Enhancing cardiac regeneration: the role of fibronectin in stem cell-derived epicardialcardiomyocyte crosstalk

Abstract

Provided herein are compositions comprising cardiomyocytes and exogenous fibronectin, and uses thereof. The invention also relates to tissue particles comprising cardiomyocytes and exogenous fibronectin in the treatment of cardiovascular conditions including cardiac infarction.

Description

[0001] COMPOSITION

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to compositions comprising cardiomyocytes and exogenous fibronectin and uses thereof. The invention also relates to tissue particles comprising cardiomyocytes and exogenous fibronectin in the treatment of cardiovascular conditions including myocardial infarction, ischaemia, cardiomyopathy, congenital heart disease or intractable arrhythmias.

[0004] BACKGROUND TO THE INVENTION

[0005] The global burden of heart failure is reflected by an estimated 37.7 million patients, of whom 50% will not survive the 5 years following their diagnosis (Ziaeian and Fonarow 2016; Zarrinkoub et al., 2013). A large proportion of heart failure is due to ischemic myocardial injury resulting in loss of contractile working myocardium. The only curative therapeutic option is heart transplantation, which is substantially hampered by a severe shortage of donor organs. Regenerative cardiovascular medicine has the potential to address the loss of contractile function by remuscularizing the failing heart. Transplantation of human pluripotent stem cell (hPSC)-derived cardiomyocytes (CMs) results in formation of robust cardiac grafts in rodents (Laflamme et al., 2007; Shiba et al., 2013) and non-human primates (Chong et al., 2014; Shiba et al., 2016), and improves cardiac function (Liu et al., 2018). Aside from direct intramyocardial cell injection, an alternative approach is to generate 3D-engineered heart tissues (3D-EHTs) to be transplanted on the epicardium (Weinberger et al., 2016; Tiburcy et al., 2017), the epicardium being an essential embryonic source of cardiac fibroblasts and coronary smooth muscle cells, which contribute to the formation of the extracellular niche and the coronary vasculature, respectively (Guadix et al., 2006; Gittenbergerde Groot et al., 1998).

[0006] However, current shortcomings limiting the efficiency of hPSC based therapeutic applications include hPSC-CM immaturity, lack of vascular supply, and limited CM proliferation following engraftment, resulting in suboptimal function and tissue repair. The generation of cardiovascular tissues with enhanced structure and function will aid in overcoming these limitations. So far, efforts have been made involving human embryonic stem cell (hESC)-derived epicardial cells (EPls). hESC-EPIs have been demonstrated to promote hESC-CM structural and functional maturity both in vitro in 3D-EHTs and in vivo in infarcted athymic rats, improving cardiac function and graft vascularization following transplantation (Bargehr et al., 2019). Nevertheless, there remains a need for methods of regeneration of cardiovascular tissues that overcomes the above issues. In particular, there is a need for improved methods of regenerating cardiovascular tissues that are (i) simpler than existing methods and (ii) able to produce results with greater consistency and tolerability to patients, such as methods that do not involve multiple cell types for transplantation.

[0007] SUMMARY OF THE INVENTION

[0008] The inventors have identified that fibronectin (FN1) plays a potent role as an enhancer of CM structure and function in 3D-EHTs. Accordingly, the present invention relates to a composition for production of engineered heart tissue, the composition comprising cardiomyocytes; and exogenous fibronectin.

[0009] Suitably, the exogenous fibronectin is present at a concentration of about at least 10 pg / ml.

[0010] Suitably, the exogenous fibronectin is present at a concentration of about 10 pg / ml to 100 ug / ml.

[0011] Suitably, the exogenous fibronectin comprises recombinant fibronectin.

[0012] Suitably, the exogenous fibronectin comprises isolated and / or purified fibronectin.

[0013] Suitably, the fibronectin has been produced in vitro.

[0014] Suitably, the cardiomyocytes are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

[0015] Suitably, the composition further comprises in vitro differentiated epicardial cells or differentiated progeny thereof.

[0016] Suitably, the epicardial cells or their progeny are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

[0017] Suitably, the cardiomyocytes are present at a ratio of about 2: 1 to 10:1 relative to the epicardial cells or progeny thereof.

[0018] Suitably, the composition further comprises one or more of ZVAD-FMK, Bck-XL, Cyclosporin A, pinacidil and / or IGF-1. The invention also provides a tissue particle comprising cardiomyocytes in a composition comprising exogenous fibronectin; wherein the composition is for culturing cells.

[0019] Suitably, the exogenous fibronectin is present at a concentration of about at least 10 pg / ml.

[0020] Suitably, the exogenous fibronectin is present at a concentration of about 10 pg / ml to 100 pg / ml.

[0021] Suitably, the exogenous fibronectin comprises recombinant fibronectin.

[0022] Suitably, the exogenous fibronectin comprises isolated and / or purified fibronectin.

[0023] Suitably, the fibronectin has been produced in vitro.

[0024] Suitably, the cardiomyocytes are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

[0025] Suitably, the composition further comprises in vitro differentiated epicardial cells or differentiated progeny thereof.

[0026] Suitably, the epicardial cells or their progeny are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

[0027] Suitably, the cardiomyocytes are present at a ratio of about 2: 1 to 10:1 relative to the epicardial cells or progeny thereof.

[0028] Suitably, the composition further comprises one or more of ZVAD-FMK, Bck-XL, Cyclosporin A, pinacidil and / or IGF-1.

[0029] Suitably, the tissue particle comprises engineered heart tissue and / or a suspension of cells.

[0030] The invention also provides a method of forming engineered heart tissue, the method comprising: providing a mixture of cardiomyocytes and exogenous fibronectin into a vessel; mixing the mixture with a matrix composition to form a gel; culturing the gel.

[0031] Suitably, the exogenous fibronectin is present at a concentration of about at least 10 pg / ml, optionally about 10 pg / ml to 100 pg / ml. Suitably, the exogenous fibronectin comprises recombinant fibronectin.

[0032] Suitably, the exogenous fibronectin comprises isolated and / or purified fibronectin.

[0033] Suitably, the fibronectin has been produced in vitro.

[0034] Suitably, the cardiomyocytes are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

[0035] Suitably, the composition further comprises in vitro differentiated epicardial cells or differentiated progeny thereof.

[0036] Suitably, the epicardial cells or their progeny are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

[0037] Suitably, the cardiomyocytes are present at a ratio of about 2: 1 to 10: 1 relative to the epicardial cells or progeny thereof.

[0038] Suitably, wherein the composition further comprises one or more of ZVAD-FMK, Bck-XL, Cyclosporin A, pinacidil and / or IGF-1

[0039] The invention also provides a method of promoting engraftment of cardiomyocytes into cardiac tissue, the method comprising administering to cardiac tissue of a subject in need thereof, a thereof a mixture comprising cardiomyocytes and exogenous fibronectin.

[0040] Suitably, the mixture comprises a composition as disclosed herein or a tissue particle as disclosed herein.

[0041] The invention also provides a method of promoting a mature phenotype of transplanted human cardiomyocytes, the method comprising administering to cardiac tissue of a subject in need thereof a mixture comprising cardiomyocytes and exogenous fibronectin.

[0042] Suitably, the mixture comprises a composition as disclosed herein or a tissue particle as disclosed herein.

[0043] Suitably, the cardiomyocyte maturity is indicated by one or more of an increase in sarcomere length, an increase in cardiomyocyte diameter or length, an increase in active force generation, an increase in passive force generation, expression of the cardiac isoform, cTnT, oftroponin, and connexin 43 expression when cardiomyocytes are transplanted in combination with epicardial cells, relative to cardiomyocyte transplantation alone. The invention also provides a method of treating or preventing a cardiovascular condition or disease, the method comprising administering to cardiac tissue of a subject in need thereof, a mixture comprising cardiomyocytes and exogenous fibronectin.

[0044] Suitably, the mixture comprises a composition as disclosed herein or a tissue particle as disclosed herein.

[0045] Suitably, the subject has suffered from a cardiac infarction.

[0046] Suitably, the cardiovascular condition or disease is myocardial infarction, ischemia, cardiomyopathy, congenital heart disease or intractable arrhythmias.

[0047] The invention also provides a mixture comprising cardiomyocytes and exogenous fibronectin for use in a method of treating or preventing a cardiovascular condition or disease, the method comprising administering the mixture to cardiac tissue of a subject in need.

[0048] Suitably, the mixture comprises a composition as disclosed herein or a tissue particle as disclosed herein.

[0049] Suitably, the subject has suffered from a cardiac infarction.

[0050] Suitably, the cardiovascular condition or disease is myocardial infarction, ischemia, cardiomyopathy, congenital heart disease or intractable arrhythmias.

[0051] The invention also provides use of a mixture comprising cardiomyocytes and exogenous fibronectin in the manufacture of a medicament for the treatment or prevention of a cardiovascular condition or disease, comprising administering the mixture to cardiac tissue of a subject in need.

[0052] Suitably, the mixture comprises a composition as disclosed herein or a tissue particle as disclosed herein.

[0053] Suitably, the subject has suffered from a cardiac infarction.

[0054] Suitably, the cardiovascular condition or disease is myocardial infarction, ischemia, cardiomyopathy, congenital heart disease or intractable arrhythmias.

[0055] The invention also provides an in vitro method of promoting maturity of cardiomyocytes, the method comprising culturing cardiomyocytes in the presence of exogenous fibronectin.

[0056] Suitably, the cardiomyocytes are cultured in the presence of a composition according as disclosed herein or a tissue particle disclosed herein. Suitably, the exogenous fibronectin is present at a concentration of about at least 10 pg / ml.

[0057] Suitably, the exogenous fibronectin is present at a concentration of about 10 pg / ml to 100 pg / ml.

[0058] Suitably, the exogenous fibronectin comprise recombinant fibronectin.

[0059] Suitably, the exogenous fibronectin comprises isolated and / or purified fibronectin.

[0060] Suitably, the fibronectin has been produced in vitro.

[0061] Suitably, the cardiomyocytes are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

[0062] Suitably, in relation to the compositions disclosed herein or the tissue particle disclosed herein or any of the methods disclosed herein, the cardiomyocytes comprise human cardiomyocytes.

[0063] Suitably, in relation to the compositions disclosed herein or the tissue particle disclosed herein or any of the methods disclosed herein, the cardiomyocytes comprise in vitro differentiated cardiomyocytes.

[0064] BRIEF DESCRIPTION OF THE FIGURES

[0065] Figure 1 : shows the generation of 3D-EHTs with optimized cell ratios: (A) Schematic for derivation of hESC-CMs; (B) Schematic for derivation of hESC epicardium; (C) Schematic for the generation of collagen-based 3D-EHTs containing hESC-CMs and EPls and their subsequent histological and functional assessment; (D) Frank-Starling curves of active force generation of 3D-EHTs containing CM only, CM + 10% hESC epicardium, CM + 30% hESC epicardium, or CM+50% hESC epicardium; (E) slope of active force generation; (F) Ca2+-upstroke velocity of 3D-EHTs containing CM only, CM + 10% hESC epicardium, CM + 30% hESC epicardium, or CM + 50% hESC epicardium; (G) Time to peak Ca2+- fluorescence in 3D-EHTs containing CM only, CM + 10% hESC epicardium, CM + 30% hESC epicardium, or CM + 50% hESC epicardium; and (F and G) presented calcium cycling data were taken from constructs paced at 1 Hz. Data presented as mean values; error bars represent SEM. *p < 0.05, **p < 0.005, ***p < 0.0001. Two-sided p values were calculated using a one-way ANOVA with post hoc correction for multiple comparisons. Each experimental group included N = 3 biological replicates. Figure 2: shows pharmacological inhibition of epicardial FN1 with pUR4 results in impaired FN1 binding to integrin a5b1 and reduced CM maturation: (A) Schematic describing the mechanism of action of the recombinant peptide pUR4. PLIR4 prevents FN1 from binding to the cell surface receptor integrin a5b1 , hence preventing FN fibrillogenesis and signal transduction; (B) Marked reduction of FN1 expression at the protein level 72 h post treatment of hESC epicardium with pUR4; (C-E) 3D-EHTs containing CM alone or EPI + CM, untreated or treated with pUR4; (C) Confocal images showing FN1 deposition following treatment with pUR4. Scale bar, 5 pm; (D) Quantification of FN1 following inhibition with pUR4; (E) Confocal images showing expression of integrin a5b1 following treatment with pUR4; (F and G) Structural cardiac maturation as expressed by sarcomeric length (F) and sarcomere alignment (G) in 3D-EHTs containing CM only or CM + EPI with or without treatment with pUR4; (H and I) Frank-Starling curves of active force generation (H) and slopes of active force (I) of 3D-EHTs containing CM only, CM + pUR4, CM +EPI, or CM + EPI + pUR4; (J and K) Frank-Starling curves of passive force generation of 3D-EHTs containing CM only, CM + pUR4, CM + EPI, or CM + EPI + pUR4; and (L-O) Ca2+ kinetics of 3D-EHTs containing CM only or CM + EPI with or without treatment with pUR4. All experimental groups had N = 3 biological replicates. (L and M) Ca2+ kinetics including upstroke velocity and time to peak fluorescence of 3D-EHTs containing CM only or CM+EPI with or without treatment with pUR4. (N and O) Ca2+ kinetics including time to 50% decay and time to 90% decay of 3D-EHTs containing CM only or CM+EPI with or without treatment with pUR4. Mean values; error bars represent SEM. *p < 0.05, **p < 0.005, ***p < 0.001, ****p < 0.0001.

[0066] Figure 3: shows constitutive loss of epicardial FN1 using a Crispr-Cas9-edited KO hESC line results in impaired CM maturation: (A) Cobblestone morphology and WT1 expression in Crispr-Cas9-edited KO FN1 epicardium. Scale bar, 20 pm; (B) RNA expression of the key epicardial markers WT1, TCF21, TBX18, and BNC1 in EPls derived from H9-hESCs, RUES2-hESCs, and RUES2-hESC with KOFN; (C) Confocal images showing FN1 expression in day 10 epicardium in KOFN and WT EPls respectively. Scale bar, 50 pm; (D) RNA expression of FN1 in H9-WT, H9-EPI, and RUES2-EPI; (E-Q) EPls and CMs were derived from RLIES2 hESC; (E and F) Confocal images showing FN1 (E) and a5b1 expression; (F) in 3D-EHTs of constructs containing CM only, CM + EPI, or CM + KOFN EPI. Scale bar, 5 pm; (G) Quantification of FN1 expression by fluorescent intensity; (H and I) Structural cardiac maturation as expressed by sarcomeric length (H) and sarcomere alignment (I) in 3D-EHTs containing CM only, CM + EPI, or CM + KOFN EPI; (J and K) Frank-Starling curves of active force generation (J) and slopes of active force (K) of 3D-EHTs containing CM only, CM + EPI, or CM + KOFN EPI; (L and M) Frank-Starling curves of passive force generation (L) and slopes of passive force (M) of 3D-EHTs containing CM only, CM + EPI, or CM + KOFN EPI; (N-Q) Ca2+-kinetics of 3D-EHTs containing CM only, CM + EPI, or KOFN EPI; and (E-Q) EPls and CMs were derived from RLIES2 hESC. All experimental groups had N = 4 biological replicates. Mean values; error bars represent SEM. *p < 0.05, **p < 0.005, ***p < 0.001 , ****p < 0.0001. Two-sided p values were calculated using a one-way ANOVA with post hoc correction for multiple comparisons.

[0067] Figure 4: shows temporal loss of epicardial FN1 expression with a tetracyclineinducible KD is sufficient to abrogate CM maturation: (A) RNA expression of the key epicardial markersWTI, TCF21, and BNC1 in three sOPTiKD-FN1 clones, with the highest expression in clone 5.3; (B) RNA expression in three sOPTiKD-FN1 clones following tetracycline exposure, with the greatest reduction in clone 5.3; (C) Cobblestone morphology and WT1 expression in clone 5.3 differentiated to D8 hESC epicardium following 24 h of tetracycline induction. Scale bar, 20 pm; (D) Confocal images showing FN1 expression in 3D-EHTs containing CM only, CM + sOPTiKD-FN1 EPI without tetracycline, and CM + sOPTiKD-FN1 EPI exposed to tetracycline; (E) Quantification of FN1 expression by fluorescent intensity; (F and G) Structural cardiac maturation as expressed by sarcomeric length (F) and sarcomere alignment (G) in 3D-EHTs containing CM only, CM + sOPTiKD- FN1 EPI without tetracycline, and CM + sOPTiKD-FN1 EPI exposed to tetracycline; (H and I) Frank-Starling curves of active force generation (H) and slopes of active force (I) of 3D- EHTs containing CM only, CM + sOPTiKDFNI EPI without tetracycline, and CM + sOPTiKD- FN1 EPI exposed to tetracycline; (J and K) Frank-Starling curves of passive force generation (J) and slopes of passive force (K) of 3D-EHTs containing CM only, CM + sOPTiKDFNI EPI without tetracycline, and CM + sOPTiKD-FN1 EPI exposed to tetracycline; and (L-O) Ca2+ kinetics of 3D-EHTs containing CM only, CM + sOPTiKD-FN1 EPI without tetracycline, and CM + sOPTiKD-FN1 EPI exposed to tetracycline. Each experimental group included N = 3 biological replicates. Mean values; error bars represent SEM. *p < 0.05, **p < 0.005. Two-sided p values were calculated using a one-way ANOVA with post hoc correction for multiple comparisons.

[0068] Figure 5: shows the addition of rhFN1 increases hPSC-CM maturity in 3D-EHTs without the presence of hPSC-EPI: (A) Immunofluorescent imaging of 3D-EHTs shows the arrangement of alpha-actinin within sarcomeres and localization of connexin-43 in constructs containing hPSC-CMs, hPSC-CMs + hPSC-EPIs, or hPSC-CMs + rhFN1 at varied concentrations; sarcomere lengths are quantified in (B); (C) Immunofluorescent imaging of 3D-EHTs highlighting the quantify of FN1 and collagen deposited within constructs containing hPSCCMs, hPSC-CMs + hPSC-EPIs, or hPSC-CMs + rhFN1 at varied concentrations; FN1 intensities are quantified in (D); (E-H) (E) Frank-Starling curves of active force generation and (F) slopes of active force, as well as (G) curves of passive force and (H) slopes of passive force measured from 3D-EHTs containing hPSC-CMs, hPSC-CMs + hPSC-EPIs, or hPSC-CMs + rhFN1 at varied concentrations; (l-L) Ca2+ kinetics of 3D- EHTs containing hPSC-CMs, hPSC-CMs + hPSC-EPIs, or hPSC-CMs + rhFN1 at varied concentrations. Each experimental group included a minimum of N = 3 biological replicates; (I and J) Ca2+ kinetics including upstroke velocity and time to peak fluorescence of 3D- EHTs containing hPSC-CMs, hPSC-CMs + hPSC-EPIs, or hPSC-CMs + rhFN1 at varied concentrations; and (K and L) Ca2+kinetics including time to 50% decay and time to 90% decay of 3D-EHTs containing hPSC-CMs, hPSC-CMs + hPSC-EPIs, or hPSC-CMs + rhFN1 at varied concentrations. Mean values; error bars represent SEM. *p < 0.05, **p < 0.005.

[0069] Figure 6: shows The EPI-CM interactome reveals a regulatory gene network driving cardiac development and regeneration: (A) Schematic overview of the study design and experimental procedure. Epicardial secretome and CM membranome were first derived using RNA sequencing. Both datasets were next integrated to generate the EPI-CM interactome, revealing a unique signaling network of regenerative pathways driving cardiac development and tissue repair. All pathways were finally ascribed reparative categories constituting a reference library for cardiac repair; (B) The interactome between hESC-EPI secretome and hESC-CM membranome. Blue nodes on the left represent genes encoding for secreted factors expressed by hESC-EPIs compared with expression in hESC-NC, shown in gray. Orange nodes on the right depict genes encoding membrane-bound receptors expressed by hESC-CM compared with hESC. All binary hESC-EPI to hESC-CM interactions with an experimental score of above 700 in STRINGdb are shown, including a second layer of interactions formed from associations with an experimental score above 400. Respective interactions are shown with gray lines. CEPI-CM regulatory gene network driving cardiac development and regeneration; and (C) hESC-EPI-secreted genes are shown as diamond symbols on blue background, and hESC-CM membrane genes are displayed as circles on red background. Interactions with a STRINGdb score of greater than 700 are shown as bold lines and those with a STRINGdb score of less than 700 as fine lines. Strength of gene expression is expressed as L2FC and visualized by the gray tone in hESC- EPI-secreted and hESC-CM membrane gene symbols. The color of the connecting line between two genes describes the reparative category based on a manual literature review with references cited in Table S1. hESC, human embryonic stem cell; hESC-EPI, human embryonic stem cell-derived EPls; hESC-CM, human embryonic stem cell-derived CMs; hESC-NC, human embryonic stem cell-derived neural crest cells.

