Small nuclear RNA processing hairpins for small RNA payloads

Abstract

Described herein are engineered RNAs and compositions comprising the same for treatment of diseases or conditions in a subject. Also disclosed herein are methods of treating diseases or conditions in a subject by administering engineered RNAs, polynucleotides encoding the described engineered RNAs, or pharmaceutical compositions described herein.

Description

SMALL NUCLEAR RNA PROCESSING HAIRPINS FOR SMALL RNA PAYLOADSCROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 462,224, entitled “SMALL NUCLEAR RNA PROCESSING HAIRPINS FOR SMALL RNA PAYLOADS,” filed April 26, 2023, which application is incorporated herein by reference.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in extensible Markup Language (XML) format and is hereby incorporated by reference in its entirety. Said XML copy, created on April 19, 2024, is named “421688- 72302 l_SL.xml” and is 1,534,028 bytes in size.BACKGROUND

[0003] A wide variety of diseases and disorders are caused by mutations, deletions, altered expression, or altered splicing of genes. RNAs can serve as a mechanism for gene therapy, such as by editing a mutated RNA sequence associated with a disease. There is a need for engineered RNAs to increase or modulate expression of RNA payloads.SUMMARY

[0004] In various aspects, the present disclosure provides a polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises: (a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and (b) a DNA sequence encoding a small nuclear RNA (snRNA) processing hairpin comprising a sequence with at least 80% identity to any one of: i) SEQ ID NO: 891, ii) SEQ ID NO: 1115, iii) SEQ ID NO: 1613, or iv) SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708.

[0005] In some aspects, the DNA sequence encoding the snRNA processing hairpin comprises a sequence with at least 85%, at least 90%, or at least 90% identity to any one of SEQ ID NO: 891, SEQ ID NO: 1115, SEQ ID NO: 1613, or SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708. In some aspects, the DNA sequence encoding the snRNA processing hairpin comprises a sequence of any one of SEQ ID NO: 891, SEQ ID NO: 1115, SEQ ID NO: 1613, or SEQ ID NO: 812 - SEQ ID NO: 890, SEQID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708. In some aspects, the DNA sequence encoding the snRNA processing hairpin is selected from: a) SEQ ID NO: 891, b) SEQ ID NO: 1115, or c) SEQ ID NO: 1613.

[0006] In various aspects, the present disclosure provides a polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises: (a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and (b) a DNA sequence encoding a snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNA processing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin.

[0007] In various aspects, the present disclosure provides a polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises: (a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and (b) a DNA sequence encoding a snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNA processing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U7 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin.

[0008] In some aspects, the polynucleotide further comprises a DNA sequence encoding an Sm- binding sequence or a DNA sequence encoding a variant Sm-binding sequence. In some aspects, the DNA sequence encoding the Sm-binding sequence comprises a sequence with at least 80% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644. In some aspects, the DNA sequence encoding the Sm-binding sequence comprises a sequence with at least 85%, at least 90%, or at least 90% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644. In some aspects, the DNA sequence encoding the Sm-binding sequence comprises a sequence with at least 85% identity to any one of SEQ ID NO: 1635, SEQ ID NO: 1636, SEQ ID NO: 1639, SEQ ID NO: 1640, SEQ ID NO: 1641, SEQ ID NO: 1642, or SEQ ID NO: 1643.

[0009] In some aspects, the targeting RNA sequence is from 60 bases to 200 bases in length. In some aspects, the target RNA is associated with a disease or condition, wherein the disease or condition is selected from the group consisting of: a neurodegenerative disease or disorder, a muscular disease or disorder, a metabolic disease or disorder, an ocular disease or disorder, a liver disease or disorder, a cancer, and any combination thereof. In some aspects, the target RNA is associated with a disease or condition selected from the group consisting of: Rett syndrome,Huntington’s disease, Parkinson’s Disease, Alzheimer’s disease, Stargardt disease, Usher syndrome, a muscular dystrophy, Spinal Muscular Atrophy (SMN), Faciocapulohumeral Muscular Dystrophy (FSHD), Limb Girdle Muscular Dystrophy (LGMD), Amyotrophic Lateral Sclerosis (ALS), Tay-Sachs Disease, Human Immunodeficiency Virus, familial hypercholesterolemia, diabetes, and cancer.

[0010] In some aspects, the targeting RNA sequence, upon hybridization to a target RNA, forms a guide -target RNA scaffold comprising a structural feature selected from the group consisting of a mismatch, a bulge, an internal loop, a hairpin, and any combination thereof, wherein the structural feature substantially forms upon hybridization to the target RNA, and wherein the structural feature is not present within the engineered guide RNA prior to the hybridization of the engineered guide RNA to the target RNA. In some aspects, the structural feature comprises the mismatch. In some aspects, the mismatch comprises at least one adenosine-guanosine (A-G) mismatch, at least one adenosine-adenosine (A- A) mismatch, or at least one adenosine-cytidine (A-C), wherein adenosine is present in the target RNA. In some aspects, the mismatch comprises an A-C mismatch, wherein the adenosine is present in the target RNA. In some aspects, the structural feature comprises the bulge. In some aspects, the bulge comprises an asymmetric bulge. In some aspects, the bulge comprises a symmetric bulge. In some aspects, the structural feature comprises the internal loop. In some aspects, the internal loop comprises an asymmetric internal loop. In some aspects, the internal loop comprises a symmetric internal loop.

[0011] In some aspects, the snRNA processing hairpin is downstream of the targeting RNA sequence. In some aspects, the engineered guide RNA is capable of recruiting an RNA editing entity to the target RNA when bound to the target RNA. In some aspects, the RNA editing entity comprises an Adenosine deaminase acting on RNA (ADAR) protein, an Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC) protein, or both. In some aspects, the RNA editing entity comprises the ADAR protein and wherein the ADAR protein comprises ADAR1 or ADAR2.

[0012] In some aspects, the target RNA is selected from the group consisting of: ABCA4, ALAS1, APP, ATP7B, CFTR, DMD, DMPK, DUX4, GAPDH, GBA, HEXA, HFE, LIPA, LRRK2, MAPT, PCSK9 start site, PINK1, PMP22, SERPINA1, SCNN1A start site, SNCA, or SOD1, a fragment of any one of these, and any combination thereof. In some aspects, the target RNA is SERPINA1, and wherein the SERPINA1 comprises an E342K mutation. In some aspects, the target RNA is LRRK2, and wherein the LRRK2 comprises a G2019S mutation.

[0013] In some aspects, the targeting RNA sequence is at least partially complementary to a splice signal proximal to an exon within the target RNA. In some aspects, the targeting RNA sequence is: (a) at least partially complementary to a branch point upstream of an exon withinthe target RNA; or (b) the targeting RNA sequence is at least partially complementary to a donor splice site downstream of an exon within the target RNA. In some aspects, the mismatch is located from 1 to 200 bases from either end of the targeting RNA sequence. In some aspects, the mismatch is located at least 45 bases from either end of the targeting RNA sequence.

[0014] In some aspects, the polynucleotide of the present disclosure further comprises a DNA sequence encoding a deaminase recruiting domain. In some aspects, the deaminase recruiting domain comprises: GluR2, Alu, or any combination thereof. In some aspects, the deaminase recruiting domain comprises a stem loop. In some aspects, the stem loop comprises at least 80% sequence identity to a GluR2 domain.

[0015] In some aspects, the targeting RNA sequence is at least partially complementary to a 3' or 5' untranslated region (UTR) of the target RNA. In some aspects, the targeting RNA sequence is at least partially complementary to a translation initiation site, a polyadenylation signal, a splice acceptor site, an upstream open reading frame, or a combination thereof. In some aspects, the targeting RNA sequence is at least partially complementary to an intronic region of the target RNA. In some aspects, the targeting RNA sequence is at least partially complementary to an exonic region of the target RNA. In some aspects, the engineered guide RNA is 80 nucleotides to 600 nucleotides.

[0016] In various aspects, the present disclosure provides a vector comprising the polynucleotide of the present disclosure. In some aspects, the vector comprises a liposome, a nanoparticle, or a dendrimer. In some aspects, the vector is a viral vector. In some aspects, the viral vector is an adeno-associated viral (AAV) vector. In some aspects, the AAV is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.OligoOOl, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.Vl, AAV.PHP.B, AAV.PhB.Cl, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, chimeras thereof, and combinations thereof.

[0017] In various aspects, the present disclosure provides a pharmaceutical composition comprising the polynucleotide of the present disclosure or the vector of the present disclosure and a pharmaceutically acceptable excipient, diluent, or carrier.

[0018] In various aspects, the present disclosure provides a method of administering an effective amount of a pharmaceutical composition comprising a polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises: (a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and (b) a DNA sequence encoding a small nuclear RNA (snRNA) processing hairpin comprising a sequence with at least 80% identity to any one of: i) SEQ ID NO: 891, ii) SEQ ID NO: 1115, iii) SEQ ID NO: 1613, or iv) SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708, to a subject.

[0019] In some aspects, the pharmaceutical composition is the pharmaceutical composition of the present disclosure. In some aspects, the administration comprises inhalation, otic, buccal, conjunctival, dental, endocervical, endosinusial, endotracheal, enteral, epidural, extra-amniotic, extracorporeal, hemodialysis, infiltration, interstitial, intraabdominal, intraamniotic, intraarterial, intraarticular, intrabiliary, intrabronchial, intrabursal, intracardiac, intracartilaginous, intracaudal, intracavemous, intracavitary, intracerebroventricular, intracisternal, intracorneal, intracoronal, intracoronary, intracorpous cavernaosum, intradermal, intradiscal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intrahippocampal, intraileal, intralesional, intraluminal, intralymphatic, intramedullary, intrameningeal, intramuscular, intraocular, intraovarian, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratendinous, intratesticular, intrathoracic, intratubular, intratumor, intratympanic, intrauterine, intravascular, intravenous, intravenous bolus, intravenous drip, intravesical, intravitreal, iontophoresis, irrigation, laryngeal, nasal, nasogastric, ophthalmic, oral, oropharyngeal, parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, retrobulbar, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, vaginal, infraorbital, intraparenchymal, intrathecal, intraventricular, stereotactic administration, or any combination thereof.

[0020] In various aspects, the present disclosure provides a method of expressing a targeting RNA sequence in a cell, the method comprising delivering the polynucleotide of the present disclosure, the vector of the present disclosure, or the pharmaceutical composition of the present disclosure to a cell and expressing the targeting RNA sequence encoded by the polynucleotide in the cell.

[0021] In various aspects, the present disclosure provides a method of editing a target RNA, the method comprising: delivering the polynucleotide of the present disclosure, the vector of the present disclosure, or the pharmaceutical composition of the present disclosure to a cell encoding the target RNA; expressing the targeting RNA sequence in the cell, wherein the targeting RNA sequence comprises an engineered guide RNA capable of hybridizing to a target RNA; forming a guide-target RNA scaffold upon hybridization of the targeting RNA sequence to the target RNA; recruiting an editing enzyme to the target RNA; and editing the target RNA with the editing enzyme.

[0022] In various aspects, the present disclosure provides a method of editing a target RNA, the method comprising: delivering a polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises: (a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and (b) a DNA sequence encoding a small nuclear RNA (snRNA) processing hairpin comprising a sequence with at least 80% identity to any one of: i) SEQ ID NO: 891, ii) SEQ ID NO: 1115, iii) SEQ ID NO: 1613, or iv) SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708; expressing the targeting RNA sequence in the cell, wherein the targeting RNA sequence comprises an engineered guide RNA capable of hybridizing to a target RNA; forming a guide -target RNA scaffold upon hybridization of the targeting RNA sequence to the target RNA; recruiting an editing enzyme to the target RNA; and editing the target RNA with the editing enzyme.

[0023] In some aspects, the DNA sequence encoding the snRNA processing hairpin comprises a sequence with at least 85%, at least 90%, or at least 90% identity to any one of SEQ ID NO: 891, SEQ ID NO: 1115, SEQ ID NO: 1613, or SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708. In some aspects, the DNA sequence encoding the snRNA processing hairpin comprises a sequence of any one of SEQ ID NO: 891, SEQ ID NO: 1115, SEQ ID NO: 1613, or SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708. In some aspects, the DNA sequence encoding the snRNA processing hairpin is selected from: a) SEQ ID NO: 891, b) SEQ ID NO: 1115, or c) SEQ ID NO: 1613.

[0024] In various aspects, the present disclosure provides a method of editing a target RNA, the method comprising: delivering a polynucleotide encoding an engineered RNA, wherein thepolynucleotide comprises: (a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and (b) a DNA sequence encoding a snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNA processing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin; expressing the targeting RNA sequence in the cell, wherein the targeting RNA sequence comprises an engineered guide RNA capable of hybridizing to a target RNA; forming a guide-target RNA scaffold upon hybridization of the targeting RNA sequence to the target RNA; recruiting an editing enzyme to the target RNA; and editing the target RNA with the editing enzyme.

[0025] In various aspects, the present disclosure provides a method of editing a target RNA, the method comprising: delivering a polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises: (a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and (b) a DNA sequence encoding a snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNA processing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U7 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin; expressing the targeting RNA sequence in the cell, wherein the targeting RNA sequence comprises an engineered guide RNA capable of hybridizing to a target RNA; forming a guide-target RNA scaffold upon hybridization of the targeting RNA sequence to the target RNA; recruiting an editing enzyme to the target RNA; and editing the target RNA with the editing enzyme.

[0026] In some aspects, the polynucleotide further comprises a DNA sequence encoding an Sm- binding sequence or a DNA sequence encoding a variant Sm-binding sequence. In some aspects, the DNA sequence encoding the Sm-binding sequence comprises a sequence with at least 80% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644. In some aspects, the DNA sequence encoding the Sm-binding sequence comprises a sequence with at least 85%, at least 90%, or at least 90% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644. In some aspects, the DNA sequence encoding the Sm-binding sequence comprises a sequence with at least 85% identity to any one of SEQ ID NO: 1635, SEQ ID NO: 1636, SEQ ID NO: 1639, SEQ ID NO: 1640, SEQ ID NO: 1641, SEQ ID NO: 1642, or SEQ ID NO: 1643.

[0027] In some aspects, the targeting RNA sequence is from 60 bases to 200 bases in length. In some aspects, the target RNA comprises a mutation relative to a wild type sequence. In someaspects, editing the target RNA corrects the mutation in the target RNA. In some aspects, the mutation is a missense mutation. In some aspects, the mutation is a nonsense mutation. In some aspects, the mutation is a G to A mutation.

[0028] In some aspects, the mutation is associated with a disease. In some aspects, the disease is a synucleinopathy, Parkinson’s disease, Lewy body dementia, multiple system atrophy, Charcot- Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, Yuan-Harel- Lupski syndrome, a tauopathy, Alzheimer’s disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn’s disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha- 1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease. In some aspects, the target RNA encodes a-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine rich repeat kinase 2 (LRRK2), Tau (MAPT), progranulin (GRN), a duplication of PMP22 associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette sub-family A member 4 (ABCA4), amyloid precursor protein (APP), alpha- 1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl CpG binding protein 2 (MECP2).

[0029] In some aspects, editing the target RNA comprises editing an untranslated region of the target RNA. In some aspects, the untranslated region is a 5’ untranslated region or a 3’ untranslated region. In some aspects, the 3’ untranslated region is a polyadenylation sequence. In some aspects, editing the target RNA comprises editing a translation initiation site. In some aspects, editing the target RNA alters expression of the target RNA. In some aspects, editing the target RNA increases expression of the target RNA. In some aspects, editing the target RNA decreases expression of the target RNA.

[0030] In some aspects, the engineered guide RNA is capable of recruiting an RNA editing entity to the target RNA when bound to the target RNA. In some aspects, the RNA editing entity comprises an Adenosine deaminase acting on RNA (ADAR) protein, an Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC) protein, or both. In some aspects, the RNA editing entity comprises the ADAR protein and wherein the ADAR protein comprises ADAR1 or ADAR2.

[0031] In various aspects, the present disclosure provides a method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising the polynucleotide of the present disclosure, the vector of the present disclosure, or thepharmaceutical composition of the present disclosure; delivering the polynucleotide to a cell of the subject; and expressing the targeting RNA sequence in the cell, thereby treating the disease.

[0032] In various aspects, the present disclosure provides a method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising a polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises: (a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and (b) a DNA sequence encoding a small nuclear RNA (snRNA) processing hairpin comprising a sequence with at least 80% identity to any one of: i) SEQ ID NO: 891, ii) SEQ ID NO: 1115, iii) SEQ ID NO: 1613, or iv) SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708; delivering the polynucleotide to a cell of the subject; and expressing the targeting RNA sequence in the cell, thereby treating the disease.

[0033] In some aspects, the DNA sequence encoding the snRNA processing hairpin comprises a sequence with at least 85%, at least 90%, or at least 90% identity to any one of SEQ ID NO: 891, SEQ ID NO: 1115, SEQ ID NO: 1613, or SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708. In some aspects, the DNA sequence encoding the snRNA processing hairpin comprises a sequence of any one of SEQ ID NO: 891, SEQ ID NO: 1115, SEQ ID NO: 1613, or SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708. In some aspects, the DNA sequence encoding the snRNA processing hairpin is selected from: a) SEQ ID NO: 891, b) SEQ ID NO: 1115, or c) SEQ ID NO: 1613.

[0034] In various aspects, the present disclosure provides a method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising a polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises: (a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and (b) a DNA sequence encoding a snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNA processing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin; delivering thepolynucleotide to a cell of the subject; and expressing the targeting RNA sequence in the cell, thereby treating the disease.

[0035] In various aspects, the present disclosure provides a method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising a polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises: (a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and (b) a DNA sequence encoding a snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNA processing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U7 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin; delivering the polynucleotide to a cell of the subject; and expressing the targeting RNA sequence in the cell, thereby treating the disease.

[0036] In some aspects, the polynucleotide further comprises a DNA sequence encoding an Sm- binding sequence or a DNA sequence encoding a variant Sm-binding sequence. In some aspects, the DNA sequence encoding the Sm-binding sequence comprises a sequence with at least 80% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644. In some aspects, the DNA sequence encoding the Sm-binding sequence comprises a sequence with at least 85%, at least 90%, or at least 90% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644. In some aspects, the DNA sequence encoding the Sm-binding sequence comprises a sequence with at least 85% identity to any one of SEQ ID NO: 1635, SEQ ID NO: 1636, SEQ ID NO: 1639, SEQ ID NO: 1640, SEQ ID NO: 1641, SEQ ID NO: 1642, or SEQ ID NO: 1643. In some aspects, the targeting RNA sequence is from 60 bases to 200 bases in length.

[0037] In some aspects, the disease is a synucleinopathy, Parkinson’s disease, Lewy body dementia, multiple system atrophy, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, Yuan-Harel-Lupski syndrome, a tauopathy, Alzheimer’s disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn’s disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha- 1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease.

[0038] In some aspects, the targeting RNA sequence comprises an engineered guide RNA that hybridizes to a target RNA, and wherein the cell encodes the target RNA. In some aspects, the target RNA encodes a-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine rich repeat kinase 2 (LRRK2), Tau (MAPT), progranulin (GRN),a duplication of the PMP22 associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP -binding cassette sub-family A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN- induced kinase 1 (PINK1), or methyl CpG binding protein 2 (MECP2).

[0039] In some aspects, the method further comprises forming a guide -target RNA scaffold upon hybridization of the engineered guide RNA to the target RNA, recruiting an editing enzyme to the target RNA, and editing the target RNA with the editing enzyme. In some aspects, the target RNA comprises a mutation relative to a wild type sequence. In some aspects, editing the target RNA corrects the mutation in the target RNA. In some aspects, the mutation is a missense mutation. In some aspects, the mutation is a nonsense mutation. In some aspects, the mutation is a G to A mutation. In some aspects, the mutation is associated with the disease.

[0040] In some aspects, editing the target RNA comprises editing an untranslated region of the target RNA. In some aspects, the untranslated region is a 5’ untranslated region or a 3’ untranslated region. In some aspects, the 3’ untranslated region is a polyadenylation sequence. In some aspects, editing the target RNA comprises editing a translation initiation site. In some aspects, editing the target RNA alters expression of the target RNA. In some aspects, editing the target RNA increases expression of the target RNA. In some aspects, editing the target RNA decreases expression of the target RNA.

[0041] In some aspects, the guide-target RNA scaffold comprises a structural feature. In some aspects, the structural feature is a bulge, a mismatch, an internal loop, a hairpin, or combinations thereof. In some aspects, the structural feature comprises the bulge, and wherein the bulge is a symmetric bulge. In some aspects, the structural feature comprises the bulge, and wherein the bulge is an asymmetric bulge. In some aspects, the structural feature comprises the internal loop, and wherein the internal loop is a symmetric internal loop. In some aspects, the structural feature comprises the internal loop, and wherein the internal loop is an asymmetric internal loop. In some aspects, the structural feature comprises the hairpin, and wherein the hairpin is a recruitment hairpin or a non-recruitment hairpin.

[0042] In some aspects, the guide-target RNA scaffold comprises a Wobble base pair. In some aspects, the editing enzyme comprises an ADAR, an APOBEC, or a Cas nuclease. In some aspects, the ADAR comprises AD ARI, ADAR2, ADAR3, or combinations thereof. In some aspects, the target RNA is a mRNA or a pre-mRNA. In some aspects, editing the target RNA comprises deamidating a nucleotide of the target RNA. In some aspects, the target RNA is edited with an efficiency of at least 10%, at least 20%, or at least 25%.

[0043] In various aspects, the present disclosure provides an engineered RNA, comprising: (a) a targeting sequence with partial or full complementarity to a target RNA; and (b) an snRNA processing hairpin sequence of any one of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 - SEQ ID NO: 1701.

[0044] In various aspects, the present disclosure provides an engineered RNA, comprising: (a) a targeting sequence with partial or full complementarity to a target RNA; and (b) an snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNA processing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin.

[0045] In various aspects, the present disclosure provides an engineered RNA, comprising: (a) a targeting sequence with partial or full complementarity to a target RNA; and (b) an snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNA processing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U7 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin.

[0046] In some aspects, the target RNA is associated with a disease or condition, wherein the disease or condition is selected from the group consisting of: a neurodegenerative disease or disorder, a muscular disease or disorder, a metabolic disease or disorder, an ocular disease or disorder, a liver disease or disorder, a cancer, and any combination thereof. In some aspects, the target RNA is associated with a disease or condition selected from the group consisting of: Rett syndrome, Huntington’s disease, Parkinson’s Disease, Alzheimer’s disease, Stargardt disease, Usher syndrome, a muscular dystrophy, Spinal Muscular Atrophy (SMN), Faciocapulohumeral Muscular Dystrophy (FSHD), Limb Girdle Muscular Dystrophy (LGMD), Amyotrophic Lateral Sclerosis (ALS), Tay-Sachs Disease, Human Immunodeficiency Virus, familial hypercholesterolemia, diabetes, and cancer. In some aspects, the engineered RNA further comprises an SmOPT or SmOPT variant sequence.

[0047] In some aspects, the targeting sequence, upon hybridization to a target RNA, forms a guide-target RNA scaffold comprising a structural feature selected from the group consisting of a mismatch, a bulge, an internal loop, a hairpin, and any combination thereof, wherein the structural feature substantially forms upon hybridization to the target RNA, and wherein the structural feature is not present within the engineered guide RNA prior to the hybridization of the engineered guide RNA to the target RNA. In some aspects, the structural feature comprises the mismatch. In some aspects, the mismatch comprises at least one adenosine-guanosine (A-G) mismatch, at least one adenosine-adenosine (A- A) mismatch, or at least one adenosine-cytidine (A-C), wherein adenosine is present in the target RNA. In some aspects, the mismatch comprisesan A-C mismatch, wherein the adenosine is present in the target RNA. In some aspects, the structural feature comprises the bulge. In some aspects, the bulge comprises an asymmetric bulge. In some aspects, the bulge comprises a symmetric bulge. In some aspects, the structural feature comprises the internal loop. In some aspects, the internal loop comprises an asymmetric internal loop. In some aspects, the internal loop comprises a symmetric internal loop.

