucleic acid sequence to be detected and / or quantified in the sample to be analyzed.

[0069] As used herein, the term “therapeutic agent” is intended to mean a compound that, when present in an effective amount, produces a desired therapeutic effect on a subject in need thereof.

[0070] “Treating” or “treatment” as used herein covers the treatment of a disease or disorder described herein, in a subject, such as a human, and includes: (i) inhibiting a disease or disorder, i.e., arresting its development; (ii) relieving a disease or disorder, i.e., causing regression of the disorder; (iii) slowing progression of the disorder; and / or (iv) inhibiting, relieving, or slowing progression of one or more symptoms of the disease or disorder. Therapeutic effects of treatment include, without limitation, inhibiting recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastases, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. By “treating a cancer” is meant that the symptoms associated with the cancer are, e.g., alleviated, reduced, cured, or placed in a state of remission.

[0071] It is also to be appreciated that the various modes of treatment of diseases as described herein are intended to mean “substantial,” which includes total but also less than 20 4868-5555-9605.1Atty. Dkt. No.115872-2946 total treatment, and wherein some biologically or medically relevant result is achieved. The treatment may be a continuous prolonged treatment for a chronic disease or a single, or few time administrations for the treatment of an acute condition. FET Proteins

[0072] The FET family of intrinsically disordered proteins (FUS, EWS, TAF15) are frequent 5’ oncogenic transcription factor (TF) fusion partners in a diversity of sarcomas and leukemias4. The most studied cancer in this class is Ewing sarcoma (ES), a pediatric bone tumor driven by the EWS-FLI1 TF fusion oncoprotein. Patients with relapsed or metastatic ES continue to have dismal outcomes despite maximally intense combination chemotherapy regimens5. Paradoxically, decades of clinical experience and laboratory testing of ES cancer cell lines have shown ES to be among the most chemo- and radiosensitive cancers6–9, at least initially. It has long been hypothesized that ES tumors harbor a DNA repair defect that explains their underlying sensitivity to DNA damaging therapies.

[0073] Native FET family proteins contain an N-terminal intrinsically disordered region (IDR) required for interactions amongst FET family members and a C-terminal domain with positively charged RGG (arginine-glycine-glycine) repeats, which mediate recruitment to DSBs via high affinity interactions with negatively charged poly-ADP ribose (PAR) molecules14,15. All 3 FET members are rapidly recruited to DSBs in a PARP-dependent manner15,16, where they undergo liquid-liquid phase separation that is thought to enable compartmentalization of DSB repair proteins17,18, though the specific role of FET proteins in DSB repair is not well defined. Interestingly, all oncogenic FET fusion proteins including EWS-FLI1 share a similar structure: the N-terminal IDR of the FET protein fused to the DNA binding domain of a transcription factor (e.g., FLI1), with loss of the C-terminal RGG repeats19. Methods for Detecting Polynucleotides Associated with Responsiveness to ATR Inhibitors or CHK1 Inhibitors

[0074] Polynucleotides associated with responsiveness to ATR inhibitors or CHK1 inhibitors may be detected by a variety of methods known in the art. Non-limiting examples of detection methods are described below. The detection assays in the methods of the present technology may include purified or isolated DNA (genomic or cDNA), RNA or protein or the detection step may be performed directly from a biological sample without 21 4868-5555-9605.1Atty. Dkt. No.115872-2946 the need for further DNA, RNA or protein purification / isolation. Nucleic Acid Amplification and / or Detection

[0075] Polynucleotides associated with responsiveness to ATR inhibitors or CHK1 inhibitors can be detected by the use of nucleic acid amplification techniques that are well known in the art. The starting material may be genomic DNA, cDNA, RNA, ctDNA, cfDNA, or mRNA. Nucleic acid amplification can be linear or exponential. Specific variants or genetic alterations may be detected by the use of amplification methods with the aid of oligonucleotide primers or probes designed to interact with or hybridize to a particular target sequence in a specific manner, thus amplifying only the target variant.

[0076] Non-limiting examples of nucleic acid amplification techniques include polymerase chain reaction (PCR), real-time quantitative PCR (qPCR), digital PCR (dPCR), reverse transcriptase polymerase chain reaction (RT-PCR), nested PCR, ligase chain reaction (see Abravaya, K. et al., Nucleic Acids Res. (1995), 23:675-682), branched DNA signal amplification (see Urdea, M. S. et al., AIDS (1993), 7(suppl 2):S11- S14), amplifiable RNA reporters, Q-beta replication, transcription-based amplification, boomerang DNA amplification, strand displacement activation, cycling probe technology, isothermal nucleic acid sequence based amplification (NASBA) (see Kievits, T. et al., J Virological Methods (1991), 35:273-286), Invader Technology, next-generation sequencing technology or other sequence replication assays or signal amplification assays.

[0077] Primers: Oligonucleotide primers for use in amplification methods can be designed according to general guidance well known in the art as described herein, as well as with specific requirements as described herein for each step of the particular methods described. In some embodiments, oligonucleotide primers for cDNA synthesis and PCR are 10 to 100 nucleotides in length, preferably between about 15 and about 60 nucleotides in length, more preferably 25 and about 50 nucleotides in length, and most preferably between about 25 and about 40 nucleotides in length.

[0078] Tm of a polynucleotide affects its hybridization to another polynucleotide (e.g., the annealing of an oligonucleotide primer to a template polynucleotide). In certain embodiments of the disclosed methods, the oligonucleotide primer used in various steps selectively hybridizes to a target template or polynucleotides derived from the target template (i.e., first and second strand cDNAs and amplified products). Typically, selective hybridization occurs when two polynucleotide sequences are substantially complementary 22 4868-5555-9605.1Atty. Dkt. No.115872-2946 (at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, preferably at least about 75%, more preferably at least about 90% complementary). See Kanehisa, M., Polynucleotides Res. (1984), 12:203, incorporated herein by reference. As a result, it is expected that a certain degree of mismatch at the priming site is tolerated. Such mismatch may be small, such as a mono-, di- or tri-nucleotide. In certain embodiments, 100% complementarity exists.

[0079] Probes: Probes are capable of hybridizing to at least a portion of the nucleic acid of interest or a reference nucleic acid (i.e., wild-type sequence). Probes may be an oligonucleotide, artificial chromosome, fragmented artificial chromosome, genomic nucleic acid, fragmented genomic nucleic acid, RNA, recombinant nucleic acid, fragmented recombinant nucleic acid, peptide nucleic acid (PNA), locked nucleic acid, oligomer of cyclic heterocycles, or conjugates of nucleic acid. Probes may be used for detecting and / or capturing / purifying a nucleic acid of interest.

[0080] Typically, probes can be about 10 nucleotides, about 20 nucleotides, about 25 nucleotides, about 30 nucleotides, about 35 nucleotides, about 40 nucleotides, about 50 nucleotides, about 60 nucleotides, about 75 nucleotides, or about 100 nucleotides long. However, longer probes are possible. Longer probes can be about 200 nucleotides, about 300 nucleotides, about 400 nucleotides, about 500 nucleotides, about 750 nucleotides, about 1,000 nucleotides, about 1,500 nucleotides, about 2,000 nucleotides, about 2,500 nucleotides, about 3,000 nucleotides, about 3,500 nucleotides, about 4,000 nucleotides, about 5,000 nucleotides, about 7,500 nucleotides, or about 10,000 nucleotides long.

[0081] Probes may also include a detectable label or a plurality of detectable labels. The detectable label associated with the probe can generate a detectable signal directly. Additionally, the detectable label associated with the probe can be detected indirectly using a reagent, wherein the reagent includes a detectable label, and binds to the label associated with the probe.

[0082] In some embodiments, detectably labeled probes can be used in hybridization assays including, but not limited to Northern blots, Southern blots, microarray, dot or slot blots, and in situ hybridization assays such as fluorescent in situ hybridization (FISH) to detect a target nucleic acid sequence within a biological sample. Certain embodiments may employ hybridization methods for measuring expression of a polynucleotide gene product, such as mRNA. Methods for conducting polynucleotide hybridization assays have been 23 4868-5555-9605.1Atty. Dkt. No.115872-2946 well developed in the art. Hybridization assay procedures and conditions will vary depending on the application and are selected in accordance with the general binding methods known including those referred to in: Maniatis et al. Molecular Cloning: A Laboratory Manual (2nd Ed. Cold Spring Harbor, N.Y., 1989); Berger and Kimmel Methods in Enzymology, Vol.152, Guide to Molecular Cloning Techniques (Academic Press, Inc., San Diego, Calif, 1987); Young and Davis, PNAS.80: 1194 (1983).

[0083] Detectably labeled probes can also be used to monitor the amplification of a target nucleic acid sequence. In some embodiments, detectably labeled probes present in an amplification reaction are suitable for monitoring the amount of amplicon(s) produced as a function of time. Examples of such probes include, but are not limited to, the 5'- exonuclease assay (TAQMAN® probes described herein (see also U.S. Pat. No.5,538,848) various stem-loop molecular beacons (see for example, U.S. Pat. Nos.6,103,476 and 5,925,517 and Tyagi and Kramer, 1996, Nature Biotechnology 14:303- 308), stemless or linear beacons (see, e.g., WO 99 / 21881), PNA Molecular Beacons™ (see, e.g., U.S. Pat. Nos.6,355,421 and 6,593,091), linear PNA beacons (see, for example, Kubista et al., 2001, SPIE 4264:53-58), non-FRET probes (see, for example, U.S. Pat. No.6,150,097), Sunrise® / Amplifluor™ probes (U.S. Pat. No.6,548,250), stem-loop and duplex Scorpion probes (Solinas et al., 2001, Nucleic Acids Research 29:E96 and U.S. Pat. No.6,589,743), bulge loop probes (U.S. Pat. No.6,590,091), pseudo knot probes (U.S. Pat. No.6,589,250), cyclicons (U.S. Pat. No.6,383,752), MGB Eclipse™ probe (Epoch Biosciences), hairpin probes (U.S. Pat. No.6,596,490), peptide nucleic acid (PNA) light-up probes, self- assembled nanoparticle probes, and ferrocene-modified probes described, for example, in U.S. Pat. No.6,485,901 ; Mhlanga et al., 2001, Methods 25:463-471 ; Whitcombe et al., 1999, Nature Biotechnology.17:804-807; Isacsson et al., 2000, Molecular Cell Probes. 14:321-328; Svanvik et al., 2000, Anal Biochem.281 :26-35; Wolffs et al., 2001, Biotechniques 766:769-771 ; Tsourkas et al., 2002, Nucleic Acids Research.30:4208-4215; Riccelli et al., 2002, Nucleic Acids Research 30:4088-4093; Zhang et al., 2002 Shanghai. 34:329-332; Maxwell et al., 2002, J. Am. Chem. Soc.124:9606-9612; Broude et al., 2002, Trends Biotechnol.20:249-56; Huang et al., 2002, Chem. Res. Toxicol.15:118- 126; and Yu et al., 2001, J. Am. Chem. Soc 14:11155-11161.

[0084] In some embodiments, the detectable label is a fluorophore. Suitable fluorescent moieties include but are not limited to the following fluorophores working individually or in combination: 4-acetamido-4'-isothiocyanatostilbene- 2,2'disulfonic acid; acridine and 24 4868-5555-9605.1Atty. Dkt. No.115872-2946 derivatives: acridine, acridine isothiocyanate; Alexa Fluors: Alexa Fluor® 350, Alexa Fluor® 488, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 647 (Molecular Probes); 5-(2- aminoethyl)aminonaphthalene-l -sulfonic acid (EDANS); 4-amino-N-[3- vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate (Lucifer Yellow VS); N-(4-anilino-l- naphthyl)maleimide; anthranilamide; Black Hole Quencher™ (BHQ™) dyes (biosearch Technologies); BODIPY dyes: BODIPY® R-6G, BOPIPY® 530 / 550, BODIPY® FL; Brilliant Yellow; coumarin and derivatives: coumarin, 7-amino-4- methylcoumarin (AMC, Coumarin 120),7-amino-4-trifluoromethylcouluarin (Coumarin 151); Cy2®, Cy3®, Cy3.5®, Cy5®, Cy5.5®; cyanosine; 4',6-diaminidino-2-phenylindole (DAPI); 5', 5"-dibromopyrogallol- sulfonephthalein (Bromopyrogallol Red); 7- diethylamino-3-(4'-isothiocyanatophenyl)-4- methylcoumarin; diethylenetriamine pentaacetate; 4,4'-diisothiocyanatodihydro-stilbene-2,2'- disulfonic acid; 4,4'- diisothiocyanatostilbene-2,2'-disulfonic acid; 5- [dimethylamino]naphthalene-l -sulfonyl chloride (DNS, dansyl chloride); 4-(4'- dimethylaminophenylazo)benzoic acid (DABCYL); 4-dimethylaminophenylazophenyl-4'- isothiocyanate (DABITC); Eclipse™ (Epoch Biosciences Inc.); eosin and derivatives: eosin, eosin isothiocyanate; erythrosin and derivatives: erythrosin B, erythrosin isothiocyanate; ethidium; fluorescein and derivatives: 5-carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2- yl)amino fluorescein (DTAF), 2',7'- dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), hexachloro-6-carboxyfluorescein (HEX), QFITC (XRITC), tetrachlorofluorescem (TET); fiuorescamine; IR144; IR1446; lanthamide phosphors; Malachite Green isothiocyanate; 4-methylumbelliferone; ortho cresolphthalein; nitrotyrosine; pararosaniline; Phenol Red; B-phycoerythrin, R-phycoerythrin; allophycocyanin; o-phthaldialdehyde; Oregon Green®; propidium iodide; pyrene and derivatives: pyrene, pyrene butyrate, succinimidyl 1 -pyrene butyrate; QSY® 7; QSY® 9; QSY® 21; QSY® 35 (Molecular Probes); Reactive Red 4 (Cibacron®Brilliant Red 3B-A); rhodamine and derivatives: 6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine green, rhodamine X isothiocyanate, riboflavin, rosolic acid, sulforhodamine B, sulforhodamine 101, sulfonyl chloride derivative of sulforhodamine 101 (Texas Red); terbium chelate derivatives; N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl rhodamine; tetramethyl rhodamine isothiocyanate (TRITC); and VIC®. Detector probes can also comprise sulfonate derivatives of fluorescenin dyes with S03 25 4868-5555-9605.1Atty. Dkt. No.115872-2946 instead of the carboxylate group, phosphoramidite forms of fluorescein, phosphoramidite forms of CY 5 (commercially available for example from Amersham).

[0085] Detectably labeled probes can also include quenchers, including without limitation black hole quenchers (Biosearch), Iowa Black (IDT), QSY quencher (Molecular Probes), and Dabsyl and Dabcel sulfonate / carboxylate Quenchers (Epoch).

[0086] Detectably labeled probes can also include two probes, wherein for example a fluorophore is on one probe, and a quencher is on the other probe, wherein hybridization of the two probes together on a target quenches the signal, or wherein hybridization on the target alters the signal signature via a change in fluorescence.

[0087] In some embodiments, interchelating labels such as ethidium bromide, SYBR® Green I (Molecular Probes), and PicoGreen® (Molecular Probes) are used, thereby allowing visualization in real-time, or at the end point, of an amplification product in the absence of a detector probe. In some embodiments, real-time visualization may involve the use of both an intercalating detector probe and a sequence-based detector probe. In some embodiments, the detector probe is at least partially quenched when not hybridized to a complementary sequence in the amplification reaction, and is at least partially unquenched when hybridized to a complementary sequence in the amplification reaction.

[0088] In some embodiments, the amount of probe that gives a fluorescent signal in response to an excited light typically relates to the amount of nucleic acid produced in the amplification reaction. Thus, in some embodiments, the amount of fluorescent signal is related to the amount of product created in the amplification reaction. In such embodiments, one can therefore measure the amount of amplification product by measuring the intensity of the fluorescent signal from the fluorescent indicator.

[0089] Primers or probes may be designed to selectively hybridize to any portion of a nucleic acid sequence encoding a FET polypeptide selected from among EWS, FUS and TAF15. Exemplary nucleic acid sequences of the human FET gene are provided below:

[0090] NM_001163285.2 Homo sapiens EWS RNA binding protein 1 (EWSR1), transcript variant 3, mRNA (SEQ ID NO: 1) GCAGTGCGGCGCCTAGAGGGAAAGCGAGAGGGAGACGGACGTTGAGAGAACGAGGAGGAAGGAGAGAAAA TGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGCGCAGCAGGGCTACAGTGCTTACACCGCCCA GCCCACTCAAGGATATGCACAGACCACCCAGGCATATGGGCAACAAAGCTATGGAACCTATGGACAGCCC ACTGATGTCAGCTATACCCAGGCTCAGACCACTGCAACCTATGGGCAGACCGCCTATGCAACTTCTTATG GACAGCCTCCCACTGGTTATACTACTCCAACTGCCCCCCAGGCATACAGCCAGCCTGTCCAGGGGTATGG CACTGGTGCTTATGATACCACCACTGCTACAGTCACCACCACCCAGGCCTCCTATGCAGCTCAGTCTGCA 26 4868-5555-9605.1Atty. Dkt. No.115872-2946 TATGGCACTCAGCCTGCTTATCCAGCCTATGGGCAGCAGCCAGCAGCCACTGCACCTACAAGACCGCAGG ATGGAAACAAGCCCACTGAGACTAGTCAACCTCAATCTAGCACAGGGGGTTACAACCAGCCCAGCCTAGG ATATGGACAGAGTAACTACAGTTATCCCCAGGTACCTGGGAGCTACCCCATGCAGCCAGTCACTGCACCT CCATCCTACCCTCCTACCAGCTATTCCTCTACACAGCCGACTAGTTATGATCAGAGCAGTTACTCTCAGC AGAACACCTATGGGCAACCGAGCAGCTATGGACAGCAGAGTAGCTATGGTCAACAAAGCAGCTATGGGCA GCAGCCTCCCACTAGTTACCCACCCCAAACTGGATCCTACAGCCAAGCTCCAAGTCAATATAGCCAACAG AGCAGCAGCTACGGGCAGCAGAGTTCATTCCGACAGGACCACCCCAGTAGCATGGGTGTTTATGGGCAGG AGTCTGGAGGATTTTCCGGACCAGGAGAGAACCGGAGCATGAGTGGCCCTGATAACCGGGGCAGGGGAAG AGGGGGATTTGATCGTGGAGGCATGAGCAGAGGTGGGCGGGGAGGAGGACGCGGTGGAATGGGCGCTGGA GAGCGAGGTGGCTTCAATAAGCCTGGTGGACCCATGGATGAAGGACCAGATCTTGATCTAGGCCCACCTG TAGATCCAGATGAAGACTCTGACAACAGTGCAATTTATGTACAAGGATTAAATGACAGTGTGACTCTAGA TGATCTGGCAGACTTCTTTAAGCAGTGTGGGGTTGTTAAGATGAACAAGAGAACTGGGCAACCCATGATC CACATCTACCTGGACAAGGAAACAGGAAAGCCCAAAGGCGATGCCACAGTGTCCTATGAAGACCCACCCA CTGCCAAGGCTGCCGTGGAATGGTTTGATGGGAAAGATTTTCAAGGGAGCAAACTTAAAGTCTCCCTTGC TCGGAAGAAGCCTCCAATGAACAGTATGCGGGGTGGTCTGCCACCCCGTGAGGGCAGAGGCATGCCACCA CCACTCCGTGGAGGTCCAGGAGGCCCAGGAGGTCCTGGGGGACCCATGGGTCGCATGGGAGGCCGTGGAG GAGATAGAGGAGGCTTCCCTCCAAGAGGACCCCGGGGTTCCCGAGGGAACCCCTCTGGAGGAGGAAACGT CCAGCACCGAGCTGGAGACTGGCAGTGTCCCAATCCGGGTTGTGGAAACCAGAACTTCGCCTGGAGAACA GAGTGCAACCAGTGTAAGGCCCCAAAGCCTGAAGGCTTCCTCCCGCCACCCTTTCCGCCCCCGGGTGGTG ATCGTGGCAGAGGTGGCCCTGGTGGCATGCGGGGAGGAAGAGGTGGCCTCATGGATCGTGGTGGTCCCGG TGGAATGTTCAGAGGTGGCCGTGGTGGAGACAGAGGTGGCTTCCGTGGTGGCCGGGGCATGGACCGAGGT GGCTTTGGTGGAGGAAGACGAGGTGGCCCTGGGGGGCCCCCTGGACCTTTGATGGAACAGATGGGAGGAA GAAGAGGAGGACGTGGAGGACCTGGAAAAATGGATAAAGGCGAGCACCGTCAGGAGCGCAGAGATCGGCC CTACTAGATGCAGAGACCCCGCAGAGCTGCATTGACTACCAGATTTATTTTTTAAACCAGAAAATGTTTT AAATTTATAATTCCATATTTATAATGTTGGCCACAACATTATGATTATTCCTTGTCTGTACTTTAGTATT TTTCACCATTTGTGAAGAAACATTAAAACAAGTTAAATGGTAGTGTGCGGAGTTTTTTTTTCTTCCTTCT TTTAAAAATGGTTGTTTAAGACTTTAACAATGGGAACCCCTTGTGAGCATGCTCAGTATCATTGTGGAGA ACCAAGAGGGCCTCTTAACTGTAACAATGTTCATGGTTGTGATGTTTTTTTTTTTTTTTTAAATAAAATT CCAAATGTTTATAAAGA