[0070] Figure 7: shows passive force and Ca2+-kinetics of 3D-EHTs with optimised cell ratios: (A) Frank-Starling curves of passive force generation of 3D-EHTs containing CM only, CM+10% hESC-epicardium, CM+30% hESC-epicardium or CM+50% hESC-epicardium; (B) Slope of active force generation; (C-D) Ca2+-upstroke velocity (C) and time to 90% fluorescence decay (D) of 3D-EHTs containing CM only, CM+10% hESC-epicardium, CM+30% hESC-epicardium or CM+50% hESC-epicardium; and (E) Quantification of Integrin a5pi in 3D-EHTs containing, CM+EPI, CM+EPI+PUR4, CM+PUR4 or CM only. Mean values; error bars represent s.e.m. *P

[0071] Figure 8: shows generation of Crispr-Cas9 Knockout FN cell line: (A) Overview of the design of gRNA incisions sites along FN exons; (B) Schematic of workflow for GeneJuicemediated transfection of ES cells with Crispr-Cas9 gRNA to generate knockout- FN cell lines; (C) Genotyped Knock-out Fibronectin in Rues2 ES cells as aligned to WT-ES cells; and (D) Quantification of Integrin a5pi in 3D-EHTs containing, CM+EPI, CM only or CM+KOFN-EPI. Each experimental group included N=3 biological replicates.

[0072] Figure 9: shows sOPTiKD-FN clone derivation after transfection with sOPTiKD vector: (A) Schematic showing the transgenic allele that is generated via sOPTiKD transfection of hPSC. AAV-prom, AAVS1 locus promoter; 5'-HAR / 3'-HAR, 5’ upstream and 3’ downstream homology arms, respectively; SA, splice acceptor; T2A, self-cleaving T2A peptide; Puro, puromycin resistance; H1, H1 human RNA polymerase III promoter; TO, tet operon; pA, polyadenylation signal; CAG, CAG promoter; OPTtetR, optimised TET repressor; (B) Gene-Juice-mediated transfection strategy for sOPTiKD vector insertion within AAVS1 locus of ES cells, with subsequent colony selection and expansion for genotyping; (C) Genotyping gels of sOPTiKD clones. Row A is representative gel for detection of homozygous targeted clones; WT H9 give a band at 1692 bp, whereas no band indicates homozygous transgene integration. All clones except ‘5.2’ (labelled ‘het’, blue circle) appear to be homozygous-targeted. Row B is representative gel for 5’ vector integration, indicated by a gel band at 1103bp (yellow circle). Row C is representative gel for 3’ vector integration, as indicated by gel band at 1447bp. In this example, clones 4.6, 5.3, 5.5, and 5.6 were homozygous-targeted with vector integration at 5’ and 3’ (arrow) (D) All sOPTiKD clones had similar levels of pluripotency markers e.g. OCT4, SOX2, NANOG, prior to differentiation to epicardium; (E) Stable expression of key epicardial genes WT1, TCF21 and BNC1 in sOPTiKD-FN 1 EPI following induction with tetracycline; and (F) Quantification of Integrin a5pi in 3D-EHTs containing, CM+sOPTiKD-FN EPI without or with tetracycline or containing CM alone. Each experimental group included N=3 biological replicates.

[0073] Figure 10: shows representative raw force and Ca2+-traces: (A) Representative FrankStarling traces of constructs containing CM only, CM+PUR4, CM+EPI or CM+EPI+PUR4; (B) Representative Frank-Starling traces of constructs containing CM only, CM+EPI or CM+KOFN1 EPI; (C) CM only, CM+sOPTiKD-FN EPI (Tetracycline on) or CM+sOPTiKD-FN EPI (Tetracycline off); (D) Representative Ca2+-curves of constructs containing CM+EPI, CM+EPI+PUR4, CM only or CM+PUR4; (E) Representative Camcurves of constructs containing CM+EPI, CM+KOFN EPI or CM only; (F) Representative Ca2+-curves of constructs containing CM+sOPTiKD-FN EPI (Tetracycline off) or CM+sOPTiKD-FN EPI (Tetracycline on) or CM only; and (G) Pooling Ca2+--handling data from hPSC-CM or hPSC-CM+hPSC-EPI controls from the individual experiments results in significant differences between negative and positive control. Statistical significance was calculated using a two-tailed Welch's t-test, n = 10 (mean technical data pooled from experiments across n = 3, 3, and 4 individual differentiations).

[0074] Figure 11 : shows technical validation of RNA sequencing: (A) Sequencing depth saturation curves for all samples in both experiments. The hESC-NC (n=3) and hESC-EPI (n=3) samples were sequenced to depths of between 10 million and 24 million reads. The H9 (n=2) and the hESC-CM (n=2) samples were sequenced to depths of between 32 million and 44 million reads. The values plotted here show the number of reads sub-sampled up to and including the maximum number of reads obtained after filtering, trimming and alignment to genomic features; (B) Key positive markers used to identify hESC-EPIs and hESC-NCs; and (C) Key positive markers used to identify hESC-CMs and H9s. Abbreviations: hESC, human embryonic stem cell; hESC-EPI, human embryonic stem cell-derived epicardial cells; hESC-CM, human embryonic stem cell-derived cardiomyocytes; hESC-NC, human embryonic stem cell-derived neural crest cells.

[0075] Figure 12: shows karyotypes of WT RLIES2 and KOFN1 RLIES2 hESC lines.

[0076] DETAILED DESCRIPTION OF THE INVENTION

[0077] Advantageously, the inventors have demonstrated that the addition of exogenous fibronectin to cardiomyocytes (CM) results in enhancement of CM structure and function. The uses, compositions and methods described herein are in part related to the discovery made by the inventors that FN1 promotes hESC-CM maturation and function in 3D-EHTs across a series of FN1 loss-of-function experiments and a gain-of-function experiment.

[0078] As used herein, “Cardiomyocytes” or “CM” may refer to cells responsible for the contraction of the heart. Cardiomyocytes may be differentiated from embryonic stem cells or from induced pluripotent stem cells. The induced pluripotent stem cells may be autologous to a transplant recipient.

[0079] As used herein, “Exogenous fibronectin” may refer to fibronectin that has a source of origin different from the source of origin of the heart tissue or cells derived from the heart. For example, the exogenous fibronectin is not secreted by cells of the heart tissue or heart- derived cells, but, for instance, is added to cells of the heart tissue or heart-derived cells. The exogenous fibronectin may be recombinant, isolated, purified, or produced in vitro. For example, the exogenous fibronectin may be isolated and purified from plasma such as human plasma.

[0080] As used herein, a “tissue particle” may refer to engineered heart tissue and / or a suspension of cells. The engineered heart tissue may comprise cardiomyocytes and epicardial cells. The engineered heart tissue may comprise one or more of the following cell types: cardiomyocytes, epicardial cells, fibroblasts, endocardial cells, endothelial cells, and inflammatory cells. The suspension of cells may comprise cardiomyocytes and epicardial cells. The suspension of cells may comprise one or more of the following cell types: cardiomyocytes, epicardial cells, fibroblasts, endocardial cells, endothelial cells, and inflammatory cells. The "tissue particle" may refer to an in vitro cultured cell composition comprising at least two different cell types in physical association with each other. In one embodiment, the cells in a tissue particle include cardiomyocytes and epicardial cells. In one embodiment, the only cells in the tissue particle are cardiomyocytes and epicardial cells. In one embodiment, the cells in a tissue particle are in v / tro-differentiated cardiomyocytes and epicardial cells. A tissue particle can, but need not necessarily contain a scaffold as the term is used herein. A tissue particle will include at least two cells, i.e., at least one each of two different cell types, but can include, for example, from 2-2500 cells, e.g., at least 2 cells, at least 4 cells, at least 5 cells, at least 10 cells, at least 20 cells, at least 30 cells, at least 40 cells, at least 50 cells, at least 100 cells, at least 200 cells, at least 300 cells, at least 400 cells, at least 500 cells, at least 600 cells, at least 700 cells, at least 800 cells, at least 900 cells, at least 1000 cells, at least 1100 cells, at least 1200 cells, at least 1300 cells, at least 1400 cells, at least 1500 cells, at least 1600 cells, at least 1700 cells, at least 1800 cells, at least 1900 cells, at least 2000 cells, at least 2100 cells, at least 2200 cells, at least 2300 cells, at least 2400 cells or about 2500 cells. In one embodiment, a tissue particle includes 2500 or fewer cells, e.g., 2400 or fewer cells, 2300 or fewer cells, 2200 or fewer cells, 2100 or fewer cells, 2000 or fewer cells, 1900 or fewer cells, 1800 or fewer cells, 1700 or fewer cells, 1600 or fewer cells, 1500 or fewer cells, 1400 or fewer cells, 1300 or fewer cells, 1200 or fewer cells, 1100 or fewer cells, 1000 or fewer cells, 900 or fewer cells, 800 or fewer cells, 700 or fewer cells, 600 or fewer cells, 500 or fewer cells, 400 or fewer cells, 300 or fewer cells, 200 or fewer cells, 100 or fewer cells, 50 or fewer cells, but at least two cells. In various embodiments, a tissue particle can include, for example, 2-100 cells, 2-500 cells, 2- 1000 cells, 2-1500 cells, 2-2000 cells, 2-2400 cells, 100-200 cells, 100-500 cells, 100-1000 cells, 100-1500 cells, 100-2000 cells, 100-2500 cells, 200-400 cells, 200-500 cells, 200-1000 cells, 200-1500 cells, 200-2000 cells, 200-2500 cells, 500-1000 cells, 500-1500 cells, 500- 2000 cells, or 500-2500 cells. When cell numbers permit, cells in a tissue particle can be present in a ratio varying from 1 : 1 , 1 :2, 1:3, 1:4, 1 :5, 1: 10; 1 : 15, 1:20, 1 :25, 1:50, 1:75 or even 1 : 100.

[0081] As used herein, “epicardial cells” may refer to epithelial cells of the epicardium, which typically serve as an outer protective layer of the heart and can provide factors for myocardial growth and maturation. Epicardial cells, as described herein, may express WTI and / or TCF21 and may further express one or more of the following markers: TBX18; BNCI; and cytokeratins. Additional functional epicardial cell criteria include, but are not limited to, formation of a polarized epithelial sheet and the ability to undergo epithelial-to- mesenchymal transition (EMT) (in vitro or in vivo) to generate fibroblasts (e.g., cardiac fibroblasts) and vascular smooth muscle lineages. The epicardial cells may refer to in vitro differentiated epicardial cells or differentiated progeny thereof. Accordingly, the epicardial cells or progeny thereof may be differentiated from embryonic stem cells or from induced pluripotent stem cells. The induced pluripotent stem cells may be autologous to a transplant recipient.

[0082] As used herein, the term "differentiated progeny of epicardial cells" refers to any of the cells developmentally downstream of, or differentiated from, epicardial cells, particularly epicardial cells that have undergone EMT to produce epicardium derived cells (EPDCs). Further non-limiting examples of differentiated progeny include vascular smooth muscle cells, cardiac fibroblasts, interstitial fibroblasts, mesenchymal-like cells (e.g., cardiac colony forming units fibroblasts (cCFU-F)) and possibly endothelial cells, cardiomyocytes or cardiac progenitor cells). Accordingly, the "differentiated progeny of epicardial cells" refers to any of the differentiated cells that are downstream from any of the epicardial cells, as that term is used herein, and in particular includes e.g., vascular smooth muscle cells, cardiac fibroblasts, interstitial fibroblasts, endothelial cells, pericytes and cardiomyocytes. It is specifically contemplated herein that cells derived from epicardial cells can be used for providing effects similar or equivalent to those provided by epicardial cells on cardiomyocyte engraftment, proliferation and function when introduced to cardiac tissue in admixture with cardiomyocytes in vivo.

[0083] As used herein, the term "mature phenotype" when applied to cardiomyocytes refers to the phenotype of a cell that comprises a phenotype similar to adult cardiomyocytes and does not comprise at least one feature of a fetal cardiomyocyte. In some embodiments, markers which indicate increased maturity of a cardiomyocyte include, but are not limited to, an increased expression of a-actinin, c-TnT and / or b-MHC, increased anisotropy, increased cellular alignment, anisotropic arrangement of gap junctions & cadherins between cells, increased T-tubule formation and caveolin expression, wherein the increase is relative to that marker in another population of the same cardiomyocytes, e.g., in relation to a population of cardiomyocytes in the absence of co-administered epicardial cells. In some embodiments, the matured cardiomyocytes have an increased conversion of ssTnl to ctTnl,N2BA to N2B, and appropriate increase or decrease in expression of ion channels as expressed in adult cardiac tissue (voltage gated K + channels, Na+ channels, voltage dependent Ca2+ channels, cyclic nucleotide dependent K+ channels, and other ion channels). In some embodiments, the matured cardiomyocytes have an increased contraction at single cell and multi-cellular level measured by contraction mapping aided by microscopy, increased strength of contraction. In some embodiments, the matured cardiomyocytes have an increased cell-cell electrical conductivity, increased syncytial nature of 2D in vitro culture in large area (cm2) allowing electrical action potential to propagate from one point to another, increased wave speed and decreased excitation threshold, increased Ca2+ transient current. Accordingly, as used herein, “promoting maturity” may refer to promoting of a mature phenotype.

[0084] As used herein, the term "treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder. For example, the term "treating" and "treatment" refers to administering to a subject an effective amount of a composition, e.g., an effective amount of a composition comprising a population of e.g.. epicardial cells, cardiomyocytes etc. so that the subject has a reduction in at least one symptom of the disease or an improvement in the disease, for example, beneficial or desired clinical results (e.g., improved cardiac function in an infarcted area of the heart, improved engraftment of cardiomyocytes etc.). For purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, diminishment of extent of disease, disease stabilization (e.g., not worsening), delay or slowing of disease progression, amelioration or palliation of the disease state, and remission ( whether partial or total), whether detectable or undetectable. In some embodiments, treating can refer to prolonging survival as compared to expected survival if not receiving treatment. Thus, one of skill in the art realizes that a treatment can improve the disease condition, but may not be a complete cure for the disease. In some embodiments, treatment can include prophylaxis. However, in alternative embodiments, treatment does not include prophylaxis.

[0085] As used herein, "prevention" or preventing," when used in reference to a disease, disorder or symptoms thereof, refers to a reduction in the likelihood that an individual will develop a disease or disorder, e.g., heart failure following myocardial infarction, as but one example. The likelihood of developing a disease or disorder is reduced, for example, when an individual having one or more risk factors for a disease or disorder either fails to develop the disorder or develops such disease or disorder at a later time or with less severity, statistically speaking, relative to a population having the same risk factors and not receiving treatment as described herein. The failure to develop symptoms of a disease, or the development of reduced (e.g., by at least 10% on a clinically accepted scale for that disease or disorder) or delayed (e.g., by days, weeks, months or years) symptoms is considered effective prevention.

[0086] As used herein, “cardiovascular condition or disease” may refer to a cardiac infarction, cardiac injury, heart failure, cardiomyopathy, congenital heart defect (e.g., noncompaction cardiomyopathy), hypertrophic cardiomyopathy, dilated cardiomyopathy, myocarditis, heart failure, cardiomegaly, myocardial infarction, ischemia, cardiomyopathy, congenital heart disease and intractable arrhythmias.

[0087] As used herein "treating” or “treatment" of a cardiovascular condition or disease (e.g., myocardial infarction) refers to therapeutic intervention that enhances cardiac function and / or enhances cardiomyocyte engraftment and / or enhances cardiomyocyte transplant or graft vascularization in a treated area, thus improving the function of e.g., the heart. That is, cardiac "treatment" is oriented to the function of the heart (e.g., enhanced function within an infarcted area), and / or other site treated with the compositions described herein. A therapeutic approach that improves the function of the heart, for example as assessed by measuring left-ventricular end-systolic dimension (LVESD)) by at least 10%, and preferably by at least 20%, 30%, 40%, 50%, 75%, 90%, 100% or more, e.g., 2-fold, 5-fold, 10-fold or more, up to and including full function, relative to such function prior to such therapy is considered effective treatment. Effective treatment need not cure or directly impact the underlying cause of the cardiovascular condition to be considered effective treatment.

[0088] As used herein the term "comprising" or "comprises" is used in reference to compositions, methods, and respective component(s) thereof, that are essential to the invention, yet open to the inclusion of unspecified elements, whether essential or not.

[0089] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus for example, references to "the method" includes one or more methods, and / or steps of the type described herein and / or which will become apparent to those persons skilled in the art upon reading this disclosure and so forth.

[0090] Cell preparations

[0091] Disclosed herein are compositions and methods involving cardiomyocytes and / or epicardial cells. The methods and compositions described herein can use cardiomyocytes and epicardial cells differentiated in vitro, e.g., from embryonic stem cells, pluripotent stem cells, such as induced pluripotent stem cells, or other stem cells that permit such differentiation. The following describes various stem cells that can be used to prepare cardiomyocytes and epicardial cells.

[0092] Embryonic Stem Cells: Stem cells are cells that retain the ability to renew themselves through mitotic cell division and can differentiate into more specialized cell types. Three broad types of mammalian stem cells include: embryonic stem (ES) cells that are found in blastocysts, induced pluripotent stem cells (iPSCs) that are reprogrammed from somatic cells, and adult stem cells that are found in adult tissues. Other sources of pluripotent stem cells can include amnion-derived or placental-derived stem cells. In a developing embryo, stem cells can differentiate into all of the specialized embryonic tissues. In adult organisms, stem cells and progenitor cells act as a repair system for the body, replenishing specialized cells, but also maintain the normal turnover of regenerative organs, such as blood, skin or intestinal tissues. Pluripotent stem cells can differentiate into cells derived from any of the three germ layers.

[0093] Cardiomyocytes and epicardial cells useful in the methods and compositions described herein can be differentiated from both embryonic stem cells and induced pluripotent stem cells, among others. In one embodiment, the compositions and methods provided herein use human cardiomyocytes and / or epicardial cells differentiated from embryonic stem cells. Alternatively, in some embodiments, the compositions and methods provided herein do not encompass generation or use of human cardiogenic cells and / or epicardial cells made from cells taken from a viable human embryo.

[0094] Embryonic stem cells and methods for their retrieval are well known in the art and are described, for example, in Trounson A O (Reprod Fertil Dev (2001) 13: 523), Roach ML (Methods

[0095] Mol Biol (2002) 185: 1), and Smith A G (Annu Rev Cell Dev Biol (2001) 17:435). The term "embryonic stem cell" is used to refer to the pluripotent stem cells of the inner cell mass of the embryonic blastocyst (see e.g., US Patent Nos. 5843780, 6200806). Such cells can similarly be obtained from the inner cell mass of blastocysts derived from somatic cell nuclear transfer (see, for example, US Patent Nos. 5945577, 5994619, 6235970). The distinguishing characteristics of an embryonic stem cell define an embryonic stem cell phenotype. Accordingly, a cell has the phenotype of an embryonic stem cell if it possesses one or more of the unique characteristics of an embryonic stem cell such that that cell can be distinguished from other cells. Exemplary distinguishing embryonic stem cell characteristics include, without limitation, gene expression profile, proliferative capacity, differentiation capacity, karyotype, responsiveness to particular culture conditions, and the like.

