Systems and methods for enhancing macroalgae production

Abstract

The present disclosure generally relates to enhancing macroalgae production and, in some cases, to enhancing macroalgae production using microorganisms or holobionts. Certain aspects, for example, are generally drawn to methods or compositions for providing a beneficial macroalgae holobiont. For instance, various embodiments are directed to certain combinations of bacteria, which can be used to improve macroalgae production. In some cases, the compositions may be provided as powders or other formulations, which may be freeze-dried. The compositions may include one or more bacteria from a variety of taxa, such as Alteromonas, Alcanivorax, and others. In certain embodiments, the compositions may be applied to a macroalgae aquaculture, e.g., in a tank or other artificial system, in an ocean- based system, or the like. Other aspects are generally drawn to macroalgae exposed to such compositions, methods of making or using such compositions, kits involving such compositions, or the like.

Description

[0001]SYSTEMS AND METHODS FOR ENHANCING MACROALGAE PRODUCTION RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application Serial No. 63 / 516,149, filed July 28, 2023, entitled “Systems and Methods for Enhancing Macroalgae Production,” incorporated herein by reference in its entirety. FIELD The present disclosure generally relates to enhancing macroalgae production and, in some cases, to enhancing macroalgae production using microorganisms or holobionts. BACKGROUND Aquacultured plants and algae can be found associated with an ecosystem of associated microorganisms, which are linked to plant survival and performance. However, modern aquaculture practices may perturb this relationship, resulting in increased crop losses, diminished stress resilience, biodiversity loss, or increasing dependence on external chemicals, fertilizers, and other unsustainable practices. Thus there is a need for methods of fortifying the microbial community of cultivated macroalgae in a way that can sustainably increase yield, stress resilience, decrease fertilizer use, and / or chemical use, or the like. SUMMARY The present disclosure generally relates to enhancing macroalgae production and, in some cases, to enhancing macroalgae production using microorganisms or holobionts. The subject matter of the present disclosure involves, in some cases, interrelated products, alternative solutions to a particular problem, and / or a plurality of different uses of one or more systems and / or articles. As an example, certain embodiments relate to methods or compositions for providing a beneficial macroalgae holobiont, including benefits to seed or derived plants. For instance, various embodiments are directed to specifically purified complex bacteria or synthetic combinations of bacteria, methods for using and making them in macroalgae production, or the like. In some cases, these may result in certain improved traits, such as improved germination rates, emergence rates, tissue biomass, macroalgae surface areas, enhanced nutrient conversion, yield, or the like. These may be used, for example, in under tank or ocean-based cultivation systems. One aspect is generally directed to a composition. In one set of embodiments, the composition comprises a formulation having a moisture content of less than 20 wt% or less than 5 wt% and comprising bacteria, wherein the bacteria comprise an Alteromonas species and an Alcanivorax species at a ratio of between 2:1 and 10:1. Another aspect is generally drawn to a method. In accordance with one set of embodiments, the method comprises adding a formulation comprising bacteria to a macroalgae aquaculture. In some cases, the bacteria comprise an Alteromonas species and an Alcanivorax species at a ratio of between 2:1 and 10:1. The method, in another set of embodiments, comprises adding a formulation comprising an Alteromonas species to a macroalgae aquaculture comprising an Asparagopsis species to increase the concentration of Alteromonas by 106CFU / L to 109CFU / L of macroalgae aquaculture. In yet another set of embodiments, the method comprises adding a freeze-dried formulation comprising bacteria to a macroalgae aquaculture. In some cases, the formulation comprises at least 2 marine bacteria species preserved in a freeze-dried state. In another aspect, the present disclosure encompasses methods of making one or more of the embodiments described herein, for example, compositions for use in enhancing macroalgae production. In still another aspect, the present disclosure encompasses methods of using one or more of the embodiments described herein, for example, compositions for use in enhancing macroalgae production. Other advantages and novel features of the present disclosure will become apparent from the following detailed description of various non-limiting embodiments of the disclosure when considered in conjunction with the accompanying figures. BRIEF DESCRIPTION OF THE DRAWINGS Non-limiting embodiments of the present disclosure will be described by way of example with reference to the accompanying figures, which are schematic and are not intended to be drawn to scale. In the figures, each identical or nearly identical component illustrated is typically represented by a single numeral. For purposes of clarity, not every component is labeled in every figure, nor is every component of each embodiment of the disclosure shown where illustration is not necessary to allow those of ordinary skill in the art to understand the disclosure. In the figures: Figs. 1A-1B illustrate the effects of Alteromonas on a macroalgae aquaculture, in accordance with one embodiment; Figs. 2A-2B illustrate the effects of Alcanivorax on a macroalgae aquaculture, in another embodiment; Fig. 3 illustrates inoculation treatment vs. DGR, in yet another embodiment; Fig. 4 illustrates inoculation treatment vs. PAM, in still another embodiment; Fig. 5 illustrates percent nitrate uptake vs. PAM, in another embodiment; and Fig. 6 illustrates treatment vs. nitrate uptake, in yet another embodiment. DETAILED DESCRIPTION The present disclosure generally relates to enhancing macroalgae production and, in some cases, to enhancing macroalgae production using microorganisms or holobionts. Certain aspects, for example, are generally drawn to methods or compositions for providing a beneficial macroalgae holobiont. For instance, various embodiments are directed to certain combinations of bacteria, which can be used to improve macroalgae production. In some cases, the compositions may be provided as powders or other formulations, which may be freeze-dried. The compositions may include one or more bacteria from a variety of taxa, such as Alteromonas, Alcanivorax, and others. In certain embodiments, the compositions may be applied to a macroalgae aquaculture, e.g., in a tank or other artificial system, in an ocean- based system, or the like. Other aspects are generally drawn to macroalgae exposed to such compositions, methods of making or using such compositions, kits involving such compositions, or