Gene recombinant microorganism producing polyhydroxyalkanoate and method for manufacturing same

Abstract

A gene recombinant microorganism according to the present disclosure comprises at least one exogenous gene including a gene having a base sequence encoding 4-hydroxyvalerate, and a gene having a base sequence derived from any one strain selected from the genus Ralstonia is introduced into the microorganism.

Description

Genetically recombinant microorganism producing polyhydroxyalkanoate and method for producing the same

[0001] The present invention relates to a genetically recombinant microorganism producing polyhydroxyalkanoate and a method for producing the same.

[0002] As plastic pollution becomes a global issue, research into the production of biodegradable plastics is actively underway to develop solutions for reducing plastic waste. Biodegradable plastics are plastics that decompose in nature, undergoing physical and chemical changes in response to organic matter such as bacteria. Types of biodegradable plastics include polyhydroxyalkanoate (PHA), polylactic acid (PLA), and polyglycolic acid (PG), and can be used as food and chemical additives, pharmaceutical ingredients, and biodegradable packaging.

[0003] Among these, polyhydroxyalkanoate is a biodegradable plastic derived from microorganisms. Compared to other existing biodegradable plastics, it has a high degree of eco-friendliness and allows for various properties to be controlled, so research on it is actively being conducted.

[0004] One aspect of the present disclosure is to provide a genetically recombinant microorganism into which a gene derived from Ralstonia eutropha has been introduced and a method for producing the same by identifying the levulinic acid metabolic pathway of Ralstonia eutropha and the production mechanism of 4-hydroxyvalerate accordingly.

[0005] Another aspect of the present disclosure provides a method for synthesizing polyhydroxyalkanoate containing 4-hydroxyvalerate as a monomer, which is easy to process and apply, by using the genetically recombinant microorganism.

[0006] The technical problems to be achieved in this document are not limited to the technical problems mentioned above, and other technical problems not mentioned can be clearly understood by a person having ordinary skill in the technical field to which the present invention belongs from the description below.

[0007] A genetically recombinant microorganism according to the invention comprises at least one foreign gene, wherein the foreign gene comprises a gene having a base sequence encoding 4-hydroxyvalerate, and a gene having the base sequence derived from any strain selected from the genus Ralstonia is introduced into the microorganism.

[0008] A method for producing a genetically recombinant microorganism according to the invention comprises the steps of isolating an LvaED gene from a strain selected from the genus Pseudomonas; comparing the identity of the isolated LvaED gene with a gene of a strain selected from the genus Ralstonia; isolating a gene having an identity of 30% or more with the LvaED gene from among the genes of the strain selected from the genus Ralstonia; and introducing a gene derived from the strain selected from the isolated Ralstonia into a microorganism.

[0009] A method for producing polyhydroxyalkanoate according to the invention comprises the steps of culturing a genetically recombinant microorganism; and obtaining polyhydroxyalkanoate produced from the genetically recombinant microorganism.

[0010] According to the idea of ​​the present disclosure, by understanding the levulinic acid metabolic pathway of Ralstonia eutropha and the production mechanism of 4-hydroxyvalerate accordingly, a genetically recombinant microorganism into which a gene derived from Ralstonia eutropha has been introduced and a method for producing the same are provided, and through this, a method for synthesizing polyhydroxyalkanoate containing 4-hydroxyvalerate as a monomer, which is easy to process and apply, is provided.

[0011] The effects that can be obtained from the present disclosure are not limited to the effects mentioned above, and other effects that are not mentioned can be clearly understood by a person having ordinary skill in the art to which the present disclosure belongs from the description below.

[0012] Figure 1 is a diagram showing the metabolic circuit for producing polyhydroxyalkanoate when a gene of the microbial strain Pseudomonas putida is introduced.

[0013] Figure 2 is a diagram showing the metabolic circuit for producing polyhydroxyalkanoate when a gene of the microbial strain Eralstonia eutropha is introduced.

[0014] Figure 3 is a diagram showing a plasmid into which the Re LvaED1 gene of Ralstonia eutropha strain has been introduced.

[0015] Figure 4 is a diagram showing a plasmid into which the Re LvaED2 gene of Ralstonia eutropha strain has been introduced.

[0016] Figure 5 is a diagram showing a plasmid into which the PhaC gene of Aeromonas salmonicida strain has been introduced.

[0017] Figure 6 is a diagram showing the metabolic pathway of Pseudomonas putida strain when levulinic acid is used as a substrate.