[0096] Cells derived from embryonic sources can include embryonic stem cells or stem cell lines obtained from a stem cell bank or other recognized depository institution. Other means of producing stem cell lines include methods comprising the use of a blastomere cell from an early stage embryo prior to formation of the blastocyst (at around the 8-cell stage). Such techniques correspond to the pre-implantation genetic diagnosis technique routinely practiced in assisted reproduction clinics. The single blastomere cell is co-cultured with established ES-cell lines and then separated from them to form fully competent ES cell lines.

[0097] Embryonic stem cells are considered to be undifferentiated when they have not committed to a specific differentiation lineage. Such cells display morphological characteristics that distinguish them from differentiated cells of embryo or adult origin. Undifferentiated embryonic stem (ES) cells are easily recognized by those skilled in the art, and typically appear in the two dimensions of a microscopic view in colonies of cells with high nuclear / cytoplasmic ratios and prominent nucleoli. In some embodiments, the human cardiomyocytes and / or epicardial cells described herein are not derived from embryonic stem cells or any other cells of embryonic origin.

[0098] Adult stem cells are stem cells derived from tissues of a post-natal or post-neonatal organism or from an adult organism. An adult stem cell is structurally distinct from an embryonic stem cell not only in markers it does or does not express relative to an embryonic stem cell, but also by the presence of epigenetic differences, e.g. differences in DNA methylation patterns.

[0099] In some embodiments, the methods and compositions described herein utilize cardiomyocytes and / or epicardial cells that are differentiated in vitro from induced pluripotent stem cells. An advantage of using iPSCs to generate cardiomyocyte and / or epicardial cells for the compositions described herein is that the cells can be derived from the same subject to which the desired human cardiomyocytes and / or epicardial cells are to be administered. That is, a somatic cell can be obtained from a subject, reprogrammed to an induced pluripotent stem cell, and then re-differentiated into a human cardiomyocyte and / or an epicardial cell to be administered to the subject (e.g., autologous cells). Since the cardiomyocytes and / or epicardial cells (or their differentiated progeny) are essentially derived from an autologous source, the risk of engraftment rejection or allergic responses is reduced compared to the use of cells from another subject or group of subjects. In some embodiments, the cardiomyocytes and / or epicardial cells useful for the compositions described herein are derived from non-autologous sources. In addition, the use of iPSCs negates the need for cells obtained from an embryonic source. Thus, in one embodiment, the stem cells used to generate epicardial cells or cardiomyocytes for use in the compositions and methods described herein are not embryonic stem cells.

[0100] Although differentiation is generally irreversible under physiological contexts, several methods have been developed in recent years to reprogram somatic cells to induced pluripotent stem cells. Exemplary methods are known to those of skill in the art and are described briefly herein below.

[0101] Reprogramming is a process that alters or reverses the differentiation state of a differentiated cell (e.g.. a somatic cell). Stated another way, reprogramming is a process of driving the differentiation of a cell backwards to a more undifferentiated or more primitive type of cell. It should be noted that placing many primary cells in culture can lead to some loss of fully differentiated characteristics. However, simply culturing such cells included in the term differentiated cells does not render these cells non-differentiated cells (e.g., undifferentiated cells) or pluripotent cells. The transition of a differentiated cell to pluripotency requires a reprogramming stimulus beyond the stimuli that lead to partial loss of differentiated character when differentiated cells are placed in culture. Reprogrammed cells also have the characteristic of the capacity of extended passaging without loss of growth potential, relative to primary cell parents, which generally have capacity for only a limited number of divisions in culture.

[0102] The cell to be reprogrammed can be either partially or terminally differentiated prior to reprogramming. In some embodiments, reprogramming encompasses complete reversion of the differentiation state of a differentiated cell (e.g.. a somatic cell) to a pluripotent state or a multipotent state. In some embodiments, reprogramming encompasses complete or partial reversion of the differentiation state of a differentiated cell (e.g.. a somatic cell) to an undifferentiated cell (e.g.. an embryonic-like cell). Reprogramming can result in expression of particular genes by the cells, the expression of which further contributes to reprogramming. In certain embodiments described herein, reprogramming of a differentiated cell (e.g.. a somatic cell) causes the differentiated cell to assume an undifferentiated state with the capacity for self-renewal and differentiation to cells of all three germ cell lineages. The resulting cells are referred to as "reprogrammed cells," or "induced pluripotent stem cells (iPSCs or iPS cells)."

[0103] The specific approach or method used to generate pluripotent stem cells from somatic cells (e.g., any cell of the body with the exclusion of a germ line cell; fibroblasts etc.) is not critical to the claimed invention. Thus, any method that re-programs a somatic cell to the pluripotent phenotype would be appropriate for use in the methods described herein. iPS cells can be generated or derived from terminally differentiated somatic cells, as well as from adult stem cells, or somatic stem cells. That is, a non-pluripotent progenitor cell can be rendered pluripotent or multipotent by reprogramming.

[0104] The efficiency of reprogramming (i.e. , the number of reprogrammed cells) derived from a population of starting cells can be enhanced by the addition of various small molecules as shown by Shi, Y., et al (2008) Cell-Stem Cell 2:525-528, Huangfu, D., et al (2008) Nature Biotechnology 26(7):795-797, and Marson, A., et al (2008) Cell-Stem Cell 3:132-135. Some non-limiting examples of agents that enhance reprogramming efficiency include soluble Wnt, Wnt conditioned media, BIX-01294 (a G9a histone methyltransferase), PD0325901 (a MEK inhibitor), DNA methyltransferase inhibitors, histone deacetylase (HDAC) inhibitors, valproic acid, 5'-azacytidine, dexamethasone, suberoylanilide, hydroxamic acid (SAHA), vitamin C, and trichostatin (TSA), among others.

[0105] To confirm the induction of pluripotent stem cells for use with the methods described herein, isolated clones can be tested for the expression of a stem cell marker. Such expression in a cell derived from a somatic cell identifies the cells as induced pluripotent stem cells. Stem cell markers can be selected from the non-limiting group including SSEA3, SSEA4, CD9, Nanog, Fbxl5, Ecatl, Esgl, Eras, Gdf3, Fgf4, Cripto, Daxl, Zpf296, Slc2a3, Rexl, lltfl, and Natl. In one embodiment, a cell that expresses Oct4 or Nanog is identified as pluripotent. Methods for detecting the expression of such markers can include, for example, RT-PCR and immunological methods that detect the presence of the encoded polypeptides, such as Western blots or flow cytometric analyses. In some embodiments, detection does not involve only RT-PCR, but also includes detection of protein markers. Intracellular markers may be best identified via RT-PCR, while cell surface markers are readily identified e.g., by immunocytochemistry.

[0106] The pluripotent stem cell character of isolated cells can be confirmed by tests evaluating the ability of the iPSCs to differentiate to cells of each of the three germ layers. As one example, teratoma formation in nude mice can be used to evaluate the pluripotent character of the isolated clones. The cells are introduced to nude mice and histology and / or immunohistochemistry is performed on a tumor arising from the cells. The growth of a tumor comprising cells from all three germ layers, for example, further indicates that the cells are pluripotent stem cells.

[0107] When reprogrammed cells are used for generation of human cardiomyocytes and / or epicardial cells to be used in the therapeutic treatment of disease, it is desirable, but not required, to use somatic cells isolated from the patient being treated. For example, somatic cells involved in diseases, and somatic cells participating in therapeutic treatment of diseases and the like can be used. A method for selecting the reprogrammed cells from a heterogeneous population comprising reprogrammed cells and somatic cells from which they were derived or generated from can be performed by any known means. For example, a drug resistance gene or the like, such as a selectable marker gene can be used to isolate the reprogrammed cells using the selectable marker as an index.

[0108] Reprogrammed somatic cells as disclosed herein can express any number of pluripotent cell markers, including: alkaline phosphatase (AP); ABCG2; stage specific embryonic antigen-1 (SSEA-1); SSEA-3; SSEA-4; TRA-1-60; TRA-1-81; Tra-2-49 / 6E; ERas / ECAT5, E-cadherin; I3-I I l-tubulin; a-smooth muscle actin (a-SMA); fibroblast growth factor 4 (Fgf4), Cripto, Daxl; zinc finger protein 296 (Zfp296); N-acetyltransferase-1 (Natl); (ES cell associated transcript 1 (ECATI); ESG1 / DPPA5 / ECAT2; ECAT3; ECAT6; ECAT7; ECAT8; ECAT9; ECATIO; ECAT15-I; ECAT15-2; Fthll 7; Sall4; undifferentiated embryonic cell transcription factor (lltfl); Rexl; p53; G3PDH;telomerase, including TERT; silent X chromosome genes; Dnmt3a; Dnmt3b; TR1M28; F-box containing protein 15 (Fbxl5); Nanog / ECAT4; Oct3 / 4; Sox2; Klf4; c-Myc; Esrrb; TDGFI; GABRB3; Zfp42, FoxD3; GDF3; CYP25AI; developmental pluripotency-associated 2 (DPPA2); T-cell lymphoma breakpoint 1 (Tell); DPPA3 / Stella; DPPA4; other general markers for pluripotency, etc. Other markers can include Dnmt3L; Soxl5; Stat3; Grb2; 13-catenin, and Bmil. Such cells can also be characterized by the down-regulation of markers characteristic of the somatic cell from which the induced pluripotent stem cell is derived.

[0109] The methods and compositions described herein can use in vitro differentiated cardiomyocytes and epicardial cells. Methods for the differentiation of either cell type from ESCs or IPSCs are known in the art. See, e.g., LaFlamme et al., Nature Biotech 25: 1015-1024 (2007), which describes the differentiation of cardiomyocytes and Witty et al., Nature Bio tech. 32: 1026-1035 (2014) and Iyer et al., Development 142:1528-1541 (2015), which describe the differentiation of epicardial cells. These approaches use various factors and conditions to activate and guide differentiation programs leading to their respective cell types. Pathways and certain of the factors involved in them are discussed in the following.

[0110] Typically, the step-wise differentiation of ESCs or IPSCs epicardial cells begins with an embryonic stem cell or induced pluripotent stem cell, which is differentiated into an early mesoderm cell, then through a lateral mesoderm cell phenotype to an epicardial cell.

[0111] In certain embodiments, the step-wise differentiation of ESCs or iPSCs to cardiomyocytes proceeds in the following order: ESC or iPSC > cardiogenic mesoderm > cardiac progenitor cells >cardiomyocytes.

[0112] As will be appreciated by those of skill in the art, in v / fro-differentiation of epicardial cells and / or cardiomyocytes produces an end-result of a cell having the phenotypic and morphological features of an epicardial cell or cardiomyocyte but that the differentiation steps of in vitro- differentiation need not be the same as the differentiation that occurs naturally in the embryo. That is, during differentiation to an epicardial cell or cardiomyocyte, it is specifically contemplated herein that the step-wise differentiation approach utilized to produce such cells need not proceed through every progenitor cell type that has been identified during embryogenesis and can essentially "skip" over certain stages of development that occur during embryogenesis.

[0113] Composition

[0114] Disclosed herein are compositions perse, compositions used for producing engineered heart tissue and compositions used in the context of the methods disclosed herein. For example, disclosed herein is a composition for production of engineered heart tissue, the composition comprising cardiomyocytes; and exogenous fibronectin.

[0115] The above compositions may comprise a pharmaceutically acceptable carrier. For example, compositions may contain a physiologically tolerable carrier together with the cell composition and optionally at least one additional bioactive agent as described herein, dissolved or dispersed therein as an active ingredient. The composition may be not substantially immunogenic when administered to a mammal or human patient for therapeutic purposes, unless so desired.

[0116] As used herein, the terms "pharmaceutically acceptable", "physiologically tolerable" and grammatical variations thereof, as they refer to compositions, carriers, diluents and reagents, are used interchangeably and represent that the materials are capable of administration to or upon a mammal without the production of undesirable physiological effects such as nausea, dizziness, gastric upset, transplant rejection, allergic reaction, and the like. A pharmaceutically acceptable carrier will not promote the raising of an immune response to an agent with which it is admixed, unless so desired. The preparation of a composition that contains active ingredients dissolved or dispersed therein is well understood in the art and need not be limited based on formulation. Typically, such compositions are prepared as injectable either as liquid solutions or suspensions, however, solid forms suitable for solution, or suspensions, in liquid prior to use can also be prepared.

[0117] The compositions disclosed herein may comprise exogenous fibronectin present at a concentration of about at least 0.1 ug / ml, at least about 10 pg / ml, or at least about 100 pg / ml. In one embodiment, exogenous fibronectin in the composition of tissue particle disclosed herein may be present at a concentration of about 10 pg / ml to 100 pg / ml. In one embodiment, the exogenous fibronectin may be present in the composition at a concentration of about 10 mg / mL, 50 mg / mL, or 100 mg / ml. In one embodiment, the exogenous fibronectin including exogenous fibronectin comprised in a composition disclosed herein or a tissue particle disclosed herein is administered at a concentration of about 1 pg / ml, about 2 pg / ml, about 3 pg / ml, about 4 pg / ml, about 5 pg / ml, about 6 pg / ml, about 7 pg / ml, about 8 pg / ml, about 9 pg / ml, about 10 pg / ml, about 11 pg / ml, about 12 pg / ml, about 13 pg / ml, about 14 pg / ml, about 15 pg / ml, about 16 pg / ml, about 17 pg / ml, about 18 pg / ml, about 19 pg / ml, about 20 pg / ml, about 21 pg / ml, about 22 pg / ml, about 23 pg / ml, about 24 pg / ml, about 25 pg / ml, about 26 pg / ml, about 27 pg / ml, about 28 pg / ml, about 29 pg / ml, about 30 pg / ml, about 31 pg / ml, about 32 pg / ml, about 33 pg / ml, about 34 pg / ml, about 35 pg / ml, about 36 pg / ml, about 37 pg / ml, about 38 pg / ml, about 39 pg / ml, about 40 pg / ml, about 41 pg / ml, about 42 pg / ml, about 43 pg / ml, about 44 pg / ml, about 45 pg / ml, about 46 pg / ml, about 47 pg / ml, about 48 pg / ml, about 49 pg / ml, about 50 pg / ml, about 51 pg / ml, about 52 pg / ml, about 53 pg / ml, about 54 pg / ml, about 55 pg / ml, about 56 pg / ml, about 57 pg / ml, about 58 pg / ml, about 59 pg / ml, about 60 pg / ml, about 61 pg / ml, about 62 pg / ml, about 63 pg / ml, about 64 pg / ml, about 65 pg / ml, about 66 pg / ml, about 67 pg / ml, about 68 pg / ml, about 69 pg / ml, about 70 pg / ml, about 71 pg / ml, about 72 pg / ml, about 73 pg / ml, about 74 pg / ml, about 75 pg / ml, about 76 pg / ml, about 77 pg / ml, about 78 pg / ml, about 79 pg / ml, about 80 pg / ml, about 81 pg / ml, about 82 pg / ml, about 83 pg / ml, about 84 pg / ml, about 85 pg / ml, about 86 pg / ml, about 87 pg / ml, about 88 pg / ml, about 89 pg / ml, about 90 pg / ml, about 91 pg / ml, about 92 pg / ml, about 93 pg / ml, about 94 pg / ml, about 95 pg / ml, about 96 pg / ml, about 97 pg / ml, about 98 pg / ml, about 99 pg / ml, about 100 pg / ml. In one embodiment, the exogenous fibronectin in the composition or tissue particle may be at a concentration of about 10 pg / ml, about 20 pg / ml, about 30 pg / ml, about 40 pg / ml, about 50 pg / ml, about 60 pg / ml, about 70 pg / ml, about 80 pg / ml, about 90 pg / ml, about 100 pg / ml, about 110 pg / ml, about 120 pg / ml, about 130 pg / ml, about 140 pg / ml, about 150 pg / ml, about 160 pg / ml, about 170 pg / ml, about 180 pg / ml, about 190 pg / ml, about 200 pg / ml, about 210 pg / ml, about 220 pg / ml, about 230 pg / ml, about 240 pg / ml, about 250 pg / ml, about 260 pg / ml, about 270 pg / ml, about 280 pg / ml, about 290 pg / ml, about 300 pg / ml, about 310 pg / ml, about 320 pg / ml, about 330 pg / ml, about 340 pg / ml, about 350 pg / ml, about 360 pg / ml, about 370 pg / ml, about 380 pg / ml, about 390 pg / ml, about 400 pg / ml, about 410 pg / ml, about 420 pg / ml, about 430 pg / ml, about 440 pg / ml, about 450 pg / ml, about 460 pg / ml, about 470 pg / ml, about 480 pg / ml, about 490 pg / ml, about 500 pg / ml, about 510 pg / ml, about 520 pg / ml, about 530 pg / ml, about 540 pg / ml, about 550 pg / ml, about 560 pg / ml, about 570 pg / ml, about 580 pg / ml, about 590 pg / ml, about 600 pg / ml, about 610 pg / ml, about 620 pg / ml, about 630 pg / ml, about 640 pg / ml, about 650 pg / ml, about 660 pg / ml, about 670 pg / ml, about 680 pg / ml, about 690 pg / ml, about 700 pg / ml, about 710 pg / ml, about 720 pg / ml, about 730 pg / ml, about 740 pg / ml, about 750 pg / ml, about 760 pg / ml, about 770 pg / ml, about 780 pg / ml, about 790 pg / ml, about 800 pg / ml, about 810 pg / ml, about 820 pg / ml, about 830 pg / ml, about 840 pg / ml, about 850 pg / ml, about 860 pg / ml, about 870 pg / ml, about 880 pg / ml, about 890 pg / ml, about 900 pg / ml, about 910 pg / ml, about 920 pg / ml, about 930 pg / ml, about 940 pg / ml, about 950 pg / ml, about 960 pg / ml, about 970 pg / ml, about 980 pg / ml, about 990 pg / ml, about 1000 pg / ml.

[0118] The exogenous fibronectin in the compositions disclosed herein may comprise one or more of recombinant fibronectin, isolated and / or purified fibronectin, and fibronectin that has been produced in vitro.

[0119] The compositions comprising cardiomyocytes and / or epicardial cells described herein may be administered as suspension formulations where the cells are admixed with a pharmaceutically acceptable carrier. One of skill in the art will recognize that a pharmaceutically acceptable carrier to be used in a cell composition will not include buffers, compounds, cryopreservation agents, preservatives, or other agents in amounts that substantially interfere with the viability of the cells to be delivered to the subject. A formulation comprising cells can include e.g., osmotic buffers that permit cell membrane integrity to be maintained, and optionally, nutrients to maintain cell viability or enhance engraftment upon administration. Such formulations and suspensions are known to those of skill in the art and / or can be adapted for use with the human cardiac progenitor cells as described herein using routine experimentation. The compositions disclosed herein may comprise cardiomyocytes at about a ratio of 2:1 to 10:1 relative to the epicardial cells or progeny thereof. In one embodiment, the compositions disclosed herein may comprise cardiomyocytes and at a ratio of about 1 :1 to 10:1, about 2:1 to 10:1 , about 3:1 to 10:1, about 4:1 to 10:1, about 5:1 to 10:1 , about 6:1 to 10:1, about 7:1 to 10:1 , about 8:1 to 10:1, about 9:1 to 10:1 relative to the epicardial cells or progeny thereof. In one embodiment, the compositions disclosed herein may comprise cardiomyocytes and at a ratio of about 1:1 , about 2:1, about 3: 1 , about 4: 1 , about 5: 1 , about 6:1 , about 7:1, about 8:1, about 9:1, about 10:1, 20:1, 30:1, 40:1 , 50:1, or 100:1 relative to the epicardial cells or progeny thereof.

[0120] The composition disclosed herein may further comprise additional useful reagents, such as one or more transplant compositions e.g., ZVAD-FMK, Bck-XL, Cyclosporin A, pinacidil and / or IGF-1.

[0121] A composition comprising any cells disclosed herein can also be emulsified or presented as a liposome composition, provided that the emulsification procedure does not adversely affect cell viability. The cells and any other active ingredient can be mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient and in amounts suitable for use in the therapeutic methods described herein.

[0122] Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline. Still further, aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes. Liquid compositions can also contain liquid phases in addition to and to the exclusion of water. Exemplary of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and wateroil emulsions. The amount of an active compound used in the cell compositions as described herein that is effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques.

[0123] Tissue particle

[0124] Disclosed herein are tissue particles comprising cardiomyocytes in a composition comprising exogenous fibronectin, wherein the composition may be for culturing cells.

