Respiratory syncytial virus antigenic polypeptide, vaccine, and use

Abstract

Provided are a respiratory syncytial virus antigenic polypeptide, a vaccine, and a use. First, a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof is provided. Compared with the amino acid sequence of a respiratory syncytial virus wild-type pre-F protein, the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof has one or more mutation sites of amino acid residues at the following positions: positions 174-176, positions 181-184, positions 210-213, and positions 160-161. The improvement of pre-F immunogenicity can be achieved and / or the protein expression level can be improved.

Description

Respiratory syncytial virus antigenic polypeptide, vaccine and application thereof Technical Field

[0001] The present invention relates to a respiratory syncytial virus antigenic polypeptide, a vaccine and applications thereof. Background Art

[0002] Respiratory syncytial virus (RSV) is a single-stranded, negative-sense RNA virus that encodes 11 proteins. Based on antigenic drift within the G protein, RSV is divided into subtypes A and B. The RSV F protein sequence is relatively conserved, but undergoes splicing and fusion conformational changes during infection.

[0003] Human respiratory syncytial virus (hRSV) can cause diseases including the upper respiratory tract, trachea, bronchi, bronchioles, alveoli, pleura and pleural cavity, as well as the nerves and muscles of breathing. RSV can be spread by respiratory droplets or infected pollutants, and can be passed to the lower respiratory tract through the nasopharynx or upper respiratory tract mucosa to induce severe infection (low respiratory tract infection, LRTI). RSV infection will first cause cold-like symptoms, such as runny nose, loss of appetite, cough, sneezing, fever, wheezing, infection, and these symptoms usually occur in stages.

[0004] RSV is the most common cause of bronchiolitis and pneumonia in children under one year old. A small number of infants infected with RSV may experience symptoms such as irritability, decreased activity, and difficulty breathing. If the infection becomes more serious, it can develop into bronchiolitis, inflammation of the small airways in the lungs, pneumonia, and lung infection. For people with weakened immune systems, the elderly, and those with lung disease and heart failure, the symptoms are more severe and may even lead to death. RSV-infected people may experience difficulty breathing or dehydration, and in severe cases, may require additional oxygen or intubation and mechanical ventilation. If the condition continues to worsen, chronic obstructive pulmonary disease (COPD) will occur, as well as serious complications of the respiratory and other systems, including pneumonia, apnea, respiratory failure, heart failure, etc., which can develop into a serious and fatal disease within a year.

[0005] The most important reason why there has been no RSV vaccine product on the market for decades is the lack of effective antigen design. Long-term research results show that the RSV surface F glycoprotein is the most conserved among different strains and induces high neutralizing antibody titers. In 2013, the National Institutes of Health (NIH) of the United States found that the metastable F protein undergoes conformational changes before and after fusion, and the most important site is the site with the highest antibody affinity. Site V exists only in the metastable conformation before fusion with the F protein (pre-F). The NIH research team stabilized pre-F by introducing cysteines at positions 155 and 290 to form disulfide bonds. Furthermore, substitutions of long hydrophobic amino acids at the antibody binding site also achieved stabilization. Through a combination of substitutions at multiple positions, the team ultimately obtained the highly effective pre-F antigen, Ds-CaV1. In 2016, the NIH team continued to optimize the structure and sequence of the pre-F antigen, introducing a GS linker at positions 104-144 to eliminate the allosteric effects of pep27 and the fusion peptide, and cysteines at positions 149 and 458 to stabilize the F protein trimer, further enhancing the antigen's immunogenicity. Clinical trials using protein vaccines based on these mutations have shown good protection rates, but the data suggest significant room for improvement. The application of mRNA technology has the potential to improve the antigen's immunogenicity at a technical level.

[0006] CN10847235A discloses RSV antigenic peptides. Building on the NIH work (GS linker + two groups of cysteines + two cavity fillings), the transmembrane region was retained, transforming the secreted protein into a membrane protein. This resulted in superior clinical results, demonstrating that the transmembrane protein and the C-terminus of the F protein contribute to enhanced antigen immunogenicity. Furthermore, the clinical results demonstrate the high immunogenicity unique to mRNA technology.