[0018] Like reference numerals refer to like elements throughout the specification. This specification does not describe all elements of the embodiments, and any general information within the technical field to which the present invention pertains or any information that overlaps between the embodiments is omitted.

[0019] Additionally, when a part is said to "include" a component, this does not mean that it excludes other components, but rather that it may include other components, unless otherwise specifically stated.

[0020] Throughout the specification, when we say that an element is "on" another element, this includes not only cases where the element is in contact with the other element, but also cases where another element exists between the two elements.

[0021] The terms first, second, etc. are used to distinguish one component from another, and the components are not limited by the aforementioned terms.

[0022] Singular expressions include plural expressions unless the context clearly indicates otherwise.

[0023] The identification codes in each step are used for convenience of explanation and do not describe the order of each step, and each step may be performed in a different order than specified unless the context clearly indicates a specific order.

[0024] The genetically recombinant microorganism is described in detail with reference to the attached drawings and sequence list below.

[0025] A genetically recombinant microorganism according to the invention comprises at least one foreign gene, wherein the foreign gene comprises a gene having a base sequence encoding 4-hydroxyvalerate, and a gene having the base sequence derived from a strain selected from the genus Ralstonia is introduced into the microorganism. As a result, the recombinant microorganism can produce a polyhydroxyalkanoate containing 4-hydroxyvalerate.

[0026] Polyhydroxyalkanoate is a biodegradable plastic derived from microorganisms and has higher environmental friendliness than existing biodegradable plastics. The polyhydroxyalkanoate may be at least one selected from the group consisting of poly(3-hydroxybutyrate), poly(3-hydroxyvalerate), poly(4-hydroxyvalerate), poly(3-hydroxybutyrate-co-3-hydroxyvalerate), poly(3-hydroxybutyrate-co-4-hydroxyvalerate), poly(3-hydroxyvalerate-co-4-hydroxyvalerate), and poly(3-hydroxybutyrate-co-4-hydroxyvalerate-co-4-hydroxyvalerate).

[0027] The above poly(3-hydroxybutyrate) may have a structure as shown in the following chemical formula 1.

[0028] [Chemical Formula 1]

[0029]

[0030] The above poly(3-hydroxyvalerate) may have a structure as shown in the following chemical formula 2.

[0031] [Chemical Formula 2]

[0032]

[0033] The above poly(4-hydroxyvalerate) may have a structure as shown in the following chemical formula 3.

[0034] [Chemical Formula 3]

[0035]

[0036] The above poly(3-hydroxybutyrate-co-3-hydroxyvalerate) may have a structure as shown in the following chemical formula 4.

[0037] [Chemical Formula 4]

[0038]

[0039] The above poly(3-hydroxybutyrate-co-4-hydroxyvalerate) may have a structure as shown in Chemical Formula 5 below.

[0040] [Chemical Formula 5]

[0041]

[0042] The above poly(3-hydroxyvalerate-co-4-hydroxyvalerate) may have a structure as shown in Chemical Formula 6 below.

[0043] [Chemical Formula 6]

[0044]

[0045] The above poly(3-hydroxybutyrate-co-4-hydroxyvalerate-co-4-hydroxyvalerate) may have a structure as shown in the following chemical formula 7.

[0046] [Chemical Formula 7]

[0047]

[0048] Poly(3-hydroxybutyrate) is difficult to utilize due to its rigid properties and high melting point, so polymerization of additional monomers is required. 3-hydroxyvalerate and 4-hydroxyvalerate can be included as monomers. In particular, when 4-hydroxyvalerate is included, polyhydroxyalkanoate can have amorphous and elastic characteristics.

[0049] 3-Hydroxyvalerate and 4-hydroxyvalerate can be synthesized from levulinic acid by microorganisms, and levulinic acid is a carbon source with significant potential as a precursor for several high-value-added substances that can be produced from various biomass. Strains that can produce polyhydroxyalkanoates including 3-hydroxyvalerate and 4-hydroxyvalerate from levulinic acid obtained from renewable resources in the wild type include Pseudomonas putida and Ralstonia eutropha. The levulinic acid metabolic pathway of Pseudomonas putida has been revealed to produce 4-hydroxyvalerate-CoA (4HV-CoA) through the LvaED gene and 3-hydroxyvalerate-CoA (3HV-CoA) through the LvaABC genes, but the mechanism related to 4-hydroxyvalerate synthesis in Ralstonia eutropha has not yet been elucidated. As shown in Fig. 6, the levulinic acid metabolic pathway of the Pseudomonas putida strain has been elucidated, enabling the production of polyhydroxyalkanoates having various monomers through various metabolic engineering methods, such as removal of metabolic pathways and gene introduction within the strain genome. Accordingly, the present invention provides a genetically recombinant microorganism in which a 4-hydroxyvalerate synthesis gene derived from the Ralstonia eutropha strain has been introduced into the microorganism by utilizing the Pseudomonas putida strain, the mechanism of which has been elucidated.