[0125] The tissue particle may comprise a composition comprising exogenous fibronectin present at a concentration of about at least 0.1 ug / ml, at least about 10 pg / ml, or at least about 100 pg / ml. In one embodiment, exogenous fibronectin may be present in the tissue particle at a concentration of about 10 pg / ml to 100 pg / ml. In one embodiment, the tissue particle may comprise a composition comprising exogenous fibronectin at a concentration of about 10 mg / mL, 50 mg / mL, or 100 mg / ml. In one embodiment, the tissue particle may comprise a composition comprising the exogenous fibronectin at a concentration of about 1 pg / ml, about 2 pg / ml, about 3 pg / ml, about 4 pg / ml, about 5 pg / ml, about 6 pg / ml, about 7 pg / ml, about 8 pg / ml, about 9 pg / ml, about 10 pg / ml, about 11 pg / ml, about 12 pg / ml, about 13 pg / ml, about 14 pg / ml, about 15 pg / ml, about 16 pg / ml, about 17 pg / ml, about 18 pg / ml, about 19 pg / ml, about 20 pg / ml, about 21 pg / ml, about 22 pg / ml, about 23 pg / ml, about 24 pg / ml, about 25 pg / ml, about 26 pg / ml, about 27 pg / ml, about 28 pg / ml, about 29 pg / ml, about 30 pg / ml, about 31 pg / ml, about 32 pg / ml, about 33 pg / ml, about 34 pg / ml, about 35 pg / ml, about 36 pg / ml, about 37 pg / ml, about 38 pg / ml, about 39 pg / ml, about 40 pg / ml, about 41 pg / ml, about 42 pg / ml, about 43 pg / ml, about 44 pg / ml, about 45 pg / ml, about 46 pg / ml, about 47 pg / ml, about 48 pg / ml, about 49 pg / ml, about 50 pg / ml, about 51 pg / ml, about 52 pg / ml, about 53 pg / ml, about 54 pg / ml, about 55 pg / ml, about 56 pg / ml, about 57 pg / ml, about 58 pg / ml, about 59 pg / ml, about 60 pg / ml, about 61 pg / ml, about 62 pg / ml, about 63 pg / ml, about 64 pg / ml, about 65 pg / ml, about 66 pg / ml, about 67 pg / ml, about 68 pg / ml, about 69 pg / ml, about 70 pg / ml, about 71 pg / ml, about 72 pg / ml, about 73 pg / ml, about 74 pg / ml, about 75 pg / ml, about 76 pg / ml, about 77 pg / ml, about 78 pg / ml, about 79 pg / ml, about 80 pg / ml, about 81 pg / ml, about 82 pg / ml, about 83 pg / ml, about 84 pg / ml, about 85 pg / ml, about 86 pg / ml, about 87 pg / ml, about 88 pg / ml, about 89 pg / ml, about 90 pg / ml, about 91 pg / ml, about 92 pg / ml, about 93 pg / ml, about 94 pg / ml, about 95 pg / ml, about 96 pg / ml, about 97 pg / ml, about 98 pg / ml, about 99 pg / ml, about 100 pg / ml. In one embodiment, The tissue particle may comprise a composition comprising exogenous fibronectin at a concentration of about 10 pg / ml, about 20 pg / ml, about 30 pg / ml, about 40 pg / ml, about 50 pg / ml, about 60 pg / ml, about 70 pg / ml, about 80 pg / ml, about 90 pg / ml, about 100 pg / ml, about 110 pg / ml, about 120 pg / ml, about 130 pg / ml, about 140 pg / ml, about 150 pg / ml, about 160 pg / ml, about 170 pg / ml, about 180 pg / ml, about 190 pg / ml, about 200 pg / ml, about 210 pg / ml, about 220 pg / ml, about 230 pg / ml, about 240 pg / ml, about 250 pg / ml, about 260 pg / ml, about 270 pg / ml, about 280 pg / ml, about 290 pg / ml, about 300 pg / ml, about 310 pg / ml, about 320 pg / ml, about 330 pg / ml, about 340 pg / ml, about 350 pg / ml, about 360 pg / ml, about 370 pg / ml, about 380 pg / ml, about 390 pg / ml, about 400 pg / ml, about 410 pg / ml, about 420 pg / ml, about 430 pg / ml, about 440 pg / ml, about 450 pg / ml, about 460 pg / ml, about 470 pg / ml, about 480 pg / ml, about 490 pg / ml, about 500 pg / ml, about 510 pg / ml, about 520 pg / ml, about 530 pg / ml, about 540 pg / ml, about 550 pg / ml, about 560 pg / ml, about 570 pg / ml, about 580 pg / ml, about 590 pg / ml, about 600 pg / ml, about 610 pg / ml, about 620 pg / ml, about 630 pg / ml, about 640 pg / ml, about 650 pg / ml, about 660 pg / ml, about 670 pg / ml, about 680 pg / ml, about 690 pg / ml, about 700 pg / ml, about 710 pg / ml, about 720 pg / ml, about 730 pg / ml, about 740 pg / ml, about 750 pg / ml, about 760 pg / ml, about 770 pg / ml, about 780 pg / ml, about 790 pg / ml, about 800 pg / ml, about 810 pg / ml, about 820 pg / ml, about 830 pg / ml, about 840 pg / ml, about 850 pg / ml, about 860 pg / ml, about 870 pg / ml, about 880 pg / ml, about 890 pg / ml, about 900 pg / ml, about 910 pg / ml, about 920 pg / ml, about 930 pg / ml, about 940 pg / ml, about 950 pg / ml, about 960 pg / ml, about 970 pg / ml, about 980 pg / ml, about 990 pg / ml, about 1000 pg / ml.

[0126] The exogenous fibronectin in the composition comprised by the tissue particle disclosed herein may comprise one or more of recombinant fibronectin, isolated and / or purified fibronectin, and fibronectin that has been produced in vitro.

[0127] In the composition comprised by the tissue particle, the cardiomyocytes may be present at about a ratio of 2:1 to 10:1 relative to the epicardial cells or progeny thereof. In one embodiment, in the composition comprised by the tissue particle, the cardiomyocytes may be present and at a ratio of about 1 : 1 to 10: 1 , about 2: 1 to 10: 1 , about 3:1 to 10:1 , about 4:1 to 10:1, about 5:1 to 10:1 , about 6:1 to 10:1, about 7:1 to 10:1 , about 8:1 to 10:1 , about 9:1 to 10:1 relative to the epicardial cells or progeny thereof. In one embodiment, In the composition comprised by the tissue particle, the cardiomyocytes may be present at a ratio of about 1:1, about 2: 1 , about 3: 1 , about 4: 1 , about 5: 1 , about 6: 1 , about 7:1 , about 8: 1 , about 9: 1 , about 10: 1 , 20: 1 , 30: 1 , 40: 1 , 50: 1 , or 100: 1 relative to the epicardial cells or progeny thereof.

[0128] Method of forming engineered heart tissue

[0129] Disclosed herein is a method of forming engineered heart tissue, the method comprising: providing a mixture of cardiomyocytes and exogenous fibronectin into a vessel; mixing the mixture with a matrix composition to form a gel; culturing the gel.

[0130] The vessel may be any container suitable for holding a mixture of cardiomyocytes and exogenous fibronectin. Accordingly, the vessel used in the method of forming engineered heart tissue may include those known in the art such as a test tube and centrifuge tube.

[0131] The mixture used in the method of method of forming engineered heart tissue may comprise any composition disclosed herein including any concentration and ratio of cardiomyocytes to epicardial cells / progeny thereof disclosed herein.

[0132] The matrix composition used in the method of forming engineered heart tissue may include one or more of matrix components such as those laid down by epicardial cells including for example, hESC-derived epicardial cells. Components of the matrix composition may include one or more of the following basement membrane components, fibronectin, agar, agarose, gelatin, gum arabic, collagens types I, II, III, IV, and V, laminin, glycosaminoglycans, polyvinyl alcohol, and fibrin.

[0133] Polymers for use in the matrix should meet the mechanical and biochemical parameters necessary to provide adequate support for the cells with subsequent growth and proliferation. The polymers can be characterized with respect to mechanical properties such as tensile strength using an Instron tester, for polymer molecular weight by gel permeation chromatography (GPC), glass transition temperature by differential scanning calorimetry (DSC) and bond structure by infrared (IR) spectroscopy.

[0134] Examples of polymers which can be used include natural and synthetic polymers, although synthetic polymers may be preferred for reproducibility and controlled release kinetics. Synthetic polymers that can be used include biodegradable polymers such as poly(lactide) (PLA), poly(glycolic acid) (PGA), poly(lactide-co-glycolide) (PLGA), and other polyhydroxyacids, poly( caprolactone), polycarbonates, polyamides, polyanhydrides, polyphosphazene, polyamino acids, polyortho esters, polyacetals, polycyanoacrylates and biodegradable polyurethanes; non-biodegradable polymers such as polyacrylates, ethylenevinyl acetate polymers and other acyl-substituted cellulose acetates and derivatives thereof; polyurethanes, polystyrenes, polyvinyl chloride, polyvinyl fluoride, poly(vinyl imidazole), chlorosulphonated polyolefins, and polyethylene oxide. Examples of biodegradable natural polymers include proteins such as albumin, collagen, fibrin, silk, synthetic polyamino acids and prolamines; polysaccharides such as alginate, heparin; and other naturally occurring biodegradable polymers of sugar units. Alternately, combinations of the aforementioned polymers can be used. In one aspect, a natural polymer that is not generally found in the extracellular matrix can be used.

[0135] PLA, PGA and PLA / PGA copolymers are particularly useful for forming biodegradable scaffolds. PLA polymers are usually prepared from the cyclic esters of lactic acids. Both L(+) and D(-) forms of lactic acid can be used to prepare the PLA polymers, as well as the optically inactive DL-lactic acid mixture of D(-) and L( +) lactic acids. Methods of preparing polylactides are well documented in the patent literature. The following U.S. Patents, the teachings of which are hereby incorporated by reference, describe in detail suitable polylactides, their properties and their preparation: U.S. Pat. No. 1,995,970 to Dorough; U.S. Pat. No. 2,703,316 to Schneider; U.S. Pat. No. 2,758,987 to Salzberg; U.S. Pat. No. 2,951,828 to Zeile; U.S. Pat. No. 2,676,945 to Higgins; and U.S. Pat. Nos. 2,683,136; 3,531,561 to Trehu.

[0136] PGA is a homopolymer of glycolic acid (hydroxyacetic acid). In the conversion of glycolic acid to poly(glycolic acid), glycolic acid is initially reacted with itself to form the cyclic ester glycolide, which in the presence of heat and a catalyst is converted to a high molecular weight linear-chain polymer. PGA polymers and their properties are described in more detail in Cyanamid Research Develops World's First Synthetic Absorbable Suture", Chemistry and Industry, 905 (1970).

[0137] The gel formed by the matrix components may be a substance that is liquid, solid, or semi-solid. Accordingly, the gel may for example have properties ranging from soft and weak to hard and tough. The gel may have properties enabling the adhesion of cells, such as cells of the heart. The gel may be cultured according to any method known in the art.

[0138] In some embodiments it can be desirable to include bioactive molecules / factors to the Matrix composition and / or gel. The bioactive factors may include growth factors. Examples of growth factors include platelet derived growth factor (PDGF), transforming growth factor alpha or beta (TGFI3), bone morphogenic protein 4 (BMP4), fibroblastic growth factor 7 (FGF7), fibroblast growth factor 10 (FGF10), epidermal growth factor (EGF / TGFa), vascular endothelium growth factor (VEGF), some of which are also angiogenic factors. Such factors are known to those skilled in the art and are available commercially or described in the literature.

[0139] A method of promoting enqraftment of cardiomyocytes

[0140] Improving engraftment may be key to subsequent regeneration of functional heart tissue following injury to the myocardium. Accordingly, disclosed herein is a method of promoting engraftment of cardiomyocytes into cardiac tissue, the method comprising administering to cardiac tissue of a subject in need thereof, a thereof a mixture comprising cardiomyocytes and exogenous fibronectin. The mixture used in the method of engraftment of cardiomyocytes into cardiac tissue may comprise any composition disclosed herein including any concentration and ratio of cardiomyocytes to epicardial cells / progeny thereof disclosed herein.

[0141] A method of promoting a mature phenotype

[0142] Disclosed herein is a method of promoting a mature phenotype of transplanted human cardiomyocytes, the method comprising administering to cardiac tissue of a subject in need thereof a mixture comprising cardiomyocytes and exogenous fibronectin.

[0143] The mixture used in the method of promoting a mature phenotype of transplanted human cardiomyocytes may comprise any composition disclosed herein. For example, the composition may comprise components of the composition (e.g., exogenous fibronectin) at any concentration disclosed herein. As a further example, the composition may comprise any ratio of cardiomyocytes to epicardial cells / progeny thereof disclosed herein.

[0144] Cardiomyocyte maturity may be indicated by one or more of an increase in sarcomere length, an increase in cardiomyocyte diameter or length, an increase in active force generation, an increase in passive force generation, expression of the cardiac isoform, cTnT, oftroponin, and connexin 43 expression when cardiomyocytes are transplanted in combination with epicardial cells, relative to cardiomyocyte transplantation alone. The skilled person may conduct any assay known in the art to determine cardiomyocyte maturity based on these parameters. For example, sarcomere length can be determined by immunofluorescent imaging as described in the Examples.

[0145] A method of treating a cardiovascular condition or disease

[0146] The heart is made of three major tissue layers: the endocardium, myocardium, and epicardium. The epicardium is the outermost epithelial layer of the heart and is responsible for the formation of coronary vascular smooth muscle cells. The epicardium can be reactivated to a more fetal form and / or the epicardial cells can undergo epithelial-to- mesenchymal transition (EMT) in response to an acute injury to the myocardium (e.g., a myocardial infarction). Provided herein are compositions and uses thereof in the treatment of cardiovascular conditions / diseases including cardiac injury, cardiac disease / disorder, which may involve the promotion of vascularization and engraftment of co-administered cardiomyocytes.

[0147] Accordingly, disclosed herein are methods of treating or preventing a cardiovascular condition or disease in a subject. The method of treatment may comprise administering to cardiac tissue of a subject in need thereof, a mixture comprising cardiomyocytes and exogenous fibronectin. The present disclosure also provides second medical uses. For example, disclosed herein is a mixture comprising cardiomyocytes and exogenous fibronectin for use in a method of treating or preventing a cardiovascular condition or disease in a subject. The method may comprise administering the mixture to cardiac tissue of the subject. The present disclosure also provides Swiss-style medical uses. For example, disclosed herein is use of a mixture comprising cardiomyocytes and exogenous fibronectin in the manufacture of a medicament for the treatment or prevention of a cardiovascular condition or disease in a subject. The use may comprise administering the mixture to cardiac tissue of the subject. Accordingly, any references herein to methods of treatment are references to the corresponding second medical use and the corresponding Swiss-style medical use, vice versa.

[0148] Cardiovascular condition or disease may include those disclosed herein such as cardiac infarction. Indicators of cardiovascular condition or disease include functional indicators or parameters, e.g., stroke volume, heart rate, left ventricular ejection fraction, heart rate, heart rhythm, blood pressure, heart volume, regurgitation, etc. as well as biochemical indicators, such as a decrease in markers of cardiac injury, such as serum lactate dehydrogenase, or serum troponin, among others. As one example, myocardial ischemia and reperfusion are associated with reduced cardiac function. Subjects that have suffered an ischemic cardiac event and / or that have received reperfusion therapy have reduced cardiac function when compared to that before ischemia and / or reperfusion. Measures of cardiac function include, for example, ejection fraction and fractional shortening. Ejection fraction is the fraction of blood pumped out of a ventricle with each heartbeat. The term ejection fraction applies to both the right and left ventricles. LVEF refers to the left ventricular ejection fraction (LVEF). Fractional shortening refers to the difference between end-diastolic and end-systolic dimensions divided by end-diastolic dimension. For example, the subject in need may have suffered a cardiac infarction.

[0149] Exogenous fibronectin including exogenous fibronectin comprised in a composition disclosed herein or a tissue particle disclosed herein may be administered at a concentration of at least about 0.1 ug / ml, at least about 10 pg / ml, or at least about 100 pg / ml. In one embodiment, exogenous fibronectin including exogenous fibronectin comprised in a composition disclosed herein or a tissue particle disclosed herein is administered at a concentration of about 10 pg / ml to 100 pg / ml. In one embodiment, the exogenous fibronectin including exogenous fibronectin comprised in a composition disclosed herein or a tissue particle disclosed herein is administered at a concentration of about 10 mg / mL, about 50 mg / mL, or about 100 mg / ml. In one embodiment, the exogenous fibronectin including exogenous fibronectin comprised in a composition disclosed herein or a tissue particle disclosed herein is administered at a concentration of about 1 pg / ml, about 2 pg / ml, about 3 pg / ml, about 4 pg / ml, about 5 pg / ml, about 6 pg / ml, about 7 pg / ml, about 8 pg / ml, about 9 pg / ml, about 10 pg / ml, about 11 pg / ml, about 12 pg / ml, about 13 pg / ml, about 14 pg / ml, about 15 pg / ml, about 16 pg / ml, about 17 pg / ml, about 18 pg / ml, about 19 pg / ml, about 20 pg / ml, about 21 pg / ml, about 22 pg / ml, about 23 pg / ml, about 24 pg / ml, about 25 pg / ml, about 26 pg / ml, about 27 pg / ml, about 28 pg / ml, about 29 pg / ml, about 30 pg / ml, about 31 pg / ml, about 32 pg / ml, about 33 pg / ml, about 34 pg / ml, about 35 pg / ml, about 36 pg / ml, about 37 pg / ml, about 38 pg / ml, about 39 pg / ml, about 40 pg / ml, about 41 pg / ml, about 42 pg / ml, about 43 pg / ml, about 44 pg / ml, about 45 pg / ml, about 46 pg / ml, about 47 pg / ml, about 48 pg / ml, about 49 pg / ml, about 50 pg / ml, about 51 pg / ml, about 52 pg / ml, about 53 pg / ml, about 54 pg / ml, about 55 pg / ml, about 56 pg / ml, about 57 pg / ml, about 58 pg / ml, about 59 pg / ml, about 60 pg / ml, about 61 pg / ml, about 62 pg / ml, about 63 pg / ml, about 64 pg / ml, about 65 pg / ml, about 66 pg / ml, about 67 pg / ml, about 68 pg / ml, about 69 pg / ml, about 70 pg / ml, about 71 pg / ml, about 72 pg / ml, about 73 pg / ml, about 74 pg / ml, about 75 pg / ml, about 76 pg / ml, about 77 pg / ml, about 78 pg / ml, about 79 pg / ml, about 80 pg / ml, about 81 pg / ml, about 82 pg / ml, about 83 pg / ml, about 84 pg / ml, about 85 pg / ml, about 86 pg / ml, about 87 pg / ml, about 88 pg / ml, about 89 pg / ml, about 90 pg / ml, about 91 pg / ml, about 92 pg / ml, about 93 pg / ml, about 94 pg / ml, about 95 pg / ml, about 96 pg / ml, about 97 pg / ml, about 98 pg / ml, about 99 pg / ml, about 100 pg / ml. In one embodiment, the exogenous fibronectin including exogenous fibronectin comprised in a composition disclosed herein or a tissue particle disclosed herein is administered at a concentration of about 10 pg / ml, about 20 pg / ml, about 30 pg / ml, about 40 pg / ml, about 50 pg / ml, about 60 pg / ml, about 70 pg / ml, about 80 pg / ml, about 90 pg / ml, about 100 pg / ml, about 110 pg / ml, about 120 pg / ml, about 130 pg / ml, about 140 pg / ml, about 150 pg / ml, about 160 pg / ml, about 170 pg / ml, about 180 pg / ml, about 190 pg / ml, about 200 pg / ml, about 210 pg / ml, about 220 pg / ml, about 230 pg / ml, about 240 pg / ml, about 250 pg / ml, about 260 pg / ml, about 270 pg / ml, about 280 pg / ml, about 290 pg / ml, about 300 pg / ml, about 310 pg / ml, about 320 pg / ml, about 330 pg / ml, about 340 pg / ml, about 350 pg / ml, about 360 pg / ml, about 370 pg / ml, about 380 pg / ml, about 390 pg / ml, about 400 pg / ml, about 410 pg / ml, about 420 pg / ml, about 430 pg / ml, about 440 pg / ml, about 450 pg / ml, about 460 pg / ml, about 470 pg / ml, about 480 pg / ml, about 490 pg / ml, about 500 pg / ml, about 510 pg / ml, about 520 pg / ml, about 530 pg / ml, about 540 pg / ml, about 550 pg / ml, about 560 pg / ml, about 570 pg / ml, about 580 pg / ml, about 590 pg / ml, about 600 pg / ml, about 610 pg / ml, about 620 pg / ml, about 630 pg / ml, about 640 pg / ml, about 650 pg / ml, about 660 pg / ml, about 670 pg / ml, about 680 pg / ml, about 690 pg / ml, about 700 pg / ml, about 710 pg / ml, about 720 pg / ml, about 730 pg / ml, about 740 pg / ml, about 750 pg / ml, about 760 pg / ml, about 770 pg / ml, about 780 pg / ml, about 790 pg / ml, about 800 pg / ml, about 810 pg / ml, about 820 pg / ml, about 830 pg / ml, about 840 pg / ml, about 850 pg / ml, about 860 pg / ml, about 870 pg / ml, about 880 pg / ml, about 890 pg / ml, about 900 pg / ml, about 910 pg / ml, about 920 pg / ml, about 930 pg / ml, about 940 pg / ml, about 950 pg / ml, about 960 pg / ml, about 970 pg / ml, about 980 pg / ml, about 990 pg / ml, about 1000 pg / ml.

