A viral vector comprising SIRT6 for treating a disease

Abstract

The invention concerns recombinant adeno-associated virus (rAAV) vectors comprising a polynucleotide sequence encoding a SIRT6 protein, wherein said polynucleotide sequence encoding a SIRT6 protein is codon-optimized for obtaining molecules with a customized stability, translation efficiency and / or reduced immunogenicity. As well as uses and methods employing the rAAV vectors for treating various diseases.

Description

[0001] A VIRAL VECTOR COMPRISING SIRT6 FOR TREATING A DISEASE

[0002] TECHNOLOGICAL FIELD

[0003] The present disclosure concerns therapeutic methods based on increasing the expression of SIRT6 using an expression vector, specifically a recombinant adeno- associated virus (rAAV) vector.

[0004] BACKGROUND ART

[0005] References considered to be relevant as background to the presently disclosed subject matter are listed below:

[0006] 1. Cai et al., Oncogene 35: 4949-4956, 2016

[0007] 2. Winter J. et al. Nat Cell Biol. 11 :228-34 (2009).

[0008] 3. Roichman A. et al.. Nature Communications volume 12, Article number: 3208 (2021)

[0009] 4. Umadevi Thirumurthi et al., Sci Signal 7(336), (2014)

[0010] 5. Wang et al Scientific Reports 11 Article No. 14253 (2021)

[0011] 6. Kong, Junsheng Ye et al. Cell Rep. 2013 December 26; 5(6): 1639-1649

[0012] 7. Sarah M. Ronnebaum et al., Molecular and Cellular Biology. 33, Issue 22, 2013, Pages 4461-4472.

[0013] 8. Alfredo Garcia-Venzor and Debra Toiber, Front. Aging Neuroscince

[0014] (13) 2021, 747989

[0015] 9. Lin, X., et al. (2020). Int. J. Mol. Sci. 21 : 1666.

[0016] 10. Gonzalez-Hunt, C. P., and Sanders, L. H. (2021). J. Neurosci.

[0017] Res. 99, 180-189.

[0018] 1 1. Eitan Okun et al., PLOS ONE https: / / doi.org / 10.1371 / joumal.pone.0179681 June 23, 2017 Acknowledgement of the above references herein is not to be inferred as meaning that these are in any way relevant to the patentability of the presently disclosed subject matter.

[0019] BACKGROUND

[0020] SIRT6 is a member of the evolutionarily conserved sirtuin family of NAD (+)- dependent protein, primarily with deacetylase activity; it also has longer chain deacylase and ADP ribosylase activities. SIRT6 is found in the nucleus, cytoplasm, and mitochondria where it performs its various enzymatic activities. Overexpression of SIRT6 confers remarkable prolongation of lifespan in mice, Drosophila, Caenorhabditis, and yeast. Prolonged lifespan in mice is accompanied by significantly improved activity like that of younger mice, all consistent with maintenance of a younger phenotype. Furthermore, the incidence of cancers and gastrointestinal adenomas are significantly reduced in mice overexpressing SIRT6 (Roichman A. et al., 2021). SIRT6 has been implicated in multiple biological processes including glucose and lipid metabolism, inflammation, anti -oxi dative stress, DNA repair, fibrosis, and tumor suppression. SIRT6 levels decrease with age, and its decline has been associated with age-related functional decline and increased susceptibility to age-related diseases.

[0021] SIRT6 plays a crucial role in maintaining the genomic integrity and epigenetic regulation necessary for brain health. It is particularly significant in human brain development and the aging process (Alfredo Garcia-Venzor and Debra Toiber., 2021). Knockout of SIRT6 in monkeys leads to severe neurodevelopmental defects, smaller brains, higher levels of immature neuron cells , reduced numbers of mature neurons, and abnormal expression of stem cell genes. These results show that SIRT6 is necessary for the proper silencing of stem-associated transcription and the differentiation of neuronal stem cells (NSCs) into neurons. In addition, human fetuses with SIRT6 nonsense mutations died prenatally and human induced pluripotent stem cells (iPSCs) derived from cells carrying this mutation in the human fetuses did not differentiate into NSCs due to a failed repression of pluripotent genes (Alfredo Garcia-Venzor and Debra Toiber, 2021). Mice over-expressing SIRT6, approximately three-fold elevation compared to wild-type mice, exhibit increased numbers of young neurons and decreased numbers of mature neurons, without affecting glial differentiation, implyiny an involvement of SIRT6 in neuronal differentiation and maturation within the hippocampus (Eitan Okun et al., 2017).

[0022] Dysfunction or loss of SIRT6 has been associated with the onset of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis (ALS) (Lin et al., 2020; Gonzalez-Hunt and Sanders, 2021).

[0023] SIRT6 is involved in many physiological processes including repair of DNA damage. It is involved in neuroprotection and cellular stress response mechanisms relevant to Alzheimer disease (AD), Parkinson’s disease (PD).

[0024] Recombinant Adeno- Associated Virus (rAAV) vectors have emerged as valuable tools in gene therapy, offering versatility, safety, and the potential for long-lasting and effective transgene expression in a wide range of therapeutic applications. These vector systems offer several benefits, such as the non-pathogenic nature of the wild-type vims, the capability of AAV to transduce both dividing and non-dividing cells, and the ability to achieve long-term and robust expression of therapeutic genes. There are various naturally occurring and recombinant AAV vector serotypes available, each with specific affinities for different tissues, organs, and cell types. This diversity expands the therapeutic possibilities of AAV-based gene therapies, as specific serotypes can be selected to target the desired site of action.

[0025] GENERAL DESCRIPTION

[0026] In a first of its aspects, the present invention provides a recombinant adeno- associated virus (rAAV) vector comprising a nucleic acid comprising (i) a promoter and / or enhancer sequence and (ii) a posttranscriptional regulatory element sequence, operably coupled to a polynucleotide sequence encoding a SIRT6 protein, wherein said polynucleotide sequence encoding a SIRT6 protein is codon-optimized for obtaining molecules with a customized (e.g., reduced, or higher) stability, and / or a customized (e.g., reduced, or higher) translation efficiency, and / or reduced immunogenicity.

[0027] In one embodiment, said polynucleotide sequence encoding SIRT6 has at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 1.

[0028] In one embodiment, said nucleic acid further comprises AAV inverted terminal repeats and / or a poly(A) signal sequence. In one embodiment, the codon-optimized polynucleotide sequence encoding SIRT6 has at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:6, SEQ ID NO:9, or SEQ ID NO: 10.

[0029] In one embodiment, said codon-optimized polynucleotide sequence encodes a modified SIRT6 mRNA.

[0030] In one embodiment, said modified SIRT6 mRNA has a deletion, or an addition in the 3' UTR such that one or more miRNA binding sites are eliminated or introduced to the SIRT6 3' UTR sequence, or wherein the whole 3'UTR sequence is being substituted.

[0031] In one embodiment, said modified SIRT6 mRNA comprises one or more mutations that prevent phosphorylation and / or ubiquitination of the SIRT6 protein.

[0032] In one embodiment, said one or more mutations is at the amino acid residue S338 (Ser338) of the SIRT6 protein.

[0033] In one embodiment, said one or more mutations comprises substituting the arginine (Arg, R) and / or leucine (Leu, L) amino acid residues within the RXXL motif of the first D-box-activating domain of the SIRT6 protein with alanine (Ala, A) (e.g., a substitution from RVGL to AVGA at positions 103-106).

[0034] In one embodiment, said one or more mutations is in the C-terminal site of SIRT6, between amino acid residues positions 263-334.

[0035] In one embodiment, said one or more mutations is at the amino acid residue K170 (Lysl70) of the SIRT6 protein (e.g., a substitution of lysine to arginine, namely K170R).

[0036] In one embodiment, the nucleic acid comprises a tissue specific or cell specific promoter and / or enhancer.

[0037] In one embodiment, said tissue specific or cell specific promoter and / or enhancer is a hepatocyte-specific promoter and / or enhancer, or a neuronal specific promoter and / or enhancer or a muscle specific promoter and / or enhancer.

[0038] In a specific embodiment, said tissue specific or cell specific promoter and / or enhancer is a hepatocyte-specific promoter and / or enhancer.

[0039] In one embodiment, said tissue specific promoter and / or enhancer is selected from a group consisting of ApoE / AATl, Synapsin (SYN), Neuron-Specific Enolase (NSE), Calcium / Calmodulin-Dependent Protein Kinase II promoter (CamKII), Thyl promoter, Nestin promoter, Cytomegalovirus Early Enhancer / Chicken Beta-Actin (GAC), Elongation Factor 1 Alpha (EFla), Phosphoglycerate Kinase 1 (PGK), Ubiquitin C (UBC), and CBA (CMV-Basic).

[0040] In one embodiment, said promoter and / or enhancer sequence is a viral promoter and / or enhancer sequence.

[0041] In one embodiment, said post-transcriptional regulatory element is Woodchuck hepatitis virus Posttranscriptional Regulatory element (WPRE).

[0042] In one embodiment, said post-transcriptional regulatory element comprises one or more untranslated regions (UTRs), e.g., 3’ and / or 5’ UTR.

[0043] In one embodiment, the WPRE comprises the sequence of SEQ ID NO: 11, or variant or homolog thereof.

[0044] In one embodiment, said rAAV vector is of the serotype AAV2, AAV8, AAV9, AAV10, or AAV-PHP.B.

[0045] In a specific embodiment, the rAAV vector is of the serotype AAV2.

[0046] In a specific embodiment, the rAAV vector is of the serotype AAV8.

[0047] In a specific embodiment, the rAAV vector is of the serotype AAV9.

[0048] In a specific embodiment, the rAAV vector is of the serotype AAV10.

[0049] In a specific embodiment, the rAAV vector is of the serotype AAV-PHP.B.

[0050] In one embodiment, said rAAV vector comprises a polycistronic expression system designed for the simultaneous expression of SIRT6 and one or more additional genes.

[0051] In one embodiment, said polycistronic expression system comprises a promoter operably linked to a first nucleic acid sequence encoding SIRT6, followed by internal ribosomal entry sites (IRES) and one or more additional nucleic acid sequences encoding one or additional genes.

[0052] In one embodiment, said one or more additional genes are selected from a group consisting of neuroprotective factors, anti-inflammatory proteins, and therapeutic agents suitable for the treatment of neurodegenerative disorders.

[0053] In another aspect, the present invention provides a method for treating a disease or disorder, or for increasing longevity, in a subject in need thereof comprising a step of administering the recombinant adeno-associated virus (rAAV) vector of any one of the preceding claims to said subject wherein said disease or disorder is at least one of a fibrotic condition, a fibrosis-associated condition, a metabolic disorder, a neurological or neurodegenerative disease, age-related frailty, an ophthalmic disease, an auditory system disease, or cancer.

[0054] In one embodiment, said fibrotic condition is selected from a group consisting of radiation-induced fibrosis, cardiac fibrosis, pulmonary fibrosis, liver fibrosis (e.g., NAFLD / NASH), skin fibrosis, fibrotic conditions in the eye, brain fibrosis, and kidney fibrosi s.

[0055] In one embodiment, said fibrosis-associated conditions are inflammation, endothelial or epithelial to mesenchymal transition, parenchymal injury, scarring, or cirrhosis.

[0056] In one embodiment, the cancer is a solid tumor or a hematological cancer.

[0057] In one embodiment, said neurological or neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD), Parkinson’s disease (PD), frailty syndrome, dementia, Amyotrophic Lateral Sclerosis (ALS), and Adrenoleukodystrophy (ALD).

[0058] In one embodiment, said ophthalmic disease is selected from the group consisting of Glaucoma, Age related Macular Degeneration (AMD), Diabetic Macular Edema (DME) and Diabetic retinopathy.

[0059] In one embodiment, the auditory system disease is Age-related hearing loss (also referred to as presbycusis).

[0060] In one embodiment, said subject is a human subject.

[0061] In one embodiment, said method further comprises administering to said subject an additional therapeutic agent.

[0062] In one embodiment the additional therapeutic agent is an anti-cancer agent or anticancer therapy.