[0050] According to the invention, a genetically recombinant microorganism may include Re LvaE, Re LvaD1, and Re LvaD2 genes as genes having a base sequence encoding 4-hydroxyvalerate. The Re LvaE, Re LvaD1, and Re LvaD2 genes refer to genes having the highest identity with the LvaE and LvaD genes of Pseudomonas putida strain among the genes of the Ralstonia eutropha strain. Gene identity is calculated as a percentage of the region where the base sequences are identical, and a higher percentage is determined to indicate a higher identity between genes, and the identity of the Re LvaE, Re LvaD1, and Re LvaD2 genes with the LvaE and LvaD genes may be 30% or more, preferably 40% or more, and more preferably 50% or more. The above Re LvaE gene, Re LvaD1, and Re LvaD2 genes may each be a polynucleotide having a base sequence of SEQ ID NO: 1 to 3, and the Re LvaE enzyme, Re LvaD1, and Re LvaD2 enzymes encoded by each of the above base sequences may be polypeptides. The Re LvaE enzyme is a short-chain acyl-CoA synthetase and can catalyze and activate levulinic acid into levulinic acid-CoA. The Re LvaD1 and Re LvaD2 enzymes are 4-oxopentanoyl-CoA-4-dehydrogenases and can catalyze the conversion of levulinic acid-CoA into 4-hydroxyvaleric acid-CoA.

[0051] The genetically recombinant microorganism according to the invention may be a strain of Ralstonia eutropha.

[0052] According to the concept of the present disclosure, a genetically recombinant microorganism into which a gene is introduced may be selected from the group consisting of the genus Escherichia, the genus Mannheimia, the genus Rhodobacter, and the genus Methylobacterium, and preferably selected from the genus Escherichia.

[0053] A genetically recombinant microorganism according to the invention may further comprise a gene selected from the group consisting of PhaA having a nucleotide sequence of SEQ ID NO: 4, PhaB having a nucleotide sequence of SEQ ID NO: 5, and PhaC having a nucleotide sequence of SEQ ID NO: 6. The term "PhaABC" used in the present invention refers to PhaA, PhaB, and PhaC genes. The PhaA gene may be a polynucleotide having a nucleotide sequence of SEQ ID NO: 4, and the PhaA enzyme encoded by the nucleotide sequence may be a polypeptide. In addition, the PhaB gene may be a polynucleotide having a nucleotide sequence of SEQ ID NO: 5, and the PhaB enzyme encoded by the nucleotide sequence may be a polypeptide. The PhaA enzyme is an acetyl-CoA acetyltransferase and can catalyze the condensation of two acetyl-coA units to form acetoacetyl-CoA. In addition, the PhaB enzyme is an acetoacetyl-CoA reductase and can catalyze the chiral reduction of acetoacetyl-CoA to (R)-3-hydroxybutyryl-CoA. The PhaC gene may be a polynucleotide having the base sequence of SEQ ID NO: 6, and the PhaC enzyme encoded by the base sequence may be a polypeptide. The PhaC enzyme is an enzyme that biosynthesizes polyhydroxyalkanoate by polymerizing the monomer hydroxyalkanoate.

[0054] A genetically recombinant microorganism according to the invention can produce polyhydroxyalkanoates with an increased mole fraction (%) of 4-hydroxyvalerate. When 4-hydroxyvalerate is included, the polyhydroxyalkanoates can have amorphous, elastomeric properties, allowing them to be used in a wide range of applications.

[0055] The following describes a method for producing the above genetically recombinant microorganism.

[0056] A genetically recombinant microorganism according to the invention may include the steps of: isolating an LvaED gene from a strain selected from the genus Pseudomonas; comparing the identity of the isolated LvaED gene with a gene of a strain selected from the genus Ralstonia; isolating a gene having an identity of 30% or more with the LvaED gene among the genes of the strain selected from the genus Ralstonia; and introducing a gene derived from the selected strain of the isolated Ralstonia into the microorganism.