[0007] Years of research have shown that it is difficult to identify new mutation sites that can maintain pre-F, making it difficult to increase the titer of pre-F neutralizing antibodies from an antigenic perspective.

[0008] Summary of the Invention

[0009] One object of the present invention is to provide a respiratory syncytial virus (RSV) antigenic polypeptide that can enhance the immunogenicity of pre-F and / or help enhance protein expression levels.

[0010] Another object of the present invention is to provide an application of the respiratory syncytial virus antigenic polypeptide.

[0011] Another object of the present invention is to provide a respiratory syncytial virus vaccine.

[0012] Another object of the present invention is to provide a use of the respiratory syncytial virus vaccine. In one aspect, the present invention provides a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof, wherein the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof has one or more mutation sites of the following amino acid residues compared to the amino acid sequence of the wild-type Pre-F protein of respiratory syncytial virus:

[0013] No. 174-176, No. 181-184, No. 210-213, No. 160-161.

[0014] According to a specific embodiment of the present invention, the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide of the present invention refers to a fragment of a partial amino acid sequence derived from a respiratory syncytial virus antigenic polypeptide and capable of eliciting an immune response against RSV. That is, the immunogenic fragment has a truncated amino acid sequence compared to the respiratory syncytial virus antigenic polypeptide of the present invention. Preferably, the immunogenic fragment has the same mutation site as the respiratory syncytial virus antigenic polypeptide of the present invention. Preferably, the immunogenic fragment has an amino acid sequence of at least positions 100-300 derived from the respiratory syncytial virus antigenic polypeptide of the present invention. Further preferably, the immunogenic fragment has an amino acid sequence of at least positions 50-400, further preferably at least positions 26-470, at least positions 26-510, at least positions 25-470, at least positions 25-510, at least positions 24-470, at least positions 24-510, at least positions 23-470, at least positions 23-510, at least positions 22-470, at least positions 22-510 or at least positions 1-470 of the respiratory syncytial virus antigenic polypeptide of the present invention.

[0015] According to a specific embodiment of the present invention, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention, the mutation site is selected from one or more of K176, L160, T174, N175, L181, N183, G184, Q210, S211, C212, and S213.

[0016] According to a specific embodiment of the present invention, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention, the mutation site is mutated to proline.

[0017] According to a specific embodiment of the present invention, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention, the mutation site is selected from one or more of K176P, L160P, T174P, N175P, L181P, N183P, G184P, Q210P, S211P, C212P, and S213P.

[0018] According to a specific embodiment of the present invention, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention, the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof further has the following mutations compared to the amino acid sequence of the wild-type Pre-F protein of respiratory syncytial virus:

[0019] Amino acid residues 104-144 are replaced with a GS linker; and / or

[0020] One or more mutation sites selected from P102A, L373R, I379V, and M447V.

[0021] According to some specific embodiments of the present invention, the amino acid sequence of the respiratory syncytial virus antigenic polypeptide of the present invention is shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11 or SEQ ID No. 12. The immunogenic fragment of the present invention has an amino acid sequence derived from at least positions 50-400, more preferably at least positions 26-470, at least positions 26-510, at least positions 22-470, at least positions 22-510 or at least positions 1-470 of these polypeptides. More preferably, the amino acid sequence of the immunogenic fragment is as shown in positions 26-470, 26-510, 25-470, 25-510, 24-470, 24-510, 23-470, 23-510, 22-470 or 22-510 of the amino acid sequence shown in SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11 or SEQ ID No.12.

[0022] On the other hand, the present invention also provides a polynucleotide encoding the amino acid sequence of the respiratory syncytial virus antigenic polypeptide of the present invention or an immunogenic fragment thereof.

[0023] According to some specific embodiments of the present invention, the polynucleotide of the present invention is DNA or RNA. The RNA may be mRNA or self-replicating RNA.

[0024] According to some specific embodiments of the present invention, the sequence of the polynucleotide encoding the respiratory syncytial virus antigenic polypeptide of the present invention is shown as SEQ ID No.14, SEQ ID No.15, SEQ ID No.16, SEQ ID No.17, SEQ ID No.18, SEQ ID No.19, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22, SEQ ID No.23, SEQ ID No.24, SEQ ID No.28 or SEQ ID No.29.

