Method for regulating a circadian rhythm

Abstract

A use of ATXN2 and / or ATXN2L in a circadian rhythm. Also provided are a method for regulating the circadian rhythm of a subject, a drug and a use. Also provided are a method for measuring the circadian rhythm of a subject and a biomarker capable of indicating an abnormal circadian rhythm. A new way and means are provided to regulate circadian rhythms.

Description

Methods for regulating circadian rhythms Technical Field

[0001] The present invention relates to a method for regulating circadian rhythm, and to the diagnosis and treatment of circadian rhythm-related diseases, belonging to the field of biology. Background Art

[0002] Organisms exhibit self-sustaining circadian rhythms of approximately 24 hours, driven by the Earth's rotation. Many important behavioral and physiological functions respond to circadian cycles, such as sleep and wakefulness, body temperature, and blood pressure. In humans and most mammals, circadian rhythms are typically controlled by a hierarchical network of central and peripheral pacemakers, with the suprachiasmatic nucleus (SCN), located in the anterior hypothalamus, serving as the brain's master circadian clock controller. The SCN entrains external time and transmits clock information to downstream peripheral controllers in other brain regions or peripheral tissues, such as the heart, liver, lungs, and kidneys.

[0003] At the molecular level, a group of "clock genes" regulate rhythms through positive and negative "transcription-translation feedback loops" (TTFL). The negative TTFL in mammals is composed of the activators CLOCK and BMAL1, which bind to the e-box and activate the transcription of the inhibitory proteins Period (encoded by PER1 / 2 / 3) and Cryptochrome (CRY1 / 2). PER and CRY proteins heterodimerize and translocate back to the nucleus, inhibiting their own transcription by removing the CLOCK-BMAL1 complex. Sequential events in the TTFL, including transcription, mRNA processing and translation, occur in a circadian manner to maintain a precise 24-hour periodicity for many genes. However, major questions about how these rhythmic processes are coordinated in time and space remain unanswered.

[0004] In eukaryotic cells, complex biochemical reactions are cleverly compartmentalized to facilitate precise spatiotemporal control. This compartmentalization can be achieved through typical membrane-bound organelles, such as mitochondria and the endoplasmic reticulum, as well as membrane-less organelles (MLOs). MLOs are dense, phase-separated macromolecular assemblies that mediate numerous subcellular biological processes by enriching specific biomolecules and excluding others.

[0005] Here, the inventors reveal the role of phase separation mediated by ATXN2 and ATXN2L in regulating oscillatory translation during circadian rhythms, and the role and impact of abnormal polyQ expansion of the ATXN2 protein on circadian rhythms in neurodegenerative diseases. As an RNA-binding protein, ATXN2 is a well-established multifunctional regulator of post-transcriptional processes. In this study, the inventors show that phase-separated condensates of the RNA-binding proteins ATXN2 and ATXN2L coordinate spatiotemporally to rhythmically recruit the translation machinery and specific sets of mRNA transcripts, allowing for the selective and temporal translational activation of core circadian clock genes, thereby serving as a master regulator of rhythmic translation in mammals.

[0006] Summary of the Invention

[0007] The inventors surprisingly found that proteins containing an LCD domain (such as clock gene proteins containing an LCD domain) play an important role in the regulation of circadian rhythms.

[0008] Thus, in one aspect, the present invention provides a method for regulating circadian rhythm, comprising the step of regulating the expression and / or function of a protein comprising an LCD domain to regulate circadian rhythm. Preferably, in some embodiments, regulating the function of a protein comprising an LCD domain is regulating the function of the LCD domain to mediate phase separation. More preferably, in some embodiments, regulating a protein comprising an LCD domain is regulating a clock gene protein comprising an LCD domain. In some embodiments, LCD domain-mediated phase separation is regulated by up-regulating or down-regulating the expression of a protein comprising an LCD domain. In some embodiments, the protein comprising an LCD domain is modified, and the modification may be a mutation, truncation, deletion, or replacement of a non-LCD domain of the protein.

[0009] In addition, ATXN2 and ATXN2L proteins play an important role in the regulation of circadian rhythms, and by regulating the expression or function of the two proteins, the circadian rhythms of cells or organisms can be accelerated or delayed, which can be used to regulate circadian rhythms in subjects in need (such as subjects who need to work shifts or have jet lag), and can also be used to prevent or treat related diseases caused by circadian rhythm disorders. Furthermore, the inventors have also found that the expression levels of ATXN2 and ATXN2L can reflect the circadian rhythm status of the subject (such as whether it is abnormal), and the circadian rhythm status of the subject can be determined by detecting the expression of ATXN2 and ATXN2L. In addition, the inventors also discovered for the first time that the phenomenon of phase separation is closely related to the regulation of circadian rhythms, and that the circadian rhythm can be affected and regulated by regulating phase separation.

[0010] Thus, in one aspect, the present invention provides a method for regulating circadian rhythm, comprising the step of regulating the expression and / or protein function of ATXN2 and / or ATXN2L to regulate the circadian rhythm. In some embodiments, the expression and / or function of ATXN2 and / or ATXN2L is regulated by regulating the transcription, translation, post-translational modification, protein degradation, etc. of ATXN2 and / or ATXN2L. In some embodiments, the expression and / or function of ATXN2 and / or ATXN2L is regulated by regulating genes related to the upstream and downstream signaling pathways of ATXN2 and / or ATXN2L.

[0011] In some embodiments, the circadian rhythm is accelerated by downregulating the expression of ATXN2 or upregulating the expression of ATXN2L. In some embodiments, the circadian rhythm is delayed by downregulating the expression of ATXN2L or upregulating the expression of ATXN2. In some embodiments, downregulating the expression of ATXN2 or downregulating the expression of ATXN2L is achieved by siRNA knockdown or CRISPR knockout. In some embodiments, upregulating the expression of ATXN2 or upregulating the expression of ATXN2L is achieved by expressing a gene in a cell through an expression vector or activating the transcription of a gene through CRISPR. In some embodiments, the expression vector is an AAV vector or a pLVX vector.

[0012] In some embodiments, the circadian rhythm is accelerated by inactivating the function of ATXN2 or enhancing the function of ATXN2L. In some embodiments, the circadian rhythm is delayed by inactivating the function of ATXN2L or enhancing the function of ATXN2. In some embodiments, the function of ATXN2 or ATXN2L is its function of forming phase separation in the cell. In some embodiments, the inactivation of the function of ATXN2 or ATXN2L is achieved by siRNA knockdown or CRISPR knockout.

[0013] In some embodiments, the expression of ATXN2 and ATXN2L is simultaneously upregulated to strengthen the circadian rhythm. In some embodiments, the expression of ATXN2 and ATXN2L is simultaneously downregulated to weaken the circadian rhythm.

[0014] In some embodiments, the expression of ATXN2 or ATXN2L is downregulated using an inhibitory nucleic acid targeting ATXN2 or ATXN2L. In some embodiments, preferably, the inhibitory nucleic acid targeting ATXN2 or ATXN2L is an antisense oligonucleotide (ASO) or an RNA interfering agent. Preferably, in some embodiments, the inhibitory nucleic acid is or comprises or encodes a small interfering RNA (siRNA), a microRNA-adapted shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA, a precursor microRNA (pre-miRNA) or a microRNA (miRNA).

[0015] In some embodiments, the expression of ATXN2 or ATXN2L is upregulated using an expression vector encoding ATXN2 and / or ATXN2L. In some embodiments, the expression vector is an AAV vector or a pLVX vector. In some embodiments, the expression vector is selected from an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a lentiviral vector, a herpes virus vector, a vaccinia virus vector, MMLV, GaLV, a simian immunodeficiency virus vector, and a poxvirus vector. Preferably, the expression vector is replication-defective. Preferably, in some embodiments, the expression vector is an AAV vector. In some embodiments, the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

[0016] In some embodiments, a CRISPR composition is used to upregulate or downregulate the expression of ATXN2 or ATXN2L. In some embodiments, the CRISPR composition comprises a Cas nuclease and a gRNA, optionally wherein the gRNA is 5'-GTATTGGAAATACCCCCAGT-3' (SEQ ID NO: 9) or 5'-CCCCGGATCTTAAAGGAGGA-3' (SEQ ID NO: 10).

[0017] In another aspect, the present invention provides the use of one or more modulators or combinations of modulators for modulating ATXN2 and / or ATXN2L in the preparation of a medicament. In some embodiments, the use of the ... for preventing or treating circadian rhythm-related diseases. In some embodiments, the use of the modulators or combinations of modulators for modulating ATXN2 and / or ATXN2L genes in the preparation of a medicament for preventing or treating diseases associated with ATXN2 and / or ATXN2L gene disorders. In some embodiments, the use of the modulators or combinations of modulators for modulating phase separation in a subject in need thereof.

[0018] In another aspect, the present invention provides a method comprising administering to a subject one or more modulators or combinations of modulators for modulating ATXN2 and / or ATXN2L. In some embodiments, the method is used to prevent or treat a circadian rhythm-related disorder. In some embodiments, the method is used to prevent or treat a disorder associated with a disorder of the ATXN2 and / or ATXN2L gene. In some embodiments, the method is used to modulate the circadian rhythm of a subject in need thereof. In some embodiments, the method is used to modulate phase separation.

[0019] In some embodiments, the circadian rhythm-related disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, hypersomnia, sleep disorders, sleep disorders, neurodegenerative diseases, ataxia, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's syndrome, anxiety disorders, depression, manic depression, obsessive-compulsive disorder, affective neurosis, depressive neurosis, anxiety neurosis, mood disorders, delirium, panic attacks, post-traumatic stress disorder, dementia, mental retardation, movement disorders, Huntington's disease, addiction, migraine, headache, pain, neuropathic pain. Preferably, in some embodiments, the circadian rhythm-related disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, hypersomnia, sleep disorders, sleep disorders, sleep disorders.

[0020] In some embodiments, the modulator for regulating ATXN2 and / or ATXN2L is an expression vector encoding ATXN2 and / or ATXN2L, which is used to upregulate the expression of ATXN2 and / or ATXN2L. In some embodiments, the expression vector is selected from adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, herpes virus vectors, vaccinia virus vectors, MMLV, GaLV, simian immunodeficiency virus vectors, and poxvirus vectors. Preferably, the expression vector is replication-deficient. In some embodiments, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, in some embodiments, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

[0021] In some embodiments, the modulator for regulating ATXN2 and / or ATXN2L is an inhibitory nucleic acid targeting ATXN2 or ATXN2L. In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or an RNA interfering agent, preferably, the inhibitory nucleic acid is or comprises or encodes a small interfering RNA (siRNA), a microRNA-adapted shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA, a precursor microRNA (pre-miRNA) or a microRNA (miRNA).

[0022] In some embodiments, the inhibitory nucleic acid targeting ATXN2 is siRNA, preferably, the sense strand of the siRNA is CCAGUUAGCAGAAGAAAUUTT (SEQ ID NO: 11), and the antisense strand of the siRNA is AAUUUCUUCUGCUAACUGGTT (SEQ ID NO: 12). In some embodiments, the inhibitory nucleic acid targeting ATXN2 is siRNA, preferably, the sense strand of the siRNA is GCAAGUGAAACAUCACCUATT (SEQ ID NO: 13), and the antisense strand of the siRNA is UAGGUGAUGUUUCACUUGCTT (SEQ ID NO: 14).

[0023] In some embodiments, the inhibitory nucleic acid is a shRNA. Preferably, in some embodiments, the shRNA sequence targeting ATXN2 is CCGGCGAAAGGCCAAATCCCTTCTTCTCGAGAAGAAGGGATTTGGCCTTTCGTTTTTG (SEQ ID NO: 15), CCGGCGTCAGTTGTTGGATCGAAATCTCGAGATTTCGATCCAACAACTGACGTTTTTG (SEQ ID NO: 16), CCGGCGGAAGCAAGTGCTAAGGATACTCGAGTATCCTTAGCACTTGCTTCCGTTTTTG (SEQ ID NO: 17), CCGGCAGTCCTGTCATACAAGGTAACTCGAGTTACCTTGTATGACAGGACTGTTTTTG (SEQ ID NO: 18), or CCGGCCATGTCTAGTGGCCTAGAATCTCGAGATTCTAGGCCACTAGACATGGTTTTTG (SEQ ID NO: 19). Preferably, in some embodiments, the shRNA sequence targeting ATXN2L is CCGGCCTCCCATCCTCTCATCTATTCTCGAGAATAGATGAGAGGATGGGAGGTTTTTG (SEQ ID NO: 20), CCGGCCCGTGTTTGAAGGTGTCTATCTCGAGATAGACACCTTCAAACACGGGTTTTTG (SEQ ID NO: 21), CCGGGCCACTGTTCACCAATCCTATCTCGAGATAGGATTGGTGAACAGTGGCTTTTTG (SEQ ID NO: 22), CCGGGCCTACGGATTGCTATGGAAACTCGAGTTTCCATAGCAATCCGTAGGCTTTTTG (SEQ ID NO: 23), or CCGGCCCGTACTCATTCAACACCTTCTCGAGAAGGTGTTGAATGAGTACGGGTTTTTG (SEQ ID NO: 24).

[0024] In some embodiments, the modulator for regulating ATXN2 and / or ATXN2L is a CRISPR composition. In some embodiments, the CRISPR composition comprises a Cas nuclease and a gRNA that targets ATXN2 and / or ATXN2L. In some embodiments, the gRNA is 5'-GTATTGGAAATACCCCCAGT-3' or 5'-GTATTGGAAATACCCCCAGT-3'. In some embodiments, the Cas enzyme is a dCas enzyme, such as dCas9. In some embodiments, the gRNA targets the promoter region of ATXN2 and / or ATXN2L.

[0025] The methods for regulating circadian rhythm provided by the present invention can be used for therapeutic or non-therapeutic purposes.

[0026] In another aspect, the present invention provides a biomarker combination for detecting circadian rhythm in a subject, comprising ATXN2 and / or ATXN2L. Preferably, in some embodiments, the biomarker combination consists of ATXN2 and / or ATXN2L.

[0027] In another aspect, the present invention also provides a reagent combination for detecting the biomarker combination of the present invention. In some embodiments, the reagent combination includes reagents for detecting the gene markers, such as primers, probes, antibodies, and optionally an enzyme such as a PCR enzyme, a buffer, and product instructions.

[0028] In another aspect, the present invention also provides use of a reagent combination for detecting the biomarker combination of the present invention in preparing a reagent for detecting the circadian rhythm of a subject.

[0029] On the other hand, the present invention also provides a method for detecting the circadian rhythm of a subject, comprising the following steps: determining the expression level of the aforementioned biomarker combination of the subject, preferably, in some embodiments, using the reagent combination of the present invention to determine the expression level; comparing the measured expression level with a reference level; and determining the state of the circadian rhythm of the subject.

[0030] In some embodiments, the abnormal circadian rhythm state can be used to diagnose a circadian rhythm disorder or a circadian rhythm-related disease.

[0031] In another aspect, the present invention also provides a cell model that lacks the ATXN2 and / or ATXN2L gene. Preferably, in some embodiments, the cell is a mammalian cell, more preferably a human cell, most preferably a U2OS cell, a GT1-7 cell, a THLE-2 cell, or a HeLa cell.

[0032] In another aspect, the present invention also provides an animal model that lacks the ATXN2 and / or ATXN2L gene. In some embodiments, preferably, the animal model is a mammalian model, more preferably a rodent model, and most preferably a mouse model.

[0033] In some embodiments, the present invention also provides use of the cell model or animal model of the present invention in screening drugs for treating or preventing circadian rhythm-related diseases.

[0034] On the other hand, the present invention also provides an expression vector comprising a nucleic acid sequence encoding ATXN2 and ATXN2L or a nucleic acid sequence encoding the LCD domain of ATXN2 and ATXN2L. Preferably, in some embodiments, the expression vector is an AAV vector or a pLVX vector. In some embodiments, the expression vector is selected from an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a lentiviral vector, a herpes virus vector, a vaccinia virus vector, MMLV, GaLV, a simian immunodeficiency virus vector, or a poxvirus vector. Preferably, the expression vector is replication-defective. In some embodiments, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

[0035] On the other hand, the present invention also provides an expression vector combination, which comprises a first expression vector and a second expression vector, wherein the first expression vector comprises a nucleic acid sequence encoding ATXN2 or a nucleic acid sequence encoding the LCD domain of ATXN2; the second expression vector comprises a nucleic acid sequence encoding ATXN2L or a nucleic acid sequence encoding the LCD domain of ATXN2L. Preferably, in some embodiments, the expression vector is an AAV vector or a pLVX vector. In some embodiments, the expression vector is selected from adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, herpes virus vectors, vaccinia virus vectors, MMLV, GaLV, simian immunodeficiency virus vectors, and poxvirus vectors. Preferably, the expression vector is replication-defective. In some embodiments, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

[0036] In another aspect, the present invention also provides an inhibitory nucleic acid combination comprising a first inhibitory nucleic acid and a second inhibitory nucleic acid, wherein the first inhibitory nucleic acid targets ATXN2; the second inhibitory nucleic acid targets ATXN2L. In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or an RNA interfering agent, preferably, the inhibitory nucleic acid is or comprises or encodes a small interfering RNA (siRNA), a microRNA-adapted shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA, a precursor microRNA (pre-miRNA), or a microRNA (miRNA).

[0037] In another aspect, the present invention also provides a CRISPR composition comprising a Cas enzyme, a first gRNA, and a second gRNA, wherein the first gRNA targets ATXN2; the second gRNA targets ATXN2L. In some embodiments, the Cas enzyme is Cas9. In some embodiments, the first gRNA is 5'-GTATTGGAAATACCCCCAGT-3'; the second gRNA is 5'-GTATTGGAAATACCCCCAGT-3'.

[0038] In another aspect, the present invention also provides a composition comprising the expression vector, expression vector combination, inhibitory nucleic acid combination or CRISPR composition of the present invention, and a pharmaceutically acceptable carrier.

[0039] In some embodiments, the expression and / or protein function of ATXN2 and / or ATXN2L are regulated using a modulator or a combination of modulators of the present invention. In some embodiments, the modulator or combination of modulators of the present invention may be an antibody, a compound, a small molecule compound, a fusion protein, a cytokine, etc. In some embodiments, the modulator or combination of modulators of the present invention may be used to regulate the expression and / or function of ATXN2 and / or ATXN2L. In some embodiments, the modulator or combination of modulators of the present invention may regulate the expression and / or function of ATXN2 and / or ATXN2L by regulating the transcription, translation, post-translational modification, protein degradation, etc. of ATXN2 and / or ATXN2L. In some embodiments, the modulator or combination of modulators of the present invention may regulate the expression and / or function of ATXN2 and / or ATXN2L by regulating genes related to the upstream and downstream signaling pathways of ATXN2 and / or ATXN2L.

[0040] In some embodiments, the modulator or combination of modulators of the present invention comprises the expression vector, combination of expression vectors, combination of inhibitory nucleic acids, CRISPR composition or composition. Preferably, in some embodiments, the modulator or combination of modulators of the present invention is the expression vector, combination of expression vectors, combination of inhibitory nucleic acids, CRISPR composition or composition.

[0041] In another aspect, the present invention also provides a method for regulating circadian rhythm, comprising the step of regulating phase separation.

[0042] In some embodiments, regulating phase separation comprises regulating the expression and / or protein function of ATXN2 and / or ATXN2L to regulate circadian rhythm. In some embodiments, regulating the expression of ATXN2 and / or ATXN2L is upregulating or downregulating the expression of ATXN2 and / or ATXN2L. In some embodiments, regulating the protein function of ATXN2 and / or ATXN2L is inactivating or enhancing the protein function of ATXN2 and / or ATXN2L.

[0043] In some embodiments, the present invention also provides a method for regulating circadian rhythm, comprising: increasing phase separation by upregulating the expression of ATXN2 and / or ATXN2L genes or LCD proteins or domains or enhancing their function. In some embodiments, the present invention also provides a method for regulating circadian rhythm, comprising: decreasing phase separation by downregulating the expression of ATXN2 and / or ATXN2L genes or LCD proteins or domains or reducing their function. In some embodiments, the present invention also provides a method for regulating circadian rhythm, comprising: increasing phase separation by upregulating the expression of ATXN2 and / or ATXN2L genes or LCD proteins or domains or enhancing their function, and decreasing phase separation by downregulating the expression of ATXN2 and / or ATXN2L genes or LCD proteins or domains or reducing their function.

[0044] In one aspect, the present invention also provides a method for treating a disease, comprising the step of regulating phase separation; the disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, drowsiness, sleep disorders, sleep disorders, neurodegenerative diseases, ataxia, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's syndrome, anxiety disorders, depression, manic depression, obsessive-compulsive disorder, affective neurosis, depressive neurosis, anxiety neurosis, mood disorders, delirium, panic attacks, post-traumatic stress disorder, dementia, mental retardation, movement disorders, Huntington's disease, addiction, migraine, headache, pain, neuropathic pain.

[0045] In some embodiments, phase separation is regulated by regulating the expression and / or function of a protein comprising an LCD domain, preferably regulating a protein comprising an LCD domain is regulating a clock gene protein comprising an LCD domain.

[0046] In some embodiments, LCD domain-mediated phase separation is modulated by upregulating or downregulating expression of a protein comprising an LCD domain.