[0048] In some aspects, the snRNA processing hairpin is downstream of the targeting sequence. In some aspects, the target RNA is selected from the group consisting of: ABCA4, ALAS1, APP, ATP7B, CFTR, DMD, DMPK, DUX4, GAPDH, GBA, HEXA, HFE, LIPA, LRRK2, MAPT, PCSK9 start site, PINK1, PMP22, SERPINA1, SCNN1A start site, SNCA, or SOD1, a fragment of any one of these, and any combination thereof.BRIEF DESCRIPTION OF THE DRAWINGS

[0049] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

[0050] FIG. 1A provides a schematic of the GFP-reporter assay used for testing the expression and enrichment of vector cassettes in a GFP-G67R cell line.

[0051] FIG. IB provides a bar graph of mCherry + GFP enrichment of vector cassettes with snRNA hairpins in a GFP-G67R cell line.

[0052] FIG. 2A provides a bar graph of mCherry fluorescence from vector cassette enrichment in a GFP-G67R cell line without introns.

[0053] FIG. 2B provides a bar graph of mCherry and GFP fluorescence (measured as the geometric mean fluorescence intensity (gMFI)) in a GFP-G67R cell line from a GFP-reporter assay measuring vector cassette enrichment, expression, and RNA editing.

[0054] FIG. 2C provides a bar graph of the fold change of mCherry and GFP fluorescence as compared to a vector cassette comprising the snRNA hairpin of SEQ ID NO: 803.

[0055] FIG. 2D provides a bar graph of Sanger sequencing to measure the RNA editing by guide RNA expressing vector cassettes in a GFP-G67R cell line from a GFP-reporter assay.

[0056] FIG. 3A provides a bar graph of mCherry fluorescence from vector cassette enrichment in a GFP-G67R cell line with introns.

[0057] FIG. 3B provides a bar graph of mCherry and GFP fluorescence (measured as the geometric mean fluorescence intensity (gMFI)) in a GFP-G67R cell line with introns from a GFP-reporter assay measuring vector cassette enrichment, expression, and RNA editing.

[0058] FIG. 3C provides a bar graph of the fold change of mCherry and GFP fluorescence as compared to a vector cassette comprising the snRNA hairpin of SEQ ID NO: 803.

[0059] FIG. 4A provides a bar graph of mCherry fluorescence from vector cassette enrichment in a GFP-G67R cell line.

[0060] FIG. 4B provides a bar graph of the measured SNCA 3’UTR RNA editing in a GFP- G67R cell line by the guide RNAs expressed by the vector constructs.

[0061] FIG. 4C provides a bar graph of the measured SNCA 3’UTR RNA editing position in a GFP-G67R cell line by the guide RNAs expressed by the vector constructs.

[0062] FIG. 4D provides a bar graph of the measured SNCA 3’UTR RNA editing position in a GFP-G67R cell line by the guide RNAs expressed by the vector constructs.

[0063] FIG. 5A provides a bar graph of RAB7A RNA editing by vector cassettes with Sm- binding hairpin sequences and modified Sm-binding hairpin sequences.

[0064] FIG. 5B provides a bar graph of DMD Exon Skipping RNA editing by vector cassettes with Sm-binding hairpin sequences and modified Sm-binding hairpin sequences.DETAILED DESCRIPTION

[0065] The present disclosure provides small nuclear (snRNA) processing hairpin RNA sequences, where the snRNA processing hairpin RNA sequence can be operably linked to the engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides (ASOs)) of the description. In some embodiments the snRNA processing hairpin RNA sequence can be a U1 hairpin, a U2 hairpin, a U4 hairpin, a U5 hairpin, a U7 hairpin, a U11 hairpin, a U12 hairpin, or a variant of any of these. Said snRNA processing hairpin RNA sequence may be positioned downstream of an SmOPT or SmOPT variant sequence, for example, an altered or variant of an optimized Sm or Sm-like protein binding domain. In some embodiments, the snRNA processing hairpin RNA sequence may be any one of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 - SEQ ID NO: 1701, as shown in TABLE 1. Placement of an snRNA processing hairpin from snRNAs Ul, U2, U4, U5, U7, U11, U12 or alternative sources, may improve both the binding of gemin5 to an engineered RNA (e.g., an engineered guide RNA or ASO) and improve processing and subsequent reimport to the nucleus. Said hairpins may be placed either downstream of, or flanking an SmOPT or SmOPT variant sequence, for example, an altered or variant of an optimized Sm or Sm-like protein binding domain.TABLE 1 - snRNA Processing Hairpin RNA and DNA Sequences

[0066] In some embodiments, an engineered snRNA processing hairpin RNA sequence may comprise a sequence with 80% identity to any one of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 - SEQ ID NO: 1701. In some embodiments, an engineered snRNA processing hairpin RNA sequence may comprise a sequence with 85% identity, 90% identity, or 95% identity to any one of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 - SEQ ID NO: 1701. In some embodiments, an engineered snRNA processing hairpin RNA sequence may comprise a sequence of any one of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 - SEQ ID NO: 1701. In some embodiments, an engineered snRNA processing hairpin RNA sequence may comprise a sequence with 80% identity to SEQ ID NO: 80. In some embodiments, an engineered snRNA processing hairpin RNA sequence may comprise a sequence with 85% identity, 90% identity, or 95% identity to SEQ ID NO: 80. In some embodiments, an engineered snRNA processing hairpin RNA sequence may comprise a sequence of SEQ ID NO: 80. In some embodiments, an engineered snRNA processing hairpin RNA sequence may comprise a sequence with 80% identity to SEQ ID NO: 304. In some embodiments, an engineered snRNA processing hairpin RNA sequence may comprise a sequence with 85% identity, 90% identity, or 95% identity to SEQ ID NO: 304. In some embodiments, an engineered snRNA processing hairpin RNA sequence may comprise a sequence of SEQ ID NO: 304. In some embodiments, an engineered snRNA processing hairpin RNA sequence may comprise a sequence with 80% identity to SEQ ID NO: 802. In some embodiments, an engineered snRNA processing hairpin RNA sequence may comprise a sequence with 85% identity, 90% identity, or 95% identity to SEQ ID NO: 802. In some embodiments, an engineered snRNA processing hairpin RNA sequence may comprise a sequence of SEQ ID NO: 802.

[0067] In some embodiments, an engineered snRNA processing hairpin RNA sequence may be encoded by a DNA sequence comprising a sequence with 80% identity to any one of SEQ ID NO: 812 - SEQ ID NO: 1622 or SEQ ID NO: 1702 - SEQ ID NO: 1708. In some embodiments, an engineered snRNA processing hairpin RNA sequence may be encoded by a DNA sequence comprising a sequence with 85% identity, 90% identity, or 95% identity to any one of SEQ ID NO: 812 - SEQ ID NO: 1622 or SEQ ID NO: 1702 - SEQ ID NO: 1708. In some embodiments, an engineered snRNA processing hairpin RNA sequence may be encoded by a DNA sequence comprising a sequence of SEQ ID NO: 812 - SEQ ID NO: 1622 or SEQ ID NO: 1702 - SEQ ID NO: 1708. In some embodiments, an engineered snRNA processing hairpin RNA sequence may be encoded by a DNA sequence comprising a sequence with 80% identity to SEQ ID NO: 891. In some embodiments, an engineered snRNA processing hairpin RNA sequence may be encoded by a DNA sequence comprising a sequence with 85% identity, 90% identity, or 95% identity to SEQ ID NO: 891. In some embodiments, an engineered snRNA processing hairpin RNA sequence may be encoded by a DNA sequence comprising a sequence of SEQ ID NO: 891. In some embodiments, an engineered snRNA processing hairpin RNA sequence may be encoded by a DNA sequence comprising a sequence with 80% identity to SEQ ID NO: 1115. In some embodiments, an engineered snRNA processing hairpin RNA sequence may be encoded by a DNA sequence comprising a sequence with 85% identity, 90% identity, or 95% identity to SEQ ID NO: 1115. In some embodiments, an engineered snRNA processing hairpin RNA sequence may be encoded by a DNA sequence comprising a sequence of SEQ ID NO: 1115. In some embodiments, an engineered snRNA processing hairpin RNA sequence may be encoded by a DNA sequence comprising a sequence with 80% identity to SEQ ID NO: 1613. In some embodiments, an engineered snRNA processing hairpin RNA sequence may be encoded by a DNA sequence comprising a sequence with 85% identity, 90% identity, or 95% identity to SEQ ID NO: 1613. In some embodiments, an engineered snRNA processing hairpin RNA sequence may be encoded by a DNA sequence comprising a sequence of SEQ ID NO: 1613.Sm-Binding Sequence Elements

[0068] In some embodiments, an engineered RNA (e.g., engineered guide RNA, antisense oligonucleotide) of the disclosure can comprise an RNA element, such as, an Sm-binding sequence. An Sm-binding sequence may be a SmOPT sequence or a SmOPT variant sequence. An SmOPT variant sequence can comprise a polynucleotide substitution or at least one polynucleotide substitution (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11); 11 or fewer (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, 1); or 1-10 (e.g., 2-9, 3-8, 4-7, 5-6) as compared to a wild type, a naturally occurring, or unmodified SmOPT sequence. An Sm-binding sequence (e.g., a SmOPT sequence or SmOPTvariant sequence) may be a Sm-binding sequence from a U1 snRNA, U2 snRNA, U4 snRNA, U5 snRNA, U5A-1 snRNA, U5B-1 snRNA, U7 snRNA, U11 snRNA, or U12 snRNA. In some embodiments, an Sm-binding sequence is a U1 snRNA Sm-binding sequence. Sm-binding sequences may have nucleotide truncation from the 3’ end, the 5’ end, or both. For example, SEQ ID NO: 1630 has a 2 nucleotide truncation on the 3’ end from SEQ ID SEQ ID NO: 1628. RNA and DNA sequences of Sm-binding sequences (e.g., SmOPT sequences or SmOPT variant sequences) of the present disclosure are provided in TABLE 2.TABLE 2 - snRNA Sm-Binding RNA and DNA Sequences

[0069] In some embodiments, an Sm-binding sequence (e.g., an SmOPT sequence or an SmOPT variant sequence) may comprise a sequence with 80% identity to any one of SEQ ID NO: 1623- SEQ ID NO: 1633. In some embodiments, an Sm-binding sequence (e.g., an SmOPT sequence or an SmOPT variant sequence) may comprise a sequence with 85% identity, 90% identity, or 95% identity to any one of SEQ ID NO: 1623 - SEQ ID NO: 1633. In some embodiments, an Sm-binding sequence (e.g., an SmOPT sequence or an SmOPT variant sequence) may comprise a sequence of any one of SEQ ID NO: 1623 - SEQ ID NO: 1633. In some embodiments, an Sm- binding sequence (e.g., an SmOPT sequence or an SmOPT variant sequence) may comprise a sequence with 80% identity to any one of SEQ ID NO: 1624, SEQ ID NO: 1625, SEQ ID NO:1628, SEQ ID NO: 1629, SEQ ID NO: 1630, SEQ ID NO: 1631, or SEQ ID NO: 1632. In some embodiments, an Sm-binding sequence (e.g., an SmOPT sequence or an SmOPT variant sequence) may comprise a sequence with 85% identity, 90% identity, or 95% identity to any one of SEQ ID NO: 1624, SEQ ID NO: 1625, SEQ ID NO: 1628, SEQ ID NO: 1629, SEQ ID NO: 1630, SEQ ID NO: 1631, or SEQ ID NO: 1632. In some embodiments, an Sm-binding sequence (e.g., an SmOPT sequence or an SmOPT variant sequence) may comprise a sequence of any one of SEQ ID NO: 1624, SEQ ID NO: 1625, SEQ ID NO: 1628, SEQ ID NO: 1629, SEQ ID NO: 1630, SEQ ID NO: 1631, or SEQ ID NO: 1632.

[0070] In some embodiments, an Sm-binding sequence (e.g., an SmOPT sequence or an SmOPT variant sequence) may be encoded by a DNA sequence comprising a sequence with 80% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644. In some embodiments, an Sm-binding sequence (e.g., an SmOPT sequence or an SmOPT variant sequence) may be encoded by a DNA sequence comprising a sequence with 85% identity, 90% identity, or 95% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644. In some embodiments, an Sm-binding sequence (e.g., an SmOPT sequence or an SmOPT variant sequence) may be encoded by a DNA sequence comprising a sequence of SEQ ID NO: 1634 - SEQ ID NO: 1644. In some embodiments, an Sm-binding sequence (e.g., an SmOPT sequence or an SmOPT variant sequence) may be encoded by a DNA sequence comprising a sequence with 80% identity to any one of SEQ ID NO: 1635, SEQ ID NO: 1636, SEQ ID NO: 1639, SEQ ID NO: 1640, SEQ ID NO: 1641, SEQ ID NO: 1642, or SEQ ID NO: 1643. In some embodiments, an Sm-binding sequence (e.g., an SmOPT sequence or an SmOPT variant sequence) may be encoded by a DNA sequence comprising a sequence with 85% identity, 90% identity, or 95% identity to any one of SEQ ID NO: 1635, SEQ ID NO: 1636, SEQ ID NO: 1639, SEQ ID NO: 1640, SEQ ID NO: 1641, SEQ ID NO: 1642, or SEQ ID NO: 1643. In some embodiments, an Sm-binding sequence (e.g., an SmOPT sequence or an SmOPT variant sequence) may be encoded by a DNA sequence comprising a sequence of any one of SEQ ID NO: 1635, SEQ ID NO: 1636, SEQ ID NO: 1639, SEQ ID NO: 1640, SEQ ID NO: 1641, SEQ ID NO: 1642, or SEQ ID NO: 1643. snRNA Sm-Binding and Hairpin Sequences

[0071] In some examples, the engineered guide RNA disclosed herein includes (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence); and (c) an engineered snRNA processing U1 hairpin RNA sequence. In some examples, the engineered guide RNA disclosed herein includes (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence); and (c) an engineered snRNA processing U2 hairpin RNA sequence. In some examples, the engineered guide RNA disclosedherein includes (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence); and (c) an engineered snRNA processing U4 hairpin RNA sequence. In some examples, the engineered guide RNA disclosed herein includes (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence); and (c) an engineered snRNA processing U5 hairpin RNA sequence. In some examples, the engineered guide RNA disclosed herein includes (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence); and (c) an engineered snRNA processing U7 hairpin RNA sequence. In some examples, the engineered guide RNA disclosed herein includes (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence); and (c) an engineered snRNA processing U11 hairpin RNA sequence. In some examples, the engineered guide RNA disclosed herein includes (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence); and (c) an engineered snRNA processing U12 hairpin RNA sequence.

[0072] In some examples, the engineered guide RNA disclosed herein includes (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence); and (c) an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 - SEQ ID NO: 1701. In some examples, the polynucleotides disclosed herein include (a) a DNA sequence encoding a targeting sequence; (b) a DNA sequence encoding an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence); and (c) a DNA sequence encoding an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 812 - SEQ ID NO: 1622 or SEQ ID NO: 1702 - SEQ ID NO: 1708.

[0073] In some embodiments, the engineered RNA of the disclosure comprises, from 5’ to 3’ (a) a targeting sequence (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence); and (c) an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 - SEQ ID NO: 1701. In some embodiments, the polynucleotides disclosed herein comprise, from 5 ’ to 3 ’ (a) a DNA sequence encoding a targeting sequence (b) a DNA sequence encoding an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence); and (c) a DNA sequence encoding an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 812 - SEQ ID NO: 1622 or SEQ ID NO: 1702 - SEQ ID NO: 1708.

[0074] In some examples, the engineered guide RNA disclosed herein includes (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of any one of SEQ ID NO: 1623 - SEQ ID NO: 1633; and (c) an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 -SEQ ID NO: 1701. In some examples, the engineered guide RNA disclosed herein includes (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of SEQ ID NO: 1628; and (c) an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 - SEQ ID NO: 1701. In some examples, the engineered guide RNA disclosed herein includes (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of SEQ ID NO: 1629; and (c) an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 - SEQ ID NO: 1701. In some examples, the engineered guide RNA disclosed herein includes (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of SEQ ID NO: 1630; and (c) an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 - SEQ ID NO: 1701. In some examples, the polynucleotides disclosed herein include (a) a DNA sequence encoding a targeting sequence; (b) a DNA sequence encoding an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of any one of SEQ ID NO: 1634 - SEQ ID NO: 1644; and (c) a DNA sequence encoding an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 812 - SEQ ID NO: 1622 or SEQ ID NO: 1702 - SEQ ID NO: 1708. In some examples, the polynucleotides disclosed herein include (a) a DNA sequence encoding a targeting sequence; (b) a DNA sequence encoding an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of SEQ ID NO: 1639; and (c) a DNA sequence encoding an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 812 - SEQ ID NO: 1622 or SEQ ID NO: 1702 - SEQ ID NO: 1708. In some examples, the polynucleotides disclosed herein include (a) a DNA sequence encoding a targeting sequence; (b) a DNA sequence encoding an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of SEQ ID NO: 1640; and (c) a DNA sequence encoding an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 812 - SEQ ID NO: 1622 or SEQ ID NO: 1702 - SEQ ID NO: 1708. In some examples, the polynucleotides disclosed herein include (a) a DNA sequence encoding a targeting sequence; (b) a DNA sequence encoding an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of SEQ ID NO: 1641; and (c) a DNA sequence encoding an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 812 - SEQ ID NO: 1622 or SEQ ID NO: 1702 - SEQ ID NO: 1708.

[0075] In some examples, the engineered guide RNA disclosed herein includes (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of SEQ ID NO: 1630; and (c) an engineered snRNA processing hairpin RNA sequence of SEQ ID NO: 80. In some examples, the polynucleotides disclosed herein include (a) a DNA sequenceencoding a targeting sequence; (b) a DNA sequence encoding an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of SEQ ID NO: 1641; and (c) a DNA sequence encoding an engineered snRNA processing hairpin RNA sequence of SEQ ID NO: 891.

[0076] In some embodiments, the engineered RNA of the disclosure comprises, from 5’ to 3’ (a) a targeting sequence (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of any one of SEQ ID NO: 1623 - SEQ ID NO: 1633; and (c) an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 - SEQ ID NO: 1701. In some embodiments, the polynucleotides disclosed herein comprise, from 5 ’ to 3 ’ (a) a DNA sequence encoding a targeting sequence (b) a DNA sequence encoding an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of any one of SEQ ID NO: 1634 - SEQ ID NO: 1644; and (c) a DNA sequence encoding an engineered snRNA processing hairpin RNA sequence of any one of SEQ ID NO: 812 - SEQ ID NO: 1622 or SEQ ID NO: 1702 - SEQ ID NO: 1708.

[0077] In some examples, the engineered RNA of the disclosure comprises, from 5’ to 3’ (a) a targeting sequence; (b) an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of SEQ ID NO: 1630; and (c) an engineered snRNA processing hairpin RNA sequence of SEQ ID NO: 80. In some embodiments, the polynucleotides disclosed herein comprise, from 5’ to 3’ (a) a DNA sequence encoding a targeting sequence; (b) a DNA sequence encoding an Sm-binding sequence (e.g., a SmOPT sequence or SmOPT variant sequence) of SEQ ID NO: 1641; and (c) a DNA sequence encoding an engineered snRNA processing hairpin RNA sequence of SEQ ID NO: 891.

[0078] Examples of snRNA Sm-binding and hairpin sequences are provided in TABLE 3.TABLE 3 - snRNA Sm-Binding and Hairpin RNA and DNA Sequences

[0079] In some embodiments, an Sm-binding and hairpin sequence may comprise a sequence with 80% identity to any one of SEQ ID NO: 1645 - SEQ ID NO: 1665. In some embodiments, an Sm-binding and hairpin sequence may comprise a sequence with 85% identity, 90% identity, or 95% identity to any one of SEQ ID NO: 1645 - SEQ ID NO: 1665. In some embodiments, an Sm-binding and hairpin sequence may comprise a sequence of any one of SEQ ID NO: 1645 - SEQ ID NO: 1665. In some embodiments, an Sm-binding and hairpin sequence may comprise a sequence with 80% identity to SEQ ID NO: 1655. In some embodiments, an Sm-binding and hairpin sequence may comprise a sequence with 85% identity, 90% identity, or 95% identity to SEQ ID NO: 1655. In some embodiments, an Sm-binding and hairpin sequence may comprise a sequence of SEQ ID NO: 1655.

[0080] In some embodiments, an Sm-binding and hairpin sequence may be encoded by a DNA sequence comprising a sequence with 80% identity to any one of SEQ ID NO: 1666 - SEQ ID NO: 1686. In some embodiments, an Sm-binding and hairpin sequence may be encoded by a DNA sequence comprising a sequence with 85% identity, 90% identity, or 95% identity to any one of SEQ ID NO: 1666 - SEQ ID NO: 1686. In some embodiments, an Sm-binding and hairpin sequence may be encoded by a DNA sequence comprising a sequence of SEQ ID NO: 1666 - SEQ ID NO: 1686. In some embodiments, an Sm-binding and hairpin sequence may be encoded by a DNA sequence comprising a sequence with 80% identity to SEQ ID NO: 1676. In some embodiments, an Sm-binding and hairpin sequence may be encoded by a DNA sequence comprising a sequence with 85% identity, 90% identity, or 95% identity to SEQ ID NO: 1676. In some embodiments, an Sm-binding and hairpin sequence may be encoded by a DNA sequence comprising a sequence of SEQ ID NO: 1676.Engineered RNAs

[0081] The engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides (ASOs)) described here comprise a targeting sequence that can be operably linked to a snRNA processing RNA hairpin sequence. In some embodiments, engineered RNAs described here comprise a targeting sequence that allows the engineered RNA to hybridize to a region of a target RNA or target RNA molecule. In some embodiments, the engineered RNAs (e.g., engineered guideRNAs, antisense oligonucleotides) described here comprise a targeting sequence with sufficient complementary to a target RNA for hybridization of the engineered RNA and target RNA. Various embodiments comprise engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides) comprising a targeting sequence linked to an SmOPT or SmOPT variant sequence and an snRNA processing hairpin.Targeting Sequence

[0082] Engineered RNAs disclosed herein can be engineered or designed in any way suitable for RNA editing or altering RNA interactions, processing, or expression. In some examples, an engineered RNA generally comprises at least a targeting sequence that is capable of hybridizing to or, in some embodiments, a targeting sequence with target complementarity to a region of a target RNA or target RNA molecule, used interchangeably here. A targeting sequence can also be referred to as a “targeting domain” or a “targeting region” and used interchangeably here.

[0083] In some cases, a targeting sequence of an engineered RNA described here allows the engineered RNA to target an RNA sequence through base pairing, such as Watson Crick base pairing. In some examples, the targeting sequence can be located at either the N-terminus or C- terminus of the engineered RNA. In some cases, the targeting sequence can be located at both termini. The targeting sequence can be of any length. In some cases, the targeting sequence can be at least about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or up to about 200 nucleotides in length. In some cases, the targeting sequence can be no greater than about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,I I, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62,63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110,I I I, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or 200 nucleotides in length. In some examples, an engineered RNA (e.g., engineered guide RNA, antisense oligonucleotide) of the disclosure comprises a targeting sequence that can be from about 60 to about 500, from about 60 to about 200, from about 75 to about 100, fromabout 80 to about 200, from about 90 to about 120, or from about 95 to about 115 nucleotides in length. In some examples, an engineered RNA described here comprises a targeting sequence that can be about 100 nucleotides in length.