[0091] NM_001163286.2 Homo sapiens EWS RNA binding protein 1 (EWSR1), transcript variant 4, mRNA (SEQ ID NO: 2) GCAGTGCGGCGCCTAGAGGGAAAGCGAGAGGGAGACGGACGTTGAGAGAACGAGGAGGAAGGAGAGAAAA TGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGCGCAGCAGGGCTACAGTGCTTACACCGCCCA GCCCACTCAAGGATATGCACAGACCACCCAGGCATATGGGCAACAAAGCTATGGAACCTATGGACAGCCC ACTGATGTCAGCTATACCCAGGCTCAGACCACTGCAACCTATGGGCAGACCGCCTATGCAACTTCTTATG GACAGCCTCCCACTGGTTATACTACTCCAACTGCCCCCCAGGCATACAGCCAGCCTGTCCAGGGGTATGG CACTGGTGCTTATGATACCACCACTGCTACAGTCACCACCACCCAGGCCTCCTATGCAGCTCAGTCTGCA TATGGCACTCAGCCTGCTTATCCAGCCTATGGGCAGCAGCCAGCAGCCACTGCACCTACAAGCTATTCCT CTACACAGCCGACTAGTTATGATCAGAGCAGTTACTCTCAGCAGAACACCTATGGGCAACCGAGCAGCTA TGGACAGCAGAGTAGCTATGGTCAACAAAGCAGCTATGGGCAGCAGCCTCCCACTAGTTACCCACCCCAA ACTGGATCCTACAGCCAAGCTCCAAGTCAATATAGCCAACAGAGCAGCAGCTACGGGCAGCAGAGTTCAT TCCGACAGGACCACCCCAGTAGCATGGGTGTTTATGGGCAGGAGTCTGGAGGATTTTCCGGACCAGGAGA GAACCGGAGCATGAGTGGCCCTGATAACCGGGGCAGGGGAAGAGGGGGATTTGATCGTGGAGGCATGAGC AGAGGTGGGCGGGGAGGAGGACGCGGTGGAATGGGCAGCGCTGGAGAGCGAGGTGGCTTCAATAAGCCTG GTGGACCCATGGATGAAGGACCAGATCTTGATCTAGGCCCACCTGTAGATCCAGATGAAGACTCTGACAA CAGTGCAATTTATGTACAAGGATTAAATGACAGTGTGACTCTAGATGATCTGGCAGACTTCTTTAAGCAG TGTGGGGTTGTTAAGATGAACAAGAGAACTGGGCAACCCATGATCCACATCTACCTGGACAAGGAAACAG GAAAGCCCAAAGGCGATGCCACAGTGTCCTATGAAGACCCACCCACTGCCAAGGCTGCCGTGGAATGGTT TGATGGGAAAGATTTTCAAGGGAGCAAACTTAAAGTCTCCCTTGCTCGGAAGAAGCCTCCAATGAACAGT ATGCGGGGTGGTCTGCCACCCCGTGAGGGCAGAGGCATGCCACCACCACTCCGTGGAGGTCCAGGAGGCC CAGGAGGTCCTGGGGGACCCATGGGTCGCATGGGAGGCCGTGGAGGAGATAGAGGAGGCTTCCCTCCAAG AGGACCCCGGGGTTCCCGAGGGAACCCCTCTGGAGGAGGAAACGTCCAGCACCGAGCTGGAGACTGGCAG TGTCCCAATCCGGGTTGTGGAAACCAGAACTTCGCCTGGAGAACAGAGTGCAACCAGTGTAAGGCCCCAA AGCCTGAAGGCTTCCTCCCGCCACCCTTTCCGCCCCCGGGTGGTGATCGTGGCAGAGGTGGCCCTGGTGG CATGCGGGGAGGAAGAGGTGGCCTCATGGATCGTGGTGGTCCCGGTGGAATGTTCAGAGGTGGCCGTGGT GGAGACAGAGGTGGCTTCCGTGGTGGCCGGGGCATGGACCGAGGTGGCTTTGGTGGAGGAAGACGAGGTG GCCCTGGGGGGCCCCCTGGACCTTTGATGGAACAGATGGGAGGAAGAAGAGGAGGACGTGGAGGACCTGG 27 4868-5555-9605.1Atty. Dkt. No.115872-2946 AAAAATGGATAAAGGCGAGCACCGTCAGGAGCGCAGAGATCGGCCCTACTAGATGCAGAGACCCCGCAGA GCTGCATTGACTACCAGATTTATTTTTTAAACCAGAAAATGTTTTAAATTTATAATTCCATATTTATAAT GTTGGCCACAACATTATGATTATTCCTTGTCTGTACTTTAGTATTTTTCACCATTTGTGAAGAAACATTA AAACAAGTTAAATGGTAGTGTGCGGAGTTTTTTTTTCTTCCTTCTTTTAAAAATGGTTGTTTAAGACTTT AACAATGGGAACCCCTTGTGAGCATGCTCAGTATCATTGTGGAGAACCAAGAGGGCCTCTTAACTGTAAC AATGTTCATGGTTGTGATGTTTTTTTTTTTTTTTTAAATAAAATTCCAAATGTTTATAAAGA

[0092] NM_001163287.2 Homo sapiens EWS RNA binding protein 1 (EWSR1), transcript variant 5, mRNA (SEQ ID NO: 3) GCAGTGCGGCGCCTAGAGGGAAAGCGAGAGGGAGACGGACGTTGAGAGAACGAGGAGGAAGGAGAGAAAA TGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGCGCAGCAGGGCTACAGTGCTTACACCGCCCA GCCCACTCAAGGATATGCACAGACCACCCAGGCATATGGGCAACAAAGCTATGGAACCTATGGACAGCCC ACTGATGTCAGCTATACCCAGGCTCAGACCACTGCAACCTATGGGCAGACCGCCTATGCAACTTCTTATG GACAGCCTCCCACTGGTTATACTACTCCAACTGCCCCCCAGGCATACAGCCAGCCTGTCCAGGGGTATGG CACTGGTGCTTATGATACCACCACTGCTACAGTCACCACCACCCAGGCCTCCTATGCAGCTCAGTCTGCA TATGGCACTCAGCCTGCTTATCCAGCCTATGGGCAGCAGCCAGCAGCCACTGCACCTACAAGACCGCAGG ATGGAAACAAGCCCACTGAGACTAGTCAACCTCAATCTAGCACAGGGGGTTACAACCAGCCCAGCCTAGG ATATGGACAGAGTAACTACAGTTATCCCCAGGTACCTGGGAGCTACCCCATGCAGCCAGTCACTGCACCT CCATCCTACCCTCCTACCAGCTATTCCTCTACACAGCCGACTAGTTATGATCAGAGCAGTTACTCTCAGC AGAACACCTATGGGCAACCGAGCAGCTATGGACAGCAGAGTAGCTATGGTCAACAAAGCAGCTATGGGCA GCAGCCTCCCACTAGTTACCCACCCCAAACTGGATCCTACAGCCAAGCTCCAAGTCAATATAGCCAACAG AGCAGCAGCTACGGGCAGCAGAGTTCATTCCGACAGGACCACCCCAGTAGCATGGGTGTTTATGGGCAGG AGTCTGGAGGATTTTCCGGACCAGGAGAGAACCGGAGCATGAGTGGCCCTGATAACCGGGGCAGGGGAAG AGGGGGATTTGATCGTGGAGGCATGAGCAGAGGTGGGCGGGGAGGAGGACGCGGTGGAATGGGGTTACAA AGTGAGAGCCTTGTATACACTTCAATACTTAAAAAGTACCCGTACTCAGTACTCAGCCGGCAGCATAATG AAAAGTGGGACTAGACACGGTGTCCATATGGAGAGGAAAAATATACATAGAATATTTTTAACAAAATGTA TTCATTGTATAAATGGAATCCTTCTGTAACTTTGGTAACTGCATACTTGTTGTTTGGTAATGAACCAGAG GAGGTATAATACTCTAGAATTGTGTAACATTAAAGTGTAAACTTTTGTGTTTAAA

[0093] NM_005243.4 Homo sapiens EWS RNA binding protein 1 (EWSR1), transcript variant 2, mRNA (SEQ ID NO: 4) GCAGTGCGGCGCCTAGAGGGAAAGCGAGAGGGAGACGGACGTTGAGAGAACGAGGAGGAAGGAGAGAAAA TGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGCGCAGCAGGGCTACAGTGCTTACACCGCCCA GCCCACTCAAGGATATGCACAGACCACCCAGGCATATGGGCAACAAAGCTATGGAACCTATGGACAGCCC ACTGATGTCAGCTATACCCAGGCTCAGACCACTGCAACCTATGGGCAGACCGCCTATGCAACTTCTTATG GACAGCCTCCCACTGGTTATACTACTCCAACTGCCCCCCAGGCATACAGCCAGCCTGTCCAGGGGTATGG CACTGGTGCTTATGATACCACCACTGCTACAGTCACCACCACCCAGGCCTCCTATGCAGCTCAGTCTGCA TATGGCACTCAGCCTGCTTATCCAGCCTATGGGCAGCAGCCAGCAGCCACTGCACCTACAAGACCGCAGG ATGGAAACAAGCCCACTGAGACTAGTCAACCTCAATCTAGCACAGGGGGTTACAACCAGCCCAGCCTAGG ATATGGACAGAGTAACTACAGTTATCCCCAGGTACCTGGGAGCTACCCCATGCAGCCAGTCACTGCACCT CCATCCTACCCTCCTACCAGCTATTCCTCTACACAGCCGACTAGTTATGATCAGAGCAGTTACTCTCAGC AGAACACCTATGGGCAACCGAGCAGCTATGGACAGCAGAGTAGCTATGGTCAACAAAGCAGCTATGGGCA GCAGCCTCCCACTAGTTACCCACCCCAAACTGGATCCTACAGCCAAGCTCCAAGTCAATATAGCCAACAG AGCAGCAGCTACGGGCAGCAGAGTTCATTCCGACAGGACCACCCCAGTAGCATGGGTGTTTATGGGCAGG AGTCTGGAGGATTTTCCGGACCAGGAGAGAACCGGAGCATGAGTGGCCCTGATAACCGGGGCAGGGGAAG AGGGGGATTTGATCGTGGAGGCATGAGCAGAGGTGGGCGGGGAGGAGGACGCGGTGGAATGGGCAGCGCT GGAGAGCGAGGTGGCTTCAATAAGCCTGGTGGACCCATGGATGAAGGACCAGATCTTGATCTAGGCCCAC CTGTAGATCCAGATGAAGACTCTGACAACAGTGCAATTTATGTACAAGGATTAAATGACAGTGTGACTCT AGATGATCTGGCAGACTTCTTTAAGCAGTGTGGGGTTGTTAAGATGAACAAGAGAACTGGGCAACCCATG ATCCACATCTACCTGGACAAGGAAACAGGAAAGCCCAAAGGCGATGCCACAGTGTCCTATGAAGACCCAC CCACTGCCAAGGCTGCCGTGGAATGGTTTGATGGGAAAGATTTTCAAGGGAGCAAACTTAAAGTCTCCCT TGCTCGGAAGAAGCCTCCAATGAACAGTATGCGGGGTGGTCTGCCACCCCGTGAGGGCAGAGGCATGCCA CCACCACTCCGTGGAGGTCCAGGAGGCCCAGGAGGTCCTGGGGGACCCATGGGTCGCATGGGAGGCCGTG GAGGAGATAGAGGAGGCTTCCCTCCAAGAGGACCCCGGGGTTCCCGAGGGAACCCCTCTGGAGGAGGAAA 28 4868-5555-9605.1Atty. Dkt. No.115872-2946 CGTCCAGCACCGAGCTGGAGACTGGCAGTGTCCCAATCCGGGTTGTGGAAACCAGAACTTCGCCTGGAGA ACAGAGTGCAACCAGTGTAAGGCCCCAAAGCCTGAAGGCTTCCTCCCGCCACCCTTTCCGCCCCCGGGTG GTGATCGTGGCAGAGGTGGCCCTGGTGGCATGCGGGGAGGAAGAGGTGGCCTCATGGATCGTGGTGGTCC CGGTGGAATGTTCAGAGGTGGCCGTGGTGGAGACAGAGGTGGCTTCCGTGGTGGCCGGGGCATGGACCGA GGTGGCTTTGGTGGAGGAAGACGAGGTGGCCCTGGGGGGCCCCCTGGACCTTTGATGGAACAGATGGGAG GAAGAAGAGGAGGACGTGGAGGACCTGGAAAAATGGATAAAGGCGAGCACCGTCAGGAGCGCAGAGATCG GCCCTACTAGATGCAGAGACCCCGCAGAGCTGCATTGACTACCAGATTTATTTTTTAAACCAGAAAATGT TTTAAATTTATAATTCCATATTTATAATGTTGGCCACAACATTATGATTATTCCTTGTCTGTACTTTAGT ATTTTTCACCATTTGTGAAGAAACATTAAAACAAGTTAAATGGTAGTGTGCGGAGTTTTTTTTTCTTCCT TCTTTTAAAAATGGTTGTTTAAGACTTTAACAATGGGAACCCCTTGTGAGCATGCTCAGTATCATTGTGG AGAACCAAGAGGGCCTCTTAACTGTAACAATGTTCATGGTTGTGATGTTTTTTTTTTTTTTTTAAATAAA ATTCCAAATGTTTATAAAGA

[0094] NM_013986.4 Homo sapiens EWS RNA binding protein 1 (EWSR1), transcript variant 1, mRNA (SEQ ID NO: 5) GCAGTGCGGCGCCTAGAGGGAAAGCGAGAGGGAGACGGACGTTGAGAGAACGAGGAGGAAGGAGAGAAAA TGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGCGCAGCAGGGCTACAGTGCTTACACCGCCCA GCCCACTCAAGGATATGCACAGACCACCCAGGCATATGGGCAACAAAGCTATGGAACCTATGGACAGCCC ACTGATGTCAGCTATACCCAGGCTCAGACCACTGCAACCTATGGGCAGACCGCCTATGCAACTTCTTATG GACAGCCTCCCACTGTAGAAGGGACCAGTACAGGTTATACTACTCCAACTGCCCCCCAGGCATACAGCCA GCCTGTCCAGGGGTATGGCACTGGTGCTTATGATACCACCACTGCTACAGTCACCACCACCCAGGCCTCC TATGCAGCTCAGTCTGCATATGGCACTCAGCCTGCTTATCCAGCCTATGGGCAGCAGCCAGCAGCCACTG CACCTACAAGACCGCAGGATGGAAACAAGCCCACTGAGACTAGTCAACCTCAATCTAGCACAGGGGGTTA CAACCAGCCCAGCCTAGGATATGGACAGAGTAACTACAGTTATCCCCAGGTACCTGGGAGCTACCCCATG CAGCCAGTCACTGCACCTCCATCCTACCCTCCTACCAGCTATTCCTCTACACAGCCGACTAGTTATGATC AGAGCAGTTACTCTCAGCAGAACACCTATGGGCAACCGAGCAGCTATGGACAGCAGAGTAGCTATGGTCA ACAAAGCAGCTATGGGCAGCAGCCTCCCACTAGTTACCCACCCCAAACTGGATCCTACAGCCAAGCTCCA AGTCAATATAGCCAACAGAGCAGCAGCTACGGGCAGCAGAGTTCATTCCGACAGGACCACCCCAGTAGCA TGGGTGTTTATGGGCAGGAGTCTGGAGGATTTTCCGGACCAGGAGAGAACCGGAGCATGAGTGGCCCTGA TAACCGGGGCAGGGGAAGAGGGGGATTTGATCGTGGAGGCATGAGCAGAGGTGGGCGGGGAGGAGGACGC GGTGGAATGGGCGCTGGAGAGCGAGGTGGCTTCAATAAGCCTGGTGGACCCATGGATGAAGGACCAGATC TTGATCTAGGCCCACCTGTAGATCCAGATGAAGACTCTGACAACAGTGCAATTTATGTACAAGGATTAAA TGACAGTGTGACTCTAGATGATCTGGCAGACTTCTTTAAGCAGTGTGGGGTTGTTAAGATGAACAAGAGA ACTGGGCAACCCATGATCCACATCTACCTGGACAAGGAAACAGGAAAGCCCAAAGGCGATGCCACAGTGT CCTATGAAGACCCACCCACTGCCAAGGCTGCCGTGGAATGGTTTGATGGGAAAGATTTTCAAGGGAGCAA ACTTAAAGTCTCCCTTGCTCGGAAGAAGCCTCCAATGAACAGTATGCGGGGTGGTCTGCCACCCCGTGAG GGCAGAGGCATGCCACCACCACTCCGTGGAGGTCCAGGAGGCCCAGGAGGTCCTGGGGGACCCATGGGTC GCATGGGAGGCCGTGGAGGAGATAGAGGAGGCTTCCCTCCAAGAGGACCCCGGGGTTCCCGAGGGAACCC CTCTGGAGGAGGAAACGTCCAGCACCGAGCTGGAGACTGGCAGTGTCCCAATCCGGGTTGTGGAAACCAG AACTTCGCCTGGAGAACAGAGTGCAACCAGTGTAAGGCCCCAAAGCCTGAAGGCTTCCTCCCGCCACCCT TTCCGCCCCCGGGTGGTGATCGTGGCAGAGGTGGCCCTGGTGGCATGCGGGGAGGAAGAGGTGGCCTCAT GGATCGTGGTGGTCCCGGTGGAATGTTCAGAGGTGGCCGTGGTGGAGACAGAGGTGGCTTCCGTGGTGGC CGGGGCATGGACCGAGGTGGCTTTGGTGGAGGAAGACGAGGTGGCCCTGGGGGGCCCCCTGGACCTTTGA TGGAACAGATGGGAGGAAGAAGAGGAGGACGTGGAGGACCTGGAAAAATGGATAAAGGCGAGCACCGTCA GGAGCGCAGAGATCGGCCCTACTAGATGCAGAGACCCCGCAGAGCTGCATTGACTACCAGATTTATTTTT TAAACCAGAAAATGTTTTAAATTTATAATTCCATATTTATAATGTTGGCCACAACATTATGATTATTCCT TGTCTGTACTTTAGTATTTTTCACCATTTGTGAAGAAACATTAAAACAAGTTAAATGGTAGTGTGCGGAG TTTTTTTTTCTTCCTTCTTTTAAAAATGGTTGTTTAAGACTTTAACAATGGGAACCCCTTGTGAGCATGC TCAGTATCATTGTGGAGAACCAAGAGGGCCTCTTAACTGTAACAATGTTCATGGTTGTGATGTTTTTTTT TTTTTTTTAAATAAAATTCCAAATGTTTATAAAGA