[0063] In another aspect, the present invention provides an adeno-associated virus (AAV) vector comprising a nucleic acid comprising (i) a promoter and / or enhancer sequence and (ii) a posttranscriptional regulatory element sequence, operably coupled to a polynucleotide sequence encoding a SIRT6 protein, wherein said polynucleotide sequence encoding a SIRT6 protein is codon-optimized for obtaining molecules with a customized (e.g., reduced, or higher) stability, and / or a customized (e.g., reduced, or higher) translation efficiency, and / or reduced immunogenicity for use in a method of treating a disease or disorder, or for increasing longevity, in a subject in need thereof wherein said method comprises a step of administering a therapeutically effective amount of said AAV vector, wherein said disease or disorder is at least one of a fibrotic condition, a fibrosis-associated condition, a metabolic disorder, a neurological or neurodegenerative disease, age-related frailty, an ophthalmic disease, an auditory system disease, or cancer.

[0064] In another aspect, the present invention provides a nucleic acid comprising (i) a promoter and / or enhancer sequence and (ii) a posttranscriptional regulatory element sequence, operably coupled to a polynucleotide sequence encoding a SIRT6 protein, wherein said polynucleotide sequence encoding a SIRT6 protein is codon-optimized for obtaining molecules with a customized (e.g., reduced, or higher) stability, and / or a customized (e.g., reduced, or higher) translation efficiency and / or reduced immunogenicity.

[0065] In one embodiment, said polynucleotide sequence encoding a SIRT6 protein comprises the sequence having at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 1.

[0066] In one embodiment, the codon-optimized polynucleotide sequence encoding SIRT6 has at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:6, SEQ ID NOV, or SEQ ID NO: 10.

[0067] In one embodiment, said promoter and / or enhancer sequence is a viral promoter and / or enhancer sequence.

[0068] In one embodiment, said promoter and / or enhancer sequence is a tissue specific or cell specific promoter and / or enhancer sequence.

[0069] In one embodiment, said tissue specific or cell specific promoter and / or enhancer is a liver-specific promoter and / or enhancer, a muscle-specific promoter and / or enhancer, a neuronal tissue-specific promotor and / or enhancer, an eye tissue-specific promotor and / or enhancer, or an ear tissue-specific promotor and / or enhancer.

[0070] In one embodiment, the nucleic acid further comprises one or more AAV inverted terminal repeats.

[0071] In another aspect, the invention provides an expression cassette suitable for use in an AAV vector, comprising a nucleic acid according to the invention.

[0072] In another aspect, the invention provides a pharmaceutical composition comprising an AAV vector as defined above and one or more pharmaceutically or physiologically acceptable carriers, excipients and / or diluents. In one embodiment, the invention provides a pharmaceutical composition as defined above, for use in the treatment of a disease or disorder, or for increasing longevity, wherein said disease or disorder is at least one of a fibrotic condition, a fibrosis-associated condition, a metabolic disorder, a neurological or neurodegenerative disease, an ophthalmic disease, an auditory system disease, or cancer.

[0073] BRIEF DESCRIPTION OF THE DRAWINGS

[0074] To exemplify and better understand the subject matter that is disclosed herein, embodiments will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which:

[0075] Fig. 1A-1D are photographs showing GFP expression in two NIH-3 IM mice liver (Mouse 1 and Mouse2) as evaluated by Maestro in-vivo imaging system 10 days (A), 17 days (B) 24 days (C) and 60 days (D) after injection of AAV8-ApoE / hAATl-eGFP- WPRE. An intact untreated mouse served as the control. Fig IE, is a graph showing quantitation of total fluorescent signal in each mouse liver (mouse# 1 and mouse#2), expressed in x106phot / cm2 / sec as a function of time (shown as days after AAV8-GFP injection).

[0076] Figs. 2A-2B present expression of SIRT6 in mouse liver 14 days following injection of 2 x1011AAV8-ApoE / hAATl-SIRT6-WPRE copies (AAV8-SIRT6) or PBS vehicle control. (A) is a photograph of a gel showing SIRT6 protein expression in AAV8- SIRT6 injected mice compared to control (PBS). Also shown are expression levels of the housekeeping protein P-Actin (B) is a graph showing SIRT6 mRNA expression in AAV8- SIRT6 injected mice compared to control (PBS), normalized to CycloA gene. Results are presented as fold of Control mouse.

[0077] Figs. 3A-3C show H&E staining of SZT-HFD mouse livers at week 11 of age (n=3; Figs. 3A-C correspond to mice #1, #2 and #3 respectively).

[0078] Fig 4 is a graph showing the survival rate over time (mice age in weeks) of Control vehicle group (N=7) compared to SIRT6-AAV treated SZT-HFD mice (N=4). Fig 5 is a schematic representation of an in-silico prediction of the Minimum free energy (MFE) secondary structure of the human SIRT6 mRNA transcribed from SEQ ID: 1, SEQ ID:2, SEQ ID:3, SEQ ID:4, SEQ ID:5, SEQ ID:6, SEQ ID:7, SEQ ID:8, SEQ ID: 9, and SEQ ID: 10.

[0079] Figs. 6A-6D present expression of different human SIRT6 mRNA in human Huh7 cells. (A-C) are photographs of gels showing protein levels of human SIRT6 expressed in Huh7 cells, 24 hours after cells transfection with increasing SIRT6 mRNA concentrations (A) 0.065 pg / ml mRNA concentration (B) 0.125 pg / ml mRNA concentration (C) 0.25 pg / ml mRNA concentration. Histone3 protein is used as the normalizing protein. The numbers #1, #9, #10, and #6 represent different SIRT6 mRNA sequences with reference to corresponding SEQ ID Nos. (D) is a graph showing relative protein expression generated by various human SIRT6 mRNA sequences. Results are presented as fold of Control untreated (without transfection) cells. The graph shows three doses of transfected SIRT6 mRNA, and negative control of Lipofectamine MessengerMAX™ reagent only (control). Results, using the human alpha globin 3’UTR target-specific primers normalized to CyCloA gene, are Average ± SE fold to control mRNA levels as examined by RT-qPCR using primers.

[0080] Figs. 7A-7C Expression levels of human SIRT6 expressed in mouse primary hepatocytes using different human SIRT6 mRNA transcripts (SEQ ID Nos: #1, #9, #10 and #6) and un-transfected cells as control. (A) is a photograph of a gel showing human SIRT6 protein levels 24 hours after cell transfection with 0.125pg / mL SIRT6 mRNA, with Histone3 protein used as a normalizing protein. (B) is a graph showing human SIRT6 mRNA levels 24 and 48 hours after transfection with one of three increasing concentrations. Results, using the human alpha globin 3’UTR target-specific primers normalized to CyCloA gene, are Average ± SE fold to control mRNA levels as examined by RT-qPCR. (C) is a graph showing protein levels of human SIRT6 expressed in mouse primary hepatocytes cells, 24 and 48 hours after cells transfection with 0.0625pg / mL SIRT6 mRNA. Histone3 protein is used as normalizing protein. Fig- 8 are microphotographs presenting SIRT6 immunostaining in cervical (C) and lumbar (L) segments of spinal cord two weeks after intrathecal (IT) injection of 5xl09(mouse#3), 1x1011(mouse #6), 5x1010(mouse#10) gene copies. Mouse #7 was injected i.v. with 3x10ngene copies and mouse #1 served as control and was injected with PBS alone. Black dots represent SIRT6 staining (magnification x10).

[0081] Figs. 9A-9J are microphotographs presenting SIRT6 immunostaining in cervical (Fig. 10A-10E) and lumbar (Fig. 1 OF- 10 J) segments of spinal cord two weeks after IT injection of 5xl09(mouse#3, Fig. 10B, 10G), 1x1011(mouse #6, Fig. 10C, 10H), 5x1010(mouse#10, Fig. 10E, 10J) gene copies. Mouse #7 (Fig. 10D, 101) was injected i.v. with 3x1011gene copies and mouse #1 (Fig. 10A, 10F) served as control and was injected with PBS alone. Black dots represent SIRT6 staining (magnification x20).

[0082] Fig. 10 is a micrograph presenting SIRT6 immunostaining in a brain section; two weeks after intrathecal (IT) injection of 5xl09(mouse#3), 1x1011(mouse #6), 5x1010(mouse#10) gene copies. Mouse #7 was injected i.v. with 3x1011gene copies and mouse #1 served as control and was injected with PBS alone. Black dots represent SIRT6 staining.

[0083] Fig. 11A-11E are microphotographs presenting SIRT6 immunostaining in the hippocampal dentate gyrus two weeks after IT injection of 5xl09(mouse#3, Fig. 10B), 1x1011(mouse #6, Fig. 10C), 5x1010(mouse#10, Fig. 10E) gene copies. Mouse #7 (Fig. 10D) was injected i.v. with 3x1011gene copies and mouse #1 (Fig. 10A) served as control and was injected with PBS alone. Black dots represent SIRT6 staining (magnification x20).

[0084] DETAILED DESCRIPTION OF EMBODIMENTS

[0085] The present invention is based on the concept that SIRT6 levels in cells can be augmented by in vivo administration of viral vectors comprising a nucleic acid that encodes for the SIRT6 protein. The present invention therefore concerns the formulation of recombinant adeno-associated virus (rAAV) vectors, in particular optimized rAAV suitable for the delivery of therapeutic rAAV products expressing the SIRT6 gene to human subjects to increase SIRT6 expression in different tissues and cells and thereby to treat a variety of diseases and disorders. The optimized rAAV vectors facilitate effective expression levels of SIRT6. The newly designed vectors enable precise and efficient expression of SIRT6 while enhancing safety and minimizing immune responses, thereby reducing drawbacks associated with excessive and continuous gene expression. The AAV vectors of the invention thus optimize the therapeutic potential of SIRT6-based therapies by achieving an ideal balance between efficient level of expression and maintenance of safety and immune tolerance.

[0086] The AAV vectors of the invention are designed to regulate gene expression in specific tissues or cell types, while reducing the risks associated with transgene overexpression and enhancing the safety profile of AAV gene therapies. Given that the gene of interest is constantly expressed using the AAV vector, various strategies can be employed to regulate protein expression and avoid safety issues associated from continuous overexpression. One approach involves optimizing the gene sequence itself. By designing mRNA molecules with a reduced or a higher stability, or by changing the secondary structure it is possible to effectively regulate translation efficiency and thereby exert control over the levels of protein expression. An alternative strategy is to stabilize the mRNA sequence, while utilizing a weak promoter to regulate protein expression. By employing a weak promoter, the transcriptional activity is reduced, leading to lower levels of mRNA production, and subsequently decreasing the translation efficiency. This facilitates achieving the desired balance in protein expression by ensuring that it remains at moderate levels.

[0087] The relatively reduced or higher expression levels can be determined qualitatively or quantitatively using methods well known to a person skilled in the art. For example, by comparing SIRT6 mRNA levels using e.g., qPCR, or SIRT6 protein levels by comparing the density / intensity of bands in Western blot analysis. Any statistically significant difference (either increase or decrease) between the intensity of the bands of the optimized nucleic acid sequence, or the protein transcribed from the optimized sequence, as compared to a control (e.g., as compared to the expression level of the native SIRT6 molecule) is considered a higher or a reduced level of expression. Comparison can also be made by analyzing staining intensity in histological sections (e.g., using immunohi stol ogy ) . For example, but not limited to, a "higher" expression refers to an increase in expression that is at least 1.5-fold, 2-fold or greater compared to the native molecule expression level.

[0088] The present invention therefore provides expression vectors, specifically adeno- associated virus (AAV) vectors encoding SIRT6 (also referred to herein in short as “AAV-SIRT6 vector”).

[0089] AAV is a non-enveloped virus comprised of a protein shell surrounding and protecting a small, single-stranded DNA genome of approximately 4.8 kilobases (kb). Its single-stranded genome contains three genes, Rep (Replication), Cap (Capsid), and aap (Assembly). These three genes give rise to at least nine gene products by using three promoters, alternative translation start sites, and differential splicing. The single-stranded AAV genomes are bounded at either end by palindromic G-C-rich inverted terminal repeats (ITRs), that are required for genome replication and packaging. Recombinant AAV (rAAV), which lacks viral DNA, is essentially a protein-based nanoparticle engineered to traverse the cell membrane, where it can ultimately traffic and deliver its DNA cargo into the nucleus of a cell. In the absence of Rep proteins. ITR-flanked transgenes encoded within rAAV can form circular concatemers that persist as episomes in the nucleus of transduced cells. AAV has evolved to enter cells through initial interactions with carbohydrates present on the surface of target cells, typically sialic acid, galactose, and heparin sulfate. Subtle differences in sugar-binding preferences, encoded in capsid sequence differences, can influence cell-type transduction preferences of the various AAV variants. For example, AAV9 has a unique ability to cross the blood-brain barrier (BBB) and infect cells of the CNS, including primary neurons and can also be used for targeting genes in the lung, skeletal and cardiac muscles, and liver. AAV8 can transfer genes to the liver, heart, skeletal muscles, and pancreas, AAV2 with broad gene transfer ability.