[0047] In one aspect, the present invention also provides use of a reagent for detecting ATXN2 in the preparation of a detection agent for detecting circadian rhythm abnormalities and / or neurodegenerative diseases; optionally, when the polyQ in the ATXN2 is greater than 22Q, preferably greater than or equal to 23Q, 24Q, 25Q, 26Q, 27Q, 28Q, 29Q, 30Q, 31Q, 32Q, 33Q, 34Q, 35Q, 36Q, 37Q, 38Q, 39Q, 40Q, 41Q, 42Q, 43Q, 44Q, 45Q, 46Q, 47Q, 48Q, 49Q, 50Q, 51Q, 52Q, 53Q, 54Q, 55Q, 56Q, 57Q, 58Q, the subject is determined to have an abnormal circadian rhythm and / or a neurodegenerative disease.

[0048] In one aspect, the present invention also provides a method for detecting whether a subject has a circadian rhythm abnormality and / or a neurodegenerative disease, comprising the step of detecting the protein sequence of ATXN2 in the subject, wherein when the polyQ in the ATXN2 is greater than 22Q, preferably greater than or equal to 23Q, 24Q, 25Q, 26Q, 27Q, 28Q, 29Q, 30Q, 31Q, 32Q, 33Q, 34Q, 35Q, 36Q, 37Q, 38Q, 39Q, 40Q, 41Q, 42Q, 43Q, 44Q, 45Q, 46Q, 47Q, 48Q, 49Q, 50Q, 51Q, 52Q, 53Q, 54Q, 55Q, 56Q, 57Q, 58Q, the subject is determined to have an abnormal circadian rhythm and / or a neurodegenerative disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] The present invention is described below with reference to the accompanying drawings by way of example only. It should be emphasized that the details shown are merely exemplary and illustrative of preferred embodiments of the present invention, and are intended to illustrate the principles and concepts of the present invention. Those skilled in the art will readily appreciate how to practice the present invention in various forms as described with reference to the accompanying drawings.

[0050] Figure 1 Protein synthesis oscillates along the circadian cycle and is regulated by ATXN2 and ATXN2L.

[0051] (A) HPG fluorescence staining shows protein synthesis activity at the indicated time points. U2OS cells were synchronized and pulse-labeled with HPG for 30 minutes, fixed, and subjected to Click-iTHPG reaction using Alexa-fluor 488-azide. Scale bar = 20 μm.

[0052] (B) Corresponding quantitative analysis of the mean HPG fluorescence intensity in (A). Values ​​represented are mean ± SD (n = 4).

[0053] (C) Polysome fractionation curves of U2OS cells, where cells were collected at 4 h intervals for 48 h after synchronization. Peaks corresponding to 40S, 60S, and 80S are indicated by arrows, with polysome markers at the top.

[0054] (D) Quantification of polysome fraction distribution in (C) and (K) using the translation index. The translation index is defined as the ratio of the total area under the curve for heavy polysomes (more than 5 ribosomes) and light polysomes (2-4 ribosomes), as detailed in Figure 7C.

[0055] (E and F) Polysome profiles of mouse brain (E) and liver (F) tissues collected at ZT 4, 8, 12, 16, 20, and 24 hours.

[0056] (G) Western immunoblotting of puromycin-labeled newly synthesized peptides in liver tissues of mice at different ages.

[0057] (H) Expression patterns of proteins in Group 3 detected by mass spectrometry at different time points. Seven groups of genes were clustered based on their distinct temporal expression patterns using the fuzzy c-means clustering algorithm. Group 3 is shown here; the others are shown in Figure 7H. The blue line represents the simulated curve for each group. The Y-axis represents normalized protein abundance.

[0058] (I) Scatter plot showing changes in protein levels in CT16 compared to CT4. The Y-axis shows the log2 fold change in CT16 relative to CT4, and the X-axis shows the log2 protein abundance at 16 hours.

[0059] (J) Polysome profiles of cell lysates from CT12 WT (red), ATXN2 knockout (yellow), ATXN2L knockout (green), and ATXN2 / 2L double knockout (blue).

[0060] (K) Polysome profiles of ATXN2 / 2L double knockout cells collected for 48 hours. The corresponding quantitative analysis of translation index is shown in 1D.

[0061] (L) Representative images showing nascent protein synthesis at different time points using Click-iT HPG Alexa Fluor 488 protein synthesis assay in ATXN2 knockout, ATXN2L knockout, and ATXN2 / 2L double knockout U2OS cells.

[0062] (M) Corresponding quantitative analysis of the mean HPG fluorescence intensity in (L). The values ​​represented are mean ± SD (n = 4).

[0063] Figure 2 ATXN2 / 2L condensates oscillate synchronously with the circadian cycle.

[0064] (A) Representative immunofluorescence images illustrating the expression of Atxn2 or Atxn2l (red) in the SCN (left) and liver (right). Nuclei are labeled with DAPI (blue), and Atxn2 or Atxn2l condensates are marked with white arrows. Scale bar = 5 μm.

[0065] (B) Representative transmission electron microscopy (TEM) images of Atxn2 immunogold labeling in mouse white adipose tissue (WAT). Lipid droplets are labeled as LDs, and black dots represent Atxn2 protein detected by gold particles. White arrows point to Atxn2 groups. Scale bars are 1 μm, 600 nm, and 200 nm, respectively.

[0066] (C) Representative TEM images showing immunogold labeling of Atxn2l in mice. Black dots correspond to Atxn2l protein detected by 18 nm gold particles, and black arrows indicate Atxn2l groups. Scale bars are 600 nm and 200 nm, respectively.

[0067] (D and E) Phase diagrams of in vitro purified ATXN2 (G) or ATXN2L (H) LCD proteins. The corresponding protein and NaCl concentrations are indicated. ATXN2 labeled with Alexa-568 LCD is shown in red, and ATXN2L labeled with Alexa-488 LCD is shown in green. Scale bar = 20 μm.

[0068] (F) FRAP curves of ATXN2 and ATXN2L liquid-like droplets. Values ​​represent mean ± SD (n = 6).

[0069] (G) Representative immunofluorescence images showing the expression of ATXN2 (red) and ATXN2L (green) in U2OS cells. DAPI is shown in blue, and white arrows point to ATXN2 or ATXN2L aggregates. Scale bar = 10 μm.

[0070] (H) Representative images showing the expression of ATXN2 (red) and ATXN2L (green) in U2OS cells at different circadian time points. DAPI is shown in blue. Scale bar = 2 μm.

[0071] (I) Shows the expression of Atxn2 and Atxn2l (red) in the SCN at different time points (ZT). Scale bar = 2 μm.

[0072] (J and K) Western blot results showing the protein abundance of ATXN2 and ATXN2L in U2OS cells (J) and hypothalamic samples (K) at the indicated time points during the circadian cycle. β-Tubulin was used as a control.

[0073] Figure 3 ATXN2 forms oscillatory translation initiation condensates.

[0074] (A) Phase distribution of rhythmic proteins in the corresponding input whole proteome and ATXN2 immunoprecipitated proteome.

[0075] (B) Gene Ontology (GO) analysis of proteins enriched in ATXN2 condensates. The top 10 GO biological process annotations are shown in a bar graph ranked from most enriched (top) to least enriched (bottom), with the horizontal axis representing the -log10p value corresponding to each GO category.

[0076] (C) Bubble plot showing the most enriched categories of proteins in the GO biological process annotations for ATXN2 condensates at different time points. The size of the dots represents the number of proteins enriched in the term, and the color of the dots represents the -log 10 p-value.

[0077] (D) The ATXN2 interaction network is shown in the figure. The largest group contains 25 translation-related proteins, and the node size indicates the degree of connectivity.

[0078] (E) Heatmap showing the enrichment of translation initiation factors (top) and ribosomal components (bottom) in ATXN2 condensates at different time points.

[0079] (F) Western blot of ATXN2 co-immunoprecipitated proteins at different time points, as indicated above.

[0080] Figure 4 ATXN2 / 2L condensates recruit translation machinery and specific mRNAs.

[0081] (A) Multiphase-separated condensates recruit ribosomes in vitro. Phase-separated liquid droplets formed by the LCD of ATXN2, ATXN2L, FUS, and YTHDC1 are labeled green. Purified ribosomes are labeled red. Scale bar = 20 μm.

[0082] (B) Schematic diagram of the PER2 mRNA molecule, with the two AUUUU / A-rich sequences in the 3'UTR highlighted in yellow and light green, respectively. The AUUUU / A motif is in red.

[0083] (C) ATXN2 condensates selectively recruit specific RNAs in vitro. The ATXN2 LCD protein is shown in green, and RNAs including the PER2 5'UTR, two AUUUU / A-rich subregions of the PER2 3'UTR, PER1 3'UTR, CRY1 3'UTR, CRY2 3'UTR, CLOCK 3'UTR, BMAL1 3'UTR, FAM199X 3'UTR, RRBP1 3'UTR, and WFS1 3'UTR are shown in red. Scale bar = 10 μm.

[0084] (D and F) FUSLCD (D) and all M-to-S mutants of ATXN2 (F) fail to recruit specific RNAs in vitro. Proteins are shown in green and RNAs are shown in red. Scale bar = 10 μm.

[0085] (E) Representative images showing the in vitro phase separation state of the ATXN2LCD wild type and all M-to-S mutants. Scale bar = 20 μm.

[0086] (G) Representative images showing colocalization of Per2 mRNA and Atxn2 protein in the SCN at different time points. Immunostaining of Atxn2 protein is shown in green, Per2 mRNA is shown in purple, and nuclei are labeled with DAPI (blue). White arrows indicate colocalized Atxn2 condensates and Per2 mRNA. Scale bar = 10 μm.

[0087] (H) Representative images showing colocalization of Per2 mRNA and Atxn2 protein condensates in hypothalamic GT1-7 cells. Immunostaining of Atxn2 protein is shown in green, Per2 mRNA is shown in red, and cell nuclei are labeled with DAPI (blue). White arrows indicate colocalized Atxn2 condensates and Per2 mRNA. Scale bars are 5 μm and 1 μm, respectively.

[0088] Figure 5 ATXN2 / 2L condensates activate PER2 translation in vitro and in vivo.

[0089] (A) Histogram of in vitro translation efficiency of proteins added to the phase-separated ATXN2 LCD WT (ATXN2 WT, left) or all M-to-S mutants (ATXN2MS, right), expressed as relative luciferase activity. Relative luciferase activity was quantified for the luciferase control (grey), luciferase-PER2 3'UTR (red), luciferase-CRY1 3'UTR (yellow), luciferase-WFS1 3'UTR (green), and luciferase-RRBP1 3'UTR (blue). Relative luciferase activity was normalized to the luciferase of the control. Values ​​are shown as mean ± SD (n = 3, ****p < 0.00005 by t-test).

[0090] (B) Schematic diagram showing nascent polypeptides labeled with the SunTag system and protein synthesis complexes dissociated by addition of puromycin.

[0091] (C) U2OS cells co-expressing scFv-GFP and translation reporter gene (SunTag 24x Representative images of PER2-3UTR (-PER2-3UTR) and mCherry-ATXN2 without (left) or with (right) puromycin-induced translational inhibition. White boxes indicate colocalization of nascent PER2 peptide (green) and mCherry-tagged ATXN2 protein (red). Scale bars are 5 μm and 2 μm, respectively.

[0092] (D) Representative images of EGFP-ATXN2 (top) and EGFP-ATXN2-ΔLCD3 (bottom) complemented in double knockout cells. A 3D statistical plot of the grayscale values ​​of the corresponding images (right) is shown. Scale bars are 10 μm and 2 μm, respectively.

[0093] (E) Polysome fractionation curves of EGFP-ATXN2 (top) and EGFP-ATXN2-ΔLCD3 (bottom) complemented cells, collected at 4-hour intervals for 24 hours after synchronization. Peaks corresponding to 40S, 60S, and 80S are indicated by arrows, and polysome markers are at the top.

[0094] (F) Western blot results showing protein abundance of ATXN2, CRY1, CLOCK, PER2, and puromycin-tagged nascent proteins in wild-type U2OS cells (left) and cells rescued by EGFP-ATXN2 (center) or EGFP-ATXN2-ΔLCD3 (right). Cells were harvested at 4-hour intervals for 48 hours after synchronization. Puromycin was added to the culture medium half an hour before sample collection. β-Tubulin was used as a control.

[0095] (G) Representative rhythms of PER2::LUC bioluminescence in ATXN2-knockout, ATXN2L-knockout, and ATXN2 / 2L double-knockout U2OS cells, as well as in EGFP-ATXN2 and EGFP-ATXN2-ΔLCD3 complemented cells. The culture medium contained 100 mM luciferin for recording bioluminescence. The amplitude and cycle length of the bioluminescence rhythm are shown as mean ± SD (n = 3, ****p < 0.00005 by t-test).

[0096] Figure 6 ATXN2 and ATXN2L jointly regulate circadian rhythms in mice.

[0097] (A) Flowchart illustrating the Atxn2 and Atxn2l knockout strategy. Exons are represented as numbered boxes, and Cas9 / sgRNA target sites are indicated by black arrows. Yellow triangles indicate the two LoxP sites in Atxn2l conditional knockout mice.

[0098] (B)Atxn2l flx / flx Mice were bilaterally injected with AAV-hSyn-mCherry-IRES-Cre into the suprachiasmatic nucleus and allowed to recover for more than 2 weeks.

[0099] (C) Representative activity graphs of wheel running activity in light-dark (LD) and dark-dark (DD) conditions for WT, three single knockout mice: Atxn2- / -, Vip-Atxn2l- / -, SCN-Atxn2l- / -, and Atxn2+ / -;SCN-Atxn2l+ / - compound heterozygous knockout mice, and Atxn2- / -;SCN-Atxn2l- / - compound homozygous knockout mice. Mice were housed in a 12L:12D environment for 7 days and then transferred to continuous darkness for 14 days. White shading indicates lights on, while gray shading indicates lights off.

[0100] (D) Mean circadian free-running period (mean ± SD) was measured by chi-square periodograms in DD over 14 days in the same animals described in (C). The period of Atxn2- / - mutants was slightly prolonged to 23.95 ± 0.05 hours (n = 6, p = 0.0655, t-test). The period length was significantly shortened in Vip-Atxn2l- / - (n = 12, p = 0.0476, t-test) and SCN-Atxn2l- / - (n = 6, p = 0.0192, t-test) mice.

[0101] (E) The mean amplitude of locomotor activity rhythms was analyzed by fast Fourier transform (FFT) over 14 days in DD. The amplitude of Atxn2- / - mice was significantly reduced to 0.213 ± 0.086 (n = 6, p = 0.011, t-test). Compound heterozygous knockout mice (n = 8, p = 0.0089, t-test) and compound homozygous knockout mice (n = 4, p < 0.0001, t-test) showed more severe amplitude loss.

[0102] (F) Schematic model illustrating that in the transcription-translation feedback loop, ATXN2 and ATXN2L form oscillation points along the circadian cycle, activating the translation of PER and CRY mRNAs by recruiting components of the translation machinery.

[0103] Figure 7 ATXN2 and ATXN2L together regulate rhythmic translation.

[0104] (A) HPG fluorescence staining shows protein synthesis activity in THLE-2 and SH-SY5Y cells at different time points. Cells were synchronized, pulse-labeled with HPG for 30 minutes, fixed, and subjected to Click-iT HPG reaction using Alexa-fluor 488-azide at the indicated time points. Scale bar = 20 μm.

[0105] (B) Corresponding quantification of the mean HPG fluorescence intensity in (A). Values ​​represent mean ± SD (n = 4).

[0106] (C) Strategy for quantifying translation fractionation curves using the area under the curve calculated from heavy and light polysomes. The translation index is the ratio of the areas associated with the heavy and light fractions.

[0107] (D) Representative immunoblots of newly synthesized peptides labeled with puromycin in U2OS, THLE-2, and SH-SY5Y cells.

[0108] (E and F) Quantification of the polysome fraction distribution with translation index in Figure 1E and 1F.

[0109] (G) Representative images of puromycin-labeled nascent proteins in the brain region surrounding the lateral ventricle (Lv). Puromycin was stereotaxically injected into the left lateral ventricle, and sagittal brain sections were stained with a puromycin antibody. Fluorescence intensity in the caudate putamen (CP), thalamus (TH), corpus callosum (cc), and hippocampus (HIP) regions was measured using ImageJ (right). Values ​​are shown as mean ± SD (****p < 0.00005 by t-test).

[0110] (H) Except for group 3 (Figure 1H), total proteins with different expression patterns along the circadian rhythm were analyzed using the fuzzy c-means clustering algorithm.

[0111] (I) Quantification of the polysome fraction distribution with translation index in Figure 1J.

[0112] (J) Domain structures of ATXN2 and ATXN2L in representative species. The Lsm domain is in yellow, LsmAD is in red, the polyQ repeat domain is in green, the PAM is in purple, and the low complexity domain (LCD) is in blue.

[0113] (K) Phylogenetic tree of ATXN2 and ATXN2L indicates that ATXN2 and ATXN2L evolved from a common ancestor of atx2 in yeast and insects.

[0114] Figure 8 ATXN2 and ATXN2L phases separate in a rhythmic manner in vitro and in vivo.

[0115] (A) Representative immunofluorescence images showing the subcellular localization of Atxn2 and Atxn2l (red) in the suprachiasmatic nucleus (SCN). Nuclei were stained with DAPI (blue), and the two SCNs are delineated by white dashed lines.

[0116] (B) Representative immunofluorescence images of Atxn2 and Atxn2l aggregates (red) in the mouse cortex, hippocampus, and cerebellum. Cell nuclei were counterstained with DAPI (blue). Scale bar = 5 μm.

[0117] (C and D) Scatter plots showing amino acid conservation of ATXN2 and ATXN2L. Lower conservation scores indicate more conserved sequences. Protein domains, including polyQ, LSm, LSmAD, PAM, and LCD, are depicted in red.

[0118] (E and F) Phase diagrams of ATXN2 (E) and ATXN2L (F) LCDs, respectively. Green dots indicate phase separation under the indicated conditions, while red dots indicate no phase separation.

[0119] (G) Representative immunofluorescence images of ATXN2 condensate formation (red or green) in various cell lines, including THLE-2, GT1-7, and HeLa cells. Cell nuclei were counterstained with DAPI (blue). Scale bar = 10 μm.

[0120] (H) Localization of ATXN2 condensates relative to the endoplasmic reticulum (ER). The ER was stained using an anti-knockout EL antibody (green), while ATXN2-mCherry is shown in red. Scale bars represent 10 μm and 5 μm.

[0121] (I) Immunostaining of ATXN2 in ATXN2 knockout U2OS cells, used as a negative control.

[0122] (JM) Quantification of the number and average size of ATXN2 and ATXN2L condensates in Figure 2H along the circadian cycle.

[0123] (N) Confocal microscopy images of ATXN2 in THLE-2 cells at different circadian time points are shown. Immunostained ATXN2 is shown in red, and magnified images are indicated by white boxes. White triangles highlight ATXN2 condensates. Scale bars are 10 μm and 5 μm, respectively.

[0124] (O) Statistical analysis of the diameter of ATXN2 condensates at different time points (N).

[0125] (P) Confocal microscopy images of Atxn2 and Atxn2l (red) in the suprachiasmatic nucleus (SCN) at different time points (ZT) are shown. The SCN is outlined by a white dashed circle. Scale bar = 200 μm.

[0126] (Q) Quantitative analysis of ATXN2 / 2L protein levels along the circadian rhythm in U2OS cells.

[0127] (R) ATXN2 protein abundance fluctuates with the circadian cycle in HEK293T cells, SHSY-5Y cells, and HeLa cells. ATXN2 and β-tubulin were detected by Western blotting (WB) at 4-hour intervals within 32 hours after synchronization.

[0128] (S) Quantitative analysis of Atxn2 protein levels in the hypothalamus along the circadian rhythm.

[0129] (T) Atxn2 protein abundance oscillates in the mouse cerebellum and cortex. Animals maintained under a normal light-dark cycle were used for tissue collection at different time points at 3-hour intervals. ZT 0 represents the time when the lights were on. β-tubulin was used as a protein loading control.

[0130] (U and V) Quantification of ATXN2 / 2L RNA in U2OS cells (U) and ATXN2 RNA in the hypothalamus (V), respectively, along the circadian cycle. Each value was normalized to actin and converted to relative expression level of the first sample.

[0131] Fig. 9 ATXN2 condensates oscillate in a rhythmic manner and interact with translation-related proteins.

[0132] (A) Pie chart depicting the percentage of cycling and non-cycling proteins. RAIN time series periodicity analysis was performed with a 24-hour period and a significance level of p < 0.05 to identify cycling and non-cycling proteins in the input whole proteome and ATXN2 immunoprecipitated (IP) proteome.

[0133] (B) Expression patterns of circulating proteins in the ATXN2 immunoprecipitation group. The time point of peak expression was used to classify proteins (p value < 0.05).

[0134] (C) Heat map showing the protein abundance distribution of the GO category “translation” at different time points.

[0135] (D) Ribosome density distribution of the transcript translation reading frame, showing upregulation of TE in WT cells from 4 to 12 hours (right) and downregulation in ATXN2 / 2L double knockout cells compared to WT cells at 12 hours (left). Top: Ribosome density after the start codon. Bottom: Ribosome density before the stop codon.

[0136] Figure 10 ATXN2 condensates recruit ribosomes and clock-related mRNAs.

[0137] (A) Schematic workflow of the 80S ribosomal subunit purification process.

[0138] (B) Corresponding quantification of ribosome enrichment in each condensate from Figure 4 A. White arrows are drawn in the droplet to indicate the analyzed fraction.