[0095] NM_001170634.1 Homo sapiens FUS RNA binding protein (FUS), transcript variant 3, mRNA (SEQ ID NO: 6) ACTTAAGCTTCGACGCAGGAGGCGGGGCTGCTCAGTCCTCCAGGCGTCGGTACTCAGCGGTGTTGGAACT 29 4868-5555-9605.1Atty. Dkt. No.115872-2946 TCGTTGCTTGCTTGCCTGTGCGCGCGTGCGCGGACATGGCCTCAAACGATTATACCCAACAAGCAACCCA AAGCTATGGGGCCTACCCCACCCAGCCCGGGCAGGGCTATTCCCAGCAGAGCAGTCAGCCCTACGGACAG CAGAGTTACAGTGGTTATAGCCAGTCCACGGACACTTCAGGCTATGGCCAGAGCAGCTATTCTTCTTATG GCCAGAGCCAGAACAGCTATGGAACTCAGTCAACTCCCCAGGGATATGGCTCGACTGGCGGCTATGGCAG TAGCCAGAGCTCCCAATCGTCTTACGGGCAGCAGTCCTCCTACCCTGGCTATGGCCAGCAGCCAGCTCCC AGCAGCACCTCGGGAAGTTACGGTAGCAGTTCTCAGAGCAGCAGCTATGGGCAGCCCCAGAGTGGGAGCT ACAGCCAGCAGCCTAGCTATGGTGGACAGCAGCAAAGCTATGGACAGCAGCAAAGCTATAATCCCCCTCA GGGCTATGGACAGCAGAACCAGTACAACAGCAGCAGTGGTGGTGGAGGTGGAGGTGGAGGTGGAGGTAAC TATGGCCAAGATCAATCCTCCATGAGTAGTGGTGGTGGCAGTGGTGGCGGTTATGGCAATCAAGACCAGA GTGGTGGAGGTGGCAGCGGTGGCTATGGACAGCAGGACCGTGGAGGCCGCGGCAGGGGTGGCAGTGGTGG CGGCGGCGGCGGCGGCGGTGGTGGTTACAACCGCAGCAGTGGTGGCTATGAACCCAGAGGTCGTGGAGGT GGCCGTGGAGGCAGAGGTGGCATGGGCGGAAGTGACCGTGGTGGCTTCAATAAATTTGGTGGCCCTCGGG ACCAAGGATCACGTCATGACTCCGAACAGGATAATTCAGACAACAACACCATCTTTGTGCAAGGCCTGGG TGAGAATGTTACAATTGAGTCTGTGGCTGATTACTTCAAGCAGATTGGTATTATTAAGACAAACAAGAAA ACGGGACAGCCCATGATTAATTTGTACACAGACAGGGAAACTGGCAAGCTGAAGGGAGAGGCAACGGTCT CTTTTGATGACCCACCTTCAGCTAAAGCAGCTATTGACTGGTTTGATGGTAAAGAATTCTCCGGAAATCC TATCAAGGTCTCATTTGCTACTCGCCGGGCAGACTTTAATCGGGGTGGTGGCAATGGTCGTGGAGGCCGA GGGCGAGGAGGACCCATGGGCCGTGGAGGCTATGGAGGTGGTGGCAGTGGTGGTGGTGGCCGAGGAGGAT TTCCCAGTGGAGGTGGTGGCGGTGGAGGACAGCAGCGAGCTGGTGACTGGAAGTGTCCTAATCCCACCTG TGAGAATATGAACTTCTCTTGGAGGAATGAATGCAACCAGTGTAAGGCCCCTAAACCAGATGGCCCAGGA GGGGGACCAGGTGGCTCTCACATGGGGGGTAACTACGGGGATGATCGTCGTGGTGGCAGAGGAGGCTATG ATCGAGGCGGCTACCGGGGCCGCGGCGGGGACCGTGGAGGCTTCCGAGGGGGCCGGGGTGGTGGGGACAG AGGTGGCTTTGGCCCTGGCAAGATGGATTCCAGGGGTGAGCACAGACAGGATCGCAGGGAGAGGCCGTAT TAATTAGCCTGGCTCCCCAGGTTCTGGAACAGCTTTTTGTCCTGTACCCAGTGTTACCCTCGTTATTTTG TAACCTTCCAATTCCTGATCACCCAAGGGTTTTTTTGTGTCGGACTATGTAATTGTAACTATACCTCTGG TTCCCATTAAAAGTGACCATTTTAGTTAAATTTTGTTCCTCTTCCCCCTTTTCACTTTCCTGGAAGATCG ATGTCCCGATCAGGAAGGTAGAGAGTTTTCCTGTTCAGATTACCCTGCCCAGCAGGAACTGGAATACAGT GTTCGGGGAGAAGGCCAAATGATATCCTTGAGAGCAGAGATTAAACTTTTCTGTCATGGGGAAAGTTGGT GTATAAATGAGAAATGAAGAACATGGGATGTCATGAGTGTTGGCCTAAATTTGCCCAGCTATGGGGAATT TTTCCTTTACCACATTTATTTGCATACTGGTCTTAGTTTATTTGCAGCAGTTTATCCCTTTTTAAGAACT CTTTGATCTTTTGGCCCTTTTAATGGTGAGGCTCAAACAAACTACATTTAAATGGGGCAGTATTCAGATT TGACCATGGTGGAGAGCGCTTAGCCACTCTGGGTCTTTCACAGGAAGGAGAGTAACTGAGTGCTGCAGGA GTTTGTGGAGTGGAGTCAGGATCTAGGAGGTGAGTGACTCCCTTCCTAGCTGCCCTGGTGAACAGCGCTT GGGTAGATACCTGCTATAAGGAGACTGGTCTGGCTGGGTTACTTTCACATCCTGCCTGTACTCAGAGGGC TTGAGGTCATTGACATTATGAGATTTTAGGCTTGATCCCTTTTTGATTGGAGGGTGGAAGGCCCTCCTAA GGGAATGATAAGTGATAAGAGGGGGAAGGGGTTGCAGCCAATGAGTTAAAACCTTAGAGCAGTGCTCCTC AGCCTCTTACCATGTGGTTGTAAACTTGCACGTACCTGCCAACCAGTTATTTAGCATGCTTTTTATTTTA GTTACACAGAGCGTAACATTAACCCAAGAGCAGAAAGGTTTTATTTACAGGGTTTTCGAACTTGGTTTGT AAGACAGCTGCCATCACAAGCATAGCTTACAAATGTGCTGGGGACCCCTAATTGGGAAGTGCTTTCCTCT CAAATTTTTATTTTTTATTTTTAGAGACAGAGTCTTGCTCTGTCATCCAGGCTGGAGTGCAGTGGCGTGA TCTCGGCTCACTGTAGCCTCTGCCTCCTGAGTTTAAGCGATTCTCCTGCCTCAGGAGAATCCCAGCTTCT GAGTAGCTGAGACTACAGGCGTGGGCCACCATGCCCACCTAGTTTTTGCATTTTTAGTGGAGGTGTGGTT TCACTGTGTTGGCCAGGCTGGTCTCTTAACTCCTGACCTCAGGTGATCCACCTGCCTTGGCCTCCCAAAG TGCTGGAATTACAGGCATGAGCCGCTGCATCTGGCCATCCTCTCAAATTTTCAAGTGTTCCACAAGTATG TTCTCTACTGAAGAGTTGCTGCATCCTTGAATCTTGGGTGATTTGAGGCACAGAAACTATGACTTTATTT TTTGAGATGGAGTTTTGCTCTTGTTGCCCAGGCTGGAGTGCAATGGCACGTTTTTCGGCTTACCGCAACT GCCGCCTCCTGGGTTCAAGCGATAGCTGGGATTACAGGCATGCGCCACCATGCCCAGCTAATTTATTTGT ATTTTTAGTAGAGACGGGGTTTCTCCATGTTGGTCAGGCTGGTCTCGAACTCCCGACCTCAGGTGATGTG CACACCTCAGCCTCCCAATAAACCATGACTTTTAAGAGGAATAGCAGGTTTACTTCCCCTGCCAGCATTG GGGTGCTCTCTAAGCAACAGTAGGCGGAGAGTGGTCTGGCGTATTAAAAACAAAGGATCGTCAAGTGGGC CTTCCCAGGCATTGCTTTGACTTAGTACATGTAGAGGATGTGGCAGTTCTCTCCGTCCCTGCCACTGCTG GTTTCTTTGTTAAATGTTTAGTTGAAATGGCCTGATACGATATTTGAGTAGTTCACTGTTGGTGCTTTGC CTAGCAGGATTCTAATCTTGCTTTGGTTGTGGTCCCCTGATGCCCTCCTGTTAGGAGTGGAGGAGGTCGA AGCTCCTTGTAAGATATGATTACTGGGACCATTAGTGTCAAGTTCCTGTGTCCTTCAAATGGCATATGTG ATTGGCCTTGACCTTAAAAGGAAATAGGGTCCCAGGTGACTGTTTAGTGGGTAGGTCCAGTTTGGGGGGA TCTTCCAGGAGAATGGATAGAGACACCTAGCAGCAGAGAGAACATTGGTGCCTCTCAAGCCAACCTCCCA CCTCAGCCTCCCAAGTAGCTGGGACTACAGGTGCTTCCTCGCTACCACACCTGGGTAATTTTTTTTTTAA TTACTTTTTTTTTTTTAAGAAACAGGGTTTCACTGGGTTGCCCAGGCTGGTCTTGAACTGGCCTCAAGTG ACCTGCCTGCCTCAGCCTCCCAAAGTGCTGGGATCACAGGTGTGACCCACTGCGTTTGGCCAGAATACTC TATTCTTACTGAATGATTGAAATCTGTCTTGAAGCATTAGGTGTCCCATTTTTGTGAGTTGGAATTGGGA CAGGCTAAGTAGGAAGTGAGGAGGGTGGGGAGAGCTGTGCTGTAGGTCTGTTTGTCCCTTCCTTGATGTA 30 4868-5555-9605.1Atty. Dkt. No.115872-2946 GCCTTCAGTTAGCCCTTTCAGCTTTTTTCCCCATCTTGTGCCGGGCCTTCCTGGGTTTCAGTACTTGGAT GTAGGGCTGCAGTTATGTCAGTGGTGGGTAGATTGACCAGGAATTAAGGTCTAGGGTCCAGCCCATGTGA GACTTGACTCACTGATCTACCTTTAGGCATGTCTTCCTTCCAGTCTCATCCTTTTTAAATTTTTTTTTTT TTTTTGAGACGGTCTCACTCTCACCCAGGCTGGATTGCAGTGGTGTGATCTCGACCAACTGCAACCTCTG CCTCCCACCCGCAAGCTATCTGCCCACCTCAGCCTCTGGAGTAGCTGGGACGGGACTACAGGCACCTGCC ACCATGACTGGCTAATTTTTTTTTGTATTTTTTGTGGAGATGGGGTCTTGCCATGTTGCTCAGGCTGGTC TGGTCTCAAAACTGCTCTGGGCTCAAGTGATTGTCCCACTTTGGCCTCCCAGAGTGCTGGGATTAAGGTG TGAGATACTGTGTCCGGCTATGAAAATTTTATTTTTAATTAACTTGTATATATTTATGGGGTACAATGTC CTATTTCTGTACATGTACACATTGTGGAATCAAATCAGGCTAATATATCCATCACTTCATATCATTAGCA TGAATGAGAACATACAAAGCCACTCTTAGAAAATTTTGAAATTTATGTTATTTCAGCCCTTTTATGCTGG AGGTTGCAAATGTTTTGTGAATAATCAGACCAAAAATAAAAACAAAAAATGATTGACTTCAGTCATTCAG TAAGAA

[0096] NM_001170937.1 Homo sapiens FUS RNA binding protein (FUS), transcript variant 4, mRNA (SEQ ID NO: 7) ACTTAAGCTTCGACGCAGGAGGCGGGGCTGCTCAGTCCTCCAGGCGTCGGTACTCAGCGGTGTTGGAACT TCGTTGCTTGCTTGCCTGTGCGCGCGTGCGCGGACATGGCCTCAAACGATTATACCCAACAAGCAACCCA AAGCTATGGGGCCTACCCCACCCAGCCCGGGCAGGGCTATTCCCAGCAGAGCAGTCAGCCCTACGGACAG CAGAGTTACAGTGGTTATAGCCAGTCCACGGACACTTCAGGCTATGGCCAGAGCAGCTATTCTTCTTATG GCCAGAGCCAGAACACAGGCTATGGAACTCAGTCAACTCCCCAGGGATATGGCTCGACTGGCGGCTATGG CAGTAGCCAGAGCTCCCAATCGTCTTACGGGCAGCAGTCCTCCTACCCTGGCTATGGCCAGCAGCCAGCT CCCAGCAGCACCTCGGGAAGTTACGGTAGCAGTTCTCAGAGCAGCAGCTATGGGCAGCCCCAGAGTGGGA GCTACAGCCAGCAGCCTAGCTATGGTGGACAGCAGCAAAGCTATGGACAGCAGCAAAGCTATAATCCCCC TCAGGGCTATGGACAGCAGAACCAGTACAACAGCAGCAGTGGTGGTGGAGGTGGAGGTAACTATGGCCAA GATCAATCCTCCATGAGTAGTGGTGGTGGCAGTGGTGGCGGTTATGGCAATCAAGACCAGAGTGGTGGAG GTGGCAGCGGTGGCTATGGACAGCAGGACCGTGGAGGCCGCGGCAGGGGTGGCAGTGGTGGCGGCGGCGG CGGCGGCGGTGGTGGTTACAACCGCAGCAGTGGTGGCTATGAACCCAGAGGTCGTGGAGGTGGCCGTGGA GGCAGAGGTGGCATGGGCGGAAGTGACCGTGGTGGCTTCAATAAATTTGGTGGCCCTCGGGACCAAGGAT CACGTCATGACTCCGAACAGGATAATTCAGACAACAACACCATCTTTGTGCAAGGCCTGGGTGAGAATGT TACAATTGAGTCTGTGGCTGATTACTTCAAGCAGATTGGTATTATTAAGACAAACAAGAAAACGGGACAG CCCATGATTAATTTGTACACAGACAGGGAAACTGGCAAGCTGAAGGGAGAGGCAACGGTCTCTTTTGATG ACCCACCTTCAGCTAAAGCAGCTATTGACTGGTTTGATGGTAAAGAATTCTCCGGAAATCCTATCAAGGT CTCATTTGCTACTCGCCGGGCAGACTTTAATCGGGGTGGTGGCAATGGTCGTGGAGGCCGAGGGCGAGGA GGACCCATGGGCCGTGGAGGCTATGGAGGTGGTGGCAGTGGTGGTGGTGGCCGAGGAGGATTTCCCAGTG GAGGTGGTGGCGGTGGAGGACAGCAGCGAGCTGGTGACTGGAAGTGTCCTAATCCCACCTGTGAGAATAT GAACTTCTCTTGGAGGAATGAATGCAACCAGTGTAAGGCCCCTAAACCAGATGGCCCAGGAGGGGGACCA GGTGGCTCTCACATGGGGGGTAACTACGGGGATGATCGTCGTGGTGGCAGAGGAGGCTATGATCGAGGCG GCTACCGGGGCCGCGGCGGGGACCGTGGAGGCTTCCGAGGGGGCCGGGGTGGTGGGGACAGAGGTGGCTT TGGCCCTGGCAAGATGGATTCCAGGGGTGAGCACAGACAGGATCGCAGGGAGAGGCCGTATTAATTAGCC TGGCTCCCCAGGTTCTGGAACAGCTTTTTGTCCTGTACCCAGTGTTACCCTCGTTATTTTGTAACCTTCC AATTCCTGATCACCCAAGGGTTTTTTTGTGTCGGACTATGTAATTGTAACTATACCTCTGGTTCCCATTA AAAGTGACCATTTTAGTTAAATTTTGTTCCTCTTCCCCCTTTTCACTTTCCTGGAAGATCGATGTCCCGA TCAGGAAGGTAGAGAGTTTTCCTGTTCAGATTACCCTGCCCAGCAGGAACTGGAATACAGTGTTCGGGGA GAAGGCCAAATGATATCCTTGAGAGCAGAGATTAAACTTTTCTGTCATGGGGAAAGTTGGTGTATAAATG AGAAATGAAGAACATGGGATGTCATGAGTGTTGGCCTAAATTTGCCCAGCTATGGGGAATTTTTCCTTTA CCACATTTATTTGCATACTGGTCTTAGTTTATTTGCAGCAGTTTATCCCTTTTTAAGAACTCTTTGATCT TTTGGCCCTTTTAATGGTGAGGCTCAAACAAACTACATTTAAATGGGGCAGTATTCAGATTTGACCATGG TGGAGAGCGCTTAGCCACTCTGGGTCTTTCACAGGAAGGAGAGTAACTGAGTGCTGCAGGAGTTTGTGGA GTGGAGTCAGGATCTAGGAGGTGAGTGACTCCCTTCCTAGCTGCCCTGGTGAACAGCGCTTGGGTAGATA CCTGCTATAAGGAGACTGGTCTGGCTGGGTTACTTTCACATCCTGCCTGTACTCAGAGGGCTTGAGGTCA TTGACATTATGAGATTTTAGGCTTGATCCCTTTTTGATTGGAGGGTGGAAGGCCCTCCTAAGGGAATGAT AAGTGATAAGAGGGGGAAGGGGTTGCAGCCAATGAGTTAAAACCTTAGAGCAGTGCTCCTCAGCCTCTTA CCATGTGGTTGTAAACTTGCACGTACCTGCCAACCAGTTATTTAGCATGCTTTTTATTTTAGTTACACAG AGCGTAACATTAACCCAAGAGCAGAAAGGTTTTATTTACAGGGTTTTCGAACTTGGTTTGTAAGACAGCT GCCATCACAAGCATAGCTTACAAATGTGCTGGGGACCCCTAATTGGGAAGTGCTTTCCTCTCAAATTTTT ATTTTTTATTTTTAGAGACAGAGTCTTGCTCTGTCATCCAGGCTGGAGTGCAGTGGCGTGATCTCGGCTC ACTGTAGCCTCTGCCTCCTGAGTTTAAGCGATTCTCCTGCCTCAGGAGAATCCCAGCTTCTGAGTAGCTG AGACTACAGGCGTGGGCCACCATGCCCACCTAGTTTTTGCATTTTTAGTGGAGGTGTGGTTTCACTGTGT 31 4868-5555-9605.1Atty. Dkt. No.115872-2946 TGGCCAGGCTGGTCTCTTAACTCCTGACCTCAGGTGATCCACCTGCCTTGGCCTCCCAAAGTGCTGGAAT TACAGGCATGAGCCGCTGCATCTGGCCATCCTCTCAAATTTTCAAGTGTTCCACAAGTATGTTCTCTACT GAAGAGTTGCTGCATCCTTGAATCTTGGGTGATTTGAGGCACAGAAACTATGACTTTATTTTTTGAGATG GAGTTTTGCTCTTGTTGCCCAGGCTGGAGTGCAATGGCACGTTTTTCGGCTTACCGCAACTGCCGCCTCC TGGGTTCAAGCGATAGCTGGGATTACAGGCATGCGCCACCATGCCCAGCTAATTTATTTGTATTTTTAGT AGAGACGGGGTTTCTCCATGTTGGTCAGGCTGGTCTCGAACTCCCGACCTCAGGTGATGTGCACACCTCA GCCTCCCAATAAACCATGACTTTTAAGAGGAATAGCAGGTTTACTTCCCCTGCCAGCATTGGGGTGCTCT CTAAGCAACAGTAGGCGGAGAGTGGTCTGGCGTATTAAAAACAAAGGATCGTCAAGTGGGCCTTCCCAGG CATTGCTTTGACTTAGTACATGTAGAGGATGTGGCAGTTCTCTCCGTCCCTGCCACTGCTGGTTTCTTTG TTAAATGTTTAGTTGAAATGGCCTGATACGATATTTGAGTAGTTCACTGTTGGTGCTTTGCCTAGCAGGA TTCTAATCTTGCTTTGGTTGTGGTCCCCTGATGCCCTCCTGTTAGGAGTGGAGGAGGTCGAAGCTCCTTG TAAGATATGATTACTGGGACCATTAGTGTCAAGTTCCTGTGTCCTTCAAATGGCATATGTGATTGGCCTT GACCTTAAAAGGAAATAGGGTCCCAGGTGACTGTTTAGTGGGTAGGTCCAGTTTGGGGGGATCTTCCAGG AGAATGGATAGAGACACCTAGCAGCAGAGAGAACATTGGTGCCTCTCAAGCCAACCTCCCACCTCAGCCT CCCAAGTAGCTGGGACTACAGGTGCTTCCTCGCTACCACACCTGGGTAATTTTTTTTTTAATTACTTTTT TTTTTTTAAGAAACAGGGTTTCACTGGGTTGCCCAGGCTGGTCTTGAACTGGCCTCAAGTGACCTGCCTG CCTCAGCCTCCCAAAGTGCTGGGATCACAGGTGTGACCCACTGCGTTTGGCCAGAATACTCTATTCTTAC TGAATGATTGAAATCTGTCTTGAAGCATTAGGTGTCCCATTTTTGTGAGTTGGAATTGGGACAGGCTAAG TAGGAAGTGAGGAGGGTGGGGAGAGCTGTGCTGTAGGTCTGTTTGTCCCTTCCTTGATGTAGCCTTCAGT TAGCCCTTTCAGCTTTTTTCCCCATCTTGTGCCGGGCCTTCCTGGGTTTCAGTACTTGGATGTAGGGCTG CAGTTATGTCAGTGGTGGGTAGATTGACCAGGAATTAAGGTCTAGGGTCCAGCCCATGTGAGACTTGACT CACTGATCTACCTTTAGGCATGTCTTCCTTCCAGTCTCATCCTTTTTAAATTTTTTTTTTTTTTTTGAGA CGGTCTCACTCTCACCCAGGCTGGATTGCAGTGGTGTGATCTCGACCAACTGCAACCTCTGCCTCCCACC CGCAAGCTATCTGCCCACCTCAGCCTCTGGAGTAGCTGGGACGGGACTACAGGCACCTGCCACCATGACT GGCTAATTTTTTTTTGTATTTTTTGTGGAGATGGGGTCTTGCCATGTTGCTCAGGCTGGTCTGGTCTCAA AACTGCTCTGGGCTCAAGTGATTGTCCCACTTTGGCCTCCCAGAGTGCTGGGATTAAGGTGTGAGATACT GTGTCCGGCTATGAAAATTTTATTTTTAATTAACTTGTATATATTTATGGGGTACAATGTCCTATTTCTG TACATGTACACATTGTGGAATCAAATCAGGCTAATATATCCATCACTTCATATCATTAGCATGAATGAGA ACATACAAAGCCACTCTTAGAAAATTTTGAAATTTATGTTATTTCAGCCCTTTTATGCTGGAGGTTGCAA ATGTTTTGTGAATAATCAGACCAAAAATAAAAACAAAAAATGATTGACTTCAGTCATTCAGTAAGAA