[0090] The term “AAV” may be used to refer to the various AAV variants or derivatives thereof. The term covers all serotypes as well as naturally occurring, recombinant forms, modifications, or derivatives, known in the art, or any combination thereof (e.g., a population of AAV particles that comprises two or more serotypes, e.g., comprising two or more of AAV2, AAV8, AAV9, AAV10 or AAV-PHP.B particles) known in the art, except where required otherwise. The term “AAV” includes for example, AAV type 1 (AAV-1), AAV type 2 (AAV-2), AAV type 3 (AAV-3), AAV type 4 (AAV-4), AAV type 5 (AAV-5), AAV type 6 (AAV-6), AAV type 7 (AAV-7), AAV type 8 (AAV-8), AAV type 9 (AAV-9), AAV type 10 (AAV-10), AAV type 12 (AAV-12), AAV-PHP.B, AAV Serotype AAVhu, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV.

[0091] The AAV vector of the invention comprises a nucleic acid comprising (i) a promoter and / or enhancer sequence and (ii) a posttranscriptional regulatory element sequence, operably coupled to a polynucleotide sequence encoding a SIRT6 protein.

[0092] In one embodiment, the AAV-SIRT6 vector encodes the native SIRT6 protein, namely the wildtype version of the protein, referred to herein as "native SIRT6" or “wildtype SIRT6”. The sequence of the SIRT6 protein, or the SIRT6 encoding polynucleotide (also referred to as the SIRT6 mRNA) can be found in amino acid or nucleotide databases (see for example, the NCBI nucleotide database). The invention encompasses variants of SIRT6 encoding sequences as may be found in such nucleotide databases. In a non-limiting embodiment, the human SIRT6 ORF which is transcribed to mRNA has the following sequence identified as SEQ ID NO 1 : ATTGTTCCCGTGGGGCAGTCGAGGATGTCGGTGAATTACGCGGCGGGGCTGTCGCCGTACGCGGACAAGG GCAAGTGCGGCCTCCCGGAGATCTTCGACCCCCCGGAGGAGCTGGAGCGGAAGGTGTGGGAACTGGCGAG GCTGGTCTGGCAGTCTTCCAGTGTGGTGTTCCACACGGGTGCCGGCATCAGCACTGCCTCTGGCATCCCC GACTTCAGGGGTCCCCACGGAGTCTGGACCATGGAGGAGCGAGGTCTGGCCCCCAAGTTCGACACCACCT TTGAGAGCGCGCGGCCCACGCAGACCCACATGGCGCTGGTGCAGCTGGAGCGCGTGGGCCTCCTCCGCTT CCTGGTCAGCCAGAACGTGGACGGGCTCCATGTGCGCTCAGGCTTCCCCAGGGACAAACTGGCAGAGCTC CACGGGAACATGTTTGTGGAAGAATGTGCCAAGTGTAAGACGCAGTACGTCCGAGACACAGTCGTGGGCA CCATGGGCCTGAAGGCCACGGGCCGGCTCTGCACCGTGGCTAAGGCAAGGGGGCTGCGAGCCTGCAGGGG AGAGCTGAGGGACACCATCCTAGACTGGGAGGACTCCCTGCCCGACCGGGACCTGGCACTCGCCGATGAG GCCAGCAGGAACGCCGACCTGTCCATCACGCTGGGTACATCGCTGCAGATCCGGCCCAGCGGGAACCTGC CGCTGGCTACCAAGCGCCGGGGAGGCCGCCTGGTCATCGTCAACCTGCAGCCCACCAAGCACGACCGCCA TGCTGACCTCCGCATCCATGGCTACGTTGACGAGGTCATGACCCGGCTCATGAAGCACCTGGGGCTGGAG ATCCCCGCCTGGGACGGCCCCCGTGTGCTGGAGAGGGCGCTGCCACCCCTGCCCCGCCCGCCCACCCCCA AGCTGGAGCCCAAGGAGGAATCTCCCACCCGGATCAACGGCTCTATCCCCGCCGGCCCCAAGCAGGAGCC CTGCGCCCAGCACAACGGCTCAGAGCCCGCCAGCCCCAAACGGGAGCGGCCCACCAGCCCTGCCCCCCAC AGACCCCCCAAAAGGGTGAAGGCCAAGGCGGTCCCCAGCTGACCAGGGTGCTTGGGGAGGGTGGGGCTTT TTGTAGAAACTGTGGATTCTTTTTCTCTCGTGGTCTCACTTTGTTACTTGTTTCTGTCCCCGGGAGCCTC AGGGCTCTGAGAGCTGTGCTCCAGGCCAGGGGTTACACCTGCCCTCCGTGGTCCCTCCCTGGGCTCCAGG GGCCTCTGGTGCGGTTCCGGGAAGAAGCCACACCCCAGAGGTGACAGGTGAGCCCCTGCCACACCCCAGC CTCTGACTTGCTGTGTTGTCCAGAGGTGAGGCTGGGCCCTCCCTGGTCTCCAGCTTAAACAGGAGTGAAC TCCCTCTGTCCCCAGGGCCTCCCTTCTGGGCCCCCTACAGCCCACCCTACCCCTCCTCCATGGGCCCTGC AGGAGGGGAGACCCACCTTGAAGTGGGGGATCAGTAGAGGCTTGCACTGCCTTTGGGGCTGGAGGGAGAC GTGGGTCCACCAGGCTTCTGGAAAAGTCCTCAATGCAATAAAAACAATTTCTTTCTTGCA

[0093] The present invention also encompasses polynucleotide sequences encoding

[0094] SIRT6 which have at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence homology to the polynucleotide sequence encoding native SIRT6. In an embodiment, the present invention refers to polynucleotide sequences encoding SIRT6 having at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence homology to a polynucleotide sequence transcribed from the human SIRT6 ORF identified as SEQ ID No 1.

[0095] In certain embodiments, the polynucleotides encode SIRT6 variants that are more common in centenarians, i.e., variants which have certain polymorphisms that are particularly associated with longevity.

[0096] Certain modifications may be introduced to the native sequence to expand its functionality, to reduce immunogenicity, to customize, namely, to reduce or increase stability, and to customize, namely, to reduce or increase protein expression.

[0097] The present invention also encompasses variants of the SIRT6 encoding polynucleotides. The variants include nucleic acid substitutions which do not reduce the functionality of the SIRT6 protein.

[0098] By the term “varian it is meant a SIRT6 encoding polynucleotide in which one or more nucleotides are deleted, substituted, or added, wherein these alterations do not abolish the functionality of the SIRT6 protein.

[0099] It should be appreciated that the term "added ", as used herein means any addition of one or more nucleic acids to the sequences described herein.

[0100] It should be appreciated that the term "substituted ", as used herein means any substitution of one or more nucleic acids of the sequences described herein.

[0101] It should be appreciated that the term "deleted ", as used herein, means any deletion of one or more nucleic acids from the sequences described herein.

[0102] The SIRT6 encoding polynucleotide may also be modified by codon usage optimization. As used herein the term "codon usage optimization" refers to the replacement of the host codon usage without modifying the amino acid sequence of the encoded protein. Codon optimization can be used to reduce or increase the stability of the molecule, to reduce immunogenicity (e.g., reduced CpG motifs ) and to reduce or increase protein expression.

[0103] Protein sequences can be encoded by an enormous multitude of possible nucleotide sequences. The degenerate mapping between amino acids and synonymous codons entails an exponential relationship between the number of potential nucleotide sequences and the length of the polypeptide chain. However, different nucleotide sequences encoding the same protein may exhibit dramatically different outcomes in expression systems.

[0104] Codon optimization is a procedure designed to increase gene expression based on a scoring function .The scoring functions include optimization of the fraction of G and C bases, matching the codon usage bias of the host expression system and / or attempting to disrupt the formation of mRNA secondary structure. The expression levels of proteins are highly correlated with codon usage bias. The frequency of codons in a DNA sequence is positively correlated with the corresponding tRNA in a species, and the tRNA concentration determines the number of amino acids available for protein translation extension, which in turn affects the efficiency of protein synthesis. Thus, rare codons tend to reduce the rate of translation and even cause translation errors.

[0105] In rAAV technology, the DNA within the recombinant adeno-associated virus is transcribed into mRNA, which is subsequently translated into protein. To achieve precise control over protein expression levels, the gene open reading frame (ORF) sequence was optimized. This optimization involves introducing modifications that affect the stability of the mRNA molecules or alterations in the secondary structure of the mRNA. By implementing such modifications, the stability of the mRNA can be reduced or improved, or the efficiency of translation can be affected. Consequently, the level of SIRT6 protein is increased or reduced.

[0106] Altering the mRNA sequence influences the rate of mRNA degradation, thereby allows controlling the abundance of SIRT6 protein and fine-tuning the expression levels of the protein for achieving desired therapeutic outcomes.

[0107] The present invention thus provides codon optimized SIRT6 mRNA molecules. These molecules were constructed based on the native wild-type sequence (SEQ ID NO: 1).

[0108] The following are codon optimized sequences according to the invention:

[0109] Human SIRT6 Codon optimized SEQ ID No: 2 (GC=59.55%, CAI=0.81 with self-folding energy -424.1 kcal / mol): atgagtgttaactatgctgccggcctgtccccttacgctgataaggggaagtgtgggctgcccgagattttcgatccc ccggaagagctggaaagaaaagtgtgggagctggcgagactggtctggcagtctagctcagttgtgttccatactgga gccggcatcagtacggccagcgggatcccggatttcagaggcccacacggcgtgtggacaatggaagagaggggactg gcccctaaattcgatactaccttcgagagcgcgagaccaacacaaactcacatggccctggtccagctggaacgcgtg gggttgctcaggttcctcgtgagtcagaacgtggacggcctgcacgtcaggagtggtttcccccgtgacaaactggcc gagttgcacggcaatatgttcgtggaagagtgtgctaagtgcaaaacccagtatgtccgcgatactgtagtcggtaca atgggcctcaaggctaccggccgtctttgcactgtggctaaggcgcgcggactgagggcgtgccgcggagagctgcgc gataccatcctggactgggaggattccttgcccgacagggacctggccctggccgacgaggctagccgcaacgcggat ctgtccattacactgggtacctccctgcagatccgccctagcggtaacttgcctcttgccacaaaaagacgtggaggg cgtctcgtgatcgtgaatctgcagcctaccaaacacgacaggcacgcagacctcagaatccacggttacgtggacgaa gtgatgactcgtctgatgaagcatttgggactggagattcctgcatgggatggcccccgtgtgctggagcgggctttg ccccctctgccccgtcctccaacccccaagctggagcctaaagaggaatccccaacccgcatcaacggttctatccca gctggaccaaagcaggagccgtgtgctcaacacaacggcagcgaacccgcctcacctaagcgcgaacgccccacctcc ccagccccacaccgccctccaaaacgcgtgaaagccaaggcagtgccctcctga

[0110] Human SIRT6 Codon optimized SEQ ID No: 3 (GC=53.84%, CAI=0.72 with self-folding energy -349.7 kcal / mol):