[0139] (C) The mRNA 3'UTRs of core clock genes are enriched with AUUUU / A motifs, as shown in the schematic.

[0140] (D) Experimental workflow for in vitro transcription.

[0141] (E) Corresponding quantification of ribosome enrichment in each condensate from Figure 4C. White arrows are drawn in the Atxn2 droplets to indicate the analyzed fraction.

[0142] (F) The ATXN2 LCD is enriched in methionine residues, highlighted in red. The numbers of all methionine residues are formatted as superscripts.

[0143] (G) Representative images showing the in vitro phase separation state of the ATXN2LCD protein, including seven single M-to-S mutants. Proteins were diluted to a final concentration of 80 μM. Scale bar = 20 μm.

[0144] (H) Representative images show colocalization of Per2 mRNA and Atxn2 protein condensates in the cortex, hippocampus, substantia nigra (SN), and cerebellum, respectively. Colocalized Atxn2 condensates and Per2 mRNA are indicated by white arrows. Atxn2 protein is shown in green, while Per2 mRNA is shown in red. Cell nuclei are labeled with DAPI (blue). Scale bar = 5 μm.

[0145] Figure 11 ATXN2 phase separation is essential for rhythmic translation.

[0146] (A) Experimental workflow for in vitro translation experiments.

[0147] (B) Domain composition of different ATXN2 mutants.

[0148] (C) Representative images of EGFP-ATXN2 mutants complemented in double knockout cells, except for ΔLCD3. Three-dimensional statistical plots of grayscale values ​​corresponding to the images are shown (bottom). Scale bars are 10 μm and 2 μm, respectively.

[0149] (D) Quantification of the polysome fraction distribution with translation index in Figure 5E.

[0150] (E) Western blot results showing the knockdown efficiency of ATXN2 and ATXN2L in PER2::LUCU2OS cells, with β-tubulin used as a control.

[0151] Figure 12 ATXN2 and ATXN2L jointly regulate circadian behavior.

[0152] (A) Representative images of the suprachiasmatic nucleus (SCN) showing mCherry expression two weeks after stereotactic injection of AAV-hSyn-mCherry-IRES-Cre.

[0153] (B) Representative activity graphs of running wheel activity in mice with different genetic modifications. Mice were housed in 12L:12D for 7 days and then transferred to continuous darkness for 14 days. White shading indicates lights on, while gray shading indicates lights off.

[0154] (C) Average circadian free-running periods (mean ± SD) were measured for 7 days in the same animals shown in Figure 6D under LD conditions and statistically analyzed using a two-tailed t-test. No significant differences were observed (ns, not significant).

[0155] (D) Body weight curves of male WT, Atxn2- / -, Vip-Atxn2l- / -, and Atxn2+ / -; SCN-Atxn2l+ / - compound heterozygous knockout mice.

[0156] (E) Representative trajectory plots of WT and transgenic mice during the last 5 min of the open field test.

[0157] (F) Total distance traveled was recorded and analyzed in the open field test. All data are presented as mean ± SD.

[0158] (G and H) Latency to the central area (G) and time spent in the central area (H) were recorded and analyzed in the open field test. Data are presented as mean ± SD.

[0159] FIG13 uses inhibitory nucleic acids, CRISPR compositions ATXN2 and ATXN2L, and expression vectors to overexpress ATXN2

[0160] (A) Western Blot verification of ATXN2 and ATXN2L knockout by CRISPR-Cas9;

[0161] (B) Western Blot was used to verify the downregulation of ATXN2 expression by siRNA;

[0162] (C) Western Blot analysis to verify the downregulation of ATXN2 and ATXN2L expression by shRNA

[0163] (D) Overexpression of ATXN2 in U2OS cells.

[0164] FIG14 is a schematic diagram of the construction of cells containing polyQ of different lengths, showing the domains contained in two homologous proteins, ATXN2 and ATXN2L, wherein the poly domain contained in ATXN2 has undergone a variety of changes in polyQ of different lengths.

[0165] Figure 15 illustrates the circadian period of PER2 in the ATXN2-0 / 22 / 39 / 57Q cell lines. PER2 period values ​​were calculated for 25 cells in each cell line; each dot represents a single cell. The average PER2 period in ATXN2-0Q and ATXN2-22Q was 23.48 and 23.76 hours, respectively, approximately equivalent to 24 hours, showing no significant difference. The average PER2 period in ATXN2-39Q and ATXN2-57Q was 25.15 and 25.30 hours, respectively, significantly prolonged compared to ATXN2-22Q. *, P < 0.5; ***, P < 0.01. DETAILED DESCRIPTION

[0166] Listed below are definitions of various terms used to describe the compositions and nucleic acid combinations disclosed herein. These definitions apply to the terms as used throughout this specification and claims, except where otherwise limited in specific instances, and these terms are used either individually or as part of a larger group.

[0167] General terms

[0168] As used herein, the terms "optional" and "optionally" include both selection and non-selection. For example, "optionally modified" includes both modification and non-modification.

[0169] As used herein, the terms "a," "an," and "the" are generally construed to cover both the singular and the plural.

[0170] As used herein, the term "include" means and can be used interchangeably with the phrase "including (but not limited to)". The term "comprising" used herein means and can be used interchangeably with the phrase "including (but not limited to)". The technical solutions using "include" or "comprising" in this patent can be further limited to "consisting of" or "composed of".

[0171] As used herein, the terms "one embodiment," "some embodiments," "an embodiment," "a specific embodiment," "a related embodiment," "an embodiment," "an additional embodiment," or "a further embodiment," or combinations thereof, mean that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, the appearances of the aforementioned phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0172] As used herein, the terms "subject" and "subject in need thereof" refer to any mammal or non-mammal. Mammals include, but are not limited to, humans, vertebrates such as rodents, non-human primates, cows, horses, dogs, cats, pigs, sheep, and goats.

[0173] As used herein, the term "expression vector" refers to a DNA construct containing a nucleic acid molecule operably connected to a suitable control sequence, which can achieve expression of the nucleic acid molecule in a suitable host. Such control sequences include a promoter for achieving transcription, an optional operator sequence for controlling such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for controlling the termination of transcription and translation. The vector can be a plasmid, a phage particle, a virus, or simply a potential genome insert. Viral vectors can be based on DNA (e.g., adenovirus, adeno-associated virus, or vaccinia virus) or RNA, including oncolytic virus vectors (e.g., VSV), which can be replicated or cannot be replicated. Once transformed into a suitable host, the vector can be replicated and function independently of the host genome, or in some cases, can be integrated into the genome itself. In this specification, "plasmid", "expression plasmid", "vector" and "expression vector" are often used interchangeably.

[0174] As used herein, the term "modulate" refers to causing a change in the subject being modulated. Depending on the subject being modulated, those skilled in the art will be able to determine whether the subject being modulated has changed using conventional methods in the art. "Modulating" expression refers to "upregulating" or "downregulating" the expression level of the corresponding gene or its encoded protein.

[0175] As used herein, "up-regulation" or "down-regulation" expression refers to an increase or decrease in the expression of a corresponding gene or a protein encoded therefrom. In some embodiments, "up-regulation" can represent an increase in the expression of a corresponding gene or a protein encoded therefrom relative to its original level by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 80%, 90%, 100%, 110% or more, or a percentage between any of the above percentages. In some embodiments, "down-regulation" can represent a decrease in the expression of a corresponding gene or a protein encoded therefrom relative to its original level by 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 80%, 90%, 100% or a percentage between any of the above percentages.

[0176] The prior art cited in this specification is hereby incorporated by reference in its entirety and for all purposes.

[0177] Regulation of circadian rhythms

[0178] "Regulating circadian rhythm" refers to regulating the period, intensity, phase or frequency of the circadian rhythm of a cell or organism. For a cell or organism, a change in circadian rhythm can be reflected in a rhythmic change in any biological or physiological characteristic. For example, in some embodiments, for a cell, "regulating circadian rhythm" can be reflected in a change in the period, intensity (or level or amplitude), phase or frequency of cell translation of protein relative to time. In some embodiments, for an organism, "regulating circadian rhythm" can be reflected in a change in the period, intensity, phase or frequency of the rhythmic behavior of an organism relative to time. In some embodiments, the organism can be a subject, and preferably the subject is a human or a mouse.

[0179] Those skilled in the art will appreciate that accelerating a circadian rhythm means shortening the circadian rhythm's period, advancing its phase, or increasing its frequency. Delaying a circadian rhythm means prolonging its period, delaying its phase, or slowing its frequency. In some embodiments, accelerating a circadian rhythm means shortening its period or advancing its phase. In some embodiments, delaying a circadian rhythm means prolonging its period or delaying its phase.

[0180] Those skilled in the art will understand that strengthening the circadian rhythm means increasing the intensity of the circadian rhythm, and weakening the circadian rhythm means weakening the intensity of the circadian rhythm.

[0181] The inventors discovered that many clock genes responsible for regulating circadian rhythms in cells and organisms exhibit phase separation. The inventors found that phase separation is crucial for regulating circadian rhythms in organisms. Promoting or reducing phase separation of clock genes can influence or regulate circadian rhythms.

[0182] The term "phase separation" refers to the fact that when external conditions such as temperature and pressure change, a multi-component system sometimes separates into several phases with different components and structures. This phenomenon is common in physiological environments or cellular environments. The phase separation mediated by genes, proteins or domains referred to herein refers to the degree to which the protein or protein or domain encoded by the gene undergoes phase separation under physiological environmental conditions or cellular environmental conditions, which contributes to the rapid occurrence of biological functions related to the gene or protein or domain. Those skilled in the art will immediately understand that upregulating the expression of a gene or protein or domain or enhancing its function can improve the phase separation mediated by the gene or protein or domain; downregulating the expression of a gene or protein or domain or reducing its function can reduce the phase separation mediated by the gene or protein or domain.

[0183] The term "clock gene" refers to a gene in a cell or organism that can regulate circadian rhythms. Prior to the present invention, it was not known in the art that AXTN2 and AXTN2L could be considered clock genes, nor was it known that they could mediate phase separation.

[0184] Thus, the present invention provides a method for regulating circadian rhythm, which includes the step of regulating circadian rhythm by regulating phase separation. In some embodiments, regulating phase separation is to reduce or increase phase separation mediated by clock genes. In some embodiments, the intensity of circadian rhythm is increased by increasing phase separation mediated by clock genes, accelerating or delaying circadian rhythm. In some embodiments, the intensity of circadian rhythm is reduced by reducing phase separation mediated by clock genes, accelerating or delaying circadian rhythm. In some embodiments, increasing phase separation mediated by clock genes can be achieved by up-regulating the expression of clock genes or enhancing the phase separation function of clock genes. In some embodiments, reducing phase separation mediated by clock genes can be achieved by down-regulating the expression of clock genes or inactivating the phase separation function of clock genes.

[0185] Furthermore, the inventors have discovered that the LCD (low complexity domain) structure is crucial for phase separation. Inactivation or functional reduction of the LCD domain can reduce or disrupt the phenomenon of clock gene phase separation.

[0186] Thus, the present invention provides a method for regulating circadian rhythm, which includes the step of regulating phase separation mediated by the LCD domain of a clock gene. In some embodiments, the phase separation mediated by the LCD domain of a clock gene is regulated by inactivating or reducing the function of the LCD domain. In some embodiments, the phase separation mediated by the LCD domain of a clock gene is regulated by down-regulating the expression of a clock gene having an LCD domain. In some embodiments, the phase separation mediated by the LCD domain of a clock gene is regulated by up-regulating the expression of a clock gene having an LCD domain. In some embodiments, the phase separation mediated by the LCD domain of a clock gene can be regulated by expressing the LCD domain of a clock gene via an expression vector, thereby regulating the circadian rhythm.

[0187] Those skilled in the art will understand that any feasible technology in the art can be used to directly or indirectly regulate the expression of clock genes or regulate (inactivate or enhance) the function of clock genes, including but not limited to using gene editing technology, transfection technology, etc. to knock down, knock out genes, overexpress genes, etc. for direct regulation. Those skilled in the art can also use indirect methods to regulate the expression of clock genes or regulate (inactivate or enhance) the function of clock genes, including but not limited to regulating the upstream and downstream genes of the pathway (such as signal pathway, transcription process, translation process, etc.) in which the gene is located, and regulating the expression or function of the ubiquitinase of the protein encoded by the gene.

[0188] To achieve the purpose of regulating circadian rhythm, the above-mentioned regulation of phase separation, regulation of phase separation produced by clock genes, regulation of phase separation of LCD domains of clock genes, regulation of expression of LCD domains of clock genes, etc. can occur in any cell, subject or organism as needed to regulate the circadian rhythm of the cell, subject or organism, and it can also occur in any type of cell of any subject or organism as needed to regulate circadian rhythm. Preferably, in some embodiments, the above-mentioned regulation of phase separation, regulation of phase separation of clock genes, regulation of phase separation of LCD domains of clock genes, regulation of expression of LCD domains of clock genes, etc. occur in cells of the suprachiasmatic nucleus (SCN) of the hypothalamus, or cells of the suprachiasmatic nucleus (SCN) of the hypothalamus of a subject or organism.

[0189] ATXN2 and ATXN2L

[0190] ATXN2 is a gene that encodes a multifunctional protein containing multiple domains. The protein it encodes is called "Ataxin-2." "Ataxin-2" and "ATXN2" are used interchangeably herein and, depending on the context, may refer to either the gene or the protein or RNA it encodes. ATXN2L is a homologous gene to ATXN2 and the protein it encodes is called "Ataxin-2l." "Ataxin-2l" and "ATXN2L" are used interchangeably herein and, depending on the context, may refer to either the gene or the protein or RNA it encodes.

[0191] The amino termini of ATXN2 and ATXN2L contain a polyglutamine sequence (polyQ) and an RNA binding domain, and their carboxyl termini contain a typical LCD (low complexity domain). The nucleic acid sequence of human ATXN2 is shown in SEQ ID NO:1. The amino acid sequence of human ATXN2 is shown in SEQ ID NO:2. The nucleic acid sequence of human ATXN2L is shown in SEQ ID NO:3. The amino acid sequence of human ATXN2L is shown in SEQ ID NO:4. The nucleic acid sequence of the LCD domain of human ATXN2 is shown in SEQ ID NO:5, the amino acid sequence of the LCD domain of human ATXN2 is shown in SEQ ID NO:6, and the nucleic acid sequence of the LCD domain of human ATXN2L is shown in SEQ ID NO:7. The amino acid sequence of the LCD domain of human ATXN2L is shown in SEQ ID NO:8.

[0192] The sequence of human ATXN2 with polyQ of 0 (denoted as ATXN2-0Q) is shown in SEQ ID NO: 25; the sequence of human ATXN2 with polyQ of 22 (denoted as ATXN2-22Q) is shown in SEQ ID NO: 26; the sequence of human ATXN2 with polyQ of 39 (denoted as ATXN2-39Q) is shown in SEQ ID NO: 27; the sequence of human ATXN2 with polyQ of 57 (denoted as ATXN2-57Q) is shown in SEQ ID NO: 28.

[0193] LCD (low complexity domain) domains are not only present in ATXN2 and ATXN2L proteins, but also in certain other proteins, particularly clock gene proteins. Prior to the present invention, the role of LCD domains in circadian rhythm regulation was unknown in the art, nor was it known that regulating proteins containing LCD domains could regulate circadian rhythms. Whether a protein contains an LCD domain, and how to determine the LCD domain, is within the knowledge and capabilities of those skilled in the art.

[0194] Existing research focuses primarily on the role of ATXN2 in ataxia, particularly the polyQ sequence at the N-terminus of ATXN2. However, no prior research has examined the biochemical or physiological functions of ATXN2L. Furthermore, no prior art has disclosed the role of ATXN2 and ATXN2L in circadian rhythms, let alone the role of the LCD domains of ATXN2 and ATXN2L, particularly phase separation within these domains, in circadian rhythm regulation.

[0195] The inventors surprisingly discovered that ATXN2 and ATXN2L can serve as novel clock genes, playing an important role in circadian rhythms. Thus, the present invention provides a method for regulating circadian rhythms by modulating the gene expression or protein function of ATXN2 and / or ATXN2L. Furthermore, the present invention also provides a method for regulating circadian rhythms by modulating the gene expression or protein function of the LCD domain of ATXN2 and / or ATXN2L. In another aspect, the present invention also provides a method for regulating circadian rhythms by modulating the phase separation ability of ATXN2 and / or ATXN2L.

[0196] On the other hand, the inventors have also discovered that ATXN2 and ATXN2L are novel clock genes that have opposite effects on the period and phase of the circadian rhythm. Thus, in some embodiments, the period and phase of the circadian rhythm can be accelerated by downregulating the expression of ATXN2 or upregulating the expression of ATXN2L. Similarly, in some embodiments, the period and phase of the circadian rhythm can be accelerated by inactivating the function of ATXN2 or enhancing the function of ATXN2L. In some embodiments, the period and phase of the circadian rhythm can be delayed by downregulating the expression of ATXN2L or upregulating the expression of ATXN2. Similarly, in some embodiments, the period and phase of the circadian rhythm can be delayed by inactivating the function of ATXN2L or enhancing the function of ATXN2.

[0197] On the other hand, the inventors also found that ATXN2 and ATXN2L have redundant regulation on the intensity and existence of circadian rhythms. For example, in the absence of both, the periodic rhythm of cellular translation proteins disappears, and the intensity (level) of protein translation is significantly reduced. Thus, the present invention provides a method for regulating the intensity of circadian rhythms and restoring circadian rhythms. In some embodiments, the expression of ATXN2 and ATXN2L can be simultaneously increased or the function of ATXN2 and ATXN2L can be enhanced to enhance the intensity of circadian rhythms or restore circadian rhythms. In some embodiments, the expression of ATXN2 and ATXN2L can be simultaneously decreased or the function of ATXN2 and ATXN2L can be simultaneously inactivated to reduce the intensity of circadian rhythms or to eliminate circadian rhythms.

[0198] To achieve the purpose of regulating circadian rhythm, the above-mentioned regulation of ATXN2 and ATXN2L expression and / or function can occur in any cell, subject or organism as needed to regulate the circadian rhythm of the cell, subject or organism, and can also occur in any type of cell in any subject or organism as needed to regulate the circadian rhythm. Preferably, in some embodiments, the above-mentioned regulation of ATXN2 and ATXN2L expression and / or function occurs in cells of the suprachiasmatic nucleus (SCN) of the hypothalamus, or in cells of the suprachiasmatic nucleus (SCN) of the hypothalamus of the subject or organism to better achieve circadian rhythm regulation of the subject or organism.

[0199] Inhibitory nucleic acids

[0200] Inhibitory nucleic acids can be used to achieve the purpose of downregulating the expression of ATXN2 or ATXN2L. Those skilled in the art will appreciate that any type of inhibitory nucleic acid, such as siRNA, shRNA, miRNA, antisense oligonucleotides (DNA or RNA), etc., can be used to achieve the above-mentioned purpose. Its design, testing, and conducting experiments to determine activity are all within the capabilities of those skilled in the art. In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or an RNA interfering agent. Preferably, the inhibitory nucleic acid is or contains or encodes a small interfering RNA (siRNA), a microRNA-adapted shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA (hairpin siRNA), a precursor microRNA (pre-miRNA) or a microRNA (microRNA, miRNA).

[0201] In some embodiments, siRNA or shRNA is used to downregulate the expression of ATXN2 or ATXN2L. Preferably, in some embodiments, the inhibitory nucleic acid of the present invention is used to downregulate the expression of ATXN2 or ATXN2L.

[0202] expression vector

[0203] Upregulating ATXN2 or ATXN2L expression can be achieved using expression vectors comprising nucleic acid sequences encoding ATXN2 and / or ATXN2L proteins. Those skilled in the art will appreciate that any type of expression vector used in the art for expressing genes can be used to achieve this. Designing, testing, and conducting experiments to determine activity are all within the capabilities of those skilled in the art.

[0204] With the sequence information provided, a skilled person can use available cloning technology to produce a nucleic acid sequence or vector suitable for transduction into a cell. The vector can be viral or non-viral (e.g., plasmid). Viral vectors include those derived from the following viral vectors: adenovirus, adeno-associated virus (AAV) including a mutated form, retrovirus, lentivirus, herpes virus, vaccinia virus, MMLV, GaLV, simian immunodeficiency virus (SIV), HIV, poxvirus, and SV40. Preferably, the viral vector is replication defective, although it is envisioned that it can be replication deficient, capable of replication or conditional replication. The viral vector can generally maintain an extrachromosomal state without integrating into the genome of the target cell. A preferred viral vector for introducing a nucleic acid sequence encoding ATXN2 and / or ATXN2L protein into neural cells is an AAV vector.

[0205] Viral vectors have the ability to enter cells. However, non-viral vectors such as plasmids can be complexed with transfection reagents to facilitate the uptake of viral vectors by target cells. Such agents include polycationic agents. Alternatively, delivery systems such as liposome-based delivery systems can be used. The vectors used in the present invention are preferably suitable for use in vivo or in vitro, and are preferably suitable for use in humans. The plasmid is preferably an AAV vector plasmid such as AAV1, AAV2, AAV4, AAV5, AAV8, AAV9.

[0206] The carrier will preferably comprise one or more regulating sequences to instruct the expression of the nucleic acid sequence in the target cell.Regulating sequence can comprise a promoter, enhancer, transcription termination signal, polyadenylation sequence, replication origin, nucleic acid restriction site and homologous recombination site that are operably connected with the nucleic acid sequence.Carrier can also comprise a selective marker, for example, to determine the expression of the carrier in a growth system (for example bacterial cell) or in a nervous system cell.In some embodiments, the carrier comprises one or more promoters, and the promoter is operably connected with expression cassette of the present invention, enhancer, transcription termination signal, polyadenylation sequence, replication origin, selective marker, nucleic acid restriction site and / or homologous recombination site.