[0025] According to some specific embodiments of the present invention, the sequence of the polynucleotide encoding the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide is a fragment of the sequence shown in SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23, SEQ ID No. 24, SEQ ID No. 28 or SEQ ID No. 29. That is, the polynucleotide encoding the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide has a truncated nucleotide sequence compared to the polynucleotide encoding the respiratory syncytial virus antigenic polypeptide of the present invention.

[0026] On the other hand, the present invention also provides the use of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof or the polynucleotide in the preparation of a respiratory syncytial virus vaccine.

[0027] On the other hand, the present invention also provides a respiratory syncytial virus vaccine comprising:

[0028] at least one mRNA having an open reading frame encoding a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof according to the present invention, and

[0029] Pharmaceutically acceptable carrier.

[0030] According to some specific embodiments of the present invention, the respiratory syncytial virus vaccine of the present invention has one or more of the following characteristics:

[0031] The open reading frame is codon-optimized; preferably, the codon optimization is as shown in SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23, SEQ ID No. 24, SEQ ID No. 28 or SEQ ID No. 29;

[0032] The open reading frame further comprises a sequence encoding a signal peptide connected to an RSV antigenic polypeptide or an immunogenic fragment thereof; preferably, the amino acid sequence of the signal peptide is as shown in positions 1-21, 1-22, 1-23, 1-24 or 1-25 of SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11 or SEQ ID No.12;

[0033] The open reading frame further comprises a sequence encoding a transmembrane region connected to an RSV antigenic polypeptide or an immunogenic fragment thereof; preferably, the amino acid sequence of the transmembrane region is as shown in positions 471-510 of SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11 or SEQ ID No.12;

[0034] The at least one mRNA comprises at least one chemical modification; preferably, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O-methyluridine; preferably, at least 80%, at least 90% or 100% of the uracils in the open reading frame have a chemical modification;

[0035] The at least one mRNA comprises at least one 5′ end cap structure;

[0036] The at least one mRNA comprises a 3′ polyA tail;

[0037] The vaccine is formulated in nanoparticles; preferably, the nanoparticles have an average diameter of 50 nm to 200 nm; preferably, the nanoparticles are lipid nanoparticles; preferably, the lipid nanoparticles comprise cationic lipids, PEG-modified lipids, sterols and non-cationic lipids; preferably, wherein the cationic lipids are ionizable cationic lipids, the non-cationic lipids are neutral lipids, and the sterols are cholesterol.

[0038] Experiments of the present invention show that the respiratory syncytial virus antigenic polypeptide of the present invention or its immunogenic fragment having the mutation site and the polynucleotide encoding the respiratory syncytial virus antigenic polypeptide of the present invention or its immunogenic fragment having the mutation site can achieve the improvement of pre-F immunogenicity and / or help to improve the protein expression level. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 shows the quantitative data of RSV F protein expression levels in each group in Example 1. The data unit in the figure is ng / 100 μL.

[0040] Figure 2 shows the quantitative statistics of RSV F protein expression levels in each group in Example 1. The data unit in the figure is ng / 100 μL.

[0041] FIG3 shows the immunoblotting results of proteins of different coding sequences of F-VP6 detected by D25 in Example 1.

[0042] FIG4 shows the immunoblotting results of proteins of different coding sequences of F-VP6 detected by motaz in Example 1.

[0043] FIG5 shows the statistics of binding antibody titers in mice 14 days after immunization in Example 2.

[0044] FIG6 shows the statistics of binding antibody titers in mice 28 days after immunization in Example 2.

[0045] Figure 7 shows the statistics of neutralizing antibody titers in mice 28 days after immunization in Example 3.

[0046] FIG8 shows the results of the neutralizing antibody titer test against RSV-A2 in Example 4.

[0047] FIG9 shows the results of the RSV-B neutralizing antibody titer detection in Example 4.

[0048] Figure 10 shows the results of lung viral load detection after challenge in Example 4.