[0097] NM_004960.4 Homo sapiens FUS RNA binding protein (FUS), transcript variant 1, mRNA (SEQ ID NO: 8) GCTCAGTCCTCCAGGCGTCGGTACTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTGTGCGCGCGTGC GCGGACATGGCCTCAAACGATTATACCCAACAAGCAACCCAAAGCTATGGGGCCTACCCCACCCAGCCCG GGCAGGGCTATTCCCAGCAGAGCAGTCAGCCCTACGGACAGCAGAGTTACAGTGGTTATAGCCAGTCCAC GGACACTTCAGGCTATGGCCAGAGCAGCTATTCTTCTTATGGCCAGAGCCAGAACACAGGCTATGGAACT CAGTCAACTCCCCAGGGATATGGCTCGACTGGCGGCTATGGCAGTAGCCAGAGCTCCCAATCGTCTTACG GGCAGCAGTCCTCCTACCCTGGCTATGGCCAGCAGCCAGCTCCCAGCAGCACCTCGGGAAGTTACGGTAG CAGTTCTCAGAGCAGCAGCTATGGGCAGCCCCAGAGTGGGAGCTACAGCCAGCAGCCTAGCTATGGTGGA CAGCAGCAAAGCTATGGACAGCAGCAAAGCTATAATCCCCCTCAGGGCTATGGACAGCAGAACCAGTACA ACAGCAGCAGTGGTGGTGGAGGTGGAGGTGGAGGTGGAGGTAACTATGGCCAAGATCAATCCTCCATGAG TAGTGGTGGTGGCAGTGGTGGCGGTTATGGCAATCAAGACCAGAGTGGTGGAGGTGGCAGCGGTGGCTAT GGACAGCAGGACCGTGGAGGCCGCGGCAGGGGTGGCAGTGGTGGCGGCGGCGGCGGCGGCGGTGGTGGTT ACAACCGCAGCAGTGGTGGCTATGAACCCAGAGGTCGTGGAGGTGGCCGTGGAGGCAGAGGTGGCATGGG CGGAAGTGACCGTGGTGGCTTCAATAAATTTGGTGGCCCTCGGGACCAAGGATCACGTCATGACTCCGAA CAGGATAATTCAGACAACAACACCATCTTTGTGCAAGGCCTGGGTGAGAATGTTACAATTGAGTCTGTGG CTGATTACTTCAAGCAGATTGGTATTATTAAGACAAACAAGAAAACGGGACAGCCCATGATTAATTTGTA CACAGACAGGGAAACTGGCAAGCTGAAGGGAGAGGCAACGGTCTCTTTTGATGACCCACCTTCAGCTAAA GCAGCTATTGACTGGTTTGATGGTAAAGAATTCTCCGGAAATCCTATCAAGGTCTCATTTGCTACTCGCC GGGCAGACTTTAATCGGGGTGGTGGCAATGGTCGTGGAGGCCGAGGGCGAGGAGGACCCATGGGCCGTGG AGGCTATGGAGGTGGTGGCAGTGGTGGTGGTGGCCGAGGAGGATTTCCCAGTGGAGGTGGTGGCGGTGGA GGACAGCAGCGAGCTGGTGACTGGAAGTGTCCTAATCCCACCTGTGAGAATATGAACTTCTCTTGGAGGA ATGAATGCAACCAGTGTAAGGCCCCTAAACCAGATGGCCCAGGAGGGGGACCAGGTGGCTCTCACATGGG GGGTAACTACGGGGATGATCGTCGTGGTGGCAGAGGAGGCTATGATCGAGGCGGCTACCGGGGCCGCGGC GGGGACCGTGGAGGCTTCCGAGGGGGCCGGGGTGGTGGGGACAGAGGTGGCTTTGGCCCTGGCAAGATGG ATTCCAGGGGTGAGCACAGACAGGATCGCAGGGAGAGGCCGTATTAATTAGCCTGGCTCCCCAGGTTCTG GAACAGCTTTTTGTCCTGTACCCAGTGTTACCCTCGTTATTTTGTAACCTTCCAATTCCTGATCACCCAA 32 4868-5555-9605.1Atty. Dkt. No.115872-2946 GGGTTTTTTTGTGTCGGACTATGTAATTGTAACTATACCTCTGGTTCCCATTAAAAGTGACCATTTTAGT TAAA

[0098] NM_003487.4 Homo sapiens TATA-box binding protein associated factor 15 (TAF15), transcript variant 2, mRNA (SEQ ID NO: 9) AGTACAGCTCCGGCCGCCGCGCCGCCTGGCTTTCGTATTCGTTGTTCTCGGCGGGCTGTGGGGCCTCCGC GCCGCGGCCGTTAGTCATGTCGGATTCTGGAAGTTACGGTCAGTCTGGGGGTGAGCAGCAAAGTTATTCT ACCTATGGAAATCCAGGCAGCCAAGGCTATGGACAAGCATCACAAAGCTATTCTGGCTATGGGCAAACGA CTGATTCCTCTTATGGACAGAACTACAGCGGTTACTCCAGTTATGGACAAAGTTATTCACAGTCCTATGG TGGTTATGAGAATCAAAAGCAGAGCTCATATAGCCAGCAACCATATAATAACCAGGGACAGCAGCAAAAC ATGGAATCATCAGGAAGCCAAGGTGGAAGAGCACCTTCCTATGACCAGCCAGACTATGGTCAACAAGATT CATATGACCAGCAGTCAGGCTATGATCAACATCAAGGCTCATATGATGAGCAGTCAAATTATGATCAGCA GCATGATTCCTATAGTCAAAACCAGCAGTCCTATCATTCACAAAGGGAAAACTACAGCCACCACACACAA GATGACCGTCGTGATGTGAGTAGGTATGGAGAAGATAATAGAGGATATGGCGGGTCACAGGGAGGAGGTA GAGGGCGTGGGGGATATGACAAGGATGGAAGAGGTCCTATGACAGGATCAAGTGGTGGTGACCGCGGTGG CTTCAAAAATTTTGGTGGTCACAGGGATTATGGACCCAGAACAGATGCTGATTCAGAATCTGATAATTCA GATAACAACACAATCTTTGTGCAAGGACTTGGGGAGGGTGTGTCTACAGATCAAGTTGGGGAGTTCTTTA AACAAATAGGAATTATCAAGACAAATAAGAAGACCGGAAAACCAATGATAAATCTTTATACAGACAAGGA CACAGGAAAGCCAAAGGGGGAGGCAACAGTGTCATTTGATGACCCTCCTTCAGCTAAGGCAGCCATTGAC TGGTTTGATGGAAAAGAATTCCATGGCAACATCATTAAAGTGTCCTTTGCCACTAGAAGACCTGAATTCA TGAGAGGAGGTGGAAGTGGAGGTGGGCGGCGAGGCCGTGGAGGATATAGAGGTCGTGGAGGCTTTCAAGG GAGAGGTGGAGACCCCAAAAGTGGGGATTGGGTTTGCCCTAATCCGTCATGCGGAAATATGAACTTTGCT CGAAGGAATTCCTGCAATCAGTGCAATGAGCCTAGACCAGAGGACTCTCGTCCCTCAGGAGGAGATTTCC GGGGGAGAGGCTACGGTGGAGAGAGGGGCTACAGAGGTCGTGGGGGCAGAGGTGGAGACCGAGGCGGCTA TGGTGGAGACAGAAGTGGGGGTGGCTATGGTGGAGACAGAAGCAGCGGTGGTGGCTACAGCGGAGATAGA AGTGGGGGCGGCTATGGTGGAGACAGAAGTGGGGGTGGCTATGGTGGGGACAGAGGCGGCGGCTATGGTG GGGACAGAGGAGGCGGCTATGGAGGAGACCGAGGAGGTGGCTATGGAGGAGATCGAGGTGGCTATGGAGG AGACCGAGGTGGAGGCTATGGTGGAGACCGAGGAGGCTATGGAGGAGATCGAGGAGGTTACGGAGGAGAT CGAGGAGGTTATGGAGGAGATCGAGGAGGCTATGGAGGAGACAGAAGCCGGGGGGGCTATGGAGGAGACC GTGGTGGTGGCAGTGGCTACGGTGGAGACCGAAGTGGAGGCTATGGAGGAGACAGGAGTGGTGGCGGCTA TGGAGGAGACCGAGGTGGGGGCTACGGAGGAGACCGAGGTGGCTATGGAGGCAAAATGGGAGGAAGAAAC GACTACAGAAATGATCAGCGCAACCGACCATACTGATGACTGTTTTGAATGTTCCTTTGTCTCTGACATG ATCCATAGTGAAATTGCCAGAGTTTTGCCTGCTGCTTTCCTCGTGGCCTCTTCTTGGGTAGTGAAATTAA GTGACATTTGGATTTTTATTTGGGTGGGAGGGCTGGGACAGTTTTTCTTCTAGAAATGTCTGTTGAGATT TCCCCCTTTAGTTTCCAACCTTCTCCCCAACCCTTGGAGCTAAATGCGTTGTAAAATATTGCCAAAATGA AAAGTGTTTTGTAATACTGCAATAAAGGCTGCTTGTTTTTGTGGACTTTTGTA

[0099] NM_139215.3 Homo sapiens TATA-box binding protein associated factor 15 (TAF15), transcript variant 1, mRNA (SEQ ID NO: 10) AGTACAGCTCCGGCCGCCGCGCCGCCTGGCTTTCGTATTCGTTGTTCTCGGCGGGCTGTGGGGCCTCCGC GCCGCGGCCGTTAGTCATGTCGGATTCTGGAAGTTACGGTCAGTCTGGGGGTGAGCAGCAAAGTTATTCT ACCTATGGAAATCCAGGCAGCCAAGGCTATGGACAAGCATCACAAAGCTATTCTGGCTATGGGCAAACGA CTGATTCCTCTTATGGACAGAACTACAGCGGTTACTCCAGTTATGGACAAAGTCAGTCAGGTTATTCACA GTCCTATGGTGGTTATGAGAATCAAAAGCAGAGCTCATATAGCCAGCAACCATATAATAACCAGGGACAG CAGCAAAACATGGAATCATCAGGAAGCCAAGGTGGAAGAGCACCTTCCTATGACCAGCCAGACTATGGTC AACAAGATTCATATGACCAGCAGTCAGGCTATGATCAACATCAAGGCTCATATGATGAGCAGTCAAATTA TGATCAGCAGCATGATTCCTATAGTCAAAACCAGCAGTCCTATCATTCACAAAGGGAAAACTACAGCCAC CACACACAAGATGACCGTCGTGATGTGAGTAGGTATGGAGAAGATAATAGAGGATATGGCGGGTCACAGG GAGGAGGTAGAGGGCGTGGGGGATATGACAAGGATGGAAGAGGTCCTATGACAGGATCAAGTGGTGGTGA CCGCGGTGGCTTCAAAAATTTTGGTGGTCACAGGGATTATGGACCCAGAACAGATGCTGATTCAGAATCT GATAATTCAGATAACAACACAATCTTTGTGCAAGGACTTGGGGAGGGTGTGTCTACAGATCAAGTTGGGG AGTTCTTTAAACAAATAGGAATTATCAAGACAAATAAGAAGACCGGAAAACCAATGATAAATCTTTATAC AGACAAGGACACAGGAAAGCCAAAGGGGGAGGCAACAGTGTCATTTGATGACCCTCCTTCAGCTAAGGCA GCCATTGACTGGTTTGATGGAAAAGAATTCCATGGCAACATCATTAAAGTGTCCTTTGCCACTAGAAGAC 33 4868-5555-9605.1Atty. Dkt. No.115872-2946 CTGAATTCATGAGAGGAGGTGGAAGTGGAGGTGGGCGGCGAGGCCGTGGAGGATATAGAGGTCGTGGAGG CTTTCAAGGGAGAGGTGGAGACCCCAAAAGTGGGGATTGGGTTTGCCCTAATCCGTCATGCGGAAATATG AACTTTGCTCGAAGGAATTCCTGCAATCAGTGCAATGAGCCTAGACCAGAGGACTCTCGTCCCTCAGGAG GAGATTTCCGGGGGAGAGGCTACGGTGGAGAGAGGGGCTACAGAGGTCGTGGGGGCAGAGGTGGAGACCG AGGCGGCTATGGTGGAGACAGAAGTGGGGGTGGCTATGGTGGAGACAGAAGCAGCGGTGGTGGCTACAGC GGAGATAGAAGTGGGGGCGGCTATGGTGGAGACAGAAGTGGGGGTGGCTATGGTGGGGACAGAGGCGGCG GCTATGGTGGGGACAGAGGAGGCGGCTATGGAGGAGACCGAGGAGGTGGCTATGGAGGAGATCGAGGTGG CTATGGAGGAGACCGAGGTGGAGGCTATGGTGGAGACCGAGGAGGCTATGGAGGAGATCGAGGAGGTTAC GGAGGAGATCGAGGAGGTTATGGAGGAGATCGAGGAGGCTATGGAGGAGACAGAAGCCGGGGGGGCTATG GAGGAGACCGTGGTGGTGGCAGTGGCTACGGTGGAGACCGAAGTGGAGGCTATGGAGGAGACAGGAGTGG TGGCGGCTATGGAGGAGACCGAGGTGGGGGCTACGGAGGAGACCGAGGTGGCTATGGAGGCAAAATGGGA GGAAGAAACGACTACAGAAATGATCAGCGCAACCGACCATACTGATGACTGTTTTGAATGTTCCTTTGTC TCTGACATGATCCATAGTGAAATTGCCAGAGTTTTGCCTGCTGCTTTCCTCGTGGCCTCTTCTTGGGTAG TGAAATTAAGTGACATTTGGATTTTTATTTGGGTGGGAGGGCTGGGACAGTTTTTCTTCTAGAAATGTCT GTTGAGATTTCCCCCTTTAGTTTCCAACCTTCTCCCCAACCCTTGGAGCTAAATGCGTTGTAAAATATTG CCAAAATGAAAAGTGTTTTGTAATACTGCAATAAAGGCTGCTTGTTTTTGTGGACTTTTGTA

[0100] Primers or probes can be designed so that they hybridize under stringent conditions to nucleotide sequences comprising FET rearrangements (e.g., EWS, FUS, or TAF15 fusion oncoproteins), but not to the respective wild-type nucleotide sequences of FET genes. Primers or probes can also be prepared that are complementary and specific for the wild-type nucleotide sequence of FET genes (e.g., EWS, FUS, or TAF15), but not to any of the corresponding rearranged nucleotide sequences. In some embodiments, the nucleotide sequences of EWS, FUS, or TAF15 fusion oncoproteins result in the loss of expression and / or activity of EWS, FUS, or TAF15.

[0101] In some embodiments, detection can occur through any of a variety of mobility dependent analytical techniques based on the differential rates of migration between different nucleic acid sequences. Exemplary mobility-dependent analysis techniques include electrophoresis, chromatography, mass spectroscopy, sedimentation, gradient centrifugation, field-flow fractionation, multi-stage extraction techniques, and the like. In some embodiments, mobility probes can be hybridized to amplification products, and the identity of the target nucleic acid sequence determined via a mobility dependent analysis technique of the eluted mobility probes, as described in Published PCT Applications WO04 / 46344 and WO01 / 92579. In some embodiments, detection can be achieved by various microarrays and related software such as the Applied Biosystems Array System with the Applied Biosystems 1700 Chemiluminescent Microarray Analyzer and other commercially available array systems available from Affymetrix, Agilent, Illumina, and Amersham Biosciences, among others (see also Gerry et al., J. Mol. Biol.292:251-62, 1999; De Bellis et al., Minerva Biotec 14:247-52, 2002; and Stears et al., Nat. Med.9:14045, including supplements, 2003). 34 4868-5555-9605.1Atty. Dkt. No.115872-2946

[0102] It is also understood that detection can comprise reporter groups that are incorporated into the reaction products, either as part of labeled primers or due to the incorporation of labeled dNTPs during an amplification, or attached to reaction products, for example but not limited to, via hybridization tag complements comprising reporter groups or via linker arms that are integral or attached to reaction products. In some embodiments, unlabeled reaction products may be detected using mass spectrometry. NGS Platforms

[0103] In some embodiments, high throughput, massively parallel sequencing employs sequencing-by-synthesis with reversible dye terminators. In other embodiments, sequencing is performed via sequencing-by-ligation. In yet other embodiments, sequencing is single molecule sequencing. Examples of Next Generation Sequencing techniques include, but are not limited to pyrosequencing, Reversible dye-terminator sequencing, SOLiD sequencing, Ion semiconductor sequencing, Helioscope single molecule sequencing etc.

[0104] The Ion TorrentTM(Life Technologies, Carlsbad, CA) amplicon sequencing system employs a flow-based approach that detects pH changes caused by the release of hydrogen ions during incorporation of unmodified nucleotides in DNA replication. For use with this system, a sequencing library is initially produced by generating DNA fragments flanked by sequencing adapters. In some embodiments, these fragments can be clonally amplified on particles by emulsion PCR. The particles with the amplified template are then placed in a silicon semiconductor sequencing chip. During replication, the chip is flooded with one nucleotide after another, and if a nucleotide complements the DNA molecule in a particular microwell of the chip, then it will be incorporated. A proton is naturally released when a nucleotide is incorporated by the polymerase in the DNA molecule, resulting in a detectable local change of pH. The pH of the solution then changes in that well and is detected by the ion sensor. If homopolymer repeats are present in the template sequence, multiple nucleotides will be incorporated in a single cycle. This leads to a corresponding number of released hydrogens and a proportionally higher electronic signal.

[0105] The 454TM GS FLXTMsequencing system (Roche, Germany), employs a light- based detection methodology in a large-scale parallel pyrosequencing system. Pyrosequencing uses DNA polymerization, adding one nucleotide species at a time and detecting and quantifying the number of nucleotides added to a given location through the light emitted by the release of attached pyrophosphates. For use with the 454TMsystem, 35 4868-5555-9605.1Atty. Dkt. No.115872-2946 adapter-ligated DNA fragments are fixed to small DNA-capture beads in a water-in-oil emulsion and amplified by PCR (emulsion PCR). Each DNA-bound bead is placed into a well on a picotiter plate and sequencing reagents are delivered across the wells of the plate. The four DNA nucleotides are added sequentially in a fixed order across the picotiter plate device during a sequencing run. During the nucleotide flow, millions of copies of DNA bound to each of the beads are sequenced in parallel. When a nucleotide complementary to the template strand is added to a well, the nucleotide is incorporated onto the existing DNA strand, generating a light signal that is recorded by a CCD camera in the instrument.

[0106] Sequencing technology based on reversible dye-terminators: DNA molecules are first attached to primers on a slide and amplified so that local clonal colonies are formed. Four types of reversible terminator bases (RT-bases) are added, and non-incorporated nucleotides are washed away. Unlike pyrosequencing, the DNA can only be extended one nucleotide at a time. A camera takes images of the fluorescently labeled nucleotides, then the dye along with the terminal 3' blocker is chemically removed from the DNA, allowing the next cycle.

[0107] Helicos's single-molecule sequencing uses DNA fragments with added polyA tail adapters, which are attached to the flow cell surface. At each cycle, DNA polymerase and a single species of fluorescently labeled nucleotide are added, resulting in template- dependent extension of the surface-immobilized primer-template duplexes. The reads are performed by the Helioscope sequencer. After acquisition of images tiling the full array, chemical cleavage and release of the fluorescent label permits the subsequent cycle of extension and imaging.

[0108] Sequencing by synthesis (SBS), like the "old style" dye-termination electrophoretic sequencing, relies on incorporation of nucleotides by a DNA polymerase to determine the base sequence. A DNA library with affixed adapters is denatured into single strands and grafted to a flow cell, followed by bridge amplification to form a high-density array of spots onto a glass chip. Reversible terminator methods use reversible versions of dye-terminators, adding one nucleotide at a time, detecting fluorescence at each position by repeated removal of the blocking group to allow polymerization of another nucleotide. The signal of nucleotide incorporation can vary with fluorescently labeled nucleotides, phosphate-driven light reactions and hydrogen ion sensing having all been used. Examples of SBS platforms include Illumina GA and HiSeq 2000. The MiSeq® personal sequencing 36 4868-5555-9605.1Atty. Dkt. No.115872-2946 system (Illumina, Inc.) also employs sequencing by synthesis with reversible terminator chemistry.

[0109] In contrast to the sequencing by synthesis method, the sequencing by ligation method uses a DNA ligase to determine the target sequence. This sequencing method relies on enzymatic ligation of oligonucleotides that are adjacent through local complementarity on a template DNA strand. This technology employs a partition of all possible oligonucleotides of a fixed length, labeled according to the sequenced position. Oligonucleotides are annealed and ligated and the preferential ligation by DNA ligase for matching sequences results in a dinucleotide encoded color space signal at that position (through the release of a fluorescently labeled probe that corresponds to a known nucleotide at a known position along the oligo). This method is primarily used by Life Technologies’ SOLiDTMsequencers. Before sequencing, the DNA is amplified by emulsion PCR. The resulting beads, each containing only copies of the same DNA molecule, are deposited on a solid planar substrate.