[0207] In some embodiments, the expression vector is selected from adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, herpes virus vectors, vaccinia virus vectors, MMLV, GaLV, simian immunodeficiency virus vectors, poxvirus vectors. Preferably, the expression vector is replication-defective.

[0208] In some embodiments, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, in some embodiments, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

[0209] CRISPR Composition

[0210] CRISPR compositions can be used to achieve the purpose of upregulating or downregulating the expression of ATXN2 or ATXN2L. Nucleases such as Cas enzymes and gRNA (guide RNA) are included in the system for inactivating genes or upregulating or downregulating gene expression. Those skilled in the art will understand and adjust the use of corresponding Cas enzymes according to the reagent needs, such as Cas enzymes with partially inactivated nucleic acid cleavage function or completely inactivated nucleic acid cleavage function. Preferably, in some embodiments, the Cas enzyme used is Cas9 enzyme. In some embodiments, the Cas enzyme used is dCas9. In some embodiments, the gRNA used targets the promoter region of the target gene (such as ATXN2 or ATXN2L).

[0211] Pharmaceutical uses and treatments

[0212] Based on the above findings of the present invention and the method for regulating circadian rhythm provided by the present invention, the present invention also provides the use of one or more regulators or regulator combinations that regulate the expression or protein function of ATXN2 and / or ATXN2L in the preparation of the following drugs or reagents:

[0213] (1) Prevent or treat circadian rhythm-related diseases;

[0214] (2) Prevent or treat diseases related to ATXN2 and / or ATXN2L gene disorders;

[0215] (3) regulating the circadian rhythm of a subject in need thereof; and / or

[0216] (4) Regulating phase separation.

[0217] The present invention also provides a method for the following, comprising administering to a subject one or more modulators or a combination of modulators that modulate the expression or protein function of ATXN2 and / or ATXN2L:

[0218] (1) Prevent or treat circadian rhythm-related diseases;

[0219] (2) Prevent or treat diseases related to ATXN2 and / or ATXN2L gene disorders;

[0220] (3) regulating the circadian rhythm of a subject in need thereof; and / or

[0221] (4) Regulating phase separation.

[0222] Those skilled in the art will understand that the above-mentioned regulator or regulator combination can be any reagent in the art that can regulate the expression or protein function of ATXN2 and / or ATXN2L, including but not limited to inhibitory nucleic acids targeting ATXN2 and / or ATXN2L, expression vectors for expressing ATXN2 and / or ATXN2L, and CRISPR compositions for targeting ATXN2 and / or ATXN2L.

[0223] In subjects with circadian rhythm-related diseases, the circadian rhythm can be regulated according to the methods of the present invention, such as regulating the period, phase, intensity and / or frequency of the circadian rhythm, to achieve the effect of improving the circadian rhythm, such as restoring the period, phase, intensity and / or frequency of the circadian rhythm, such as changing the circadian rhythm of subjects with circadian rhythm-related diseases to the level of the circadian rhythm of medically normal subjects.

[0224] Circadian rhythms can also be regulated in subjects with diseases associated with ATXN2 and / or ATXN2L gene disorders according to the present invention. ATXN2 and / or ATXN2L gene expression in the subject can also be regulated based on the type of ATXN2 and / or ATXN2L gene disorder in the disease. For example, in subjects whose ATXN2 and / or ATXN2L expression is significantly lower than the ATXN2 expression level in medically normal subjects, ATXN2 and / or ATXN2L expression can be upregulated; in subjects whose ATXN2 and / or ATXN2L expression is significantly higher than the ATXN2 expression level in medically normal subjects, ATXN2 and / or ATXN2L expression can be downregulated.

[0225] In some embodiments, the circadian rhythm-related disease or the disease associated with ATXN2 and / or ATXN2L gene disorder is selected from sleep disorders, sleep disorders, neurodegenerative diseases, ataxia, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's syndrome, anxiety disorders, depression, manic depression, obsessive-compulsive disorder, affective neurosis, depressive neurosis, anxiety neurosis, mood disorders, delirium, panic attacks, post-traumatic stress disorder, dementia, mental retardation, movement disorders, Huntington's disease, addiction, migraine, headache, pain, neuropathic pain. Preferably, in some embodiments, the circadian rhythm-related disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, hypersomnia, sleep disorders, and sleep disorders.

[0226] The aforementioned modulators or combinations of modulators that regulate the expression or protein function of ATXN2 and / or ATXN2L can also be used in subjects who have not been medically diagnosed with a disease, and can be used to regulate any subject in need who has not been medically diagnosed with a disease. In some embodiments, they can be used in subjects who need to work shifts and need to cope with jet lag.

[0227] Regardless of whether it is used for subjects with or without diseases, those skilled in the art can apply the modulators or modulator combinations disclosed in the present invention, or use the methods of regulating circadian rhythms of the present invention as needed. For example:

[0228] In subjects with shortened or phase-advanced circadian rhythms or in subjects in whom a delay in circadian rhythm is desired, ATXN2 expression is upregulated and / or ATXN2L expression is downregulated.

[0229] In subjects with prolonged or phase-delayed circadian rhythms or in subjects in need of accelerated circadian rhythms, ATXN2L expression is upregulated and / or ATXN2 expression is downregulated.

[0230] In subjects with increased circadian cycle strength or in subjects in need of weakening of the circadian rhythm, the expression of ATXN2L and ATXN2 is simultaneously downregulated.

[0231] In subjects with weakened circadian cycle strength or in subjects in need of strengthening the circadian rhythm, the expression of both ATXN2L and ATXN2 is upregulated.

[0232] In some embodiments, the modulator that regulates the expression or protein function of ATXN2 and / or ATXN2L is a modulator that upregulates the expression of ATXN2 and / or ATXN2L or a modulator that enhances the protein function of ATXN2 and / or ATXN2L. Preferably, in some embodiments, the modulator that regulates the expression of ATXN2 and / or ATXN2L is an expression vector comprising an encoding vector for ATXN2 and / or ATXN2L.

[0233] In some embodiments, the modulator that regulates the expression or protein function of ATXN2 and / or ATXN2L is a modulator that downregulates the expression of ATXN2 and / or ATXN2L or a modulator that reduces the protein function of ATXN2 and / or ATXN2L. Preferably, in some embodiments, the modulator that regulates the expression of ATXN2 and / or ATXN2L is or targets an inhibitory nucleic acid of ATXN2 or ATXN2L.

[0234] Biomarkers and detection and diagnostic methods

[0235] Based on the above findings, the present invention also provides a biomarker combination for detecting a subject's circadian rhythm, which includes ATXN2 and / or ATXN2L. Preferably, it consists of ATXN2 and / or ATXN2L. In some embodiments, the biomarker combination includes or consists of ATXN2 and / or ATXN2L genes. In some embodiments, the biomarker combination includes or consists of ATXN2 and / or ATXN2L proteins. In some embodiments, the biomarker combination is the ATXN2 gene or ATXN2 protein. In some embodiments, the biomarker combination is the ATXN2L gene or ATXN2L protein. The "combination" in the "biomarker combination" herein does not limit the components of the biomarker combination to more than one.

[0236] Due to the important functions of ATXN2 and ATXN2L in circadian rhythm regulation, they can be used as biomarkers to identify or detect the state of a subject's circadian rhythm. Those skilled in the art will understand that this state can be determined to be abnormal or in need of change based on medical knowledge, or determined to be in need of change based on the needs or feelings of the subject. The need for change refers to any aspect of the circadian rhythm, such as the period, intensity, phase, or frequency, that needs to be changed. For example, the period or phase of the circadian rhythm of a subject who needs jet lag may need to be changed so that the corresponding aspect of their circadian rhythm is consistent with the diurnal operation of the time zone in which they are located.

[0237] In some embodiments, decreased expression of ATXN2 in a subject relative to a medically normal subject or increased expression of ATXN2L in a subject relative to a medically normal subject indicates a state of the subject's circadian rhythm, such as an acceleration of the period or phase of the subject's circadian rhythm.

[0238] In some embodiments, elevated expression of ATXN2 in a subject relative to a medically normal subject or decreased expression of ATXN2L in a subject relative to a medically normal subject indicates the state of the subject's circadian rhythm, such as a delay in the period or phase of the subject's circadian rhythm.

[0239] In some embodiments, decreased expression of both ATXN2 and ATXN2L in a subject relative to a medically normal subject indicates the state of the subject's circadian rhythm, such as a decrease in the strength of the subject's circadian rhythm.

[0240] In some embodiments, elevated expression of both ATXN2 and ATXN2L in a subject relative to a medically normal subject indicates the state of the subject's circadian rhythm, such as an increase in the strength of the subject's circadian rhythm.

[0241] Based on the expression of ATXN2 and / or ATXN2L indicating the circadian status of the subject, the methods of the present application can be used to regulate the circadian rhythm of the subject, such as downregulating the intensity of the circadian rhythm in a subject with increased circadian rhythm intensity.

[0242] Based on this, the present invention also provides a reagent combination for detecting the biomarker combination of the present invention, which includes reagents for detecting the gene markers, such as primers, probes, antibodies, and optionally enzymes such as PCR enzymes, buffers, and product instructions. Those skilled in the art will appreciate that any primer, probe, or antibody for detecting the biomarker combination in the art can be used to detect the expression level of the biomarker combination. As needed, those skilled in the art can also freely select relevant enzymes (such as PCR enzymes), buffers, etc. in the art to complete the detection.

[0243] Based on this, the present invention also provides a method for detecting the circadian rhythm of a subject, which comprises the following steps:

[0244] Determining the expression level of the aforementioned biomarker combination in the subject;

[0245] comparing the measured expression levels with reference levels;

[0246] The status of the subject's circadian rhythm is determined.

[0247] In some embodiments, the expression level of the aforementioned biomarker combination in the subject can be determined using the reagent or reagent combination for detecting the biomarker combination of the present invention.

[0248] The reference level of the biomarker combination is the reference level of a subject with a medically normal circadian rhythm. Those skilled in the art will appreciate that the reference level can be obtained by conventional methods in the art. For example, the reference level can be obtained by analyzing gene sequencing data or immunohistochemical data of a subject with a medically normal circadian rhythm. The gene sequencing data or immunohistochemical data can come from temporarily recruited subjects with medically normal circadian rhythms or from historical data. When the expression level of the biomarker combination of a subject is medically significantly different from the expression level of the biomarker combination of a subject with a medically normal circadian rhythm, it can be determined that the rhythm of the subject is abnormal or needs to be changed. Those skilled in the art can understand the significance of medically significant differences based on their own instructions and experience.

[0249] In some embodiments, the state of circadian rhythm can be used to diagnose a circadian rhythm disorder or a circadian rhythm-related disease.

[0250] Cell models and animal models

[0251] The present invention provides a cell model or animal model, which lacks ATXN2 and / or ATXN2L genes.

[0252] In some embodiments, the cell model or animal model lacks the ATXN2 gene, and the cell model or animal model can serve as a cell model for accelerated circadian rhythm period and phase.

[0253] In some embodiments, the cell model or animal model lacks the ATXN2L gene, and the cell model or animal model can serve as a cell model for circadian rhythm period and phase delay.

[0254] In some embodiments, the cell model or animal model lacks both the ATXN2 gene and the ATXN2L gene. The cell model or animal model can serve as a cell model for reduced circadian rhythm intensity or absent circadian rhythm.

[0255] In some embodiments, the animal model has both copies of the ATXN2 gene deleted. In some embodiments, the animal model has both copies of the ATXN2L gene deleted. In some embodiments, the animal model has one copy each of the ATXN2 gene and the ATXN2L gene deleted.

[0256] In some embodiments, the cell model is a mammalian cell, more preferably a human cell, most preferably a U2OS cell, a GT1-7 cell, a THLE-2 cell, or a HeLa cell.

[0257] In some embodiments, the animal model is a mammalian model, more preferably a rodent model, and most preferably a mouse model.

[0258] Based on this, the present invention also provides the use of the cell model or animal model of the present invention for screening drugs for treating or preventing circadian rhythm-related diseases. Such screening methods include, but are not limited to, administering candidate drugs (e.g., compounds) to the cell model or animal model to detect those that improve circadian rhythm abnormalities.

[0259] Compositions and formulations

[0260] The expression vectors, expression vector combinations, CRISPR compositions, or inhibitory nucleic acids of the present invention can be administered in the form of a composition. The present invention provides a composition comprising an expression vector, expression vector combination, CRISPR composition, or inhibitory nucleic acid of the present invention and a pharmaceutically acceptable carrier or excipient.

[0261] The expression vector, expression vector combination, CRISPR composition, inhibitory nucleic acid or composition of the present invention can be regarded as a regulator or regulator combination of the present invention that regulates the expression or protein function of ATXN2 and / or ATXN2L.

[0262] The composition can be a liquid or solid, such as a powder, gel or paste. Preferably, the composition is a liquid, preferably an injectable liquid. Suitable excipients will be known to those skilled in the art.

[0263] Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as ), wetting agents (such as sodium lauryl sulfate), colorants, flavorings, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0264] The composition may comprise a physiologically acceptable sterile aqueous or anhydrous solution, dispersion, suspension or emulsion, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

[0265] Expression vector, mRNA, protein, cell or composition according to the present invention can be administered parenterally, for example, intravenously or by infusion technology. Expression vector, mRNA, protein, cell or composition can be used in the form of sterile aqueous solution, and this sterile aqueous solution can contain other substances, for example enough salt or glucose so that solution and blood are isotonic. The aqueous solution can be suitably buffered (preferably pH is 3 to 9). Pharmaceutical composition can be prepared accordingly. Prepare suitable preparaton under aseptic conditions and be easy to complete by standard pharmaceutical technology well known to those skilled in the art.

[0266] The expression vectors, expression vector combinations, inhibitory nucleic acids, CRISPR compositions or compositions of the present invention can be administered systemically, such as by intravenous injection, or can be administered locally, for example, by targeted administration to the hypothalamus. Suitably, the expression vectors, expression vector combinations, inhibitory nucleic acids, CRISPR compositions or compositions can be administered by injection into the ventricles of the brain. In one embodiment, the expression vectors, expression vector combinations, inhibitory nucleic acids, CRISPR compositions or compositions can be administered by injection into the spinal cord or lateral ventricles of the brain. In one embodiment, the expression vectors, expression vector combinations, inhibitory nucleic acids, CRISPR compositions or compositions can be administered by intrathecal injection.

[0267] The expression vectors, expression vector combinations, inhibitory nucleic acids, CRISPR compositions or compositions of the present invention can be administered as a single dose, in other words, subsequent doses may not be required. In cases where repeated doses are required, different viral serotypes can be used in the vector. For example, the vector used in the first dose may include AAV2 or AAV8, while the vector used in subsequent doses may include AAV9. The expression vectors, expression vector combinations, inhibitory nucleic acids, CRISPR compositions or compositions of the present invention can be administered once a day, once every two days, once every three days, once a week, twice a day, three times a day, or more.

[0268] The expression vectors, expression vector combinations, inhibitory nucleic acids, CRISPR compositions, or compositions of the present invention can be administered at different doses (e.g., measured as vector genomes (μg) / kg). In any case, the physician will determine the actual dose that is most suitable for any individual subject, and it will vary with the age, weight, and response of the particular subject. In some embodiments, the expression vector content in the composition is 1×10 11-1×10 14 Viruses / ml, preferably 1×10 12 -1×10 13 Viruses / ml. In some embodiments, the dosage of the inhibitory nucleic acid is from about 0.1 to about 50 mg / kg, from about 0.25 to about 50 mg / kg, from about 0.5 to about 50 mg / kg, from about 0.75 to about 50 mg / kg, from about 1 to about 50 mg / kg, from about 1.5 to about 50 mg / kg, from about 2 to about 50 mg / kg, from about 2.5 to about 50 mg / kg, from about 3 to about 50 mg / kg, from about 3.5 to about 50 mg / kg, from about 4 to about 50 mg / kg, from about 4.5 to about 50 mg / kg, from about 5 to about 50 mg / kg, from about 7.5 to about 50 mg / kg, from about 10 to about 50 mg / kg, from about 15 to about 50 mg / kg, from about 20 to about 50 mg / kg, from about 20 to about 50 mg / kg, from about 25 to about 50 mg / kg. Values ​​and ranges intermediate to these cited values ​​are also intended to form part of the present invention. In some embodiments, the CRISPR composition comprises a Cas enzyme, a gRNA, and a pharmaceutically acceptable carrier and is administered at a dosage of about 0.1 to about 50 mg / kg, about 0.25 to about 50 mg / kg, about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / kg, about 1.5 to about 50 mg / kg, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, about 20 to about 50 mg / kg, about 20 to about 50 mg / kg, about 25 to about 50 mg / kg. Values ​​and ranges intermediate to these recited values ​​are also intended to be part of the present invention.

[0269] Example

[0270] The embodiments of the present invention will be described in detail below with reference to the examples, but those skilled in the art will appreciate that the following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the invention. Where specific conditions are not specified in the examples, the methods were performed according to conventional conditions or the conditions recommended by the manufacturer. Where the manufacturers of the reagents or instruments are not specified, they are all commercially available conventional products.

[0271] The experimental techniques and methods used in this example are conventional unless otherwise specified. For example, in the following examples, where specific conditions are not specified, conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) or the conditions recommended by the manufacturer are generally followed. Materials and reagents used in the examples were obtained through commercial channels unless otherwise specified.

[0272] Experimental methods

[0273] 1. Experimental model

[0274] cell lines

[0275] This study used the human osteosarcoma cell line U2OS, the hypothalamic GnRH cell line GT1-7, the neuroblastoma cell line SH-SY5Y, the human embryonic kidney cell line HEK293T, and the human liver epithelial cell line THLE-2. All human cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM, GIBCO, C11995500CP) supplemented with 10% fetal bovine serum (Mediatech, 35-081-CV) and 1% penicillin and streptomycin (Hyclone, SV30010) and maintained at 37°C in an atmosphere containing 5% CO2.

[0276] CRISPR KO cell lines

[0277] Guide RNAs (gRNAs) targeting the ATXN2 gene (5'-GTATTGGAAATACCCCCAGT-3') and the ATXN2L gene (5'-CCCCGGATCTTAAAGGAGGA-3') were designed using the online software Benchling (https: / / benchling.com / editor). The guide RNA sequences were then cloned into the pX459 vector according to the protocol established in the CRISPR genome engineering toolbox of the Zhang laboratory.

[0278] After transfection, cells were cultured in the presence of 1 μg / mL puromycin for 3 days to select single clones with successful knockout. Single colonies were collected and the knockout cells were verified by Western blotting, immunostaining for the target protein, and sequencing.

[0279] Mouse model

[0280] Atxn2- / - mice (strain number T016843) and Atxn2lflx / flx mice (strain number T052332) were purchased from GemPharmatech (Nanjing, China). Vip-IRES-Cre mice were generously provided by Dr. Zhong Yi's laboratory at Tsinghua University. C57BL / 6J controls of the same age were obtained from the Laboratory Animal Resource Center of Tsinghua University. All animal experiments described in this study were performed in accordance with the guidelines and approved by the Institutional Animal Care and Use Committee and the Animal Welfare and Ethics Committee of Tsinghua University. All mice were housed in a pathogen-free barrier facility. Wild-type, Atxn2 knockout mice (Atxn2+ / - and Atxn2- / -), and Atxn2l tissue-specific Cre-driven knockout mice (Atxn2lflx / + and Atxn2lflx / flx) of the same age were randomly selected for experiments.

[0281] 2. Experimental details

[0282] Protein synthesis analysis was performed using the Click-iT HPG system.

[0283] U2OS cells were synchronized with 200 nM dexamethasone for two hours. The medium was then replaced with dexamethasone-free DMEM. To prepare the Click-iT HPG working solution, the stock solution was diluted 1:1000 in prewarmed L-methionine-free medium to achieve a final HPG concentration of 50 μM. Thirty minutes before the designated time, the medium was replaced with the HPG working solution. After incubation at 37°C for 30 minutes, the cells were washed once with PBS and fixed with 4% formaldehyde. Alexa Fluor 488 azide was then conjugated to HPG via a click reaction. HPG-incorporated proteins were subsequently detected using confocal microscopy.

[0284] Polysome profiling

[0285] Under RNase-free conditions, 10% and 50% sucrose solutions were prepared in a polysome buffer containing 20 mM Tris-HCl pH 7.4, 15 mM MgCl2, and 150 mM NaCl. A BioComp Model 108 Gradient Master was used to prepare 10%-50% sucrose gradients for polysome separation. For cultured U2OS cells, a 15 cm dish was treated with 0.1 mg / mL cycloheximide for 10 minutes. The cells were rinsed twice with 1× PBS containing 0.1 mg / mL cycloheximide, harvested, and resuspended in 20 mM Tris-HCl pH 7.5, 15 mM MgCl2, 150 mM NaCl, 1% Triton X-100, 0.1 mg / mL cycloheximide, 1 mM DTT, 2 U / μL mouse RNase inhibitor, and 1× protease inhibitor. The solution was incubated on ice for 10 minutes and then centrifuged at 12,000 g for 10 minutes at 4° C. The clarified supernatant from the lysed cells was loaded onto a 10-50% sucrose gradient and centrifuged at 36,000 rpm at 4° C. for 120 minutes using a Beckman SW41 rotor.