[0150] Cardiomyocytes including cardiomyocytes comprised in a composition disclosed herein or a tissue particle disclosed herein may be administered to the subject in need thereof at about a ratio of 2:1 to 10:1 relative to the epicardial cells or progeny thereof. In one embodiment, cardiomyocytes including cardiomyocytes comprised in a composition disclosed herein or a tissue particle disclosed herein may be administered to the subject in need thereof at a ratio of about 1 : 1 to 10: 1 , about 2:1 to 10:1 , about 3: 1 to 10: 1 , about 4: 1 to 10:1, about 5:1 to 10:1 , about 6:1 to 10:1, about 7:1 to 10:1, about 8:1 to 10:1 , about 9:1 to 10:1 relative to the epicardial cells or progeny thereof. In one embodiment, cardiomyocytes including cardiomyocytes comprised in a composition disclosed herein or a tissue particle disclosed herein may be administered to the subject in need thereof at a ratio of about 1:1, about 2: 1 , about 3: 1 , about 4: 1 , about 5: 1 , about 6: 1 , about 7:1, about 8: 1 , about 9: 1 , about 10: 1 , 20: 1 , 30: 1 , 40: 1 , 50: 1 , or 100: 1 relative to the epicardial cells or progeny thereof.

[0151] Non-limiting examples of clinical tests that can be used to assess cardiac functional parameters include echocardiography (with or without Doppler flow imaging), electrocardiogram (EKG), exercise stress test, Holter monitoring, or measurement of 13- natriuretic peptide.

[0152] Exemplary modes of administration for use in the methods described herein include, but are not limited to, injection, intracardiac delivery, systemic administration and implantation (with or without a scaffold material). "Injection" includes, without limitation, intracardiac, intravenous, intramuscular, intraarterial, intradermal, intraperitoneal and subcutaneous.

[0153] In some embodiments, a therapeutically effective amount of cardiomyocytes and / or epicardial cells is administered using direct injection into the heart including, but not limited to administration during open-heart surgery or by intracardiac injection through an intact chest. In some aspects of these methods, a therapeutically effective amount of cardiomyocytes and / or epicardial cells are administered using a systemic, such as an intraperitoneal or intravenous route. In other aspects of these methods, a therapeutically effective amount of cardiomyocytes and / or epicardial cells is administered using systemic or intraperitoneal administration. These methods are particularly aimed at therapeutic and prophylactic treatments of human subjects having, or at risk of having, a cardiac disease or disorder. The human cardiomyocytes and / or epicardial cells) described herein can be administered to a subject having any cardiac disease or disorder by any appropriate route which results in an effective treatment in the subject. In some embodiments of the aspects described herein, a subject having a cardiac disorder is first selected prior to administration of the cells.

[0154] In some embodiments, an effective amount of cardiomyocytes and / or epicardial cells are administered to a subject by intracardiac administration or delivery. As defined herein, intracardiac administration or delivery refers to all routes of administration whereby a population of cardiomyocytes and / or epicardial cells is administered in a way that results in direct contact of these cells with the myocardium of a subject, including, but not limited to, direct cardiac injection, intra-myocardial injection(s), intra-infarct zone injection, injection during surgery (e.g., cardiac bypass surgery, during implantation of a cardiac mini-pump or a pacemaker, etc.). In some such embodiments, the cells are injected into the myocardium (e.g., cardiomyocytes), or into the cavity of the atria and / or ventricles. In some embodiments, intracardiac delivery of cells includes administration methods whereby cells are administered, for example as a cell suspension, to a subject undergoing surgery via a single injection or multiple "mini" injections into the desired region of the heart.

[0155] The choice of formulation will depend upon the specific composition used and the number of cardiomyocytes and / or epicardial cells to be administered; such formulations can be adjusted by the skilled practitioner. By way of example, where the composition is cardiomyocytes and / or epicardial cells in a pharmaceutically acceptable carrier, the composition can be a suspension of the cells in an appropriate buffer (e.g., saline buffer) at an effective concentration of cells per mL of solution. The formulation can also include cell nutrients, a simple sugar (e.g., for osmotic pressure regulation) or other components to maintain the viability of the cells.

[0156] In some embodiments, additional agents to aid in treatment of the subject can be administered before or following treatment with the cardiomyocytes and / or epicardial cells as described. Such additional agents can be used to prepare the target tissue for administration of the progenitor cells. Alternatively, the additional agents can be administered after the cardiomyocytes and / or epicardial cells to support the engraftment and growth of the administered cell into the heart or other desired administration site. In some embodiments, the additional agent comprises growth factors, such as VEGF or PDGF. Other exemplary agents can be used to reduce the load on the heart while the cardiomyocytes are engrafting (e.g.. beta blockers, medications to lower blood pressure etc.).

[0157] The cardiomyocytes and / or epicardial cells can be derived from one or more donors, or can be obtained from an autologous source. In some embodiments of the aspects described herein, the cardiomyocytes and / or epicardial cells are expanded in culture prior to administration to a subject in need thereof.

[0158] The methods and compositions provided herein relate to a therapeutically effective amount of cardiomyocytes and / or epicardial cells (e.g., human cardiomyocytes and human epicardial cells). Thus, in some embodiments a therapeutically effective amount of cardiomyocytes is co-administered with epicardial cells to a subject to (i) repair infarcted zones of cardiac injury, (ii) promote recovery following cardiac ischemia or injury, and / or (iii) promote tissue repair and / or tissue engineering.

[0159] Compositions comprising cardiomyocytes and / or epicardial cells as described herein can be administered to any desired region of the heart including, but not limited to, an infarcted zone, peri infarcted zone, ischemic zone, penumbra, the border zone, areas of wall thinning, areas of non-compaction, or in area(s) at risk of maladaptive cardiac remodelling.

[0160] In some embodiments, a composition comprising the cardiomyocytes and / or epicardial cells as described herein is delivered at least 6 hours following the initiation of reperfusion, for example, following a myocardial infarction. During an ischemic insult and subsequent reperfusion, the microenvironment of the heart or that of the infarcted zone can be too "hostile" to permit engraftment of cardiomyocytes and / or epicardial cells administered to the heart. Thus, in some embodiments it is preferable to administer such compositions at least 6 hours, at least 12 hours, at least 18 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days or more following the initiation of reperfusion. In some embodiments, the compositions comprising cardiomyocytes and / or epicardial cells as described herein can be administered to an infarcted zone, peri-infarcted zone, ischemic zone, penumbra, or the border zone of the heart at any length of time after a myocardial infarction (e.g., at least 1 month, at least 6 months, at least one year, at least 2 years, at least 5 years, at least 10 years, at least 20 years, at least 30 years or more), however as will be appreciated by those of skill in the art, the success of engraftment following a lengthy interval of time after infarct will depend on a number of factors, including but not limited to, amount of scar tissue deposition, density of scar tissue, size of the infarcted zone, degree of vascularization surrounding the infarcted zone, etc. As such, earlier intervention by administration of compositions comprising cardiomyocytes and / or epicardial cells may be more efficacious than administration after e.g., a month or more after infarct.

[0161] The methods described herein can be used to treat, ameliorate, prevent or slow the progression of a number of cardiac diseases or their symptoms, such as those resulting in pathological damage to the structure and / or function of the heart. The terms "cardiovascular disease” or “cardiovascular condition” may refer to a condition and / or disorder relating to the heart, including the functional engraftment and vascularization of cardiomyocytes into e.g., infarcted zones.

[0162] The efficacy of treatment can be determined by the skilled clinician. However, a treatment is considered "effective treatment," as the term is used herein, if any one or all of the symptoms, or other clinically accepted symptoms or markers of disease, e.g., cardiac disease, heart failure, cardiac injury and / or a cardiac disorder are reduced, e.g., by at least 10% following treatment with a composition comprising human cardiomyocytes and / or epicardial cells as described herein. Methods of measuring these indicators are known to those of skill in the art.

[0163] An in vitro method of promoting maturity

[0164] Disclosed herein is an in vitro method of promoting maturity of cardiomyocytes, the method comprising culturing cardiomyocytes in the presence of exogenous fibronectin.

[0165] Exogenous fibronectin may be present at a concentration of at least about 0.1 ug / ml, at least about 10 pg / ml, or at least about 100 pg / ml. In one embodiment, exogenous fibronectin may be present at a concentration of about 10 pg / ml to 100 pg / ml. In one embodiment, exogenous fibronectin may be present at a concentration of about 10 mg / mL, about 50 mg / mL, or about 100 mg / ml. In one embodiment, the exogenous fibronectin may be present at a concentration of about 1 pg / ml, about 2 pg / ml, about 3 pg / ml, about 4 pg / ml, about 5 pg / ml, about 6 pg / ml, about 7 pg / ml, about 8 pg / ml, about 9 pg / ml, about 10 pg / ml, about 11 pg / ml, about 12 pg / ml, about 13 pg / ml, about 14 pg / ml, about 15 pg / ml, about 16 pg / ml, about 17 pg / ml, about 18 pg / ml, about 19 pg / ml, about 20 pg / ml, about 21 pg / ml, about 22 pg / ml, about 23 pg / ml, about 24 pg / ml, about 25 pg / ml, about 26 pg / ml, about 27 pg / ml, about 28 pg / ml, about 29 pg / ml, about 30 pg / ml, about 31 pg / ml, about 32 pg / ml, about 33 pg / ml, about 34 pg / ml, about 35 pg / ml, about 36 pg / ml, about 37 pg / ml, about 38 pg / ml, about 39 pg / ml, about 40 pg / ml, about 41 pg / ml, about 42 pg / ml, about 43 pg / ml, about 44 pg / ml, about 45 pg / ml, about 46 pg / ml, about 47 pg / ml, about 48 pg / ml, about 49 pg / ml, about 50 pg / ml, about 51 pg / ml, about 52 pg / ml, about 53 pg / ml, about 54 pg / ml, about 55 pg / ml, about 56 pg / ml, about 57 pg / ml, about 58 pg / ml, about 59 pg / ml, about 60 pg / ml, about 61 pg / ml, about 62 pg / ml, about 63 pg / ml, about 64 pg / ml, about 65 pg / ml, about 66 pg / ml, about 67 pg / ml, about 68 pg / ml, about 69 pg / ml, about 70 pg / ml, about 71 pg / ml, about 72 pg / ml, about 73 pg / ml, about 74 pg / ml, about 75 pg / ml, about 76 pg / ml, about 77 pg / ml, about 78 pg / ml, about 79 pg / ml, about 80 pg / ml, about 81 pg / ml, about 82 pg / ml, about 83 pg / ml, about 84 pg / ml, about 85 pg / ml, about 86 pg / ml, about 87 pg / ml, about 88 pg / ml, about 89 pg / ml, about 90 pg / ml, about 91 pg / ml, about 92 pg / ml, about 93 pg / ml, about 94 pg / ml, about 95 pg / ml, about 96 pg / ml, about 97 pg / ml, about 98 pg / ml, about 99 pg / ml, about 100 pg / ml. In one embodiment, the exogenous fibronectin may be present at a concentration of about 10 pg / ml, about 20 pg / ml, about 30 pg / ml, about 40 pg / ml, about 50 pg / ml, about 60 pg / ml, about 70 pg / ml, about 80 pg / ml, about 90 pg / ml, about 100 pg / ml, about 110 pg / ml, about 120 pg / ml, about 130 pg / ml, about 140 pg / ml, about 150 pg / ml, about 160 pg / ml, about 170 pg / ml, about 180 pg / ml, about 190 pg / ml, about 200 pg / ml, about 210 pg / ml, about 220 pg / ml, about 230 pg / ml, about 240 pg / ml, about 250 pg / ml, about 260 pg / ml, about 270 pg / ml, about 280 pg / ml, about 290 pg / ml, about 300 pg / ml, about 310 pg / ml, about 320 pg / ml, about 330 pg / ml, about 340 pg / ml, about 350 pg / ml, about 360 pg / ml, about 370 pg / ml, about 380 pg / ml, about 390 pg / ml, about 400 pg / ml, about 410 pg / ml, about 420 pg / ml, about 430 pg / ml, about 440 pg / ml, about 450 pg / ml, about 460 pg / ml, about 470 pg / ml, about 480 pg / ml, about 490 pg / ml, about 500 pg / ml, about 510 pg / ml, about 520 pg / ml, about 530 pg / ml, about 540 pg / ml, about 550 pg / ml, about 560 pg / ml, about 570 pg / ml, about 580 pg / ml, about 590 pg / ml, about 600 pg / ml, about 610 pg / ml, about 620 pg / ml, about 630 pg / ml, about 640 pg / ml, about 650 pg / ml, about 660 pg / ml, about 670 pg / ml, about 680 pg / ml, about 690 pg / ml, about 700 pg / ml, about 710 pg / ml, about 720 pg / ml, about 730 pg / ml, about 740 pg / ml, about 750 pg / ml, about 760 pg / ml, about 770 pg / ml, about 780 pg / ml, about 790 pg / ml, about 800 pg / ml, about 810 pg / ml, about 820 pg / ml, about 830 pg / ml, about 840 pg / ml, about 850 pg / ml, about 860 pg / ml, about 870 pg / ml, about 880 pg / ml, about 890 pg / ml, about 900 pg / ml, about 910 pg / ml, about 920 pg / ml, about 930 pg / ml, about 940 pg / ml, about 950 pg / ml, about 960 pg / ml, about 970 pg / ml, about 980 pg / ml, about 990 pg / ml, about 1000 pg / ml.

[0166] The exogenous fibronectin used in the method may comprise one or more of recombinant fibronectin, isolated and / or purified fibronectin, and fibronectin that has been produced in vitro.

[0167] The cardiomyocytes in the method, may be cultured in the presence of any composition and / or tissue particle disclosed herein.

[0168] The degree of cardiomyocyte maturity may be indicated by one or more of an increase in sarcomere length, an increase in cardiomyocyte diameter or length, an increase in active force generation, an increase in passive force generation, expression of the cardiac isoform, cTnT, oftroponin, and connexin 43 expression when cardiomyocytes are transplanted in combination with epicardial cells, relative to cardiomyocyte transplantation alone. The skilled person may conduct any assay known in the art to determine cardiomyocyte maturity based on these parameters. For example, sarcomere length can be determined by immunofluorescent imaging as described in the Examples.

[0169] The reader's attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.

[0170] EXAMPLES

[0171] The following Examples are provided to illustrate the invention, but not to limit the invention.

[0172] 1 - Results

[0173] Competitive inhibition of FN1 using the recombinant peptide pUR4 impairs hESC-CM maturation

[0174] The effects of epicardial FN1 on CM structure and function were studied. Firstly, 3D- EHTs with hESC-CMs and hESC-EPIs were generated (Figures 1A-1C). For each experiment, 3DEHTs were transferred to a myograph with a length controller and a force transducer to assess force generation followed by testing of Ca2+ kinetics. CM structure using histological sections was also assessed. Before investigating the effects of FN1 inhibition, the ratio of CM and EPI cells within the 3D-EHTs was optimized and it was found that 3D-EHTs containing 10% EPI generated the greatest amount of active and passive force compared with 3D-EHTs containing either 30% EPI or 50% EPI, or only CM (Figures 1D, 1E, 7A, and 7B). This result was confirmed by investigating Ca2+ handling and the highest Ca2+-upstroke velocity, shortest time to peak, and shortest decay time in 3D-EHTs containing 10% EPI was found (Figures 1F, 1G, 7C, and 7D). To test whether epicardial FN1 was at least in part responsible for the epicardial effects on CM structure and function, FN1 using the 49-residue recombinant peptide pUR4 was inhibited. pUR4 binds to the N- terminal regions of FN1, competing with a5b1 for its binding domain and inhibiting assembly of FN fibrils (Figure 2A). The hESC-EPI in 2D monolayers was treated with pUR4 for 72 h and it was noted that FN1 protein levels in the cell / substrate layer were drastically reduced (Figure 2B). Furthermore, using immunohistochemistry (IHC) it was found that FN1 deposition was qualitatively and quantitatively reduced in 3D-EHTs composed of pUR4- treated EPI cells compared with constructs containing untreated EPI (Figures 2C and 2D). This finding was consistent with diminished a5b1 clustering (Figures 2E and S1E) and paralleled by reduced sarcomeric length and myofibril alignment of CMs in 3D-EHTs containing pUR4-treated EPI (Figures 2F and 2G).

[0175] Active and passive force generation was next assessed on a myograph and it was found that the active force generated by 3DEHTs was significantly reduced when pUR4- treated EPI cells were used in their construction compared with untreated EPI (Figures 2H and 2I). However, pUR4-mediated inhibition of epicardial FN1 had no effect on passive force generated by 3D-EHTs (Figures 2J and 2K). Finally, Ca2+ handling was examined, which showed that FN1 inhibition reduced Ca2+ upstroke velocity and increased times to peak fluorescent intensity of 3D-EHTs, but not decay times (Figures 2L-2O). In summary, the performance of 3D-EHTs was impaired after inhibiting FN1-integrin binding, suggesting that intact fibrillogenesis of FN1 is an essential component of the epicardial effect on promoting structure and function of CMs.

[0176] Constitutive loss of epicardial FN1 using a CRISPRCas9-edited KO hESC line impairs CM maturation

[0177] To study the effects of a complete loss of epicardial FN1 from the hESC stage onwards, a CRISPR-Cas9-edited FN1 KO line was generated from RLIES2 hESCs (KOFN1) (Figures 8A-8C). Firstly, KOFN1- hESCs can differentiate to EPls, as demonstrated by robust expression of the epicardial markers WT 1 , TCF21 , and BNC1 at the transcript and protein level, respectively (Figures 3A and 3B). At the same time KOFN1-EPI completely lacked FN1 expression both at the transcript and protein level, in contrast with wild-type (WT) EPI (Figures 3C and 3D). In 3D-EHTs containing KOFN1-EPI, FN1 deposition was also markedly reduced and clustering of integrin a5b1 was impaired (Figures 3E-3G and 8D). These results demonstrated a successful loss of FN1 in our constructs while epicardial identity was maintained, allowing the focus to be on FN1 -specific effects.