[0084] In some cases, a targeting domain comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to a target RNA, of sufficient complementarity to a target RNA to hybridize. In some cases, a targeting sequence comprises less than 100% complementarity to a target RNA sequence and can hybridize in part to the target RNA. For example, a targeting sequence and a region of a target RNA that can be bound by the targeting sequence can have a single base mismatch.

[0085] Some embodiments of the disclosure provide an engineered RNA (e.g., engineered guide RNA, antisense oligonucleotide) described here comprising a targeting sequence with complementarity or sufficient complementarity to a target RNA thereby providing partial hybridization or complete hybridization of the targeting sequence and the target RNA that form guide-target RNA scaffold. A “guide-target RNA scaffold,” as disclosed herein, is the resulting double stranded RNA formed upon hybridization of a guide RNA, with latent structure, to a target RNA. A guide-target RNA scaffold has one or more structural features formed within the double stranded RNA duplex upon hybridization. For example, the guide-target RNA scaffold can have one or more features selected from a bulge, mismatch, internal loop, hairpin, or wobble base pair. Various aspects of the disclosure provide targeting sequences having complete complementarity to a target RNA. In some examples, the engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides) of the disclosure comprise a targeting sequence that is substantially complementary to a target RNA. Useful targeting sequences of the disclosure can have sufficient complementarity to a target RNA.

[0086] “Sufficient complementarity” as used here, can mean at least 5 nucleotides (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600); or can mean 600 nucleotides or fewer (e.g., 550, 450, 350, 250, 150, 105, 95, 85, 75, 65, 55, 45, 35, 25, 15, 5) of the engineered RNA are complementary to or has base pairing to a target RNA; can mean 5-600 nucleotides (e.g., 10-550, 15-450, 20-350, 25-250, 30-150, 35-105, 40-95, 45-85, 50-75, 55-65) of the engineered RNA that are complementary to or has base pairing to a target RNA; can mean at least 70% (e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) of the engineered RNA nucleotides are complementary to the target RNA; can mean 100% or less (e.g., 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%); or can mean 70%-100% (e.g., 71%-99%,72%-98%, 73%-97%, 74%-96%, 75%-95%, 76%-94%, 77%-93%, 78%-92%, 79%-91%, 80%- 90%, 81 %-89%, 82%-88%, 83%-87%, 84%-86) of the engineered RNA nucleotides are complementary to the target RNA.

[0087] In some embodiments, a double stranded RNA (dsRNA) substrate is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The resulting dsRNA substrate is also referred to herein as a “guide-target RNA scaffold.” Described herein are “structural features” that can be present in a guide-target RNA scaffold of the present disclosure. Examples of structural features include a mismatch, a bulge (symmetrical bulge or asymmetrical bulge), an internal loop (symmetrical internal loop or asymmetrical internal loop), or a hairpin (a recruiting hairpin or a non-recruiting hairpin, such as the snRNA processing hairpin RNA sequences of the present disclosure). Engineered guide RNAs of the present disclosure can have from 1 to 50 features. Engineered guide RNAs of the present disclosure can have from 1 to 5, from 5 to 10, from 10 to 15, from 15 to 20, from 20 to 25, from 25 to 30, from 30 to 35, from 35 to 40, from 40 to 45, from 45 to 50, from 5 to 20, from 1 to 3, from 4 to 5, from 2 to 10, from 20 to 40, from 10 to 40, from 20 to 50, from 30 to 50, from 4 to 7, or from 8 to 10 features. In some embodiments, structural features (e.g., mismatches, bulges, internal loops) can be formed from latent structure in an engineered latent guide RNA upon hybridization of the engineered latent guide RNA to a target RNA and, thus, formation of a guide-target RNA scaffold. The term “engineered latent guide RNA” refers to an engineered guide RNA that comprises a portion of sequence that, upon hybridization or only upon hybridization to a target RNA, substantially forms at least a portion of a structural feature, other than a single A / C mismatch feature at the target adenosine to be edited. In some embodiments, structural features are not formed from latent structure and are, instead, pre-formed structures (e.g., a GluR2 recruitment hairpin).

[0088] In some embodiments, upon hybridization of the described engineered RNAs (e.g., engineered guide RNA, antisense oligonucleotide) and the described target RNAs, or at least a portion thereof such as the targeting sequence described here, can have one or more structural features (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25); 50 or fewer structural features (e.g., 49, 48, 47, 46, 45, 40, 35, 30, 25, 20, 15, 10, 5, 1); or from 1-50 structural features (e.g., 2-49; 3-48; 4-47; 5-46; 6-45; 7-44; 8-43; 9-42; 10-41; 11-40; 12- 39; 13-38; 14-37; 15-36; 16-35; 17-34; 18-33; 19-32; 20-31; 21-30; 22-29; 23-28; 24-27; 25-26; 1-5; 10-15; 15-20; 20-25; 25-30; 30-35; 35-40; 40-45; 45-50; 5-20; 1-3; 4-5; 2-10; 20-40; 10-40; 20-50; 30-50; 4-7; 8-10), where the one or more structural features is selected from the group consisting of: a bulge, a mismatch, an internal loop, a hairpin, a wobble base pair, and any of combinations thereof.

[0089] In some embodiments, the targeting sequence described here can be formed or configured to have at least one mismatched nucleotide when hybridized to a target RNA. In some examples, a structural feature of the guide-target RNA scaffold formed upon hybridization of the engineered RNA and the target RNA of the disclosure, where the structural feature can comprise a wobble base pair, where the wobble base pair refers to two bases that weakly pair. For example, a wobble base pair of the present disclosure may refer to a G paired with a U.

[0090] Some examples of the disclosure provide the described engineered RNA (e.g., engineered guide RNA, antisense oligonucleotide) comprising a targeting sequence that where, upon hybridization of the targeting sequence to the target RNA, at least one mismatch forms, and the at least one mismatch comprises at least one adenosine-guanosine (A-G) mismatch, at least one adenosine-adenosine (A- A) mismatch, or at least one adenosine-cytidine (A-C), and where the adenosine (A) in the mismatch can be present in the target RNA. In examples of the disclosure, the engineered RNA described can have at least one mismatch comprising an A-C mismatch, where the adenosine in the mismatch can be present in the target RNA. Some embodiments provide for at least one mismatch that can be located from about 1 base to about 200 bases from either end of the targeting sequence.Antisense Oligonucleotide Engineered RNAs

[0091] As disclosed herein, engineered RNAs of the present disclosure, that can be operably linked to a snRNA processing RNA hairpin sequence of the present disclosure, can be antisense oligonucleotides (also referred to as ASOs) comprising short, chemically modified or synthesized single-stranded nucleotides. Some examples are directed to an engineered RNA that can be an antisense oligonucleotide substantially complementary to a target RNA. ASOs are chemically modified or synthesized DNA or RNA that can be substantially or fully complementary to a target sequence and designed or configured to inhibit, cover, mask, or block a target sequence. ASOs can be chemically modified to avoid degradation in view of their short length. ASOs can be DNA or RNA, but the DNA does not encode for the RNA. In some embodiments of the disclosure, the antisense oligonucleotides that are delivered can be RNA itself or DNA encoding for the RNA. Described herein are engineered RNA antisense oligonucleotides modified or altered from RNA found in nature that can modulate or alter RNA interactions, processing, expression, or combinations thereof. In some instances, an ASO designed or configured to inhibit, cover, mask, or block a target sequence of a target RNA promotes exon skipping of an exon in the target sequence. Methods have been used to induce exon skipping of a protein coding transcript. In many cases, a number of proteins such as alpha- synuclein and DMD can be expressed as different splice variants, some of which can beimplicated in disease. It is thought that by promoting exon skipping events, exons containing a mutation implicated in a disease can be bypassed, or a codon reading frame can be restored, thereby facilitating the translation of variants that are sufficient to correct a disease or disorder, or alleviate symptoms of a disease or disorder.Engineered Guide RNAs

[0092] As disclosed herein, an engineered guide RNA of the present disclosure that can be operably linked to a snRNA processing RNA hairpin sequence of the present disclosure can be utilized for editing of a base of a nucleotide of a target RNA. The engineered guide RNAs described comprise a targeting sequence with sufficient complementarity to a target RNA operably linked to an engineered Sm or Sm-like protein binding domain sequence (e.g., an engineered SmOPT sequence) and a snRNA processing hairpin RNA sequence of the present disclosure (e.g., any one of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 - SEQ ID NO: 1701).

[0093] In some examples of the disclosure, the engineered guide RNAs described here can have a length from about 80 nucleotides to about 600 nucleotides (e.g., 90-500, 100-400, 200-300); can have a length of at least about 80 nucleotides or greater (e.g., 85, 95, 150, 250, 350, 450, 550, 600, 650); or can have a length of about 600 nucleotides or fewer (e.g., 575, 525, 475, 425, 375, 325, 275, 225, 175, 125, 115, 110, 105, 95, 90, 85, 80, 75, 70).Circularized Guide RNA

[0094] In some instances, an engineered guide RNA can be circularized. A circularized engineered guide RNA can be produced from a precursor engineered polynucleotide. In some cases, a precursor engineered polynucleotide can be a precursor engineered linear polynucleotide. In some cases, a precursor engineered polynucleotide can be linear. For example, a precursor engineered polynucleotide can be a linear mRNA transcribed from a plasmid. In another example, a precursor engineered polynucleotide can be constructed to be a linear polynucleotide with domains such as a ribozyme domain and a ligation domain that allow for circularization in a cell. The linear polynucleotide with the ligation and ribozyme domains can be transfected into a cell where it can circularize via endogenous cellular enzymes. In some cases, a precursor engineered polynucleotide can be circular. In some cases, a precursor engineered polynucleotide can comprise DNA, RNA or both. In some cases, a precursor engineered polynucleotide can comprise a precursor engineered guide RNA. In some cases, a precursor engineered guide RNA can be used to produce an engineered guide RNA. For example, PCT / US2021 / 034301 provides a description of circular guide RNAs and theirstructures, sequences of circular guide RNAs, and methods of engineering circularized polynucleotide domains, and each of these descriptions in PCT / US2021 / 034301 is herein incorporated by reference.

[0095] In some instances, an engineered guide RNA can be circularized. A circularized engineered guide RNA can be produced from a precursor engineered polynucleotide. In some cases, a precursor engineered polynucleotide can be a precursor engineered linear polynucleotide. In some cases, a precursor engineered polynucleotide can be linear. For example, a precursor engineered polynucleotide can be a linear mRNA transcribed from a plasmid. In another example, a precursor engineered polynucleotide can be constructed to be a linear polynucleotide with domains such as a ribozyme domain and a ligation domain that allow for circularization in a cell. The linear polynucleotide with the ligation and ribozyme domains can be transfected into a cell where it can circularize via endogenous cellular enzymes. In some cases, a precursor engineered polynucleotide can be circular. In some cases, a precursor engineered polynucleotide can comprise DNA, RNA or both. In some cases, a precursor engineered polynucleotide can comprise a precursor engineered guide RNA. In some cases, a precursor engineered guide RNA can be used to produce an engineered guide RNA.Engineered Guide RNAs Having a Recruiting Domain

[0096] In some examples, an engineered guide RNA can comprise a recruiting domain that is formed and present in the absence of hybridization of the engineered guide RNA to a target RNA, where the recruiting domain recruits an RNA editing entity (e.g., adenosine deaminases acting on RNA (ADARs), apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC) domains, or both). A “recruiting domain” can be referred to herein interchangeably as a “recruiting sequence” or a “recruiting region.” In some examples, an engineered guide RNA can be configured to facilitate editing of a base of a nucleotide of a polynucleotide of a region of a target RNA, modulation expression of a polypeptide encoded by the target RNA, or both. In some cases, an engineered guide RNA can be configured to facilitate an editing of a base of a nucleotide or polynucleotide of a region of an RNA by an RNA editing entity. In order to facilitate editing, an engineered guide RNA of the disclosure can be configured to recruit an RNA editing entity. Some embodiments provide for an RNA editing entity comprising an ADAR protein, where the ADAR protein can be selected from the group consisting of an AD ARI (e.g., human or mouse), an ADAR2 (e.g., human or mouse), and any combination thereof. Various RNA editing entity recruiting domains can be utilized. In some examples, a recruiting domain comprises: Glutamate ionotropic receptor AMPA type subunit 2 (GluR2), APOBEC, or Alu. In some embodiments of the disclosure, the RNA editing entity can have anADAR protein, an APOBEC protein, or both. When the RNA editing entity is an ADAR protein, the ADAR protein can be selected from the group consisting of: an AD ARI, an ADAR2, and a combination of AD ARI and ADAR2. Other embodiments can be directed to an RNA editing entity selected from the group consisting of: a human AD ARI, a mouse AD ARI, a human ADAR2, a mouse ADAR2, and any combination thereof.

[0097] In some examples, more than one recruiting domain can be included in an engineered guide RNA of the disclosure. In examples where a recruiting domain can be present, the recruiting domain can be utilized to position the RNA editing entity to effectively react with a target RNA after the targeting sequence, for example an antisense sequence, hybridizes to a target RNA. In some cases, a recruiting domain can allow for transient binding of the RNA editing entity to the engineered guide RNA. In some examples, the recruiting domain allows for permanent binding of the RNA editing entity to the engineered guide RNA. A recruiting domain can be of any length. In some cases, a recruiting domain can be from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60,61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, up to about 80 nucleotides in length. In some cases, a recruiting domain can be no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65,66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or 80 nucleotides in length. In some cases, a recruiting domain can be about 45 nucleotides in length. In some cases, at least a portion of a recruiting domain comprises at least 1 to about 75 nucleotides. In some cases, at least a portion of a recruiting domain comprises about 45 nucleotides to about 60 nucleotides.

[0098] In some embodiments, a recruiting domain comprises a GluR2 sequence or functional fragment thereof. In some cases, a GluR2 sequence can be recognized by an RNA editing entity, such as an ADAR or biologically active fragment thereof. In some embodiments, a GluR2 sequence can be a non-naturally occurring sequence. In some cases, a GluR2 sequence can be modified, for example for enhanced recruitment. In some embodiments, a GluR2 sequence can comprise a portion of a naturally occurring GluR2 sequence and a synthetic sequence.

[0099] In some examples, a recruiting domain comprises a GluR2 sequence, or a sequence having at least about 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity to GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO:1696), a length to: GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO:1697), or both. In some cases, a recruiting domain can comprise at least about 80% sequencehomology to at least about 10, 15, 20, 25, or 30 nucleotides of SEQ ID NO: 1696. In some examples, a recruiting domain can comprise at least about 90%, 95%, 96%, 97%, 98%, or 99% sequence homology to SEQ ID NO: 1696, length to SEQ ID NO: 1697, or combinations thereof.

[0100] Additional RNA editing entity recruiting domains are also contemplated. In an embodiment, a recruiting domain comprises an apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC) domain. In some cases, an APOBEC domain can comprise a non-naturally occurring sequence or naturally occurring sequence. In some embodiments, an APOBEC-domain-encoding sequence can comprise a modified portion. In some cases, an APOBEC-domain-encoding sequence can comprise a portion of a naturally occurring APOBEC- domain-encoding-sequence. In another embodiment, a recruiting domain can be from an Alu domain.

[0101] Any number of recruiting domains can be found in an engineered RNA of the present disclosure. In some examples, at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to about 10 recruiting domains can be included in an engineered RNA. Recruiting domains can be located at any position of an engineered guide RNA. In some cases, a recruiting domain can be on an N- terminus, middle, or C-terminus of a polynucleotide. A recruiting domain can be upstream or downstream of a targeting sequence. In some cases, a recruiting domain flanks a targeting sequence of a guide. A recruiting sequence can comprise all ribonucleotides or deoxyribonucleotides, although a recruiting domain comprising both ribo- and deoxyribonucleotides can in some cases not be excluded.Engineered Guide RNAs with Latent Structure

[0102] In some examples, the engineered guide RNAs disclosed herein can lack a recruiting domain. In some cases, recruitment of the RNA editing entity can be effectuated by the guidetarget RNA scaffold formed by hybridization of the engineered guide RNA and a target RNA. In some examples, the engineered guide RNA, when present in an aqueous solution and not bound to the target RNA molecule, does not comprise structural features that recruit the RNA editing entity (e.g., ADAR, APOBEC, or both). Some embodiments provide for an RNA editing entity comprising an ADAR protein, where the ADAR protein can be selected from the group consisting of an AD ARI (e.g., human or mouse), an ADAR2 (e.g., human or mouse), and any combination thereof. The engineered guide RNA, upon hybridization to a target RNA, forms with the target RNA, one or more structural features that recruits an RNA editing entity (e.g., ADAR).

[0103] In cases where a recruiting sequence can be absent, an engineered guide RNA can still be capable of associating with an RNA editing entity (e.g., ADAR) to facilitate editing of a targetRNA, modulate expression of a polypeptide encoded by a target RNA, or combinations thereof. This can be achieved through features constructed in the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA and the target RNA described here. The term “latent structure” refers to a structural feature that substantially forms only upon hybridization of an engineered guide RNA to a target RNA. For example, the sequence of an engineered guide RNA provides one or more structural features, but these structural features substantially form only upon hybridization to the target RNA, and thus the one or more latent structural features manifest as structural features upon hybridization to the target RNA. Upon hybridization of the engineered guide RNA to the target RNA, the structural feature is formed, and the latent structure provided in the engineered guide RNA is, thus, unmasked. A latent guide RNA as described here refers to an engineered guide RNA that comprises a portion of sequence that, upon hybridization to a target RNA, forms at least a portion of a structural feature, other than a single A / C mismatch feature at the target adenosine to be edited. In some embodiments, the targeting sequence structural features can comprise any one of a: mismatch, symmetrical bulge, asymmetrical bulge, symmetrical internal loop, asymmetrical internal loop, hairpins, wobble base pairs, or any combination thereof.

[0104] Provided herein are engineered guide RNAs and compositions comprising said engineered guide RNAs. In some examples, the engineered guide RNA can be an engineered polynucleotide. For example, in some embodiments, the present disclosure provides for engineered polynucleotides encoding for engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides). In some embodiments, the engineered RNA comprises DNA. In some examples, the engineered RNA comprises modified RNA bases or unmodified RNA bases. In some embodiments, the engineered RNA comprises modified DNA bases or unmodified DNA bases. In some examples, the engineered RNA comprises both DNA and RNA bases.

[0105] In some examples, the engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides) provided here comprise an engineered RNA that can be configured, upon hybridization to a target RNA or at least a portion of the target RNA, to form, at least in part, a guide-target RNA scaffold. In some embodiments, a guide-target RNA scaffold is formed upon hybridization of an engineered RNA (e.g., engineered guide RNA, antisense oligonucleotide) of the present disclosure to a target RNA. A guide-target RNA scaffold can have structural features formed within a double stranded RNA duplex. For example, the guide-target RNA scaffold can have at least one structural feature, or two or more structural features selected from the group consisting of a mismatch, a bulge (e.g., symmetrical bulge or asymmetrical bulge), an internal loop (e.g., symmetrical internal loop or asymmetrical internal loop), a hairpin (e.g., a recruiting hairpin or a hairpin comprising a non-targeting domain), a wobble base pair, and anycombination thereof, where the guide -target RNA scaffold recruits an RNA editing entity and facilitates a chemical modification of a base of a nucleotide in the target RNA by the RNA editing entity.

[0106] Described herein can be a structural feature that can be present in a guide-target RNA scaffold of the present disclosure. The guide -target RNA scaffold can be formed upon hybridization of an engineered guide RNA and a target RNA, and the scaffold can have at least one or two or more structural features. Examples of structural features include a mismatch, a bulge (symmetrical bulge or asymmetrical bulge), an internal loop (symmetrical internal loop or asymmetrical internal loop), or a hairpin (a hairpin comprising a non-targeting domain), or wobble base pair. Engineered guide RNAs of the present disclosure can have from 1 to 50 features. Engineered guide RNAs of the present disclosure can have from 1 to 5, from 5 to 10, from 10 to 15, from 15 to 20, from 20 to 25, from 25 to 30, from 30 to 35, from 35 to 40, from 40 to 45, from 45 to 50, from 5 to 20, from 1 to 3, from 4 to 5, from 2 to 10, from 20 to 40, from 10 to 40, from 20 to 50, from 30 to 50, from 4 to 7, or from 8 to 10 features. As disclosed herein, a “structured motif’ refers to a combination of or comprises two or more features in a guidetarget RNA scaffold.

[0107] In some examples, a double stranded RNA (dsRNA) substrate (a guide -target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. As disclosed herein, a “mismatch,” as used here, refers to a single nucleotide in an engineered RNA (e.g., engineered guide RNA, ASO) of the disclosure that is unpaired to an opposing single nucleotide in a target RNA within the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA of the present disclosure and the target RNA. A mismatch can comprise any two single nucleotides that do not base pair. Where the number of participating nucleotides on the guide RNA side and the target RNA side exceeds 1 , the resulting structure is no longer considered a mismatch, but rather, is considered a bulge or an internal loop, depending on the size of the structural feature. In some embodiments, a mismatch can be an A / C mismatch, an A / G mismatch, or an A / A mismatch. For example, an A / C mismatch can comprise a C in an engineered RNA (e.g., engineered guide RNA, ASO) of the present disclosure opposite an A in a target RNA. An A / C mismatch can comprise an A in an engineered RNA (e.g., engineered guide RNA, ASO) of the present disclosure opposite a C in a target RNA. For example, a G / G mismatch can comprise a G in an engineered RNA (e.g., engineered guide RNA, ASO) of the present disclosure opposite a G in a target RNA. In some embodiments, a mismatch positioned 5 ' of the edit site can facilitate base-flipping of the A of the target RNA (or target A) to be edited. A mismatch can also assist in conferring sequencespecificity. Thus, a mismatch can be a structural feature formed from a latent structure provided by an engineered latent guide RNA. In some embodiments, a mismatch comprises an A / C mismatch, wherein the A can be in the target RNA and the C can be in the targeting sequence of the engineered RNA (e.g., engineered guide RNA, antisense oligonucleotide). In another embodiment, the A in the A / C mismatch can be the base of the nucleotide in the target RNA edited by an RNA editing entity.

[0108] A double stranded RNA (dsRNA) substrate (a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. In some aspects, a “bulge” refers to the structure substantially formed only upon formation of the guide-target RNA scaffold, where contiguous nucleotides in either the engineered guide RNA of the disclosure or the target RNA are not complementary to their positional counterparts on the opposite strand. A bulge can change the secondary or tertiary structure of the guide-target RNA scaffold. A bulge can have from 0 to 4 contiguous nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1 to 4 contiguous nucleotides on the target RNA side of the guide-target RNA scaffold or a bulge can have from 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 to 4 contiguous nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. However, a bulge, as used herein, does not refer to a structure where a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA do not base pair - a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA that do not base pair is referred to herein as a mismatch. Further, where the number of participating nucleotides on either the engineered guide RNA side or the target RNA side exceeds 4, the resulting structure is no longer considered a bulge, but rather, is considered an internal loop. In some embodiments, the guide-target RNA scaffold of the present disclosure has 2 bulges. In some embodiments, the guide-target RNA scaffold of the present disclosure has 3 bulges. In some embodiments, the guide-target RNA scaffold of the present disclosure has 4 bulges. Thus, a bulge can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0109] In some embodiments, the presence of a bulge in a guide-target RNA scaffold can position or can help to position ADAR to selectively edit the target A in the target RNA and reduce off-target editing of non-target A(s) in the target RNA. In some examples, the presence of a bulge in a guide-target RNA scaffold can recruit or help recruit additional amounts of ADAR proteins (e.g., mouse or human AD ARI, mouse or human ADAR2, or any combination thereof). Bulges in guide -target RNA scaffolds disclosed here can recruit other proteins, such as other RNA editing entities (e.g., an Apolipoprotein B mRNA Editing Catalytic Polypeptide-like(APOBEC), or both an ADAR and an APOBEC). In some embodiments, a bulge positioned 5 ' of the edit site can facilitate base-flipping of the target “A” of the target RNA to be edited. A bulge can also assist in conferring sequence specificity for the A of the target RNA to be edited, relative to other A(s) present in the target RNA. For example, a bulge can assist in directing ADAR editing by constraining it in an orientation that yields selective editing of the target A of the target RNA.