[0111] ATGTCTGTAAATTACGCCGCCGGCCTCTCACCATACGCTGATAAGGGCAAGTGCGGTCTTCCAGAGATATTTGACCCG

[0112] CCTGAGGAGCTGGAGCGAAAAGTCTGGGAACTCGCACGACTTGTATGGCAATCCTCTTCTGTGGTATTTCACACCGGA

[0113] GCCGGGATCTCAACTGCCTCTGGAATTCCCGATTTCCGCGGTCCCCATGGAGTGTGGACAATGGAAGAACGAGGGTTG

[0114] GCCCCAAAATTTGACACCACCTTTGAATCCGCTCGGCCTACACAGACTCACATGGCGTTGGTTCAACTCGAGCGGGTT

[0115] GGGTTGCTGAGATTTCTCGTGAGTCAAAATGTTGATGGTCTTCATGTGAGAAGTGGGTTTCCAAGGGACAAATTGGCC

[0116] GAACTGCATGGGAACATGTTCGTTGAGGAGTGCGCAAAGTGCAAGACACAGTACGTAAGGGACACCGTTGTTGGGACT

[0117] ATGGGTCTGAAGGCTACTGGACGCCTCTGCACCGTCGCAAAGGCGAGGGGACTCCGCGCTTGCCGGGGAGAGCTTCGA

[0118] GATACAATCCTTGACTGGGAAGATTCACTCCCTGATAGAGATCTCGCGTTGGCTGACGAGGCATCTCGGAATGCAGAC

[0119] CTTTCCATCACCTTGGGTACTTCTCTTCAAATTCGGCCATCAGGAAATCTTCCACTTGCTACAAAAAGACGGGGTGGT

[0120] CGCCTTGTGATTGTAAACCTGCAGCCTACTAAACATGATCGGCACGCTGATCTCAGGATCCATGGTTATGTTGATGAA

[0121] GTAATGACGCGACTGATGAAGCATCTCGGTCTCGAAATACCCGCTTGGGACGGGCCTAGGGTACTCGAGAGAGCCCTT

[0122] CCCCCACTGCCGAGACCACCGACCCCTAAACTCGAACCAAAGGAGGAGTCCCCAACCAGGATTAACGGTAGCATTCCC

[0123] GCCGGACCCAAACAGGAACCGTGCGCTCAACACAACGGTTCAGAACCGGCGTCTCCTAAAAGAGAGCGACCAACCTCT

[0124] CCGGCGCCTCACCGCCCCCCTAAAAGGGTCAAGGCAAAAGCAGTACCTTCATGA

[0125] Human SIRT6 Codon optimized SEQ ID No: 4 (GC=63.20%, CAI=0.94 with self-folding energy -398.1 kcal / mol):

[0126] ATGAGCGTGAACTACGCCGCCGGCCTGAGCCCCTACGCCGACAAGGGCAAGTGCGGCCTGCCCGAGATCTTC

[0127] GACCCCCCCGAGGAGCTGGAGAGAAAGGTGTGGGAGCTGGCTAGACTGGTGTGGCAGAGCAGCAGCGTGGTGTTCCAC

[0128] ACCGGCGCCGGCATCTCCACCGCGAGCGGTATTCCCGACTTCAGAGGCCCCCACGGCGTGTGGACCATGGAGGAGAGA

[0129] GGCCTGGCCCCCAAGTTCGACACCACCTTCGAGAGCGCTAGACCCACACAGACCCACATGGCCCTGGTGCAGCTGGAG

[0130] AGAGTGGGCCTGCTGAGATTCCTGGTGTCTCAGAACGTGGACGGCCTGCACGTGAGAAGCGGCTTCCCTAGAGACAAG

[0131] CTGGCCGAGCTGCACGGCAACATGTTCGTGGAGGAGTGCGCCAAGTGCAAGACACAGTACGTGAGAGACACCGTGGTG

[0132] GGCACCATGGGCCTGAAGGCCACCGGCAGACTGTGCACCGTGGCCAAGGCTAGAGGCCTGAGAGCCTGCAGAGGCGAG

[0133] CTGAGAGACACCATCCTGGACTGGGAGGACAGCCTGCCCGACAGAGACCTGGCCCTGGCCGACGAGGCTAGCAGAAAT

[0134] GCCGACTTAAGCATTACCCTGGGCACAAGCCTGCAGATCAGACCTAGCGGCAACCTGCCCCTGGCCACCAAGAGAAGA

[0135] GGCGGCAGACTGGTGATCGTGAACCTGCAGCCCACCAAGCACGACAGACATGCAGACCTGAGAATCCACGGCTACGTG

[0136] GACGAGGTGATGACAAGACTGATGAAGCACCTGGGGCTTGAGATCCCCGCATGGGATGGACCTAGAGTGCTGGAGAGA

[0137] GCCTTACCCCCCTTGCCGAGACCTCCCACACCCAAGCTGGAGCCCAAGGAGGAGAGCCCCACCCGCATCAATGGAAGC ATCCCCGCTGGGCCCAAGCAAGAGCCCTGTGCTCAGCACAATGGCAGCGAGCCCGCTAGCCCGAAACGGGAGAGACCA ACGTCACCTGCCCCCCACAGACCCCCCAAGAGAGTGAAGGCCAAGGCCGTGCCTAGCTGA

[0138] Human SIRT6 Codon optimized SEQ ID No: 5 (GC=61.61%, CAI=0.93 with self-folding energy -414.1 kcal / mol):

[0139] ATGAGCGTGAACTATGCCGCTGGCCTGAGCCCCTACGCCGACAAGGGCAAGTGCGGCCTGCCTGAGATCTTT GACCCCCCCGAGGAACTGGAGAGAAAGGTGTGGGAGCTGGCCCGGCTGGTCTGGCAGAGCAGCAGCGTGGTGTTCCAC ACAGGCGCCGGAATCAGCACCGCCAGCGGCATTCCTGACTTCAGAGGCCCTCACGGCGTGTGGACCATGGAAGAGAGA GGCCTTGCCCCTAAATTCGACACCACATTCGAGAGCGCCAGACCTACACAGACACACATGGCCCTGGTCCAGCTGGAG CGGGTGGGCCTGCTGCGGTTCCTGGTGTCCCAGAACGTGGACGGCCTCCATGTGCGGAGCGGCTTCCCCAGAGATAAG CTGGCCGAGCTGCACGGAAATATGTTTGTGGAAGAATGTGCTAAGTGCAAGACCCAGTACGTGAGAGATACAGTGGTC GGCACCATGGGCCTGAAGGCCACCGGCAGACTGTGCACCGTGGCCAAAGCCAGAGGACTCAGGGCATGCAGAGGAGAG CTGAGAGACACCATCCTGGACTGGGAAGATAGCCTGCCAGATCGGGACCTGGCTCTGGCCGATGAGGCCTCTAGAAAC GCCGATCTGTCCATCACCCTGGGAACATCTCTGCAAATCAGACCCTCTGGCAACCTGCCTCTGGCTACAAAGCGGAGA GGAGGCAGACTCGTGATCGTGAATCTGCAGCCTACCAAGCACGACAGACACGCCGACCTGCGCATCCACGGCTACGTG GACGAGGTGATGACCCGGCTGATGAAACACCTGGGCCTGGAGATCCCTGCCTGGGACGGCCCCAGAGTTCTGGAAAGA GCTCTGCCTCCTCTGCCCAGACCTCCAACCCCTAAACTGGAACCCAAGGAAGAGAGCCCTACGCGGATCAACGGCAGC ATCCCGGCCGGCCCCAAGCAGGAGCCATGTGCCCAGCACAACGGCAGCGAGCCTGCCTCCCCAAAGCGGGAACGGCCT ACCAGCCCTGCTCCTCACAGACCACCTAAGAGGGTGAAGGCCAAGGCCGTGCCTTCTTGA

[0140] Human SIRT6 Codon optimized SEQ ID No: 6 (GC=58.80%, CAI=0.93 with self-folding energy -378.8 kcal / mol):

[0141] ATGAGCGTGAACTATGCCGCCGGACTGAGCCCCTATGCCGATAAGGGAAAGTGTGGCCTGCCTGAGATCTTC GACCCTCCTGAGGAACTGGAAAGAAAAGTGTGGGAACTCGCCCGGCTCGTGTGGCAGAGTAGCTCTGTGGTGTTTCAC ACCGGCGCTGGCATCTCTACAGCCAGCGGCATCCCTGATTTCAGAGGACCTCATGGCGTGTGGACCATGGAAGAGAGA GGACTGGCCCCAAAGTTCGACACCACCTTCGAGAGCGCCAGACCTACACAGACACACATGGCCCTGGTGCAGCTGGAA AGAGTGGGACTGCTGAGATTCCTGGTGTCCCAGAATGTGGACGGACTGCATGTGCGGAGCGGCTTCCCTAGAGATAAG CTGGCCGAGCTGCACGGCAACATGTTCGTGGAAGAGTGCGCCAAGTGCAAGACCCAGTACGTGCGGGATACAGTCGTG GGCACAATGGGCCTGAAAGCCACCGGCAGACTGTGCACTGTGGCCAAAGCTAGAGGCCTGAGAGCCTGTAGAGGCGAG CTGAGAGACACCATCCTGGACTGGGAAGATAGCCTGCCAGACAGAGATCTGGCCCTGGCCGATGAGGCCAGCAGAAAT GCCGATCTGAGCATCACCCTGGGCACCAGCCTGCAGATCAGACCATCTGGCAATCTGCCTCTGGCCACCAAGAGAAGA GGCGGCAGACTCGTGATCGTGAACCTGCAGCCTACCAAGCACGACAGACACGCCGACCTGAGAATCCACGGCTACGTG GACGAAGTGATGACCCGGCTGATGAAGCACCTGGGCCTCGAAATTCCAGCCTGGGATGGACCCAGAGTGCTGGAAAGG GCACTTCCTCCACTGCCTAGACCTCCAACACCTAAGCTGGAACCCAAAGAGGAAAGCCCCACCAGAATCAACGGCAGC ATTCCCGCCGGACCTAAGCAAGAGCCTTGCGCTCAGCACAATGGCAGCGAACCTGCTAGCCCTAAGAGAGAGAGGCCT ACAAGCCCCGCTCCTCACAGACCACCAAAGAGAGTGAAGGCCAAGGCCGTGCCTAGCTGA

[0142] Human SIRT6 Codon optimized SEQ ID No: 7 (GC=59.74%, CAI=0.90 with self-folding energy -402.3 kcal / mol):

[0143] ATGAGCGTGAATTACGCTGCCGGCCTGAGTCCTTATGCTGACAAGGGCAAGTGCGGCCTGCCTGAAATCTTC GACCCTCCTGAGGAGCTGGAGCGTAAAGTGTGGGAGCTGGCTAGGCTGGTGTGGCAGTCTAGCTCTGTGGTGTTTCAC ACCGGCGCCGGTATCTCCACCGCCAGCGGAATCCCTGATTTCAGAGGCCCACACGGCGTCTGGACCATGGAAGAGAGA GGATTAGCCCCAAAATTCGACACCACCTTCGAGAGTGCCAGACCTACACAGACCCACATGGCCCTGGTGCAGCTGGAA AGGGTCGGCCTGCTGAGGTTCCTGGTGAGCCAGAACGTGGATGGCCTTCATGTGAGGAGCGGCTTTCCAAGAGATAAG CTGGCCGAGCTGCACGGGAATATGTTCGTGGAGGAGTGCGCCAAGTGCAAGACACAGTACGTGAGGGATACAGTCGTG GGGACTATGGGCCTGAAAGCAACTGGAAGGCTGTGCACAGTGGCCAAGGCTAGAGGCCTCCGCGCCTGCAGGGGTGAG CTGAGAGATACCATCCTGGATTGGGAAGACTCTCTGCCTGACAGAGACCTGGCCCTGGCTGACGAAGCCTCTCGGAAT GCCGATCTCAGCATCACCCTGGGAACCAGCCTGCAGATCAGACCTTCCGGCAACCTGCCCCTGGCTACCAAAAGACGC GGAGGAAGACTGGTGATAGTGAACCTGCAGCCTACCAAGCACGACAGACACGCAGACCTGCGGATCCACGGCTACGTG GACGAGGTTATGACTAGGCTGATGAAACACCTGGGCCTGGAGATCCCAGCCTGGGATGGACCCAGAGTGCTGGAGCGC GCCCTGCCACCCCTGCCCAGGCCCCCAACACCTAAGCTTGAGCCAAAGGAGGAATCTCCAACCCGGATTAATGGCTCT ATCCCAGCCGGCCCCAAGCAGGAGCCATGTGCCCAGCACAACGGCAGTGAGCCCGCCAGTCCCAAGAGAGAACGGCCA ACCTCACCAGCCCCACACCGGCCACCTAAAAGGGTGAAAGCTAAAGCCGTGCCAAGCTGA

[0144] Human SIRT6 Codon optimized SEQ ID No: 8 (CAI: 0.82 ; GC content : 55.96% with self-folding energy -397.3 kcal / mol):