[0057] The wild type strain Ralstonia eutropha produces polyhydroxyalkanoates including 4-hydroxyvalerate and 3-hydroxyvalerate from levulinic acid. However, the levulinic acid metabolic pathway and the production mechanism of 4-hydroxyvalerate and 3-hydroxyvalerate have not yet been elucidated. Therefore, in order to elucidate the production mechanism, we assumed that Ralstonia eutropha has a similar metabolic pathway to that of Pseudomonas putida, whose levulinic acid metabolic pathway has been clearly elucidated. Therefore, genes in Ralstonia eutropha with a high percent identity were selected when compared with the LvaED gene of Pseudomonas putida. At this time, the levulinic acid metabolic circuit of the Pseudomonas putida strain is as shown in Figure 6, and the genes with the highest identity are named Re LvaE, Re LvaD1, and Re LvaD2, respectively, and the identity between the genes can preferably be 30% or more.

[0058] A plasmid, pKM212Re LvaE Re LvaD1, into which the Re LvaED1 gene derived from the Ralstonia eutropha strain has been inserted can be constructed as shown in Fig. 3, and a plasmid, pKM212Re LvaE Re LvaD2, into which the Re LvaED2 gene has been inserted can be constructed as shown in Fig. 4. Referring to FIG. 5, p3AZ2C-ReAB and pKM212 Re LvaE Re LvaD1 plasmids can be introduced. When the plasmids are introduced into a microorganism selected from the group consisting of the genus Escherichia, the genus Mannheimia, the genus Rhodobacter, and the genus Methylobacterium using a cloning (transformation) method and then cultured using levulinic acid and glucose as carbon sources, a polymer having a higher 4-hydroxyvalerate molar fraction than before can be produced.

[0059] Microorganisms of the genus Pseudomonas include Pseudomonas theae, Pseudomonas tolaasii, Pseudomonas fluorescens, Pseudomonas tremae, Pseudomonas viridiflava, Pseudomonas putida, Pseudomonas caricapapayae, Pseudomonas corrugata, Pseudomonas costantinii, Pseudomonas ficuserectae, Pseudomonas fuscovaginae, Pseudomonas marginalis, Pseudomonas mediterranea, Pseudomonas syringae pv. actinidiaeactinidiae), Pseudomonas meliae, Pseudomonas palleroniana, Pseudomonas salomonii, Pseudomonas agarici, Pseudomonas amygdali, Pseudomonas asplenii, Pseudomonas asiatica, Pseudomonas citronellolis, Pseudomonas taiwanensis, Pseudomonas avellanae, Pseudomonas plecoglossicida, It may be Pseudomonas cannabina, Pseudomonas inefficax, Pseudomonas monteilii, etc., and especially Pseudomonas fluorescens, Pseudomonas putida, Pseudomonas syringae pv. actinidiae, Pseudomonas asiatica, Pseudomonas citronelloris, Pseudomonas taiwanensis, Pseudomonas plecoglossida, Pseudomonas inepicax, Pseudomonas monteilii, etc., and especially Pseudomonas fluorescens, Pseudomonas putida, Pseudomonas syringae pv. It may be Actinidiae, Pseudomonas asiatica, Pseudomonas citronellolis, Pseudomonas plecoglossida, etc., and preferably Pseudomonas putida KT2440 strain.

[0060] In the present invention, the term "LvaED" refers to the LvaD gene and the LvaE gene. The LvaD gene and the LvaE gene may be polynucleotides having the base sequences of SEQ ID NOs: 7 and 8, respectively, and the LvaD enzyme and the LvaE enzyme encoded by the respective base sequences may be polypeptides. The LvaE enzyme is a short-chain acyl-CoA synthetase and can catalyze the conversion of levulinic acid into levulinic acid-CoA, thereby activating it. The LvaD enzyme is a 4-oxopentanoyl-CoA-4-dehydrogenase and can catalyze the conversion of levulinic acid-CoA into 4-hydroxyvaleric acid-CoA.

[0061] In the method for producing a genetically recombinant microorganism according to the invention, the gene having 30% or more identity with the LvaED gene may include a Re LvaE gene having a base sequence of SEQ ID NO: 1, a Re LvaD1 gene having a base sequence of SEQ ID NO: 2, and a Re LvaD2 gene having a base sequence of SEQ ID NO: 3.