[0049] FIG. 11 shows the lung assessment scoring results in Example 4. DETAILED DESCRIPTION

[0050] To provide a clearer understanding of the technical features, objectives, and beneficial effects of the present invention, the following detailed description of the technical solutions of the present invention is provided. However, this description is not intended to limit the scope of the present invention. Experimental methods in the examples where specific conditions are not specified were performed according to conventional conditions in the field or the conditions recommended by the instrument manufacturer's instructions.

[0051] The present invention provides 12 RSV F variants based on wild-type (WT) RSV F, each of which has one of the following mutation sites: L160P, E161P, T174P, N175P, K176P, L181P, N183P, G184P, Q210P, S211P, C212P, S213P; and each variant has P102A, 373R, I379V, and M447V mutation sites added, and amino acid residues 104-144 compared to wild-type RSV F are replaced with a GS linker. The amino acid and encoding nucleotide sequences of wild-type and variant RSV F are shown in Table 1.

[0052] Table 1

[0053] Example 1

[0054] In this example, the expression level of RSV F glycoprotein before fusion on the cell surface was detected by double antibody sandwich enzyme-linked immunosorbent assay using antibodies specific for RSV F glycoprotein before fusion (D25, Mota), and the effect of each RSV F variant on the expression level of RSV pre-F was investigated.

[0055] 1. mRNA transfection into cells

[0056] 293T cells (293T cells were cultured in 6-well plates, with approximately 2 million cells per well) were transfected with 4 μg of mRNA of different sequences (SEQ ID No. 13-SEQ ID No. 24) (each mRNA was prepared according to conventional techniques in the art). The culture was terminated after 24 hours, and intracellular protein was collected and quantified for total protein.

[0057] 2. Enzyme-linked immunosorbent assay (ELISA) to measure antigen expression

[0058] ① Antibody-coated ELISA plate:

[0059] Take out the packaged antibody protein (Mota) from the refrigerator, dilute it to 2 μg / mL with Coating Buffer, Research Grade Motavizumab (DVV02803), take a 96-well plate (Greiner, 655061), add 100 μL to each well, cover the ELISA plate, and coat it in a refrigerator at 2-8°C overnight.

[0060] Remove the coated 96-well plate, pour off the coating solution, and remove any excess solution to ensure no residue remains in the wells. Add 300 μL of 1x Washing Buffer diluted in ultrapure water to each well and wash the plate three times. Firmly tap off any remaining liquid on absorbent paper, then add 300 μL of blocking solution to each well. Seal the plate with film and incubate at 37°C for 2 hours.

[0061] ②Add the sample to be tested:

[0062] First, dilute the protein stock solution (cell lysate) in step 1 to 1-2 μg / μL, and then perform the antigen test experiment. Especially for samples with unknown protein expression, previous studies recommend using the gradient dilution method to prepare them. The gradient dilution multiples of the diluted samples are set to 40, 80, 160, 320, 640, 1280, and 2560 times.

[0063] Remove the sealed 96-well plate and remove any remaining liquid after washing. Add 100 μl of sample diluent to the blank well and 100 μl of the standard or test sample to each of the remaining wells (be careful not to create bubbles. Add the sample to the bottom of the plate well, minimizing contact with the well walls. Load each plate within 10 minutes). Cover the plate with film and incubate at 37°C for 2 hours. To ensure the validity of the results, use a fresh standard solution for each experiment.

[0064] ③Add detection antibodies:

[0065] Remove the blocked 96-well plate, pour off the coating solution, clean up the remaining liquid, and wash five times. Dilute the detection antibody Anti-HRSV-A F / Fusion glycoprotein F0 Antibody (D25) (RVV02809) - Bioti (concentration 0.79 mg / ml) at a ratio of 1:2000, add 100 μL of the diluted antibody to each well of the 96-well plate, seal the plate with film, and incubate at 37°C in the dark for 1 hour.

[0066] ④Add substrate solution:

[0067] Remove the 96-well plate after adding the detection antibody, pour off the coating solution, and clean the residual liquid five times. Dilute HRP-conjugated Streptavidin (SA00001-0) at a ratio of 1:10,000 and add 100 μL of the diluted HRP-conjugated Streptavidin to each well of the 96-well plate. Seal the plate with film and incubate at 37°C in the dark for 30 minutes.