[0110] In some aspects, a guide-target RNA scaffold is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. A bulge of the disclosure can be a symmetrical bulge or an asymmetrical bulge. A “symmetrical bulge” is formed when the same number of nucleotides is present on each side of the bulge. For example, a symmetrical bulge in a guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetrical bulge of the present disclosure can be formed by 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical bulge of the present disclosure can be formed by 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical bulge of the present disclosure can be formed by 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guidetarget RNA scaffold. Thus, a symmetrical bulge can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0111] In some examples, a double stranded RNA (dsRNA) substrate (a guide -target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. A bulge can be a symmetrical or an asymmetrical bulge. An “asymmetrical bulge” is formed when a different number of nucleotides is present on each side of the bulge. For example, an asymmetrical bulge in a guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. In some embodiments, an asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1 nucleotide on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNAscaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosurecan be formed by 2 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 3 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, an asymmetrical bulge can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0112] In some examples, a double stranded RNA (dsRNA) substrate (a guide -target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. As disclosed here, an “internal loop” refers to the structure substantially formed upon formation of the guide-target RNA scaffold, where nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts on the opposite strand and where one side of the internal loop, either on the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold, has 5 nucleotides or more. Where the number of participating nucleotides on both the engineered guide RNA side and the target RNA side drops below 5, the resulting structure is no longer considered an internal loop, but rather, is considered a bulge or a mismatch, depending on the size of the structural feature. An internal loop can be a symmetrical internal loop or an asymmetrical internal loop. Internal loops present in the vicinity of the edit site can assist with base flipping of the target A in the target RNA to be edited.

[0113] In some aspects, a guide-target RNA scaffold can be formed upon hybridization of an engineered RNA (e.g., engineered guide RNA, antisense oligonucleotides) of the present disclosure to a target RNA. One side of the internal loop, either on the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold, can be formed by from 5 to 150 nucleotides. One side of the internal loop can be formed by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 120, 135, 140, 145, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1,000 nucleotides, or any number of nucleotides therebetween. One side of the internal loop can be formed by 5 nucleotides. One side of the internal loop can be formed by 10 nucleotides. One side of the internal loop can be formed by 15 nucleotides. One side of the internal loop can be formed by 20 nucleotides. One side of the internal loop can be formed by 25 nucleotides. One side of the internal loop can be formed by 30 nucleotides. One side of the internal loop can be formed by 35 nucleotides. One side of the internal loop can be formed by 40 nucleotides. Oneside of the internal loop can be formed by 45 nucleotides. One side of the internal loop can be formed by 50 nucleotides. One side of the internal loop can be formed by 55 nucleotides. One side of the internal loop can be formed by 60 nucleotides. One side of the internal loop can be formed by 65 nucleotides. One side of the internal loop can be formed by 70 nucleotides. One side of the internal loop can be formed by 75 nucleotides. One side of the internal loop can be formed by 80 nucleotides. One side of the internal loop can be formed by 85 nucleotides. One side of the internal loop can be formed by 90 nucleotides. One side of the internal loop can be formed by 95 nucleotides. One side of the internal loop can be formed by 100 nucleotides. One side of the internal loop can be formed by 110 nucleotides. One side of the internal loop can be formed by 120 nucleotides. One side of the internal loop can be formed by 130 nucleotides. One side of the internal loop can be formed by 140 nucleotides. One side of the internal loop can be formed by 150 nucleotides. One side of the internal loop can be formed by 200 nucleotides. One side of the internal loop can be formed by 250 nucleotides. One side of the internal loop can be formed by 300 nucleotides. One side of the internal loop can be formed by 350 nucleotides. One side of the internal loop can be formed by 400 nucleotides. One side of the internal loop can be formed by 450 nucleotides. One side of the internal loop can be formed by 500 nucleotides. One side of the internal loop can be formed by 600 nucleotides. One side of the internal loop can be formed by 700 nucleotides. One side of the internal loop can be formed by 800 nucleotides. One side of the internal loop can be formed by 900 nucleotides. One side of the internal loop can be formed by 1,000 nucleotides. Thus, an internal loop can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0114] In some embodiments, a double stranded RNA (dsRNA) substrate (a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. An internal loop can be a symmetrical internal loop or an asymmetrical internal loop. A “symmetrical internal loop” can be formed when the same number of nucleotides is present on each side of the internal loop. For example, a symmetrical internal loop in a guidetarget RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. In some examples described here, a symmetrical internal loop of the present disclosure can be formed from 5 to 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and from 5 to 150 nucleotides on the target RNA side of the guide-target RNA scaffold, where the number of nucleotides is the same on the engineered guide RNA side of the guide-target RNA scaffold and on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed from 5 to 1000 nucleotides on the engineered guide RNA side of the dsRNA target and from 5 to 1000 nucleotides on the targetRNA side of the guide-target RNA scaffold, wherein the number of nucleotides is the same on the engineered guide RNA side of the guide-target RNA scaffold and on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 5 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 15 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 15 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 20 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 20 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 30 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 30 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 40 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 40 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 50 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 60 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 60 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 70 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 70 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internalloop of the present disclosure can be formed by 80 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 80 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 90 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 90 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 100 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 110 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 110 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 120 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 120 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 130 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 130 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 140 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 140 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 150 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 200 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 250 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 250 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 300 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 350 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 350 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 400 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 450 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 450 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internalloop of the present disclosure can be formed by 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 500 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 600 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 600 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 700 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 700 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 800 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 800 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 900 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 900 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 1,000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1,000 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a symmetrical internal loop can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0115] Some examples of the disclosure provide a guide-target RNA scaffold that can be formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. An internal loop can be a symmetrical internal loop or an asymmetrical internal loop. An “asymmetrical internal loop” is formed when a different number of nucleotides is present on each side of the internal loop. For example, an asymmetrical internal loop in a guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. In some aspects, an asymmetrical internal loop of the present disclosure can be formed by from 5 to 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and from 5 to 150 nucleotides on the target RNA side of the guide-target RNA scaffold, where the number of nucleotides is different on the engineered guide RNA side of the guide-target RNA scaffold than the number of nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed from 5 to 1,000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and from 5 to 1,000 nucleotides on the target RNA side of the guide-target RNA scaffold, where the number of nucleotides is different on the engineered guide RNA side of the guide-target RNA scaffold than the number of nucleotides on the target RNA side of the guide-target RNA scaffold. In some examples, an asymmetrical internal loop of the present disclosure can be formed by 5nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 6 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the presentdisclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the presentdisclosure can be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 9 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the presentdisclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guidetarget RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guidetarget RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop ofthe present disclosure can be formed by 300 nucleotides on the target RNA side of the guidetarget RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guidetarget RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guidetarget RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guidetarget RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guidetarget RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guidetarget RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop ofthe present disclosure can be formed by 200 nucleotides on the target RNA side of the guidetarget RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guidetarget RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guidetarget RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guidetarget RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guidetarget RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop ofthe present disclosure can be formed by 200 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guidetarget RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guidetarget RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guidetarget RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop ofthe present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. Thus, an asymmetrical internal loop can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0116] Some embodiments provide a guide-target RNA scaffold formed upon hybridization of an engineered guide RNA of the present disclosure and a target RNA, where a structural feature can be present in the guide-target RNA scaffold of the present disclosure, and the structural feature can be a hairpin. In some cases, an engineered guide RNA of the disclosure can lack a hairpin domain. In other cases, an engineered guide RNA described here can contain a hairpin domain or more than one hairpin domain. A “hairpin” as described here includes an RNA duplex, where a portion of a single RNA strand has folded in upon itself to form the RNA duplex. The portion of the single RNA strand folds upon itself due to having nucleotide sequences that base pair to each other, where the nucleotide sequences are separated by an intervening sequence that does not base pair with itself, thus forming a base-paired portion and non-base-paired, intervening loop portion. A hairpin can have from 10 to 500 nucleotides in length of the entire duplex structure. The loop portion of a hairpin can be from 3 to 15 nucleotides long. A hairpin can be present in any of the engineered guide RNAs disclosed here. The engineered guide RNAs disclosed here can have from 1 to 10 hairpins. In some embodiments, the engineered guide RNAs disclosed here can have 1 hairpin. In some embodiments, the engineered guide RNAs disclosed here can have 2 hairpins. As disclosed here, a hairpin can refer to a recruitment hairpin or a hairpin or a non-recruitment hairpin. A hairpin can be located anywhere within the engineered guide RNAs of the present disclosure. In some embodiments, one or more hairpins is proximal to or present at the 3 ' end of an engineered RNA of the present disclosure, proximal to or at the 5 ' end of an engineered guide RNAs of the present disclosure, or any combination thereof.

[0117] In some examples, a “recruitment hairpin,” as disclosed here, can recruit at least in part an RNA editing entity, such as ADAR. In some embodiments, a recruitment hairpin can be formed and present in the absence of binding to a target RNA. In some embodiments, a recruitment hairpin is a GluR2 domain or portion thereof. In some embodiments, a recruitmenthairpin is an Alu domain or portion thereof. A recruitment hairpin, as defined here, can include a naturally occurring ADAR substrate or truncations thereof. Thus, a recruitment hairpin such as GluR2 is a pre-formed structural feature that may be present in constructs comprising an engineered guide RNA, not a structural feature formed by latent structure provided in an engineered latent guide RNA

[0118] In some aspects, a “non-recruitment hairpin,” as disclosed here, does not have a primary function of recruiting an RNA editing entity. A non-recruitment hairpin, in some instances, does not recruit an RNA editing entity. A non-recruitment hairpin can exhibit functionality that improves localization of the engineered guide RNA to the target RNA. In some embodiments, the non-recruitment hairpin improves nuclear retention. In some embodiments, the non- recruitment hairpin comprises a hairpin from an snRNA processing hairpin of the present disclosure. Thus, a non-recruitment hairpin such as a hairpin from an snRNA processing hairpin of the present disclosure is a pre-formed structural feature that may be present in constructs comprising engineered guide RNA constructs, not a structural feature formed by latent structure provided in an engineered latent guide RNA.

[0119] A hairpin of the present disclosure can be of any length. In some aspects, a hairpin can be from about 10-500 or more nucleotides. In some cases, a hairpin can comprise about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37,38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89,90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111,112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130,131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149,150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168,169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187,188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206,207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225,226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244,245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263,264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282,283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301,302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320,321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339,340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358,359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377,378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396,397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415,416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434,435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453,454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472,473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491,492, 493, 494, 495, 496, 497, 498, 499, 500 or more nucleotides. In other cases, a hairpin can also comprise 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100, 10 to 110, 10 to 120, 10 to 130, 10 to 140, 10 to 150, 10 to 160, 10 to 170, 10 to 180, 10 to190, 10 to 200, 10 to 210, 10 to 220, 10 to 230, 10 to 240, 10 to 250, 10 to 260, 10 to 270, 10 to280, 10 to 290, 10 to 300, 10 to 310, 10 to 320, 10 to 330, 10 to 340, 10 to 350, 10 to 360, 10 to370, 10 to 380, 10 to 390, 10 to 400, 10 to 410, 10 to 420, 10 to 430, 10 to 440, 10 to 450, 10 to460, 10 to 470, 10 to 480, 10 to 490, or 10 to 500 nucleotides.

[0120] In other aspects, a structural feature described here comprises a wobble base. A “wobble base pair” refers to two bases that weakly base pair. For example, a wobble base pair of the present disclosure can refer to a G paired with a U. Thus, a wobble base pair can be a structural feature formed from latent structure provided by an engineered latent guide RNA.RNA Editing

[0121] RNA editing can refer to a process by which RNA can be enzymatically modified post synthesis at specific nucleosides. RNA editing can comprise any one of an insertion, deletion, or substitution of a nucleotide(s). Examples of RNA editing include chemical modifications, such as pseudouridylation (the isomerization of uridine residues) and deamination (removal of an amine group from cytidine to give rise to uridine, or C-to-U editing or from adenosine to inosine, or A-to-I editing). RNA editing can be used to introduce mutations, correct missense mutations, or edit coding or non-coding regions of RNA to inhibit RNA translation and effect protein knockdown. In some instances, inhibiting, covering, masking, or blocking a target sequence in a target RNA using an engineered RNA of the present disclosure can be used to knock down expression of protein translated from the target RNA.

[0122] In some instances, RNA editing entities, such as but not limited to ADARs, can be enzymes that catalyze the chemical conversion of adenosines to inosines in RNA. Because the properties of inosine mimic those of guanosine (inosine will form two hydrogen bonds with cytosine, for example), inosine can be recognized as guanosine by the translational cellular machinery. “Adenosine-to-inosine (A-to-I) RNA editing”, therefore, effectively changes the primary sequence of RNA targets. In general, ADAR enzymes share a common domainarchitecture comprising a variable number of amino-terminal dsRNA binding domains (dsRBDs) and a single carboxy-terminal catalytic deaminase domain. Human ADARs possess two or three dsRBDs. Evidence suggests that ADARs can form homodimer as well as heterodimer with other ADARs when bound to double-stranded RNA, however it can be currently inconclusive if dimerization is needed for editing to occur. The engineered guide RNAs disclosed herein can facilitate RNA editing by any of or any combination of catalytically active human ADARs (e.g., AD ARI or ADAR2). ADARs have a typical modular domain organization that includes at least two copies of a dsRNA binding domain (dsRBD; AD ARI with three dsRBDs; ADAR2 and ADAR3 each with two dsRBDs) in their N-terminal region followed by a C-terminal deaminase domain. The engineered guide RNAs of the present disclosure facilitate RNA editing by endogenous ADAR enzymes. In some embodiments, exogenous ADAR can be delivered alongside the engineered guide RNAs disclosed herein.

[0123] As provided herein, an engineered guide RNA can comprise a targeting sequence with target complementarity to a target RNA of interest. Hybridization of the target RNA to the targeting sequence of an engineered guide RNA can provide a structural feature that is a substrate for ADAR-editing. Accordingly, engineered guide RNA as provided herein can site- specifically bind targets and facilitate targeted editing of target RNA. Further, an engineered guide RNA as described herein can comprise two additional sequences that, when present, increase an amount or efficiency of editing. First, an engineered guide RNA can comprise a Sm or Sm-like binding domain sequence. Second, an engineered guide RNA can comprise an snRNA hairpin from Ul, U2, U4, U5, U7, U11, U12 (e.g., any of SEQ ID NO: 1 - SEQ ID NO: 811 or SEQ ID NO: 1698 - SEQ ID NO: 1701, as shown in TABLE 1). Without wishing to be bound by theory, the presence of one of both of these features can improve localization of the engineered guide RNA to the target RNA.

[0124] The described engineered guide RNAs of the disclosure can further be operably linked to an RNA polymerase Il-type promoter in some embodiments (e.g., Ul, U6, or U7 promoters).Target RNAs and Mutations

[0125] In various embodiments described here, engineered RNAs provided here (e.g., engineered guide RNA, ASO) can comprise a targeting sequence having substantial complementarity to a target RNA and an snRNA processing hairpin sequence, where the engineered guide RNAs of the disclosure are useful as therapeutics for treating subjects suffering from a disease or condition, where the subject can have a target RNA comprising a mutation or a target RNA in need of a mutation.

[0126] In some examples of the disclosure, a method of treating (including preventing, reducing, or ameliorating) a subject suffering from a disease or a condition or symptoms of the disease or the condition, comprises administering to the subject, a therapeutic that facilitates editing of a target RNA. In some embodiments, editing the target RNA can facilitate correction of a mutation. For example, an engineered RNA of the present disclosure can facilitate an edit of an adenosine present in the mutation to an inosine (read as guanosine). By targeting RNAs with a G to A point mutations, engineered RNAs of the present disclosure can correct the mutation by utilizing ADAR1 or AD AR2 -mediated editing of the mutation directly. In some cases, a mutation can be corrected through exon skipping as described herein. An engineered RNA as described herein (e.g., engineered guide RNA, ASO) can facilitate an edit of an adenosine via AD ARI or ADAR2 that facilitates skipping of an exon harboring a particular mutation, thereby restoring functional protein. In some instances, an engineered RNA of the present disclosure (e.g., engineered guide RNA, ASO) can be designed or configured to inhibit, cover, mask, or block a target sequence harboring a mutation in a target RNA, thereby promoting exon skipping of the mutation in the target RNA in the absence of ADAR meditated editing. In some instances, an engineered RNA of the present disclosure can facilitate editing a target adenosine and can inhibit, cover, mask, or block a target sequence, both of which inducing exon skipping of a mutation in a target RNA.

[0127] The mutation may be a missense mutation or a nonsense mutation. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate multiple RNA edits of a target RNA. By “mutation” as used herein, refers to an alteration to a nucleic acid sequence encoding a protein relative to the consensus sequence of said protein. “Missense” mutations result in the substitution of one codon for another; “nonsense” mutations change a codon from one encoding a particular amino acid to a stop codon. Nonsense mutations often result in truncated translation of proteins. “Silent” mutations are those which have no effect on the resulting protein. As used herein the term “point mutation” refers to a mutation affecting only one nucleotide in a gene sequence. “Splice site mutations” are those mutations present pre- mRNA (prior to processing to remove introns) resulting in mistranslation and often truncation of proteins from incorrect delineation of the splice site. A mutation can comprise a single nucleotide variation (SNV). A mutation can comprise a sequence variant, a sequence variation, a sequence alteration, or an allelic variant. The reference DNA sequence can be obtained from a reference database. A mutation can affect function. A mutation may not affect function. A mutation can occur at the DNA level in one or more nucleotides, at the ribonucleic acid (RNA) level in one or more nucleotides, at the protein level in one or more amino acids, or any combination thereof. The reference sequence can be obtained from a database such as the NCBIReference Sequence Database (RefSeq) database. Specific changes that can constitute a mutation can include a substitution, a deletion, an insertion, an inversion, or a conversion in one or more nucleotides or one or more amino acids. A mutation can be a point mutation. A mutation can be a fusion gene. A fusion pair or a fusion gene can result from a mutation, such as a translocation, an interstitial deletion, a chromosomal inversion, or any combination thereof. A mutation can constitute variability in the number of repeated sequences, such as triplications, quadruplications, or others. For example, a mutation can be an increase or a decrease in a copy number associated with a given sequence (copy number variation, or CNV). A mutation can include two or more sequence changes in different alleles or two or more sequence changes in one allele. A mutation can include two different nucleotides at one position in one allele, such as a mosaic. A mutation can include two different nucleotides at one position in one allele, such as a chimeric. A mutation can be present in a malignant tissue. A presence or an absence of a mutation can indicate an increased risk to develop a disease or condition. A presence or an absence of a mutation can indicate a presence of a disease or condition. A mutation can be present in a benign tissue. Absence of a mutation can indicate that a tissue or sample is benign. As an alternative, absence of a mutation may not indicate that a tissue or sample is benign. Methods as described herein can comprise identifying a presence of a mutation in a sample.

[0128] In some instances, an engineered RNA of the present disclosure (e.g., engineered guide RNA, ASO) can be designed or configured to inhibit, cover, mask, or block a target sequence in a target RNA, thereby knocking down expression of protein translated from the target RNA. In some embodiments, an engineered RNA described herein (e.g., engineered guide RNA or ASO) can introduce a mutation in order to produce protein knockdown. Protein knockdown can also be referred to as reduced expression of wild-type protein. Engineered guide RNAs of the present disclosure can target one or any combination of a translation initiation site (TIS), an untranslated region such as a 5’ UTR, a polyadenylation (poly A) signal site, or a splice site.

[0129] In some embodiments, an engineered RNA of the present disclosure (e.g., engineered guide RNA, ASO) can be used to target any of the following genes for RNA editing: ABCA4, APP, DMPK, DUX4, DMD, GRN, LRRK2, MAPT, PMP22, SERPINA1, SNCA, SOD1.Delivery Vehicles

[0130] Other embodiments of the disclosure can provide for a delivery vehicle comprising any of the engineered RNAs (e.g., engineered guide RNAs, ASOs) of the disclosure comprising a targeting sequence having substantial complementarity to a target RNA and an snRNA processing hairpin of the present disclosure. Non-limiting examples of useful delivery vehicles include: a vector, a liposome, a particle, a dendrimer, and any combination thereof. Anengineered RNA (e.g., engineered guide RNA, ASO) of the present disclosure or polynucleotide encoding such engineered RNA of the disclosure can be delivered to a subject or at least one cell of a subject via a delivery vehicle. In some embodiments, the delivery vehicle is a vector. A vector can facilitate delivery of an engineered RNA into a cell to genetically modify the cell. In some examples, the vector comprises DNA, such as double stranded or single stranded DNA. In some examples, the delivery vector can be a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector or plasmid), a viral vector, or any combination thereof. In some embodiments, the vector is an expression cassette. In some embodiments, a viral vector comprises a viral capsid, an inverted terminal repeat sequence, and the engineered RNA (e.g., engineered guide RNA, ASO) or polynucleotide encoding the engineered RNA (e.g., engineered guide RNA, ASO) of the disclosure can be used to deliver the engineered RNA (e.g., engineered guide RNA, ASO) to a cell.

[0131] In some embodiments, the viral vector can be a retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, an alphavirus vector, a lentivirus vector (e.g., human or porcine), a Herpes virus vector, an Epstein-Barr virus vector, an SV40 virus vectors, a pox virus vector, or any combination thereof. In some embodiments, the viral vector can be a recombinant vector, a hybrid vector, a chimeric vector, a self-complementary vector, a single-stranded vector, or any combination thereof.

[0132] Some embodiments can provide for a viral vector delivery vehicle, where the viral vector can be an adeno-associated viral (AAV) vector or derivative thereof, where the AAV vector, derivative thereof, or a hybrid of the AAV vector or derivative thereof, can be selected from a group of viral vector serotypes consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAVhu68, a derivative of any of these, and a hybrid of any of these. In some embodiments, the AAV vector or derivative thereof can be selected from a group consisting of: a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, and any combination thereof.

[0133] In some embodiments, the AAV vector can be a recombinant vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, a single-stranded AAV, or any combination thereof.-I l l-

[0134] In some embodiments, the AAV vector can be a recombinant AAV (rAAV) vector. Methods of producing recombinant AAV vectors generally involve, in some cases, introducing into a producer cell line: (1) DNA necessary for AAV replication and synthesis of an AAV capsid, (b) one or more helper constructs comprising the viral functions missing from the AAV vector, (c) a helper virus, and (d) the plasmid construct containing the genome of the AAV vector, e.g., ITRs, promoter and engineered RNA sequences, etc. In some examples, the viral vectors described herein can be engineered through synthetic or other suitable means by references to published sequences, such as those that may be available in the literature. For example, the genomic and protein sequences of various serotypes of AAV, as well as the sequences of the native terminal repeats (TRs), Rep proteins, and capsid subunits can be found in the literature or in public databases such as GenBank or Protein Data Bank (PDB).