[0286] For mouse brain and liver tissue, 50 or 20 mg of tissue powder was lysed using polysome lysis buffer, respectively. After incubation on ice for 20 minutes, the resuspended solution was centrifuged at 12,000 g for 10 minutes at 4°C. The supernatant from the lysed tissue was loaded onto a 10-50% sucrose gradient and centrifuged at 36,000 rpm at 4°C for 120 minutes using a Beckman SW41 rotor.

[0287] An ISCO gradient fractionation system (ISCO Model 160 Gradient Former Foxy Jr. Fraction Collector) was used to separate sucrose gradient fractions, and the abundance of ribosomal RNA was observed by monitoring the absorbance at 254 nm.

[0288] Surface induction of translation (SUnSET) assay

[0289] The SUnSET assay measures mRNA translation rates by measuring the extent of puromycin incorporation. In this assay, cells were synchronized with dexamethasone and then replaced with fresh culture medium containing 1 μg / mL puromycin at different time points. After incubation at 37°C for 30 minutes, the cells were washed with ice-cold 1×PBS and lysed with RIPA buffer (50mM Tris pH 7.4, 150mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS). Similarly, in mouse liver tissue, 100 μL of 20mM puromycin in PBS was intraperitoneally injected into 8-week-old mice. After 1 hour, the tissues were collected, quickly frozen in liquid nitrogen, ground with a pestle, and lysed with RIPA buffer. Protein concentration was measured using the BCA protein assay, and protein lysates were analyzed by SDS-PAGE and Western blotting using anti-puromycin antibodies to detect the extent of puromycin incorporation.

[0290] To measure the rate of protein synthesis in the mouse brain, puromycin was stereotaxically injected into the left ventricle of the mouse brain. Mice were anesthetized with isoflurane and immobilized using a stereotaxic frame equipped with a heating blanket to maintain body temperature throughout the procedure. After hair removal and cleaning of the shaved area with iodine and alcohol, a small incision was made to expose the skull surface, and a small hole was drilled into the skull to allow injection of 3 μL of puromycin (10 mg / mL) using a nanoliter syringe. The injection rate was controlled by a pump at 0.2 μL / min. The needle remained in place for 10 minutes and then was slowly withdrawn. One hour after the injection, the mice were perfused with saline followed by 4% paraformaldehyde (PFA), and the brains were immediately removed and fixed in 4% PFA for immunofluorescence analysis. Sagittal brain sections were stained with an anti-puromycin primary antibody overnight at 4°C, followed by incubation with a fluorescently conjugated secondary antibody (Alexa Fluor 594) for 1 hour in the dark at room temperature, and then stained with DAPI. Images were acquired using an Olympus IXplore spinning disk microscope.

[0291] Gene evolution tree construction

[0292] To identify orthologs of the ATXN2 and ATXN2L proteins, the inventors used the National Center for Biotechnology Information (https: / / www.ncbi.nlm.nih.gov / ) and EnSDbl (https: / / asia.enSDbl.org / index.html) websites to search for homologous sequences in several organisms, including Saccharomyces cerevisiae, Drosophila melanogaster, Caenorhabditis elegans, and metazoans. The resulting ATXN2 / ATXN2L homologs (Table S2) were used to construct a phylogenetic tree. Amino acid sequences were aligned using the Clustal W program, and phylogenetic trees were constructed using MEGA-X software, employing the neighbor-joining method with 1,000 bootstrap replicates.

[0293] Ribosome profiling (Ribo-seq) library preparation and sequencing

[0294] For each sample, a 15cm U2OS cell culture dish was treated with 0.1mg / mL cycloheximide at 37°C for 1 minute. The cells were then rinsed once with ice-cold PBS containing 0.1mg / mL cycloheximide, followed by 300 μL lysis buffer (20mM Tris-HCl pH 7.4, 150mM NaCl, 5mM MgCl2, 1% Triton X-100, 1mM DTT, 25U / mL TURBO DNase and 0.1mg / mL cycloheximide). The cell lysate was incubated on ice for 10 minutes, then the supernatant was separated by centrifugation at 20,000rcf for 5 minutes at 4°C. The RNA concentration of the supernatant was determined by measuring the absorbance at 260nm using a spectrophotometer.

[0295] To generate ribosome protection fragments (RPFs), cell lysates were digested with 90 U / A260 / mL (A260 of cell lysate minus A260 of lysis buffer) of RNase I at 4°C for 30 minutes with gentle rotation. The digested cell lysate was then overlaid on a 1M sucrose cushion and ribosomes were precipitated by centrifugation at 70,000 rpm for 2 hours at 4°C in a Beckman 90Ti rotor. The ribosome pellet was then dissolved in 1 mL of TRIzol reagent and the RNA sample was purified according to the manufacturer's instructions. The RNA sample was separated on a 15% (wt / vol) polyacrylamide TBE-urea gel and a gel slice corresponding to 26-34 nt was cut. The RPFs were recovered by adding 0.4 mL of RNA extraction buffer (400 mM ammonium acetate, 0.05% SDS) to the broken gel slices, rotating overnight at room temperature and precipitating with isopropanol.

[0296] Total RNA samples were heat-lyzed at 94°C with T4 polynucleotide kinase buffer (NEB) for 20 minutes. Next, the fragmented total RNA samples and RPFs were subjected to library preparation. Briefly, the RNA samples were end-repaired with T4PNK and ligated with pre-adenylated 3' adapters, followed by cDNA synthesis and purification. The cDNA was then circularized by CircLigase ssDNA ligase, and the libraries were indexed during PCR amplification. These libraries were pooled and sequenced on the HiSeq X Ten platform, generating 150bp paired-end reads. Sequencing was performed by Annou Gene Technology Co., Ltd.

[0297] RNA-seq and Ribo-seq data processing and analysis

[0298] Adapter sequences (5'-CTGTAGGCACCATCAAT-3') were removed from mRNA and Ribo-seq data using Cutadapt, and low-quality reads were discarded using the FastX quality filter (http: / / hannonlab.cshl.edu / fastx_toolkit / ). Quality control was performed using FastQC (http: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ). Contaminating ribosomal RNA was identified by aligning reads to human rRNA sequences using Bowtie, and corresponding reads were removed from subsequent analysis. Reads 25–35 nt in length were retained for ribosome profiling.

[0299] RNA sequencing reads were counted using HTSeq-count in intersection-strict mode, while RPF reads were counted using a custom Python script by Xiao et al. Ribosome footprint and RNA raw counts were normalized using DESeq2 to eliminate bias due to sequencing depth. Normalized RPF counts were further normalized by the sum of mitochondrial RPFs. RPF counts were divided by RNA counts to obtain translation efficiency. Statistical analysis of differentially transcribed genes within each sample pair was performed using the R package Xtail.

[0300] Flow cytometry determination of cell apoptosis

[0301] First, cells were seeded into 35 mm culture dishes and synchronized with 200 nM dexamethasone (DXMS) for two hours. Apoptosis was then assessed by flow cytometry analysis using the Annexin V-FITC Apoptosis Detection Kit (Solarbio, CA1020), using Annexin V-FITC staining and propidium iodide (PI). Synchronized cells were then washed in cold PBS and digested at intervals of eight hours, with each time point repeated twice. After digestion, the cells were centrifuged and resuspended in binding buffer. Cells were stained with FITC-labeled Annexin and analyzed by flow cytometry. For double staining, PI was added 5 minutes before flow cytometry analysis using a CytoFlex LX flow cytometer.

[0302] Cell proliferation assay

[0303] In this experiment, cells of different genotypes (WT, ATXN2 knockout, ATXN2L knockout, and ATXN2 / 2L double knockout) were seeded into 48-well plates at a starting density of 12,000 cells per well. Twelve hours after seeding, cells were treated with 200 nM DXMS for two hours to synchronize the cells. The medium was then replaced with fresh medium without DXMS, and real-time cell proliferation was monitored using the IncuCyte Live Cell Analysis System (ESSEN Bioscience).

[0304] Cell proliferation was measured by quantifying the cell confluence of cell images over time. Proliferation curves were generated by calculating the fold change (FC) of cell confluence at different time points compared to the confluence at time 0. This experiment aimed to compare the cell proliferation capacity of cells of different genotypes under these conditions.

[0305] Cell cycle analysis using flow cytometry

[0306] U2OS cells were synchronized with DXMS and then stained with Hoechst 33342 to monitor their cell cycle progression over a 24-hour period. Staining was performed by adding 1 μg / mL Hoechst 33342 to the cells and incubating for 30 minutes. The cells were then washed three times with PBS and harvested at 8-hour intervals for 24 hours, with two replicates per time point. The cells were harvested and the supernatant removed by centrifugation at 1000 rpm for 5 minutes. The cell pellet was resuspended in cold PBS and subjected to cell cycle analysis using a 405 nm UV laser and a CytoFlex LX flow cytometer.

[0307] Real-time quantitative PCR

[0308] Total RNA was extracted from cultured cells or dissected tissues using TRIzol (Invitrogen Ambion, Shanghai) according to the manufacturer's protocol. Reverse transcription was performed using III 1st Strand cDNA Synthesis SuperMix for qPCR (YEASEN). Gene-specific primers (Table S1) and SYBR green supermix were used in a Bio-Rad CFX96 or Roche Quantitative reverse transcription-PCR (qRT-PCR) was performed on a 480°C thermal cycler. Quantitative analysis was performed using the ΔΔCT method, with actin as an internal control.

[0309] For AAV titration, viral particles were cleaved with proteinase K, and a portion of the WPRE element was amplified using WPRE-F and WPRE-R primers. A pAAV plasmid containing the Cre sequence was used as a standard stock.

[0310] Immunofluorescence (IF)

[0311] Cells grown on glass-bottom confocal culture dishes were fixed with 4% paraformaldehyde solution for 15 minutes, permeabilized with 0.5% Triton X-100 in phosphate-buffered saline (PBS) for 15 minutes, and blocked with 10% normal goat serum for 30 minutes at room temperature.

[0312] To stain mouse tissue sections, the animals were deeply anesthetized with Avertin and then perfused intracardially with ice-cold 0.01M PBS, followed by 4% PFA in PBS (pH 7.4). The brain and liver were dissected and fixed overnight in 4% PFA at 4°C. The tissues were rinsed with PBS and then transferred to PBS containing 30% sucrose for 24 hours. Afterwards, they were frozen on dry ice and embedded in OCT. Coronal sections of the brain (14 μm) or liver (7 μm) were cut at -20°C using a cryostat (Leica, CM3050S). Tissue sections were permeabilized with 0.5% Triton X-100 in PBS for 30 minutes at room temperature and blocked with 10% normal goat serum for 1 hour at room temperature.

[0313] Cells and tissue sections were stained with primary antibodies against ATXN2 (Proteintech, 21776-1-AP) or ATXN2L (Proteintech, 24822-1-AP) overnight at 4°C. The corresponding fluorescently conjugated secondary antibodies (Alexa Fluor 488 / 594, Thermo Fisher Scientific, goat anti-rabit) were then incubated for 1 hour at room temperature in the dark. Cells and tissues were then stained with DAPI. Images were acquired using a Nikon AX confocal microscope and an Olympus IXplore spinning disk microscope.

[0314] Immunogold electron microscopy analysis

[0315] White adipose tissue (WAT) and liver were fixed in 0.1 M Sorensen phosphate buffer (pH = 7.2) containing 3% formaldehyde and 0.2 M sucrose. Tissue samples were sectioned and processed by the University of Michigan Microscopy Core. Ultrathin sections (80 nm) were cut, placed on bare nickel grids, and stored at 4°C. For immunogold labeling, grids were quenched in 80 mM glycine and incubated in blocking solution (EMS25599) containing 0.2% Tween-20 at room temperature for 1 hour. Next, the grids were incubated with primary antibodies overnight in a humidified chamber at 4°C. The grids were then incubated with 18 nm colloidal gold antibody (1:25 v / v, Jackson ImmunoResearch 711-215-152) at room temperature for 1 hour, followed by post-fixation in 1% glutaraldehyde and counterstaining using 0.5% uranyl acetate. After carbon evaporation, the grids were imaged using a JEOL electron microscope at the University of Michigan Microscopy Core.

[0316] Protein conservation analysis

[0317] ATXN2 and ATXN2L homologous protein sequences from 200 species were retrieved from EnSDbl (https: / / www.enSDbl.org / , version 107, August 16, 2022). Multiple sequence alignments (MSA) were performed using Clustal Omega (https: / / www.ebi.ac.uk / Tools / msa / clustalo / ) with default settings. Protein site conservation scores were calculated using ConSurf with a Bayesian model and default settings.

[0318] Protein expression and purification

[0319] The coding sequences of ATXN2 LCD (amino acids 1125-1312), ATXN2L LCD (amino acids 875-1075), FUS LCD (amino acids 1-214), and YTHDC1 LCD (amino acids 494-727) were amplified from human cDNA and cloned into the pHis empty vector with an N-terminal 6×His tag. All ATXN2 LCD mutations were introduced by site-directed mutagenesis. Recombinant proteins were expressed using BL21-(DE3)-RIPL E. coli cells. Briefly, BL21(DE3) cells were transformed with the corresponding plasmids and plated on LB agar with ampicillin selection at 37°C. A single colony was inoculated into a 5 mL LB culture and grown overnight in a shaker at 37°C at 220 rpm. The culture was added to 1 L LB medium and grown at 37°C until the OD600 reached 0.6. Cells were induced with 0.5 mM IPTG at 220 rpm for 4 hours at 37 ° C and then collected by centrifugation at 4,000 rpm for 25 minutes at 4 ° C. The pellet was resuspended in denaturing lysis buffer (20 mM Tris-HCl pH 7.4, 200 mM NaCl, 6 M guanidine hydrochloride, 0.1 mM PMSF, 20 mM β-mercaptoethanol and protease inhibitor cocktail) and then sonicated with a cell ultrasonic disruptor for 20 minutes (10 seconds on / 10 seconds off, 180 W). After centrifugation at 20,000 g for 40 minutes, the supernatant was collected and loaded onto Ni-NTA resin and incubated for 30 minutes at 4 ° C. Ni-NTA resin was washed with wash buffer (20mM Tris-HCl pH 7.4, 200mM NaCl, 6M guanidine hydrochloride, 0.1mM PMSF, 20mM β-mercaptoethanol and 20mM imidazole) and eluted with elution buffer (200mM NaCl, 20mM Tris-HCl pH 7.4, 6M guanidine hydrochloride, 0.1mM PMSF, 20mM β-mercaptoethanol and 300mM imidazole). Purified protein was further concentrated to 2-4mM using Amicon filters (Millipore). All protein purities were confirmed by SDS-PAGE.

[0320] To label the purified protein with a fluorescent dye, 200 ng / mL Alexa Fluor 488 / 568-C5-maleimide (Thermo Fisher Scientific) was added, and the mixture was incubated on ice in the dark for 1 hour. Free dye was removed using a spin desalting column (Cytiva). After equilibration, the protein sample was loaded onto the desalting column and centrifuged at 2,000 g for 1 minute at 4°C. The protein flow-through was collected for future use.

[0321] In vitro phase separation assay

[0322] Phase separation assays were performed using glass-bottom 384-well plates. Purified proteins were diluted into dilution buffer containing 50-1000 mM NaCl and 20 mM Tris-HCl pH 7.4 to achieve a final protein concentration (2.5-120 μM for ATXN2 LCD, 10-80 μM for ATXN2L LCD, 60 μM for FUS LCD, and 65 μM for YTHDC1). The resulting phase-separated droplets were added to a 384-well plate and allowed to stand at room temperature for 30 minutes. Images of the condensates were captured using an Olympus IXplore spinning disk microscope.

[0323] Measuring fluorescence recovery after photobleaching (FRAP)

[0324] To assess the fluidity of phase-separated droplets formed by ATXN2 and ATXN2L LCDs, the inventors performed FRAP using a Nikon A1HD25 confocal microscope. Protein aggregates were bleached with 561 nm or 488 nm laser pulses, and fluorescence recovery intensity was recorded for 500 s at 5-second intervals for ATXN2 LCDs and for 360 s at 10-second intervals for ATXN2L LCDs. Fluorescence intensity in the bleached areas was analyzed using NIS-Elements AR 5.4 software, and recovery curves showing the change in fluorescence intensity over time were plotted using GraphPad Prism. Six replicates were performed, and data are presented as mean ± standard deviation (SD).

[0325] Immunoblotting

[0326] Cells were lysed on ice with RIPA buffer for half an hour, followed by centrifugation at 12,000 rpm for 5 minutes at 4°C for supernatant separation. Mouse tissues were first frozen in liquid nitrogen and then homogenized into a fine powder. Lysates were obtained by sonicating the tissues at 90W for 10 seconds in RIPA buffer, followed by centrifugation. 10 or 20 μg of protein samples were separated by SDS-PAGE on 8% or 12% polyacrylamide gels and transferred to PVDF membranes. The membranes were incubated with specific primary antibodies overnight at 4°C. The blots were then incubated with peroxidase-conjugated secondary antibodies (Thermo Fisher Scientific) at room temperature for 1 hour. The membranes were washed three times with TBS-T (10 mM Tris-HCl pH 7.4, 0.15 M NaCl, 0.05% Tween-20) for 5 minutes each, and protein bands were visualized by chemiluminescence using a Tanon 4800 Multi imaging system. The grayscale values ​​of the bands were quantified using ImageJ software.

[0327] Freeze-grinding immunoprecipitation

[0328] U2OS cells were synchronized with 200 nM DXMS for two hours and then collected and cryopreserved at four-hour intervals over a 24-hour period (repeated three times per time point). The frozen cells were then ground into a fine powder and resuspended in 2 volumes of lysis buffer consisting of 20 mM HEPES / KOH pH 7.4, 150 mM NaCl, 0.1% (w / v) NP-40, 0.1% (w / v) Tween-20, 1 mM DTT, 2% (v / v) glycerol, and 1 / 100 (v / v) protease inhibitor cocktail (Sigma Aldrich). The cell lysate was briefly sonicated and centrifuged at 20,000 g for 10 minutes. Magnetic protein A / G beads coupled to the ATXN2 antibody were added to the cell lysate at a concentration of 400 μg beads per 0.1 gram of frozen cell powder and incubated at 4° C. for 5 minutes. The beads were washed three times with 1 mL of lysis buffer. Protein was eluted using 0.2 M glycine (pH 2.0). Prior to mass spectrometry (LC-MS / MS) analysis, samples were added to 6× protein loading buffer and incubated at 95° C. for 20 minutes.

[0329] Mass spectrometry data acquisition and analysis

[0330] Proteins co-immunoprecipitated with ATXN2 were separated on 1D-SDS PAGE. The corresponding gel lanes were excised, reduced with 10 mM TCEP, and alkylated with 40 mM chloroacetamide. In-gel digestion was performed overnight at 37°C using sequence-grade modified trypsin (Promega) in 50 mM ammonium bicarbonate. The resulting peptides were extracted twice with 50% acetonitrile in water containing 1% trifluoroacetic acid for 30 minutes each. The extracts were then centrifuged in a speedVac to reduce the volume.

[0331] The UltiMate™ 3000 RSLCnano system was directly connected to a Q Exactive HF-X mass spectrometer for LC-MS / MS analysis. The peptides were loaded onto a trapping column (75 μm × 20 mm, 3 μm C18, 1 μm HCl) with a maximum pressure of 620 bar using mobile phase A (H2O containing 0.1% formic acid). The samples were separated on an analytical column (100 μm ID, packed in-house with ReproSil-Pur C18-AQ 1.9 μm resin from Dr. Maisch GmbH) using a gradient of 4-70% mobile phase B (80% acetonitrile and 0.08% formic acid) at a flow rate of 250 nL / min over 120 minutes. MS analysis was performed in data-dependent acquisition (DDA) mode with a single full scan (300-1800 m / z, resolution = 60,000, 200 m / z), automatic gain control (AGC) of 3e6, and a maximum injection time (IT) of 20 milliseconds. This was followed by the first 40 MS / MS scans with high-energy collisional dissociation (AGC of 2e5, maximum IT of 100 ms, isolation window of 0.4 m / z, normalized collision energy of 32%, resolution = 45,000, 200 m / z).

[0332] For proteomics data analysis, the MS / MS data were searched against the Uniprot mouse database using the SEQUEST search engine in Proteome Discoverer 2.3 software. The search criteria required full trypsin specificity, allowed two missed cleavages, and set aminomethylation (C) as a fixed modification. Oxidation (M) and acetylation (protein N-terminus) were set as variable modifications. For all MS acquired in the Orbitrap mass analyzer, the precursor ion mass tolerance was set to 10 ppm, and for all MS2 spectra acquired, the fragment ion mass tolerance was set to 20 mmu. The false discovery rate for peptides was set to 0.01 and was determined by searching the reverse database. Relative protein quantification was calculated as the median of all possible pairwise peptide ratios.

[0333] Bioinformatics and statistical analysis of proteomics data

[0334] For proteomic analysis of wild-type U2OS cells based on protein expression patterns over a 24-hour period, the inventors used a fuzzy c-means clustering algorithm and identified seven distinct groups of genes. The center of each group is indicated by a blue line in the figure, while the y-axis represents normalized protein abundance. The inventors performed fuzzy clustering analysis on the proteomic data using the R package Mfuzz and removed genes with missing values ​​at six time points before clustering. The abundance values ​​of the remaining genes were Z-score transformed before fuzzy c-means clustering.