[0068] ⑤ Color development and detection of OD value:

[0069] Turn off the indoor light, remove the 96-well plate after incubation with the secondary antibody, and discard the primary antibody solution and wash five times. Remove the disposable sample reservoir and place it in a light-proof box. Pour the TMB solution into the reservoir and use a dispenser to add 100μL of TMB to each well. Develop the color in the dark for 20 minutes (do not exceed 25 minutes). At this point, positive samples will appear blue. The addition time and waiting time for each sample must be recorded to prevent experimental errors. After the color development time is up, use a dispenser to add 100μL of Stop Solution to each well. At this time, the sample will first appear yellow. Measure its absorbance at 450nm. Read the plate within two minutes after adding the Stop Solution to each plate, otherwise the absorbance of the blank well will increase and the absorbance of the sample well will decrease. Set the microplate reader program to an absorbance of 450nm and low-speed shaking for 5 seconds.

[0070] The results of the detection of RSV F glycoprotein before cell surface fusion are shown in Figures 1 and 2. The results show that each RSV F variant of the present invention contributes to the increase in the expression level of RSV pre-F.

[0071] Based on the aforementioned RSV F variant expression validation results, it was determined that F-VP6 had the best expression level and stability. Therefore, this example further optimized the sequence of this variant (see SEQ ID No. 28 and SEQ ID No. 29 for the optimized sequences) to demonstrate that all coding sequences had good expression levels. The cell culture and protein extraction experimental procedures were the same as above, and the protein immunoblotting experiment was as follows:

[0072] (1) The prepared protein samples were spotted into 4%-20% protein gels in sequence, and electrophoresed at 80V for 30 minutes, then at 120V for 55 minutes;

[0073] (2) Film transfer: Mark films 1 to 8 in order. When transferring two films simultaneously, 25V, 2.5A, 12min;

[0074] (3) Blocking: Wash the NC membrane with pure water for 10 min, then transfer the membrane to a plate and add 15 mL of 5% skim milk for blocking at room temperature for 1 h.

[0075] (4) Primary antibody incubation:

[0076] Primary antibody incubation for membrane 1, membrane 2, membrane 3, and membrane 4: D25 monoclonal antibody was diluted 1:3000 in 5 ml of 5% skim milk and incubated at 4°C on a roller mixer for 15 hours.

[0077] Membrane 5, membrane 6, membrane 7, membrane 8 primary antibody incubation: Mota monoclonal antibody was diluted 1:3000 in 5 ml of 5% skim milk and incubated at 4 degrees on a roller mixer for 15 hours.

[0078] (5) Primary antibody elution: After the primary antibody incubation is completed, the primary antibody solution is removed and the membrane is placed in TBST and shaken on a shaker for three times, each time for 15 minutes;

[0079] (6) Secondary antibody incubation:

[0080] Membranes 1-8 were incubated with human secondary antibodies: HRP-conjugated Affinipure Goat Anti-human IgG (H+L) was diluted 1:1000 in 5 mL of 5% skim milk according to the instructions and incubated on a roller mixer at room temperature for 1 h.

[0081] (7) Secondary antibody elution: After the secondary antibody incubation is completed, the secondary antibody solution is removed and the membrane is placed in TBST and shaken on a shaker for 3 times, each time for 15 minutes. After the elution is completed, the membrane is soaked in TBST solution;

[0082] (8) Development:

[0083] Prepare the developing solution (thermo), take 4000 μL of developing solution A and 4000 μL of developing solution B and mix them for later use;

[0084] The membrane of each group B sample (intracellular sample) was placed in the imager tray, 500 μL of developer mixture was added to the surface, and the membrane was exposed for 40 seconds.

[0085] The results are shown in Figures 3 and 4. They show that all optimized sequences can normally express F-VP6 protein, with clear signals appearing at the correct positions using both D25 and mota antibody detection. Therefore, it can be inferred that F-VP6 has a well-defined pre-F structure.

[0086] Example 2

[0087] This example uses F-VP6 in Example 1 as an example to investigate the in vivo immunogenicity (mouse binding antibodies) of the RSV F variants of the present invention in mice.