[0135] In some examples, methods of producing delivery vectors herein comprising packaging an engineered RNA of the present disclosure (e.g., a polynucleotide encoding for an engineered RNA) in an AAV vector. In some examples, methods of producing the delivery vectors described herein comprise, (a) introducing into a cell: (i) a polynucleotide comprising a promoter and an engineered RNA payload disclosed herein; and (ii) a viral genome comprising a Replication (Rep) gene and Capsid (Cap) gene that encodes a wild-type AAV capsid protein or modified version thereof; (b) expressing in the cell the wild-type AAV capsid protein or modified version thereof; (c) assembling an AAV particle; and (d) packaging the payload disclosed herein in the AAV particle, thereby generating an AAV delivery vector. In some examples, the recombinant vectors comprise one or more inverted terminal repeats and the inverted terminal repeats comprise a 5 ' inverted terminal repeat, a 3 ' inverted terminal repeat, and a mutated inverted terminal repeat. In some examples, the mutated terminal repeat lacks a terminal resolution site, thereby enabling formation of a self-complementary AAV.

[0136] In some examples, a hybrid AAV vector can be produced by transcapsidation, e.g., packaging an inverted terminal repeat (ITR) from a first serotype into a capsid of a second serotype, wherein the first and second serotypes may not be the same. In some examples, the Rep gene and ITR from a first AAV serotype (e.g., AAV2) can be used in a capsid from a second AAV serotype (e.g., AAV 5 or AAV9), wherein the first and second AAV serotypes may not be the same. As a non-limiting example, a hybrid AAV serotype comprising the AAV2 ITRs and AAV9 capsid protein can be indicated AAV2 / 9. In some examples, the hybrid AAV delivery vector comprises an AAV2 / 1, AAV2 / 2, AAV 2 / 4, AAV2 / 5, AAV2 / 8, or AAV2 / 9 vector.

[0137] In some examples, the AAV vector can be a chimeric AAV vector. In some examples, the chimeric AAV vector comprises an exogenous amino acid or an amino acid substitution, or capsid proteins from two or more serotypes. In some examples, a chimeric AAV vector can be genetically engineered to increase transduction efficiency, selectivity, or a combination thereof.

[0138] In some examples, the AAV vector comprises a self-complementary AAV genome. Self- complementary AAV genomes can contain both DNA strands which can anneal together to form double-stranded DNA.

[0139] In some examples, the delivery vector can be a retroviral vector. In some examples, the retroviral vector can be a Moloney Murine Leukemia Virus vector, a spleen necrosis virus vector, or a vector derived from the Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, or mammary tumor virus, or a combination thereof. In some examples, the retroviral vector can be transfected such that the majority of sequences coding for the structural genes of the virus (e.g., gag, pol, and env) can be deleted and replaced by the gene(s) of interest.

[0140] In some examples, the delivery vehicle can be a non-viral vector. In some examples, the delivery vehicle can be a plasmid. In some embodiments, the plasmid comprises DNA. In some examples, the plasmid comprises circular double-stranded DNA. In some examples, the plasmid can be linear. In some examples, the plasmid comprises one or more genes of interest and one or more regulatory elements. In some examples, the plasmid comprises a bacterial backbone containing an origin of replication and an antibiotic resistance gene or other selectable marker for plasmid amplification in bacteria. In some examples, the plasmid can be a minicircle plasmid. In some examples, the plasmid contains one or more genes that provide a selective marker to induce a target cell to retain the plasmid. In some examples, the plasmid can be formulated for delivery through injection by a needle carrying syringe. In some examples, the plasmid can be formulated for delivery via electroporation. In some examples, the plasmids can be engineered through synthetic or other suitable means. For example, in some cases, the genetic elements can be assembled by restriction digest of the desired genetic sequence from a donor plasmid or organism to produce ends of the DNA which can then be readily ligated to another genetic sequence.

[0141] In some embodiments, the vector containing the engineered RNA or polynucleotide encoding the engineered RNA is a non-viral vector system. In some embodiments, the non-viral vector system comprises cationic lipids, or polymers. For example, the non-viral vector system can be a liposome or polymeric nanoparticle. In some embodiments, the engineered RNA or polynucleotide encoding the engineered RNA of the disclosure or a non-viral vector comprisingthe engineered RNA or polynucleotide is delivered to a cell by hydrodynamic injection or ultrasound.Pharmaceutical Compositions

[0142] The pharmaceutical compositions described herein (e.g., compositions comprising the engineered RNAs (e.g., engineered guide RNA, ASO), the polynucleotides encoding the engineered RNAs (e.g., engineered guide RNA, ASO), or the delivery vehicles comprising the engineered RNAs or the polynucleotides encoding the engineered RNAs, all of which described here) can be formulated with a pharmaceutically acceptable carrier for administration to a subject (e.g., a human or a non-human animal) in need of the engineered RNA (e.g., engineered guide RNA, ASO), the polynucleotides, or the delivery vehicles described here, or in need of treatment of a disease or condition described here. In some embodiments, the pharmaceutical composition described here can be in a unit dose form or unit dosage form. Some embodiments of the disclosure can provide a pharmaceutical composition, comprising: (a) any of the engineered RNAs (e.g., engineered guide RNA, ASO) described here, any of the polynucleotides encoding for any of the engineered RNAs described here, or any of the delivery vehicles comprising the engineered RNAs (e.g., engineered guide RNA, ASO) or polynucleotides encoding the engineered RNAs described here; and (b) a pharmaceutically acceptable: excipient, diluent, or carrier.Administration

[0143] Administration can refer to methods that can be used to enable the delivery of a composition described herein (e.g., an engineered guide RNA, ASO) to the desired site of biological action. For example, an engineered RNA (e.g., engineered guide RNA, ASO) comprising a targeting sequence sufficiently complementary to a target RNA of interest and an engineered SmOPT variant sequence, a small nuclear RNA (snRNA) processing hairpin sequence, or both the engineered SmOPT variant sequence and the small nuclear RNA (snRNA) processing hairpin sequence, or polynucleotide encoding such engineered RNA can be comprised in a DNA construct, a viral vector, or both and be administered by intravenous administration. Administration disclosed herein to an area in need of treatment or therapy can be achieved by, for example, and not by way of limitation, oral administration, topical administration, intravenous administration, inhalation administration, or any combination thereof. In some embodiments, delivery can include inhalation, otic, buccal, conjunctival, dental, endocervical, endosinusial, endotracheal, enteral, epidural, extra-amniotic, extracorporeal, hemodialysis, infiltration, interstitial, intraabdominal, intraamniotic, intraarterial, intraarticular,intrabiliary, intrabronchial, intrabursal, intracardiac, intracartilaginous, intracaudal, intracavernous, intracavitary, intracerebroventricular, intracistemal, intracorneal, intracoronal, intracoronary, intracorpous cavemaosum, intradermal, intradiscal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intrahippocampal, intraileal, intralesional, intraluminal, intralymphatic, intramedullary, intrameningeal, intramuscular, intraocular, intraovarian, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratendinous, intratesticular, intrathoracic, intratubular, intratumor, intratympanic, intrauterine, intravascular, intravenous, intravenous bolus, intravenous drip, intravesical, intravitreal, iontophoresis, irrigation, laryngeal, nasal, nasogastric, ophthalmic, oral, oropharyngeal, parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, retrobulbar, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, vaginal, infraorbital, intraparenchymal, intrathecal, intraventricular, stereotactic, or any combination thereof. Delivery can include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular or infusion), oral administration, inhalation administration, intraduodenal administration, rectal administration, or a combination thereof. Delivery can include direct application to the affected tissue or region of the body. In some cases, topical administration can comprise administering a lotion, a solution, an emulsion, a cream, a balm, an oil, a paste, a stick, an aerosol, a foam, a jelly, a foam, a mask, a pad, a powder, a solid, a tincture, a butter, a patch, a gel, a spray, a drip, a liquid formulation, an ointment to an external surface of a surface, such as a skin. Delivery can include a parenchymal injection, an intra-thecal injection, an intra- ventricular injection, or an intra-cisternal injection. A composition provided herein can be administered by any method.

[0144] A method of administration can be by intra-arterial injection, intracistemal injection, intramuscular injection, intraparenchymal injection, intraperitoneal injection, intraspinal injection, intrathecal injection, intravenous injection, intraventricular injection, stereotactic injection, subcutaneous injection, epidural, or any combination thereof. Delivery can include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular or infusion administration). In some embodiments, delivery can comprise a particle, such as a nanoparticle, a liposome, an exosome, an extracellular vesicle, an implant, or a combination thereof. In some cases, delivery can be from a device. In some instances, delivery can be administered by a pump, an infusion pump, or a combination thereof. In some embodiments, delivery can be by an enema, an eye drop, a nasal spray, or any combination thereof. In some instances, a subject can administer the composition in the absenceof supervision. In some instances, a subject can administer the composition under the supervision of a medical professional (e.g., a physician, nurse, physician’s assistant, orderly, hospice worker, etc.). In some embodiments, a medical professional can administer the composition.

[0145] In some cases, administering can be oral ingestion. In some cases, delivery can be a capsule or a tablet. Oral ingestion delivery can comprise a tea, an elixir, a food, a drink, a beverage, a syrup, a liquid, a gel, a capsule, a tablet, an oil, a tincture, or any combination thereof. In some embodiments, a food can be a medical food. In some instances, a capsule can comprise hydroxymethylcellulose. In some embodiments, a capsule can comprise a gelatin, hydroxypropylmethyl cellulose, pullulan, or any combination thereof. In some cases, capsules can comprise a coating, for example, an enteric coating. In some embodiments, a capsule can comprise a vegetarian product or a vegan product such as a hypromellose capsule.

[0146] In some embodiments, delivery can comprise inhalation by an inhaler, a diffuser, a nebulizer, a vaporizer, or a combination thereof.

[0147] In some embodiments, disclosed herein can be a method, comprising administering a composition disclosed herein to a subject (e.g., a human) in need thereof. In some instances, the uses or methods of the disclosure can treat or prevent a disease or condition in the subject.Methods of Treatment

[0148] The engineered RNA (e.g., engineered guide RNA, ASO) described here comprising a can be directed to a target RNA that is associated with or implicated in a disease or condition, where the target RNA associated in a disease can cause, or partially cause, or contribute to one or more symptoms of the associated disease or condition, or can be associated with or implicated in a pathway that manifests in the disease or condition. Such disease or condition can be selected from: a neurodegenerative disease or disorder, a muscular disease or disorder, a metabolic disease or disorder, an ocular disease or disorder, a liver disease or disorder, a cancer, and any combination thereof. In some aspects, the disease or condition can be selected from: Rett syndrome, Huntington’s disease, Parkinson’s Disease, Alzheimer’s disease, a muscular dystrophy, and Tay-Sachs Disease. In some embodiments, said disease or condition may be associated with a gene target comprising ABCA4, ALAS1, APP, ATP7B, CFTR, DMD, DMPK, DUX4, GAPDH, GBA, GRN, HEXA, HFE, LIPA, LRRK2, MAPT, GRN, PCSK9 start site, PINK1, PMP22, SERPINA1, SCNN1A start site, SNCA, or SOD1, a fragment of any one of these, and any combination thereof.

[0149] An engineered polynucleotide as described herein can comprise one or more polynucleotide sequence(s) that encode one or more engineered guide RNA(s). For example, anengineered polynucleotide can comprise 1, 2, 3, 4, or more than 4 polynucleotide sequence(s) that encode 1, 2, 3, 4, or more than 4 engineered guide RNAs.

[0150] In some instances, the engineered polynucleotide can comprise one or more polynucleotide sequence(s) encoding one or more engineered guide RNA(s) that independently hybridize to (target): (1) different target sequences of the same target RNA, or (2) different target sequences of different target RNAs. For example, a first engineered guide RNA encoded by a first polynucleotide sequence can hybridize to a target sequence of a first target RNA while a second engineered guide RNA encoded by a second polynucleotide sequence can hybridize to a target sequence of a second target RNA, in some instances resulting in ADAR-mediated editing of an adenosine in the target sequence of the first target RNA and an adenosine in the target sequence of the second target RNA.

[0151] In some instances, the engineered polynucleotide can comprise one or more polynucleotide sequence(s) encoding one or more engineered guide RNA(s) that independently hybridize to (target) the same target sequence of a target RNA. For example, the one or more engineered guide RNA(s) encoded by the one or more polynucleotide sequence(s) can each independently hybridize to a target sequence of a target RNA and / or facilitate editing of the same adenosine in the target sequence of the target RNA via ADAR. In some cases, the one or more engineered guide RNA(s) that hybridize to (target) the same target sequence of a target RNA have identical sequences (i.e., the one or more engineered guide RNAs are copies of each other).

[0152] Alternatively, two or more engineered guide RNA(s) that hybridize to (target) the same target sequence of a target RNA can comprise different sequences. For example, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to: 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some instances, a first engineered guide RNA encoded by an engineered polynucleotide can have at least about 70% to about 99% sequence identity, at least about 60% to about 99% sequence identity, at least about 80% to about 99% sequence identity, at least about 60% to about 70% sequence identity, at least about 70% to about 80% sequence identity, at least about 75% to about 85% sequence identity, at least about 85% to about 99% sequence identity, at least about 85% to about 90% sequence identity, at least about 88% to about 93% sequence identity, at least about 90% to about 95% sequence identity, at least about92% to about 99% sequence identity, or at least about 95% to about 99% sequence identity to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 60% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 61% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 62% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 63% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 64% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 65% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 66% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 67% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineeredguide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 68% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 69% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 70% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 71% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 72% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 73% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 74% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 75% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotidecan have a sequence identity of less than, greater than, or equal to about 76% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 77% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 78% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 79% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 80% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 81% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 82% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 83% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 84% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNAhybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 85% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 86% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 87%, to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 88% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 89% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 90% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 91% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 92% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotidecan have a sequence identity of less than, greater than, or equal to about 93% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 94% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 95% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 96% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 97% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 98% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some cases, a first engineered guide RNA encoded by an engineered polynucleotide can have a sequence identity of less than, greater than, or equal to about 99% to a second engineered guide RNA encoded by the engineered polynucleotide, where the second engineered guide RNA hybridizes to (targets) the same target sequence of a target RNA as the first engineered guide RNA. In some embodiments, polynucleotides encoding a first engineered guide RNA, a second engineered guide RNA, or both can be delivered via an AAV. In some instances, the AAV can be formulated in a composition, such as any of the pharmaceutical compositions disclosed herein.

[0153] As used herein, the term “polynucleotide” refers to a single or double-stranded polymer of deoxyribonucleotide (DNA) or ribonucleotide (RNA) bases read from the 5 ’ to the 3 ’ end. The term “RNA” is inclusive of dsRNA (double stranded RNA), snRNA (small nuclear RNA), IncRNA (long non-coding RNA), mRNA (messenger RNA), miRNA (microRNA) RNAi(inhibitory RNA), siRNA (small interfering RNA), shRNA (short hairpin RNA), tRNA (transfer RNA), rRNA (ribosomal RNA), snoRNA (small nucleolar RNA), and cRNA (complementary RNA). The term DNA is inclusive of cDNA, genomic DNA, and DNA-RNA hybrids. A sequence of a polynucleotide may be provided interchangeably as an RNA sequence (containing U) or a DNA sequence (containing T). A sequence provided as an RNA sequence is intended to also cover the corresponding DNA sequence and the reverse complement RNA sequence or DNA sequence. A sequence provided as a DNA sequence is intended to also cover the corresponding RNA sequence and the reverse complement RNA sequence or DNA sequence.

[0154] As used herein, the term “engineered guide RNA” can be used interchangeable with “guide RNA” and refers to a designed polynucleotide that is at least partially complementary to a target RNA. An engineered guide RNA of the present disclosure can be used to facilitate modification of the target RNA. Modification of the target RNA includes alteration of RNA splicing, reduction or enhancement of protein translation, target RNA knockdown, target RNA degradation, and / or ADAR mediated RNA editing of the target RNA. In some cases, guide RNAs facilitate ADAR mediated RNA editing for the purpose of target mRNA knockdown, downstream protein translation reduction or inhibition, downstream protein translation enhancement, correction of mutations (including correction of any G to A mutation, such as missense or nonsense mutations), introduction of mutations (e.g., introduction of an A to I (read as a G by cellular machinery) substitution), or alter the function of any adenosine containing a regulatory motif (e.g., polyadenylation signal, miRNA binding site, etc.). In some cases, a guide RNA can effect a functional outcome (e.g., target RNA modulation, downstream protein translation) via a combination of mechanisms, for example, ADAR-mediated RNA editing and binding and / or degrading target RNA. In some cases, a guide RNA can facilitate introduction of mutations at sites targeted by enzymes in order to modify the affinity of such enzymes for targeting and cleaving such sites. The guide RNAs of this disclosure can contain one or more structural features. A structural feature can be formed from latent structure in latent (unbound) guide RNA upon hybridization of the engineered latent guide RNA to a target RNA. Latent structure refers to a structural feature that forms or substantially forms only upon hybridization of a guide RNA to a target RNA. For example, upon hybridization of the guide RNA to the target RNA, the latent structural feature is formed in the resulting double stranded RNA (also referred herein as guide-target RNA scaffold). In such cases, a structural feature can include, but is not limited to, a mismatch, a wobble base pair, a symmetric internal loop, an asymmetric internal loop, a symmetric bulge, or an asymmetric bulge. In other instances, a structural feature can be a pre-formed structure (e.g., a GluR2 recruitment hairpin, or a hairpin from U7 snRNA).

[0155] As used herein, the term “targeting sequence” can be used interchangeable with “targeting domain” or “targeting region” and refers to a polynucleotide sequence within an engineered guide RNA sequence that is at least partially complementary to a target polynucleotide. The target polynucleotide (e.g., a target RNA or a target DNA) may be a region of a polynucleotide of interest, such as a gene or a messenger RNA. As used herein, a “complementary” sequence refers to a sequence that is a reverse complement relative to a second sequence.

[0156] A targeting sequence of an engineered guide RNA allows the engineered guide RNA to hybridize to a target polynucleotide (e.g., a target RNA) through base pairing, such as Watson Crick base pairing. A targeting sequence can be located at either the N-terminus or C-terminus of the engineered guide RNA, or both, or the targeting sequence can be within the engineered guide RNA. The targeting sequence can be of any length sufficient to hybridize with the target polynucleotide. In some cases, the targeting sequence is at least about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,I I, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62,63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110,I I I, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129,130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148,149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167,168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186,187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or up to about 200 nucleotides in length. In an embodiment, an engineered polynucleotide comprises a targeting sequence that is about 25 to 200, 50 to 150, 75 to 100, 80 to 110, 90 to 120, 95 to 115, 60 to 200, 60 to 180, 60 to 160, 60 to 140, 70 to 200, 70 to 180, 70 to 160, 70 to 140, 80 to 200, 80 to 190, 80 to 170, 80 to 160, 80 to 150, 80 to 140, 80 to 130, 80 to 120, 90 to 200, 90 to 190, 90 to 180, 90 to 170, 90 to 160, 90 to 150, 90 to 140, 90 to 130, 90 to 120, 100 to 200, 100 to 190, 100 to 180, 100 to170, 100 to 160, 100 to 150, 100 to 140, 100 to 130, 100 to 120, 110 to 200, 110 to 190, 110 to180, 110 to 170, 110 to 160, 110 to 150, 110 to 140, 110 to 120, 120 to 200, 120 to 190, 120 to180, 120 to 170, 120 to 160, 120 to 150, 120 to 140, 130 to 200, 130 to 190, 130 to 180, 130 to170, 130 to 160, 130 to 150, 140 to 200, 140 to 190, 140 to 180, 140 to 170, 140 to 160, 150 to200, 150 to 190, 150 to 180, 150 to 170, 160 to 200, 160 to 190 or 160 to 180 nucleotides in length.

[0157] A targeting sequence comprises at least partial sequence complementarity to a target polynucleotide. The targeting sequence may have a degree of sequence complementarity to thetarget polynucleotide sufficient to hybridize with the target polynucleotide. In some cases, the targeting sequence comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to the target polynucleotide. In some cases, the targeting sequence comprises less than 100% complementarity to the target polynucleotide sequence. For example, the targeting sequence may have a single base mismatch relative to the target polynucleotide when bound to the target polynucleotide. In other cases, the targeting sequence comprises at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 20, 30, 40 or up to about 50 base mismatches relative to the target polynucleotide when bound to the target polynucleotide. In some aspects, nucleotide mismatches can be associated with structural features provided herein. In some aspects, a targeting sequence comprises at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or up to about 15 nucleotides that differ in complementarity from a wildtype polynucleotide of a subject target polynucleotide.

[0158] A targeting sequence comprises nucleotide residues having complementarity to a target polynucleotide. The targeting sequence may have a number of residues with complementarity to the target polynucleotide sufficient to hybridize with the target polynucleotide. The complementary residues may be contiguous or non-contiguous. In some cases, the targeting sequence comprises at least 50 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 150 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 200 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 250 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 300 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134,135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153,154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172,173, 174, 175, 176, 177, 178, 179, 180, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200,201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219,220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238,239, 240, 241, 242, 243, 244, 245, 246, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260,261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279,280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298,299, or 300 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises more than 50 nucleotides total and has at least 50 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 400 nucleotides total and has from 50 to 150 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 400 nucleotides total and has from 50 to 200 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 400 nucleotides total and has from 50 to 250 nucleotides having complementarity to the target polynucleotide. In some cases, the targeting sequence comprises from 50 to 400 nucleotides total and has from 50 to 300 nucleotides having complementarity to the target polynucleotide. In some cases, the at least 50 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. In some cases, the from 50 to 150 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. In some cases, the from 50 to 200 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. In some cases, the from 50 to 250 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. In some cases, the from 50 to 300 nucleotides having complementarity to the target polynucleotide are separated by one or more mismatches, one or more bulges, or one or more loops, or any combination thereof. For example, a targeting sequence comprises a total of 54 nucleotides wherein, sequentially, 25 nucleotides are complementarity to the target polynucleotide, 4 nucleotides form a bulge, and 25 nucleotides are complementarity to the target polynucleotide. As another example, a targeting sequence comprises a total of 118 nucleotides wherein, sequentially, 25 nucleotides are complementarity to the target polynucleotide, 4 nucleotides form a bulge, 25 nucleotides are complementarity to the target polynucleotide, 14 nucleotides form a loop, and 50 nucleotides are complementary to the target polynucleotide.

[0159] As disclosed herein, a “base paired (bp) region” refers to a region of the guide-target RNA scaffold in which bases in the guide RNA (e.g., the bases in the targeting sequence of the guide RNA) are paired with opposing bases in the target polynucleotide. Base paired regions can extend from one end or proximal to one end of the guide -target RNA scaffold to or proximal to the other end of the guide-target RNA scaffold. Base paired regions can extend between two structural features. Base paired regions can extend from one end or proximal to one end of the guide-target RNA scaffold to or proximal to a structural feature. Base paired regions can extendfrom a structural feature to the other end of the guide-target RNA scaffold. In some embodiments, a base paired region has from 1 to 50, 1 to 75, 1 to 100, 1 to 125, 1 to 150, 1 to 175, 1 to 200, 1 to 225, 1 to 250, 1 to 275, 1 to 300, 50 to 75, 50 to 100, 50 to 125, 50 to 150, 50 to 175, 50 to 200, 50 to 225, 50 to 250, 50 to 275, 50 to 300, 60 to 75, 60 to 100, 60 to 125, 60 to 150, 60 to 175, 60 to 200, 60 to 225, 60 to 250, 60 to 275, 60 to 300, 70 to 100, 70 to 125, 70 to150, 70 to 175, 70 to 200, 70 to 225, 70 to 250, 70 to 275, 70 to 300, 80 to 100, 80 to 125, 80 to150, 80 to 175, 80 to 200, 80 to 225, 80 to 250, 80 to 275, 80 to 300, 90 to 125, 90 to 150, 90 to175, 90 to 200, 90 to 225, 90 to 250, 90 to 275, 90 to 300, 100 to 125, 100 to 150, 100 to 175,100 to 200, 100 to 225, 100 to 250, 100 to 275, 100 to 300, 150 to 200, 150 to 225, 150 to 250, 150 to 275, or 150 to 300 base pairs. In some embodiments, a base paired region has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126,127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145,146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164,165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 191, 192,193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211,212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230,231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 250, 251, 252,253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271,272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290,291, 292, 293, 294, 295, 296, 297, 298, 299, or 300 base pairs.