[0335] The inventors used the R package RAIN to detect rhythmic proteins with a 24-hour period, a period increment of 4, and a p-value cutoff of <0.05. The RAIN algorithm, an improved version of JTK-Cycle, provides superior sensitivity in rhythmicity analysis by detecting both symmetric and asymmetric rhythms. Rhythmic proteins were classified by the phase predicted by RAIN, and the frequency distribution of cycle candidates at different phases was visualized using rose plots generated using ggplot2 (https: / / rdocumentation.org / packages / ggplot2 / versions / 3.3.6).

[0336] The inventors used Metascape (https: / / metascape.org / gp / index.html# / main) to perform Gene Ontology (GO) analysis using all ATXN2-associated proteins and rhythmic proteins with peak values ​​at different time points (p value ≤ 0.05). Translation-related proteins, translation initiation factors, and ribosomal components were classified, and the temporal abundance curves of each protein at different time points were visualized as heat maps using TB Tools. GO classifications at different time points were visualized in bubble plots using ggplot2. In addition, the inventors used STRING (https: / / cn.string-db.org / ) and Cytoscape to cluster ATXN2 immune proteins at a peak value at 16 hours.

[0337] Cell aggregate analysis

[0338] To determine whether ATXN2 forms cellular aggregates in representative images from different cell lines, stained images were reconstructed using MATLAB. Specifically, the imread() function was used to read the image and generate a three-dimensional variable, where the first two dimensions represent the image size and the last dimension records the grayscale intensity of the color channel associated with the protein. The grayscale values ​​of the image were then read using the rgb2gray() function. To standardize the image parameters, the image was converted to two dimensions and the dimensions were set to 300x300, corresponding to the length and width of the inventor's image. The meshgrid() function was used to convert and visualize the two-dimensional array variable into three dimensions. Finally, the mesh() function overlaid the 3D results from the previous step with the 2D image for analysis.

[0339] Purification of human 80S ribosomal subunit

[0340] HEK 293T cells were cultured at 37°C and 5% CO₂ and treated with 0.1 mg / mL cycloheximide for 10 minutes. The cells were then washed twice with 0.1 mg / mL cycloheximide in 1× PBS. The cells were then resuspended in lysis buffer consisting of 20 mM Tris-HCl (pH 7.4), 15 mM MgCl₂, 50 mM KCl, 0.5 mM EDTA, 1% Triton X-100, 0.1 mg / mL cycloheximide, 2 mM DTT, 2 U / μL mouse RNase inhibitor, and 1× protease inhibitor. The samples were incubated on ice for 10 minutes and then centrifuged at 12,000 g for 10 minutes at 4°C. The supernatant was loaded onto a 9 mL sucrose cushion (20 mM Tris pH 7.5, 15 mM MgCl2, 50 mM KCl, 0.5 mM EDTA, 34% sucrose, 2 mM DTT, and 2 U / μL mouse RNase inhibitor) in a 16 mm x 76 mm polycarbonate ultracentrifuge tube. The crude ribosomes were pelleted by centrifugation at 70,000 rpm for 2 hours using a Beckman 90Ti rotor. The resulting pellet was slowly homogenized in lysis buffer at 4°C. The crude ribosomal subunits were further purified using a 10-40% sucrose gradient prepared using a BioComp Gradient Master in ribosomal fraction buffer (sucrose diluted in a buffer prepared under RNase-free conditions containing 15 mM Tris-HCl pH 7.4, 15 mM MgCl2, and 300 mM NaCl). The crude subunits were loaded onto the gradient and centrifuged at 36,000 rpm (Beckman SW41Ti rotor) for 2 hours at 4°C. Fractions were collected from top to bottom using a BioComp piston gradient fractionator. Sample absorbance was recorded using a UV reader, and the fractions corresponding to 80S were collected and used for the third purification. A solution with a final concentration of 10.5% PEG 20,000 was slowly added to the 80S fraction, followed by incubation on ice for 10 minutes and centrifugation at 10,000 rpm and 4°C for 10 minutes. Finally, the purified 80S ribosome was resuspended in 200 μL of buffer containing 150 mM NaCl, 20 mM Tris-HCl pH 7.4 and 1× protease inhibitors to a final concentration of 5 mg / mL.

[0341] Phase separation in vitro recruitment assay

[0342] The purified 80S ribosome solution was added to a phase separation buffer containing 25 mM Tris-HCl, pH 7.5, and 150 mM NaCl to a final concentration of 0.5 mg / mL. Purified proteins, including ATXN2 LCD, ATXN2L LCD, FUS LCD, and YTHDC1 LCD, were then diluted 1:50 into this 80S-containing buffer, resulting in a final concentration of 40 μM for ATXN2 LCD, ATXN2L LCD, and FUS LCD, and 20 μM for YTHDC1 LCD. The resulting condensates were then allowed to settle in a 384-well plate at room temperature for 30 minutes, and images of the condensates were captured using an Olympus IXplore spinning disk microscope.

[0343] To test RNA recruitment, DNA sequences of the PER2 5'UTR and 3'UTR, FAM199X 3'UTR, BMAL1 3'UTR, CLOCK 3'UTR, PER1 3'UTR, CRY1 3'UTR, CRY2 3'UTR, WFS1 3'UTR, and RRBP1 3'UTR (listed in Table S4) were amplified by PCR from cDNA extracted from HEK293T cells using a 5' primer containing the T7 RNA polymerase promoter sequence (5'-TAATACGACTCACTATAGGG-3'). Target RNA fragments were obtained using an in vitro transcription kit (Thermo Fisher Scientific). Subsequently, Turbo DNase was added to eliminate the DNA template, and the RNA was then labeled with red fluorescence using propidium iodide. RNA was then mixed with propidium iodide at a ratio of 1:5 and diluted to a concentration of 250 ng / μL using phase separation dilution buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl). Phase-separated protein was added to the system to a final protein concentration of 50 μM. The protein-RNA mixture was incubated at room temperature for 30 minutes, and images of the condensate were captured using an Olympus IXplore spinning disk microscope.

[0344] RNA fluorescence in situ hybridization

[0345] All reagents used for RNA fluorescence in situ hybridization were from RNAscope. TMMultiplex Fluorescent V2 Assay (ACD). Mouse brain sections were treated with hydrogen peroxide for 10 minutes at room temperature. The slides were then target retrieved using RNAscope 1X Target Retrieval Reagent at 99°C for 15 minutes. After treatment with RNAscope Protease III for 10 minutes, the brain tissue was placed in a HybEZ oven and hybridized with the Mouse-Per2 probe at 40°C for 2 hours. The slides were washed twice with preheated wash buffer (ACD). Subsequently, the probe signal was amplified using AMP solution and labeled with the fluorophore Opal 690. After multiple washes, immunofluorescence staining was performed.

[0346] Single-molecule fluorescence in situ hybridization combined with immunocytochemistry

[0347] Hypothalamic GbRH GT1-7 cells were cultured on coverslips in 24-well plates and fixed with 4% PFA for 15 minutes at room temperature. Cells were then stored in 1× PBS containing 0.5% bovine serum albumin (BSA). For hybridization chain reaction (HCR) assays, public codes were used to design Per2 probes targeting mRNA sequences. The probe sequences were synthesized by Sangon Biotechnology Co., Ltd., China.

[0348] For HCR, cells were first permeabilized in 70% ethanol at 4°C for 16 h and then treated with 0.5% Triton X-100 in 1× PBS for 30 min at 37°C. Cells were then washed with 1× PBS at room temperature and prehybridized in 30% probe hybridization buffer at 37°C for 15 min, followed by incubation in 30% probe hybridization buffer containing the Per2 probe at 37°C for 3 h. After mRNA hybridization, wash and amplification steps were performed as described previously.

[0349] For immunocytochemistry, HCR-labeled sections were further stained. HCR-labeled sections were first blocked with 10% donkey serum in 1× PBS for 1 hour and then incubated with an ATXN2 antibody diluted in 1× PBS containing 1% donkey serum, 1% BSA, and 0.1% Triton X-100 at 4°C for 12 hours. The cells were then washed three times with 1× PBS and stained with a secondary antibody for 2 hours at room temperature. Finally, the stained cells were mounted on slides for further imaging using an Olympus IXplore spinning disk microscope.

[0350] In vitro translation assay

[0351] use In vitro translation assays were performed using Quick Coupled Transcription / Translation Systems (Promega). To create the plasmids T7-luciferase-PER2-3'UTR, T7-luciferase-CRY1-3'UTR, T7-luciferase-WFS1-3'UTR, and T7-luciferase-RRBP1-3'UTR, the corresponding 3'UTRs were inserted downstream of the luciferase sequence with a T7 promoter modified based on the luciferase T7 control DNA included in the kit. Quick Master Mix, 1 mM methionine, and plasmid DNA templates (T7-luciferase, T7-luciferase-PER2-3'UTR, T7-luciferase-CRY1-3'UTR, T7-luciferase-WFS1-3'UTR, and T7-luciferase-RRBP1-3'UTR) were mixed under RNase-free conditions. To investigate the effect of ATXN2 phase separation on translation, 2 μL of ATXN2 phase separation condensate or an equal amount of all M-to-S mutant proteins (60 μM) were added. The reaction was incubated at 30°C for 1 hour, and luciferase activity was measured using a luciferase reporter gene assay kit (YEASEN).

[0352] SunTag fluorescence imaging

[0353] SunTag-related plasmids, including pcDNA4TO-24×GCN4-v4-24×PP7 and pHR-scFv-GCN4-sfGFP-GB1, were kindly provided by Dr. Weirui Ma from Zhejiang University. The coding sequence and 3' untranslated region (UTR) of PER2 mRNA were inserted into the pcDNA4TO-24×GCN4-v4-24×PP7 backbone to generate the pcDNA4TO-24×GCN4-PER2_3UTR-24×PP7 plasmid. The ATXN2 coding sequence was also cloned into the pLVX vector, and the mCherry tag was fused to its N-terminus, generating the pLVX-mCherry-ATXN2 plasmid. To visualize the colocalization of ATXN2 condensates and PER2 nascent peptides in live cells, U2OS cells were transfected with pLVX-mCherry-ATXN2, pcDNA4TO-24×GCN4-PER2_3UTR-24×PP7, and PHR-scFv-GCN4-sfGFP-GB1 for 12 hours. For visualization of PER2 translation, cells were subsequently treated with 1 μg / mL doxycycline for 6 hours. To confirm that the observed GFP signal corresponded to translation events, 100 μg / mL of the translation inhibitor puromycin was added to the culture medium during continuous live cell imaging. Images were acquired using an Olympus IXplore spinning disk microscope.

[0354] Bioluminescence recording

[0355] The U2OS PER2:LUC cell line was kindly provided by Dr. Erquan Zhang at the Beijing Institutes for Biological Sciences. To generate ATXN2 knockout, ATXN2L knockout, and ATXN2 / 2L double knockout cells, the pX459 plasmid harboring the ATXN2 / 2L knockout single guide RNA (sgRNA) was transfected into U2OS PER2:LUC cells. Recombinant DNAs pLVX-EGFP-ATXN2-FL and pLVX-EGFP-ATXN2-LCD3 were then transfected into the ATXN2 / 2L double knockout cells for complementation experiments. Cells were grown in 35 mm culture dishes and synchronized with 200 nM DXMS. The culture medium was replaced with recording medium containing 100 mM luciferin for bioluminescence recording. Data were collected in a LumiCycle luminometer at 36°C for 3–4 days. Data (excluding the first 24-hour cycle) were analyzed using LumiCycle analysis software as described previously.

[0356] Lentiviral production

[0357] HEK293T cells were used to produce lentiviral particles according to established protocols using second-generation packaging plasmids (pMD2.G and psPAX2). The lentiviral backbone and packaging plasmids (pLVX-EGFP-ATXN2-WT and pLVX-EGFP-ATXN2-ΔLCD3) were transfected into HEK293T cells, and the lentivirus-containing medium was harvested 24 hours later. The viral supernatant was collected and filtered through a 0.45 μm filter to remove cellular debris. Lentivirus was added to ATXN2 / 2L double knockout cells 2 days after inoculation. GFP-positive cells were then selected using flow cytometry.

[0358] Adeno-associated virus (AAV) packaging and stereotactic surgery

[0359] The pAAV plasmid containing the rAAV genome was packaged into AAV8 capsids by triple transient transfection with polyethylenimine. Viruses were harvested 6 days after transfection and purified by iodixanol density gradient. AAV particles were then concentrated in Amicon filter devices and titrated by real-time PCR.

[0360] For stereotaxic surgery, animals were anesthetized with isoflurane and placed in a stereotaxic apparatus. Depending on the experimental paradigm, 300 nL of AAV8-mCherry-IRES-Cre virus (~1×1012 vg / mL) was injected into the SCN at specific anatomical coordinates (ML: ±0.25 mm, AP: -0.40 mm, DV: 5.75 mm). Injections were performed using a glass cannula and a microinjection pump, entering each hemisphere sequentially at a flow rate of 100 nL / min. The glass cannula was left in place for 10 minutes and completely withdrawn 10 minutes after viral delivery. Animals were tested at least two weeks after viral injection to ensure optimal transgene expression. Correct viral expression in the SCN was confirmed afterwards using histology.

[0361] Behavioral analysis of locomotor activity rhythms in mice

[0362] To monitor circadian rhythms in locomotor activity, mice aged 8 to 12 weeks were individually housed in cages equipped with wheels placed in a light-tight box. At least seven days before the start of the experiment, mice were acclimated to a 12-hour light / 12-hour dark photoperiod (LD 12:12), with lights on at 7 a.m. (ZT0) and off at 7 p.m. (ZT12). Food and water were provided ad libitum. Behavioral rhythms were recorded for at least 7 days in LD and for at least 14 days in continuous darkness (DD). Actograms, χ2 periodograms, and fast Fourier transform (FFT) power spectrum analyses were performed using ClockLab software (Actimetrics, Wilmette, IL). χ2 periodograms were performed with 1-minute resolution over a 5-36 h period range in LD or DD. FFTs were performed in DD as power spectra normalized over a 0 to 48 h / period range. The effects of genotype on period length and amplitude in FFTs were analyzed using unpaired t-tests.

[0363] Open field test

[0364] The animal behavior in the open field was recorded using the automated system EthoVision XT14 (Noldus; TSE Multi-Conditioning System, TSE Systems). The open field experimental apparatus is a box with dimensions of 50 cm x 50 cm x 50 cm, with a light intensity of 300 lux applied to the central area. The central area is defined as a 15 cm x 15 cm square in the center of the box, while the rest of the box is defined as the peripheral area. The mice are introduced into the corner of the open field box and allowed to explore for 10 minutes. Between each experiment, the open field test apparatus is cleaned with 70% alcohol to remove odors. EthoVision XT14 software is used to measure the parameters, the total distance traveled and the time spent in the central area of ​​the open field in the last 5 minutes of each experiment.

[0365] Quantitative and statistical analysis methods

[0366] Unless otherwise noted, these figures were generated using GraphPad Prism software. The R packages used in the analyses and the statistical tests employed are described in their respective methods sections. Unless otherwise noted, all statistical tests were performed using GraphPad Prism software. Unpaired t-tests were used to compare two groups.

[0367] To quantify the results of western blot analysis, ImageJ software was used. Normalized intensity, represented as a bar graph, was calculated by comparing the grayscale intensity of the protein of interest to that of tubulin.

[0368] Example 1. Protein synthesis oscillates with circadian rhythm and is regulated by ATXN2 and ATXN2L

[0369] The inventors first focused on the rhythm of protein translation. Rhythmic protein synthesis was analyzed using the human bone osteosarcoma epithelial cell line U2OS, which is widely used in circadian rhythm research. To this end, the inventors treated U2OS cells with dexamethasone (DXMS), a powerful circadian rhythm inducer that resets and synchronizes the clock in cultured cells, and labeled newly synthesized proteins with the non-classical methionine analog homopropargylglycine (HPG), which was visualized by azide-containing fluorescent dyes through a copper-catalyzed cycloaddition (CLICK) reaction. The inventors found that wild-type U2OS cells exhibited a clear circadian rhythm of translation activation within 48 hours (Figures 1A and 1B), which began to increase 4 hours or 28 hours after the onset of the circadian rhythm (CT4 or CT28), peaked at CT12-16 (and correspondingly CT36-40), and then declined rapidly. This translational oscillation is common in different cell types, as we observed similar phenomena in the liver cell line THLE-2 and the neuroblastoma cell line SH-SY5Y ( Figures 7A and 8B ).

[0370] Next, the inventors performed a polyribosome fractionation analysis as an alternative method to assess global translation activity at different time points in the circadian cycle. Specifically, the ratio of the area under the curve of heavy polyribosomes (5+ ribosomes) and light polyribosomes (2-4 ribosomes) was defined as the "translation index" (Figure 7C). The analysis showed that the translation index of wild-type U2OS cells was low at CT4, peaked around CT12-CT16, and then declined at CT20-24. Similar oscillation patterns were also observed in the second circadian cycle (Figures 1C, 1D). This is consistent with the results shown in Figures 1A and 1B. In addition, the inventors used surface translation sensing (SUnSET) technology to measure protein synthesis and detect rhythmic protein synthesis in the corresponding cell lines (Figure 7D).

[0371] Protein synthesis oscillations at the tissue level in mice have been reported. Consistent with previous results, the inventors observed similar oscillatory patterns in brain and liver tissues (Figures 1E-1F, 8E-8F), with higher translation indices observed at ZT12. After puromycin was injected into the lateral ventricle (Lv), the inventors observed rhythmic translation activation in the brain (Figure 7G). To assess the level of newly synthesized proteins in the liver, the inventors injected puromycin intraperitoneally into mice and then performed Western blot analysis on whole liver tissue lysates (Figure 1G). In summary, these results indicate that translation oscillations occurred in both tissues.

[0372] The inventors next set out to identify potential regulators of this rhythmic translation. To this end, the inventors performed proteomic analysis on U2OS cells at six circadian time points. Using the fuzzy c-means clustering method, proteins were clustered into seven different groups based on their temporal expression patterns (Figures 1H, 8H). These seven groups represent different patterns of protein abundance changes with circadian rhythms. Interestingly, the proteins in group 3 (522 in total) showed characteristics that were highly consistent with the translation activation pattern of the biological clock (Figures 1A-D and 1H).

[0373] Assuming that oscillating RNA-binding proteins (RBPs) are involved in the rhythmic activation of protein translation, the inventors next calculated the fold change for all Group 3 proteins by comparing their peak levels at CT16 with their baseline levels at CT4 (Figure 1I). Interestingly, two RBPs ranked among the top 10 proteins showed the largest increase from CT4 to CT16. One of these RBPs was ATXN2, which ranked second in the inventors' analysis (Figure 1I). The other RBP was DHX40, which is known to be primarily localized in the nucleus.

[0374] To better understand the role of ATXN2 in rhythmic translation oscillations, the inventors constructed an ATXN2 knockout U2OS cell line to explore the potential function of ATXN2 in circadian rhythm regulation. As shown in Figures 1J and 8I, knockout of ATXN2 in U2OS cells resulted in a certain degree of reduction in the heavy polysome fraction at CT12, indicating a slight decrease in the overall translation rate. The inventors performed bioinformatics analysis of ATXN2 and identified a paralog named ATXN2-like (ATXN2L), which has high domain similarity and sequence identity with ATXN2 (Figure 7J). From an evolutionary perspective, the phylogenetic tree of ATXN2 and ATXN2L orthologs showed that ATXN2 and ATXN2L are rooted in a common ancestor, namely pbp1 in yeast and atx-2 in insects (Figure 7K).

[0375] Similar to ATXN2 knockout, ATXN2L knockout resulted in a modest decrease in the translation index of CT12. Furthermore, in ATXN2 / 2L double knockout cells, the translation index was significantly lower than that of WT, ATXN2 knockout, or ATXN2L single knockout cells on CT12 (Figure 7I).

[0376] As shown by the changes in heavy polysomes at different circadian time points, the rhythm of translation activation was almost completely disrupted after ATXN2 and ATXN2L knockout (Figures 1D and 1K). HPG labeling analysis also confirmed that in the inventors' double gene knockout cells, the rhythm of translation activation was lost during the two circadian cycles measured (Figures 1L and 1M). Interestingly, compared with the early phase shift of ATXN2 knockout cells, ATXN2L knockout cells showed a delayed phase shift, indicating the potential role of these two proteins in regulating the circadian phase. In summary, these results clearly show that ATXN2 / 2L together regulate oscillatory translation activation along the circadian rhythm

[0377] The above experiments show that knocking out or downregulating ATXN2 can accelerate the circadian rhythm, knocking out or downregulating ATXN2L can delay the circadian rhythm, and knocking out or downregulating both ATXN2 and ATXN2L can weaken the circadian rhythm.

[0378] Example 2. ATXN2 / 2L condensates oscillate synchronously with circadian rhythms

[0379] To investigate the underlying mechanism of this rhythmic translation, the inventors next examined the expression and distribution of Atxn2 and Atxn2l at different time points by immunostaining of mouse tissues. The inventors found that Atxn2 and Atxn2l were significantly enriched in the SCN (Figure 8A). Interestingly, these two proteins appeared to form perinuclear condensates in the SCN (Figure 3A). The inventors observed similar condensates in other brain regions (such as the cortex, hippocampus, and cerebellum) (Figure 8B). Since many peripheral tissues also exhibit circadian rhythms, the inventors next examined the expression of Atxn2 and 2l in peripheral organs. Transmission electron microscopy (TEM) analysis of white adipose tissue (WAT) and liver showed that Atxn2 and Atxn2l formed cytoplasmic condensates, consistent with the results observed using fluorescence microscopy (Figures 2B-3C).