[0110] SMRT ^ sequencing is based on the sequencing by synthesis approach. The DNA is synthesized in zero-mode wave-guides (ZMWs)-small well-like containers with the capturing tools located at the bottom of the well. The sequencing is performed with use of unmodified polymerase (attached to the ZMW bottom) and fluorescently labeled nucleotides flowing freely in the solution. The wells are constructed in a way that only the fluorescence occurring at the bottom of the well is detected. The fluorescent label is detached from the nucleotide at its incorporation into the DNA strand, leaving an unmodified DNA strand. ATR Inhibitors

[0111] ATR (“ATM and Rad3 related”) is a key mediator of cellular responses to a DNA damage structure that is characterized by tracts of single stranded DNA coated by replication protein A (RPA). RPA coated single stranded DNA commonly arises as a result of replication stress, which occurs when a cell attempts to replicate DNA through unresolved DNA damage lesions. Failure to repair replication stress can lead to lethal double strand breaks or deleterious DNA mutation. ATR along with its substrates coordinates multiple cell functions in response to replication stress including cell cycle control, DNA replication and DNA damage repair. 37 4868-5555-9605.1Atty. Dkt. No.115872-2946

[0112] ATR inhibitors may be selective or non-selective. ATR inhibitors can be small molecules or biomolecules (e.g., antibodies and aptamers). In some embodiments, the ATR inhibitor is selected from the group consisting of elimusertib (BAY1895344), Schisandrin B, NU6027, dactolisib (NVP-BEZ235), ETP-46464, Torin 2, AZ20, Gartisertib (VX-803), berzosertib (M6620 (VX-970)), VE-821, Camonsertib, Abd110, CGK733, Garcinone C, ATR-IN-14, ATR-IN-10, ATR-IN-19, ATR-IN-15, ATR-IN-21, ATR-IN-17, ATR-IN-20, and ceralasertib (AZD6738). CHK1 inhibitors

[0113] The term "CHK1 inhibitor" refers to compounds which inhibit signaling through CHK1, as well as compounds which inhibit the expression of the CHK1 gene. Compounds which inhibit signaling through CHK1 are called CHK1 antagonists. They include compounds which inhibit the activity of CHK1, or by inhibiting CHK1 signaling by other mechanisms. CHK1 antagonists include, but are not limited to, small organic molecules, antibodies and aptamers. CHK1 inhibitors may be selective or non-selective.

[0114] Examples of CHK1 inhibitors include, but are not limited to, AZD7762, LY2603618, MK-8776 (SCH 900776), PF-00477736, LY2606368 (Prexasertib), CCT244747, CHIR-124, GNE-783, GNE-900, PD-321852, PD-407824, SAR-020106, SB- 218078, 3-alkoxyamino-5-(pyridin-2-ylamino)pyrazine-2-carbonitriles, 1-(5-chloro-2- alkoxyphenyl)-3-(5-cyanopyrazin-2-yl)ureas, S1181 and V158411. ATM inhibitors

[0115] The term "ATM inhibitor" refers to compounds which inhibit signaling through ATM, as well as compounds which inhibit the expression of the ATM gene. Compounds which inhibit signaling through ATM are called ATM antagonists. They include compounds which inhibit the activity of ATM, or by inhibiting ATM signaling by other mechanisms. ATM antagonists include, but are not limited to, small organic molecules, antibodies and aptamers. ATM inhibitors may be selective or non-selective.

[0116] Examples of ATM inhibitors include, but are not limited to, AZD-7648, AZD1390, berzosertib, KU55933, caffeine, KU-60019, AZD0156, VE-821, Camonsertib (RP-3500), Lartesertib, CP-466722, Ro 90-7501, CGK733, AZ32, ETP-46464, AZ31, A011, ATM Inhibitor-1, ATM Inhibitor-3, ATM Inhibitor-4, and ATR-IN-15. 38 4868-5555-9605.1Atty. Dkt. No.115872-2946 Pharmaceutical Compositions Including the ATR Inhibitors, CHK1 Inhibitors and / or ATM Inhibitors

[0117] The pharmaceutical compositions of the present technology can be manufactured by methods well known in the art such as conventional granulating, mixing, dissolving, encapsulating, lyophilizing, or emulsifying processes, among others. Compositions may be produced in various forms, including granules, precipitates, or particulates, powders, including freeze dried, rotary dried or spray dried powders, amorphous powders, tablets, capsules, syrup, suppositories, injections, emulsions, elixirs, suspensions or solutions. Formulations may optionally contain solvents, diluents, and other liquid vehicles, dispersion or suspension aids, surface active agents, pH modifiers, isotonic agents, thickening or emulsifying agents, stabilizers and preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. In certain embodiments, the compositions disclosed herein are formulated for administration to a mammal, such as a human.

[0118] Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, cyclodextrins, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

[0119] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are 39 4868-5555-9605.1Atty. Dkt. No.115872-2946 used in the preparation of injectables. The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use. Compositions formulated for parenteral administration may be injected by bolus injection or by timed push, or may be administered by continuous infusion.

[0120] In order to prolong the effect of a compound of the present disclosure, it is often desirable to slow the absorption of the compound from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the compound then depends upon its rate of dissolution that, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered compound form is accomplished by dissolving or suspending the compound in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the compound in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of compound to polymer and the nature of the particular polymer employed, the rate of compound release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues.

[0121] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and / or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case 40 4868-5555-9605.1Atty. Dkt. No.115872-2946 of capsules, tablets and pills, the dosage form may also comprise buffering agents such as phosphates or carbonates.

[0122] Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes.

[0123] The active compounds can also be in micro-encapsulated form with one or more excipients as noted above. In such solid dosage forms the active compound may be admixed with at least one inert diluent such as sucrose, lactose or starch. Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets and pills, the dosage forms may also comprise buffering agents. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. Modes of Administration and Effective Dosages

[0124] Any method known to those in the art for contacting a cell, organ or tissue with one or more ATR inhibitors, CHK1 inhibitors, and / or ATM inhibitors disclosed herein may be employed. Suitable methods include in vitro, ex vivo, or in vivo methods. In vivo methods typically include the administration of one or more ATR inhibitors, CHK1 inhibitors, and / or ATM inhibitors to a mammal, suitably a human. When used in vivo for therapy, the one or more ATR inhibitors, CHK1 inhibitors, and / or ATM inhibitors described herein are administered to the subject in effective amounts (i.e., amounts that have desired therapeutic effect). The dose and dosage regimen will depend upon the degree of the disease state of the subject, the characteristics of the particular ATR inhibitor, CHK1 inhibitor, or ATM inhibitor used, e.g., its therapeutic index, and the subject’s history. 41 4868-5555-9605.1Atty. Dkt. No.115872-2946

[0125] The effective amount may be determined during pre-clinical trials and clinical trials by methods familiar to physicians and clinicians. An effective amount of one or more ATR inhibitors, CHK1 inhibitors, and / or ATM inhibitors useful in the methods may be administered to a mammal in need thereof by any of a number of well-known methods for administering pharmaceutical compounds. The ATR inhibitor, CHK1 inhibitor, or ATM inhibitor may be administered systemically or locally.

[0126] The one or more ATR inhibitors, CHK1 inhibitors, and / or ATM inhibitors described herein can be incorporated into pharmaceutical compositions for administration, singly or in combination, to a subject for the treatment or prevention of a disease or condition described herein. Such compositions typically include the active agent and a pharmaceutically acceptable carrier. As used herein the term “pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.

[0127] Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral (e.g., intravenous, intradermal, intraperitoneal or subcutaneous), oral, inhalation, transdermal (topical), intraocular, iontophoretic, and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. For convenience of the patient or treating physician, the dosing formulation can be provided in a kit containing all necessary equipment (e.g., vials of drug, vials of diluent, syringes and needles) for a treatment course (e.g., 7 days of treatment).

[0128] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the 42 4868-5555-9605.1Atty. Dkt. No.115872-2946 extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, CREMOPHOR EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, a composition for parenteral administration must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.

[0129] The pharmaceutical compositions having one or more ATR inhibitors, CHK1 inhibitors, and / or ATM inhibitors disclosed herein can include a carrier, which can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thiomerasol, and the like. Glutathione and other antioxidants can be included to prevent oxidation. In many cases, it will be advantageous to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin.

[0130] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, typical methods of preparation include vacuum drying and freeze drying, which can yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0131] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral 43 4868-5555-9605.1Atty. Dkt. No.115872-2946 compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and / or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

[0132] For administration by inhalation, the compounds can be delivered in the form of an aerosol spray from a pressurized container or dispenser, which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Pat. No.6,468,798.

[0133] Systemic administration of a therapeutic compound as described herein can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. In one embodiment, transdermal administration may be performed by iontophoresis.

[0134] A therapeutic agent can be formulated in a carrier system. The carrier can be a colloidal system. The colloidal system can be a liposome, a phospholipid bilayer vehicle. In one embodiment, the therapeutic agent is encapsulated in a liposome while maintaining the agent’s structural integrity. One skilled in the art would appreciate that there are a variety of methods to prepare liposomes. (See Lichtenberg, et al., Methods Biochem. Anal., 33:337-462 (1988); Anselem, et al., Liposome Technology, CRC Press (1993)). Liposomal formulations can delay clearance and increase cellular uptake (See Reddy, Ann. Pharmacother., 34(7-8):915-923 (2000)). An active agent can also be loaded into a particle prepared from pharmaceutically acceptable ingredients including, but not limited to, soluble, insoluble, permeable, impermeable, biodegradable or gastroretentive polymers or liposomes. Such particles include, but are not limited to, nanoparticles, biodegradable 44 4868-5555-9605.1Atty. Dkt. No.115872-2946 nanoparticles, microparticles, biodegradable microparticles, nanospheres, biodegradable nanospheres, microspheres, biodegradable microspheres, capsules, emulsions, liposomes, micelles and viral vector systems.

[0135] The carrier can also be a polymer, e.g., a biodegradable, biocompatible polymer matrix. In one embodiment, the therapeutic agent can be embedded in the polymer matrix, while maintaining the agent’s structural integrity. The polymer may be natural, such as polypeptides, proteins or polysaccharides, or synthetic, such as poly α-hydroxy acids. Examples include carriers made of, e.g., collagen, fibronectin, elastin, cellulose acetate, cellulose nitrate, polysaccharide, fibrin, gelatin, and combinations thereof. In one embodiment, the polymer is poly-lactic acid (PLA) or copoly lactic / glycolic acid (PGLA). The polymeric matrices can be prepared and isolated in a variety of forms and sizes, including microspheres and nanospheres. Polymer formulations can lead to prolonged duration of therapeutic effect. (See Reddy, Ann. Pharmacother., 34(7-8):915-923 (2000)). A polymer formulation for human growth hormone (hGH) has been used in clinical trials. (See Kozarich and Rich, Chemical Biology, 2:548-552 (1998)).

[0136] Examples of polymer microsphere sustained release formulations are described in PCT publication WO 99 / 15154 (Tracy, et al.), U.S. Pat. Nos.5,674,534 and 5,716,644 (both to Zale, et al.), PCT publication WO 96 / 40073 (Zale, et al.), and PCT publication WO 00 / 38651 (Shah, et al.). U.S. Pat. Nos.5,674,534 and 5,716,644 and PCT publication WO 96 / 40073 describe a polymeric matrix containing particles of erythropoietin that are stabilized against aggregation with a salt.

[0137] In some embodiments, the therapeutic compounds are prepared with carriers that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using known techniques. The materials can also be obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to specific cells with monoclonal antibodies to cell-specific antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No.4,522,811. 45 4868-5555-9605.1Atty. Dkt. No.115872-2946

[0138] The therapeutic compounds can also be formulated to enhance intracellular delivery. For example, liposomal delivery systems are known in the art, see, e.g., Chonn and Cullis, “Recent Advances in Liposome Drug Delivery Systems,” Current Opinion in Biotechnology 6:698-708 (1995); Weiner, “Liposomes for Protein Delivery: Selecting Manufacture and Development Processes,” Immunomethods, 4(3):201-9 (1994); and Gregoriadis, “Engineering Liposomes for Drug Delivery: Progress and Problems,” Trends Biotechnol., 13(12):527-37 (1995). Mizguchi, et al., Cancer Lett., 100:63-69 (1996), describes the use of fusogenic liposomes to deliver a protein to cells both in vivo and in vitro.

[0139] Dosage, toxicity and therapeutic efficacy of any therapeutic agent can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 / ED50. Compounds that exhibit high therapeutic indices are advantageous. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

[0140] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds may be within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to determine useful doses in humans accurately. Levels in plasma may be measured, for example, by high performance liquid chromatography.

[0141] Typically, an effective amount of the one or more ATR inhibitors, CHK1 inhibitors, and / or ATM inhibitors disclosed herein sufficient for achieving a therapeutic or prophylactic effect, range from about 0.000001 mg per kilogram body weight per day to about 10,000 mg per kilogram body weight per day. Suitably, the dosage ranges are from 46 4868-5555-9605.1Atty. Dkt. No.115872-2946 about 0.0001 mg per kilogram body weight per day to about 100 mg per kilogram body weight per day. For example, dosages can be 1 mg / kg body weight or 10 mg / kg body weight every day, every two days or every three days or within the range of 1-10 mg / kg every week, every two weeks or every three weeks. In one embodiment, a single dosage of the therapeutic compound ranges from 0.001-10,000 micrograms per kg body weight. In one embodiment, one or more ATR inhibitor / CHK1 inhibitor / ATM inhibitor concentrations in a carrier range from 0.2 to 2000 micrograms per delivered milliliter. An exemplary treatment regime entails administration once per day or once a week. In therapeutic applications, a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, or until the subject shows partial or complete amelioration of symptoms of disease. Thereafter, the patient can be administered a prophylactic regime.

[0142] In some embodiments, a therapeutically effective amount of one or more ATR inhibitors, CHK1 inhibitors, and / or ATM inhibitors may be defined as a concentration of inhibitor at the target tissue of 10-32to 10-6molar, e.g., approximately 10-7molar. This concentration may be delivered by systemic doses of 0.001 to 100 mg / kg or equivalent dose by body surface area. The schedule of doses would be optimized to maintain the therapeutic concentration at the target tissue, such as by single daily or weekly administration, but also including continuous administration (e.g., parenteral infusion or transdermal application).

[0143] The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to, the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the therapeutic compositions described herein can include a single treatment or a series of treatments.

[0144] The mammal treated in accordance with the present methods can be any mammal, including, for example, farm animals, such as sheep, pigs, cows, and horses; pet animals, such as dogs and cats; laboratory animals, such as rats, mice and rabbits. In some embodiments, the mammal is a human. 47 4868-5555-9605.1Atty. Dkt. No.115872-2946 Therapeutic Methods of the Present Technology

[0145] Oncogenic FET fusion proteins including EWS-FLI1 share a similar structure: the N-terminal intrinsically disordered region (IDR) of the FET protein fused to the DNA binding domain of a transcription factor (e.g. FLI1), with loss of the C-terminal RGG repeats.

[0146] In one aspect, the present disclosure provides a method for selecting a cancer patient for treatment with an ATR inhibitor or a CHK1 inhibitor comprising detecting the presence of at least one FET fusion oncoprotein in a biological sample obtained from the cancer patient; and administering an effective amount of an ATR inhibitor or a CHK1 inhibitor to the cancer patient. In another aspect, the present disclosure provides a method for treating cancer in a patient in need thereof comprising administering an effective amount of an ATR inhibitor or a CHK1 inhibitor to the patient, wherein the patient comprises at least one FET fusion oncoprotein. The at least one FET fusion oncoprotein may comprise an N-terminal intrinsically disordered region (IDR) of a FET protein fused to a DNA binding domain of a transcription factor. In some embodiments, the FET protein is EWS, FUS, or TAF15. Additionally or alternatively, in certain embodiments, the transcription factor is an ETS transcription factor family gene, such as FLI1, ERG, ETV1, ETV4, and FEV. In other embodiments, the transcription factor is NFATC2, PATZ1, WT1, DDIT3, CREB1, CREB, ATF1, CREM, PBX1, PBX3, ZNF444, POU5F1, ATF1, KLF17, CREB3L1, CREB3L2, CREB3L3, CREBL1, NR4A3, SMAD3, or TFCP2. Examples of FET fusion oncoproteins include, but are not limited to, EWS-FLI1, EWS-ERG, EWS- ETV1, EWS-ETV4, EWS-FEV, FUS-FLI1, FUS-ERG, FUS-ETV1, FUS-ETV4, FUS- FEV, TAF15-FLI1, TAF15-ERG, TAF15-ETV1, TAF15-ETV4, TAF15-FEV, EWS- NFATC2, FUS-NFATC2, EWS-PATZ1, EWS-WT1, FUS-DDIT3 , EWS-DDIT3, EWS- CREB1, EWS-CREB, FUS-CREB, EWS-ATF1, FUS-ATF1, EWS-CREM, FUS-CREM, EWS-PBX1, EWS-PBX3, EWS-ZNF444, EWS-POU5F1, EWS-ATF1, EWS-KLF17, FUS- PBX1, FUS-PBX3, FUS-ZNF444, FUS-POU5F1, FUS-ATF1, FUS-KLF17, EWS- CREB3L1, FUS-CREB3L2, EWS-CREB3L2, EWS-CREB3L3, FUS-CREB3L1, EWS- CREBL1, EWSR1-NR4A3, TAF15-NR4A3, EWS-SMAD3, EWS-TFCP2 and FUS- TFCP2.

[0147] In any of the preceding embodiments of the methods disclosed herein, the at least one FET fusion oncoprotein is detected via next-generation sequencing, PCR, real- time quantitative PCR (qPCR), digital PCR (dPCR), Southern blotting, Reverse 48 4868-5555-9605.1Atty. Dkt. No.115872-2946 transcriptase-PCR (RT-PCR), Northern blotting, microarray, dot or slot blots, in situ hybridization, fluorescent in situ hybridization (FISH), Western blotting, enzyme-linked immunosorbent assays (ELISA), immunohistochemistry, immunofluorescence, immunoprecipitation, immunoelectrophoresis, or mass-spectrometry. Additionally or alternatively, in some embodiments, the biological sample obtained from the cancer patient comprises biopsied tumor tissue, whole blood, plasma, or serum.

[0148] Also disclosed herein are methods for sensitizing a cancer patient to therapy with an ATR inhibitor or a CHK1 inhibitor comprising administering to the cancer patient an effective amount of an ATM inhibitor separately, sequentially or simultaneously with the ATR inhibitor or the CHK1 inhibitor. Examples of ATM inhibitors include, but are not limited to AZD-7648, AZD1390, berzosertib, KU55933, caffeine, KU-60019, AZD0156, VE-821, Camonsertib (RP-3500), Lartesertib, CP-466722, Ro 90-7501, CGK733, AZ32, ETP-46464, AZ31, A011, ATM Inhibitor-1, ATM Inhibitor-3, ATM Inhibitor-4, or ATR- IN-15.

[0149] In any of the preceding embodiments of the methods disclosed herein, the patient suffers from or is diagnosed with Ewing’s sarcoma (ES), desmoplastic small-round- cell tumors, myxoid liposarcoma, angiomatoid fibrous histiocytoma, intracranial mesenchymal tumors, primary pulmonary myxoid sarcoma, clear cell sarcomas, clear cell sarcoma-like gastrointestinal tumors, mesothelioma, myoepithelioma, sclerosing epithelioid fibrosarcoma, low-grade fibromyxoid sarcoma, extraskeletal myxoid chondrosarcoma, fibroblastic tumors, and epithelioid or spindle cell rhabdomyosarcoma.

[0150] In any and all embodiments of the methods disclosed herein, the ATR inhibitor is selected from the group consisting of elimusertib (BAY1895344), Schisandrin B, NU6027, dactolisib (NVP-BEZ235), ETP-46464, Torin 2, AZ20, Gartisertib (VX-803), berzosertib (M6620 (VX-970)), VE-821, Camonsertib, Abd110, CGK733, Garcinone C, ATR-IN-14, ATR-IN-10, ATR-IN-19, ATR-IN-15, ATR-IN-21, ATR-IN-17, ATR-IN-20, and ceralasertib (AZD6738). In any and all embodiments of the methods disclosed herein, the CHK1 inhibitor is selected from the group consisting of AZD7762, LY2603618, MK- 8776 (SCH 900776), PF-00477736, LY2606368 (Prexasertib), CCT244747, CHIR-124, GNE-783, GNE-900, PD-321852, PD-407824, SAR-020106, SB-218078, 3-alkoxyamino- 5-(pyridin-2-ylamino)pyrazine-2-carbonitriles, 1-(5-chloro-2-alkoxyphenyl)-3-(5- cyanopyrazin-2-yl)ureas, S1181 and V158411. 49 4868-5555-9605.1Atty. Dkt. No.115872-2946

[0151] Additionally or alternatively, in some embodiments of the methods disclosed herein, the ATR / CHK1 inhibitor can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), simultaneously with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of an ATM inhibitor to a patient with cancer (e.g., malignant peripheral nerve sheath tumor or melanoma).

[0152] In some embodiments, the ATR / CHK1 inhibitor and ATM inhibitor are administered to a patient, for example, a mammal, such as a human, in a sequence and within a time interval such that the inhibitor that is administered first acts together with the inhibitor that is administered second to provide greater benefit than if each inhibitor were administered alone. For example, the ATR / CHK1 inhibitor and ATM inhibitor can be administered at the same time or sequentially in any order at different points in time; however, if not administered at the same time, the ATR / CHK1 inhibitor and ATM inhibitor are administered sufficiently close in time so as to provide the desired therapeutic or prophylactic effect of the combination of the two inhibitors. In one embodiment, the ATR / CHK1 inhibitor and ATM inhibitor exert their effects at times which overlap. In some embodiments, the ATR / CHK1 inhibitor and ATM inhibitor each are administered as separate dosage forms, in any appropriate form and by any suitable route. In other embodiments, the ATR / CHK1 inhibitor and ATM inhibitor are administered simultaneously in a single dosage form.