[0160] A double stranded RNA (dsRNA) substrate is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The resulting dsRNA substrate is also referred to herein as a “guide-target RNA scaffold.” Described herein are structural features that can be present in a guide-target RNA scaffold of the present disclosure. Examples of features include a mismatch, a bulge (symmetrical bulge or asymmetrical bulge), an internal loop (symmetrical internal loop or asymmetrical internal loop), or a hairpin (a recruiting hairpin or a non-recruiting hairpin). Engineered guide RNAs of the present disclosure can have from 1 to 50 features. Engineered guide RNAs of the present disclosure can have from 1 to 5, from 5 to 10, from 10 to 15, from 15 to 20, from 20 to 25, from 25 to 30, from 30 to 35, from 35 to 40, from 40 to 45, from 45 to 50, from 5 to 20, from 1 to 3, from 4 to 5, from 2 to 10, from 20 to 40, from 10 to 40, from 20 to 50, from 30 to 50, from 4 to 7, or from 8 to 10 features. In some embodiments, structural features (e.g., mismatches, bulges, internal loops) can be formed fromlatent structure in an engineered latent guide RNA upon hybridization of the engineered latent guide RNA to a target RNA and, thus, formation of a guide-target RNA scaffold. In some embodiments, structural features are not formed from latent structures and are, instead, preformed structures (e.g., a GluR2 recruitment hairpin or a hairpin from U7 snRNA).

[0161] Latent structure refers to a structural feature that substantially forms only upon hybridization of a guide RNA to a target RNA. For example, the sequence of a guide RNA provides one or more structural features, but these structural features substantially form only upon hybridization to the target RNA, and thus the one or more latent structural features manifest as structural features upon hybridization to the target RNA. Upon hybridization of the guide RNA to the target RNA, the structural feature is formed, and the latent structure provided in the guide RNA is, thus, unmasked. The formation and structure of a latent structural feature upon binding to the target RNA depends on the guide RNA sequence. For example, formation and structure of the latent structural feature may depend on a pattern of complementary and mismatched residues in the guide RNA sequence relative to the target RNA. The guide RNA sequence may be engineered to have a latent structural feature that forms upon binding to the target RNA.

[0162] An engineered latent guide RNA refers to an engineered guide RNA that comprises a portion of sequence that, upon hybridization or only upon hybridization to a target RNA, substantially forms at least a portion of a structural feature, other than a single A / C mismatch feature at the target adenosine to be edited.

[0163] A guide-target RNA scaffold, as disclosed herein, is the resulting double stranded RNA formed upon hybridization of a guide RNA, with latent structure, to a target RNA. A guidetarget RNA scaffold has one or more structural features formed within the double stranded RNA duplex upon hybridization. For example, the guide -target RNA scaffold can have one or more structural features selected from a bulge, mismatch, internal loop, hairpin, or wobble base pair.

[0164] As disclosed herein, a structured motif comprises two or more structural features in a guide-target RNA scaffold.

[0165] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. As disclosed herein, a mismatch refers to a single nucleotide in a guide RNA that is unpaired to an opposing single nucleotide in a target RNA within the guide-target RNA scaffold. A mismatch can comprise any two single nucleotides that do not base pair. Where the number of participating nucleotides on the guide RNA side and the target RNA side exceeds 1 , the resulting structure is no longer considered a mismatch, but rather, is considered a bulge or an internal loop, depending on the size of the structural feature. In some embodiments, a mismatchis an A / C mismatch. An A / C mismatch can comprise a C in an engineered guide RNA of the present disclosure opposite an A in a target RNA. An A / C mismatch can comprise an A in an engineered guide RNA of the present disclosure opposite a C in a target RNA. A G / G mismatch can comprise a G in an engineered guide RNA of the present disclosure opposite a G in a target RNA.

[0166] In some embodiments, a mismatch positioned 5’ of the edit site can facilitate baseflipping of the target A to be edited. A mismatch can also help confer sequence specificity.

[0167] Thus, a mismatch can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0168] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. As disclosed herein, a bulge refers to the structure substantially formed only upon formation of the guide-target RNA scaffold, where contiguous nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts on the opposite strand. A bulge can change the secondary or tertiary structure of the guide -target RNA scaffold. A bulge can have from 0 to 4 contiguous nucleotides on the guide RNA side of the guide-target RNA scaffold and 1 to 4 contiguous nucleotides on the target RNA side of the guide-target RNA scaffold or a bulge can have from 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 to 4 contiguous nucleotides on the guide RNA side of the guide-target RNA scaffold. However, a bulge, as used herein, does not refer to a structure where a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA do not base pair - a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA that do not base pair is referred to herein as a mismatch. Further, where the number of participating nucleotides on either the guide RNA side or the target RNA side exceeds 4, the resulting structure is no longer considered a bulge, but rather, is considered an internal loop. In some embodiments, the guide-target RNA scaffold of the present disclosure has 2 bulges. In some embodiments, the guide-target RNA scaffold of the present disclosure has 3 bulges. In some embodiments, the guide-target RNA scaffold of the present disclosure has 4 bulges.

[0169] Thus, a bulge can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0170] In some embodiments, the presence of a bulge in a guide-target RNA scaffold can position or can help to position ADAR to selectively edit the target A in the target RNA and reduce off-target editing of non-target A(s) in the target RNA. In some embodiments, the presence of a bulge in a guide-target RNA scaffold can recruit or help recruit additional amountsof ADAR. Bulges in guide-target RNA scaffolds disclosed herein can recruit other proteins, such as other RNA editing entities. In some embodiments, a bulge positioned 5’ of the edit site can facilitate base-flipping of the target A to be edited. A bulge can also help confer sequence specificity for the A of the target RNA to be edited, relative to other A(s) present in the target RNA. For example, a bulge can help direct ADAR editing by constraining it in an orientation that yields selective editing of the target A.

[0171] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. A bulge can be a symmetrical bulge or an asymmetrical bulge. A symmetrical bulge is formed when the same number of nucleotides is present on each side of the bulge. For example, a symmetrical bulge in a guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guidetarget RNA scaffold. A symmetrical bulge of the present disclosure can be formed by 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical bulge of the present disclosure can be formed by 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical bulge of the present disclosure can be formed by 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a symmetrical bulge can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0172] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. A bulge can be a symmetrical bulge or an asymmetrical bulge. An asymmetrical bulge is formed when a different number of nucleotides is present on each side of the bulge. For example, an asymmetrical bulge in a guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guidetarget RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1 nucleotide on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 nucleotide on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosurecan be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 1 nucleotide on the target RNA side of the guide -target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 2 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guideRNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical bulge of the present disclosure can be formed by 3 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, an asymmetrical bulge can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0173] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. As disclosed herein, an internal loop refers to the structure substantially formed only upon formation of the guide-target RNA scaffold, where nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts on the opposite strand and where one side of the internal loop, either on the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold, has 5 nucleotides or more. Where the number of participating nucleotides on both the guide RNA side and the target RNA side drops below 5, the resulting structure is no longer considered an internal loop, but rather, is considered a bulge or a mismatch, depending on the size of the structural feature. An internal loop can be a symmetrical internal loop or an asymmetrical internal loop. Internal loops present in the vicinity of the edit site can help with base flipping of the target A in the target RNA to be edited.

[0174] One side of the internal loop, either on the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold, can be formed by from 5 to 150 nucleotides. One side of the internal loop can be formed by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 120, 135, 140, 145, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 nucleotides, or any number of nucleotides therebetween. One side of the internal loop can be formed by 5 nucleotides. One side of the internal loop can be formed by 10 nucleotides. One side of the internal loop can be formed by 15 nucleotides. One side of the internal loop can be formed by 20 nucleotides. One side of the internal loop can be formed by 25 nucleotides. One side of the internal loop can be formed by 30 nucleotides. One side of the internal loop can be formed by 35 nucleotides. One side of the internal loop can be formed by 40 nucleotides. One side of the internal loop can be formed by 45 nucleotides. One side of the internal loop can be formed by 50 nucleotides. One side of the internal loop can be formed by 55 nucleotides. One side of the internal loop can be formed by 60 nucleotides. One side of the internal loop can be formed by 65 nucleotides. One side of the internal loop can be formed by 70 nucleotides. One side of the internal loop can be formed by 75 nucleotides. One side of the internal loop can be formed by 80nucleotides. One side of the internal loop can be formed by 85 nucleotides. One side of the internal loop can be formed by 90 nucleotides. One side of the internal loop can be formed by 95 nucleotides. One side of the internal loop can be formed by 100 nucleotides. One side of the internal loop can be formed by 110 nucleotides. One side of the internal loop can be formed by 120 nucleotides. One side of the internal loop can be formed by 130 nucleotides. One side of the internal loop can be formed by 140 nucleotides. One side of the internal loop can be formed by 150 nucleotides. One side of the internal loop can be formed by 200 nucleotides. One side of the internal loop can be formed by 250 nucleotides. One side of the internal loop can be formed by 300 nucleotides. One side of the internal loop can be formed by 350 nucleotides. One side of the internal loop can be formed by 400 nucleotides. One side of the internal loop can be formed by 450 nucleotides. One side of the internal loop can be formed by 500 nucleotides. One side of the internal loop can be formed by 600 nucleotides. One side of the internal loop can be formed by 700 nucleotides. One side of the internal loop can be formed by 800 nucleotides. One side of the internal loop can be formed by 900 nucleotides. One side of the internal loop can be formed by 1000 nucleotides.

[0175] Thus, an internal loop can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0176] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. An internal loop can be a symmetrical internal loop or an asymmetrical internal loop. A symmetrical internal loop is formed when the same number of nucleotides is present on each side of the internal loop. For example, a symmetrical internal loop in a guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 5 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 7 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 8 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 9 nucleotides on the engineered guide RNA sideof the guide-target RNA scaffold target and 9 nucleotides on the target RNA side of the guidetarget RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 10 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 15 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 15 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 20 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 20 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 30 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 30 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 40 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 40 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 50 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 60 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 60 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 70 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 70 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 80 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 80 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 90 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 90 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 100 nucleotides on the target RNA side of the guide -target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 110 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 110 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 120 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 120 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 130 nucleotides on theengineered guide RNA side of the guide-target RNA scaffold target and 130 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 140 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold target and 140 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 150 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 200 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 250 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 250 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 300 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 350 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 350 nucleotides on the target RNA side of the guide -target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 400 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 450 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 450 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 500 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 600 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold target and 600 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 700 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 700 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 800 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 800 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internal loop of the present disclosure can be formed by 900 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 900 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetrical internalloop of the present disclosure can be formed by 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 1000 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a symmetrical internal loop can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0177] A double stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. An internal loop can be a symmetrical internal loop or an asymmetrical internal loop. An asymmetrical internal loop is formed when a different number of nucleotides is present on each side of the internal loop. For example, an asymmetrical internal loop in a guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold.

[0178] An asymmetrical internal loop of the present disclosure can be formed by from 5 to 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and from 5 to 150 nucleotides on the target RNA side of the guide-target RNA scaffold, wherein the number of nucleotides is the different on the engineered side of the guide-target RNA scaffold target than the number of nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by from 5 to 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and from 5 to 1000 nucleotides on the target RNA side of the guide-target RNA scaffold, wherein the number of nucleotides is the different on the engineered side of the guide-target RNA scaffold target than the number of nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 6 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNAscaffold and 8 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide -target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the target RNA side of the guide-targetRNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides internal loop the target RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 9 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNAscaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guidetarget RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guidetarget RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guidetarget RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guidetarget RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guidetarget RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guidetarget RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guidetarget RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guidetarget RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guidetarget RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guidetarget RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guidetarget RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guidetarget RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guidetarget RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guidetarget RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guidetarget RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guidetarget RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guidetarget RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guidetarget RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guidetarget RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetrical internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, an asymmetrical internal loop can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0179] As disclosed herein, a hairpin includes an RNA duplex wherein a portion of a single RNA strand has folded in upon itself to form the RNA duplex. The portion of the single RNA strand folds upon itself due to having nucleotide sequences that base pair to each other, where the nucleotide sequences are separated by an intervening sequence that does not base pair withitself, thus forming a base-paired portion and non-base paired, intervening loop portion. A hairpin can have from 10 to 500 nucleotides in length of the entire duplex structure. The loop portion of a hairpin can be from 3 to 15 nucleotides long. A hairpin can be present in any of the engineered guide RNAs disclosed herein. The engineered guide RNAs disclosed herein can have from 1 to 10 hairpins. In some embodiments, the engineered guide RNAs disclosed herein have 1 hairpin. In some embodiments, the engineered guide RNAs disclosed herein have 2 hairpins. As disclosed herein, a hairpin can include a recruitment hairpin or a non-recruitment hairpin. A hairpin can be located anywhere within the engineered guide RNAs of the present disclosure. In some embodiments, one or more hairpins is proximal to or present at the 3 ’ end of an engineered guide RNA of the present disclosure, proximal to or at the 5 ’ end of an engineered guide RNA of the present disclosure, proximal to or within the targeting domain (e.g., the targeting sequence) of the engineered guide RNAs of the present disclosure, or any combination thereof.

[0180] A recruitment hairpin, as disclosed herein, can recruit at least in part an RNA editing entity, such as ADAR. In some cases, a recruitment hairpin can be formed and present in the absence of binding to a target RNA. In some embodiments, a recruitment hairpin is a GluR2 domain or portion thereof. In some embodiments, a recruitment hairpin is an Alu domain or portion thereof. A recruitment hairpin, as defined herein, can include a naturally occurring ADAR substrate or truncations thereof. Thus, a recruitment hairpin such as GluR2 is a preformed structural feature that may be present in constructs comprising an engineered guide RNA, not a structural feature formed by latent structure provided in an engineered latent guide RNA.

[0181] A non-recruitment hairpin, as disclosed herein, does not have a primary function of recruiting an RNA editing entity. A non-recruitment hairpin, in some instances, does not recruit an RNA editing entity. In some instances, a non-recruitment hairpin has a dissociation constant for binding to an RNA editing entity under physiological conditions that is insufficient for binding. For example, a non-recruitment hairpin has a dissociation constant for binding an RNA editing entity at 25 °C that is greater than about 1 mM, 10 mM, 100 mM, or 1 M, as determined in an in vitro assay. A non-recruitment hairpin can exhibit functionality that improves localization of the engineered guide RNA to the target RNA. In some embodiments, the non- recruitment hairpin improves nuclear retention. In some embodiments, the non-recruitment hairpin comprises a hairpin from U7 snRNA. Thus, a non-recruitment hairpin such as a hairpin from U7 snRNA is a pre-formed structural feature that can be present in constructs comprising engineered guide RNA constructs, not a structural feature formed by latent structure provided in an engineered latent guide RNA.

[0182] A wobble base pair refers to two bases that weakly base pair. For example, a wobble base pair of the present disclosure can refer to a G paired with a U. Thus, a wobble base pair can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0183] Guide RNAs of the present disclosure can further comprise a macro-footprint. In some embodiments, the macro-footprint comprises a barbell macro-footprint. A micro-footprint can serve to guide an RNA editing enzyme and direct its activity towards the target adenosine to be edited. A “barbell ” as described herein refers to a pair of internal loop latent structures that manifest upon hybridization of the guide RNA to the target RNA. In some embodiments, each internal loop is positioned towards the 5 ' end or the 3 ' end of the guide-target RNA scaffold formed upon hybridization of the guide RNA and the target RNA. In some embodiments, each internal loop flanks opposing sides of the micro-footprint sequence. Insertion of a barbell macrofootprint sequence flanking opposing sides of the micro-footprint sequence, upon hybridization of the guide RNA to the target RNA, results in formation of barbell internal loops on opposing sides of the micro-footprint. In some cases, barbell internal loops can comprise at least one structural feature that facilitates editing of a specific target RNA.

[0184] In some embodiments, the presence of barbells flanking the micro-footprint can improve one or more aspects of editing. For example, the presence of a barbell macro-footprint in addition to a micro-footprint can result in a higher amount of on target adenosine editing, relative to an otherwise comparable guide RNA lacking the barbells. Additionally, and or alternatively, the presence of a barbell macro-footprint in addition to a micro-footprint can result in a lower amount of local off-target adenosine editing, relative to an otherwise comparable guide RNA lacking the barbells. Further, while the effect of various micro-footprint structural features can vary on a target-by-target basis based on selection in a high throughput screen, the increase in the one or more aspects of editing provided by the barbell macro-footprint structures can be independent of the particular target RNA. For example, macro-footprints (e.g., barbell macro-footprints) and micro-footprints can provide an increased amount of on target adenosine editing relative to an otherwise comparable guide RNA lacking the barbells. In other embodiments, the presence of the barbell macro-footprint in addition to the micro-footprint described here can result in a lower amount of local off-target adenosine editing, relative to an otherwise comparable guide RNA, upon hybridization of the guide RNA and target RNA to form a guide-target RNA scaffold lacking the barbells.

[0185] A dumbbell design in an engineered guide RNA comprises two symmetrical internal loops, wherein the target A to be edited is positioned between the two symmetrical loops for selective editing of the target A. The two symmetrical internal loops are each formed by 6nucleotides on the guide RNA side of the guide -target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a dumbbell can be a structural feature formed from latent structure provided by an engineered latent guide RNA.

[0186] As disclosed herein, a “macro-footprint” sequence can be positioned such that it flanks a micro-footprint sequence. Further, while a macro-footprint sequence can flank a micro-footprint sequence, additional latent structures can be incorporated that flank either end of the macrofootprint as well. In some embodiments, such additional latent structures are included as part of the macro-footprint. In some embodiments, such additional latent structures are separate, distinct, or both separate and distinct from the macro-footprint.

[0187] In some embodiments, a macro-footprint sequence can comprise a barbell macrofootprint sequence comprising latent structures that, when manifested, produce a first internal loop and a second internal loop.

[0188] In some embodiments, the first internal loop of the barbell or the second internal loop of the barbell is positioned at least about 5 bases (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases) away from the A / C mismatch with respect to the base of the first internal loop or the second internal loop that is the most proximal to the A / C mismatch. In some embodiments, the first internal loop of the barbell or the second internal loop of the barbell is positioned at most about 50 bases away from the A / C mismatch (e.g., 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5) with respect to the base of the first internal loop or the second internal loop that is the most proximal to the A / C mismatch.

[0189] In some embodiments, a first internal loop or a second internal loop independently comprises a number of bases of at least about 5 bases or greater (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150); about 150 bases or fewer (e.g., 145, 135, 125, 115, 95, 85, 75, 65, 55, 45, 35, 25, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5); or at least about 5 bases to at least about 150 bases (e.g., 5-150, 6-145, 7-140, 8-135, 9-130, 10-125, 11-120, 12-115, 13-110, 14-105, 15-100, 16-95, 17-90, 18-85, 19- 80, 20-75, 21-70, 22-65, 23-60, 24-55, 25-50) of the engineered guide RNA and a number of bases of at least about 5 bases or greater (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150); about 150 bases or fewer (e.g., 145, 135, 125, 115, 95, 85, 75, 65, 55, 45, 35, 25, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5); or at least about 5 bases to at least about 150 bases (e.g., 5-150, 6-145, 7-140, 8-135, 9-130, 10- 125, 11-120, 12-115, 13-110, 14-105, 15-100, 16-95, 17-90, 18-85, 19-80, 20-75, 21-70, 22-65, 23-60, 24-55, 25-50) of the target RNA.

[0190] As described herein, a “micro-footprint” sequence refers to a sequence with latent structures that, when manifested, facilitate editing of the adenosine of a target RNA via an adenosine deaminase enzyme. A macro-footprint can serve to guide an or focus RNA editing entity (e.g., ADAR) and direct its activity towards a micro-footprint. In some embodiments, included within the micro-footprint sequence is a nucleotide that is positioned such that, when the guide RNA is hybridized to the target RNA, said nucleotide is opposite the adenosine to be edited by the ADAR enzyme and does not base pair with the adenosine to be edited. This nucleotide is referred to herein as the “mismatched position” or “mismatch” and can be a cytosine. Micro-footprint sequences as described herein have upon hybridization of the engineered guide RNA and target RNA, at least one structural feature selected from the group consisting of: a bulge, an internal loop, a mismatch, a hairpin, and any combination thereof. Engineered guide RNAs with superior micro-footprint sequences can be selected based on their ability to facilitate editing of a specific target RNA. Engineered guide RNAs selected for their ability to facilitate editing of a specific target are capable of adopting various micro-footprint latent structures, which can vary on a target-by-target basis.

[0191] In some embodiments, provided herein are engineered guide RNAs comprising a barbell macro-footprint. In some embodiments, provided herein are engineered guide RNAs comprising a micro-footprint. In some embodiments, provided herein are engineered guide RNAs comprising a macro-footprint and a micro-footprint. In some cases, an engineered guide RNA disclosed herein can comprise a micro-footprint in the absence of a macro-footprint. In some cases, an engineered guide RNA disclosed herein can comprise a macro-footprint in the absence of a micro-footprint.

[0192] In some embodiments, a macro-footprint sequence can comprise a barbell macrofootprint sequence comprising latent structures that, when manifested, produce a first internal loop and a second internal loop.

[0193] In some examples, a first internal loop is positioned near the 5 ' end of the guide-target RNA scaffold and a second internal loop is positioned near the 3 ' end of the guide-target RNA scaffold. The length of the dsRNA comprises a 5 ' end and a 3 ' end, where up to half of the length of the guide-target RNA scaffold at the 5 ' end can be considered to be “near the 5 ' end” while up to half of the length of the guide-target RNA scaffold at the 3 ' end can be considered “near the 3 ' end.” Non-limiting examples of the 5 ' end can include about 50% or less of the total length of the dsRNA at the 5 ' end, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, or about 5%. Non-limiting examples of the 3 ' end can include about 50% or less of the total length of the dsRNA at the 3 ' end about45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, or about 5%.

[0194] In some embodiments, the engineered guide RNAs of the disclosure comprising a barbell macro-footprint sequence (that manifests as a first internal loop and a second internal loop) can improve RNA editing efficiency, increase the amount or percentage of RNA editing generally, as well as for on-target nucleotide editing, such as on-target adenosine. In some embodiments, the engineered guide RNAs of the disclosure comprising a first internal loop and a second internal loop can also facilitate a decrease in the amount of or reduce off-target nucleotide editing, such as off-target adenosine or unintended adenosine editing. The decrease or reduction in some examples can be of the number of off-target edits or the percentage of off-target edits.

[0195] Each of the first and second internal loops of the barbell macro-footprint can independently be symmetrical or asymmetrical, where symmetry is determined by the number of bases or nucleotides of the engineered guide RNA and the number of bases or nucleotides of the target RNA, that together form each of the first and second internal loops.