[0062] In a method for producing a genetically recombinant microorganism according to the invention, a step of introducing into the microorganism at least one gene selected from the group consisting of PhaA having a base sequence of SEQ ID NO: 4, PhaB having a base sequence of SEQ ID NO: 5, and PhaC having a base sequence of SEQ ID NO: 6 may be further included. The PhaA and PhaB genes may be derived from a Ralstonia eutropha strain, and the PhaC gene may be derived from an Aeromonas salmonicida strain, but is not limited thereto.

[0063] In FIGS. 1 and 6, "LvaABC" refers to LvaA, LvaB, and LvaC genes. The LvaA gene may be a polynucleotide having a base sequence represented by SEQ ID NO: 9, and the LvaA enzyme encoded by the base sequence may be a polypeptide. The LvaB gene may be a polynucleotide having a base sequence represented by SEQ ID NO: 10, and the LvaB enzyme encoded by the base sequence may be a polypeptide. In addition, the LvaC gene may be a polynucleotide having a base sequence represented by SEQ ID NO: 11, and the LvaC enzyme may be a polypeptide.

[0064] The term "transformation" or "genetic recombination" used in the present invention means introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the target protein can be expressed in the host cell.

[0065] The following describes a method for producing polyhydroxyalkanoates.

[0066] A method for producing polyhydroxyalkanoate according to the invention comprises the steps of culturing the genetically recombinant microorganism described above; and obtaining polyhydroxyalkanoate produced from the genetically recombinant microorganism. The p3AZ2C-ReAB and pKM212 Re LvaE Re LvaD1 plasmids can be introduced. When the plasmids are introduced into a microorganism selected from the group consisting of the genus Escherichia, the genus Mannheimia, the genus Rhodobacter, and the genus Methylobacterium using a cloning (transformation) method and then cultured using levulinic acid and glucose as carbon sources, a polymer having a higher molar fraction of 4-hydroxyvalerate than before can be produced. The metabolic pathway for producing a polymer by introducing the ReLvaED1D2 gene derived from a Ralstonia eutropha strain is as shown in FIG. 2.

[0067] The method for producing polyhydroxyalkanoate according to the invention of the present disclosure may be a method in which the culturing step is performed by subculturing in a nitrogen-limited environment using levulinic acid as a main substrate.

[0068] Polyhydroxyalkanoates are thought to be produced by microorganisms to conserve energy in nutrient-limited environments. Because microorganisms struggle to grow in such environments, a process is necessary to initially produce microorganisms that have grown to a certain level. Therefore, microorganisms are first cultured in nutrient-rich complex media until they reach a certain size, and then subcultured onto nitrogen-limited defined media to induce polyhydroxyalkanoate polymer production.

[0069] The medium and other culture conditions used for culturing the microorganism of the present invention can be any medium used for conventional culture without particular limitations. Specifically, the microorganism of the present invention can be cultured under aerobic conditions in a conventional medium containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and / or vitamins, while controlling temperature, pH, etc.

[0070] The above-mentioned medium may contain potassium dihydrogen phosphate, dipotassium hydrogen phosphate, or sodium-containing salts as personnel. It may also contain metal salts such as magnesium sulfate or iron sulfate. In addition, amino acids, vitamins, and appropriate precursors may be included.

[0071] Additionally, the pH of the culture can be adjusted by appropriately adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the culture during cultivation. Furthermore, to maintain aerobic conditions in the culture, oxygen or oxygen-containing gas can be injected into the culture. To maintain anaerobic and microaerobic conditions, no gas can be injected, or nitrogen, hydrogen, or carbon dioxide can be injected.

[0072] The temperature of the culture medium may generally be 20°C to 40°C, specifically 25°C to 37°C, and more specifically 30°C, but may be varied without limitation depending on the intended purpose. The culture period may continue until the desired amount of useful material is produced, and may specifically be 10 to 100 hours, but is not limited thereto.

[0073] Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are intended only to illustrate the present invention and the scope of the present invention is not limited to these examples.

[0074] [Example]

[0075] Genetically recombinant microorganisms were produced using strains according to Table 1 below.

[0076] Name Characteristics Ralstonia eutropha KCTC2649 Wild type Pseudomonas putida KT2440 Wild type Escherichia coli XL1- Blue Wild type, recombinant strain

[0077] Specifically, the identity of the LvaED gene of Pseudomonas putida, for which the production mechanism of 4-hydroxyvalerate has been elucidated, and the gene of Ralstonia eutropha was compared, and among them, the genes with the highest genetic identity, Re LvaE, Re LvaD1, and Re LvaD2, are shown in Table 2 below.