the like. One aspect is generally drawn to compositions that can be used to enhance macroalgae production. Macroalgae are also known as seaweed, and include a variety of species, such as Asparagopsis (red macroalgae), or others including those discussed herein. Macroalgae may be cultivated, or “farmed,” e.g., in an aquaculture setting, for a variety of uses, such as food, animal feed, biofuel, raw materials for chemical production, or the like. The aquaculture may occur in artificially constructed systems (e.g., tanks, aquariums, raceways, tubular systems, greenhouses, etc.), or in an ocean-based system. The compositions may be added at any suitable point, e.g., to the water containing the macroalgae, and / or directly to the macroalgae, e.g., to various macroalgae tissues. In addition, in certain embodiments, the compositions may be applied multiple times to a macroalgae aquaculture. In some embodiments, the composition may contain one or more types of bacteria. For example, the composition may contain bacteria from two or more taxa (for example, Alteromonas and Alcanivorax), and may be present in any suitable ratio or amount. Without wishing to be bound by any theory, it is believed that many macroalgae naturally form associations with various microorganisms, which may together form a symbiotic relationship, e.g., promoting growth of the macroalgae. As such relationship may be lost in many aquaculture settings, certain embodiments such as discussed herein are directed to artificially-created compositions that can be used to expose certain types of microorganisms (e.g., bacteria) to macroalgae, for example, in order to enhance macroalgae production or improve certain traits, etc. Furthermore, in accordance with certain embodiments, such compositions can be formulated to allow them to be stored or transported for long periods of time, e.g., using standard storage and transportation methods used in the safeguarding of bacteria organisms, or in dry or non-oceanic environments, for example, prior to use. Thus, for example, the composition may be formulated in a powder, e.g., formed via lyophilization, that can be added to a macroalgae aquaculture as needed. The above discussion is a non-limiting example of certain embodiments generally directed to compositions for enhancing macroalgae production. However, it should be understood that other aspects are also possible. For example, various compositions such as any of those described herein can be used to enhance a variety of macroalgae, in certain aspects of the invention. As mentioned, macroalgae are also sometimes known as seaweed, and encompass a variety of macroscopic, multicellular, marine algae. One example of macroalgae are those belonging to the genus Asparagopsis, also known as the red macroalgae. Many such macroalgae are edible. Non-limiting examples of seaweed within the red macroalgae genus include Asparagopsis taxiformis or Asparagopsis armata. Various cultivars have been developed, including the Icarus variety described in US Plant Patent No. PP 34,510, incorporated herein by reference. Other examples of macroalgae that may be enhanced include, but are not limited to, macroalgae in the following families: Acinetosporaceae, Agaraceae, Ahnfelitaceae, Alariaceae, Arthrospira, Bangiaceae, Bonnemaisoniaceae, Caulerpacaea, Chlorella, Chordariaceae, Cladophoraceae, Codiaceae, Compsopogonales, Cyanidioschyzonaceae, Cyanidiaceae, Cylindrospermum, Delesseriaceae, Desmarestiaceae, Dictyotaceae, Dumontiaceae, Erythropeltales, Fucaceae, Furcellariaceae, Gelidiellacaeae, Gigartinaceae, Gracilariaceae, Halimedacaea, Haylmedacaea, Laminariaceae, Naccariaceae, Nannochloropsis, Palmariaceae, Phaeophyceae, Phyllophoraceae, Phragmonemataceae, Porphyridiaceae, Pterocladiaceae, Rhodomelaceae, Rhodochaetales, Rhizophyllidacaeae, Rhodomelaceae, Rufusiaceae, Sargassacaea, Sphacelariaeceae, Stylonemataceae, or Ulvaceae. In addition, in some cases, more than one type of macroalgae may be present in an aquaculture setting. As mentioned, macroalgae may be cultivated, or “farmed,” e.g., in an aquaculture setting. In some cases, the aquaculture may be present in an artificially constructed system. Examples include but are not limited to, tanks, aquariums, artificial ponds, canals, etc. In addition, in some embodiments, the aquaculture may be present in an ocean-based system (e.g., in shallow waters of the ocean, enclosed sections of ocean water, etc.). For example, the macroalgae may be cultivated attached or unattached to a substrate, e.g., in enclosed sections of open ocean, farms in littoral waters, in artificially constructed tanks, aquariums, ponds, canals, etc. that contain ocean water, or the like. In certain aspects, the macroalgae in such aquaculture settings may be enhanced by exposing the macroalgae to certain compositions, e.g., as discussed herein. In some cases, the compositions may be added to the macroalgae to improve certain traits, such as improved tissue biomass, tissue content of certain compounds, photosynthetic capability, germinationrates, emergence rates, or the like.For example, emergence can be quantified by countingthe number of tetrasporangia or carposporangia under microscopy. Germination can be quantified by the number of settled and productive carpospores or tetraspores counted under microscopy. For example, in some cases, exposure of the macroalgae to compositions such as those described herein may result in increased biomass, e.g., when compared to similar macroalgae not treated with such compositions. In some cases, the treated macroalgae may exhibit an increase in biomass of at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%, etc., after a period of time of at least 3 days, 5 days, 7 days, or 10 days, i.e., as compared to untreated macroalgae identically raised. As another example, in certain cases, exposure of the macroalgae to compositions such as those described herein may result in enhanced photosynthetic capacity, e.g., when compared to similar macroalgae not treated with such compositions. For instance, in some cases, the treated macroalgae may exhibit an increase in photosynthetic capacity, as measured by fluorescence-based techniques such as PAM fluorescence, of at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%, etc., after a period of time of at least 3 days, 5 days, 7 days, or 10 days, e.g., as compared to untreated macroalgae identically raised. As is known by those of ordinary skill in the art, PAM (Pulse Amplitude Modulated) fluorescence can be used to estimate the minimum (Fo) and maximum (Fm) fluorescence yield of the algae. Other fluorescence techniques can also be used to estimate Fo and Fm. The information derived from quantifying Fo and Fm (which may be in combination with knowledge of the photoadaptive state of the algae) can be used to estimate the photosynthetic capacity of the algae, i.e., its capacity to photosynthesize. Other techniques of determining photosynthetic capacity, such as Y(II), ^F / Fm’ (Delta F / Fm’), ETR, OJIP, OJIDP, etc. can also be used in other embodiments. The composition may be added at any