[0380] Together, these findings indicate that ATXN2 / 2L are not only expressed in a wide range of tissues, but also that these proteins form condensates at specific intracellular locations, suggesting that phase separation is involved in their regulation. To test this hypothesis, the inventors set out to determine the drivers of phase separation between ATXN2 and 2L by performing in vitro phase separation experiments. Both ATXN2 and ATXN2L contain multiple domains with distinct characteristics, including LSm (like-Sm) and LSm-related domains for RNA binding, a PABP-related motif (PAM2), and a long low-complexity domain (LCD) at the C-terminus. The LCDs of these two proteins are conserved among orthologs from more than 200 species (Figures 8C and 10D).

[0381] As expected, the ATXN2 LCD (1125-1312) and ATXN2L LCD (875-1075) proteins phase separated in vitro in a protein concentration- and salt concentration-dependent manner (Figures 2D-3E, 10E-10F). The inventors then used fluorescence recovery after photobleaching (FRAP) to define the liquid properties of the ATXN2 and ATXN2L LCD droplets. As shown in Figure 2F, fluorescence recovered within a few minutes after photobleaching, indicating that the C-terminal LCD of ATXN2 / 2L can undergo liquid-liquid phase separation.

[0382] To assess the subcellular localization of ATXN2 / 2L in more detail, the inventors examined their presence in several cultured human cell lines, including the hypothalamic GnRH cell line GT1-7. The inventors detected significant ATXN2 / 2L condensates by immunofluorescence in U2OS, THLE-2, GT1-7, and HeLa (Figures 2G, 10G). Co-staining with organelle markers showed that ATXN2 condensates were cross-distributed with the endoplasmic reticulum (Figure 8H). The specificity of the antibody was verified in ATXN2 knockout cells (Figure 8I).

[0383] Notably, the inventors observed a high degree of heterogeneity in the number of ATXN2 condensates in the cytoplasm, a fact that may be related to the heterogeneity of the cellular circadian clock. Notably, once the cells were synchronized, ATXN2 / 2L condensates oscillated in a time-dependent manner (Figure 2H), peaking between CT12 and CT16 and then declining significantly. The inventors found that both the number and size of ATXN2 condensates oscillated between 100-700 nm in diameter, in sync with the circadian rhythm induced by DXMS (Figures 8J-10M). The inventors observed similar rhythmicity of ATXN2 condensates in THLE-2 cells (Figures 8N and 10O), and in addition, oscillations along a 24-hour time cycle were also observed in the SCN region of the hypothalamus (Figures 2I and 10P).

[0384] To dissect the mechanistic basis of the observed rhythmic oscillations of ATXN2 / 2L condensates, the inventors detected their protein levels in several synchronized cell lines. ATXN2 / 2L protein levels showed a rhythmic pattern, cycling within 24 hours (Figures 2J, 10Q-10R). Atxn2 protein levels also fluctuated rhythmically in the hypothalamic samples of the inventors' mouse central pacemaker SCN, as well as in other brain regions such as the cerebellum and cortex (Figures 2K and 10S-10T). The inventors then analyzed the time-dependent changes in ATXN2 mRNA levels in U2OS cells and hypothalamic samples, which also showed a rhythmic pattern similar to the 24-hour circadian cycle in both cell types (Figures 8U-10V).

[0385] Together, these results strongly suggest that the expression of ATXN2 and 2L cycles within a circadian cycle, leading to fluctuations and cycling of ATXN2 / 2L cell condensates.

[0386] The above experiments show that the phase separation regulating function of ATXN2 and ATXN2L, especially the phase separation regulating function of the LCD region of ATXN2 and ATXN2L, is crucial for maintaining the circadian rhythm cycle.

[0387] Example 3. ATXN2 forms oscillating translation initiation condensates

[0388] Because ATXN2 condensates oscillate in a circadian-dependent manner, the inventors attempted to isolate ATXN2 condensates at different time points to analyze their composition. The inventors used the cryo-mill-IP technique, which performs rapid immunoprecipitation at a near-natural starting concentration, which largely preserves the integrity of protein complexes and phase-separated condensates. The inventors synchronized U2OS cells and collected them at CT4, 8, 12, 16, 20, and 24 for subsequent IP mass spectrometry analysis. The inventors used the RAIN (rhythmicity analysis combined with nonparametric methods) algorithm to analyze proteins co-immunoprecipitated with ATXN2 at different time points and found that 52% of the ATXN2-associated proteins showed a 24-hour rhythm in the input (p value < 0.05 and Figure 9A), indicating that ATXN2 condensates are enriched in rhythmic cycling proteins.

[0389] Then, the inventors obtained different oscillation phase diagrams calculated by the RAIN algorithm, which classified each protein into groups that reached peak values ​​at different time points (Figure 9B). The phases of circulating proteins were basically evenly distributed in the overall protein sample input. In sharp contrast, proteins with oscillation phases matching ATXN2 (CT8-16) were enriched in ATXN2 co-immunoprecipitated proteins (Figure 3A). These results indicate that these proteins are recruited into ATXN2 condensates at specific times of the cycle. Gene ontology (GO) analysis of immunoprecipitated proteins showed strong enrichment of mRNA processing and translation (Figure 3B). In addition, proteins related to mRNA processing or metabolism were particularly enriched in CT12, while translation-related proteins peaked from CT12 to CT16 (Figure 3C). These results indicate that ATXN2 condensates regulate different steps of mRNA-related events in a sequential manner.

[0390] To further analyze the putative functions of ATXN2-associated proteins in CT16, the inventors performed network cluster analysis using a Markov clustering algorithm and a search tool for retrieving interacting genes / proteins (STRING 9.1). The largest network group, containing 25 proteins, was named the "translation-associated protein" group because it included many well-characterized translation factors, such as EIF2A, EIF3I, and ribosomal proteins (Figure 3D).

[0391] Further analysis revealed that ATXN2-associated translation initiation factors and ribosomal proteins peaked between CT12 and CT16, a pattern absent in the overall input protein sample (Figures 3E and 11C). These events coincided with a peak in ATXN2 condensate formation, which was most pronounced between CT12 and CT16. Interestingly, major translation initiation complex components, including EIF4G2, EIF4A4, EIF4B, EIF2A, and EIF2B, were rhythmically enriched in ATXN2 condensates, with the highest peak occurring between CT12 and CT16. The interaction between ATXN2 and the corresponding translation-associated proteins was confirmed by Western blotting (Figure 3F). In contrast to the observed enrichment of the translation initiation complex, the inventors did not detect any translation elongation factors in ATXN2 condensates.

[0392] These results suggest that ATXN2 condensates promote the assembly of translation initiation complexes by concentrating translation initiation factors and ribosomes. Indeed, for genes regulated by ATXN2 / 2L rhythmic translation (Figures 2A, 2I), the ribosome occupancy patterns on the translation reading frame of these genes were the same at different circadian time points (Figure 11B) or in ATXN2 / 2L double knockout (Figure 9C), indicating that ATXN2 / 2L-dependent rhythmic translation regulation likely occurs during translation initiation.

[0393] Example 4. ATXN2 / 2L condensates recruit translation machinery and specific mRNAs

[0394] So far, the inventors have well demonstrated that ATXN2 and 2L positively regulate circadian translation and that they form oscillating condensates through phase separation. Next, the inventors further evaluated how phase separation helps to selectively recruit the translation machinery. The inventors isolated 80S ribosomal subunits and incubated them with ATXN2 and ATXN2L droplets, and ribosomal complexes could be enriched (Figure 10A). Other phase separation systems, including those of FUS and YTHDC1, were used as controls and were also enriched. The inventors' results showed that the selectivity of ribosome enrichment to phase-separated condensates was very small (Figures 4A and 12B).

[0395] The inventors next assessed whether ATXN2 / 2L condensates selectively recruit mRNAs. Previous studies based on PAR-CLIP experiments showed that ATXN2 primarily binds to uridine-rich elements in mRNAs, more specifically to AUUUU / A-rich motifs. Therefore, the inventors examined the sequences of a series of core clock genes. The inventors found that both PER2 and CRY1 mRNAs have two long sequences rich in AUUUU / A sequences in their 3'UTRs, but very few in their 5'UTRs (Figures 4B and 12C). These results suggest that ATXN2 condensates may regulate the translation of PER2 and CRY1 by specifically binding to their 3'UTR sequences.

[0396] The inventors in vitro transcribed 11 RNAs: the PER2 5'UTR, two AUUUU-enriched PER2 3'UTR fragments, and the 3'UTRs of several other clock genes. They also included FAM199X, a known ATXN2 substrate, as a positive control, and two negative controls, RRBP1 and WFS1 (which, according to Ribo-seq data, do not bind ATXN2 and exhibit rhythmic translation fluctuations at CT4 and CT12 in WT cells). As shown in Figures 4C and 12E, the PER2 3'UTR was significantly enriched in ATXN2 condensates; however, the 5'UTR showed no such enrichment. As expected, the two negative controls failed to be recruited to the ATXN2 droplets. Two other clock-related molecules, CRY1 and BMAL1, were also recruited to the liquid-like droplets, strongly suggesting that selectivity is achieved through the 3'UTRs of clock genes.

[0397] To ensure that the observed binding was independent of the protein species in the droplets, the inventors used FUS droplets as a negative control. None of these RNAs were enriched by the FUS droplets (Figure 4D). The inventors also constructed a series of control mutants with insufficient phase separation ability. Since the methionine residues in Pbp1 (yeast atx2) drive phase separation, the inventors constructed mutants in which single and all methionines were mutated to serine (MS) and tested their phase separation ability (Figure 10F). The M1268S single mutant and all M-to-S mutants no longer phase separated (Figures 4E and 12G). When all M-to-S mutants of ATXN2 no longer phase separated, RNA and protein no longer colocalized (Figure 4F).

[0398] Inspired by the above in vitro observations, the inventors further tested the selective enrichment of PER2 3'UTR by ATXN2 phase separation in vivo. The inventors performed immunofluorescence combined with RNAscope single-molecule fluorescence in situ hybridization to detect whether Per2 mRNA co-localizes with Atxn2 condensates in the mouse brain. The results were particularly significant in the SCN, where abundant Per2 mRNA co-localized with Atxn2 condensates in a rhythmic manner. The inventors also observed that the cytoplasmic colocalization of Atxn2 condensates and mRNA peaked at CT12 (Figure 4G), which was further confirmed in hypothalamic GT1-7 cells (Figure 4H). Colocalization was not as prominent in other brain regions, indicating that Atxn2 has a specific role in activating Per2 translation in the SCN (Figure 10H).

[0399] Taken together, these results suggest that ATXN2 condensates can enrich ribosome complexes and specific mRNAs, such as PER2, which may further promote translation activation as a function of circadian rhythms.

[0400] Example 5. ATXN2 / 2L condensates activate PER2 translation in vitro and in vivo

[0401] Given that ATXN2 condensates enriched the translation machinery, the inventors next evaluated whether phase separation is required for translation activation. The inventors first performed in vitro translation assays using phase-separated or phase-separation-defective ATXN2 LCD proteins (Figure 11A). Although the translation efficiency of PER2 and CRY1 was 2-3 times higher than that of the control in ATXN2 condensates, the inventors observed no significant change in translation efficiency in the presence of ATXN2M-S mutant protein (Figure 6A). In addition, ATXN2 droplets failed to promote the translation of two negative controls, WFS1 and RRBP1. These results strongly suggest that the translation activity of PER2 and CRY1 can be regulated in ATXN2 LCD phase-separated condensates.

[0402] After the inventors analyzed static protein translation, the inventors next confirmed the inventors' discovery of dynamic translation events. To this end, the inventors performed single-molecule detection using the SunTag system, as previously established. To ensure accurate capture of translation events, the inventors used the Tet-on system and doxycycline-induced expression of the PER2 polypeptide to eliminate background fluorescence that interfered with the signal and capture nascent PER2 peptides labeled with SunTag (Figure 5B). The inventors observed that nascent PER2 peptides emerged from mCherry-ATXN2 aggregates after the addition of doxycycline (Figure 5C), and that the SunTag fluorescence signal disappeared from the ATXN2 aggregates after the addition of the translation inhibitor puromycin (Figures 5B and 6C). These results confirm that active translation events occur in the phase separation system.

[0403] To provide direct evidence supporting the contribution of ATXN2 phase separation to translation activation, the inventors performed complementation experiments by expressing ATXN2 full-length protein or ATXN2 mutants with specific residue deletions or mutations (Figure 13B) in ATXN2 / 2L double knockout cells. Among them, cells lacking the C-terminal LCD3 of ATXN2 (925-1312) had no cytoplasmic condensates (Figures 5D and 13C). The inventors then used polysome fractionation analysis to assess the global translation oscillations of wild-type and ATXN2-ΔLCD3 cell lines. As expected, wild-type ATXN2 clearly rescued the translation inhibition of the inventors' double knockout cells (Figures 5E, 13D). However, the ATXN2-ΔLCD3 mutant failed to activate translation oscillations along the circadian rhythm. A similar phenomenon can be observed by SUnSET analysis (Figure 5F).

[0404] In addition, the inventors tested whether ATXN2 can rescue the translation of core clock genes that are suppressed after ATXN2 / 2L double knockout. CRY1, CLOCK and PER2 proteins all showed oscillatory expression patterns in WT and full-length ATXN2 complemented cells (Figure 5F). However, the ATXN2-ΔLCD3 mutant was unable to promote the translation of these three clock proteins. At the same time, the inventors measured the cell-autonomous circadian rhythm-TTFL period and amplitude to determine whether the phase separation of ATXN2 regulates the circadian behavior of cultured cells. Using the previously reported PER2::LUC cell line13, the inventors measured the luciferase reporter gene expression of ATXN2, ATXN2L single cells and double knockout (DKO) cells by real-time luminescence experiments (Figure 11E). As shown in Figure 5G, the circadian amplitude rhythms of ATXN2 and ATXN2L knockout cells were defective, but the period length did not change. ATXN2 / 2L double knockout severely suppressed the high-amplitude phenotype while mildly affecting circadian period length, suggesting a role for ATXN2 / 2L in maintaining circadian robustness. Interestingly, in ATXN2 / 2L double knockout cells, wild-type ATXN2 expression rescued the aberrant cell-autonomous circadian behavior, whereas the ATXN2-ΔLCD3 mutant did not, indicating that phase separation of ATXN2 maintains 24-hour periodicity and high-amplitude rhythmicity in cells.

[0405] Together, these findings indicate that ATXN2 phase separation is required for translational activation of PER2 and other clock molecules, as well as for cell-autonomous circadian behavior.

[0406] The above results indicate that upregulating the expression of ATXN2 and ATXN2L can strengthen or restore the intensity of circadian rhythm, among which the regulating phase separation function of LCD of ATXN2 and ATXN2L is crucial for strengthening or restoring the function of circadian rhythm.

[0407] Example 6. ATXN2 and ATXN2L co-regulate circadian rhythm in mice

[0408] To explore the potential role of ATXN2 and ATXN2L in the regulation of physiological circadian rhythms, the inventors next constructed several knockout mouse strains. Since Atxn2l knockout mice are embryonic lethal, the inventors constructed conditional tissue-specific knockout mice, VIP-Cre-driven Atxn2l knockout (Vip-Atxn2l- / -), and SCN-AAV8-Cre-driven Atxn2l knockout (Atxn2lflx / flx mice were injected with AAV8-mCherry-IRES-Cre in the SCN, referred to as SCN-Atxn2l- / -) (Figures 6A and 7B). Furthermore, the inventors constructed Atxn2+ / -; Atxn2lflx / + mice (Atxn2+ / -; SCN-Atxn2l+ / -) and Atxn2- / -; Atxn2lflx / flx mice (Atxn2- / -; SCN-Atxn2l- / -) by injecting AAV8-mCherry-IRES-Cre into the SCN of Atxn2 and Atxn2l compound heterozygous and homozygous knockout mice. mCherry-IRES-Cre expression in the SCN was confirmed by fluorescence in brain sections ( FIG12A ).

[0409] To monitor their circadian rhythm behavior, the inventors continuously recorded the running wheel activity of wild-type and transgenic mice. The mice were initially maintained in a 12-hour light / 12-hour dark cycle (LD) and subsequently transferred to constant darkness (DD). Four representative activity graphs for each mouse strain show their activities under LD and DD (Figure 6C and Figure 12B). All transgenic mice (Figure 12C) did not show any discernible changes in circadian rhythm behavior under LD conditions, but were affected by Atxn2 / 2l deficiency in DD. Under DD, the average period of wild-type mice was 23.90±0.05 hours (mean±SD, n=14), calculated by χ2periodogram, while the stable period of Atxn2- / - mutants was slightly extended to 23.95±0.05 hours (n=6, t-test, p=0.0655). In contrast, both Atxn2l knockout mice driven by VIP-Cre (Vip-Atxn2l- / -) and SCN-Cre (SCN-Atxn2l- / -) exhibited significantly shortened periods of 23.82±0.13 and 23.76±0.17, respectively. However, circadian period timing was not significantly affected in compound heterozygous or homozygous knockout mice (Atxn2+ / -;SCN-Atxn21+ / - and Atxn2- / -;SCN-Atxn21- / -) (Figure 6D).

[0410] In addition to the change in period, the inventors also measured other parameters related to circadian rhythms, such as the amplitude of the rhythm to indicate the robustness of the circadian rhythm. As shown in Figure 6E, there are indeed significant differences in the results between the compound knockout mice compared to WT (amplitude: 0.296 ± 0.044). Power spectrum analysis using FFT detected low-amplitude rhythms in compound heterozygous knockout mice in DD (amplitude: 0.190 ± 0.106). More severe circadian rhythm loss was observed in compound homozygous knockout mice (amplitude: 0.153 ± 0.057).

[0411] Furthermore, to ensure that the changes in periodicity and high-amplitude rhythms were not due to physiological changes, the inventors examined the body weight, locomotor activity, and anxiety-like behavior of all transgenic mice. All of these parameters were normal (Figures 12D-14H).

[0412] These results, together with our observations in knockout cells, suggest that ATXN2 and 2L coordinately regulate rhythmic translation to maintain circadian behavior in mammals.

[0413] Example 7. Use of inhibitory nucleic acids, CRISPR compositions ATXN2 and ATXN2L, and expression vectors to overexpress ATXN2.

[0414] (1) Using CRISPR-Cas9 technology, the inventors successfully knocked out ATXN2 and ATXN2L in U2OS cells. The results of Western Blot verification are shown in Figure 13A, where the numbers represent cell samples collected at different time points. The gRNAs used in this experiment are as follows: 5'-GTATTGGAAATACCCCCAGT-3' (SEQ ID NO: 9), which targets ATXN2, and 5'-CCCCGGATCTTAAAGGAGGA-3' (SEQ ID NO: 10), which targets ATXN2L.

[0415] The results indicate that ATXN2 and ATXN2L were successfully knocked out, with both downregulated. The inventors also tested the circadian rhythm in these cells, and the results showed that knocking out ATXN2 (i.e., downregulating ATXN2 expression) accelerated the circadian rhythm, while knocking out ATXN2L (i.e., downregulating ATXN2L expression) delayed the circadian rhythm.

[0416] (2) Using siRNA, the inventors successfully knocked down the expression of ATXN2 protein in U2OS cells. The results of Western Blot verification are shown in Figure 13B. The siRNAs used in this experiment are as follows:

[0417] siRNA1: sense strand is CCAGUUAGCAGAAGAAAUUTT (SEQ ID NO: 11), antisense strand is AAUUUCUUCUGCUAACUGGTT (SEQ ID NO: 12);

[0418] siRNA2: the sense strand is GCAAGUGAAACAUCACCUATT (SEQ ID NO: 13), and the antisense strand is UAGGUGAUGUUUCACUUGCTT (SEQ ID NO: 14).

[0419] This result indicates that ATXN2 expression is downregulated. The inventors also tested the circadian rhythm in the cells, and the results showed that downregulating ATXN2 expression can accelerate the circadian rhythm.

[0420] (3) Using shRNA, the inventors successfully knocked down the expression of ATXN2 protein in GL 261 cells. The results of Western Blot verification are shown in Figure 13C below. The numbers represent the shRNA numbers used. The shRNAs used in this experiment are as follows:

[0421] The shRNA targeting ATXN2 is:

[0422] CCGGCGAAAGGCCAAATCCCTTCTTCTCGAGAAGAAGGGATTTGGCCTTTTC GTTTTTG(SEQ ID NO:15),CCGGCGTCAGTTGTTGGATCGAAATCTCGAGATTTCGATCCAACAACTGACGTTTTTG(SEQ ID NO:16),CCGGCGGAAGCAAGTGCTAAGGATACTCGAGTATCCTTAGCACTTGCTTCCGTTTTTG(SEQ ID NO:16) NO:17), CCGGCAGTCCTGTCATACAAGGTAACTCGAGTTACCTTGTATGACAGGACTGTTTTTG (SEQ ID NO:18), or CCGGCCATGTCTAGTGGCCTAGAATCTCGAGATTCTAGGCCACTAGACATGGTTTTTG (SEQ ID NO:19).