[0145] ATGTCTGTGAATTACGCTGCCGGGCTCTCACCATACGCAGATAAGGGTAAGTGCGGTCTGCCAGAGATTTTC GATCCTCCTGAGGAATTGGAGCGAAAGGTGTGGGAGCTTGCACGCCTCGTTTGGCAGAGCAGCAGCGTGGTCTTTCAT ACCGGAGCCGGAATATCTACTGCAAGCGGAATCCCGGATTTCCGAGGTCCACACGGGGTGTGGACCATGGAGGAAAGG GGGTTGGCACCAAAGTTCGACACAACATTCGAGAGCGCTAGACCTACCCAGACTCACATGGCTCTGGTGCAGCTCGAG AGAGTTGGCCTGCTCCGATTCCTCGTGAGCCAGAATGTGGATGGACTTCACGTACGAAGCGGCTTTCCTCGGGATAAA CTGGCTGAGTTGCACGGGAACATGTTTGTGGAGGAGTGCGCTAAGTGTAAGACCCAGTACGTGCGCGATACCGTCGTG GGCACCATGGGTCTCAAGGCAACTGGCAGACTGTGTACAGTTGCTAAGGCACGGGGACTGAGGGCATGTAGAGGAGAG CTGCGCGATACTATCCTGGACTGGGAAGACAGCCTCCCTGATAGAGATCTCGCCCTGGCTGACGAGGCCTCTAGGAAT GCCGACCTCTCCATCACGCTCGGCACTAGCCTGCAGATCCGCCCATCCGGAAACCTCCCTCTTGCTACCAAGAGAAGA GGAGGACGACTTGTGATCGTCAACCTGCAGCCAACTAAGCACGACAGGCACGCCGATCTCAGAATCCACGGGTATGTG GATGAGGTCATGACACGGTTGATGAAGCATTTGGGGTTGGAAATTCCTGCATGGGACGGACCAAGGGTCCTTGAGAGA GCTCTGCCACCTTTGCCTAGGCCTCCTACTCCCAAGTTGGAACCGAAAGAAGAATCCCCTACTAGAATCAACGGCTCC ATTCCTGCTGGACCTAAGCAGGAACCCTGTGCTCAGCACAATGGATCAGAACCAGCGTCCCCTAAAAGAGAGAGGCCC ACCAGCCCTGCTCCTCACAGACCACCTAAACGCGTGAAGGCTAAGGCTGTCCCAAGTTGA

[0146] Human SIRT6 Codon optimized SEQ ID No: 9 (CAI:0.956 ;GC-Content:72.65% with self-folding energy -469.6 kcal / mol):

[0147] ATGAGCGTGAACTACGCCGCCGGCCTGAGCCCCTACGCCGACAAGGGCAAGTGCGGCCTGCCCGAGATCTTC GACCCCCCCGAGGAGCTGGAGCGCAAGGTGTGGGAGCTGGCCCGCCTGGTGTGGCAGAGCAGCAGCGTGGTGTTCCAC ACCGGCGCCGGCATCAGCACCGCCAGCGGCATCCCCGACTTCCGCGGCCCCCACGGCGTGTGGACCATGGAGGAGCGC GGCCTGGCCCCCAAGTTCGACACCACCTTCGAGAGCGCCCGCCCCACCCAGACCCACATGGCCCTGGTGCAGCTGGAG CGCGTGGGCCTGCTGCGCTTCCTGGTGAGCCAGAACGTGGACGGCCTGCACGTGCGCAGCGGCTTCCCCCGCGACAAG CTGGCCGAGCTGCACGGCAACATGTTCGTGGAGGAGTGCGCCAAGTGCAAGACCCAGTACGTGCGCGACACCGTGGTG GGCACCATGGGCCTGAAGGCCACCGGCCGCCTGTGCACCGTGGCCAAGGCCCGCGGCCTGCGCGCCTGCCGCGGCGAG CTGCGCGACACCATCCTGGACTGGGAGGACAGCCTGCCCGACCGCGACCTGGCCCTGGCCGACGAGGCCAGCCGCAAC GCCGACCTGAGCATCACCCTGGGCACCAGCCTGCAGATCCGCCCCAGCGGCAACCTGCCCCTGGCCACCAAGCGCCGC GGCGGCCGCCTGGTGATCGTGAACCTGCAGCCCACCAAGCACGACCGCCACGCCGACCTGCGCATCCACGGCTACGTG GACGAGGTGATGACCCGCCTGATGAAGCACCTGGGCCTGGAGATCCCCGCCTGGGACGGCCCCCGCGTGCTGGAGCGC GCCCTGCCCCCCCTGCCCCGCCCCCCCACCCCCAAGCTGGAGCCCAAGGAGGAGAGCCCCACCCGCATCAACGGCAGC ATCCCCGCCGGCCCCAAGCAGGAGCCCTGCGCCCAGCACAACGGCAGCGAGCCCGCCAGCCCCAAGCGCGAGCGCCCC ACCAGCCCCGCCCCCCACCGCCCCCCCAAGCGCGTGAAGGCCAAGGCCGTGCCCAGCTAA Human SIRT6 Codon optimized SEQ ID No: 10 (GC=64.61%, CAI=0.96 with self-folding energy -416.00 kcal / mol):

[0148] ATGAGCGTGAATTACGCCGCCGGCCTGAGCCCCTACGCCGATAAGGGCAAGTGCGGCCTGCCTGAGATCTTC GACCCCCCTGAGGAGCTGGAGAGAAAAGTGTGGGAGCTGGCGCGGCTGGTGTGGCAGAGCAGCAGCGTGGTGTTCCAC ACCGGCGCCGGCATCTCCACCGCCAGCGGCATCCCTGATTTCAGAGGCCCCCACGGCGTGTGGACCATGGAAGAGAGA GGACTGGCCCCAAAGTTCGACACCACCTTCGAGAGCGCCAGACCTACACAGACCCACATGGCCCTGGTGCAGCTGGAG AGAGTGGGCCTGCTGAGATTCCTGGTGAGCCAGAACGTGGACGGCCTGCATGTGCGAAGCGGCTTCCCCAGAGACAAG CTGGCCGAGCTGCACGGCAACATGTTCGTGGAGGAGTGCGCCAAGTGCAAGACCCAGTACGTGCGAGATACCGTCGTG GGCACCATGGGCCTGAAGGCCACCGGCAGACTGTGCACCGTGGCCAAGGCTAGAGGACTGAGGGCCTGCAGAGGAGAG CTGAGAGACACCATCCTGGACTGGGAAGACAGCCTGCCCGACAGAGACCTGGCCCTGGCCGACGAGGCCAGCAGGAAT GCCGACCTGTCCATCACCCTGGGCACCAGCCTGCAGATCCGACCATCCGGCAACCTGCCTCTGGCTACCAAGAGACGA GGAGGCCGACTGGTGATCGTGAACCTGCAGCCTACCAAGCACGACAGACACGCCGACCTGAGAATCCACGGCTACGTG GACGAGGTGATGACCCGGCTGATGAAGCACCTGGGCCTGGAGATCCCCGCCTGGGATGGACCCAGAGTGCTGGAGAGA GCCCTGCCACCCCTGCCCAGACCTCCAACCCCCAAGCTGGAGCCCAAGGAGGAATCCCCCACCCGGATCAACGGCAGC ATCCCCGCCGGACCCAAGCAGGAGCCCTGTGCTCAGCACAACGGCAGCGAGCCCGCCAGCCCTAAGCGAGAGCGGCCC ACCAGCCCTGCCCCTCACAGACCACCTAAAAGGGTGAAGGCCAAGGCCGTCCCTAGCTGA

[0149] It should be noted that once transcribed to mRNA the thymine (T) bases in the sequence are replaced with uridines (U), and thus the mRNA transcribed has the same sequence albeit with uridine bases instead of the thymine bases.

[0150] Codon Adaptation Index (CAI) measures the synonymous codon usage bias for a DNA or RNA sequence. The CAI quantifies the similarity between the synonymous codon usage of a gene and the synonymous codon frequency of a reference set.

[0151] In one embodiment, the present invention therefore provides an mRNA molecule transcribed from any one of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO: 10.

[0152] In specific embodiments, the present invention provides an mRNA molecule transcribed from SEQ ID NO:6, SEQ ID NO:9 or SEQ ID NO: 10.

[0153] As shown in the Examples below, higher expression of SIRT6 protein was seen in cells transfected with SEQ ID NO:9 compared to SEQ ID NO:6 and SEQ ID NO: 10 sequences, and the native human SEQ ID NO: 1 sequence. Interestingly, higher mRNA levels were detected for human SIRT6 SEQ ID NOs: 10 and 6, although less protein expression was observed. On the other hand, a reduced level of SIRT6 mRNA was seen in cells transfected with SEQ ID NO: 9 although these samples showed the highest expression of SIRT6 protein. Without wishing to be bound by theory, the observed disparities between protein levels and mRNA expression levels, which do not show a correlation, are likely attributed to alterations in the secondary structure of mRNA that impact translation efficiency. Changes in the secondary structure can hinder or facilitate the translation process, leading to variations in protein production that may not directly correspond to mRNA expression levels.

[0154] To regulate the spreading of AAV while reducing SIRT6 fold expression (for example, the spreading of AAV9 capsid in the brain), the following approaches can be taken:

[0155] 1. Injection of a high viral titer with a plasmid containing a weak promoter: By using a weak promoter, the expression of the SIRT6 gene can be moderated, leading to reduced levels of protein expression. Thereby a balance is achieved between desired therapeutic effects and potential risks associated with excessive gene expression. The high viral titer ensures broader distribution of the AAV9 capsid in the brain, facilitating transduction of a larger number of cells.

[0156] 2. Use of an optimized SIRT6 sequence with high translation ability: Incorporating an optimized SIRT6 gene sequence, such as SEQ ID NOV, can enhance translation efficiency. Thereby, the mRNA corresponding to the SIRT6 gene is more effectively translated into protein, resulting in higher expression levels. However, to maintain control over protein expression, it is advantageous to combine this optimized sequence with a weak promoter to limit the overall expression level of SIRT6.

[0157] 3. Use of a strong promoter with an optimized SIRT6 sequence resulting in reduced translation efficiency: If a strong promoter, is used in combination with an optimized SIRT6 gene sequence such as the one represented by SEQ ID NO:6 or SEQ ID NO: 10, it may lead to higher transcription levels. However, the translation efficiency of the mRNA produced from this combination is intentionally reduced, resulting in lower protein expression levels. This approach allows for precise control over SIRT6 expression, balancing therapeutic benefits with potential risks.

[0158] 4. Use of a mid / weak promoter with an optimized SIRT6 sequence resulting in youthful gene expression translation efficiency: If a mid / weak promoter, is used in combination with an optimized SIRT6 gene sequence such as the one represented by SEQ ID NO:6 or SEQ ID NO: 10, it may lead to low transcription levels. However, the translation efficiency of the mRNA produced from this combination is intentionally significantly reduced, resulting in very low protein expression levels. This approach mitigates the reduction in gene expression typically observed in old age, thus potentially promoting a more youthful gene expression profile, balancing therapeutic benefits with potential risks.

[0159] These strategies achieve the desired balance between effective SIRT6 expression and safety considerations, enabling the potential therapeutic benefits of SIRT6 while minimizing the potential drawbacks associated with excessive gene expression.

[0160] Ubiquitination is the biochemical process in which proteins are marked by ubiquitin and thereby targeted for degradation. One way of increasing stability and half- life of SIR.T6 in cells is by modifying the molecule to be less prone to ubiquitination and degradation. Accordingly, the SIRT6 encoding polynucleotide may also be modified by replacing amino acid residues that are prone to be phosphorylated and thereby lead to ubiquitination of SIRT6. For example, SIRT6 is known to be phosphorylated at Ser338 by the kinase AKT1, which induces the interaction and ubiquitination of SIRT6 by MDM2, targeting SIRT6 for protease-dependent degradation (Umadevi Thirumurthi 2014).

[0161] Therefore, in one embodiment, the SIRT6 encoding polynucleotide may be modified to prevent SIRT6 phosphorylation by mutating the Ser338 residue.

[0162] It is also known that SIRT6 is a substrate of anaphase-promoting complex / cyclosome (APC / C). APC / C, together with its co-activators CDC20 and CDH1, mediate SIRT6 degradation via the ubiquitination-proteasome pathway (Wang et al 2021). The APC mediates degradation in a D-Box-Dependent manner.