suitable point in time, in accordance with certain aspects. For example, the composition may be added at early hatchery stages to expose or dose “juvenile” tissue fragments of macroalgae, in aquaculture with regular dosing to continuously supplement the microbiome of the macroalgae, after an antibiotic treatment to repopulate the of macroalgae with bacteria, or at other times including any of those described herein. The composition may be added, for example, to the water containing the macroalgae within an aquaculture and / or directly to various macroalgae tissues, e.g., to the apical tips, holdfast, stipe, etc. of the macroalgae. The composition may be applied in any suitable manner to the aquaculture and / or to the macroalgae. In one set of embodiments, for example, the composition may be present as a powder or other formulation, which may be dispersed into the water within the aquaculture, or brushed upon a surface of the macroalgae. Otherexamples includepulse dosing, automated release, continuous infusion, single inoculation, or other techniques. In some cases, the powder or other formulation may first be reconstituted in water, e.g., to form a solution or suspension. In addition, in some cases, the composition may be present as a liquid, e.g., as a solution or suspension. The liquid can then be dispersed into the water within the aquaculture, or the macroalgae dipped into the liquid containing the bacteria, etc., for example, using techniques such as those described above. In some cases, for example, the composition may be added to the aquaculture to increase the bacteria from the composition within the aquaculture by at least 103CFU / L, at least 104CFU / L, at least 105CFU / L, at least 106CFU / L, at least 107CFU / L, at least 108CFU / L, at least 109CFU / L, or at least 1010CFU / L, i.e., colony forming units of bacteria (CFU) per liter of solution of the aquaculture. Examples of bacteria that may be increased include any of those discussed herein. In some cases, the increase may be no more than 1010CFU / L, no more than 109CFU / L, no more than 108CFU / L, no more than 107CFU / L, no more than 106CFU / L, no more than 105CFU / L, no more than 104CFU / L, or no more than 103CFU / L. Combinations of any of these are also possible in still other embodiments; for instance, the composition may be added to the aquaculture to increase the concentration by between 106CFU / L and 109CFU / L, between 103CFU / L and 104CFU / L, between 105CFU / L and 1010CFU / L, between 106CFU / L and 107CFU / L, between CFU / L 103and 108CFU / L, etc. In some cases, the CFU / L (or CFU / mL) can be determined via proxy testing on marine agar plates using traditional plate count techniques. Other non-limiting example techniques for determining CFU / L counts include, but are not limited to, direct fluorescence microscopy, turbidity via spectrometry or other phototransmission, cell counter techniques, most probable number estimations, or the like. The composition may be applied to the aquaculture at any suitable dosage or frequency. For instance, a composition may be applied to an aquaculture only once, or more than once, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times. If the composition is applied multiple times, any suitable rate may be used in various embodiments. For example, the composition may be applied once per day, once every other day, once every other day, once every week, once every 2 weeks, once every 4 weeks, etc. It addition, it should be understood that for multiple applications, the same or different techniques may be used to apply the composition in each application. In certain embodiments, the composition may be added to the aquaculture at a dosage of at least 0.1 g of composition / L of aquaculture. In some cases, the dosage may be at least 0.2 g / L, at least 0.3 g / L, at least 0.5 g / L, at least 1 g / L, at least 2 g / L, at least 3 g / L, at least 5 g / L, at least 10 g / L, at least 20 g / L, at least 30 g / L, at least 50 g / L, at least 100 g / L, etc. The dosage, in certain cases, may be no more than 100 g / L, no more than 50 g / L, no more than 30 g / L, no more than 20 g / L, no more than 10 g / L, no more than 5 g / L, no more than 3 g / L, no more than 2 g / L, no more than 1 g / L, no more than 0.5 g / L, no more than 0.3 g / L, no more than 0.2 g / L, or no more than 0.1 g / L. Combinations of any of these are also possible. For example, the dosage may be between 0.1 g / L and 10 g / L, between 20 g / L and 50 g / L, between 0.3 g / L and 5 g / L, or the like. In some cases, the composition may be added to aquaculture cultivation media, e.g., to produce these concentrations. Various bacteria may also be present within the composition in accordance with certain aspects. The composition may only have a single type of bacteria, or 2, 3, 4, 5, 6, 7, 8, 9, 10, or more species may be present within a composition, in other embodiments. The bacteria may be marine bacteria, e.g., bacteria that live in marine or oceanic environments, and cannot live in drier (e.g., not in air) or less salty environments (e.g., not in fresh water). However, in certain cases, the bacteria may be able to survive in other environments in addition to marine environments. For example, the bacteria, in certain embodiments, may be able to also survive in freshwater, and / or terrestrial environments. In some embodiments, for instance, certain species or strains of Bacillus or Micrococcus can survive in one of or all three environments.In some cases, the bacteria may be preserved within the composition, e.g., in a lyophilized orfreeze-dried state. Examples of bacteria that may be present include, but are not limited to, any one or more of the following taxa: Alteromonas, Alcanivorax, Hyphomonas, Cognatishimia, Roseobacter, Bosea, Erythrobacter, Hoflea, Imperialibacter, Marinobacter, Rhizobium, Roseovarius, Sphingomonas, or the like. Examples of Alteromonas include, but are not limited to, Alteromonas addita, Alteromonas genovensis, Alteromonas hispanica, Alteromonas litorea, Alteromonas macleodii, Alteromonas marina, Alteromonas simiduii, Alteromonas stellipolaris, or Alteromonas tagae. In some embodiments, the Alteromonas is a strain identified as ATCC 27126, or has a 16S ribosomal identification sequence that is at least 90% or at least 95% identical to SEQ ID NO: 2. In certain embodiments, the Alteromonas has a 16S ribosomal identification sequence that is at least 90% or at least 95% identical to the 16S ribosomal identification sequence found in Alteromonas addita, Alteromonas genovensis, Alteromonas hispanica, Alteromonas litorea, Alteromonas macleodii, Alteromonas marina, Alteromonas simiduii, Alteromonas stellipolaris, or Alteromonas tagae. Non-limiting examples of Alcanivorax include Alcanivorax balearicus, Alcanivorax borkumensis, Alcanivorax dieselolei, Alcanivorax gelatiniphagus, Alcanivorax hongdengensis, Alcanivorax indicus, Alcanivorax jadensis, Alcanivorax limicola, Alcanivorax marinus, Alcanivorax mobilis, Alcanivorax nanhaiticus, Alcanivorax pacificus, Alcanivorax profundi, Alcanivorax profundimaris, Alcanivorax