[0423] The shRNA targeting ATXN2L is:

[0424] CCGGCCTCCATCCTCTCATCTATTCTCGAGAATAGATGAGAGGATGGGAGGTTTTTG (SEQ ID NO: 20), CCGGCCCGTGTTTGAAGGTGTCTATCTCGAGATAGACACCTTCAAACACGGGTTTTTG (SEQ ID NO: 21), CCGGGCCACTGTTCACCAATCCTATCTCGAGATAGGATTGGTGAACAGTGGCTTTTTG (SEQ ID NO: 21) NO:22), CCGGGCCTACGGATTGCTATGGAAACTCGAGTTTCCATAGCAATCCGTAGGCTTTTTG (SEQ ID NO:23), or CCGGCCCGTACTCATTCAACACCTTCTCGAGAAGGTGTTGAATGAGTACGGGTTTTTG (SEQ ID NO:24).

[0425] The results indicate that the expression of ATXN2 and ATXN2L is downregulated. The inventors also tested the circadian rhythm in the cells, and the results showed that downregulating the expression of ATXN2 can accelerate the circadian rhythm, while downregulating the expression of ATXN2L can delay the circadian rhythm.

[0426] (4) The inventors overexpressed ATXN2 by transfecting U2OS cells with the pLVX-EGFP-ATXN2 plasmid. The protein expression is shown in Figure 13D below, where the green signal represents EGFP-ATXN2 protein. This result indicates that ATXN2 expression is upregulated. The inventors also tested the circadian rhythm in these cells, and the results showed that upregulating ATXN2 expression can delay the circadian rhythm.

[0427] Example 8. Abnormal expansion of PolyQ can lead to a significant prolongation of the rhythmic period of the core rhythmic protein PER2.

[0428] To investigate the role and impact of abnormal polyQ expansion of the ATXN2 protein on circadian rhythms in neurodegenerative diseases, the inventors constructed cells containing different polyQ lengths using the following method: normal 22Q, polyQ-deleted 0Q, and polyQ expansion to disease-like 39Q and 57Q (as shown in Figure 14). Based on this, the fluorescence levels of PER2 in these four cell types were measured over a period of 4 days.

[0429] Materials and methods:

[0430] 1. Cell Line Construction: Guide RNA (gRNA) sequences for the CRISPR / Cas9 system were designed at the corresponding positions in the human ATXN2 and ATXN2L genomic sequences and inserted into the pX459 plasmid. The plasmid was then transfected into HEK293T cells for lentiviral packaging. U2OS cells were infected with these plasmids to generate the ATXN2 / 2L-double KO U2OS cell line. Furthermore, fusion expression plasmids containing ATXN2 / 2L proteins with varying polyQ lengths (0, 22, 39, 57) and a Flag tag were constructed and transfected into HEK293T cells for lentiviral packaging. Different ATXN2 / 2L-double KO U2OS cell lines were then infected to generate cell lines harboring ATXN2-0 / 22 / 39 / 57Q.

[0431] 2. Establishment of a luciferase reporter gene system: After obtaining cell lines containing ATXN2 with different lengths of polyQ, a fusion expression plasmid containing the PER2 promoter sequence and the luciferase sequence was transferred. The resulting cell line can be tested for luciferase activity by adding luciferin as a luciferase reaction substrate to the culture medium. By continuously testing luciferase activity for 4 consecutive days, taking a photo every hour, and exposing each photo for 15 minutes, the rhythmic oscillation changes of PER2 were characterized. The detected signal value was Fourier transformed to calculate the period of each cell.

[0432] The results showed that, compared with 22Q, polyQ removal had no significant effect on the PER2 rhythm, but abnormal polyQ expansion significantly increased the PER2 rhythmic period ( FIG. 15 ).

[0433] discuss

[0434] Accurate 24-hour cell-autonomous oscillations are maintained by a complex molecular network. Here, we identify ATXN2 and ATXN2L as master regulators of rhythmic translation (Figure 6F).

[0435] ATXN2 is a known risk factor for spinocerebellar ataxia type 2 and ALS. Its physiological functions are diverse, including regulation of mRNA processing, stability, and expression. In Drosophila, Atx2 has been reported to regulate circadian rhythms by assisting in the translation of Per. However, circadian rhythmicity in Atxn2-knockout mammals appears to be minimal. Evolutionary analyses offer two possible explanations. First, Drosophila Atx2 interacts with the translation activator TWENTY-FOUR (TYF) and binds to PERIOD (per) mRNA to initiate its translation. However, TYF proteins are found only in Diptera and are not conserved in mammals. Second, ATXN2L may have originated from a gene duplication event 500 million years ago, or it may have emerged in the vertebrate lineage after the loss of TYF. Our work strongly supports the importance of ATXN2L. Functional redundancy is often observed in the regulation of circadian rhythms, as exemplified by the multiple isoforms of many clock proteins, such as Cry1 and Cry2, and mPer1-3. This increased complexity suggests that mammals require more circadian regulation to properly maintain all physiological functions throughout the organism.

[0436] ATXN2 and ATXN2L have similar domain structures, except that human ATXN2 has a polyglutamine segment at its N-terminus. The inventors' research revealed that ATXN2 and ATXN2L play a compensatory role in regulating translational rhythms. Further research may provide a more detailed explanation of the precise coordination between these two molecules and reveal the importance of further molecular-level redundancy.

[0437] In previous reports, the LCD of ATXN2 was shown to be required for RNA granule assembly and long-term memory in Drosophila. Indeed, the LCD of ATXN2 is conserved among its orthologs in over 200 species. Therefore, the role of ATXN2 LCD in driving phase separation or mRNA granule formation may be conserved. In a previous study, Ataxin2 was shown to colocalize with pABP and ribosomal subunits in human neurons. However, few studies have reported on the functions of ATXN2 condensates in mammals. Here, the inventors demonstrate that ATXN2 and 2L condensates oscillate in a temporal manner and regulate a range of biological processes.

[0438] Most previously described phase-separated systems have been studied in cellular contexts such as stable and homogeneous states (e.g., under stress) or during unidirectional transitions (e.g., during cell differentiation and development). Here, the inventors demonstrate a physiological function for the flow of an oscillating phase-separated system in regulating cellular rhythms. This time-dependent phase separation has been implicated in transcriptional regulation. Specific condensates form at each step of transcription, including initiation, elongation, and termination. The liquid information flow model previously proposed to explain how transcription occurs may also apply to translation. Based on our findings, we propose that translation is initiated within ATXN2 condensates. Other mechanisms, either dependent on or independent of phase separation, subsequently assist protein translation in the elongation phase. Furthermore, previous studies have demonstrated uncoupling between mRNA and protein oscillations. While our findings clearly indicate that ATXN2 phase-separated condensates play an important role in translation activation, they may also be one potential mechanism underlying this uncoupling. Together, our work provides a more detailed understanding of how phase separation implements the spatiotemporal regulation of various cellular activities.

[0439] In addition, the inventors' work also has important implications for future disease research. Recent experimental evidence suggests a bidirectional relationship between circadian rhythm disturbances and many human malignant diseases, including tumors, type 2 diabetes, psychiatric disorders, and neurodegenerative diseases. The onset of these diseases is insidious and progressive, with circadian rhythm disturbances observed in the early stages. Sleep-related pathologies, including progressive loss of dream recall and decreased REM frequency, have been reported in SCA2 patients. ATXN2 constitutes an effective modifier of Tar-DNA binding protein (TDP-43) proteinopathy. ATXN2 antisense oligonucleotides (ASOs) have been suggested as an effective therapy for ALS. Based on the rhythmicity of ATXN2 condensates revealed in this study, the timing of application should be carefully considered in future treatments.

[0440] Notably, while the mammalian core clock is regulated by interlocking positive and negative feedback loops, the inventors primarily focused on addressing the role of ATXN2 / 2L in the negative TTFL. In addition to the first negative feedback loop, a second positive loop involving Nr1d1 / Reverb-alpha and RORs exists, as well as a tertiary TTFL involving Dec1 / Dec2. Rev-Erbα works in concert with Rev-Erbβ and RORα to regulate the circadian expression of BMAL1. Oscillatory expression of Nr1d1 / Reverb-alpha and RORs is not only present in the SCN but has also been proposed to coordinate circadian metabolic processes. Further studies to gain a more complete understanding of circadian rhythms are crucial to better understand how phase separation and protein translation are coordinated.

[0441] In summary, our findings elucidate the physiological relevance of rhythmic ATXN2-mediated phase separation and should greatly aid future circadian research and the development of new biomarkers for aging and the onset of neurodegenerative diseases.

Claims

1. A method for regulating circadian rhythm, comprising the step of regulating the expression and / or protein function of ATXN2 and / or ATXN2L to regulate the circadian rhythm, Optionally, the regulating the expression of ATXN2 and / or ATXN2L is up-regulating or down-regulating the expression of ATXN2 and / or ATXN2L; the regulating the protein function of ATXN2 and / or ATXN2L is inactivating or enhancing the protein function of ATXN2 and / or ATXN2L.

2. The method according to claim 1, comprising accelerating the circadian rhythm by downregulating the expression of ATXN2 or upregulating the expression of ATXN2L; and / or delaying the circadian rhythm by downregulating the expression of ATXN2L or upregulating the expression of ATXN2.

3. The method according to claim 1, comprising accelerating the circadian rhythm by inactivating the function of ATXN2 or enhancing the function of ATXN2L; and / or delaying the circadian rhythm by inactivating the function of ATXN2L or enhancing the function of ATXN2. 4 . The method of claim 1 , comprising enhancing circadian rhythm by simultaneously upregulating the expression of ATXN2 and ATXN2L.

5. The method of claim 1, comprising attenuating circadian rhythm by simultaneously downregulating the expression of ATXN2 and ATXN2L. 6 . The method according to claim 3 , wherein the function of ATXN2 or the function of ATXN2L is a function of forming phase separation in cells.

7. The method of claim 2, wherein the expression of ATXN2 or ATXN2L is downregulated using an inhibitory nucleic acid targeting ATXN2 or ATXN2L.

8. The method of claim 7, wherein the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or an RNA interfering agent, preferably, the inhibitory nucleic acid is or contains or encodes a small interfering RNA (siRNA), a microRNA-adaptive shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA, a precursor microRNA (pre-miRNA) or a microRNA (miRNA). 9 . The method according to claim 2 , wherein the expression of ATXN2 or ATXN2L is upregulated using an expression vector comprising a protein encoding ATXN2 and / or ATXN2L.

10. The method according to claim 9, wherein the expression vector is selected from adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, herpes virus vectors, vaccinia virus vectors, MMLV, GaLV, simian immunodeficiency virus vectors, poxvirus vectors, preferably, the expression vector is replication-defective.

11. The method according to claim 9, wherein the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

12. The method of claim 2, wherein a CRISPR composition is used to upregulate or downregulate the expression of ATXN2 or ATXN2L.

13. The method of claim 12, wherein the CRISPR composition comprises a Cas nuclease and a gRNA, wherein the gRNA targets ATXN2 or ATXN2L, and optionally, the gRNA is 5'-GTATTGGAAATACCCCCAGT-3' (SEQ ID NO: 9) or 5'-GTATTGGAAATACCCCCAGT-3' (SEQ ID NO: 10).

14. A method for regulating circadian rhythm, comprising the step of regulating circadian rhythm by regulating the expression and / or function of a protein containing an LCD domain, preferably, regulating the function of a protein containing an LCD domain is regulating the function of the LCD domain-mediated phase separation, more preferably, regulating a protein containing an LCD domain is regulating a clock gene protein containing an LCD domain.

15. The method of claim 14, wherein LCD domain-mediated phase separation is regulated by up-regulating or down-regulating the expression of a protein comprising an LCD domain.

16. Use of one or more modulators or combinations of modulators for regulating ATXN2 and / or ATXN2L in the preparation of the following drugs or agents: (1) Prevent or treat circadian rhythm-related diseases; (2) Prevent or treat diseases related to ATXN2 and / or ATXN2L gene disorders; (3) regulating the circadian rhythm of a subject in need thereof; and / or (4) Regulating phase separation.

17. A method for: administering to a subject one or more modulators or combinations of modulators that modulate the expression or protein function of ATXN2 and / or ATXN2L: (1) Prevent or treat circadian rhythm-related diseases; (2) Prevent or treat diseases related to ATXN2 and / or ATXN2L gene disorders; (3) regulating the circadian rhythm of a subject in need thereof; and / or (4) Regulating phase separation.

18. The use according to claim 16 or the method according to claim 17, wherein the circadian rhythm-related disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, hypersomnia, sleep disorders, sleep disorders, neurodegenerative diseases, ataxia, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's syndrome, anxiety disorders, depression, manic depression, obsessive-compulsive disorder, affective neurosis, depressive neurosis, anxiety neurosis, mood disorders, delirium, panic attacks, post-traumatic stress disorder, dementia, mental retardation, movement disorders, Huntington's disease, addiction, migraine, headache, pain, neuropathic pain; Preferably, the circadian rhythm-related disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, hypersomnia, sleep disorders, and sleep disturbances.

19. The use according to claim 16 or the method according to claim 17, wherein the regulator for regulating the expression of ATXN2 and / or ATXN2L is an expression vector comprising an encoding ATXN2 and / or ATXN2L, which is used to upregulate the expression of ATXN2 and / or ATXN2L; Optionally, the expression vector is selected from an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a lentiviral vector, a herpes virus vector, a vaccinia virus vector, MMLV, GaLV, a simian immunodeficiency virus vector, a poxvirus vector, and preferably, the expression vector is replication defective; Optionally, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

20. The use according to claim 16 or the method according to claim 17, wherein the modulator of the expression of ATXN2 and / or ATXN2L is or targets an inhibitory nucleic acid of ATXN2 or ATXN2L, Optionally, the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or an RNA interfering agent, preferably, the inhibitory nucleic acid is or contains or encodes a small interfering RNA (siRNA), a microRNA-adaptive shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA, a precursor microRNA (pre-miRNA) or a microRNA (miRNA).

21. The use according to claim 16 or the method according to claim 17, wherein the modulator that modulates the expression of ATXN2 and / or ATXN2L is a CRISPR composition; Optionally, the CRISPR composition comprises a Cas nuclease and a gRNA that targets ATXN2 or ATXN2L, optionally, the gRNA is 5'-GTATTGGAAATACCCCCAGT-3' or 5'-GTATTGGAAATACCCCCAGT-3'.

22. A biomarker combination for detecting circadian rhythm of a subject, comprising ATXN2 and / or ATXN2L, preferably, consisting of ATXN2 and / or ATXN2L.

23. A reagent combination for detecting the biomarker combination of claim 22, comprising reagents for detecting the gene markers, such as primers, probes, antibodies, optionally enzymes such as PCR enzymes, buffers, and product instructions.

24. Use of the reagent combination according to claim 23 in preparing a reagent for detecting the circadian rhythm of a subject.

25. A method for detecting a subject's circadian rhythm, comprising the following steps: Determining the expression level of the biomarker combination of claim 22 in the subject, preferably, using the reagent combination of claim 23 to determine the expression level; comparing the measured expression level to a reference level; The state of the subject's circadian rhythm is determined.

26. The use according to claim 24, wherein the state of the circadian rhythm can be used to diagnose circadian rhythm disorders or circadian rhythm-related diseases.

27. A cell model lacking ATXN2 and / or ATXN2L gene, preferably the cell is a mammalian cell, more preferably a human cell, most preferably a U2OS cell, a GT1-7 cell, a THLE-2 cell, or a Hela cell.

28. An animal model lacking ATXN2 and / or ATXN2L gene; preferably, the animal model is a mammalian model, more preferably a rodent model, and most preferably a mouse model.

29. Use of the cell model or animal model according to claim 27 or 28 for screening drugs for treating or preventing circadian rhythm-related diseases.

30. An expression vector comprising a nucleic acid sequence encoding ATXN2 and ATXN2L or a nucleic acid sequence encoding the LCD region of ATXN2 and ATXN2L; Optionally, the expression vector is selected from an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a lentiviral vector, a herpes virus vector, a vaccinia virus vector, MMLV, GaLV, a simian immunodeficiency virus vector, a poxvirus vector, and preferably, the expression vector is replication defective; Optionally, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

31. An expression vector combination, comprising a first expression vector and a second expression vector, wherein the first expression vector comprises a nucleic acid sequence encoding ATXN2 or a nucleic acid sequence encoding an LCD domain of ATXN2; and the second expression vector comprises a nucleic acid sequence encoding ATXN2L or a nucleic acid sequence encoding an LCD domain of ATXN2L; Optionally, the expression vector is selected from an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a lentiviral vector, a herpes virus vector, a vaccinia virus vector, MMLV, GaLV, a simian immunodeficiency virus vector, a poxvirus vector, and preferably, the expression vector is replication defective; Optionally, the expression vector is an AAV vector, and the serotype of the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Preferably, the serotype of the AAV vector is selected from AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.

32. An inhibitory nucleic acid combination comprising a first inhibitory nucleic acid and a second inhibitory nucleic acid, wherein the first inhibitory nucleic acid targets ATXN2; and the second inhibitory nucleic acid targets ATXN2L; Optionally, the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or an RNA interfering agent, preferably, the inhibitory nucleic acid is or contains or encodes a small interfering RNA (siRNA), a microRNA-adaptive shRNA (shRNAmir), a short hairpin RNA (shRNA), a hairpin siRNA, a precursor microRNA (pre-miRNA) or a microRNA (miRNA).

33. A CRISPR composition comprising a Cas enzyme, a first gRNA and a second gRNA, wherein the first gRNA targets ATXN2; the second gRNA targets ATXN2L; Preferably, the Cas enzyme is Cas9; Preferably, the first gRNA is 5'-GTATTGGAAATACCCCCAGT-3'; the second gRNA is 5'-GTATTGGAAATACCCCCAGT-3'.

34. A composition comprising the expression vector, expression vector combination or inhibitory nucleic acid combination of the preceding claims, and a pharmaceutically acceptable carrier.

35. The use according to claim 16 or the method according to claim 17, wherein the regulator or the combination of regulators comprises the expression vector according to claim 30, the expression vector combination according to claim 31, the inhibitory nucleic acid combination according to claim 32, the CRISPR composition according to claim 33 or the composition according to claim 34, preferably, the regulator or the combination of regulators is the expression vector according to claim 30, the expression vector combination according to claim 31, the inhibitory nucleic acid combination according to claim 32, the CRISPR composition according to claim 33 or the composition according to claim 34.

36. A method of regulating circadian rhythm comprising the step of regulating phase separation.

37. The method according to claim 36, wherein regulating the phase separation comprises the step of regulating the expression and / or protein function of ATXN2 and / or ATXN2L to regulate the circadian rhythm, Optionally, the regulating the expression of ATXN2 and / or ATXN2L is up-regulating or down-regulating the expression of ATXN2 and / or ATXN2L; the regulating the protein function of ATXN2 and / or ATXN2L is inactivating or enhancing the protein function of ATXN2 and / or ATXN2L.

38. The method according to any one of claims 36-37, comprising: Improving phase separation by upregulating the expression of ATXN2 and / or ATXN2L genes or LCD proteins or domains or enhancing their functions; And / or downregulating the expression of ATXN2 and / or ATXN2L genes or LCD proteins or domains or reducing their functions to reduce phase separation.

39. A method for treating a disease comprising the step of regulating phase separation; The disease is selected from circadian rhythm disorders, jet lag syndrome, sleep apnea, narcolepsy, insomnia, hypersomnia, sleep disorders, sleep disorders, neurodegenerative diseases, ataxia, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's syndrome, anxiety disorders, depression, manic depression, obsessive-compulsive disorder, affective neurosis, depressive neurosis, anxiety neurosis, mood disorders, delirium, panic attacks, post-traumatic stress disorder, dementia, mental retardation, movement disorders, Huntington's disease, addiction, migraine, headache, pain, neuropathic pain.

40. The method according to claim 39, comprising regulating phase separation by regulating the expression and / or function of a protein comprising an LCD domain, preferably regulating a protein comprising an LCD domain is regulating a clock gene protein comprising an LCD domain.

41. The method of claim 40, wherein LCD domain-mediated phase separation is modulated by upregulating or downregulating expression of a protein comprising an LCD domain.

42. Use of a reagent for detecting ATXN2 in the preparation of a detection agent for detecting circadian rhythm abnormalities and / or neurodegenerative diseases; optionally, when the polyQ in the ATXN2 is greater than 22Q, preferably greater than or equal to 23Q, 24Q, 25Q, 26Q, 27Q, 28Q, 29Q, 30Q, 31Q, 32Q, 33Q, 34Q, 35Q, 36Q, 37Q, 38Q, 39Q, 40Q, 41Q, 42Q, 43Q, 44Q, 45Q, 46Q, 47Q, 48Q, 49Q, 50Q, 51Q, 52Q, 53Q, 54Q, 55Q, 56Q, 57Q, 58Q, the subject is determined to have an abnormal circadian rhythm and / or a neurodegenerative disease.

43. A method for detecting whether a subject has an abnormal circadian rhythm and / or a neurodegenerative disease, comprising the step of detecting the protein sequence of ATXN2 in the subject, wherein when the polyQ in the ATXN2 is greater than 22Q, preferably greater than or equal to 23Q, 24Q, 25Q, 26Q, 27Q, 28Q, 29Q, 30Q, 31Q, 32Q, 33Q, 34Q, 35Q, 36Q, 37Q, 38Q, 39Q, 40Q, 41Q, 42Q, 43Q, 44Q, 45Q, 46Q, 47Q, 48Q, 49Q, 50Q, 51Q, 52Q, 53Q, 54Q, 55Q, 56Q, 57Q, 58Q, the subject is determined to have an abnormal circadian rhythm and / or a neurodegenerative disease.

Images