[0088] 1. Methods and Grouping

[0089] In vitro synthesis of experimental mRNA was performed according to conventional procedures in the art. The target F-VP6 mRNA molecule in this example includes, in addition to the coding sequence (SEQ ID No. 17), a 5' UTR (GGAGATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCGCCACC, SEQ ID No. 25) and a 3' UTR (GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG, SEQ ID No. 26). The 5' CAP is Cap2-6 (structure shown in Formula I), and the 3' end is tailed with a Poly A tail (AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA, SEQ ID No. 27), with 100% m1ψ modification.

[0090] The target F-VP6 mRNA was encapsulated in T19-5LNPs (T19-5LNP composition and molar ratio: T19 (structural formula II, 48%); DSPC (16%); DMG-PEG2000 (1.5%); and CHOL (34.5%), with a particle size of approximately 100 nm. The mRNA was injected intramuscularly (IM) into eight-week-old BALB / c mice (n=10 per group). The mRNA was administered at two-week intervals, with a single injection dose of 5 μg. Serum was collected weekly. Serum binding antibody titers against the D14 and D28 pre-F glycoproteins were determined by ELISA.

[0091] Prefusion F-specific IgG titers were measured two weeks after the first administration (i.e., 14 days after immunization of mice) and two weeks after the second administration (i.e., 28 days after immunization of mice).

[0092] 2. The specific experimental process is as follows:

[0093] ① Sample dilution

[0094] Bleed the mouse from the rim of the eye and centrifuge at high speed to obtain a supernatant of no less than 50 μL. Dilute serum (primary antibody): Dilute the sample to a gradient of 4000x, 40000x, 400000x, 4000000x, 8000000x, 20000000x, and 40000000x. The serum dilution method can refer to the following steps: The control serum CK dilution gradient is 40x, 400x, and 4000x. The addition steps are the same as for serum. Note that a control should be set up for each 96-well plate.

[0095] ② Enzyme-linked immunosorbent assay

[0096] Remove the pre-F protein from the refrigerator and dilute it to 2 μg / mL with Coating Buffer. Add 100 μL of sample to each well of a 96-well plate (Greiner, 655061). Cover the plate and coat overnight at 2-8°C. Remove the coated 96-well plate, pour off the coating buffer, and remove any excess solution to ensure no residue remains in the wells. Wash the plate with 1× Washing Buffer diluted with ultrapure water, adding 300 μL per well. Repeat this wash three times. Firmly tap off any remaining liquid on absorbent paper. Add 300 μL of Blocking Buffer to each well. Seal the plate with film and incubate at 37°C for 2 hours.

[0097] Remove the coated 96-well plate and pour off the coating solution, ensuring no residue remains in the wells. Wash the plate three times with 300 μL of Washing Buffer diluted to 1x with ultrapure water. After removing any residual liquid, add 300 μL of Blocking Diluent to each well. Seal the plate with film and incubate at 4°C for 2 hours.

[0098] Pour off the coating solution and clean up the residual liquid; add the diluted test serum sample and the control group serum sample, take each sample three times, 100 μL each time, and make 3 parallel replicates. Note that a blank control and CK must be set up for each plate.

[0099] Dilute Goat pab to Ms IgG (HRP) in dilution buffer at a 1:10,000 dilution (the dilution factor should be determined according to the manufacturer's instructions) and vortex to mix. Remove the 96-well plate after primary antibody incubation, discard the primary antibody solution, and clean any remaining liquid from the wells. Wash the plate five times with a microplate washer to remove any remaining liquid. Add 100 μL of the diluted antibody to each well of the 96-well plate, seal with film, and incubate at room temperature in the dark for 1 hour.

[0100] Turn off the indoor light, remove the 96-well plate after incubation with the secondary antibody, and discard the primary antibody solution and wash five times. Remove the disposable sample reservoir and place it in a light-proof box. Pour the TMB solution into the reservoir and use a dispenser to add 100μL of TMB to each well. Develop the color in the dark for 20 minutes (do not exceed 25 minutes). At this point, positive samples will appear blue. The addition time and waiting time for each sample must be recorded to prevent experimental errors. After the color development time is up, use a dispenser to add 100μL of Stop Solution to each well. At this time, the sample will first appear yellow. Measure its absorbance at 450nm. Read the plate within two minutes after adding the Stop Solution to each plate, otherwise the absorbance of the blank well will increase and the absorbance of the sample well will decrease. Set the microplate reader program to an absorbance of 450nm and low-speed shaking for 5 seconds.