sediminis, Alcanivorax venustensis, or Alcanivorax xenomutans. In some embodiments, the Alcanivorax is a strain identified as JC109, or has a 16S ribosomal identification sequence that is at least 90% or at least 95% identical to SEQ ID NO: 1. In certain embodiments, the Alcanivorax has a 16S ribosomal identification sequence that is at least 90% or at least 95% identical to the 16S ribosomal identification sequence found in Alcanivorax balearicus, Alcanivorax borkumensis, Alcanivorax dieselolei, Alcanivorax gelatiniphagus, Alcanivorax hongdengensis, Alcanivorax indicus, Alcanivorax jadensis, Alcanivorax limicola, Alcanivorax marinus, Alcanivorax mobilis, Alcanivorax nanhaiticus, Alcanivorax pacificus, Alcanivorax profundi, Alcanivorax profundimaris, Alcanivorax sediminis, Alcanivorax venustensis, or Alcanivorax xenomutans. In certain cases, if more than one bacteria is present, the bacteria may be present in any suitable ratio. For instance, two bacteria present in a composition (e.g., Alteromonas and Alcanivorax) may be present at a ratio of at least 0.1:1, at least 0.2:1, at least 0.3:1, at least 0.4:1, at least 0.5:1, at least 0.6:1, at least 0.7:1, at least 0.8:1, at least 0.9:1, at least 1:1, at least 2:1, at least 3:1 at least 4:1, at least 5:1, at least 6:1, at least 7:1, at least 8:1, at least 9:1, at least 10:1, etc., and / or no more than 10:1, no more than 9:1, no more than 8:1, no more than 7:1, no more than 6:1, no more than 5:1, no more than 4:1, no more than 3:1, no more than 2:1, no more than 1:1, no more than 0.9:1, no more than 0.8:1, no more than 0.7:1, no more than 0.6:1, no more than 0.5:1, no more than 0.4:1, no more than 0.3:1, no more than 0,2:1, no more than 0.1:1, etc. Combinations of any of these are possible. For example, the bacteria may be present at a ratio of between 2:1 and 10:1, between 2:1 and 4:1, between 7:1 and 9:1, or the like. In some cases, the combination of Alcanivorax and Alteromonas may result in surprising benefits, compared to individually adding either alone to an aquaculture. Without wishing to be bound by any theory, it is believed that certain concentrations of Alteromonas are desirable, but higher concentrations of Alteromonas may be less desirable. By including Alcanivorax at concentrations below harmful levels, the Alcanivorax may compete with the Alteromonas, and thereby keep the Alteromonas to desirable concentrations. Those of ordinary skill in the art will be able to identify such bacteria, e.g., using technique such as genotypic sequencing, e.g., 16S ribosomal identification, PCR, ELISA- based methods, or the like. For example, in some cases, 16S rRNA Sanger sequencing of genomic DNA of bacteria isolated from an aquaculture (e.g., using PureLinkTMMicrobiome DNA Purification Kits, or other known techniques) can be used to determine the bacteria. Non-limiting examples of certain bacterial species and their 16S rRNA sequences, identified via 27F or 1492R primers, are shown in the table below: Table 1 S ecies 16s rRNA Se uence Se uence No ACTTATCGCGTTAGCTGCGCCACCAAAGTCACTAA GTTGCATCGAATTAAACCACATGCTCCACCGCTTGT CATTGTAGCATGCGTGAAGCCCAAGACATANNGG In addition, in certain aspects, the composition may be formulated to allow the bacteria to be stored or transported for long periods of time, e.g., in dry or non-oceanic environments, prior to use. Indeed, many such bacteria are oceanic and are not naturally found in dry or desiccated environments; in many cases, such bacteria do not naturally exist in air, and can only be found under water. Thus, in one set of embodiments, compositions such as those described herein may be useful for preserving or storing bacteria in non- naturally conditions, e.g., for extended periods of time, for example in a desiccated formulation. For instance, in one set of embodiments, the composition may be a desiccated formulation, e.g., having a moisture or water content of less than 25 wt%, less than 20 wt%, less than 15 wt%, less than 12 wt%, less than 10 wt%, less than 7 wt%, less than 5 wt%, less than 3 wt%, less than 1 wt%, etc. In some cases, the composition may be a powder, e.g., formed via lyophilization or freeze-drying techniques. In some cases, a composition may be prepared from an aqueous or oceanic solution containing the bacteria. The solution may be freeze-dried under various conditions to preserve the bacteria. Freeze-drying the solution may result in a powder or other formulation (e.g., a solid formulation) containing the bacteria. Those of ordinary skill in the art will be aware of various techniques useful for freeze- drying bacteria. As a non-limiting example, in one embodiment, freeze drying may include exposing a solution containing bacteria to a temperature of between -20oC and -50oC; applying vacuum to a pressure of at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% (100% = pure vacuum); primary drying, where the temperature is between -15oC and -30oC for a period of time of at least 2 hours, at least 3 hours, at least 4 hours, at least 6 hours, at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours; and secondary drying, where the temperature is between -120oC and 20oC for a period of time of at least 2 hours, at least 3 hours, at least 4 hours, at least 6 hours, at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours and / or no more than 48 hours, no more than 36 hours, no more than 24 hours, no more than 12 hours, no more than 6 hours, no more than 4 hours, no more than 3 hours, no more than 2 hours, etc. Other variations and methods for freeze drying bacteria will be known to those of ordinary skill in the art. In addition, in some cases, the composition may contain lyophilization media to facilitate the freeze-drying process. For example, the composition may contain buffers containing sucrose or other sugars that reduce damage to the bacteria during the freeze-drying process. Other examples of sugars that may be present in a buffer include, but are not limited to, trehalose, raffinose, glucose, maltose, or the like. Those of ordinary skill in the art will be aware of other techniques for freeze-drying bacteria. In some embodiments, the lyophilization media may include a lyoprotectant carbohydrate source, and may also include a protein source. Some examples of lyophilization media include, but are not limited to skim milk dissolved in deionized water, or sucrose dissolved in deionized water, e.g., at concentrations of at least 1% (as determined by g / l of solution), at least 3%, at least 5%, at least 7%, at least 10%, at least 13%, at least 15%, at least 20%, etc., and / or at concentrations of no more than 20%, no more than 15%, no more than 13%, no more than 10%, no more than 7%, no more than 5%, no more than 3%, or no more than 1%. Combinations of any of these are also possible, e.g., the concentration may be between 7% and 13%, between 5% and 10%, between 13% and 15%, etc. In another set of embodiments, the lyophilization media may contain a culture broth, a sugar, and a plant protein and / or bovine serum albumin (BSA), all mixed into deionized water. Examples of sugars include