[0078] Ralstonia eutrophapseudomonas putidaIdentity (%)Re LvaELvaE54.51Re LvaD1LvaD51.17Re LvaD2LvaD51.81

[0079] The primers used for plasmid construction are as follows.

[0080] Primer name sequence InformationRe_LvaE55_F_EcoRIaaaagaattcatgctgcccaggccgctgccacRe_LvaE55_R_XbaIaaaatctagatcatgggtgggtgccggaattgRe_LvaD52_1_F_SbfI_rbsaaaaacctgcaggtttcacacaggaaacagaccatgaaccagcaagaacgcaaRe_Lva D52_1_R_HindIIIaaaaaaagctttcagagcgagctgaccgcgtRe_LvaD52_2_F_SbfI_rbsaaaaacctgcaggtttcacaca ggaaacagaccatggcttccccacctcgtccacaaRe_LvaD52_2_R_HindIIIaaaaaaagctttcagagcgagctgaccagatgccc

[0081] The plasmid used was pKM212, which contains the pBBR1 origin, tac promoter, and kanamycin resistance. To construct a plasmid for specific use, the pKM212 plasmid was digested with EcoRI and XbaI. The Re LvaE gene from the genome of Ralstonia eutropha was amplified by PCR using the primers Re_LvaE55_F_EcoRI and Re_LvaE55_R_XbaI. The amplified gene was digested with EcoRI and XbaI, and ligated to the digested pKM212 plasmid. The constructed plasmid was then transformed into E. coli XL1-Blue strain, and colonies were selected on a medium supplemented with kanamycin antibiotic.

[0082] The constructed pKM212 Re LvaE plasmid was digested with SbfI and HindIII. The Re LvaD1 and Re LvaD2 genes from the genome of Ralstonia eutropha were amplified by PCR using primers Re_LvaD52_1_F_SbfI_rbs, Re_LvaD52_1_R_HindIII and Re_LvaD52_2_F_SbfI_rbs, Re_LvaD52_2_R_HindIII, respectively. The amplified genes were digested with SbfI and HindIII, and ligated with the digested pKM212 Re LvaE plasmid. After transformation into Escherichia coliXL1-Blue strain, pKM212 Re LvaE Re LvaD1, pKM212 Re LvaE Re LvaD2 plasmids were constructed by selecting colonies on a medium supplemented with kanamycin antibiotic. The constructed pKM212 Re LvaE Re LvaD1, pKM212 Re LvaE Re LvaD2 plasmids were introduced into Ralstonia eutropha strain through a transformation method. The transformation method is as follows.

[0083] Competent cells of Escherichia coli XL1-Blue strain were created, plasmids were inserted, and heat-shocked at 42°C for 1 minute and 30 seconds. 1 mL of LB liquid medium was added and recovered for 1 hour in a 37°C shaker. Centrifugation was then performed, the supernatant was discarded, and the cells were resuspended and spread on LB solid medium containing kanamycin antibiotic. At this time, plasmid p3AZ2CReAB containing the PhaA and PhaB genes of Ralstonia eutropha and the PhaC gene of Aeromonas salmonicida was introduced together to produce polyhydroxyalkanoates including 3-hydroxybutyrate and 4-hydroxyvalerate.

[0084] Escherichia coli XL1-Blue strains containing pKM212 Re LvaE Re LvaD1 and p3AZ2CReAB, pKM212 Re LvaE Re LvaD2 and p3AZ2CReAB plasmids were inoculated into 10 ml of LB liquid medium containing kanamycin and ampicillin antibiotics, and cultured at 37°C for one day. Afterwards, MR containing kanamycin and ampicillin antibiotics (per liter: 6.67 g KH2PO4, 4 g (NH4)2HPO4, 0.8 g MgSO4·7H2O, 0.8 g citric acid, 5 ml trace metal solution, Trace metal solution per liter of 0.5M HCl: 10 g FeSO4·7H2O, 2 g CaCl2, 2.2 g ZnSO4·7H2O, 0.5 g MnSO4·4H2O, 1 g CuSO4·5H2O, 0.1 g (NH4)6M o7 O 24 ·4H2O, 0.02 g Na2B4O7·10H2O) 1 mL of culture solution was inoculated into a 250 mL flask containing 100 mL of liquid medium and cultured at 30°C for 72 hours. 20 g / L glucose and 1 g / L levulinic acid were included as carbon sources. All experiments were performed in triplicate.