[0178] Using the same assessments as before, we examined how a constitutive loss of FN1 in EPI-containing 3D-EHTs affects CM structure and function. First, it was found that CMs in constructs containing KOFN1-EPI had shorter sarcomeric lengths and a reduced myofibril alignment compared with CMs in constructs containing WT-EPI (Figures 3H and 3I). In line with these findings, the inclusion of KOFN1-EPI in 3D-EHTs instead of WT-EPI attenuated the active force-length relationship, while no effects on passive force generation were observed (Figures 3J-3M). This was paralleled by decreased Ca2+ upstroke velocity and increased time to peak fluorescence (Figures 3N and 30), but not a significant prolongation of Ca2+ decay times (Figures 3P and 3Q). Finally, high variance in Ca2+ handling data was noted in experiments shown in Figures 1, 2, and 3 with inconsistencies in differences between the control conditions in individual experiments (hESC-CM only compared with hESC-CM + EPI) (Figures 1F, 1G, 7C, 7D, 2L-2O, 3P, and 3Q). However, the results of these control conditions were pooled together and the differences reached statistical significance, validating our experiments (Figure 10G).

[0179] Collectively, these results corroborated the findings on FN1 inhibition, demonstrating that a complete loss of epicardial FN1 in 3D-EHTs impaired CM maturation and produced CMs with a structure and function comparable with CMs in 3D-EHTs constructed without any EPI.

[0180] Temporal loss of epicardial FN1 expression with a tetracycline-inducible knockdown is sufficient to abrogate CM maturation To investigate the effects of temporal modulation of epicardial FN1 expression, a tetracycline-inducible knockdown (KD) of FN1 was performed. For this, a singlestep optimized inducible gene KD (sOPTiKD) of FN1 was used to generate an hESC-sOPTiKD- FN1 cell line (Bertero et al., 2016, 2018) (Figures 9A-9C). Three sOPTiKD-FN1 H9 clones into hESC-EPI were then differentiated, which expressed epicardial markers including FN1 and maintained typical epicardial morphology (Figures 4A-4C). All clones successfully downregulated FN1 after exposure to tetracycline (up to 81%) (Figure 4B). However, clone 5.3 was selected for further experiments as it expressed the highest level of pluripotency markers at the hESC stage and epicardial markers after directed differentiation both with and without tetracycline (Figures 9D and 9E). 3D-EHTs were then constructed by combining CMs and sOPTiKD-FN1 EPI clone 5.3 which validated the approach, finding that FN1 deposition was decreased after tetracycline exposure of 3D-EHTs containing sOPTiKD-FN1 EPI (Figures 4D, 4E, and 9F). This temporal loss of FN1 following tetracycline exposure abrogated the beneficial effects caused by EPI on CM maturation and structure, including sarcomere length and alignment (Figures 4F and 4G). Additionally, active force generation was reduced in 3D-EHTs containing sOPTiKD-FN1 EPI that were exposed to tetracycline (Figures 4H and 4I), while no effect was observed on passive force generation (Figures 4J and 4K). Furthermore, tetracycline-induced KD of FN1 resulted in increased time to peak fluorescence but had no significant impact on Ca2+ upstroke velocity or Ca2+ decay times (Figures 4L-4O).

[0181] Although these results continued to show that FN1 deposition in 3D-EHTs was a major component of the epicardial effect, it was not clear if FN1 acted independently of other epicardial mechanisms. Therefore, it was tested whether the addition of recombinant human FN1 (rhFN1) to CM-only 3D-EHTs could reproduce the effects elicited on CMs by hPSC-EPI in 3D-EHTs. It was found that rhFN added to 3D-EHTs at concentrations of 10 mg / mL, 50 mg / mL, and 100 mg / ml resulted in significant increases in sarcomeric length compared with untreated 3D-EHTs (Figures 5A and 5B). Moreover, improvements in sarcomere length were positively correlated with rhFN dose (one-tailed Pearson correlation; p < 0.05). It was confirmed that FN1 was detectable in supplemented 3D-EHTs at greater levels than in 3D- EHTs without supplementation, but not at levels exceeding those seen in hESC-EPI- containing constructs (Figures 5C and 5D). Additionally, it was found that 3D-EHTs treated with 100 mg / mL rhFN generated more active force than untreated 3D-EHTs, in line with hESC-EPI-containing constructs (Figures 5E and 5F). Furthermore, lower doses of rhFN also appeared to increase the passive force of 3D-EHTs (Figures 5G and 5H). However, the addition of rhFN to 3DEHTs had no effect on Ca2+ handling (Figures 5I-5L). Overall, these results provided further evidence that FN1 is required for the full positive effect of hESC-EPI on CM maturation. Moreover, by decoupling FN1 from epicardium, it was shown shown that FN1 may act independently to increase CM structure and function.

[0182] The EPI-CM interactome reveals a regulatory gene network driving cardiac development and regeneration

[0183] FN1 may only be one facet of EPI-CM crosstalk that regulates myocardial growth and maturation. Therefore, the interface of secreted epicardial factors and membrane-bound cell surface receptors on CMs and the role of FN1 within was investigated. To do so, bulk RNAsequencing data from H9-derived hESC-EPI and hESC-CM was used to extract the EPI secretome and the CM membranome. A schematic of the experiment is shown in Figure 6A and the technical validation is depicted in Figure 11.

[0184] A differential expression analysis was performed between the hESC-EPI and neural crest (NC), using DESeq2. As previously described, H9-hESC-NC was chosen as a negative control due to its redundancy in CM maturation and development (Bargehr et al., 2019). Significantly upregulated EPI genes were filtered to retain only genes encoding putatively secreted proteins according to the Human Protein Atlas (HPA) (http: / / www.proteinatlas.org / humanproteome / secretome) (llhle'n et al., 2019). This dataset is called the epicardial secretome (Figure 6B; Table 1). In parallel, differential expression analysis was performed between day 30 hESC-CM and H9-hESCs before differentiation. Significantly upregulated CM genes were filtered and restricted to genes encoding receptors and proteins with predicted membrane-anchored regions according to the HPA (llhle'n et al., 2019). This dataset is termed the CM membranome (Figure 6B; Table 1). In total, a potential secretome of 379 upregulated epicardial factors and a membranome of 1,417 upregulated CM receptors was found (Figure 6B; Table 1).

[0185] Table 1 - Putative paracrine interactions between hESC-epicardium secreted factors and hESC-cardiomyocyte membrane components as predicted and ranked by String-DB.

[0186] Next, to determine the EPI-CM interactome, these gene lists were connected, revealing a network of secreted epicardial factors and their respective membrane-bound receptors on CMs. The protein interaction database STRINGdb v11 ( https : / / strin g- db.org / cgi / download.pl [2019 11 29]) was used, which covered 99.5% and 95.5% of the upregulated secretome and membranome genes respectively. The interactome was constructed by filtering the secretome to retain genes that interacted with genes found only within the membranome. This list was subset by only including interactions with a minimum experimental evidence score of above 400 for a higher confidence network (Figure 6C). Each interaction pair with a combined confidence score of above 700 was then functionally annotated following a manual literature review, categorizing the pathways where possible into the following regenerative roles: CM proliferation, maturation, survival, angiogenesis, development, extracellular matrix (ECM) regulation, inflammation, metabolism, and, more broadly, regeneration. Gene-pairs were then assigned to one or more of these roles (Table 1).

[0187] It was found that FN1 was one component of a network of 23 predicted interactions between hESC-EPI and hESC-CM cells. Specifically, FN1 was predicted to interact in a proliferative role directly with integrins (subunits alpha 5 and beta 3) and c-MET via modulation of its ligand human growth factor, also secreted by hESC-EPI cells. Additionally, FN1 appeared to interact with EGFR at the center of a hESCCM membrane network targeted by an array of hESC-EPI factors with putative roles in ECM regulation, vasculogenesis, development, and survival among other regenerative functions (Figure 6C). Furthermore, we also predicted multiple FN1 independent interactions between hESC-CM and hESC-EPI, including three from RSPO1, a recently identified regenerative epicardial protein (Li et al., 2019). The EPI-CM interactome demonstrated here provided key insights into additional crosstalk between EPI and CM cells in our 3D-EHTs and presents a paracrine network that drives cardiac development and maturation in EHTs. Epicardial FN1 plays a genotypic and phenotypic key role in this process.

[0188] Example 2 - Discussion

[0189] The addition of a stromal cell types such as the hESC-EPI to 3D-EHTs is seen to enhance hESC-CM contractile function and maturation (Bargehr et al., 2019). Although epicardia-lmyocardial crosstalk is likely responsible for this effect, the exact components ormechanisms governing the interaction remain unclear. Previous analysis on the 3D-EHTs only placed FN1 as candidate for further exploration as 3DEHTs containing hESC-EPI had increased FN1 deposition and upregulated FN1 expression compared with hESC-NC (Bargehr et al., 2019). Here, the inventors demonstrate FN1 as a key component and provided several lines of evidence for an essential role of FN1 in improving CM maturation and function as part of the beneficial effect of hESC-EPIs as adjuvants in 3D-EHTs.

[0190] First, through histological analysis, it was showed that the presence of epicardial FN1 was essential for maturation of the myofibril assembly. Without FN1, 3D-EHTs containing hESC-EPIs appeared histologically similar to those constructed with CMs alone. Second, by knocking out epicardial FN1 at both the gene and protein level, it was consistently shown that a loss of 3D-EHT function and CM maturity by observing a diminished active forcelength relationship and inefficient excitation-contraction coupling, which are defining features of immature CMs (Karbassi et al., 2020). Moreover, this reduced functional performance was similar to 3D-EHTs constructed with hESC-CMs only, suggesting that, without FN1, the epicardium is unable to significantly improve upon these parameters and that FN1 is necessary for the full effect of hESCEPI in driving hESC-CM maturation in collagen-based 3D-EHTs. It was demonstrated that FN1-integrin binding was the key step in this process using pUR4. Third, it was possible to recapitulate structural and functional benefits of adding hESC-EPI to 3D-EHTs by supplementing rhFN into CM-only constructs. Unlike the addition of hESC-EPI cells to 3D-EHTs, it was noted that rhFN administered in this manner only increased the force of CM-only constructs and not Ca2+ handling. While these results demonstrate that FN1 is in itself capable of augmenting 3D-EHTs and that FN1 is necessary for the full epicardial effect, they also suggest that FN1 is not the only factor in mediating the beneficial interaction between hESC-EPIs and hESC-CMs.

[0191] To explore the additional interactions between hESC-EPI and hESC-CM cells within the 3DEHTs using bioinformatics, FN1 was found in a wider paracrine interactome between both cell types. This interactome suggests that epicardial FN1 signals via a network of receptors and soluble factors to mediate the epicardialmyocardial crosstalk. In addition to CMmaturation, further downstream functions were outlined, including ECM turnover, cell survival, proliferation, and angiogenesis. Experimentally assessing the contribution of epicardial FN1 toward these additional facets of cardiac regeneration was outside of the scope of this study as 3D-EHTs restricted observations to maturation-based observations. Nonetheless, the interactome confirmed the necessary role of epicardial FN1 within EPI-CM crosstalk and revealed other signaling effectors that may drive CM maturation that require further exploration. This list of hESC-EPI-secreted factors provides a valuable resource of targets for insight into the mechanisms that govern CM maturation. Using the interactome as a starting point, it is proposed that, through individual or combined perturbation, future studies may drive CM maturation using commercially available cytokines, factor-expressing microbeads, targeted genetic manipulation of the parental line, or the use of hESC-EPIs themselves, as previously described (Bargehr et al., 2019; Iyer et al., 2015). Collectively, this interactome provides the basis to understand the beneficial effects of hESC-EPIs on structure and function of hESC-CMs by elucidating the underlying mechanistic pathways. While the epicardium is a prominent example of a cell lineage that supports cardiac development and repair, we encourage the use of these data to guide investigations on other cell types to study their regenerative function, including cardiac fibroblasts, endothelial cells, and smooth muscle cells. Code describing the derivation of the interactome is openly accessible and can be used by other groups to investigate the interaction between diverse cell types (GitHub: https: / / github.com / Hindrance / EpiSciData2020).

[0192] It was hypothesized that a loss of FN1 impairs hESC-CM maturation through a decrease of integrin-a5b1 clustering and downstream signaling as observed in this study. Normally, FN1 polymerization activates cell-surface integrin-a5b1 receptors (Wickstro"m et al. 2011; Israeli-Rosenberg et al., 2014) as an interface between extracellular and intracellular communication. Active integrins act as mechano-transducers, converting environmental mechanical cues into biochemical signals (Israeli-Rosenberg et al., 2014) that govern the cellular responses such as cell migration, survival, cell cycle progression, and differentiation (Schwarzbauer and DeSimone 2011 ; Wickstro"m et al. 2011). The FN1- integrin interaction in hESC-CMs may transmit these crucial biophysical and biochemical signals for communicating environmental cues, and subsequently regulate maturation and function. The inventors proposed that the loss of epicardial FN1 impairs the ability of hESC- CMs to respond to the environment by attenuating outside-inside signaling.

[0193] Despite the wide evolutionary distance, the phenotype induced in 3D-EHTs by loss of epicardial FN1 paralleled the observations within the zebrafish. In the injured zebrafish, activated EPls secrete FN1, which binds to integrinb3 receptors to recruit CMs within the site of injury (Wang et al., 2013). FN1 loss-of-function mutations disrupt zebrafish heart regeneration, leading to fibrosis instead of a contiguous wall of new muscle (Wang et al., 2013). It was noted that epicardial FN1 is highly expressed in zebrafish ECM, which may facilitate the ability of the zebrafish to successfully regenerate cardiac tissue (Mercer et al. 2013). While the dynamic nature of epicardial FN1 in human cellular models remains unclear, the role of epicardial FN1 in mediating epicardial-myocardial crosstalk to promote CM function appears to be conserved across species and broadens the relevance of these findings.

[0194] The applications for cardiac repair have grown exponentially over the past decade, ranging from direct intramyocardial injection of hPSC-derived cardiovascular cells to tissue engineering approaches and in vitro generation of complex tissues. While this study further highlights the complex nature of the mechanisms underlying these approaches, one major interaction and a further network of mechanisms was revealed that may be used to optimize therapeutic approaches according to their application. For instance, tissue-engineered cardiovascular patches might prioritize the induction of vasculogenesis post transplantation over the regulation of ECM and inflammation post myocardial infarction (Ml). Hence, one could selectively activate the angiogenic signaling pathways predicted by this interactome using individualized tissue constructs or microbeads that express activating factors. In contrast, for direct intramyocardial grafting of hESC-CMs, cells could be structurally and functionally matured in vitro, prior to transplantation targeting anti-inflammatory and prosurvival alongside ECM regulation pathways to dictate therapeutic success. Alternatively, for in vitro applications such as drug toxicity assays (for example, assays using chemotherapeutics to elicit toxic effects and arrhythmias), one may focus on activating cardiac maturation pathways to generate CMs with a more robust readout, more closely resembling the drug response exhibited by patients.

[0195] There were limitations within this study. Namely, experiments were carried out on small sample sizes, and biological variability was seen across all replicates when assessing force generation, Ca2+ handling, and sarcomeric assembly. This variability was attributed to independent cellular differentiations despite the use of robust differentiation protocols (Iyer et al., 2015; Bargehr et al., 2019). In particular, this affected the assessment of Ca2+ handling using fluorescent trace analysis as it is less sensitive than the assessment of force generation on a myograph. However, while individual Ca2+-handling experiments were unable to show effect size clearly, we increased statistical power by pooling the data of experiments shown in (Figures 1, 2, and 3) and demonstrated significant differences in all Ca2+-handling parameters between CM 3D-EHTs generated with or without hESC-EPI. Nonetheless, 3D-EHTs are the most physiologically relevant model to assess hESC-CM maturation as they enable functional readouts such as active force-length relationship and Ca2+ handling (Karbassi et al., 2020). These limitations were addressed prior to experiments by ensuring that hESC-CM differentiations were pure (>80% positive for cardiac troponin T [cTNT]), and that cell viability was optimized using with a 42C heat shock prior to constructing the 3D-EHTs. Furthermore, the hESC-EPI dose optimization experiments were performed only using hESC-EPIs derived from the H9 cell line. Although previously it was shown that the benefits of hESC-EPIs on 3D-EHTs was regardless of cell line (Bargehr et al., 2019), modest cell-line-dependent differences might exist at different hESC-EPI fractions. As such, the dose-response curves generated to optimize hESC-EPI content could be taken in the context of the cell line used and assessed during subsequent experiments. A final limitation is noted in the RNA-sequencing experiment that was performed on hESC derivatives in vitro and not from 3D-EHTs before or following transplantation. The analysis was not designed to draw conclusion about either the crosstalk between hESC-EPIs and hESC-CMs following transplantation in vivo or the crosstalk between primary EPls and CMs.

[0196] To conclude, it was demonstrated that FN1 promoted hESCCM maturation and function in 3D-EHTs across a series of FN1 loss-of-function experiments and a gain-of- function experiment. The findings implied that a loss of FN1 reduced integrin clustering and therefore signaling with hESC-CMs directed by the epicardium and epicardial FN1. Considering these results, it was concluded that epicardial FN1 is necessary for mediating the full effect of hESC-EPIs in driving CM maturation in 3D-EHTs. The epicardialmyocardial interactome expands on this key observation and highlights other components of epicardialmyocardial crosstalk that regulate proliferation, survival, angiogenesis, and ECM turnover, all processes crucial to achieving robust cardiac regeneration. Last, it can be concluded that the new understanding of FN1 and additional interactome may guide the development of individualized next-generation cardiac tissues for heart regeneration.

[0197] Example 3 - experimental procedures

[0198] Materials availability hESC lines used herein are available from the inventors with a completed materials transfer agreement.

[0199] Data and code availability

[0200] Data supporting the findings of the study disclosed herein are available within the main and supplemental manuscript. RNA-sequencing experiments are available from published datasets previously deposited in the NCBI’s Gene Expression Omnibus under accession number GSE122714 for hESC-EPI and hESC-NC and GSE85331 for the hESCCM (Liu et al., 2017) and hESC-EPI (Bargehr et al., 2019). Code generated to produce the interactome is available online (GitHub https: / / github.com / Hindrance / EpiSciData2020).

[0201] Differentiation of hESC-CM and hESC-EPI

[0202] EPls were differentiated from H9 hESCs (WiCell, Madison) and from RUES2 (female line, Rockefeller University, NIH registry number 0013), respectively. The differentiation protocol was as previously described (Iyer et al., 2016). To differentiate into epicardium, cells were singly suspended in CDM-PVA, WNT3A (25 ng / mL, R&D), BMP4 (50 ng / mL), and retinoic acid (4 mM, Sigma) at a seeding density of 2.5 3 104 cells / cm2 and replated for exactly 10 days with medium change every 5 days. CMs were differentiated from RUES2 cells as previously described (Bargehr et al., 2019) using the ABCX method (see supplemental experimental procedures). Respective karyotypes are shown in Figure 12.

[0203] Generation and characterization of 3D-EHTs

[0204] 3D-EHTs were constructed in polydimethylsiloxane (PDMS) (PDMS, Sylgard 184; Dow Corning, Midland, Ml) wells by combining hESC-CM and hESC-EPI in a collagen-based hydrogel as previously described (Bargehr et al., 2019). To conduct Frank-Starling force measurements, 3D-EHTs were removed from the PDMS wells and suspended between a force transducer (Aurora Scientific, model 400A) and length controller (Aurora Scientific, model 312B). Both passive tension and active force traces were recorded and analyzed using customized LabView and MATLAB software. For non-ratiometric assessment of Ca2+ handling, 3D-EHTs were incubated with Fluo-4 AM (Molecular Probes, Invitrogen). Then, videos were recorded at both intrinsic contractile rates and paced at 1, 1.5, and 2 Hz before being analyzed with customized MATLAB software. Final analysis made use of Ca2+ data from constructs paced at 1 Hz. Representative force and Ca2+ traces are depicted in Figure 10. 3D-EHTs were subsequently cryo-embedded and sectioned on a cryotome prior to IHC and quantitative assessment of morphological endpoints.

[0205] Loss of function of epicardial FN Pharmacological inhibition of epicardial FN1 with pUR4 (Genescript) was performed on day 7 of epicardial differentiation at a concentration of 500 nm for 72 h. Furthermore, 10 mL of pUR4 (500 nM) were included in the gel mixture during 3D-EHTs generation and along with medium, changed on alternate days over 14 days. FN, the protein, was subsequently quantified by western blot. The western blot technique is described in detail within supplemental experimental procedures below.