trehalose or sucrose. Examples of culture broth include, but are not limited to, trypticase soy broth, phenol red carbohydrate broth, MR-VP broth, and nutrient broth. In some cases, the lyophilization media may contain at least 1%, at least 3%, at least 5%, at least 7%, at least 10%, etc., and / or at concentrations of no more than 10%, no more than 7%, no more than 5%, no more than 3%, or no more than 1% of plant protein and / or BSA. In addition, in some cases, the lyophilization media may contain at least 5%, at least 7%, at least 10%, at least 13%, at least 15%, at least 20%, etc., and / or at concentrations of no more than 20%, no more than 15%, no more than 13%, no more than 10%, no more than 7%, no more than 5% of sugar. In some cases, the lyophilization media may contain at least 1%, at least 3%, at least 5%, at least 7%, at least 10%, etc., and / or at concentrations of no more than 10%, no more than 7%, no more than 5%, no more than 3%, or no more than 1% of a culture broth. For example, in one embodiment, the lyophilization media may contain ~1% trypticase soy broth, ~10% sucrose, and ~5% plant protein and / or bovine serum albumin (BSA), all mixed into deionized water. In certain embodiments, the composition may be formulated such that, after freeze- drying, the concentration of a species of bacteria may be at least 103CFU / g, at least 104CFU / g, at least 105CFU / g, at least 106CFU / g, at least 107CFU / g, at least 108CFU / g, at least 109CFU / g, or at least 1010CFU / g of the final composition. In some cases, however, the composition may be formulated to have no more than 1010CFU / g, no more than 109CFU / g, no more than 108CFU / g, no more than 107CFU / g, no more than 106CFU / g, no more than 105CFU / g, no more than 104CFU / g, or no more than 103CFU / g. Combinations of any of these are also possible in still other embodiments; for instance, the composition may be added to the aquaculture to increase the concentration by between 106CFU / g and 109CFU / g, between 103CFU / g and 104CFU / g, between 105CFU / g and 1010CFU / g, between 106CFU / g and 107CFU / g, between CFU / g 103and 108CFU / g, etc. In certain embodiments, the compositions may be relatively shelf stable. For example, the compositions may be prepared such that at least 10% of the CFUs are viable after storage, e.g., in desiccated form. In some cases, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the bacteria present within the composition are viable and can form CFUs after storage, e.g., in a desiccated or lyophilized state. In addition, in certain embodiments, the composition may be stored for at least 1 day, at least 1 week, at least 2 weeks, at least 4 weeks, at least 12 weeks, at least 25 weeks, at least 1 year, at least 2 years, at least 3 years, at least 4 years, at least 5 years, at least 10 years, etc. In some embodiments, the compositions may be stored in a relatively cool and / or dry state. For example, the composition may be stored at room temperature (e.g., about 25oC), or temperatures below 25oC, below 10oC, below 0oC, below -4oC, below -20oC, etc. In some cases, the composition may be stored in an environment having an average relative humidity of less than 50%, less than 40%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, etc. The composition may be stored in a desiccated or lyophilized state in certain embodiments. U.S. Provisional Patent Application Serial No. 63 / 516,149, filed July 28, 2023, entitled “Systems and Methods for Enhancing Macroalgae Production,” is incorporated herein by reference in its entirety. The following examples are intended to illustrate certain embodiments of the present disclosure, but do not exemplify the full scope of the disclosure. EXAMPLE 1 This example illustrates a composition comprising Alteromonas and Alcanivorax, in accordance with one embodiment. In this example, sequencing was conducted using 16s rRNA Sanger sequencing of genomic DNA that was isolated via PureLinkTMMicrobiome DNA Purification Kit. Within each genus there is a closest match to a distinct “strain.” In one embodiment, the formulation included Alteromonas (ATCC 27126) and Alcanivorax (JC109) at an approximate ratio of 3:1. The formulation was tested in an aquaculture system at a starting concentration of Alteromonas at 2.1x104CFU / mL and Alcanivorax at a starting concentration of 7x103CFU / mL of the final aquaculture solution. In another embodiment, the formulation included Alteromonas and Alcanivorax at an approximate ratio of 8:1, at a starting concentration of Alteromonas of 103CFU / mL to 106CFU / mL. The bacterial cultures were preserved as a powderized freeze dried stock. Upon formula creation, isolated stocks were rehydrated 2216 Zobell’s Marine Broth. Colony forming unit per milliliter of broth for each isolated component was established via colony plate counts on 2216 marine agar through dilution. At this stage, the individual components were mixed together in order to achieve the desired formula ratios. Inoculation of the bacterial mixture occurred via liquid addition to the algae and its associated water column. In one experiment, a formulation containing primarily Alteromonas (ATCC 27126) demonstrated statistically significant beneficial effects on the health of photosynthetic receptors and growth rates of the algal tissue. The bacteria were conserved via preservation in a sucrose based buffer and lyophilized. This resulted in a stable powder product that could be reconstituted in seawater after extended periods without the need for nutrients, light, etc. One example of this experimental work is shown in Fig. 1. This figure demonstrates the beneficial effect of Alteromonas bacteria on the overall performance of the formulation at different concentrations for Asparagopsis taxiformis cultivated on land. There was variability in the cultivation conditions over the duration of the experiment resulting in non-ideal cultivation conditions related to excess light and heat. Cultures inoculated with the artificial formulation proved to be more resilient to these stressors than the control group without the bacterial formulation. All treatments were run in triplicate. Fig. 1A shows the change in biomass accumulation in response to different amounts of Alteromonas added to the algae cultures. Fig. 1B shows the associated differences in photosynthetic capacity when exposed to the different amounts of Alteromonas. Another example is shown in Fig. 2. This experiment used conditions similar to those shown in Fig. 1. Fig. 2demonstrates the beneficial effect of Alcanivorax bacteria on the overall performance of the formulation at different concentrations for Asparagopsis taxiformis cultivated on land. Fig. 2A shows the change in biomass accumulation in response to different amounts of Alcanivorax added to the algae cultures. Fig. 2B shows the associated differences in photosynthetic capacity when exposed to the different amounts of Alcanivorax. This serves as an example of how certain components of a bacterial formulation at certain concentrations will provide a commensalistic or neutral effect while