[0196] As described herein, an engineered guide can comprise a circular structure. An engineered polynucleotide can be circularized from a precursor engineered polynucleotide. Such a precursor engineered polynucleotide can be a precursor engineered linear polynucleotide. In some cases, a precursor engineered linear polynucleotide can be a precursor for a circular engineered guide RNA. For example, a precursor engineered linear polynucleotide can be a linear mRNA transcribed from a plasmid, which can be configured to circularize within a cell using the techniques described herein. A precursor engineered linear polynucleotide can be constructed with domains such as a ribozyme domain and a ligation domain that allow for circularization when inserted into a cell. A ribozyme domain can include a domain that is capable of cleaving the linear precursor RNA at specific sites (e.g., adjacent to the ligation domain). A precursor engineered linear polynucleotide can comprise, from 5’ to 3’: a 5’ ribozyme domain, a 5 ’ ligation domain, a circularized region, a 3 ’ ligation domain, and a 3 ’ ribozyme domain. In some cases, a circularized region can comprise a guide RNA described herein. In some cases, the precursor polynucleotide can be specifically processed at both sites by the 5’ and the 3’ ribozymes, respectively, to free exposed ends on the 5’ and 3’ ligation domains. The free exposed ends can be ligation competent, such that the ends can be ligated to form a mature circularized structure. For instance, the free ends can include a 5 ’-OH and a 2’, 3 ’-cyclic phosphate that are ligated via RNA ligation in the cell. The linear polynucleotide with the ligation and ribozyme domains can be transfected into a cell where it can circularize via endogenous cellular enzymes. In some cases, a polynucleotide can encode an engineered guide RNA comprising the ribozyme and ligation domains described herein, which can circularizewithin a cell. For example, PCT / US2021 / 034301 provides a description of circular guide RNAs and their structures, sequences of circular guide RNAs, and methods of engineering circularized polynucleotide domains, and each of these descriptions in PCT / US2021 / 034301 is herein incorporated by reference.

[0197] An engineered polynucleotide as described herein (e.g., a circularized guide RNA) can include spacer domains. As described herein, a spacer domain can refer to a domain that provides space between other domains. A spacer domain can be used to between a region to be circularized and flanking ligation sequences to increase the overall size of the mature circularized guide RNA. Where the region to be circularized includes a targeting domain as described herein that is configured to associate to a target sequence, the addition of spacers can provide improvements (e.g., increased specificity, enhanced editing efficiency, etc.) for the engineered polynucleotide to the target polynucleotide, relative to a comparable engineered polynucleotide that lacks a spacer domain. In some instances, the spacer domain is configured to not hybridize with the target RNA. In some embodiments, a precursor engineered polynucleotide or a circular engineered guide, can comprise, in order of 5’ to 3’: a first ribozyme domain; a first ligation domain; a first spacer domain; a targeting domain that can be at least partially complementary to a target RNA, a second spacer domain, a second ligation domain, and a second ribozyme domain. In some cases, the first spacer domain, the second spacer domain, or both are configured to not bind to the target RNA when the targeting domain binds to the target RNA.

[0198] A circular or looped RNA can be formed by employing a self-cleaving entity, such as a ribozyme, tRNA, aptamer, catalytically active fragment of any of these, or any combination thereof. For example, a ribozyme, a tRNA, an aptamer, a catalytically active fragment of any of these, or any combination thereof can be added to a 3 ’ end, a 5 ’ end, or both of a precursor engineered RNA. In another example, a ribozyme, a tRNA, an aptamer, a catalytically active fragment of any of these, or any combination thereof can be added to a 3’ terminal end, a 5’ terminal end, or both of a precursor engineered RNA. A self-cleaving ribozyme can comprise, for example, an RNase P RNA a Hammerhead ribozyme (e.g., a Schistosoma mansoni ribozyme), a glmS ribozyme, an HDV-like ribozyme, an R2 element, a peptidyl transferase 23 S rRNA, a GIRI branching ribozyme, a leadzyme, a group II intron, a hairpin ribozyme, a VS ribozyme, a CPEB3 ribozyme, a CoTC ribozyme, or a group I intron. In some cases, the selfcleaving ribozyme can be a trans-acting ribozyme that joins one RNA end on which it is present to a separate RNA end. In some embodiments, an aptamer can be added to each end of the engineered guide RNA. A ligase can be contacted with the aptamers at each end of the engineered guide RNA to form a covalent linkage between the aptamers thereby forming acircular engineered guide RNA. In some cases, a self-cleaving element or an aptamer can be configured to facilitate self-circularization of an engineered polynucleotide or a propolynucleotide (e.g., from a precursor engineered polypeptide) after transcription in a cell. In some instances, circularization of a guide RNA can be shown by PCR. For example, primers can by developed that bind to the end of a guide RNA and are directed outward such that a product is only formed when guides are circularized.

[0199] In some cases, circularization can occur by back-slicing and ligation of an exon. For example, an RNA can be engineered from 5 ’ to 3 ’ to comprise a forward complementary sequence intron, an exon (which can comprise the guide sequence), followed by a reverse complementary sequence intron. Once transcribed, the complementary sequence introns can hybridize and form dsRNA. The internal exon containing the guide sequence can be removed by splicing and ligated by an endogenous ligase to form a circular guide. In one example, an engineered guide RNA can initiate circularization in a cell by autocatalytic reactions of encoded ribozymes. After cleavage by one or more ribozymes, the linear polynucleotide will undergo intracellular RNA ligation of the 5 ’ and the 3 ’ end of ligation sequences by an endogenous ligase to circularize the guide RNA.

[0200] A suitable self-cleaving molecule can include a ribozyme. For example, a ribozyme domain can create an autocatalytic RNA. A ribozyme can comprise an RNase P, an rRNA (such as a Peptidyl transferase 23 S rRNA), Leadzyme, Group I intron ribozyme, Group II intron ribozyme, a GIRI branching ribozyme, a glmS ribozyme, a hairpin ribozyme, a Hammerhead ribozyme, an HDV ribozyme, a Twister ribozyme, a Twister sister ribozyme, a VS ribozyme, a Pistol ribozyme, a Hatchet ribozyme, a viroid, or any combination thereof. A ribozyme can include a P3 twister U2A ribozyme.

[0201] A ligation domain can facilitate a linkage, covalent or non-covalent, of a first nucleotide to a second nucleotide. In some embodiments, a ligation domain can recruit a ligating entity to facilitate a ligation reaction. In some cases, a ligation domain can recruit a recombining entity to facilitate a homologous recombination. In some instances, a first ligation domain can facilitate a linkage, covalent or non-covalent, to a second ligation domain. In some embodiments, a first ligation domain can facilitate the complementary pairing of a second ligation domain.

[0202] The compositions and methods of the present disclosure provide engineered polynucleotides encoding for guide RNAs that are operably linked to a portion of a small nuclear ribonucleic acid (snRNA) sequence. The engineered polynucleotide can include at least a portion of a small nuclear ribonucleic acid (snRNA) sequence. The U7 and U1 small nuclear RNAs, whose natural role is in spliceosomal processing of pre-mRNA, have for decades been re-engineered to alter splicing at desired disease targets. Replacing the first 18 nt of the U7snRNA (which naturally hybridizes to the spacer element of histone pre-mRNA) with a short targeting (or antisense) sequence of a disease gene, redirects the splicing machinery to alter splicing around that target site. Furthermore, converting the wild type U7 Sm-domain binding site to an optimized consensus Sm-binding sequence (SmOPT) can increase the expression level, activity, and subcellular localization of the artificial antisense-engineered U7 snRNA. Many subsequent groups have adapted this modified U7 SmOPT snRNA chassis with antisense sequences of other genes to recruit spliceosomal elements and modify RNA splicing for additional disease targets.

[0203] An snRNA is a class of small RNA molecules found within the nucleus of eukaryotic cells. They are involved in a variety of important processes such as RNA splicing (removal of introns from pre-mRNA), regulation of transcription factors (7SK RNA) or RNA polymerase II (B2 RNA) and maintaining the telomeres. They are always associated with specific proteins, and the resulting RNA-protein complexes are referred to as small nuclear ribonucleoproteins (snRNP) or sometimes as snurps. There are many snRNAs, which are denominated U1 , U2, U3, U4, U5, U6, U7, U8, U9, and U10.

[0204] The snRNA of the U7 type is normally involved in the maturation of histone mRNA. This snRNA has been identified in a great number of eukaryotic species (56 so far) and the U7 snRNA of each of these species should be regarded as equally convenient for this disclosure.

[0205] Wild-type U7 snRNA includes a stem-loop structure, the U7-specific Sm sequence, and a sequence antisense to the 3’ end of histone pre-mRNA.

[0206] In addition to the SmOPT domain, U7 comprises a sequence antisense to the 3 ’ end of histone pre-mRNA. When this sequence is replaced by a targeting sequence that is antisense to another target pre-mRNA, U7 is redirected to the new target pre-mRNA. Accordingly, the stable expression of modified U7 snRNAs containing the SmOPT domain and a targeting antisense sequence has resulted in specific alteration of mRNA splicing.

[0207] The engineered polynucleotide can comprise at least in part an snRNA sequence. The snRNA sequence can be Ul, U2, U3, U4, U5, U6, U7, U8, U9, or a U10 snRNA sequence.

[0208] In some instances, an engineered polynucleotide that comprises at least a portion of an snRNA sequence (e.g., an snRNA promoter, an snRNA hairpin, and the like) can have superior properties for treating or preventing a disease or condition, relative to a comparable polynucleotide lacking such features. For example, as described herein an engineered polynucleotide that comprises at least a portion of an snRNA sequence can facilitate exon skipping of an exon at a greater efficiency than a comparable polynucleotide lacking such features. Further, as described herein an engineered polynucleotide that comprises at least a portion of an snRNA sequence can facilitate an editing of a base of a nucleotide in a target RNA(e.g., a pre-mRNA or a mature RNA) at a greater efficiency than a comparable polynucleotide lacking such features. Promoters and snRNA components are described in PCT / US2021 / 028618 and PCT / US2022 / 078801, and each of these descriptions in PCT / US2021 / 028618 and PCT / US2022 / 078801 are herein incorporated by reference.

[0209] An engineered guide RNA as described herein for use in treating a disease or condition in a subject can comprise at least one chemical modification. In some embodiments, the engineered guide RNA can comprise at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 50, 100, or more chemical modifications. In some embodiments, the engineered guide RNA described herein may not comprise a chemical modification. In some cases, the engineered guide RNAs disclosed herein with barbell macrofootprints can be manufactured, chemically modified, and delivered directly to a subject in need thereof as RNA (without a vector, such as an AAV).

[0210] Exemplary chemical modifications comprise any one of: 5’ adenylate, 5’ guanosinetriphosphate cap, 5’ N7-Methylguanosine-triphosphate cap, 5’ triphosphate cap, 3’ phosphate, 3 ’thiophosphate, 5 ’phosphate, 5 ’thiophosphate, Cis-Syn thymidine dimer, trimers, C12 spacer, C3 spacer, C6 spacer, dSpacer, PC spacer, rSpacer, Spacer 18, Spacer 9,3 ’-3’ modifications, 5’- 5’ modifications, abasic, acridine, azobenzene, biotin, biotin BB, biotin TEG, cholesteryl TEG, desthiobiotin TEG, DNP TEG, DNP-X, DOTA, dT -Biotin, dual biotin, PC biotin, psoralen C2, psoralen C6, TINA, 3 ’DABCYL, black hole quencher 1, black hole quencher 2, DABCYL SE, dT -DABCYL, IRDye QC-1, QSY-21, QSY-35, QSY-7, QSY-9, carboxyl linker, thiol linkers, 2’ deoxyribonucleoside analog purine, 2 ’deoxyribonucleoside analog pyrimidine, ribonucleoside analog, 2’ -O-methyl ribonucleoside analog, sugar modified analogs, wobble / universal bases, fluorescent dye label, 2’ fluoro RNA, 2’ O-methyl RNA, methylphosphonate, phosphodiester DNA, phosphodiester RNA, phosphothioate DNA, phosphorothioate RNA, UNA, pseudouridine-5 ’ -triphosphate, 5 -methylcytidine-5 ’ -triphosphate, 2-O-methyl 3phosphorothioate or any combinations thereof.

[0211] A chemical modification can be made at any location of the engineered guide RNA. In some cases, a modification may be located in a 5’ or 3’ end, or both. In some cases, a polynucleotide can comprise a modification at a base selected from: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,I I, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62,63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110,I I I, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148,149, or 150. In some cases, more than one modification can be made to the engineered guide RNA. In some cases, a modification can be permanent. In other cases, a modification can be transient. In some cases, multiple modifications may be made to the engineered guide RNA. The engineered guide RNA modification can alter physio-chemical properties of a nucleotide, such as their conformation, polarity, hydrophobicity, chemical reactivity, base-pairing interactions, or any combination thereof.

[0212] In some embodiments, a chemical modification can also be a phosphorothioate substitute. In some cases, a natural phosphodiester bond can be susceptible to rapid degradation by cellular nucleases and a modification of intemucleotide linkage using phosphorothioate (PS) bond substitutes can be more stable towards hydrolysis by cellular degradation. A modification can increase stability in a polynucleic acid. A modification can also enhance biological activity. In some cases, a phosphorothioate enhanced RNA polynucleic acid can inhibit RNase A, RNase Tl, calf serum nucleases, or any combinations thereof. These properties can allow the use of PS- RNA polynucleic acids to be used in applications where exposure to nucleases may be of high probability in vivo or in vitro. For example, phosphorothioate (PS) bonds can be introduced between the last 3-5 nucleotides at the 5 ’-or 3 ’-end of a polynucleic acid which can inhibit exonuclease degradation. In some cases, phosphorothioate bonds can be added throughout an entire polynucleic acid to reduce attack by endonucleases.

[0213] In some embodiments, a chemical modification can occur at 3 ’OH, group, 5 ’OH group, at the backbone, at the sugar component, or at the nucleotide base. Chemical modification can include non-naturally occurring linker molecules of interstrand or intrastrand cross links. In one aspect, the chemically modified nucleic acid comprises modification of one or more of the 3 ’OH or 5 ’OH group, the backbone, the sugar component, or the nucleotide base, or addition of non- naturally occurring linker molecules. In some embodiments, a chemically modified backbone comprises a backbone other than a phosphodiester backbone. In some embodiments, a modified sugar comprises a sugar other than deoxyribose (in modified DNA) or other than ribose (modified RNA). In some embodiments, a modified base comprises a base other than adenine, guanine, cytosine, thymine or uracil. In some embodiments, the engineered guide RNA comprises at least one chemically modified base. In some instances, an engineered guide RNA can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more modified bases. In some cases, chemical modifications to the base moiety include natural and synthetic modifications of adenine, guanine, cytosine, thymine, or uracil, and purine or pyrimidine bases.

[0214] In some embodiments, a chemical modification of the engineered guide RNA can comprise a modification of any one of or any combination of: modification of one or both of the non-linking phosphate oxygens in the phosphodiester backbone linkage; modification of one ormore of the linking phosphate oxygens in the phosphodiester backbone linkage; modification of a constituent of the ribose sugar; replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring nucleobase; modification of the ribosephosphate backbone; modification of 5’ end of polynucleotide; modification of 3’ end of polynucleotide; modification of the deoxyribose phosphate backbone; substitution of the phosphate group; modification of the ribophosphate backbone; modifications to the sugar of a nucleotide; modifications to the base of a nucleotide; or stereopure of nucleotide. Chemical modifications to the engineered guide RNA include any modification contained herein, while some exemplary modifications are recited in TABLE 4.TABLE 4 - Exemplary Chemical ModificationModification of the Phosphate Backbone

[0215] In some embodiments, the chemical modification can comprise modification of one or both of the non-linking phosphate oxygens in the phosphodiester backbone linkage or modification of one or more of the linking phosphate oxygens in the phosphodiester backbone linkage. As used herein, “alkyl” may be meant to refer to a saturated hydrocarbon group which may be straight-chained or branched. Example alkyl groups include methyl (Me), ethyl (Et), propyl (e.g., n-propyl or isopropyl), butyl (e.g., n-butyl, isobutyl, or t-butyl), or pentyl (e.g., n- pentyl, isopentyl, or neopentyl). An alkyl group can contain from 1 to about 20, from 2 to about 20, from 1 to about 12, from 1 to about 8, from 1 to about 6, from 1 to about 4, or from 1 to about 3 carbon atoms. As used herein, “aryl” may refer to monocyclic or polycyclic (e.g., having 2, 3, or 4 fused rings) aromatic hydrocarbons such as, for example, phenyl, naphthyl, anthracenyl, phenanthrenyl, indanyl, or indenyl. In some embodiments, aryl groups have from 6 to about 20 carbon atoms. As used herein, “alkenyl” may refer to an aliphatic group containing at least one double bond. As used herein, “alkynyl” may refer to a straight or branched hydrocarbon chain containing 2-12 carbon atoms and characterized in having one or more triple bonds. Examples of alkynyl groups can include ethynyl, propargyl, or 3-hexynyl. “Arylalkyl”or “aralkyl” may refer to an alkyl moiety in which an alkyl hydrogen atom may be replaced by an aryl group. Aralkyl includes groups in which more than one hydrogen atom has been replaced by an aryl group. Examples of "arylalkyl" or "aralkyl" include benzyl, 2-phenylethyl, 3- phenylpropyl, 9-fluorenyl, benzhydryl, and trityl groups. “Cycloalkyl” may refer to a cyclic, bicyclic, tricyclic, or polycyclic non- aromatic hydrocarbon groups having 3 to 12 carbons. Examples of cycloalkyl moieties include, but are not limited to, cyclopropyl, cyclopentyl, and cyclohexyl. “Heterocyclyl” may refer to a monovalent radical of a heterocyclic ring system. Representative heterocyclyls include, without limitation, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, pyrrolidonyl, piperidinyl, pyrrolinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, and morpholinyl. “Heteroaryl” may refer to a monovalent radical of a heteroaromatic ring system. Examples of heteroaryl moieties can include imidazolyl, oxazolyl, thiazolyl, triazolyl, pyrrolyl, furanyl, indolyl, thiophenyl pyrazolyl, pyridinyl, pyrazinyl, pyridazinyl, pyrimidinyl, indolizinyl, purinyl, naphthyridinyl, quinolyl, and pteridinyl.

[0216] In some embodiments, the phosphate group of a chemically modified nucleotide can be modified by replacing one or more of the oxygens with a different substituent. In some embodiments, the chemically modified nucleotide can include replacement of an unmodified phosphate moiety with a modified phosphate as described herein. In some embodiments, the modification of the phosphate backbone can include alterations that result in either an uncharged linker or a charged linker with unsymmetrical charge distribution. Examples of modified phosphate groups can include phosphorothioate, phosphonothioacetate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates and phosphotriesters. In some embodiments, one of the non-bridging phosphate oxygen atoms in the phosphate backbone moiety can be replaced by any of the following groups: sulfur (S), selenium (Se), BR3 (wherein R can be, e.g., hydrogen, alkyl, or aryl), C (e.g., an alkyl group, an aryl group, and the like), H, NR2 (wherein R can be, e.g., hydrogen, alkyl, or aryl), or (wherein R can be, e.g., alkyl or aryl). The phosphorous atom in an unmodified phosphate group can be achiral. However, replacement of one of the non-bridging oxygens with one of the above atoms or groups of atoms can render the phosphorous atom chiral. A phosphorous atom in a phosphate group modified in this way may be a stereogenic center. The stereogenic phosphorous atom can possess either the "R" configuration (herein Rp) or the "S" configuration (herein Sp). In some cases, the engineered guide RNA can comprise stereopure nucleotides comprising S conformation of phosphorothioate or R conformation of phosphorothioate. In some embodiments, the chiral phosphate product may be present in a diastereomeric excess of 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the chiral phosphate product may be present in a diastereomeric excess of 95%. In some embodiments, thechiral phosphate product may be present in a diastereomeric excess of 96%. In some embodiments, the chiral phosphate product may be present in a diastereomeric excess of 97%. In some embodiments, the chiral phosphate product may be present in a diastereomeric excess of 98%. In some embodiments, the chiral phosphate product may be present in a diastereomeric excess of 99%. In some embodiments, both non-bridging oxygens of phosphorodithioates can be replaced by sulfur. The phosphorus center in the phosphorodithioates can be achiral which precludes the formation of oligoribonucleotide diastereomers. In some embodiments, modifications to one or both non-bridging oxygens can also include the replacement of the nonbridging oxygens with a group independently selected from S, Se, B, C, H, N, and OR (R can be, e.g., alkyl or aryl). In some embodiments, the phosphate linker can also be modified by replacement of a bridging oxygen, (i.e., the oxygen that links the phosphate to the nucleoside), with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylenephosphonates). In some cases, the replacement can occur at either or both of the linking oxygens.

[0217] In certain embodiments, nucleic acids comprise linked nucleic acids. Nucleic acids can be linked together using any inter nucleic acid linkage. The two main classes of inter nucleic acid linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing inter nucleic acid linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (P=S). Representative non-phosphorus containing inter nucleic acid linking groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester (-O-C(O)-S-), thionocarbamate (-O-C(O)(NH)-S-); siloxane (-O-Si(H)2-O-); and N,N* -dimethylhydrazine (-CH2-N(CH3)-N(CH3)). In certain embodiments, inter nucleic acids linkages having a chiral atom can be prepared as a racemic mixture, as separate enantiomers, e.g., alkylphosphonates and phosphorothioates. Unnatural nucleic acids can contain a single modification. Unnatural nucleic acids can contain multiple modifications within one of the moieties or between different moieties.

[0218] In some cases, backbone phosphate modifications to nucleic acid include, but are not limited to, methyl phosphonate, phosphorothioate, phosphoramidate (bridging or non-bridging), phosphotriester, phosphorodithioate, phosphodithioate, and boranophosphate, and can be used in any combination. Other non-phosphate linkages may also be used.

[0219] In some embodiments, backbone modifications (e.g., methylphosphonate, phosphorothioate, phosphoroamidate and phosphorodithioate internucleotide linkages) can confer immunomodulatory activity on the modified nucleic acid and / or enhance their stability in vivo.

[0220] In some instances, a phosphorous derivative (or modified phosphate group) may be attached to the sugar or sugar analog moiety in and can be a monophosphate, diphosphate, triphosphate, alkylphosphonate, phosphorothioate, phosphorodithioate, phosphoramidate or the like.

[0221] In some cases, backbone modification comprises replacing the phosphodiester linkage with an alternative moiety such as an anionic, neutral or cationic group. Examples of such modifications include: anionic internucleoside linkage; N3’ to P5’ phosphoramidate modification; boranophosphate DNA; prooligonucleotides; neutral intemucleoside linkages such as methylphosphonates; amide linked DNA; methylene(methylimino) linkages; formacetal and thioformacetal linkages; backbones containing sulfonyl groups; morpholino oligos; peptide nucleic acids (PNA); and positively charged deoxyribonucleic guanidine (DNG) oligos. A modified nucleic acid may comprise a chimeric or mixed backbone comprising one or more modifications, e.g., a combination of phosphate linkages such as a combination of phosphodiester and phosphorothioate linkages.

[0222] In some cases, substitutes for the phosphate include, for example, short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH2 component parts. It may be also understood in a nucleotide substitute that both the sugar and the phosphate moieties of the nucleotide can be replaced, by for example an amide type linkage (aminoethylglycine) (PNA). It may be also possible to link other types of molecules (conjugates) to nucleotides or nucleotide analogs to enhance for example, cellular uptake. In some cases, conjugates can be chemically linked to the nucleotide or nucleotide analogs. Such conjugates include but are not limited to lipid moieties such as a cholesterol moiety, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1-di-O-hexadecyl- rac-glycero-S-H-pho...

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises:(a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and(b) a DNA sequence encoding a small nuclear RNA (snRNA) processing hairpin comprising a sequence with at least 80% identity to any one of: i) SEQ ID NO: 891, ii) SEQ ID NO: 1115, iii) SEQ ID NO: 1613, or iv) SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708.

2. The polynucleotide of claim 1, wherein the DNA sequence encoding the snRNA processing hairpin comprises a sequence with at least 85%, at least 90%, or at least 90% identity to any one of SEQ ID NO: 891, SEQ ID NO: 1115, SEQ ID NO: 1613, or SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708.