[0163] Therefore, in one embodiment, the SIRT6 encoding polynucleotide may be modified to prevent or reduce SIRT6 degradation by substituting the arginine and / or leucine amino acid residues within the RxxL motif of the first D-box-activating domain of the SIRT6 protein with alanine (e.g., a substitution from RVGL to AVGA at positions 103-106).

[0164] The ubiquitin-specific peptidase USP10, a tumor suppressor that often has low expression in human cancers, is a SIRT6-specific de-ubiquitinase. Suppression of USP10 expression promotes human colon cancer cell growth and tumor formation through proteasomal degradation of SIRT6 (Kong, Junsheng Ye et al., 2013)

[0165] Therefore, in one embodiment, the SIRT6 encoding polynucleotide may be modified in the C-terminal site, between positions 263-334, to prevent SIRT6 ubiquitination.

[0166] The ubiquitin ligase CHIP (carboxyl terminus of Hsp70-interacting protein) ubiquitinates SIRT6 at K170, which stabilizes SIRT6 and prevents SIRT6 canonical ubiquitination by other ubiquitin ligases. SIRT6 K170 mutation (mutated the lysine at position 170 in wildtype SIRT6 to arginine K170R SIRT6) increases SIRT6 half-life and prevents proteasome-mediated degradation (Sarah M. Ronnebaum et al., 2013).

[0167] Therefore, in one embodiment, the SIRT6 encoding polynucleotide may be modified at position K170 to arginine, namely K170R, to increase SIRT6 half-life.

[0168] The SIRT6 encoding polynucleotides of the invention may also be modified to remove or alter naturally occurring miRNA binding sites. miRNAs are small, single-stranded, noncoding RNAs, containing approximately 21 nucleotides (nt) that regulate gene expression at a posttranscri phonal level. They complementarily bind to the 3’ untranslated region (3’ UTR) of their target mRNAs causing their degradation, translational repression, and / or deadenylation (Winter J et al, 2009).

[0169] The expression of SIRT6 has been shown to be directly and / or reciprocally regulated by different miRNA identified by their seed target to human SIRT6 3 ’UTR (a list of miRNA sequences can be found for example in http: / / mirdb.org / data base). These include but are not limited to hsa-miR-766-3p, hsa-miR-33b-5p, hsa-miR-33a-5p, hsa- miR-33b, hsa-miR-10396b-5p, hsa-miR-6787-5p, hsa-miR-1908-5p, hsa-miR-663a, hsa- miR-541-3p, hsa-miR-654-5p and / or other miRNA with only partial match to miRNA seed target including, but not limited to hsa-miR-122-5p.

[0170] Therefore, to effectively regulate SIRT6 expression in the diseased tissue, microRNA binding sites can be removed from the native SIRT6 3 ’UTR sequence, to increase protein expression in the tissue. Alternatively, one or more point-mutations or nucleic acid substitutions may be introduced to the 3’ UTRs of the encoding polynucleotide to alter (i.e., disable) these microRNA binding sites or the whole sequence of the 3’UTR may be replaced with a sequence that does not contain a miRNA targeting site.

[0171] For example, an inverse correlation between SIRT6 levels and miR-122 or miR- 33 has been observed in hepatocytes where miR-122 (partial seed match) and miR-33 (full seed match) target the 3'UTR regions of SIRT6 mRNAs, block its translational process and lead to gene silencing.

[0172] Therefore, in specific embodiments one or more of hsa-miR-122-5p (e.g. positions 122-146, 197-218, and 228-249 of the SIRT6 3’UTR), hsa-miR-33a-5p (e.g. position 497- 486 of the SIRT6 3’UTR), and hsa-miR-33b binding sites may be removed from the 3’UTR of SIRT6 to improve SIRT6 protein expression at different stages of liver metabolic diseases.

[0173] Regulation of expression in multiple tissues can be accomplished through removal of one or several microRNA bindings sites.

[0174] In one embodiment, to increase mRNA stability and protein yield, a 3’UTR is added. The 3UTR region can be replaced with the 3’UTR of genes that produce large amounts of protein and / or have a long half-life (e.g., the 3' UTR of human growth hormone, and alpha or beta globin).

[0175] It has been shown (Cai et al., 2016) that small ubiquitin-like modifier (SUMO) can deposit posttranslational modification on SIRT6, in turn modulating SIRT6 deacetylation activity. Accordingly, in one embodiment, SIRT6 SUMOylation is modified.

[0176] As indicated above the AAV SIRT6 vector of the invention comprises a nucleic acid comprising a promoter and / or enhancer sequence.

[0177] Promoters play a crucial role in typical AAV expression vectors as they are cisacting elements responsible for enabling and regulating the transcription of associated genes. The activity of promoters is determined by the recruitment of transcription factors, which can be widely expressed, spatially restricted, or specific to certain cell types.

[0178] In the field of AAV gene therapy vectors, both exogenous promoters derived from viruses and endogenous promoters that are either ubiquitous or tissue / cell-specific have been commonly utilized. While strong constitutive promoters are often employed to achieve robust, rapid, and long-term transgene expression, they also pose certain disadvantages. Overexpression of transgenes driven by strong promoters can lead to potential toxicity and may trigger immune reactions. In contrast, weaker promoters, although typically resulting in reduced expression levels compared to their ubiquitous counterparts, offer the valuable advantage of spatially controlling transgene expression. This precise control allows for the regulation of gene expression in specific tissues or cell types, reducing the risks associated with transgene overexpression and enhancing the safety profile of AAV gene therapies.

[0179] In one embodiment, the promoter is a strong, constitutively active promoter suitable for high-level expression of SIRT6. Non-limiting examples of constitutively active promoters in accordance with the invention include but are not limited to the CMV (cytomegalovirus) promoter / enhancer, EFla (elongation factor la), SV40 (simian virus 40), chicken b-actin and CAG (CMV, chicken b-chicken b-actin, rabbit b-globin). The invention also encompasses tissue specific or cell specific promoters that target the AAV SIRT6 vector to a specific tissue or organ. For example, to the liver (al -antitrypsin promoter or Thyroxin Binding Globulin (TBG) promoter by targeting to hepatocytes for example), to neuronal cells to address neurological applications (neuron specific enolase promoters attain high levels of neuron specific expression). Additional neuron specific weak promoters are Synapsin (SYN), Calcium / Calmodulin-Dependent Protein Kinase II promoter (CamKII), Thyl promoter, Nestin promoter, Neuronal-Specific pill Tubulin (TUBB3) or The GFAP (Glial Fibrillary Acidic Protein) promoter, which is active in astrocytes, a type of glial cell in the central nervous system and can be used to drive gene expression specifically in astrocytes.

[0180] In the heart (myosin heavy chain promoter which significantly restricts expression to cardiac muscle), kidney, lung, muscles, or fat tissue.

[0181] In one embodiment, the promoter in accordance with the invention is the ApoE / AATl chimeric promoter which consists of the core promoter from human alpha- 1-antitrypsin gene (also known as hAATl, SERPINA1, Al A, Al AT, AAT, or alphal AT) and the enhancer / hepatic locus control region (HCR) from the ApoE gene. The ApoE- hAATl chimeric promoter is about 0.7Kb and is used for driving gene expression in hepatocytes.

[0182] In one embodiment, the promoter in accordance with the invention is the chicken b-actin and CAG (CMV, chicken b-chicken b-actin, rabbit b-globin).

[0183] In one embodiment, the post-transcriptional regulatory element in the nucleic acid is Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) which is a DNA sequence that, when transcribed creates a tertiary structure enhancing expression. WPRE is a tripartite regulatory element with gamma, alpha, and beta components. The sequence for full tripartite WPRE is denoted by SEQ ID NO: 11 and is as follows:

[0184] TCGACAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTA AC'TATGT'T'GCTCCTTTTACGC'TATGTGGATACCiClTGCTTTAATGCCT'T'TGTA'T'CATGCTAT TGCTTCCCGTATGGCTnUATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTAT GAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGC AACCCCC.ACTGGTTGGGGC.ATTGCCACCACCTGTCAGCTCCTTTCCGGG.ACTTTCGCTTT CCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAG GGGCTCG G CTGTTGGGCACTG ACAATTCCGTGGTGTTGTCGGGG AAGGTG ACGTCCTTT CCA’I GGC’I GC I CGCCTGTG I TGCC ACC I GGA’I TCTGCGCGGGACGTCC’I TCTGCT A CGI C CCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCT CTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCG CCTG

[0185] In certain embodiments, the recombinant vectors provided herein comprise one or more untranslated regions (UTRs), e.g., 3' and / or 5' UTRs. In certain embodiments, the UTRs are optimized for the desired level of SIRT6 expression. In certain embodiments, the UTRs are optimized for the half-life, the stability and / or the secondary structure of the mRNA encoding SIRT6.

[0186] In certain embodiments, the recombinant vectors provided herein comprise a polycistronic expression system designed for the simultaneous expression of SIRT6 and one or more additional genes. This system includes a promoter operably linked to a first nucleic acid sequence encoding SIRT6, followed by internal ribosomal entry sites (IRES) and one or more additional nucleic acid sequences encoding genes that either enhance the mechanism of action of SIRT6 or target unrelated pathways to improve therapeutic effects. These additional genes are selected from a group consisting of neuroprotective factors, anti-inflammatory proteins, or other agents relevant to the treatment of neurodegenerative disorders. The additional genes are chosen to provide synergistic effects with SIRT6 for the treatment of neurodegenerative disorders.

[0187] The present invention also provides AAV-SIRT6 vectors for use as a medicament for affecting multiple biological processes. Accordingly, the administration of the AAV- SIRT6 vector may concomitantly affect several pathological conditions. For example, the increase in SIRT6 levels can be applied for treating fibrosis, as well as pre-fibrotic conditions (e.g., inflammation, endothelial or epithelial to mesenchymal transition) and post-fibrotic conditions (e.g., parenchymal injury, scarring, cirrhosis, or cancer). For example, administration of the AAV-SIRT6 vector of the invention can halt or prevent the development of numerous organ-specific fibrotic disorders including radiation-induced fibrosis, cardiac fibrosis, pulmonary fibrosis, liver fibrosis (including NAFLD / NASH), skin fibrosis, fibrotic conditions in the eye, brain fibrosis, kidney fibrosis and their respective stage, neurological disorders.

[0188] In addition, by affecting lipid and carbohydrate (e.g. glucose) metabolism, such as, but not limited to, affecting response to insulin, reducing the level of free fatty acids (FFA), reducing oxidative stress and affecting DNA repair, the increase in SIRT6 levels can halt or prevent the development of heart disease, stroke, type 2 diabetes, increased blood pressure, high blood sugar, excess body fat and abnormal cholesterol or triglyceride levels and can therefore be used for treating metabolic disorders (e.g., metabolic syndrome), frailty and for affecting longevity.

[0189] Accordingly, in one of its aspects, the present invention provides a method for treating a disease or disorder, or for increasing longevity, in a subject in need thereof comprising a step of administering the adeno-associated virus (AAV) vector of the invention to said subject wherein said disease or disorder is at least one of a fibrotic condition, a fibrosis-associated condition, a metabolic disorder, a neurological or neurodegenerative disease, age-related frailty, an ophthalmic disease, an auditory system disease, or cancer.

[0190] It is to be understood that the terms "treat , “treating”, “treatment" or forms thereof, as used herein, mean reducing, preventing, curing, reversing, ameliorating, attenuating, alleviating, minimizing, suppressing, slowing, or halting, in whole or part, the deleterious effects or symptoms of a disease or a condition or delaying the onset of one or more clinical indications of a disease or disorder, as defined herein.

[0191] The terms "fibrosis" and "a fibrotic condition" are used interchangeably herein and refer to pathological wound healing in which connective tissue replaces normal parenchymal tissue, leading to considerable tissue re-modelling and the formation of permanent scar tissue. Fibrosis may occur in any one of multiple organs including, but not limited to liver, lungs, kidney, skin, eye, or the heart muscle. As used herein the term fibrosis or a fibrotic condition also refers to different stages of the tissue fibrosis. In one specific embodiment the fibrotic condition is a non-alcoholic fatty liver disease (NAFLD) (e.g., nonalcoholic steatohepatitis (NASH)) which is a chronic liver disease that is manifested clinically by an increase in hepatic triglycerides, inflammation (e.g., steatohepatitis), and fibrosis.