also having a parasitic effect at other concentrations. By including these biological components at different quantities in the formulation, different symbiotic relationships can be induced. EXAMPLE 2 This example shows that inoculation of 250 microliters and 500 microliters of marine broth containing Alteromonas sp. had a 212% and 192% total growth rate respective to the control, in accordance with certain embodiments. It was also found that the growth rate between 1000 microliters inoculation and control was not significantly different. The hypothesis tested in this example was that there was no significant difference between algal biomass growth between cultures treated with 0 microliters, 250 microliters, 500 microliters, and 1000 microliters of Alteromonas sp. at CFU concentrations between 104to 108CFU / L. Due to the wide variety of bacterial metabolisms, the microbial consortia of a macroalgae plantlet can have positive or negative effects on its performance in culture. Previous studies conducted on the bacterial consortia associated with varying commercial seaweeds have identified huge potential for increased growth. In one study exploring the growth-promoting potential of seaweed isolated bacteria, the most successful bacterial strains prompted a 173% increase in growth of the macroalgae Ulva clathrata. By increasing the understanding of the effect that specific microbial species can have on the performance of a culture, this example illustrates the further optimization of the growth of A. taxiformis. The first step of this process is determining what effect, if any, inoculation concentration has on the health of the algae. If the effect is negative, this has the potential to help establish CFU threshold values for consideration when determining the health of a culture. In an outdoor cultivation experiment, 0.5 g of A. taxiformis was be added to 12 flasks (500 mL). 250 microliters, 500 microliters, and 1000 microliters of bacterial inoculate from one species were be added in triplicates to the flasks and cultured for 7 days. The flasks were inoculated with AT-1 media minus vitamins. This is because bacteria may potentially be a good source of vitamin B12. The flasks had a volume of all getting 50 micromoles / m2 / s of light exposure. At the time of stocking, baseline CFU, PAM, and nitrate levels were recorded. After the experimental period of 7 days, the flasks were harvested and data recorded. Each replicate flask was harvested through a weigh bag and dewatered via hand squeezing. The weight was recorded on a scale. Weight measurements were used to calculate the DGR (daily growth rate) of the algae during the seven day period, and baseline DGR was calculated from performance of mother culture in a 25 L reactor. Three PAM measurements were averaged per replicate and included as a measure of photosynthetic health using PAM fluorometry. The PAM measurement were taken before dewatering was performed, since dewatering procedures may cause a decline in PAM score. CFU per treatment were plated and recorded at a 1:100 dilution level. Fig. 3 shows a boxplot for inoculation treatment (by volume) vs. DGR in 500 microliter flasks using Alteromonas sp. There were three replicates per treatment and p value significance between treatments is demonstrated within the respective brackets. Based on a significance level of p<0.05, there was a significance difference between the control (0) and the 250 microliter / 500 microliter treatments, with the 250 microliter / 500 microliter addition of Alteromonas sp. treatments producing significantly higher A. taxiformis daily growth rates. Fig. 4 is a boxplot for inoculation treatment (by volume) vs. PAM measurements for photosynthetic health. There were three replicates per treatment and p value significance between treatments is demonstrated within the respective brackets. Based on a significance level of p<0.05, there was a significant difference between the control and the 250 mircoliter and 500 mircoliter treatments, with the 250 mircoliter / 500 mircoliter addition of Alteromonas sp. treatments producing significantly higher A. taxiformis PAM health readings. All other differences were not significant between the replicate groups. Fig. 5 shows linear regression for percent nitrate uptake vs. PAM. A relatively high R value of -0.81 indicates a negative correlation between PAM and % Nitrate Left. This supports the conclusion the nitrate uptake, photosynthetic health, and DGR were all correlated in the treatments that exhibited statistical significance from the control. Fig. 6 shows a boxplot of treatment vs nitrate uptake. Statistical significance was observed between the 500 microliter treatment of bacteria from the control. A significantly different uptake in nitrogen indicated a significantly different uptake in growth based on regression models. Based on this experiment, the null hypothesis that there was no significant difference between cultures grown without an inoculating concentration of Alteromonas and those grown with an inoculation treatment can be rejected. The average growth rate of the control group was 3.3% and the average growth rate of both the 250 microliter and 500 microliter treatments was ~11.0%. With a growth rate of more than triple than control and a statistically significant result for both, it can be concluded that through inoculating cultures of A. taxiformis with this strain of Alteromonas, there was a net positive effect on culture health and growth. While several embodiments of the present disclosure have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the present disclosure. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the teachings of the present disclosure is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the disclosure described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, the disclosure may be practiced otherwise than as specifically described and claimed. The present disclosure is directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the scope of the present disclosure. In cases where the present specification and a document incorporated by reference include conflicting and / or inconsistent disclosure, the present specification shall control. If two or more documents incorporated by reference include conflicting and / or inconsistent disclosure with respect to each other, then the document having the later effective date shall control. All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms. The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.” The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and / or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc. As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and / or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc. When the word “about” is used herein in reference to a number, it should be understood that still another embodiment of the disclosure includes that number not modified by the presence of the word “about.” It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited. In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.