[0153] It will be appreciated that the frequency with which any of these therapeutic agents can be administered can be once or more than once over a period of about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 20 days, about 28 days, about a week, about 2 weeks, about 3 weeks, about 4 weeks, about a month, about every 2 months, about every 3 months, about every 4 months, about every 5 months, about every 6 months, about every 7 months, about every 8 months, about every 9 months, about every 10 months, about every 11 months, about every year, about every 2 years, about every 3 years, about every 4 years, or about every 5 years.

[0154] For example, an ATR / CHK1 inhibitor or ATM inhibitor may be administered daily, weekly, biweekly, or monthly for a particular period of time. An ATR / CHK1 50 4868-5555-9605.1Atty. Dkt. No.115872-2946 inhibitor or ATM inhibitor may be dosed daily over a 14 day time period, or twice daily over a seven day time period. An ATR / CHK1 inhibitor or ATM inhibitor may be administered daily for 7 days.

[0155] Alternatively, an ATR / CHK1 inhibitor or ATM inhibitor may be administered daily, weekly, biweekly, or monthly for a particular period of time followed by a particular period of non-treatment. In some embodiments, the ATR / CHK1 inhibitor or ATM inhibitor can be administered daily for 14 days followed by seven days of non-treatment, and repeated for two more cycles of daily administration for 14 days followed by seven days of non-treatment. In some embodiments, the ATR / CHK1 inhibitor or ATM inhibitor can be administered twice daily for seven days followed by 14 days of non-treatment, which may be repeated for one or two more cycles of twice daily administration for seven days followed by 14 days of non-treatment.

[0156] In some embodiments, the ATR / CHK1 inhibitor or ATM inhibitor is administered daily over a period of 14 days. In another embodiment, the ATR / CHK1 inhibitor or ATM inhibitor is administered daily over a period of 12 days, or 11 days, or 10 days, or nine days, or eight days. In another embodiment, the ATR / CHK1 inhibitor or ATM inhibitor is administered daily over a period of seven days. In another embodiment, the ATR / CHK1 inhibitor or ATM inhibitor is administered daily over a period of six days, or five days, or four days, or three days.

[0157] In some embodiments, individual doses of the ATR / CHK1 inhibitor and the ATM inhibitor are administered within a time interval such that the two inhibitors can work together (e.g., within 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 5 days, 6 days, 1 week, or 2 weeks). In some embodiments, the treatment period during which the therapeutic agents are administered is then followed by a non- treatment period of a particular time duration, during which the therapeutic agents are not administered to the patient. This non-treatment period can then be followed by a series of subsequent treatment and non-treatment periods of the same or different frequencies for the same or different lengths of time. In some embodiments, the treatment and non-treatment periods are alternated. It will be understood that the period of treatment in cycling therapy may continue until the patient has achieved a complete response or a partial response, at which point the treatment may be stopped. Alternatively, the period of treatment in cycling therapy may continue until the patient has achieved a complete response or a partial response, at which point the period of treatment may continue for a particular number of cycles. In some embodiments, the length of the period of treatment may be a particular 51 4868-5555-9605.1Atty. Dkt. No.115872-2946 number of cycles, regardless of patient response. In some other embodiments, the length of the period of treatment may continue until the patient relapses.

[0158] In some embodiments, the ATR / CHK1 inhibitor and the ATM inhibitor are cyclically administered to a patient. Cycling therapy involves the administration of a first agent (e.g., a first prophylactic or therapeutic agent) for a period of time, followed by the administration of a second agent and / or third agent (e.g., a second and / or third prophylactic or therapeutic agent) for a period of time and repeating this sequential administration. Cycling therapy can reduce the development of resistance to one or more of the therapies, avoid or reduce the side effects of one of the therapies, and / or improve the efficacy of the treatment.

[0159] In some embodiments, the ATR / CHK1 inhibitor is administered for a particular length of time prior to administration of the ATM inhibitor. For example, in a 21-day cycle, the ATR / CHK1 inhibitor may be administered on days 1 to 5, days 1 to 7, days 1 to 10, or days 1 to 14, and the ATM inhibitor may be administered on days 6 to 21, days 8 to 21, days 11 to 21, or days 15 to 21. In other embodiments, the ATM inhibitor is administered for a particular length of time prior to administration of the ATR / CHK1 inhibitor. For example, in a 21-day cycle, the ATM inhibitor may be administered on days 1 to 5, days 1 to 7, days 1 to 10, or days 1 to 14, and the ATR / CHK1 inhibitor may be administered on days 6 to 21, days 8 to 21, days 11 to 21, or days 15 to 21.

[0160] In one embodiment, the administration is on a 21-day dose schedule in which a once daily dose of ATR / CHK1 inhibitor is administered beginning on day eight for seven days, followed by seven days of non-treatment, in combination with twice-daily administration of the ATM inhibitor for seven days followed by 14 days of non-treatment (e.g., the ATR / CHK1 inhibitor is administered on days 8-14 and the ATM inhibitor is administered on days 1-7 of the 21-day schedule). In another embodiment, the administration is on a 21-day dose schedule in which a once daily dose of ATM inhibitor is administered beginning on day eight for seven days, followed by seven days of non- treatment, in combination with twice-daily administration of the ATR / CHK1 inhibitor for seven days followed by 14 days of non-treatment (e.g., the ATM inhibitor is administered on days 8-14 and the ATR / CHK1 inhibitor is administered on days 1-7 of the 21-day schedule).

[0161] In some embodiments, the ATR / CHK1 inhibitor and ATM inhibitor each are administered at a dose and schedule typically used for that agent during monotherapy. In other embodiments, when the ATR / CHK1 inhibitor and ATM inhibitor are administered 52 4868-5555-9605.1Atty. Dkt. No.115872-2946 concomitantly, one or both of the agents can advantageously be administered at a lower dose than typically administered when the agent is used during monotherapy, such that the dose falls below the threshold that an adverse side effect is elicited.

[0162] The therapeutically effective amounts or suitable dosages of the ATR / CHK1 inhibitor and the ATM inhibitor in combination depends upon a number of factors, including the nature of the severity of the condition to be treated, the particular inhibitor, the route of administration and the age, weight, general health, and response of the individual patient. In certain embodiments, the suitable dose level is one that achieves a therapeutic response as measured by tumor regression or other standard measures of disease progression, progression free survival, or overall survival. In other embodiments, the suitable dose level is one that achieves this therapeutic response and also minimizes any side effects associated with the administration of the therapeutic agent.

[0163] Suitable daily dosages of ATR / CHK1 inhibitors can generally range, in single or divided or multiple doses, from about 10% to about 120% of the maximum tolerated dose as a single agent. In certain embodiments, the suitable dosages of ATR / CHK1 inhibitors are from about 20% to about 100% of the maximum tolerated dose as a single agent. In other embodiments, the suitable dosages of ATR / CHK1 inhibitors are from about 25% to about 90% of the maximum tolerated dose as a single agent. In some embodiments, the suitable dosages of ATR / CHK1 inhibitors are from about 30% to about 80% of the maximum tolerated dose as a single agent. In other embodiments, the suitable dosages of ATR / CHK1 inhibitors are from about 40% to about 75% of the maximum tolerated dose as a single agent. In some embodiments, the suitable dosages of ATR / CHK1 inhibitors are from about 45% to about 60% of the maximum tolerated dose as a single agent. In other embodiments, suitable dosages of ATR / CHK1 inhibitors are about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, or about 120% of the maximum tolerated dose as a single agent.

[0164] Suitable daily dosages of ATM inhibitors can generally range, in single or divided or multiple doses, from about 10% to about 120% of the maximum tolerated dose as a single agent. In certain embodiments, the suitable dosages of ATM inhibitors are from about 20% to about 100% of the maximum tolerated dose as a single agent. In some other embodiments, the suitable dosages of ATM inhibitors are from about 25% to about 90% of the maximum tolerated dose as a single agent. In some other embodiments, the suitable 53 4868-5555-9605.1Atty. Dkt. No.115872-2946 dosages of ATM inhibitors are from about 30% to about 80% of the maximum tolerated dose as a single agent. In some other embodiments, the suitable dosages of ATM inhibitors are from about 40% to about 75% of the maximum tolerated dose as a single agent. In some other embodiments, the suitable dosages of ATM inhibitors are from about 45% to about 60% of the maximum tolerated dose as a single agent. In other embodiments, suitable dosages of ATM inhibitors are about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, or about 120% of the maximum tolerated dose as a single agent. Kits

[0165] The present disclosure provides kits comprising an ATR inhibitor or CHK1 inhibitor, alone or in combination with an ATM inhibitor, and instructions for treating cancers (e.g., FET rearranged cancers).

[0166] When simultaneous administration is contemplated, the kit may comprise an ATR inhibitor or CHK1 inhibitor, and an ATM inhibitor that has been formulated into a single pharmaceutical composition such as a tablet, or as separate pharmaceutical compositions. When the ATR inhibitors or CHK1 inhibitors, and ATM inhibitors disclosed herein are not administered simultaneously, the kit may comprise an ATR inhibitor or CHK1 inhibitor, and an ATM inhibitor that has been formulated as separate pharmaceutical compositions either in a single package, or in separate packages.

[0167] The kits may further comprise pharmaceutically acceptable excipients, diluents, or carriers that are compatible with one or more kit components described herein. Optionally, the above described components of the kits of the present technology are packed in suitable containers and labeled for the treatment of FET rearranged cancers. Examples of FET rearranged cancers include, but are not limited to, Ewing’s sarcoma (ES), desmoplastic small-round-cell tumors, myxoid liposarcoma, angiomatoid fibrous histiocytoma, intracranial mesenchymal tumors, primary pulmonary myxoid sarcoma, clear cell sarcomas, clear cell sarcoma-like gastrointestinal tumors, mesothelioma, myoepithelioma, sclerosing epithelioid fibrosarcoma, low-grade fibromyxoid sarcoma, extraskeletal myxoid chondrosarcoma, fibroblastic tumors, and epithelioid and spindle cell rhabdomyosarcoma. In some embodiments, the FET rearranged cancers comprise an EWS fusion protein, a FUS fusion protein, and / or an TAF15 fusion protein. 54 4868-5555-9605.1Atty. Dkt. No.115872-2946

[0168] Additionally or alternatively, in some embodiments, the FET rearranged cancers comprise a FET fusion oncoprotein selected from among EWS-FLI1, EWS-ERG, EWS- ETV1, EWS-ETV4, EWS-FEV, FUS-FLI1, FUS-ERG, FUS-ETV1, FUS-ETV4, FUS- FEV, TAF15-FLI1, TAF15-ERG, TAF15-ETV1, TAF15-ETV4, TAF15-FEV, EWS- NFATC2, FUS-NFATC2, EWS-PATZ1, EWS-WT1, FUS-DDIT3 , EWS-DDIT3, EWS- CREB1, EWS-CREB, FUS-CREB, EWS-ATF1, FUS-ATF1, EWS-CREM, FUS-CREM, EWS-PBX1, EWS-PBX3, EWS-ZNF444, EWS-POU5F1, EWS-ATF1, EWS-KLF17, FUS- PBX1, FUS-PBX3, FUS-ZNF444, FUS-POU5F1, FUS-ATF1, FUS-KLF17, EWS- CREB3L1, FUS-CREB3L2, EWS-CREB3L2, EWS-CREB3L3, FUS-CREB3L1, EWS- CREBL1, EWSR1-NR4A3, TAF15-NR4A3, EWS-SMAD3, EWS-TFCP2 and FUS- TFCP2.

[0169] The kits may optionally include instructions customarily included in commercial packages of therapeutic products, that contain information about, for example, the indications, usage, dosage, manufacture, administration, contraindications and / or warnings concerning the use of such therapeutic products. EXAMPLES

[0170] Those skilled in the art will recognize that several embodiments are possible within the scope and spirit of this present application. The present application will now be described in greater detail by reference to the following non-limiting examples. The following examples further illustrate the present application but, of course, should not be construed as in any way limiting its scope. Example 1: Experimental Materials and Methods

[0171] Cell culture

[0172] U2OS and 293T cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM)-High glucose (Cytiva) supplemented with 10% fetal calf serum (FCS) and streptomycin / penicillin (100 μg / ml). A673, TC71, ES8, SU-CCS-1 and HCC364 cells were grown in RPMI-1640 (Gibco) supplemented with 10% FCS and streptomycin / penicillin (100 μg / ml). A673 cells with doxycycline(dox)-inducible shRNA against EWS-FLI1 were a kind gift from Olivier Delattre32. Cell lines were maintained at 37 °Celsius in a humidified incubator with 5% CO2. All cell lines were subjected to STR analysis and mycoplasma testing.

[0173] CRISPR-interference screen 55 4868-5555-9605.1Atty. Dkt. No.115872-2946

[0174] Ewing sarcoma cell line A673 was transduced with dCas9-KRAB-BFP and then doubly sorted for BFP positive cells. Lentiviral particles were generated from 293T cells transduced with pooled sgRNA libraries (7000 genes, 10 genes per guide) as described previously25and then used to infect A673 dCas9-KRAB cells at a multiplicity of infection of 0.3. Cells were selected in puromycin for 48 hours and an aliquot was frozen for t0analysis. The remainder of cells were seeded in 500 cm2tissue culture plates at equal density (1 × 107cells / plate) and then treated with vehicle (DMSO) or 12.5 nM / 40 nM doxorubicin for 72 hours. After 72 hours, cells were trypsinized, counted and pooled every 3 days, and then replated in media without doxorubicin at the same density to maintain minimum 500× coverage of each sgRNA construct. Cells were viably frozen after 10 days and cell counts were used to determine actual lethal dose (LD) values.2 biologic replicates were performed, and data combined.

[0175] Deep sequencing and data analysis were performed as described25. Briefly, genomic DNA was extracted from t0 and tend cells using a DNEasy Blood & Tissue kit (Qiagen), digested to enrich for lentiviral integration sites, and sgRNA sequences were amplified by PCR for subsequent sequencing on an Illumina HiSeq. Reads were aligned to the sgRNA library and fold-change from t0to tendin the DMSO, low and high doxorubicin conditions was calculated. A gene-level score was then calculated as the mean of the top 3 scoring sgRNAs targeting a given transcript.

[0176] CRISPRi growth assays

[0177] dCas9-KRAB expressing cells were infected with gRNAs (sequences below) and then selected with puromycin for 48 hours.50,000 cells were then re-plated in a 6 well plate and cell counts were obtained by trypsinization and counting at day 5. For experiments in A673 cells with dox-inducible shRNA against EWS-FLI1, 1μg / ml Dox (or vehicle) was added upon replating the puromycin selected, gRNA-expressing cells. gRNA sequences are as follows:

[0178] sgBRCA1-1: GCGTAAGGCGTTGTGAACCCT (SEQ ID NO:11)

[0179] sgBRCA1-2: GCTCGCTGAGACTTCCTGGAC (SEQ ID NO:12)

[0180] sgPALB2-1: GCGCACTGAGGGTGCGATCC (SEQ ID NO:13)

[0181] sgPALB2-2: GATTTAATTGGCCGGAGTTT (SEQ ID NO:14)

[0182] sgControl-1: GGCTCGGTCCCGCGTCGTCG (SEQ ID NO:15) 56 4868-5555-9605.1Atty. Dkt. No.115872-2946

[0183] sgControl-2: GAACGACTAGTTAGGCGTGTA (SEQ ID NO:16)

[0184] Computational analysis of genomic data

[0185] Whole genome sequencing data from known BRCA mutant breast cancer patient samples and Ewing sarcoma samples were obtained from EGA (EGA datasets: EGAD00001001322 and EGAD00001001051, respectively). FASTQ files were aligned to the GRCh38 (patch 5) human genome reference using BWA MEM49, with pre- and post- alignment filtering and processing using NGSUtils50and GATK51. Insertions and deletions (indel) were called using MuTect 2 for short indels52and Delly for larger indels53. For each indel, the amount of microhomology at the flanking ends was calculated using the custom software “mhscan”. Briefly, for each indel, mhscan will determine the number of bases of homology between the insert or deletion and the flanking sequence. All indels with between 2-6 bp of homology were classified as microhomology (MH) positive. Mutational signatures were calculated using the somatic single-nucleotide variants for each sample. COSMIC v254, 55signatures were calculated using deconstructSigs56.

[0186] Determining deletion length bins

[0187] The binning ranges were determined by calculating the ability for the number of deletions of each length (1-100 bp) to accurately separate the BRCA wild type (wt) / mutant (mut) samples into two groups. The deletions were classified as either MH-positive or MH- negative and the total number of deletions for each length was calculated for BRCA wt and BRCA mut samples (data were aggregated for all samples in the group). For each deletion length, a Fisher exact test was used to calculate the statistical significance of whether the MH-positive to MH-negative ratio separated the BRCA wt / mut groups (data not shown). The distribution of p-values was used to determine appropriate bin sizes for downstream analysis. Deletions were binned into ranges of 1-6 bp, 7-28 bp, 29-45 bp, 46-100 bp, and 101-1000 bp.

[0188] DSB Repair reporter assays

[0189] HR, Alt-EJ, SSA and c-NHEJ efficiencies were measured using previously established DR-GFP, EJ2-GFP, SA-GFP and EJ5-GFP reporter systems respectively36. Briefly, dual promoter plasmids co-expressing mTagBFP and EWS-FLI1 (or empty vector, EV) were generated by replacing the puromycin cassette with mTagBFP in the plasmid pCDH-CMV-EWS-FLI1 (Addgene #102813). Co-expression plasmids were delivered by nucleofection into U2OS DSB reporter cell lines using the SE Cell Line 4D-Nucleofector 57 4868-5555-9605.1Atty. Dkt. No.115872-2946 XL Kit (Lonza Biosciences). To induce a DSB, the I-SceI-P2A-mCherry plasmid which we generated by replacing AmCyan with I-SceI in the bicistronic plasmid Amcyan-P2A- mCherry (Addgene #45350) was delivered by nucleofection after 24 hours. Flow cytometry was performed 72 hours after I-SceI introduction. DSB repair efficiency was calculated by determining the percentage of GFP positive cells within the BFP and mCherry double- positive population (data not shown). For siRNA experiments, siRNA (5nM) was delivered by transfection using Dharmafect transfection reagent (Dharmacon) 72 hours prior to I-SceI introduction.

[0190] Western blotting

[0191] Cells were washed with 1X PBS and scraped in RIPA buffer (25 mM Tris⋅HCl (pH 7.6), 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS), supplemented with 1X HALT protease inhibitor cocktail and 1X HALT phosphatase inhibitor cocktail. Cells were lysed using a syringe and cellular debris were separated by centrifugation. Lysates were quantified using Bradford’s reagent and 15μg lysate was loaded onto SDS- PAGE gels followed by blotting of separated proteins. Blots were blocked with 5% BSA in TBS-T for 30 minutes at room temperature followed by incubation with primary antibody overnight at 4°C. After 1 hour incubation with appropriate HRP-conjugated secondary antibody, signal was detected using ECL Prime reagent (Amersham, Cytiva) on an ImageQuant LAS 4000. Quantifications were performed using Fiji and all protein levels were normalized to loading control Actin.

[0192] The list of antibodies utilized in this study includes: FLI1 (Abcam, ab84078, 1:200), CtIP (Cell Signaling Technologies (CST), D76F7, 1:000), 53BP1(Abcam, ab17593, 1:1000), pATM (CST, 4526S,1:1000), ATM (CST, 2873S, 1:1000), pCHK2-T68 (CST, 2661S, 1:1000), CHK2 (CST, 2662S, 1:1000), pKAP1 (Novus Biologicals, A700-013, 1:1000), KAP1 (Novus Biologicals, A700-014, 1:1000), pDNA-PK (CST, 68716S, 1:1000), DNA-PK (CST, 4602T, 1:1000), pATR (Genetex, GTX128145, 1:1000), ATR (Novus Biologicals, A300-138A, 1:1000), GFP (CST, 2956S, 1:1000), EWSR1 (Genetex, GTX114069, 1:1000), beta-Actin (Sigma, A2228, 1:2000), anti-Flag (Sigma, F3165, 1:2000), ATF1 (Novus Biologicals, A303-036A, 1:1000), FUS (Novus Biologicals, A300- 302A-1:1000), RNaseH1 (Genetex, GTX117624, 1:1000).