[0192] "Cirrhosis" is a non-limiting example of a post-fibrotic condition, an advanced fibrosis. Cirrhosis, also known as liver cirrhosis or hepatic cirrhosis, is an end-stage liver disease, characterized by impaired liver function caused by the formation of a fibrotic scar tissue, due to damage caused by liver disease. Damage causes tissue repair and subsequent formation of scar tissue, which over time replaces normal functioning tissue leading to the impaired liver function of cirrhosis.

[0193] A "metabolic disorder" is a group of disorders that negatively alters the body's processing and distribution of macronutrients such as proteins, fats, and carbohydrates.

[0194] "Metabolic syndrome" is a cluster of conditions that occur together, increasing the risk of heart disease, stroke, and type 2 diabetes, obesity, and frailty. These conditions include increased blood pressure, high blood sugar, excess body fat around the waist, and abnormal cholesterol or triglyceride levels.

[0195] In accordance with the invention, the term "cancer" encompasses both solid tumors and hematological cancers.

[0196] As used herein the term “neurological or neurodegenerative disease” refers to any condition that affects the central nervous system (CNS), e.g., the brain and spinal cord, or the peripheral nervous system (PNS). Including for example Alzheimer’s disease (AD), Parkinson’s disease (PD), dementia, Adrenoleukodystrophy (ALD), Amyotrophic Lateral Sclerosis (ALS) and frailty syndrome.

[0197] As used herein the term “ophthalmic disease” refers to any condition that affects the eye and / or the vision. Including for example Glaucoma, Age related Macular Degeneration (AMD), Diabetic Macular Edema (DME) and Diabetic retinopathy. As used herein the term “auditory system disease” refers to any condition that affects the ear and / or the hearing, including for example “hearing loss” which refers to any condition that affects the hearing. Including for example presbycusis.

[0198] Among others, the invention concerns harnessing rAAV technology to enhance SIRT6 levels and activity and thereby help modulating age-related molecular pathways affected by SIRT6, such as genomic stability, epigenetic regulation, metabolic homeostasis, and cellular stress response. The present invention thus offers a therapeutic intervention in diverse age-related diseases.

[0199] A “therapeutically effective amount of the AAV-SIRT6 vector according to the invention, or the pharmaceutical composition according to the invention for purposes herein defined is determined by such considerations as are known in the art to produce a desired therapeutic and / or prophylactic effect, cure, arrest or at least alleviate or ameliorate the medical condition. For any preparation used in the methods of the invention, the dosage or the therapeutically effective amount can be estimated initially from in vitro cell culture assays or based on suitable animal models. In the context of therapeutic or prophylactic applications, the amount of the AAV-SIRT6 vector, or a composition comprising same, administered to the subject will vary depending on the composition, organ, tissue, the degree, type, and severity of the disease or risk of the disease and on the characteristics of the subject.

[0200] As used herein, a "subject" or "patient" is a mammal, such as a cat, dog, or a household or farm animal. Typically, the subject is a human, such as a human suffering from a disease or disorder as defined above. The term "subject" and "patient" can be used interchangeably.

[0201] As used herein, "administering" or the "administration" of the AAV-SIRT6 vector or pharmaceutical composition to a subject includes any route of introducing or delivering to a subject an effective amount of the AAV-SIRT6 vector or pharmaceutical composition of the present invention to perform its intended function. Administration according to the present invention may be performed by any of the following routes: oral administration, intravenous administration, peripheral vein infusion, intramuscular administration, intraperitoneal administration, intrathecal administration, subcutaneous administration, intra-rectal administration, intranasal administration (e.g., by inhalation using an aspirator), and intraocular administration (e.g., using intravitreous injection, eye drops or gels), ear drop administration, Intracochlear administration, Intrathecal administration, Intracerebroventricular administration, Intracerebral administration, and Intra-arterial administration.

[0202] In some embodiments the AAV-SIRT6 vector according to the invention or the pharmaceutical composition according to the invention is administered to the subject as a single dose or by repeated doses. The AAV-SIRT6 vector as herein defined, or any pharmaceutical compositions comprising the same may be administered to a subject prior to or post disease onset (i.e., during the disease).

[0203] In one embodiment, the AAV-SIRT6 vector or the pharmaceutical compositions of the invention are administered at a dose of between about 2x1010to 2xl015vector genomes copies (vgs) per person.

[0204] In an embodiment, the AAV-SIRT6 vector encodes the human SIRT6 protein.

[0205] In one embodiment, the AAV-SIRT6 vector or the pharmaceutical compositions of the invention are administered alone or together with immunomodulatory regimens or, B-cell depletion prior to gene transfer to block humoral immune responses to AAV- SIRT6 or corticosteroid treatment within or post vector infusion.

[0206] The AAV-SIRT6 vector of the invention may be administered as a monotherapy or in combination with at least one additional therapeutic agent,

[0207] As indicated above, the AAV-SIRT6 vector of the invention may be administered as part of a combination therapy together with an additional therapeutic agent.

[0208] For example, the AAV-SIRT6 vector may be administered with conventional anticancer therapeutics, including but not limited to, chemotherapy (e.g., alkylating agents, plant alkaloids, anti-metabolites, anti-tumor antibiotics and corticosteroids), biological and immunotherapy (e.g., tyrpsine kinase inhibitors, immune checkpoint inhibitors, antibodies, and immune cells modulators) or irradiation.

[0209] In such cases, the AAV-SIRT6 vector may be directed to treat the tumor itself (namely, to induce senescence or lead to apoptotic death), it may reduce metastasis, and / or reduce resistance to conventional anti-cancer drugs. In some embodiments, the present invention provides pharmaceutical compositions comprising AAV-SIRT6 vector as disclosed herein and a suitable carrier or excipient or diluent. The pharmaceutical compositions may be used in the methods of treatment, or preventative treatment, of a disease as described herein. The pharmaceutical composition'1'’ of the invention generally comprises an effective amount of the AAV-SIRT6 vector as herein defined and a buffering agent, an agent which adjusts the osmolarity of the composition and optionally, one or more pharmaceutically acceptable carriers, excipients and / or diluents as known in the art.

[0210] The effective amount may be determined in relation to a mammalian subject, preferably a human subject.

[0211] As used herein the term pharmaceutically acceptable carrier, excipient or diluent” includes any solvents, dispersion media, coatings, antibacterial and antifungal agents, and the like, as known in the art. The carrier can be solvent or dispersion medium containing, for example, sucrose, less than about 100 mM sodium citrate, saline, Phosphate buffer, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. Each carrier should be both pharmaceutically and physiologically acceptable in the sense of being compatible with the other ingredients and not injurious to the subject.

[0212] In other embodiments the pharmaceutical composition according to the invention further comprises an additional therapeutic agent.

[0213] EXAMPLES

[0214] Materials and methods

[0215] RNA extraction

[0216] RNA is isolated from cells using the PureLink™ RNA Isolation Kit (Thermo fisher scientific cat-12183018A) according to the manufacturer's protocol.

[0217] Quantitative real-time PCR

[0218] Ipg of total RNA is reversed transcribed with the High-capacity reversed transcription kit (Thermo scientific) according to the manufacturer's instructions. qRTPCR is performed with the PowerUp™ SYBR™ Green Master Mix, (ThermoFisher) according to the manufacturer's protocol with minor adjustments. Primer sequences are as follow:

[0219] SIRT6 Forward primer: CAGAGCTGCACGGAAACATG SEQ ID NO: 12

[0220] SIRT6 Reverse primer: TCATCAGCGAGCATCAGGTC SEQ ID NO: 13,

[0221] 3’UTR of the human SIRT6 mRNA molecules Forward primer:

[0222] CTCGGTGGCCTAGCTTCTT SEQ ID NO: 14,

[0223] 3’UTR of the human SIRT6 mRNA molecules Reverse primer:

[0224] CTCGGTGGCCTAGCTTCTT SEQ ID NO: 15,

[0225] CycloA Forward primer: AATGGCACTGGTGGCAAGTC SEQ ID NO: 16,

[0226] CycloA Reverse primer: CAGTCTTGGCAGTGCAGATG SEQ ID NO: 17,

[0227] The reaction is performed with the CFX Connect Real-Time PCR Detection System (Bio-Rad) with Sybr green fluorescence and quantified with the Bio-rad CFX maestro program.

[0228] Western blot analysis

[0229] Cells are lysed in cold lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM DTT, 10% Glycerol, ImM MgC12, 0.1% NP-40) for 10 minutes.

[0230] Lysates are sonicated and centrifuged for 10 minutes at 17000g, at 4°C. Laemmli buffer is added to each sample and boiled for 5 minutes at 100°C.

[0231] 20-100pg of total protein is resolved on SDS acrylamide gel and transferred to a nitrocellulose membrane with the Trans-Blot Turbo System (Bio-Rad). Membranes are blocked in 5% non-fat (skim) milk (Difco) in Tris buffered saline with Tween 20 (0.1%) for 1 hour. Membranes are incubated over night with anti SIRT6 rabbit monoclonal antibody (cat-12486, Cell Signaling) or overnight with either HRP-conjugated Beta Actin Monoclonal antibody (cat-HRP-60008, ThermoFisher) or Histone H3 (D1H2) XP Rabbit mAb (cat-CST-4499S, Cell Signaling) in blocking buffer (TBST with 5% w / v with BSA) at 4°C. Membranes are washed 3 times in TBST and are incubated for 1 hour with a secondary anti Rabbit antibody linked to horseradish peroxidase. Immunoreactive bands are detected with the Clarity Western ECL Substrate (Bio-Rad).

[0232] Histological analysis:

[0233] The right liver lateral lobe is fixed in 4% Neutral Buffered formaldehyde (NBF). Hematoxylin and eosin (H&E) stains are performed on formalin fixed, paraffin- embedded liver sections at Phatho-Lab Diagnostic LTD, Israel, according to the facility’s common practice.

[0234] After transcranial perfusion whole brains and spinal columns were dissected and put into the buffered formalin solution and transferred to Smart Assays, Israel. Brain samples were bisected longitudinally and processed for paraffin embedding so that sagittal sections could be prepared. Whole spinal columns were decalcified in EDTA solution. After decalcification each spinal column was dissected and processed for the paraffin embedding so that transverse sections through cervical and lumbar segments were prepared. Standard five micrometer sections of paraffin blocks were prepared and mounted onto glass slides.

[0235] Sections were subjected to heat induced epitope retrieval (HIER) procedure in Tris-EDTA buffer pH 9.0. After HIER the sections were incubated with rabbit monoclonal antibody to SIRT6 (cat-12486, Cell Signaling) diluted 1 :200. Sections bound primary antibody were revealed using a peroxidase labeled anti-rabbit IgG polymeric reagent. Sections processed without primary antibody were used as a negative control.

[0236] Sections of a composite block comprising pellets of wild type (WT) and SIRT6 knockout (KO) Hepa 1-6 cells and liver samples from a normal mouse and AAV8-SIRT6 injected were used as a positive control.

[0237] Sections were studied using Olympus BX51 microscope equipped with 12 MP InSight CMOS camera (Spot Imaging).

[0238] Example 1: Evaluation of the AAV8-hcrApoE / hAATl dose for protein expression in the liver

[0239] AAV8-ApoE / hAATl-eGFP-WPRE was supplied by - Vector Biolabs, Inc., (Lot Number: 220117#38, Titer: 2.2X1013genome copies (GC) / ml). AAV8-ApoE / hAATl-eGFP-WPRE were injected to NIH-31M mice (Taconic Bioscience) at titer of 2X1011GC per mouse (n=2, Body weight appr. 30gr). Expression of GFP protein was evaluated 10, 17, 24 and 60 days after injection using Maestro in- vivo imaging system. As shown in Figure 1A and B, GFP was significantly detected in the liver of the injected mice compared to the control untreated mouse.

[0240] Example2: Inducing the expression of SIRT6 protein in mice liver after injection of AAV8-hcrApoE / hAATl-mSIRT6-WPRE

[0241] AAV8 viruses having the same promoter as for the viruses described in Examplel above, namely hcrApoE / hAATl, with the sequence of mouse SIRT6 (mSIRT6) were Supplied by Vector Biolabs.

[0242] The vector comprises the mouse SIRT6 mRNA molecule (RefSeq#: BC052763) defined herein as the native SIRT6 mRNA sequence which corresponds to the open reading frame (ORF).