Claims

What is claimed is: CLAIMS 1. A composition, comprising: a formulation having a moisture content of less than 5 wt% and comprising bacteria, wherein the bacteria comprise an Alteromonas species and an Alcanivorax species at a ratio of between 2:1 and 10:

1.

2. The composition of claim 1, wherein the Alteromonas species has a 16S ribosomal sequence at least 90% identical to SEQ ID NO:

2.

3. The composition of any one of claims 1 or 2, wherein the Alteromonas species has a 16S ribosomal sequence at least 95% identical to SEQ ID NO:

2.

4. The composition of any one of claims 1-3, wherein the Alteromonas species is strain ATCC 27126.

5. The composition of any one of claims 1-4, wherein the Alteromonas species is Alteromonas macleodii.

6. The composition of any one of claims 1-5, wherein the Alcanivorax species has a 16S ribosomal sequence at least 90% identical to SEQ ID NO:

1.

7. The composition of any one of claims 1-6, wherein the Alcanivorax species has a 16S ribosomal sequence at least 95% identical to SEQ ID NO:

1.

8. The composition of any one of claims 1-7, wherein the Alcanivorax species is strain JC109.

9. The composition of any one of claims 1-8, wherein the Alcanivorax species is Alcanivorax xenomutans.

10. The composition of any one of claims 1-9, wherein the Alcanivorax species has a 16S ribosomal sequence at least 90% identical to the 16S ribosomal sequence of Alcanivorax xenomutans.