[0206] To generate CRISPR-Cas9-mediated KO FN (KOFN1) hESC line, an FN1- targeted sgRNA was chosen from Genscript (https: / / www. genscript.com / gRNA- database.html), and cloned in pX459 (Addgene #62988 all according to a Zhang lab protocol (https: / / www.addgene.org / crispr / zhang / PX459-SpCas9 -sgRNA). The sgRNA sequence was (5’ to 3’ ) CACCGTACAAACCAACGCATTGCCT (SEQ ID NO: 1) with (3’ to 5’ ) CATGTTTGGTTGCGTAACGGACAAA (SEQ ID NO: 2). Gene targeting was done via gene juice-mediated transfection and with subsequent genotyping of the targeted clones, as further described in the supplemental experimental procedures below.

[0207] For generation of an inducible FN KD (sOPTiKD-FN1) hESC line, a short hairpin RNA (shRNA) was selected from the Broad Institute TRC library (Moffat et al., 2006). The shRNA sequences for psOPTIkd vector construction were as follows: top (5’ to 3’ )

[0208] GATCCCGCCTGCTCCAAGAATTGGTTTCTCGAGAAACCAATTCTTGGAGCAGGC TTTTTTG (SEQ ID NO: 3) and bottom (5’ to 3’ ) TCGACAAAAAAGCCTGCTCCAAGAATTGGTTTCTCGAGAAACCAATTCTTGGAGCAGGC GG (SEQ ID NO: 4). Bglll overhang is in bold, and terminator sequence / Sall overhang in underline.

[0209] The shRNA was into pAAV-Puro_siKD (a gift from the Vallier Group, University of Cambridge; Addgene #86695) as previously described (Bertero et al., 2016). Gene targeting was done via gene juice-mediated transfection and is described in detail in the supplemental experimental procedures along with the genotyping of the targeted clones. Differentiation of hESC epicardium was carried out in the absence of tetracycline. Tetracycline was added 2 days prior to harvest, after epicardial differentiation and maintained when 3D-EHTs were generated.

[0210] Recombinant human FN1 dose-response assay

[0211] Human plasma FN (rhFN) (Merck, F2006) was integrated into the tissue constructs at concentrations of 10, 50, and 100 mg / mL of the total tissue construct volume through subtraction of the additional sterile water volume to compensate for the volume of supplemented rhFN. After reconstitution of the cells within the gel, the tissue suspension was cast into the PDMS molds and left to solidify in the incubator at 37C for 30 min prior to being immersed in RPMI medium supplemented with B-27 (Gibco) and insulin. The 3D- EHTs were maintained with medium changes every 2 days prior to use. Spontaneous contractions were observed within 3 days.

[0212] Bulk RNA sequencing

[0213] Starting material for RNA sequencing was composed of H9 hESCEPI, H9 hESC-NC, and H9 hESC-CM as well as undifferentiated H9 hESCs. The datasets had previously been deposited in the NCBI’s Gene Expression Omnibus under accession number GSE122714 for hESC-EPI and hESC-NC and GSE85331 for the hESC-CM (Liu et al., 2017) and hESCEPI (Bargehr et al., 2019).

[0214] Analysis of epicardial-CM interactome

[0215] We first performed a differential expression analysis between the hESC-EPI and hESC-NC, using DESeq2. As previously described, hESC-NCs were chosen as a negative control due to their redundancy in hESC-CM maturation and development. The list of differentially upregulated genes was filtered to retain only genes encoding putatively secreted proteins according to the HPA (http: / / www. proteinatlas.org / humanproteome / secretome) (llhle'n et al., 2019). This dataset is called the hESC-EPI secretome. In parallel, differential expression analysis was performed between day 30 hESC-CM and H9s before differentiation. The list of differentially expressed genes was filtered and restricted to genes encoding receptors and proteins with predicted membrane-anchored regions according to the HPA (llhle'n et al., 2019). This dataset is termed the hESCCM membranome. To determine the interactome, both gene lists were jointly analyzed to elucidate hESC- EPI-secreted factors and their respective membrane-bound receptors on hESCCMs. The interaction database STRINGdb v11 (https: / / string-db.org / cgi / download. pl [2019 11 29]) was used, which covered 99.5% and 95.5% of the upregulated secretome and membranome genes respectively. The interactome was constructed by filtering the secretome to retain genes with interactions with genes only found in the membranome. The interactome network is shown in Figure 6 and Table 1. The technical validation of the sequenced data and EPI / CM differentiation is detailed in the supplemental experimental procedures and Figure 11, respectively.

[0216] Statistical analysis

[0217] All in vitro studies were performed as three parallel technical replicates for each individual biological replicate. Each biological replicate was an independent experiment with EHTs generated on different days and measured separately, from different cellular differentiations. Statistical testing was only performed on biological replicates, using an unpaired t test for two-group comparisons and a paired t test for comparison of two paired groups. One-way ANOVA was used for the statistical comparison of more than two groups, and a post hoc Tukey test was used if the group variance was equal. As for groups with unequal variance, a post hoc Kruskal- Wallis test with Dunn’s correction for multiple comparisons was applied. Measuring two-sided significance, a p value of 0.05 was considered statistically significant. All results are presented as mean ± SEM unless otherwise stated. All analyses were performed using GraphPad Prism 9.0 software.

[0218] Example 4 - supplemental experimental procedures

[0219] Cell Differentiations and Preparations hESC-derived epicardium

[0220] Epicardial cells were differentiated from GFP-transgenic hESCs (H9, WiCell, Madison) as previously described (Iyer et al., 2015). hESCs were maintained in a chemically defined medium composed of bovine serum albumin fraction A (CDMBSA), with Activin-A (10 ng / mL, R&D Systems) and FGF2 (12 ng / ml, R&D Systems) on gelatin-coated plates. Cell colonies were passaged when they reached -70% confluence. Chemically defined media contained IMDM (250 ml, Life Technologies), Ham’s F12 (250 ml, Life Technologies), penicillin-streptomycin (Sigma, 1%), Insulin (7 pg / ml, Roche), transferrin (15 pg / ml, Roche), chemically defined lipid concentrate (Life Technologies) and monothioglycerol (450 pM, Sigma). All subsequent differentiations were conducted in CDM-PVA, containing polyvinyl alcohol (PVA, 1 mg / ml, Sigma) instead of BSA (Iyer et al., 2015). Early mesoderm differentiation started with CDM-PVA, FGF2 (20 ng / ml), LY294002 (10 pM, Sigma) and BMP4 (10 ng / ml, R&D) for 1.5 days. Lateral mesoderm differentiation was initiated in CDMPVA, FGF2 (20 ng / ml) and BMP4 (50 ng / ml) for 3.5 days. To differentiate into epicardium, cells were singly suspended in CDM-PVA, WNT3A (25 ng / ml, R&D), BMP4 (50 ng / ml) and RA (4 pM, Sigma), then replated at a density of 2.5 x 104 cells / cm2 for exactly ten days with a full media change after five days.

[0221] RUES2-derived epicardium

[0222] To differentiate epicardial cells from a different cell line (RUES2, female line, Rockefeller University, NIH registry number 0013), a few modifications to the step above was undertaken. RUES2 cell line was maintained in feeder-free, irradiated mouse embryonic fibroblast (MEF)-conditioned medium containing bFGF (4 ng / ml, Peprotech) with single-cell passaging when -70% confluent. Lateral mesoderm differentiation was conducted in CDM- PVA, FGF2 (20 ng / ml) and BMP4 (50 ng / ml) for a maximum of 2.5 days. To differentiate into epicardium, cells were singly suspended in CDM-PVA, WNT3A (25 ng / ml, R&D), BMP4 (50 ng / ml) and RA (4 pM, Sigma) at a replating density of 1.5 x 104 cells / cm2 for ten days with media change every five days. All re-plating of the cells included Rock inhibitor (10 pM, Y- 27632) in addition to the cytokines described above. Additionally, SB431542 (2 pM) was introduced into the culture medium on Day 3 after epicardium differentiation. hESC-derived cardiomyocytes hESC-derived CMs were generated with the ABCX method as previously described (Bargehr et al., 2019) As above, hESCs (RUES2, female line, Rockefeller University, NIH registry number 0013) were maintained in feeder-free, irradiated mouse embryonic fibroblast (MEF)-conditioned medium containing bFGF (4 ng / ml, Peprotech) with single-cell passaging when -70% confluent. Cells were seeded as single cells (1 x 105 / cm2 ) on Matrigel-coated (BD 449) plates with media enriched with Chiron 99021 (1 pM, Cayman Chemical) and ROCK inhibitor (10 pM, Y-27632). On Day 0, the RPMI medium was supplemented with 1X B27 minus insulin (Invitrogen) and Activin A (100 ng / ml) for 18 hours. On day 1 , cells were fed with RPMI media plus B27 containing BMP4 (5 ng / ml) and Chiron 99021 (1 pM) for 2 days. On day 3, the media was exchanged with RPMI medium plus B27 and Xav 939 (1 pM, Tocris). On day 5, the media was switched to RPMI medium plus B27. On day 7, the media was exchanged with RPMI plus B27 with insulin (Invitrogen). Subsequently, this media was replaced every other day until D28 and harvested for 3D-EHTs generation.

[0223] Generation of 3D-EHTs

[0224] The 3D-EHTs wells were fabricated using polydimethylsiloxane (PDMS) (PDMS, Sylgard 184; Dow Corning, Midland, Ml). PDMS linker and base were mixed in a 1:10 massratio and poured into laser-etched acrylic negative templates, which composed of four wells measuring 3x8x2 mm each. Each well also contained 2x1 mm diameter posts positioned 3mm from each other. PDMS was baked at 65°C overnight, then removed from the negatives, and autoclaved. PDMS wells were treated with 5% pluronic acid F127 solution (Sigma, P2443) for 1 hour before generating the 3DEHTs hESC-CMs were cultured for ~ 21-24 days before 3D-EHTs generation. Flow cytometry was performed on the harvested cells using cTnT antibody (Thermo, MS295-P) on a BD FACSCanto II instrument (Beckton Dickinson, San Jose, CA) and analysed using FACSDiva software (BD Biosciences), which revealed a purity of 90% ±0.5 (i.e. , cTnT+). For 3D-EHTs generation, CMs and epicardial cells were trypsinized and mixed in a collagen- based gel containing 10x RPMI-1640 medium (Sigma), NaOH, geltrex (Invitrogen, A1413202), collagen I Rat Protein (Gibco Life Technologies, A1048301) and water. The cellgel mixture was poured into the PDMS wells and left to solidify for 30 minutes at 37°C. Each tissue contained either 5x105 CMs alone or 5x105 CMs plus 5x104 supportive cells. Each tissue was fed with 7ml of RPMI media with B27 plus insulin every other day, and spontaneous contractions were observed within five days. All 3D-EHTs were cultured for 14 days prior to functional measurements as described below.

[0225] Frank-Starling force measurements of 3D-EHTs

[0226] Force measurement of 3D-EHTs were performed after two weeks in culture as previously described (Bargehr et al., 2019). The tissues were removed from the PDMS wells and suspended between a force transducer (Aurora Scientific, model 400A) and length controller (Aurora Scientific, model 312B). To examine its FrankStarling active force generation, each tissue was stretched from its resting length to an additional 25% strain within 6 steps. Measurements were performed in a HEPESbuffered Tyrode solution at 37°C. Initially, force traces were recorded without electrical stimulation and subsequently with 1, 1.5, 2.5Hz at 5V and 50ms pulse duration. Both passive tension and active force traces were analysed with LabView and MATLAB software. Non-ratiometric assessment of3D-EHTs’ calcium-handling

[0227] To analyse the tissues’ calcium kinetics, the tissues were first incubated with Fluo-4 AM (Molecular Probes, Invitrogen) for 30 min at 37.5°C. Videos of constructs were recorded at intrinsic beating rates and paced at 1 Hz, 1.5Hz and 2Hz with a Sony Handycam (Vixia HFS20) and fluorescence microscope (Nikon Eclipse TS100). Videos were taken at 60 frames per second (fps), converted to independent frames, imported, and analysed for fluorescence intensity per frame using Image J software. All videos were normalized to the background Ca2+ signal.

[0228] Histological processing of3D-EHTs

[0229] Tissues were washed in PBS, fixed in 4% PFA for 60 minutes with subsequent embedding in 30% sucrose overnight at 4°C. This procedure is to reduce the tissue water content and improve tissue preservation during cryo-embedding. On the next day, each tissue was fully embedded in OCT and transferred onto an ice bath composed of 100% ethanol on dry ice. Using a cryotome, the cryo-embedded blocks were serially sliced to produce sections with a 10pm thickness. To characterise hESC-CM, fibronectin deposition and integrin a5pi, antibodies directed at p-MHC (1 :1 Developmental Studies Hybridoma Bank), FN (1:250, Abeam, Cat No: ab2413) and activated integrin a5pi (1:200, Abeam, Cat No: ab150361) were used. Whole stained sections were scanned with Zeiss AxioScan 7. Subsequently, images were exported for further analyses of sarcomeric, and morphometric calculations as previously described (Liu et al., 2018, Bargehr et al., 2019, Wang et al., 2013, leda et al., 2009) via Image J software, performed in a blinded fashion. pUR4 generation and cellular treatment pUR4 is a small peptide derived from a surface protein of Streptococcus pyogenes termed F1 adhesin and is a well-described inhibitor of FN polymerization. pUR4 at -99% purity was obtained commercially from Genscript. At D7 after epicardium differentiation, hESC-epicardium received pUR4 (500 nM) for 72hrs. During 3D-EHT casting, 10 uL of pUR4 (500nM) was included in the gel mixture, and similar concentration of pUR4 was added to the 3D-EHTs during alternative day media changes, for a total of 14 days.

[0230] Western blotting

[0231] After 72 hours of pUR4 treatment, fibronectin protein content was assessed by immunoblotting. Lysate from one confluent well of hESC-epi cells from a six-well plate was separated by SDS PAGE on an 8% acrylamide gel, using 10 ul of Precision Plus Protein All Blue as standards. Protein was then transferred overnight onto a polyvinylidene difluoride (PVDF) membrane (Merck Millipore, IPVH00010). Membranes were blocked with 5% fat-free milk in Tris-buffered saline and 0.05% Tween 20 (TBS-T) for 1 hour at room temperature, followed by incubation overnight at 4°C. Primary antibodies used to detect fibronectin (1:250, Abeam ab2413) and to detect p-actin (1:1000, CST 2148S). Membranes were washed with TBS-T three times for 5 minutes at RT before incubation with secondary anti-rabbit (1:10,000 NEB 7074S) or anti-mouse (1:10,000 NEB 7076S) HRP-conjugated antibody for 1 hour at RT. Membranes were washed with TBS-T, and protein was detected with ECL western blotting detection reagents (Pierce).

[0232] Generation of CRISPR-Cas9-mediated Knockout Fibronectin (K0FN1) hESC cell Line Crispr-Cas9-mediated knockout: annealing and cloning FN1-targeted sgRNA Oligonucleotides were designed using homo sapiens FN1 sequences from Genscript (https: / / www.genscript.com / gRNA-database.html) and modified according to a Zhang Lab protocol (https: / / www.addgene.org / crispr / zhang / PX459-SpCas9 -sgRNA). The sequence of the sgRNA was (5’ to 3’) CACCGTACAAACCAACGCATTGCCT (SEQ ID NO: 1) with (3’ to 5’) CATGTTTGGTTGCGTAACGGACAAA (SEQ ID NO: 2). Oligonucleotides were annealed and ligated into the cut vector pSpCas9(BB)-2A-Puro (PX459) V2.0 (a kind gift from Feng Zhang) using T4 ligase for 1 hour at RT. The ligation mix was transformed into alpha-select competent cells (BioLine) and incubated prior to colony picking and sequencing.

[0233] Sequencing of transformed cells

[0234] Each colony of transformed cells was digested with the restriction enzyme Bbsl to select out the cloned plasmids with sgRNA. Unmodified PX459V2 plasmid was used as a control. Colony digests were analysed by agarose gel (1%) electrophoresis (1.30 hour at 100V). Uncut plasmids showed a size of 580bp. Positive colonies were plasmid miniprepped (Qiagen) before sequencing with Source BioScience. Plasmids with the correct insertion of the sgRNA sequence were midi-prepped (Qiagen).

[0235] Gene-targeting by GeneJuice-mediated transfection

[0236] Individual wells of hESCs were transfected with cloned plasmids using GeneJuice. After passaging, hESCs were incubated with 4 pg of DNA and 10 pl per well of GeneJuice in Opti-MEM medium (Gibco) for 24 hours. Cells were washed in PBS before incubation with DNA-OptiMEM mixtures. The DNA-OptiMEM mixtures comprised of (i) 4 pg DNA in 250 pl OptiMEM per well of a six-well plate and (ii)10 pl GeneJuice in 250 pl OptiMEM per well. 500 pl transfection mix of 1:1 of Mixture 1 & Mixture 2, was added to each well of hESCs. After 24 hours of incubation with DNAOptiMEM mixtures, cells were cultured in mTeSR. After 2 days, 1 pg / ml puromycinenriched culture media was added to the cells and puromycin- resistant colonies were picked for expansion.

[0237] Genotyping of targeted clones Genomic PGR was used to screen genetically targeted clones to verify site-specific targeting, determine whether allele targeting was heterozygous or homozygous, and to check for off-target integrations of the targeting plasmid. Sequences of FN1 primer stated in Table 2.

[0238] Table 2 - PGR primer sequence for genotyping CRISPR-cas9 edited KOFN clones

[0239] Generation of Inducible Fibronectin Knockdown (sOPTiKD-FN) hESC cell line

[0240] Inducible knockdown: design and annealing shRNA oligonucleotides For generation of an inducible Fibronectin knockdown (sOPTiKD-FN1) hESC cell line, an shRNA was selected from the Broad Institute TRC library (Moffat et al., 2006). The shRNA sequences for psOPTIkd vector construction used: TOP (5’ to 3’) GATCCCGCCTGCTCCAAGAATTGGTTTCTCGAGAAACCAATTCTTGGAGCAGGCTTTTT TG (SEQ ID NO: 3) and BOTTOM (5’ to 3’) TCGACAAAAAAGCCTGCTCCAAGAATTGGTTTCTCGAGAAACCAATTCTTGGAGCAGGC GG (SEQ ID NO: 4). Bglll overhang is in bold, terminator sequence / Sall overhang in italics. Oligonucleotides were annealed as previously described (22), and ligated into the linearised, optimised inducible knockdown sOPTiKD vector (a gift from the Vallier Group, University of Cambridge) using T4 ligase for 2 hs at room temperature. The ligation mix was transformed into alpha-select competent cells (BioLine), prior to colony PCR screening for successful transformants.

[0241] Colony PCR of transformants

[0242] After overnight incubation, transformants grown on LB agar plates were picked in the morning for colony PCR to check for transformation. AAVs-KD forward (CGAACGCTGACGTCATCAACC (SEQ ID NO: 17)) and reverse (GGGCTATGAACTAATGACCCCG (SEQ ID NO: 18)) primers were used; thermocycling conditions were as follows: 95°C for five minutes, then 35 cycles of 95°C for 30 seconds, 63°C for 30 seconds and 72°C for 1 minute. These PCR reactions were analysed by agarose gel (1.5%) electrophoresis; vectors with the desired insert showed a size of 520bp. Miniprep of transformed colonies (Qiagen, miniprep kit) were conducted for genomic DNA extraction before Sanger sequencing. Sequencing was done via Source BioScience with the protocol specified for strong hairpin structures. Plasmid vectors with a correctly inserted shRNA sequence were expanded and selected for Midiprep (Qiagen), in preparation for cell transfection.