[0193] DDR signaling experiments 58 4868-5555-9605.1Atty. Dkt. No.115872-2946

[0194] For experiments in U20S cells, the respective fusion proteins (EWS-FLI1-GFP, EWS-ATF1-GFP, or EV-GFP) were introduced via nucleofection with homemade buffers (Solution 1: 2g ATP-disodium salt, 1.2g MgCl2.6H20 in 10ml water; Solution 2: 6g KH2PO4, 0.6g NaHCO3, 0.2g Glucose in 500ml water, pH 7.4. Solutions were stored at - 20°C and 80μl of Solution1 was mixed with 4ml of solution 2 at the time of nucleofection). GFP positive cells were selected by FACS.24 hours after sorting, cells were subjected to 5Gy IR using a Cs-137 irradiator. Lysates were collected at 1, 3, and 6 hours post-IR and subjected to Western blotting. For experiments in A673 cells with inducible shRNA against EWS-FLI1, knockdown was induced by addition of 1μg / ml Dox for 72 hours followed by IR treatment. For experiments in SU-CCS-1 cells, siRNA against EWS-ATF1 was delivered by nucleofection 72 hours prior to IR. For improved induction of ATR / CHK1 signaling, cells were treated with neocarzinostatin (200ng / mL) for 30 minutes and then collected at 1, 3, and 6 hours after removing the drug.

[0195] siRNA / shRNA sequences

[0196] siEWS: Mix of two siRNAs targeting the C-terminus of EWSR1: GGAACAGAUGGGAGGAAGA (SEQ ID NO: 17) and AGGAAAGCCCAAAGGCGAU (SEQ ID NO: 18)

[0197] siCTIP: On-TARGETplus SMARTpool siRNA (Dharmacon, L-011376-00-0005)

[0198] si53BP1: On-TARGETplus SMARTpool siRNA (Dharmacon, L-003548-00- 0005)

[0199] siEWS-ATF1: GCGGUGGAAUGGGAAAAAUUU (SEQ ID NO: 19)

[0200] shRNA sequence against native EWS: TGCATTGACTACCAGATTTAT (SEQ ID NO: 20)

[0201] shRNA sequence against LIG4: TATGTCAGTGGACTAATGGAT (SEQ ID NO: 21)

[0202] Cell survival assays

[0203] 350,000 cells were seeded in 6-well plates, 24 hours prior to drug treatment. Cells were treated with varying doses of ATR kinase inhibitor VE-821 (Selleckchem) or CHK1 inhibitor LY2603618 (Selleckchem) for 3 days at the end of which cells were counted to determine fractional cell survival. For dox-inducible EWS-FLI1 knockdown in A673 cells, shRNA was induced by treatment with 1μg / ml dox for 72 hours prior to ATR or CHK1 59 4868-5555-9605.1Atty. Dkt. No.115872-2946 inhibitor treatment. For RNAseH1 experiments, A673 cells were infected with pLV-EF1a- RNAseH1-IRES-Blast lentivirus (derived from Addgene plasmid #85133) or empty vector and selected for stably infected cells.

[0204] pH2AX flow cytometry

[0205] EWS-FLI1 (or EV) expressing U20S cells were obtained by nucleofection as above. U20S cells with shRNA against LIG4 or native EWS were obtained through puromycin selection with pLKO.1 shRNA expressing vectors with sequences as above. Cells were treated with 10Gy IR and harvested at 15 minutes and 1, 3, 6 hours post-IR. After washing with 1ml ice cold PBS, cells were resuspended in 300μl 1X PBS and 700μl of 100% ice-cold ethanol dropwise while gently vortexing the tubes and then incubated overnight at -20°C. The next day, cells were washed with 1x PBS and incubated for 15min at room temperature (RT) in 1.5 mL wash buffer (1% BSA containing 0.25% Triton X-100 in PBS). After centrifugation, cells were incubated in 200 µL of α-phospho H2AX FITC conjugate (JBW301, Millipore,1:500 in wash buffer) for 2 hours at RT in the dark. Cells were then resuspended in 300-500 µl PI solution for 60 min at RT in the dark prior to FACS analysis.

[0206] Laser micro-irradiation

[0207] Laser micro-irradiation was performed as previously described20. Briefly, U20S cells expressing EWS-GFP, EWS-FLI1-GFP, or EWS-ATF1-GFP were seeded in 8-well Lab Tek II Chamber Slides (Thermo Fisher Scientific) for 24 hours. Cells were treated with 1µg / ml Hoechst 33342 (Thermo Fisher Scientific) for 30 minutes prior to micro-irradiation. Live cell microscopy was performed using Nikon Ti microscope with a CSU-W1 spinning disk confocal using a 100X / 1.4 Plan Apo VC objective. To induce DNA damage, 5 pixel wide stripes were drawn in every cell nucleus to label the region of interest (ROI) and irradiated with a 405nm diode laser (40mW). Images were acquired pre-irradiation and at 1 minute intervals post-laser damage for 15 minutes. To plot recruitment kinetics, the pre- irradiation fluorescence intensity was subtracted from the intensity of the ROI for every nucleus.

[0208] Proximity ligation assay

[0209] U2OS cells were seeded on autoclaved coverslips and subjected to 10Gy IR.15 minutes post-IR, cells were washed twice with 1X PBS and fixed with 4% formaldehyde for 15 minutes at room temperature. Fixed cells were incubated with 0.5% Triton X-100 for 10 60 4868-5555-9605.1Atty. Dkt. No.115872-2946 minutes. Cells were then washed twice with 1X PBS and blocked in 5% BSA / 1X PBS solution for 1 hour at room temperature. Coverslips were then incubated overnight at 4 °C with EWS (Origene, 1:200) and pH2AX (CST, 1:500) antibodies. The following day proximity ligation assay (PLA) was performed using Duolink PLA technology (Sigma- Aldrich) according to the manufacturer’s instructions. Images were acquired using Nikon Ti microscope with a CSU-W1 spinning disk confocal using a 100X / 1.4 Plan Apo VC objective (Center for Advanced Light Microscopy, UCSF).

[0210] EWS Co-Immunoprecipitation (co-IP)

[0211] 293T cells were transfected with Flag-EWS and EWS-FLI1 (or empty vector) for 48 hours. Cells were then treated with NCS (200ng / mL) for 30 minutes and cells were collected at 15 minutes, 30 minutes and 1 hour post NCS treatment. Nuclear co-IP was performed using the Nuclear Co-IP kit (Active Motif) according to the manufacturer’s instructions.

[0212] Cell cycle analysis

[0213] U2OS cells were nucleofected with the dual promoter pCDH-EWS-FLI1-EF1a- mtagBFP (or empty vector) and analyzed at 48 hours. Cells were fixed using 4% formaldehyde for 15 minutes at room temperature. After washing with 1% BSA in PBS, cells were resuspended in 500μl of FxCycle™ PI / RNAse Solution (ThermoFisher Scientific) for 30 minutes at room temperature. Cell cycle profiles were also analyzed using Click-iT EdU Alexa Fluor 488 Flow Cytometry Assay Kit (Invitrogen). Cells were pulse labelled with 10μM EdU for 30 minutes and processed according to the manufacturer’s instructions. Flow cytometry was used to analyze the cell cycle profile for BFP positive, EWS-FLI1 (or empty vector) expressing cells.

[0214] Statistics

[0215] Data from at least three independent experiments were used to calculate P values which were determined with Student’s t tests and ANOVA using GraphPad software.

[0216] Data and Code Availability

[0217] All data supporting the findings of this study are available within the paper and its Supplementary Information. Code for “mhscan” is available on request. 61 4868-5555-9605.1Atty. Dkt. No.115872-2946 Example 2: ES cells are dependent on HR factors for survival

[0218] To address the uncertainty surrounding putative DNA repair defect(s) in ES, we set out to identify genes that modulate ES cell survival in response to doxorubicin, a DNA DSB-inducing agent and major component of current chemotherapy regimens24(FIG.1A). We selected a CRISPR interference (CRISPRi) based screening approach given the concern of studying DSB repair phenotypes using an active Cas9 that generates DSBs25. Surprisingly, we found that key HR factors BRCA1 and PALB2 were essential for the growth of ES cells even in the absence of doxorubicin (FIG.1B). Given the prevailing model that ES tumors are functionally HR-deficient, BRCA-like tumors14, the screen results were unexpected. We validated the finding of HR factor dependency in ES using two independent guide RNAs (gRNAs) against BRCA1 and PALB2 in the screening cell line (A673) and two additional ES cell lines TC71 and ES8 (FIGs.1C-1E and 8A-8B). In contrast, the same BRCA1 and PALB2 gRNAs had limited effects on cell growth in two non-ES cancer cell lines, which was consistent with the set of published CRISPRi screens25–27and suggested the observed dependency on HR factors may be specific to ES cells (FIGs. 8C-8D). To test the role of EWS-FLI1 in inducing this dependency, we utilized an ES cell line with a doxycycline-inducible shRNA against EWS-FLI128(FIG.8E). We observed that EWS-FLI1 knockdown rescued the growth defects caused by BRCA1 or PALB2 loss, confirming that the oncogenic fusion protein is necessary for the observed dependency on HR factors in ES cells (FIG.1F).

[0219] CRISPRi screening also identified genes whose loss sensitized ES cells to doxorubicin including LIG4, NHEJ1 (XLF), and 53BP1 (FIG.8F). The presence of key canonical non-homologous end joining (c-NHEJ) genes as top chemo-sensitizer hits validated our experimental approach as this pathway is critical for repairing both drug and ionizing radiation (IR) induced DSBs and provides evidence for a functional c-NHEJ pathway in ES cells. The list of top chemosensitizer genes included Aurora Kinase A (AURKA), for which inhibitors are under clinical development29, and the E3 Ubiquitin Ligase RNF8, both of which could be targeted in combinatorial therapeutic approaches with doxorubicin-based treatment regimens. The final category of screen hits were genes whose loss promoted survival under high doses of doxorubicin (LD97), mirroring the residual disease state in ES patients (FIG.8G). SLFN11 is a notable hit as loss of SLFN11 has been shown to promote chemotherapy resistance in multiple cancer subtypes including ES30, 31. Given the paradoxical finding of HR factor dependence in ES, we chose to focus on the 62 4868-5555-9605.1Atty. Dkt. No.115872-2946 regulation of DSB repair in ES and whether ES tumors are properly classified as BRCA-like cancers. Example 3: ES patient tumors do not display the genomic scars of HR deficiency

[0220] We next directly examined genomic DNA from 99 ES patient tumor samples32for evidence of functional HR deficiency. This is a validated strategy in BRCA1 / 2 mutant and BRCA-like tumors wherein defective HR repair results in specific genomic scars that result from increased utilization of compensatory pathways such as alternative end-joining (alt-EJ) and single-strand annealing (SSA)33, 34. We developed a custom bioinformatics pipeline to analyze the genomic landscape of ES tumor genomes, using BRCA1 / 2 mutant and wildtype breast cancer genomes to validate our algorithms. At least thirty mutational signatures have been identified in human cancers with Signature 3 being the most highly associated with BRCA1 / 2 mutant cancers33. Our analysis confirmed high levels of Signature 3 in BRCA mutant as compared to BRCA wildtype tumors but did not show increased levels of Signature 3 in ES tumors (FIGs.2A and 9A). In addition to increased Signature 3, BRCA1 / 2 mutant tumors displayed an increase in the number and size of deletions compared to BRCA wildtype tumors (FIGs.2B, C and 9B-9D) consistent with previous reports33. ES tumors are clearly distinct from BRCA1 / 2 mutant tumors displaying few deletions per genome and a size distribution skewed further towards small deletions than even BRCA wildtype tumor samples (FIGs.2B-2C and 9B-9D).

[0221] We further examined the sequences flanking deletion sites for short stretches of overlapping microhomology (MH). Defective HR repair in BRCA mutant or BRCA-like tumors results in increased usage of the error prone DSB repair pathway alt-EJ that employs MH for initial annealing of resected DSB ends35. We utilized BRCA mutant / wildtype samples to computationally define deletion size bins and identified an increase in the proportion of intermediate size deletions (7-28 base pairs (bp), 29-45 bp) in BRCA mutant samples as reported previously (FIGs.9E-9F). We then verified a significant increase in breakpoint MH at intermediate size (7-28bp and 29-45bp) deletions in BRCA mutant tumors compared to wildtype and no increase in MH at small deletions (1-6bp) where c- NHEJ predominates (FIGs.2D-2E, and 9E-9G), both consistent with published findings33. ES samples clustered with BRCA wildtype tumors and display a trend toward even less MH-mediated DSB repair than BRCA wildtype samples (FIGs.2D-2E, and 9G). Our findings in ES were independent of the recurrent STAG2 and p53 mutations that occur in a subset of these cancers (FIGs.9H-9I). Taken together, these results demonstrate that ES 63 4868-5555-9605.1Atty. Dkt. No.115872-2946 patient tumors do not display the genomic signatures of BRCA1 / 2 mutant cancers and lack the footprint of isolated HR deficiency. Example 4: EWS-FLI1 impairs resection-dependent DSB repair

[0222] The absence of HR deficient genomic scars in ES tumors and paradoxical requirement of HR factors for ES cell survival prompted us to systematically re-examine how EWS-FLI1 impacts DSB repair pathway utilization (FIG.3A). We posited that previous reports of defective HR in ES might alternatively be explained by a more general upstream defect in DSB repair. We utilized a set of well-established DSB repair reporter cell lines wherein expression of the I-SceI endonuclease induces a DSB within an interrupted GFP reporter cassette, such that utilization of a particular DSB repair pathway restores a GFP coding sequence enabling a quantitative readout of individual repair pathway efficiency36. Nucleofection of EWS-FLI1 into each reporter cell line was performed using a BFP-expressing, dual promoter plasmid, followed by expression of mCherry-I-SceI after 24 hours to induce a single DSB (FIGs.10A-10B). The use of fluorescently tagged plasmids enabled detection of DSB repair specifically in cells that expressed both EWS-FLI1 (or empty vector) and I-SceI (FIG.10A).

[0223] To examine HR repair, we utilized the DR-GFP reporter and observed a reduction in HR upon EWS-FLI1 expression, consistent with previous reports14(FIG.3B). However, EWS-FLI1 expression also reduced the efficiency of MH-mediated alt-EJ repair (EJ2) and long-stretch MH mediated-SSA repair (FIGs.3C, 3D and 7C). EWS-FLI1 mediated reductions in HR, alt-EJ, and SSA repair efficiency were intermediate compared to knockdown of the key end-resection factor CtIP that is required for all resection-dependent DSB repair37(FIGs.3C-3D and 10C). These data indicate EWS-FLI1 expression does not result in isolated HR defects, but instead compromises all three resection-dependent DSB repair pathways.

[0224] We also evaluated c-NHEJ, a fast-acting DSB repair pathway which does not require end-resection, using the EJ5 reporter system. We observed an increase in the usage of c-NHEJ upon EWS-FLI1 expression (FIG.3E) consistent with our CRISPRi screen findings of an intact c-NHEJ pathway (FIG.8F) and the increased frequency of small deletions observed in ES patient samples (FIG.2C). We verified that the repair phenotypes were not the result of EWS-FLI altering cell cycle profiles or causing a cell cycle arrest in these short-term assays (FIGs.10D-10E). To assess how EWS-FLI1 regulates the transcription of DDR genes that control resection-dependent DSB repair, we analyzed 64 4868-5555-9605.1Atty. Dkt. No.115872-2946 published RNA-sequencing data in ES cells before and after EWS-FLI1 knockdown38(FIG. 10F). Interestingly, we found that EWS-FLI1 either increased or had minimal effect on the expression of key genes involved in resection-dependent DSB repair (MRE11, CtIP, BRCA1 / 2, PALB2, RAD52, POLQ), and had no effect on expression of many c-NHEJ genes (LIG4, NHEJ1). These data suggest that EWS-FLI’s effect on DSB repair pathway utilization is not the result of transcriptional downregulation of key end-resection and resection-dependent DSB repair genes (e.g., BRCA1) by the fusion oncoprotein. In summary, we demonstrate that EWS-FLI1 does not induce isolated HR deficiency but instead compromises all three resection-dependent DSB repair pathways. Example 5: ATM activation and signaling is defective in Ewing sarcoma

[0225] To explain our finding that EWS-FLI1 impairs multiple branches of resection- dependent DSB repair, we focused on the upstream regulation of the DDR and end- resection in ES cells (FIG.3A). The DDR is a partially redundant signaling network regulated by three kinases, DNA-PK, ATM, and ATR, each of which control distinct aspects of DDR signal amplification and DSB pathway choice. ATM was a logical candidate since it promotes DNA end-resection and HR39, and ATM loss creates a synthetic lethal dependence on HR proteins40, 41. We therefore tested whether EWS-FLI1 affects the activation and function of these three apical DDR kinases.

[0226] Transient knockdown of EWS-FLI1 in ES cells increased both ATM activation (autophosphorylation) and to a greater extent, downstream ATM signaling (phosphorylation of key downstream targets CHK2 and KAP1) in response to ionizing radiation (IR) (FIGs. 4A-4B). In contrast, activation of the other apical DDR kinases was either unaffected (DNA-PK) or decreased (ATR) by EWS-FLI1 knockdown in ES cells (FIGs.4C and 11A). In the reciprocal experiment, expression of EWS-FLI1 in a non-ES cancer cell line (U2OS) suppressed ATM activation and downstream ATM signaling in response to IR (FIGs. 4D and 11B-11D), without affecting DNA-PK or ATR activation and signaling (FIGs.11E- 11F). Absolute p-ATM foci number after IR was not affected by EWS-FLI1 (FIG.11G) and we observed a reduction in pH2AX signal intensity by flow cytometry, but not absolute pH2AX foci number, after IR in EWS-FLI1 expressing cells (FIGs.4E and 11H). These data further support an ATM signaling defect in ES as ATM is the principal DDR kinase responsible for the phosphorylation and amplifying spread of pH2AX surrounding DSBs39.

[0227] Both ATM and ATR coordinate aspects of resection-dependent DSB repair (FIG. 3A) and ATM mutant tumors display synthetic lethality with ATR inhibitors, thus 65 4868-5555-9605.1Atty. Dkt. No.115872-2946 demonstrating the vital compensatory role of the ATR signaling axis in the absence of ATM42, 43. We therefore tested if functional ATM deficiency caused by EWS-FLI1 induced a collateral dependence on the ATR signaling axis in ES given this emerging synthetic lethal relationship between the two DDR kinases. Indeed, ES cells displayed increased sensitivity to inhibitors of both ATR and its key downstream target CHK1, and inhibitor sensitivity was reversed by EWS-FLI1 knockdown in both cases (FIGs.4F and 11I). Overexpression of RNAseH1 which degrades R-loops, the major source of oncogene- induced replication stress in ES14, did not alter the ATR inhibitor sensitivity of ES cells (FIGs.11J-11K) suggesting that the molecular basis of ATR inhibitor response in ES cells may be a consequence of functional ATM deficiency. The collective findings establish an EWS-FLI1-dependent specific impairment of ATM function in ES and resultant synthetic lethality with the compensatory ATR signaling axis. Example 6: Loss of native EWS phenocopies the DNA repair defects caused by EWS- FLI1

[0228] We hypothesized that previously reported interactions between EWS-FLI1 and native FET proteins (e.g., EWS) may disrupt the putative function of native FET family members in early DSB repair compartmentalization44, 45, thereby impacting ATM activation and downstream signaling. Consistent with prior studies45, EWS-FLI1 and another native FET family member (FUS) coprecipitated with FLAG-tagged EWS (FIG.12A). The strength of these interactions was unchanged in the setting of the DNA DSB-inducing agent neocarzinostatin (NCS) indicating a high affinity interaction not disrupted by the DDR. Given that native EWS accumulates at laser-induced DSB stripes within seconds19, we tested whether the aberrant interaction between EWS and EWS-FLI1 in ES impacts the kinetics of native EWS recruitment to DNA DSBs.

[0229] The initial recruitment of EWS to laser micro-irradiated DSBs was unaffected by EWS-FLI1. Instead, EWS-FLI1 expression resulted in the premature and rapid clearance of EWS from DSB stripes (FIGs.5A-5B). To determine whether loss of native EWS function at DNA DSBs may contribute to EWS-FLI1-dependent DNA repair defects, we first characterized the role of native EWS in DSB repair using the pathway-specific DSB repair reporters. Analogous to EWS-FLI1 expression, native EWS knockdown decreased all three resection-dependent DSB repair pathways, HR, alt-EJ and SSA (FIGs.5C-5E and 12B). Interestingly, c-NHEJ efficiency was also reduced upon EWS knockdown (FIG.5F), highlighting differences between native EWS loss and EWS-FLI1 overexpression that may 66 4868-5555-9605.1Atty. Dkt. No.115872-2946 relate to the rapid kinetics of c-NHEJ repair and preserved initial recruitment of native EWS despite EWS-FLI1 expression.