11. The composition of any one of claims 1-10, wherein the Alcanivorax species has a 16S ribosomal sequence at least 95 identical to the 16S ribosomal sequence of Alcanivorax xenomutans.

12. The composition of any one of claims 1-11, wherein the ratio is between 2:1 and 4:

1.

13. The composition of any one of claims 1-12, wherein the ratio is between 7:1 and 9:

1.

14. The composition of any one of claims 1-13, wherein the bacteria are present within the powder at a density of between 104and 109colony forming units per gram of powder.

15. The composition of any one of claims 1-14, wherein the formulation is a powder.

16. The composition of any one of claims 1-15, wherein the formulation is freeze-dried.

17. The composition of any one of claims 1-16, wherein the formulation further comprises a sucrose-based buffer.

18. A method, comprising: adding a formulation comprising bacteria to a macroalgae aquaculture, wherein the bacteria comprise an Alteromonas species and an Alcanivorax species at a ratio of between 2:1 and 10:

1.

19. The method of claim 18, wherein the formulation is a powder.

20. The method of any one of claims 18 or 19, wherein the formulation is freeze-dried.

21. The method of any one of claims 18-20, wherein the formulation further comprises a sucrose-based buffer.

22. The method of any one of claims 18-21, comprising adding the formulation to the macroalgae aquaculture at a dosage of between 0.1 and 10 grams of formulation per liter of macroalgae aquaculture cultivation media.

23. The method of any one of claims 18-22, wherein the bacteria are present within the formulation at a density of between 104and 109colony forming units per gram of formulation.

24. The method of any one of claims 18-23, wherein adding the formulation to the macroalgae aquaculture comprises adding the formulation to macroalgae cultivation media.

25. The method of any one of claims 18-24, wherein adding the formulation to the macroalgae aquaculture comprises adding the formulation directly to the macroalgae in the aquaculture.

26. The method of any one of claims 18-25, wherein adding the formulation to the macroalgae aquaculture comprises dissolving the formulation in water to form a solution, and dipping the macroalgae in the solution.

27. The method of any one of claims 18-26, wherein the macroalgae aquaculture comprises an Asparagopsis species.

28. The method of any one of claims 18-27, wherein the macroalgae aquaculture comprises a Palmaria species.

29. The method of any one of claims 18-28, wherein the macroalgae aquaculture comprises a Pyropia species.

30. The method of any one of claims 18-29, wherein the macroalgae aquaculture comprises an Ulva species.

31. The method of any one of claims 18-30, wherein the macroalgae aquaculture comprises a Gracilaria species.

32. The method of any one of claims 18-31, wherein the macroalgae aquaculture comprises a Kappaphycus species.

33. A method, comprising: adding a formulation comprising an Alteromonas species to a macroalgae aquaculture comprising an Asparagopsis species to increase the concentration of Alteromonas by 106CFU / L to 109CFU / L of macroalgae aquaculture.

34. The method of claim 33, wherein the formulation is a powder.

35. The method of any one of claims 33 or 34, comprising adding the formulation to the macroalgae aquaculture at a dosage of between 0.1 and 10 grams of formulation per liter of macroalgae aquaculture.

36. The method of any one of claims 33-35, wherein the bacteria are present within the formulation at a density of between 104and 109colony forming units per gram of formulation.

37. The method of any one of claims 33-36, wherein the macroalgae aquaculture comprises an Asparagopsis species.

38. The method of any one of claims 33-37, wherein the macroalgae aquaculture comprises a Palmaria species.

39. The method of any one of claims 33-38, wherein the macroalgae aquaculture comprises a Pyropia species.

40. The method of any one of claims 33-39, wherein the macroalgae aquaculture comprises an Ulva species.

41. The method of any one of claims 33-40, wherein the macroalgae aquaculture comprises a Gracilaria species.

42. The method of any one of claims 33-41, wherein the macroalgae aquaculture comprises a Kappaphycus species.

43. A method, comprising: adding a freeze-dried formulation comprising bacteria to a macroalgae aquaculture, wherein the formulation comprises at least 2 marine bacteria species preserved in a freeze-dried state.

44. The method of claim 43, wherein the bacteria comprises an Alteromonas species.

45. The method of any one of claims 43 or 44, wherein the bacteria comprises an Alcanivorax species.

46. The method of any one of claims 43-45, wherein the formulation comprises at least 3 marine bacteria species.

47. The method of any one of claims 43-46, wherein the formulation comprises at least 5 marine bacteria species.

48. The method of any one of claims 43-47, wherein the formulation is a powder.

49. The method of any one of claims 43-48, wherein the formulation further comprises a sucrose-based buffer.

50. The method of any one of claims 43-49, comprising adding the formulation to the macroalgae aquaculture at a dosage of between 0.1 and 10 grams of formulation per liter of macroalgae aquaculture.

51. The method of any one of claims 43-50, wherein the bacteria are present within the formulation at a density of between 104and 109colony forming units per gram of formulation.

52. The method of any one of claims 43-51, wherein the macroalgae aquaculture comprises an Asparagopsis species.

53. The method of any one of claims 43-52, wherein the macroalgae aquaculture comprises a Palmaria species.

54. The method of any one of claims 43-53, wherein the macroalgae aquaculture comprises a Pyropia species.

55. The method of any one of claims 43-54, wherein the macroalgae aquaculture comprises an Ulva species.

56. The method of any one of claims 43-55, wherein the macroalgae aquaculture comprises a Gracilaria species.

57. The method of any one of claims 43-56, wherein the macroalgae aquaculture comprises a Kappaphycus species.

Images