[0085] After the incubation was completed, the culture solution was centrifuged at 4,000 rpm for 20 minutes at 4°C to collect the pellet, which was washed twice and then dried at 65°C for one day. The dried pellet was reacted with 2 mL of chloroform and 1 mL of PHA solution at 95°C for one day for PHA analysis, and after cooling to room temperature, 1 mL of tertiary water was added and vortexed. The separated reactant (organic solvent layer) was then analyzed by GC.

[0086] In Table 4 below, the results of culturing E. coli introduced with p3AZ2C-ReAB and pKM212 Re LvaE Re LvaD1 plasmids are shown as Example 1, and the results of culturing E. coli introduced with p3AZ2C-ReAB and pKM212 Re LvaE Re LvaD2 plasmids are shown as Example 2.

[0087] PHA content (%)PHA conc. (g / L)3HB mol%4HV mol%Example 164.000.7098.481.52Example 268.251.4199.720.28

[0088] PHA: Polyhydroxyalkanoate 3HB: 3-hydroxybutyrate 4HV: 4-hydroxyvalerate

[0089] According to Table 4 above, it was confirmed that polyhydroxyalkanoate containing 4-hydroxyvalerate can be produced in E. coli by introducing genes of Ralstonia eutropha, which are thought to have the same role as the LvaED gene of Pseudomonas putida, and through this, it was confirmed that Re LvaE, Re LvaD1, and Re LvaD2 of Ralstonia eutropha have similar roles to the LvaED gene of Pseudomonas putida, and it is explained that polyhydroxyalkanoate containing 4-hydroxyvalerate can be produced in E. coli by introducing these genes.

[0090] In one embodiment, a genetically recombinant microorganism comprises at least one foreign gene, wherein the foreign gene comprises a gene having a base sequence encoding 4-hydroxyvalerate, and a gene having the base sequence derived from any strain selected from the genus Ralstonia is introduced into the microorganism.

[0091] Additionally, the gene having the base sequence encoding the above 4-hydroxyvalerate may include the Re LvaE, Re LvaD1, and Re LvaD2 genes.

[0092] Additionally, the above Re LvaE gene may have the base sequence of sequence number 1.

[0093] Additionally, the above Re LvaD1 gene may have the base sequence of sequence number 2.

[0094] Additionally, the above Re LvaD2 gene may have the base sequence of sequence number 3.

[0095] Additionally, the strain may be a Ralstonia eutropha strain.

[0096] Additionally, the microorganism may be selected from the group consisting of the genus Escherichia, the genus Mannheimia, the genus Rhodobacter, and the genus Methylobacterium.

[0097] In addition, the genetically recombinant microorganism may further include a gene selected from the group consisting of PhaA having a base sequence of sequence number 4, PhaB having a base sequence of sequence number 5, and PhaC having a base sequence of sequence number 6.

[0098] Additionally, the genetically recombinant microorganism can produce polyhydroxyalkanoate having an increased 4-hydroxyvalerate mole fraction (%).

[0099] A method for producing a genetically recombinant microorganism according to one embodiment comprises the steps of: isolating an LvaED gene from a strain selected from the genus Pseudomonas; comparing the identity of the isolated LvaED gene with a gene of a strain selected from the genus Ralstonia; isolating a gene having an identity of 30% or more with the LvaED gene among the genes of the strain selected from the genus Ralstonia; and introducing a gene derived from the strain selected from the isolated Ralstonia into a microorganism.

[0100] Additionally, the LvaE gene may have a base sequence of sequence number 7.

[0101] Additionally, the LvaD gene may have a base sequence of sequence number 8.

[0102] In addition, genes having 30% or more identity with the LvaED gene may include Re LvaE having a base sequence of sequence number 1, Re LvaD1 having a base sequence of sequence number 2, and Re LvaD2 having a base sequence of sequence number 3.

[0103] In addition, the method may further include a step of introducing into the microorganism at least one gene selected from the group consisting of PhaA having a base sequence of sequence number 4, PhaB having a base sequence of sequence number 5, and PhaC having a base sequence of sequence number 6.

[0104] Additionally, the microorganism may be selected from the group consisting of the genus Escherichia, the genus Mannheimia, the genus Rhodobacter, and the genus Methylobacterium.

[0105] A method for producing polyhydroxyalkanoate according to one embodiment comprises the steps of culturing a genetically recombinant microorganism; and the step of obtaining polyhydroxyalkanoate produced from the genetically recombinant microorganism.

[0106] In addition, the method for producing polyhydroxyalkanoate may be such that the culturing step is performed by subculturing in a nitrogen-limited environment using levulinic acid as the main substrate.