[0101] The results of binding antibody titer detection are shown in Figures 5 and 6, which show that the F-VP6 of the present invention can induce a higher pre-F binding antibody titer.

[0102] Example 3

[0103] This example provides a method for conducting neutralizing antibody detection on samples 28 days after immunization of the mice in Example 2 to measure the level of RSV-A2 neutralizing antibodies in the serum of the immunized mice.

[0104] The main experimental operation is to inactivate the sample by heating it at 56°C for 30 minutes, and use the plaque reduction neutralization test (PRNT) to detect the anti-RSV neutralization titer in the serum.

[0105] RSV A2 strain (or RSV A2 strain with RFP fluorescent label) was diluted to approximately 80 plaque units (PFU) per inoculation dose. Equal amounts of progressively diluted serum were added and incubated at 37°C for 60 minutes. Two wells of a 24-well plate with cells already forming a monolayer were inoculated with 0.2 ml of each dilution at each dilution. The cells were incubated at 37°C for 2 hours. The inoculum was then removed and pre-warmed 37°C culture medium containing 0.8% methylcellulose was added. The cells were then incubated at 37°C for 72 hours. The number of virus-infected plaques in each well was counted using the antibody immunoplaque assay (or fluorescent plaque assay), and the neutralizing titer of the serum required to reduce the number of plaques by 50% was calculated.

[0106] The results of the neutralizing antibody titer test are shown in Figure 7. Combining Figures 6 and 7, it can be seen that although the binding antibody levels of the samples 28 days after mouse immunization were not significantly different from those of the control WT group, having reached saturation levels, the values ​​of the F-VP6 antigen involved in the present invention were slightly higher than those of the WT control. It is worth noting that the results in Figure 7 show that the designed F-VP6 antigen of the present invention can elicit higher levels of neutralizing antibody titers compared to the wild-type.

[0107] Example 4. In vivo immunogenicity study (cotton rats)

[0108] The immunogenicity of F-VP6 was evaluated in cotton rats. The research aims to evaluate the immunogenicity, efficacy, and safety of F-VP6 as an antigen in the cotton rat model and to assess the potential of the proposed dose to cause enhanced respiratory disease (ERD), including viral load and lung pathology assessment after challenge.

[0109] F-VP6mRNA (same as Example 2) is configured in lipid nanoparticles, and the lipid nanoparticle component is the same as the T19-5LNP of Example 2, and the RSV virus (group) after formaldehyde treatment and non-immune, non-challenging toxic substances group are used as controls. Female cotton rats (6-8 week old) are divided into 5 groups of 10, including low-dose and high-dose groups. Rat immunity is carried out according to the time shown in Table 2. The 1st and 2nd groups are respectively low-dose and high-dose LNP-mRNA (F-VP6) groups, the 3rd group is the RSV virus group (FI-RSV) after formaldehyde treatment, and the 4th and 5th groups are respectively non-immune, non-challenging toxic substances group. On the 56th day, blood was collected and neutralizing antibody titer was identified, and mice were attacked by intranasal administration of 5 log10 RSV A2. On the 61st day, animals were put to death, and lung tissue was collected and viral load assay and pathological evaluation were carried out.

[0110] Table 2

[0111] For evaluation, the neutralizing antibody detection method is the same as Example 3. The extraction of samples for lung pathology and viral load evaluation includes transferring the right lung (4 lobes) into MACS tissue grinding M tubes and tightening the lid for the next step. Add 2mL of DPBS to the tissue grinding tube. Place the tissue grinding tube on a MACS tissue cell disruptor and use the RNA-01-01 program for tissue disruption. Centrifuge the tissue grinding tube at 1000g for 5 minutes, centrifuge the foam and tissue residue, transfer to a biosafety cabinet, and freeze the homogenate at -80°C.