3. The polynucleotide of claim 1 or claim 2, wherein the DNA sequence encoding the snRNA processing hairpin comprises a sequence of any one of SEQ ID NO: 891, SEQ ID NO: 1115, SEQ ID NO: 1613, or SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708.

4. The polynucleotide of any one of claims 1-3, wherein the DNA sequence encoding the snRNA processing hairpin is selected from: a) SEQ ID NO: 891, b) SEQ ID NO: 1115, or c) SEQ ID NO: 1613.

5. A polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises: (a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequencecontains at least one mismatch relative to the target RNA; and(b) a DNA sequence encoding a snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNA processing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin.

6. A polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises:(a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and(b) a DNA sequence encoding a snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNA processing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U7 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin.

7. The polynucleotide of any one of claims 1-6, wherein the polynucleotide further comprises a DNA sequence encoding an Sm-binding sequence or a DNA sequence encoding a variant Sm-binding sequence.

8. The polynucleotide of claim 7, wherein the DNA sequence encoding the Sm-binding sequence comprises a sequence with at least 80% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644.

9. The polynucleotide of claim 7 or claim 8, wherein the DNA sequence encoding the Sm- binding sequence comprises a sequence with at least 85%, at least 90%, or at least 90% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644.

10. The polynucleotide of claim 7 or claim 8, wherein the DNA sequence encoding the Sm- binding sequence comprises a sequence with at least 85% identity to any one of SEQ ID NO: 1635, SEQ ID NO: 1636, SEQ ID NO: 1639, SEQ ID NO: 1640, SEQ ID NO: 1641, SEQ ID NO: 1642, or SEQ ID NO: 1643.

11. The polynucleotide of any one of claims 1-10, wherein the targeting RNA sequence is from 60 bases to 200 bases in length.

12. The polynucleotide of any one of claims 1-11, wherein the target RNA is associated with a disease or condition, wherein the disease or condition is selected from the group consisting of:a neurodegenerative disease or disorder, a muscular disease or disorder, a metabolic disease or disorder, an ocular disease or disorder, a liver disease or disorder, a cancer, and any combination thereof.

13. The polynucleotide of any one of claims 1-12, wherein the target RNA is associated with a disease or condition selected from the group consisting of: Rett syndrome, Huntington’s disease, Parkinson’s Disease, Alzheimer’s disease, Stargardt disease, Usher syndrome, a muscular dystrophy, Spinal Muscular Atrophy (SMN), Faciocapulohumeral Muscular Dystrophy (FSHD), Limb Girdle Muscular Dystrophy (LGMD), Amyotrophic Lateral Sclerosis (ALS), Tay-Sachs Disease, Human Immunodeficiency Virus, familial hypercholesterolemia, diabetes, and cancer.

14. The polynucleotide of any one of claims 1-13, wherein the targeting RNA sequence, upon hybridization to a target RNA, forms a guide-target RNA scaffold comprising a structural feature selected from the group consisting of a mismatch, a bulge, an internal loop, a hairpin, and any combination thereof, wherein the structural feature substantially forms upon hybridization to the target RNA, and wherein the structural feature is not present within the engineered guide RNA prior to the hybridization of the engineered guide RNA to the target RNA.

15. The polynucleotide of claim 14, wherein the structural feature comprises the mismatch.

16. The polynucleotide of claim 14, wherein the mismatch comprises at least one adenosineguanosine (A-G) mismatch, at least one adenosine-adenosine (A-A) mismatch, or at least one adenosine-cytidine (A-C), wherein the adenosine is present in the target RNA.

17. The polynucleotide of claim 14, wherein the mismatch comprises an adenosine-cytidine (A-C) mismatch, wherein the adenosine is present in the target RNA.

18. The polynucleotide of claim 14, wherein the structural feature comprises the bulge.

19. The polynucleotide of claim 18, wherein the bulge comprises an asymmetric bulge.

20. The polynucleotide of claim 18, wherein the bulge comprises a symmetric bulge.

21. The polynucleotide of claim 14, wherein the structural feature comprises the internal loop.

22. The polynucleotide of claim 21, wherein the internal loop comprises an asymmetric internal loop.

23. The polynucleotide of claim 21, wherein the internal loop comprises a symmetric internal loop.

24. The polynucleotide of any one of claims 1-23, wherein the snRNA processing hairpin is downstream of the targeting RNA sequence.

25. The polynucleotide of any one of claims 1-24, wherein the engineered guide RNA is capable of recruiting an RNA editing entity to the target RNA when bound to the target RNA.

26. The polynucleotide of claim 25, wherein the RNA editing entity comprises an Adenosine deaminase acting on RNA (ADAR) protein, an Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC) protein, or both.

27. The polynucleotide of claim 26, wherein the RNA editing entity comprises the ADAR protein and wherein the ADAR protein comprises ADAR1 or ADAR2.

28. The polynucleotide of any one of claims 1-27, wherein the target RNA is selected from the group consisting of: ABCA4, ALAS1, APP, ATP7B, CFTR, DMD, DMPK, DUX4, GAPDH, GBA, HEXA, HFE, LIPA, LRRK2, MAPT, PCSK9 start site, PINK1, PMP22, SERPINA1, SCNN1A start site, SNCA, or SOD1, a fragment of any one of these, and any combination thereof.

29. The polynucleotide of claim 28, wherein the target RNA is SERPINA1, and wherein the SERPINA1 comprises an E342K mutation.

30. The polynucleotide of claim 28, wherein the target RNA is LRRK2, and wherein the LRRK2 comprises a G2019S mutation.

31. The polynucleotide of any one of claims 1-30, wherein the targeting RNA sequence is at least partially complementary to a splice signal proximal to an exon within the target RNA.

32. The polynucleotide of any one of claims 1-31, wherein the targeting RNA sequence is:(a) at least partially complementary to a branch point upstream of an exon within the target RNA; or(b) the targeting RNA sequence is at least partially complementary to a donor splice site downstream of an exon within the target RNA.

33. The polynucleotide of any one of claims 1-32, wherein the mismatch is located from 1 to 200 bases from either end of the targeting RNA sequence.

34. The polynucleotide of any one of claims 1-33, wherein the mismatch is located at least 45 bases from either end of the targeting RNA sequence.

35. The polynucleotide of any one of claims 1-34, further comprising a DNA sequence encoding a deaminase recruiting domain.

36. The polynucleotide of claim 35, wherein the deaminase recruiting domain comprises: GluR2, Alu, or any combination thereof.

37. The polynucleotide of claim 35 or claim 36, wherein the deaminase recruiting domain comprises a stem loop.

38. The polynucleotide of claim 37, wherein the stem loop comprises at least 80% sequence identity to a GluR2 domain.

39. The polynucleotide of any one of claims 1-38, wherein the targeting RNA sequence is at least partially complementary to a 3' or 5' untranslated region (UTR) of the target RNA.

40. The polynucleotide of any one of claims 1-39, wherein the targeting RNA sequence is at least partially complementary to a translation initiation site, a polyadenylation signal, a splice acceptor site, an upstream open reading frame, or a combination thereof.

41. The polynucleotide of any one of claims 1-39, wherein the targeting RNA sequence is at least partially complementary to an intronic region of the target RNA.

42. The polynucleotide of any one of claims 1-39, wherein the targeting RNA sequence is at least partially complementary to an exonic region of the target RNA.

43. The polynucleotide of any one of claims 1-42, wherein the engineered guide RNA is 80 nucleotides to 600 nucleotides.

44. A vector comprising the polynucleotide of any one of claims 1-43.

45. The vector of claim 44, wherein the vector comprises a liposome, a nanoparticle, or a dendrimer.

46. The vector of claim 44 or claim 45, wherein the vector is a viral vector.

47. The vector of claim 46, wherein the viral vector is an adeno-associated viral (AAV) vector.

48. The vector of claim 47, wherein the AAV is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.OligoOOl, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.Vl, AAV.PHP.B, AAV.PhB.Cl, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, chimeras thereof, and combinations thereof.

49. A pharmaceutical composition comprising the polynucleotide of any one of claims 1-43 or the vector of any one of claims 44-48 and a pharmaceutically acceptable excipient, diluent, or carrier.

50. A method of administering an effective amount of a pharmaceutical composition comprising a polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises:(a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and(b) a DNA sequence encoding a small nuclear RNA (snRNA) processing hairpin comprising a sequence with at least 80% identity to any one of: i) SEQ ID NO: 891, ii) SEQ ID NO: 1115, iii) SEQ ID NO: 1613, or iv) SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708, to a subject.

51. The method of claim 50, wherein the pharmaceutical composition is the pharmaceutical composition of claim 49.

52. The method of claim 51 or claim 52, wherein the administration comprises inhalation, otic, buccal, conjunctival, dental, endocervical, endosinusial, endotracheal, enteral, epidural, extra-amniotic, extracorporeal, hemodialysis, infiltration, interstitial, intraabdominal, intraamniotic, intraarterial, intraarticular, intrabiliary, intrabronchial, intrabursal, intracardiac, intracartilaginous, intracaudal, intracavemous, intracavitary, intracerebroventricular, intracistemal, intracorneal, intracoronal, intracoronary, intracorpous cavernaosum, intradermal, intradiscal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intrahippocampal, intraileal, intralesional, intraluminal, intralymphatic, intramedullary, intrameningeal, intramuscular, intraocular, intraovarian, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratendinous, intratesticular, intrathoracic, intratubular, intratumor, intratympanic, intrauterine, intravascular, intravenous, intravenous bolus, intravenous drip, intravesical, intravitreal, iontophoresis, irrigation, laryngeal, nasal, nasogastric, ophthalmic, oral, oropharyngeal, parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, retrobulbar, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, vaginal, infraorbital, intraparenchymal, intrathecal, intraventricular, stereotactic administration, or any combination thereof.

53. A method of expressing a targeting RNA sequence in a cell, the method comprising delivering the polynucleotide of any one of claims 1-43, the vector of any one of claims 44-48, or the pharmaceutical composition of claim 49 to a cell and expressing the targeting RNA sequence encoded by the polynucleotide in the cell.

54. A method of editing a target RNA, the method comprising: delivering the polynucleotide of any one of claims 1-43, the vector of any one of claims 44-48, or the pharmaceutical composition of claim 49 to a cell encoding the target RNA; expressing the targeting RNA sequence in the cell, wherein the targeting RNA sequence comprises an engineered guide RNA capable of hybridizing to a target RNA; forming a guide-target RNA scaffold upon hybridization of the targeting RNA sequence to the target RNA; recruiting an editing enzyme to the target RNA; and editing the target RNA with the editing enzyme.

55. A method of editing a target RNA, the method comprising: delivering a polynucleotide encoding an engineered RNA to a cell encoding the target RNA, wherein the polynucleotide comprises:(a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and(b) a DNA sequence encoding a small nuclear RNA (snRNA) processing hairpin comprising a sequence with at least 80% identity to any one of: i) SEQ ID NO: 891, ii) SEQ ID NO: 1115, iii) SEQ ID NO: 1613, or iv) SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708; expressing the targeting RNA sequence in the cell, wherein the targeting RNA sequence comprises an engineered guide RNA capable of hybridizing to a target RNA; forming a guide-target RNA scaffold upon hybridization of the targeting RNA sequence to the target RNA; recruiting an editing enzyme to the target RNA; and editing the target RNA with the editing enzyme.

56. The method of claim 55, wherein the DNA sequence encoding the snRNA processing hairpin comprises a sequence with at least 85%, at least 90%, or at least 90% identity to any one of SEQ ID NO: 891, SEQ ID NO: 1115, SEQ ID NO: 1613, or SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708.

57. The method of claim 55 or claim 56, wherein the DNA sequence encoding the snRNA processing hairpin comprises a sequence of any one of SEQ ID NO: 891 , SEQ ID NO: 1115, SEQ ID NO: 1613, or SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO:1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708.

58. The method of any one of claims 55-57, wherein the DNA sequence encoding the snRNA processing hairpin is selected from: a) SEQ ID NO: 891,b) SEQ ID NO: 1115, or c) SEQ ID NO: 1613.

59. A method of editing a target RNA, the method comprising: delivering a polynucleotide encoding an engineered RNA to a cell encoding the target RNA, wherein the polynucleotide comprises:(a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and(b) a DNA sequence encoding a snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNA processing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin; expressing the targeting RNA sequence in the cell, wherein the targeting RNA sequence comprises an engineered guide RNA capable of hybridizing to a target RNA; forming a guide-target RNA scaffold upon hybridization of the targeting RNA sequence to the target RNA; recruiting an editing enzyme to the target RNA; and editing the target RNA with the editing enzyme.

60. A method of editing a target RNA, the method comprising: delivering a polynucleotide encoding an engineered RNA to a cell encoding the target RNA, wherein the polynucleotide comprises:(a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and(b) a DNA sequence encoding a snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNA processing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U7 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin; expressing the targeting RNA sequence in the cell, wherein the targeting RNA sequence comprises an engineered guide RNA capable of hybridizing to a target RNA; forming a guide-target RNA scaffold upon hybridization of the targeting RNA sequence to the target RNA;recruiting an editing enzyme to the target RNA; and editing the target RNA with the editing enzyme.

61. The method of any one of claims 55-60, wherein the polynucleotide further comprises a DNA sequence encoding an Sm-binding sequence or a DNA sequence encoding a variant Sm- binding sequence.

62. The method of claim 61, wherein the DNA sequence encoding the Sm-binding sequence comprises a sequence with at least 80% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644.

63. The method of claim 61 or claim 62, wherein the DNA sequence encoding the Sm- binding sequence comprises a sequence with at least 85%, at least 90%, or at least 90% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644.

64. The method of claim 61 or claim 62, wherein the DNA sequence encoding the Sm- binding sequence comprises a sequence with at least 85% identity to any one of SEQ ID NO: 1635, SEQ ID NO: 1636, SEQ ID NO: 1639, SEQ ID NO: 1640, SEQ ID NO: 1641, SEQ ID NO: 1642, or SEQ ID NO: 1643.

65. The method of any one of claims 55-64, wherein the targeting RNA sequence is from 60 bases to 200 bases in length.

66. The method of any one of claims 53-65, wherein the target RNA comprises a mutation relative to a wild type sequence.

67. The method of claim 66, wherein editing the target RNA corrects the mutation in the target RNA.

68. The method of claim 66 or claim 67, wherein the mutation is a missense mutation.

69. The method of claim 66 or claim 67, wherein the mutation is a nonsense mutation.

70. The method of any one of claims 66-69, wherein the mutation is a G to A mutation.

71. The method of any one of claims 66-70, wherein the mutation is associated with a disease.

72. The method of claim 71, wherein the disease is a synucleinopathy, Parkinson’s disease, Lewy body dementia, multiple system atrophy, Charcot-Marie-Tooth disease, hereditaryneuropathy with liability to pressure palsies, Yuan-Harel-Lupski syndrome, a tauopathy, Alzheimer’s disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn’s disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha- 1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease.

73. The method of any one of claims 53-72, wherein the target RNA encodes a-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine rich repeat kinase 2 (LRRK2), Tau (MAPT), progranulin (GRN), a duplication of PMP22 associated with Charcot-Marie-Tooth disease type 1 A (CMT1 A), ATP -binding cassette sub-family A member 4 (ABCA4), amyloid precursor protein (APP), alpha- 1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl CpG binding protein 2 (MECP2).

74. The method of claim 54-73, wherein editing the target RNA comprises editing an untranslated region of the target RNA.

75. The method of claim 74, wherein the untranslated region is a 5’ untranslated region or a 3 ’ untranslated region.

76. The method of claim 75, wherein the 3’ untranslated region is a polyadenylation sequence.

77. The method of any one of claims 54-76, wherein editing the target RNA comprises editing a translation initiation site.

78. The method of any one of claims 54-77, wherein editing the target RNA alters expression of the target RNA.

79. The method of claim 78, wherein editing the target RNA increases expression of the target RNA.

80. The method of claim 78, wherein editing the target RNA decreases expression of the target RNA.

81. The method of any one of claims 53-80, wherein the engineered guide RNA is capable of recruiting an RNA editing entity to the target RNA when bound to the target RNA.

82. The method of claim 81, wherein the RNA editing entity comprises an Adenosine deaminase acting on RNA (ADAR) protein, an Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC) protein, or both.

83. The method of claim 82, wherein the RNA editing entity comprises the ADAR protein and wherein the ADAR protein comprises AD ARI or ADAR2.

84. A method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising the polynucleotide of any one of claims 1-43, the vector of any one of claims 44-48, or the pharmaceutical composition of claim 49; delivering the polynucleotide to a cell of the subject; and expressing the targeting RNA sequence in the cell, thereby treating the disease.

85. A method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising a polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises:(a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and(b) a DNA sequence encoding a small nuclear RNA (snRNA) processing hairpin comprising a sequence with at least 80% identity to any one of: i) SEQ ID NO: 891, ii) SEQ ID NO: 1115, iii) SEQ ID NO: 1613, or iv) SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708; delivering the polynucleotide to a cell of the subject; and expressing the targeting RNA sequence in the cell, thereby treating the disease.

86. The method of claim 85, wherein the DNA sequence encoding the snRNA processing hairpin comprises a sequence with at least 85%, at least 90%, or at least 90% identity to any one of SEQ ID NO: 891, SEQ ID NO: 1115, SEQ ID NO: 1613, or SEQ ID NO: 812 - SEQ ID NO:890, SEQ ID NO: 892 - SEQ ID NO: 1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708.

87. The method of claim 85 or claim 86, wherein the DNA sequence encoding the snRNA processing hairpin comprises a sequence of any one of SEQ ID NO: 891 , SEQ ID NO: 1115, SEQ ID NO: 1613, or SEQ ID NO: 812 - SEQ ID NO: 890, SEQ ID NO: 892 - SEQ ID NO:1114, SEQ ID NO: 1116 - SEQ ID NO: 1612, SEQ ID NO: 1614 - SEQ ID NO: 1622, or SEQ ID NO: 1702 - SEQ ID NO: 1708.

88. The method of any one of claims 85-87, wherein the DNA sequence encoding the snRNA processing hairpin is selected from: a) SEQ ID NO: 891, b) SEQ ID NO: 1115, or c) SEQ ID NO: 1613.

89. A method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising a polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises:(a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and(b) a DNA sequence encoding a snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNA processing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin; delivering the polynucleotide to a cell of the subject; and expressing the targeting RNA sequence in the cell, thereby treating the disease.

90. A method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising a polynucleotide encoding an engineered RNA, wherein the polynucleotide comprises:(a) a DNA sequence encoding a targeting RNA sequence comprising at least 50 nucleotides having complementarity to a target RNA, wherein the targeting RNA sequence contains at least one mismatch relative to the target RNA; and(b) a DNA sequence encoding a snRNA processing hairpin sequence, wherein the snRNA processing hairpin sequence is a U1 snRNA processing hairpin, U2 snRNAprocessing hairpin, U4 snRNA processing hairpin, U5 snRNA processing hairpin, U7 snRNA processing hairpin, U11 snRNA processing hairpin, U12 snRNA processing hairpin; delivering the polynucleotide to a cell of the subject; and expressing the targeting RNA sequence in the cell, thereby treating the disease.

91. The method of any one of claims 85-90, wherein the polynucleotide further comprises a DNA sequence encoding an Sm-binding sequence or a DNA sequence encoding a variant Sm- binding sequence.

92. The method of claim 91, wherein the DNA sequence encoding the Sm-binding sequence comprises a sequence with at least 80% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644.

93. The method of claim 91 or claim 92, wherein the DNA sequence encoding the Sm- binding sequence comprises a sequence with at least 85%, at least 90%, or at least 90% identity to any one of SEQ ID NO: 1634 - SEQ ID NO: 1644.

94. The method of claim 91 or claim 92, wherein the DNA sequence encoding the Sm- binding sequence comprises a sequence with at least 85% identity to any one of SEQ ID NO: 1635, SEQ ID NO: 1636, SEQ ID NO: 1639, SEQ ID NO: 1640, SEQ ID NO: 1641, SEQ ID NO: 1642, or SEQ ID NO: 1643.

95. The method of any one of claims 85-94, wherein the targeting RNA sequence is from 60 bases to 200 bases in length.

96. The method of any one of claims 84-95, wherein the disease is a synucleinopathy, Parkinson’s disease, Lewy body dementia, multiple system atrophy, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, Yuan-Harel-Lupski syndrome, a tauopathy, Alzheimer’s disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn’s disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha- 1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease.

97. The method of any one of claims 84-96, wherein the targeting RNA sequence comprises an engineered guide RNA that hybridizes to a target RNA, and wherein the cell encodes the target RNA.

98. The method of claim 97, wherein the target RNA encodes a-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine rich repeat kinase 2 (LRRK2), Tau (MAPT), progranulin (GRN), a duplication of the PMP22 associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP -binding cassette sub-family A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl CpG binding protein 2 (MECP2).

99. The method of claim 97 or claim 98, further comprising forming a guide-target RNA scaffold upon hybridization of the engineered guide RNA to the target RNA, recruiting an editing enzyme to the target RNA, and editing the target RNA with the editing enzyme.

100. The method of any one of claims 97-99, wherein the target RNA comprises a mutation relative to a wild type sequence.

101. The method of claim 100, wherein editing the target RNA corrects the mutation in the target RNA.

102. The method of claim 100 or claim 101, wherein the mutation is a missense mutation.

103. The method of claim 100 or claim 101, wherein the mutation is a nonsense mutation.

104. The method of any one of claims 100-103, wherein the mutation is a G to A mutation.

105. The method of any one of claims 100-104, wherein the mutation is associated with the disease.

106. The method of any one of claims 99-102, wherein editing the target RNA comprises editing an untranslated region of the target RNA.

107. The method of claim 106, wherein the untranslated region is a 5’ untranslated region or a 3 ’ untranslated region.

108. The method of claim 107, wherein the 3’ untranslated region is a polyadenylation sequence.

109. The method of any one of claims 99-108, wherein editing the target RNA comprises editing a translation initiation site.

110. The method of any one of claims 99-109, wherein editing the target RNA alters expression of the target RNA.

111. The method of claim 110, wherein editing the target RNA increases expression of the target RNA.

112. The method of claim 110, wherein editing the target RNA decreases expression of the target RNA.

113. The method of any one of claims 54-83 or 99-112, wherein the guide-target RNA scaffold comprises a structural feature.

114. The method of claim 113, wherein the structural feature is a bulge, a mismatch, an internal loop, a hairpin, or combinations thereof.

115. The method of claim 114, wherein the structural feature comprises the bulge, and wherein the bulge is a symmetric bulge.

116. The method of claim 114, wherein the structural feature comprises the bulge, and wherein the bulge is an asymmetric bulge.

117. The method of any one of claims 113-116, wherein the structural feature comprises the internal loop, and wherein the internal loop is a symmetric internal loop.

118. The method of any one of claims 113-117, wherein the structural feature comprises the internal loop, and wherein the internal loop is an asymmetric internal loop.

119. The method of any one of claims 113-118, wherein the structural feature comprises the hairpin, and wherein the hairpin is a recruitment hairpin or a non-recruitment hairpin.

120. The method of any one of claims 54-83 or 99-119, wherein the guide-target RNA scaffold comprises a Wobble base pair.

121. The method of any one of claims 54-83 or 99-120, wherein the editing enzyme comprises an ADAR, an APOBEC, or a Cas nuclease.

122. The method of claim 121, wherein the ADAR comprises ADAR1, ADAR2, ADAR3, or combinations thereof.

123. The method of any one of claims 54-122, wherein the target RNA is a mRNA or a pre- mRNA.

124. The method of any one of claims 54-83 or 99-123, wherein editing the target RNA comprises deamidating a nucleotide of the target RNA.

125. The method of any one of claims 54-83 or 99-124, wherein the target RNA is edited with an efficiency of at least 10%, at least 20%, or at least 25%.

Images