[0107] In addition, the method for producing polyhydroxyalkanoate may be such that the polyhydroxyalkanoate obtained above has an increased 4-hydroxyvalerate mole fraction (%).

[0108] In addition, the method for producing polyhydroxyalkanoate may be such that the polyhydroxyalkanoate is at least one selected from the group consisting of poly(3-hydroxybutyrate), poly(3-hydroxyvalerate), poly(4-hydroxyvalerate), poly(3-hydroxybutyrate-co-3-hydroxyvalerate), poly(3-hydroxybutyrate-co-4-hydroxyvalerate), poly(3-hydroxyvalerate-co-4-hydroxyvalerate), and poly(3-hydroxybutyrate-co-4-hydroxyvalerate-co-4-hydroxyvalerate).

[0109] Above, a method for producing a genetically recombinant microorganism and polyhydroxyalkanoate according to one embodiment has been described.

[0110] Although the embodiments of the invention disclosed above have been illustrated and described, the disclosed invention is not limited to the specific embodiments described above, and various modifications may be implemented by a person having ordinary skill in the art to which the disclosed invention pertains without departing from the gist claimed in the claims.

[0111] Attached electronic file of sequence list (D: / Auto Backup / Desktop / 0524 / Genetically recombinant microorganism producing polyhydroxyalkanoate and method for producing the same.xml)

Claims

1. Contains at least one foreign gene, The above foreign gene comprises a gene having a base sequence encoding 4-hydroxyvalerate, A genetically recombinant microorganism, wherein a gene having the above base sequence derived from any strain selected from the genus Ralstonia is introduced into the microorganism.

2. In claim 1, A genetically recombinant microorganism comprising a gene having a base sequence encoding the above 4-hydroxyvalerate, comprising Re LvaE, Re LvaD1, and Re LvaD2 genes.

3. In claim 2, A genetically recombinant microorganism having the above Re LvaE gene having the base sequence of sequence number 1.

4. In claim 2, The above Re LvaD1 gene is a genetically recombinant microorganism having the base sequence of sequence number 2.

5. In claim 2, The above Re LvaD2 gene is a genetically recombinant microorganism having the base sequence of sequence number 3.

6. In claim 1, The above strain is a genetically recombinant microorganism, Ralstonia eutropha strain.

7. In claim 1, The above microorganism is a genetically recombinant microorganism selected from the group consisting of the genus Escherichia, the genus Mannheimia, the genus Rhodobacter, and the genus Methylobacterium.

8. In claim 1, The above genetically recombinant microorganism further comprises a gene selected from the group consisting of PhaA having a base sequence of sequence number 4, PhaB having a base sequence of sequence number 5, and PhaC having a base sequence of sequence number 6.

9. In claim 1, The above genetically recombinant microorganism is a genetically recombinant microorganism that produces polyhydroxyalkanoate having an increased mole fraction (%) of 4-hydroxyvalerate.

10. A step of isolating the LvaED gene from a strain selected from the genus Pseudomonas; A step of comparing the identity of the above separated LvaED gene with the gene of a strain selected from the genus Ralstonia; A step of isolating a gene having the highest identity with the LvaED gene among the genes of a strain selected from the genus Ralstonia; and A step of introducing a gene derived from a strain selected from the above separated Ralstonia spp. into a microorganism; A method for producing a genetically recombinant microorganism, comprising:

11. In claim 10, A method for producing a genetically recombinant microorganism, wherein the LvaE gene has a base sequence of sequence number 7.

12. In claim 10, A method for producing a genetically recombinant microorganism, wherein the LvaD gene has a base sequence of sequence number 8.

13. In claim 10, A method for producing a genetically recombinant microorganism, wherein the genes having the highest identity with the above LvaED gene include ReLvaE having a base sequence of sequence number 1, ReLvaD1 having a base sequence of sequence number 2, and ReLvaD2 having a base sequence of sequence number 3.

14. In claim 10, A method for producing a genetically recombinant microorganism, further comprising the step of introducing into the microorganism at least one gene selected from the group consisting of PhaA having a base sequence of sequence number 4, PhaB having a base sequence of sequence number 5, and PhaC having a base sequence of sequence number 6.

15. In claim 10, A method for producing a genetically recombinant microorganism, wherein the above microorganism is selected from the group consisting of the genus Escherichia, the genus Mannheimia, the genus Rhodobacter, and the genus Methylobacterium.

Images