[0112] The results of the cotton rat evaluation experiment are shown in Figures 8 to 11. The results showed that vaccination with 10 μg and 20 μg F-VP6 induced the production of neutralizing antibodies against RSV A and RSV B strains. After the challenge, the lung viral load of the immunized cotton rats was significantly lower than that of the non-immunized mice, and the rate of weight loss was also lower than that of the non-vaccinated group. The lung damage was also alleviated. The vaccine effect was evaluated by clinical symptoms, weight changes, neutralizing antibody titers, lung tissue pathological changes and viral load in mice. The following conclusions can be drawn: In the cotton rat model, vaccination with 10 μg / mouse and 20 μg / mouse vaccines can induce the production of neutralizing antibodies against A / B strains of respiratory syncytial virus and has a protective effect against A / B strain infection.

Claims

1. A respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof, wherein: The amino acid sequence of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof has one or more mutation sites of the amino acid residues at the following positions compared to the amino acid sequence of the wild-type Pre-F protein of respiratory syncytial virus: No. 174-176, No. 181-184, No. 210-213, No. 160-161.

2. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to claim 1, wherein: The mutation site is selected from one or more of K176, L160, T174, N175, L181, N183, G184, Q210, S211, C212, and S213.

3. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to claim 1, wherein: The mutation site is selected from one or more of K176P, L160P, T174P, N175P, L181P, N183P, G184P, Q210P, S211P, C212P, and S213P.

4. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to any one of claims 1 to 3, wherein: The amino acid sequence of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof further has the following mutations compared to the amino acid sequence of the wild-type Pre-F protein of respiratory syncytial virus: Amino acid residues 104-144 are replaced with a GS linker; and / or One or more mutation sites selected from P102A, L373R, I379V, and M447V.

5. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to claim 1, wherein: The amino acid sequence of the respiratory syncytial virus antigenic polypeptide is shown as SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11 or SEQ ID No.

12.

6. A polynucleotide encoding the amino acid sequence of the respiratory syncytial virus antigenic polypeptide according to any one of claims 1 to 5 or an immunogenic fragment thereof.

7. The polynucleotide according to claim 6, which is DNA or RNA; Preferably, the sequence of the polynucleotide encoding the respiratory syncytial virus antigenic polypeptide is as shown in SEQ ID No.14, SEQ ID No.15, SEQ ID No.16, SEQ ID No.17, SEQ ID No.18, SEQ ID No.19, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22, SEQ ID No.23, SEQ ID No.24, SEQ ID No.28 or SEQ ID No.29; Preferably, the sequence of the polynucleotide encoding the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide is from SEQ ID No.14, SEQ ID No.15, SEQ ID No.16, SEQ ID No.17, SEQ ID No.18, SEQ ID No.19, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22, SEQ ID No.23, SEQ ID No.24, The sequence shown in SEQ ID No.28 or SEQ ID No.

29.

8. Use of the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to any one of claims 1 to 5 or the polynucleotide according to claim 6 or 7 in the preparation of a respiratory syncytial virus vaccine.

9. A respiratory syncytial virus vaccine comprising: at least one mRNA having an open reading frame encoding a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof according to any one of claims 1 to 5, and A pharmaceutically acceptable carrier.

10. The vaccine according to claim 9, having one or more of the following characteristics: The open reading frame is codon optimized; The open reading frame also has a sequence encoding a signal peptide linked to a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof; The open reading frame also has a sequence encoding a transmembrane region connected to a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof; The at least one mRNA comprises at least one chemical modification; preferably, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O-methyluridine; preferably, at least 80%, at least 90% or 100% of the uracils in the open reading frame have a chemical modification; The at least one mRNA comprises at least one 5′ end cap structure; The at least one mRNA comprises a 3′ polyA tail; The vaccine is formulated in nanoparticles; preferably, the nanoparticles have an average diameter of 50 nm to 200 nm; preferably, the nanoparticles are lipid nanoparticles; preferably, the lipid nanoparticles comprise cationic lipids, PEG-modified lipids, sterols and non-cationic lipids; preferably, wherein the cationic lipids are ionizable cationic lipids, the non-cationic lipids are neutral lipids, and the sterols are cholesterol.

Images