[0243] Gene-targeting by GeneJuice-mediated transfection

[0244] To generate an inducible FN1 knockdown hESC cell line, AAVS1 locus targeting was performed by GeneJuice-mediated transfection. Briefly, individual wells of hESCs were transfected with five different cloned plasmids using GeneJuice. After passaging, hESCs were incubated with 4 pg of DNA and 10 pl per well of GeneJuice in Opti-MEM medium (Gibco) for 24 hours. Cells were washed in PBS before incubation with DNA-OptiMEM mixtures. The DNA-OptiMEM mixtures comprised of (i) 4 pg DNA in 250 pl OptiMEM per well of a six-well plate and (ii)10 pl GeneJuice in 250 pl OptiMEM per well. The mixtures were mixed gently and incubated at room temperature for 5 minutes. 250 pl of Mixture 2 was then added to 250 pl Mixture 1 before incubation at room temperature for 20 minutes. 500 pl transfection mix of 1:1 of Mixture 1 & Mixture 2, was added to each well of hESCs. After 24 hours of incubation with DNA-OptiMEM mixtures, cells were cultured in mTeSR. After 2 days, 1 pg / ml puromycin-enriched culture media was added to the cells. A week later, puromycin-resistant colonies were picked and expanded. Genotyping of targeted clones

[0245] Genomic PGR was used to screen genetically targeted clones to verify site-specific targeting and determine whether allele targeting was heterozygous or homozygous. PGR primers used as in Table 3. Locus PGR (‘PGR T) for wild-type AAVS1 locus indicates a non- targeted allele. ‘PGR 2’ is a locus PCR / loss-of-allele PGR. ‘PGR 2’ and ‘PGR 3’ refer to 5’INT / 3’INT PGR respectively, which are PGR reactions for vector backbone 5’-end and 3’- end genomic integration region, indicative of specific transgene targeting. Table 3 - PCR primer sequences for genotyping sOPTIKD clones

[0246] Firstly, DNA was extracted from all targeted clones using a genomic DNA extraction kit (Sigma-Aldrich). All PCRs were performed using 100 ng of genomic DNA as a template in a 25 pl reaction volume, LongAmp Taq DNA Polymerase (NEB), and including 2.5% (v:v) dimethyl sulphoxide (DMSO). One homozygous-targeted clone for each vector transfection was selected for subsequent differentiation into hESCepicardium with or without the addition of 1 pg / ml tetracycline (Sigma) to culture media with the aim of mediating FN1 knockdown. hESC-epicardium was differentiated in the presence and absence of tetracycline.

[0247] Statistics

[0248] All in vitro studies were performed as three biological replicates (independent experiments) from different cellular differentiations. Statistical testing was performed using an unpaired t-test for two-group comparisons and a paired t-test for comparison of two paired groups. One-way ANOVA was used for the statistical comparison of more than two groups, and a post-hoc Tukey test was used if the group variance was equal. As for groups with unequal variance, a post-hoc Kruskal- Wallis test with Dunn’s correction for multiple comparisons was applied. Measuring two-sided significance, a P-value of 0.05 was considered statistically significant. All results are presented as mean ± s.e.m unless otherwise stated. All analyses were performed using GraphPad Prism 9.0 software.

[0249] Bulk RNA sequencing

[0250] The starting material for RNA sequencing was H9 hESC-EPIs, H9 hESC-neural crest cells (hESC-NCs) and H9 hESC-CMs, and undifferentiated H9s. HESC-EPIs were differentiated from H9s via early and lateral mesoderm induction, prior to differentiation to epicardium as previously described (Bargehr et al., 2019, Iyer et al., 2015). HESC-NC was differentiated from H9s as previously described (Bargehr et al., 2019). HESC-CMs were differentiated as monolayers with a commercially available kit (Thermo Fisher Scientific) (Liu et al., 2017). Day 30 hESC-CMs were used for all further bioinformatics analysis. The datasets had previously been deposited in the NCBI’s Gene Expression Omnibus under accession number GSE122714 for hESCEPI and hESC-NC and GSE85331 for the hESC- CM and hESC-EPI (Bargehr et al., 2019).

[0251] Raw FASTQ files of the hESC-CM and H9 datasets were downloaded from the European Nucleotide Archive (ENA) under the run accession identifiers SRR4011898, SRR4011899, SRR4011904 and SRR4011905. The FASTQ files were preprocessed using fastp, with the default parameters (fastp). Transcript-level counts for the paired files were estimated using the pseudoalignment tool kallisto (Bray et al., 2016) using the full list of cDNA contained in the annotated Homo sapiens genome (version GRCh38 release 98). Transcripts were merged by gene ensembl identifier to produce gene-level features ready for further analysis.

[0252] As described more fully in (Bargehr et al., 2019), the hESC-EPI and hESC-NC data were mapped to the Homo sapiens genome GRCh38 using HISAT2 (Kim et al., 2015). Reads were counted using SeqMonk (https: / / www.bioinformatics.babraham.ac.uk / projects / seqmonk / ) and were already locally available; these steps were not repeated for this analysis and we used the same counts matrix that was generated in (Bargehr et al., 2019).

[0253] Both read count matrices were imported in R and processed to remove low expression genes. As no comparisons were made between datasets the analysis was run in parallel and an intersection of the features was not created. The technical validation of both datasets is as displayed in Figure 10.

[0254] Analysis of Epicardial-Myocardial Interactome

[0255] Workflow to generate the epicardial-myocardial interactome

[0256] To identify the molecular pathways by which hESC-EPIs improved hESC-CM’s structure and function, the interface of secreted hESC-EPI factors and membranebound cell surface receptors on hESC-CMs were investigated.

[0257] First performed a differential expression analysis between the hESC-EPI and hESC- NC, using DESeq2 was performed. As previously described, hESC-NCs were chosen as a negative control due to their redundancy in hESC-CM maturation and development (Bargehr et al., 2019). The list of differentially upregulated genes was filtered to retain only genes encoding putatively secreted proteins according to the Human Protein Atlas (http: / / www.proteinatlas.org / humanproteome / secretome) (llhlen et al., 2019). This dataset is entitled as the hESC-EPI secretome (Figure 6). In parallel, differential expression analysis was performed between day 30 hESC-CM and H9s before differentiation. The list of differentially expressed genes was filtered and restricted to genes encoding receptors and proteins with predicted membrane- anchored regions according to the Human Protein Atlas (llhlen et al., 2019). This dataset is termed the hESC-CM membranome (Figure 6). We found a potential secretome of 379 upregulated factors and a membranome of 1417 upregulated receptors (Figure 6).

[0258] Next, to determine the interactome, both gene lists were jointly analysed to elucidate hESC-EPI secreted factors and their respective membrane-bound receptors on hESC-CMs.

[0259] We used the interaction database StringDB v11 (https: / / string-db.org / cgi / download.pl [2019 11 29]) which covered 99.5 % and 95.5 % of the upregulated secretome and membranome genes respectively. We constructed the interactome by filtering the secretome to retain genes with interactions with genes found only within the membranome. Initially, we only included high-confidence interactions with an experimental evidence score of above 700. However, to uncover further potential interactions and generate a more cohesive interactome network within the highconfidence interactome, we included a set of lower-score interactions with a minimum score of 400. The interactome network is shown in (Figure 6).

[0260] If a secreted protein was equally or greater expressed by hESC-CM than by hESCEPI, then it is unlikely this would mediate the beneficial effects of hESC-EPIs on the other cell type. Since the aim of this study was to identify putative factors that mediate the positive effects of hESC-EPI, the interactome network was filtered to retain only interactions where the expression of secreted protein transcripts was significantly higher in the hESC- EPIs when compared to hESC-CMs (p < 0.05) (Figure 6). To relate these molecular pathways to cardiac repair, the interactome was categorised into separate groups using the following biological process terms cardiomyocyte proliferation, maturation, survival, angiogenesis, development, extracellular matrix (ECM) regulation, inflammation, metabolism and regeneration. This functional annotation was performed manually following a review of the literature of all presented gene pairs and one or more regenerative biological processes were attributed to interactions based on previously identified signalling pathways. The literature used for this decision process is listed in Table 1.

[0261] Technical Validation of sequenced data

[0262] To validate technical aspects of sequencing before analysis, read counts for both datasets were sub-sampled at different levels to generate theoretical gene detection saturation curves Figure 10. Although higher depths of sequencing are generally observed with bulk RNAseq analyses, the number of genes detected appeared to plateau across all samples. This suggests that the transcriptional complexities of the cell lines were efficiently captured, confirming that the sequencing depth of all cell lines was adequate for further analysis.

[0263] Technical Validation of epicardial and cardiomyocyte differentiation

[0264] H9s were differentiated to lateral mesoderm and subsequently to epicardium phenotype as previously described (Bargehr et al., 2019, Iyer et al., 2015) Cells were subsequently prepared for RNA sequencing as previously described (Bargehr et al., 2019). Confirmation of cell line phenotypes was carried out by testing for differences in the expression of key markers. The expressions of key epicardial cell markers such as WT 1 , ALDH1A2, TCF21, and BNC1 were increased in the H9 hESC-EPI samples when compared with H9 hESC-NC while the neural crest markers SOX9 and TFAP2A were also seen to be lower in H9 hESC-EPI samples than in H9 hESCNC (Figure 11).

[0265] H9s were differentiated to cardiomyocyte phenotype with a commercially available differentiation kit as detailed and were sequenced on day 30 of differentiation as previously described (Liu et al., 2017). The expressions of the key cardiomyocyte markers MYH6, MYH7, MYL2 and MYL7 were significantly higher in the D30 H9 hESC-CM samples than in the H9 samples. Moreover, the expressions of pluripotent markers SOX2 and POLI5F1 (OCT4) were reduced from DO to D30 in the H9 hESCCM data set (Figure 11).

[0266] These differences were significant in all cases and were determined with a Welch’s two samples t test (p < 0.05). Finally, isogenic replicates were highly correlated. The lowest correlation within replicates was seen between H9 hESC-NC samples (Spearman’s Rho > 0.895, not shown). The cell lines used in constructing our interactome were thus deemed technically valid in terms of the quality and congruency of data, and as bona fide H9-derived versions of the human tissues in question.

[0267] The code used to generate and process the interactome in this manuscript has been deposited on GitHub (https: / / github.com / Hindrance / EpiSciData2020).

[0268] REFERENCES

[0269] • Liu YW, Chen B, Yang X, Fugate JA, Kalucki FA, Futakuchi-Tsuchida A, et al.

[0270] Human embryonic stem cell-derived cardiomyocytes restore function in infarcted hearts of non-human primates. Nature biotechnology. 2018;36(7):597-605.

[0271] • Bargehr J, Ong LP, Colzani M, Davaapil H, Hofsteen P, Bhandari S, et al. Epicardial cells derived from human embryonic stem cells augment cardiomyocytedriven heart regeneration. Nature biotechnology. 2019;37(8):895-906.

[0272] • Wang J, Karra R, Dickson AL, Poss KD. Fibronectin is deposited by injury-activated

[0273] • epicardial cells and is necessary for zebrafish heart regeneration. Developmental biology. 2013;382(2):427-35.

[0274] • leda M, Tsuchihashi T, Ivey KN, Ross RS, Hong TT, Shaw RM, et al. Cardiac fibroblasts regulate myocardial proliferation through betal integrin signaling. Dev Cell. 2009;16(2):233-44.

[0275] • Iyer, Dharini, Laure Gambardella, William G Bernard, Felipe Serrano, Victoria L Mascetti, Roger a Pedersen, Amarnath Talasila, and Sanjay Sinha. 2015. “Robust Derivation of Epicardium and Its Differentiated Smooth Muscle Cell Progeny from Human Pluripotent Stem Cells.” Development (Cambridge, England) 142 (8): 1528- 41. https: / / doi.Org / 10.1242 / dev.119271

[0276] • Bertero, Alessandro, Matthias Pawlowski, Daniel Ortmann, Kirsten Snijders, Loukia Yiangou, Miguel Cardoso De Brito, Stephanie Brown, et al. 2016. “Optimized Inducible ShRNA and CRISPR / Cas9 Platforms for in Vitro Studies of Human Development Using HPSCs.” Development (Cambridge) 143 (23): 4405-18. https: / / doi.Org / 10.1242 / dev.138081.

[0277] • Kim, Daehwan, Ben Langmead, and Steven L. Salzberg. 2015. “HISAT: A Fast Spliced Aligner with Low Memory Requirements.” Nature Methods 12 (4):357-60. https: / / d0i.0rg / l 0.1038 / nmeth.3317

[0278] • Liu Q, Jiang C, Xu J, Zhao MT, Van Bortle K, Cheng X, et al. Genome-Wide Temporal Profiling of Transcriptome and Open Chromatin of Early Cardiomyocyte Differentiation Derived From hiPSCs and hESCs. Circulation research.

[0279] 2017;121(4):376-91 • Moffat J, Grueneberg DA, Yang X, Kim SY, Kloepfer AM, Hinkle G, Piqani B,

[0280] Eisenhaure TM, Luo B, Grenier JK, Carpenter AE, Foo SY, Stewart SA, Stockwell BR, Hacohen N, Hahn WC, Lander ES, Sabatini DM, Root DE. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 2006 Mar 24; 124(6): 1283-98. doi: 10.1016 / j.cell.2006.01.040. • Uhlen M, Karlsson MJ, Hober A, Svensson AS, Scheffel J, Kotol D, et al. (2019). The human secretome. Sci Signal, 12, 609

[0281] • Bray NL, Pimentel H, Melsted P, Pachter L. Near-optimal probabilistic RNA-seq quantification. Nature biotechnology. 2016;34(5):525-7.

Claims

CLAIMS1. A composition for production of engineered heart tissue, the composition comprising cardiomyocytes; and exogenous fibronectin.

2. The composition of claim 1 , wherein the exogenous fibronectin is present at a concentration of about at least 10 pg / ml.

3. The composition of claim 1 , wherein the exogenous fibronectin is present at a concentration of about 10 pg / ml to 100 ug / ml.

4. The composition of claims 1 to 3, wherein the exogenous fibronectin comprises recombinant fibronectin.

5. The composition of any of claims 1 to 4, wherein the exogenous fibronectin comprises isolated and / or purified fibronectin.

6. The composition of any of claims 1 to 5, wherein the fibronectin has been produced in vitro.

7. The composition of any of claims 1 to 6, wherein the cardiomyocytes are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

8. The composition of any of claims 1 to 7, wherein the composition further comprises in vitro differentiated epicardial cells or differentiated progeny thereof.

9. The composition of claim 8, wherein the epicardial cells or their progeny are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

10. The composition of claims 7 to 9, wherein the cardiomyocytes are present at a ratio of about 2: 1 to 10:1 relative to the epicardial cells or progeny thereof.

11. The composition of any of claims 1 to 10, wherein the composition further comprises one or more of ZVAD-FMK, Bck-XL, Cyclosporin A, pinacidil and / or IGF-1.

12. A tissue particle comprising cardiomyocytes in a composition comprising exogenous fibronectin; wherein the composition is for culturing cells.

13. The tissue particle of claim 12, wherein the exogenous fibronectin is present at a concentration of about at least 10 pg / ml.

14. The tissue particle of claim 13, wherein the exogenous fibronectin is present at a concentration of about 10 pg / ml to 100 pg / ml.

15. The tissue particle of any of claims 12 to 14, wherein the exogenous fibronectin comprises recombinant fibronectin.

16. The tissue particle of any of claims 12 to 15, wherein the exogenous fibronectin comprises isolated and / or purified fibronectin.

17. The tissue particle of any of claims 12 to 16, wherein the fibronectin has been produced in vitro.

18. The tissue particle of any of claims 12 to 17, wherein the cardiomyocytes are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

19. The tissue particle of any of claims 12 to 18, wherein the composition further comprises in vitro differentiated epicardial cells or differentiated progeny thereof.

20. The tissue particle of claim 19, wherein the epicardial cells or their progeny are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

21. The tissue particle of claims 19 or 20, wherein the cardiomyocytes are present at a ratio of about 2: 1 to 10:1 relative to the epicardial cells or progeny thereof.

22. The tissue particle of any of claims 12 to 21 , wherein the composition further comprises one or more of ZVAD-FMK, Bck-XL, Cyclosporin A, pinacidil and / or IGF-1.

23. The tissue particle of any of claims 12 to 22, wherein the tissue particle comprises engineered heart tissue and / or a suspension of cells.

24. A method of forming engineered heart tissue, the method comprising: providing a mixture of cardiomyocytes and exogenous fibronectin into a vessel; mixing the mixture with a matrix composition to form a gel; culturing the gel.

25. The method claim 24, wherein the exogenous fibronectin is present at a concentration of about at least 10 pg / ml, optionally about 10 pg / ml to 100 pg / ml.

26. The method of claims 25 or 26, wherein the exogenous fibronectin comprises recombinant fibronectin.

27. The method of any of claims 24 to 26, wherein the exogenous fibronectin comprises isolated and / or purified fibronectin.

28. The method of any of claims 24to 27, wherein the fibronectin has been produced in vitro.

29. The method of any of claims 24to 28, wherein the cardiomyocytes are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

30. The method of any of claims 24 to 29, wherein the composition further comprises in vitro differentiated epicardial cells or differentiated progeny thereof.

31. The method of claim 30, wherein the epicardial cells or their progeny are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

32. The method of claims 30 or 31 , wherein the cardiomyocytes are present at a ratio of about 2: 1 to 10: 1 relative to the epicardial cells or progeny thereof.

33. The method of any of claims 24 to 32, wherein the composition further comprises one or more of ZVAD-FMK, Bck-XL, Cyclosporin A, pinacidil and / or IGF-134. A method of promoting engraftment of cardiomyocytes into cardiac tissue, the method comprising administering to cardiac tissue of a subject in need thereof, a thereof a mixture comprising cardiomyocytes and exogenous fibronectin.

35. The method of claim 34, wherein the mixture comprises a composition according to any of claims 1 to 11 or a tissue particle according to any of claims 12 to 23.

36. A method of promoting a mature phenotype of transplanted human cardiomyocytes, the method comprising administering to cardiac tissue of a subject in need thereof a mixture comprising cardiomyocytes and exogenous fibronectin.

37. The method of claim 36, wherein the mixture comprises a composition according to any of claims 1 to 11 or a tissue particle according to any of claims 12 to 23.

38. The method according to claims 36 or 37, wherein the cardiomyocyte maturity is indicated by one or more of an increase in sarcomere length, an increase in cardiomyocyte diameter or length, an increase in active force generation, an increase in passive force generation, expression of the cardiac isoform, cTnT, oftroponin, and connexin 43 expression when cardiomyocytes are transplanted in combination with epicardial cells, relative to cardiomyocyte transplantation alone.

39. A method of treating or preventing a cardiovascular condition or disease, the method comprising administering to cardiac tissue of a subject in need thereof, a mixture comprising cardiomyocytes and exogenous fibronectin.

40. The method of claim 39, wherein the mixture comprises a composition according to any of claims 1 to 11 or a tissue particle according to any of claims 12 to 23.

41. The method of any one of claims 34 to 40, wherein the subject has suffered from a cardiac infarction.

42. The method of any one of claims 34 to 41 wherein the cardiovascular condition or disease is myocardial infarction, ischemia, cardiomyopathy, congenital heart disease and intractable arrhythmias.

43. An in vitro method of promoting maturity of cardiomyocytes, the method comprising culturing cardiomyocytes in the presence of exogenous fibronectin.

44. The method of claim 43, wherein the cardiomyocytes are cultured in the presence of a composition according to any of claims 1 or 4 to 11 or a tissue particle according to any of claims 12 or 15 to 23.

45. The method of claim 43 or 44, wherein the exogenous fibronectin is present at a concentration of about at least 10 pg / ml.

46. The method of claim 45, wherein the exogenous fibronectin is present at a concentration of about 10 pg / ml to 100 pg / ml.

47. The method of claims 43 or 45, wherein the exogenous fibronectin comprise recombinant fibronectin.

48. The method of any of claims 43, 45 or 47, wherein the exogenous fibronectin comprises isolated and / or purified fibronectin.

49. The method of any of claims 43 or 45 to 48, wherein the fibronectin has been produced in vitro.

50. The method of any of claims 43 or 45 to 49, wherein the cardiomyocytes are differentiated from embryonic stem cells or from induced pluripotent stem cells; optionally wherein the induced pluripotent stem cells are autologous to a transplant recipient.

51. The composition of any of claims 1 to 11 or a tissue particle of any of claims 12 to 23 or a method according to any one of claims 24 to 50, wherein the cardiomyocytes comprise human cardiomyocytes.

52. The composition of any of claims 1 to 11 and 51 or a tissue particle of any of claims 12 to 23 and 51 or a method according to any one of claims 24 to 51, wherein the cardiomyocytes comprise in vitro differentiated cardiomyocytes.

Images