[0230] We further assessed the role of native EWS in activation of the upstream DDR kinases ATM, DNA-PK, and ATR. Analogous to EWS-FLI1 expression, native EWS knockdown reduced activation of ATM itself (autophosphorylation) and to a greater extent, functional ATM signaling (phosphorylation of CHK2 and KAP1) upon IR, again with either no effect (DNA-PK) or increased (ATR) activation of the other two DDR kinases (FIGs. 5G and 12C-12G). We utilized a proximity ligation assay (PLA) to establish an IR- dependent interaction between pH2AX and EWS (FIGs.5H and 12H), further supporting a role for native EWS in coordinating early DSB repair responses. Finally, knockdown of native EWS also decreased IR-induced pH2AX signal intensity by flow cytometry, but not pH2AX foci number, analogous to EWS-FLI1 overexpression (FIG.5I). These data define the function of native FET family member EWS as a specific regulator of ATM activation and signaling. In total, we demonstrate that EWS-FLI1 causes premature loss of native EWS from DSBs and functional ATM defects that are phenocopied by native EWS knockdown. Example 7: EWS-FLI1 and other FET fusion oncoproteins are recruited to DNA double- strand breaks

[0231] To determine a molecular basis for the ATM defects seen in ES, we asked whether the interaction between native EWS and EWS-FLI1 (FIG.12A) might promote aberrant localization of the fusion oncoprotein to DNA DSBs. Indeed, we discovered that EWS- FLI1, like native EWS, is recruited to laser-induced DSBs (FIGs.6B-6E). The kinetics of EWS-FLI1 recruitment were delayed compared to native EWS, which accumulates within seconds due to C-terminal, positively charged RGG domains not present in EWS-FLI1 (FIGs.6A-6E). Importantly, recruitment to DSBs represents an unanticipated neomorphic property of the fusion protein contributed by the N-terminal IDR of EWS. Control experiments with the full-length FLI1 protein showed no accumulation at laser-induced DSBs (FIG.13A). Consistent with the N-terminus of EWS mediating DSB recruitment, mutation of the DNA binding domain of FLI1 (R2L2 mutant of EWS-FLI146) had no effect on the DSB localization of EWS-FLI1 (FIG.13B). Furthermore, knockdown of native EWS reduced accumulation of EWS-FLI1 at laser-induced DSB stripes, indicating that the localization of EWS-FLI1 to DSBs depends, at least in part, on native EWS (FIG.13C). 67 4868-5555-9605.1Atty. Dkt. No.115872-2946

[0232] Lastly, we tested the generality of the concept that N-terminal IDRs, as a shared structural feature of FET fusion oncoproteins (FIG.6A), could promote aberrant DSB recruitment in other tumors within this class. EWS-ATF1 is the sole oncogenic driver of clear cell sarcoma (CCS) and contains the identical N-terminal IDR sequence as EWS- FLI1. The EWS-ATF1 fusion oncoprotein localized to laser-induced DSBs with delayed recruitment kinetics similar to EWS-FLI1 though with differences in departure timing (FIGs.6F-6G). Analogous to our findings in ES, transient knockdown of EWS-ATF1 in a patient-derived CCS cell line increased downstream ATM signaling (phosphorylation of ATM targets CHK2 and KAP1) in response to ionizing radiation (IR), with either no effect (DNA-PK) or compensatory decrease (ATR) in activation of the other upstream DDR kinases (FIGs.6H-6I and 13D-13G). These data also reveal differences between FET fusion oncoproteins; only EWS-FLI1 affected the initial activation of ATM (autophosphorylation), while both EWS-ATF1 and EWS-FLI1 caused functional ATM defects in terms of downstream signaling. Despite these differences, the consequence of functional ATM deficiency in CCS was similarly increased reliance on compensatory ATR signaling, as CCS cells displayed EWS-ATF1-dependent synthetic lethality with ATR inhibition (FIG.6J). Taken together, our results support a model in which EWS fusion oncoproteins are aberrantly recruited to DSB repair sites and induce specific defects in ATM function. Example 8: Effects of ATR inhibitors in xenograft animals bearing FET-rearranged cancers

[0233] We are testing ATR inhibitors in PDX models of a diverse set of FET rearranged sarcomas including Ewing sarcoma, clear cell sarcoma, and desmoplastic small round cell tumor. PDX tumors will be assessed for tumor volume and pharmacodynamic measurements of drug efficacy such as ATR and CHK1 phosphorylation status. These studies are based on the novel finding that FET rearranged tumors have functional ATM deficiency. To assess the extent of functional ATM inactivation in these tumors, we are benchmarking our findings with FET fusion oncoproteins to loss of classic ATM activators such as MRE11 and NBS1.

[0234] It is anticipated that treatment with ATR inhibitors will reduce tumor volume and / or reduce phosphorylation of ATR and / or CHK1. 68 4868-5555-9605.1Atty. Dkt. No.115872-2946 EQUIVALENTS

[0235] The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0236] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0237] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non- limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.

[0238] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification. 69 4868-5555-9605.1Atty. Dkt. No.115872-2946 REFERENCES 1. Groelly F. J., Fawkes M., Dagg R. A., Blackford A. N. & Tarsounas M. Targeting DNA damage response pathways in cancer. Nature Reviews Cancer (2022).10.1038 / s41568-022- 00535-5 2. Bryant H. E. et al. Specific killing of BRCA2-deficient tumours with inhibitors of poly(ADP-ribose) polymerase. Nature 434, 913–917 (2005).10.1038 / nature03443 3. Farmer H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917–921 (2005).10.1038 / nature03445 4. Schwartz J., Cech T. & Parker R. Biochemical Properties and Biological Functions of FET Proteins. Annual review of biochemistry 84 (2014).10.1146 / annurev-biochem-060614- 034325 5. Grünewald T. G. P. et al. Ewing sarcoma. Nature Reviews Disease Primers 4, 5 (2018). 10.1038 / s41572-018-0003-x 6. Krikelis D. & Judson I. Role of chemotherapy in the management of soft tissue sarcomas. Expert Rev Anticancer Ther 10, 249–260 (2010).10.1586 / era.09.176 7. Garnett M. J. et al. Systematic identification of genomic markers of drug sensitivity in cancer cells. Nature 483, 570–575 (2012).10.1038 / nature11005 8. Stewart E. et al. Targeting the DNA repair pathway in Ewing sarcoma. Cell Rep 9, 829– 841 (2014).10.1016 / j.celrep.2014.09.028 9. Ewing J. R. Diffuse endothelioma of bone.. Proceedings of the New York Pathological Society 450, 12:17 (1921). 10. Gorthi A. et al. EWS-FLI1 increases transcription to cause R-loops and block BRCA1 repair in Ewing sarcoma. Nature 555, 387–391 (2018).10.1038 / nature25748 11. Choy E. et al. Phase II study of olaparib in patients with refractory Ewing sarcoma following failure of standard chemotherapy. BMC Cancer 14, 813 (2014).10.1186 / 1471- 2407-14-813 12. Kondrashova O. et al. Methylation of all BRCA1 copies predicts response to the PARP inhibitor rucaparib in ovarian carcinoma. Nat Commun 9, 3970 (2018).10.1038 / s41467- 018-05564-z 70 4868-5555-9605.1Atty. Dkt. No.115872-2946 13. Lee J. m., Ledermann J. A. & Kohn E. C. PARP Inhibitors for BRCA1 / 2 mutation- associated and BRCA-like malignancies. Annals of Oncology 25, 32–40 (2014). 10.1093 / annonc / mdt384 14. Schwartz J. C., Cech T. R. & Parker R. R. Biochemical Properties and Biological Functions of FET Proteins. Annual Review of Biochemistry 84, 355–379 (2015). 10.1146 / annurev-biochem-060614-034325 15. Altmeyer M. et al. Liquid demixing of intrinsically disordered proteins is seeded by poly(ADP-ribose). Nature Communications 6, 8088 (2015).10.1038 / ncomms9088 16. Izhar L. et al. A Systematic Analysis of Factors Localized to Damaged Chromatin Reveals PARP-Dependent Recruitment of Transcription Factors. Cell Rep 11, 1486–1500 (2015).10.1016 / j.celrep.2015.04.053 17. Levone B. R. et al. FUS-dependent liquid-liquid phase separation is important for DNA repair initiation. J Cell Biol 220 (2021).10.1083 / jcb.202008030 18. Singatulina A. S. et al. PARP-1 Activation Directs FUS to DNA Damage Sites to Form PARG-Reversible Compartments Enriched in Damaged DNA. Cell Rep 27, 1809– 1821.e1805 (2019).10.1016 / j.celrep.2019.04.031 19. Kovar H. Dr. Jekyll and Mr. Hyde: The Two Faces of the FUS / EWS / TAF15 Protein Family. Sarcoma 2011, 837474 (2011).10.1155 / 2011 / 837474 20. Cote G. M. & Choy E. Update in treatment and targets in Ewing sarcoma. Hematol Oncol Clin North Am 27, 1007–1019 (2013).10.1016 / j.hoc.2013.07.001 21. Gilbert L. A. et al. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell 159, 647–661 (2014).10.1016 / j.cell.2014.09.029 22. Daggubati V. et al. Smoothened-activating lipids drive resistance to CDK4 / 6 inhibition in Hedgehog-associated medulloblastoma cells and preclinical models. The Journal of Clinical Investigation 131 (2021).10.1172 / JCI141171 23. Rosenbluh J. et al. Complementary information derived from CRISPR Cas9 mediated gene deletion and suppression. Nat Commun 8, 15403 (2017).10.1038 / ncomms15403 24. Tirode F. et al. Mesenchymal Stem Cell Features of Ewing Tumors. Cancer Cell 11, 421–429 (2007).10.1016 / j.ccr.2007.02.027 71 4868-5555-9605.1Atty. Dkt. No.115872-2946 25. Du R., Huang C., Liu K., Li X. & Dong Z. Targeting AURKA in Cancer: molecular mechanisms and opportunities for Cancer therapy. Molecular Cancer 20, 15 (2021). 10.1186 / s12943-020-01305-3 26. Coleman N., Zhang B., Byers L. A. & Yap T. A. The role of Schlafen 11 (SLFN11) as a predictive biomarker for targeting the DNA damage response. British Journal of Cancer 124, 857–859 (2021).10.1038 / s41416-020-01202-y 27. Tang S. W. et al. SLFN11 Is a Transcriptional Target of EWS-FLI1 and a Determinant of Drug Response in Ewing Sarcoma. Clin Cancer Res 21, 4184–4193 (2015). 10.1158 / 1078-0432.Ccr-14-2112 28. Tirode F. et al. Genomic landscape of Ewing sarcoma defines an aggressive subtype with co-association of STAG2 and TP53 mutations. Cancer Discov 4, 1342–1353 (2014). 10.1158 / 2159-8290.Cd-14-0622 29. Nik-Zainal S. et al. Landscape of somatic mutations in 560 breast cancer whole-genome sequences. Nature 534, 47–54 (2016).10.1038 / nature17676 30. Polak P. et al. A mutational signature reveals alterations underlying deficient homologous recombination repair in breast cancer. Nat Genet 49, 1476–1486 (2017). 10.1038 / ng.3934 31. Nik-Zainal S. et al. Mutational processes molding the genomes of 21 breast cancers. Cell 149, 979–993 (2012).10.1016 / j.cell.2012.04.024 32. Gunn A. & Stark J. M. I-SceI-based assays to examine distinct repair outcomes of mammalian chromosomal double strand breaks. Methods Mol Biol 920, 379–391 (2012). 10.1007 / 978-1-61779-998-3_27 33. Bennardo N., Cheng A., Huang N. & Stark J. M. Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. PLoS Genet 4, e1000110 (2008). 10.1371 / journal.pgen.1000110 34. Riggi N. et al. EWS-FLI1 utilizes divergent chromatin remodeling mechanisms to directly activate or repress enhancer elements in Ewing sarcoma. Cancer Cell 26, 668–681 (2014).10.1016 / j.ccell.2014.10.004 35. Blackford A. N. & Jackson S. P. ATM, ATR, and DNA-PK: The Trinity at the Heart of the DNA Damage Response. Mol Cell 66, 801–817 (2017).10.1016 / j.molcel.2017.05.015 72 4868-5555-9605.1Atty. Dkt. No.115872-2946 36. Chen C. C. et al. ATM loss leads to synthetic lethality in BRCA1 BRCT mutant mice associated with exacerbated defects in homology-directed repair. Proc Natl Acad Sci U S A 114, 7665–7670 (2017).10.1073 / pnas.1706392114 37. Cai M. Y. et al. Cooperation of the ATM and Fanconi Anemia / BRCA Pathways in Double-Strand Break End Resection. Cell Rep 30, 2402–2415.e2405 (2020). 10.1016 / j.celrep.2020.01.052 38. Min A. et al. AZD6738, A Novel Oral Inhibitor of ATR, Induces Synthetic Lethality with ATM Deficiency in Gastric Cancer Cells. Mol Cancer Ther 16, 566–577 (2017). 10.1158 / 1535-7163.Mct-16-0378 39. Menezes D. L. et al. A synthetic lethal screen reveals enhanced sensitivity to ATR inhibitor treatment in mantle cell lymphoma with ATM loss-of-function. Mol Cancer Res 13, 120–129 (2015).10.1158 / 1541-7786.Mcr-14-0240 40. Soutoglou E. & Misteli T. Activation of the Cellular DNA Damage Response in the Absence of DNA Lesions. Science 320, 1507–1510 (2008).10.1126 / science.1159051 41. Boulay G. et al. Cancer-Specific Retargeting of BAF Complexes by a Prion-like Domain. Cell 171, 163–178.e119 (2017).10.1016 / j.cell.2017.07.036 42. Bailly R. A. et al. DNA-binding and transcriptional activation properties of the EWS- FLI-1 fusion protein resulting from the t(11;22) translocation in Ewing sarcoma. Molecular and Cellular Biology 14, 3230–3241 (1994).10.1128 / mcb.14.5.3230-3241.1994 43. Gruber J. J. et al. A phase II study of talazoparib monotherapy in patients with wild-type BRCA1 and BRCA2 with a mutation in other homologous recombination genes. Nature Cancer 3, 1181–1191 (2022).10.1038 / s43018-022-00439-1 44. Wang W. Y. et al. Interaction of FUS and HDAC1 regulates DNA damage response and repair in neurons. Nat Neurosci 16, 1383–1391 (2013).10.1038 / nn.3514 45. Li H. & Durbin R. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics 26, 589–595 (2010).10.1093 / bioinformatics / btp698 46. Breese M. R. & Liu Y. NGSUtils: a software suite for analyzing and manipulating next- generation sequencing datasets. Bioinformatics 29, 494–496 (2013). 10.1093 / bioinformatics / bts731 73 4868-5555-9605.1Atty. Dkt. No.115872-2946 47. McKenna A. et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20, 1297–1303 (2010). 10.1101 / gr.107524.110 48. Benjamin D. et al. Calling Somatic SNVs and Indels with Mutect2. bioRxiv, 861054 (2019).10.1101 / 861054 49. Rausch T. et al. DELLY: structural variant discovery by integrated paired-end and split- read analysis. Bioinformatics 28, i333–i339 (2012).10.1093 / bioinformatics / bts378 50. Tate J. G. et al. COSMIC: the Catalogue Of Somatic Mutations In Cancer. Nucleic Acids Res 47, D941–d947 (2019).10.1093 / nar / gky1015 51. Alexandrov L. B. et al. Signatures of mutational processes in human cancer. Nature 500, 415–421 (2013).10.1038 / nature12477 52. Rosenthal R., McGranahan N., Herrero J., Taylor B. S. & Swanton C. DeconstructSigs: delineating mutational processes in single tumors distinguishes DNA repair deficiencies and patterns of carcinoma evolution. Genome Biol 17, 31 (2016).10.1186 / s13059-016-0893-4 74 4868-5555-9605.1

Claims

Atty. Dkt. No.115872-2946 CLAIMS 1. A method for selecting a cancer patient for treatment with an ATM and Rad3 related (ATR) inhibitor or a CHK1 inhibitor comprising (a) detecting the presence of at least one FET fusion oncoprotein in a biological sample obtained from the cancer patient; and (b) administering an effective amount of an ATR inhibitor or a CHK1 inhibitor to the cancer patient.

2. A method for treating cancer in a patient in need thereof comprising administering an effective amount of an ATR inhibitor or a CHK1 inhibitor to the patient, wherein the patient comprises at least one FET fusion oncoprotein.

3. The method of claim 1 or 2, wherein the at least one FET fusion oncoprotein comprises an N-terminal intrinsically disordered region (IDR) of a FET protein fused to a DNA binding domain of a transcription factor.

4. The method of claim 3, wherein the FET protein is EWS, FUS, or TAF15.

5. The method of claim 3 or 4, wherein the transcription factor is an ETS transcription factor family gene.

6. The method of claim 5, wherein the ETS transcription factor family gene is selected from the group consisting of FLI1, ERG, ETV1, ETV4, and FEV.

7. The method of claim 3 or 4, wherein the transcription factor is NFATC2, PATZ1, WT1, DDIT3, CREB1, CREB, ATF1, CREM, PBX1, PBX3, ZNF444, POU5F1, ATF1, KLF17, CREB3L1, CREB3L2, CREB3L3, CREBL1, NR4A3, SMAD3, or TFCP2.

8. The method of any one of claims 1-7, wherein the at least one FET fusion oncoprotein is selected from the group consisting of EWS-FLI1, EWS-ERG, EWS-ETV1, EWS-ETV4, EWS-FEV, FUS-FLI1, FUS-ERG, FUS-ETV1, FUS-ETV4, FUS-FEV, TAF15-FLI1, TAF15-ERG, TAF15-ETV1, TAF15-ETV4, TAF15-FEV, EWS-NFATC2, FUS-NFATC2, EWS-PATZ1, EWS-WT1, FUS-DDIT3 , EWS-DDIT3, EWS-CREB1, EWS-CREB, FUS-CREB, EWS-ATF1, FUS-ATF1, EWS-CREM, FUS-CREM, EWS- PBX1, EWS-PBX3, EWS-ZNF444, EWS-POU5F1, EWS-ATF1, EWS-KLF17, FUS- PBX1, FUS-PBX3, FUS-ZNF444, FUS-POU5F1, FUS-ATF1, FUS-KLF17, EWS- CREB3L1, FUS-CREB3L2, EWS-CREB3L2, EWS-CREB3L3, FUS-CREB3L1, EWS- CREBL1, EWSR1-NR4A3, TAF15-NR4A3, EWS-SMAD3, EWS-TFCP2 and FUS- TFCP2. 75 4868-5555-9605.1Atty. Dkt. No.115872-2946 9. The method of any one of claims 1-8, wherein the at least one FET fusion oncoprotein is detected via next-generation sequencing, PCR, real-time quantitative PCR (qPCR), digital PCR (dPCR), Southern blotting, Reverse transcriptase-PCR (RT-PCR), Northern blotting, microarray, dot or slot blots, in situ hybridization, fluorescent in situ hybridization (FISH), Western blotting, enzyme-linked immunosorbent assays (ELISA), immunohistochemistry, immunofluorescence, immunoprecipitation, immunoelectrophoresis, or mass-spectrometry.

10. The method of any one of claims 1 or 3-8, wherein the biological sample obtained from the patient comprises biopsied tumor tissue, whole blood, plasma, or serum.

11. A method for sensitizing a cancer patient to therapy with an ATR inhibitor or a CHK1 inhibitor comprising administering to the cancer patient an effective amount of an ATM inhibitor separately, sequentially or simultaneously with the ATR inhibitor or the CHK1 inhibitor.

12. The method of claim 11, wherein the ATM inhibitor is AZD-7648, AZD1390, berzosertib, KU55933, caffeine, KU-60019, AZD0156, VE-821, Camonsertib (RP-3500), Lartesertib, CP-466722, Ro 90-7501, CGK733, AZ32, ETP-46464, AZ31, A011, ATM Inhibitor-1, ATM Inhibitor-3, ATM Inhibitor-4, or ATR-IN-15.

13. The method of claim 11 or 12, wherein the patient suffers from or is diagnosed with Ewing’s sarcoma (ES), desmoplastic small-round-cell tumors, myxoid liposarcoma, angiomatoid fibrous histiocytoma, intracranial mesenchymal tumors, primary pulmonary myxoid sarcoma, clear cell sarcomas, clear cell sarcoma-like gastrointestinal tumors, mesothelioma, myoepithelioma, sclerosing epithelioid fibrosarcoma, low-grade fibromyxoid sarcoma, extraskeletal myxoid chondrosarcoma, fibroblastic tumors, and epithelioid or spindle cell rhabdomyosarcoma.

14. The method of any one of claims 1-13, wherein the ATR inhibitor is selected from the group consisting of elimusertib (BAY1895344), Schisandrin B, NU6027, dactolisib (NVP-BEZ235), ETP-46464, Torin 2, AZ20, Gartisertib (VX-803), berzosertib (M6620 (VX-970)), VE-821, Camonsertib, Abd110, CGK733, Garcinone C, ATR-IN-14, ATR-IN- 10, ATR-IN-19, ATR-IN-15, ATR-IN-21, ATR-IN-17, ATR-IN-20, and ceralasertib (AZD6738).

15. The method of any one of claims 1-13, wherein the CHK1 inhibitor is selected from the group consisting of AZD7762, LY2603618, MK-8776 (SCH 900776), PF-00477736, LY2606368 (Prexasertib), CCT244747, CHIR-124, GNE-783, GNE-900, PD-321852, PD- 407824, SAR-020106, SB-218078, 3-alkoxyamino-5-(pyridin-2-ylamino)pyrazine-2- 76 4868-5555-9605.1Atty. Dkt. No.115872-2946 carbonitriles, 1-(5-chloro-2-alkoxyphenyl)-3-(5-cyanopyrazin-2-yl)ureas, S1181 and V158411. 77 4868-5555-9605.1

Images