[0243] The sequence of the mouse SIRT6 ORF is defined below as SEQ ID NO: 18

[0244] ATGTCGGTGAATTATGCAGCAGGGTTGTCGCCTTACGCGGATAAGGGCAAGTGCGGGCTGCCCGAGATCT TCGACCCACCAGAGGAGCTGGAACGCAAGGTGTGGGAGCTGGCCCGGCTAATGTGGCAGTCCTCCAGCGT GGTTTTCCACACGGGCGCCGGCATCAGCACCGCCTCTGGCATCCCCGACTTCAGAGGCCCCCATGGCGTG TGGACCATGGAGGAACGCGGCCTGGCCCCCAAGTTTGACACCACCTTCGAGAATGCTCGGCCCTCGAAGA CCCACATGGCCCTGGTTCAGCTAGAACGCATGGGCTTCCTCAGCTTCCTGGTCAGCCAGAACGTAGACGG GCTGCACGTGCGCTCGGGCTTCCCCAGGGACAAGCTGGCAGAGCTGCACGGAAACATGTTTGTAGAGGAA TGTCCCAAGTGTAAGACGCAGTACGTCAGAGACACGGTTGTGGGCACCATGGGCCTCAAGGCCACAGGCC GGCTCTGCACCGTGGCCAAGACCAGGGGACTTCGGGCCTGTAGAGGGGAGCTGAGAGACACCATTCTGGA CTGGGAGGACTCGTTGCCTGACCGGGACCTGATGCTCGCTGATGAGGCCAGCAGGACCGCAGACCTGTCT GTCACCCTGGGTACCTCGCTGCAGATCCGCCCCAGTGGGAACCTGCCCCTTGCCACTAAGCGCCGAGGAG GCCGTCTGGTCATTGTCAACCTGCAACCCACAAAACATGACCGCCAGGCTGACCTGCGCATCCACGGCTA CGTGGATGAGGTGATGTGCAGACTCATGAAGCATCTGGGGCTGGAGATTCCAGCCTGGGATGGACCCTGC GTGCTAGACAAAGCCCTGCCACCTCTGCCTCGCCCAGTAGCACTCAAGGCTGAGCCCCCCGTGCATCTCA ATGGTGCAGTGCATGTTTCGTATAAGTCCAAGCCCAACAGCCCTATACTCCACAGGCCCCCCAAAAGAGT GAAGACCGAGGCTGCCCCCAGCTGA

[0245] The viruses were CsCl purified, titer of the stock AAV8-hcrApoE / hAATl- mSIRT6-WPRE was 9.2 x 1012GC / mL in PBS 5% Glycerol. AAV8-hcrApoE / hAATl-mSIRT6-WPRE were injected to C57BL / 6J mice at a titer of 2x1011GC per mouse. Two weeks after injection, liver tissues were extracted, and SIRT6 mRNA expression level was assessed using qPCR analysis and the protein expression was tested by Western blot analysis. As shown in Figure 2A and B, SIRT6 was significantly detected in the liver of the injected mouse compared to the control untreated mouse.

[0246] Example 3: Induction of SIRT6 expression in the liver in a mouse model of NASH significantly improves survival.

[0247] To further investigate the impact of SIRT6 expression induction using SIRT6- AAV, the survival of mice in a severe non-alcoholic steatohepatitis (NASH) mouse model was assessed. C57BL / 6J, male, neonatal mice were injected subcutaneously with low dose (200pg) of streptozotocin (STZ) (Sigma). Five weeks after birth, STZ-primed mice were stimulated with High Fat Diet (HFD) (Research Diet, Cat- D1003190H) continuously, which induced sequential histological changes including fatty liver and NASH. The STZ-primed high fat diet mice are termed herein STZ-HFD. The AAV8- hcrApoE / hAATl-mSIRT6-WPRE, as described in Example 2, above, was introduced to C57BL / 6J mice on the background of a STZ-HFD model at week 11 of age at a dose of 1x1011gene copies (N=4). Mice injected with the vehicle PBS served as control (N=7).

[0248] The treatment of mice with either PBS or hcrApoE / hAATl-mSIRT6-WPRE started at week 11 of age, which corresponds to a liver steatohepatitis stage. Blood sugar was high (450 mg / dl±110) and hepatocyte swelling, and ballooning were detectable, as shown by H&E staining in three representative mice (Figures 3 A-C).

[0249] Mice from the Control vehicle group with fatty, early fibrotic, and inflamed liver (STZ-HFD model) who received continuously the HFD started to die at week 16 of age. Approximately 42% of mice died at week 18 and 85% at week 23. At week 27 of age all the mice from the control group had died. On the other hand, 75% of the treated group survived until week 21 while 50% died at week 23 (Figure 4). All remaining mice survived after week 28 of age (two-sided p value 0.005).

[0250] The study was terminated, one week after all control mice died. Control mice had severe hyperlipidemia with classic “white, milky” blood. The blood from the SIRT6- AAV treated animals was normal in appearance. Blood test from the SIRT6-AAV treated mice at week 28 of age showed significant reduction in blood glucose (373 ± 177 mg / dl) and triglycerides (312 ± 26 mg / dl) levels compared to the last dying mouse at week 27 of age from the control group (776mg / dl and 868mg / dl, respectively).

[0251] Example 4: Optimization of the human SIRT6 mRNA sequence to regulate protein levels

[0252] The expression levels exerted by various human SIRT6 mRNA molecules was investigated. To that end, a codon optimized SIRT6 mRNA was prepared. Codon optimization was implemented to human SIRT6 mRNA transcribed from native human SIRT6 open reading frame (ORF) which is transcribed to mRNA and has the sequence identified as SEQ ID NO: 1 (GC=67.32%, CAI=0.84 with self-folding energy - 473.8 kcal / mol). It is also referred to herein as the wild-type or native SIRT6 mRNA.

[0253] As used throughout the Examples, when referring to SEQ ID Nos 1, and 2-10, it means the mRNA molecules transcribed from these sequences, namely mRNA molecules having these sequences with uridine bases instead of thymine bases. The different sequences were introduced by cloning into expression vectors. Each of the vectors included similar critical elements that enable efficient in vitro translation in a human cell- free system (same 5’UTR including Kozak consensus sequence, 3’UTR sequences and polyadenosine tail (poly(A) tail) of 80 adenosine ribonucleotides at the 3 '-end). A T7 bacteriophage RNA polymerase was chosen for transcription in the Human (In vitro transcription) IVT System. The plasmids were designed to be suitable for Capped (Cap 1) RNA using CleanCap® AG. Also, to improve mRNA stability, translational properties and immunogenicity, uridines were substituted with the chemically modified Nl- Methylpseudouridine-5'-Triphosphate.

[0254] SEQ ID NO: 6, SEQ ID NO: 9 and SEQ ID NO: 10 were selected for further examination based on the differences in their GC content and self folding energy [SEQ ID NO: 6 (GC=58.8%; self folding energy -378.8kcal / mol), SEQ ID NOV (GC=72.65%; self folding energy -469.6kcal / mol)and SEQ ID NO: 10 (GC=64.61%; self folding energy -416kcal / mol). A high GC content increases mRNA stability but also increases activation of the immune system e.g., by TLR3. Self-folding energy affects the stability of the mRNA secondary structure and translation efficiency. Accordingly, stability and expression were compared between the transcribed human SIRT6 molecules SEQ ID NO: 1, SEQ ID NO: 6, SEQ ID NO: 9 and SEQ ID NO: 10.

[0255] To determine whether optimizing human SIRT6 ORF codon reduces or improves mRNA translation and protein stability, human Huh7 cells were transfected with increasing doses of the following human SIRT6 mRNA (0.0625pg, 0.125pg, and 0.25pg) using Lipofectamine™ MessengerMAX™ Transfection Reagent, according to manufacturer's protocol. 6 hours after transfection, medium was replaced to remove excess mRNA that did not enter the cells. Expression of SIRT6 mRNA and protein levels were evaluated 24 hours after cells transfection using RT-qPCR and Western blot analysis, respectively. Transfection of the cells resulted in increased levels of human SIRT6 protein (Figures 6A-C), and mRNA (Figure 6D). Specific primers matching the 3’UTR sequence of the different mRNA molecules were used to compare the samples. Results were normalized to CycloA gene expression.

[0256] Higher expression of SIRT6 protein was seen in cells transfected with SEQ ID NO:9 compared to the optimized SEQ ID NO:6 and SEQ ID NO: 10 sequences, and the native human SEQ ID NO: 1 sequence, as seen by the more condensed signal. The loading of protein extract was similar in all samples and can be compared by the signal obtained with anti-Histone 3 antibodies. The expression level of SIRT6 protein does not correlate with the mRNA expression level. Higher mRNA levels were detected for human SIRT6 SEQ ID NOs: 10 and 6, although less protein expression is observed. On the other hand, a reduced level of SIRT6 mRNA was seen in cells transfected with SEQ ID NO: 9 although these samples showed the highest expression of SIRT6 protein. Without wishing to be bound by theory, the observed disparities between protein levels and mRNA expression levels, which do not show a correlation, are likely attributed to alterations in the secondary structure of mRNA that impact translation efficiency (as shown in Figure 5). Changes in the secondary structure can hinder or facilitate the translation process, leading to variations in protein production that may not directly correspond to mRNA expression levels.

[0257] The stability of the different mRNA molecules and translation efficiency was also tested in mouse liver primary cells grown for up to 48 hours in culture. Similar results were obtained when the human SIRT6 mRNA molecules were introduced to mouse Primary hepatocytes. Mouse Primary hepatocytes were freshly isolated from C57 / BL mice liver. Cells were plated in 12-well plates and 24 hours afterwards they were transfected with increasing doses (0.0625pg, 0.125pg, and 0.25pg) of human SIRT6 mRNA using Lipofectamine™ MessengerMAX™ Transfection Reagent, according to manufacturer's protocol. Six hours after transfection, the medium was replaced to remove excess mRNA that did not enter the cells. Expression of SIRT6 mRNA and protein levels were evaluated 24 and 48 hours after cells transfection using RT-qPCR and Western blot analysis, respectively.

[0258] Transfection of mouse Primary hepatocytes resulted in increased levels of human SIRT6 protein (Figure 7A), and mRNA (Figure 7B). Like the observation in the human cell line, higher expression of SIRT6 protein was seen in cells transfected with SEQ ID NO:9 compared to the other tested sequences, as seen by the more condense signals. This observation was similar in both tested time points, namely 24 hours and 48 hours. The loading of protein extract was similar in all samples and can be compared by the signal obtained with anti-Histone 3 Abs. In this experiment as well, the expression level of SIRT6 protein did not correlate with the mRNA expression level. Higher mRNA levels were detected for human SIRT6 SEQ ID NO: 10 and SEQ ID NO: 6 although less protein expression was observed. On the other hand, reduced levels of SIRT6 mRNA were observed in cells transfected with SEQ ID NO: 9 although these samples showed the highest expression of SIRT6 protein. These levels were higher compared to the native human SIRT6 ORF (SEQ ID NO: 1). Primary hepatocytes do not divide in culture hence SIRT6 protein and mRNA stability can be followed. Both mRNA and protein levels were reduced after 48 hours in culture compared to their counterpart samples taken after 24 hours (Figure 6C). Yet, the levels of human SIRT6 mRNA SEQ ID NO:9 is reduced, but its protein level is higher compared to any of the other mRNA molecules.

[0259] These results show that SIRT6 mRNA codon optimization is a meaningful determinant in regulating protein expression and that SEQ ID NO: 9 increases human SIRT6 expression by at least two-fold compared to the wild-type (WT) sequence (SEQ ID NO: 1) while the other two sequence, SEQ ID NO: 6 and 10, show reduced levels of the protein over time. Example 5: Induced expression of human SIRT6 in the brain and spinal column by AAV9-SIRT6.

[0260] To investigate the fold increase of SIRT6 protein expression in the nervous system, recombinant adeno-associated virus serotype 9 (AAV9) carrying the native human SIRT6 gene SEQ ID NO: 1 was employed. The AAV9- human SIRT6 having hybrid cytomegalovirus / chicken beta-actin promoter (CBA, also known as the CAG promoter) and Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE) to enhance expression (AAV9-CAG-hSIRT6). This experimental design allowed the establishment of a baseline level of SIRT6 expression induced by native SIRT6 sequence and known neuronal specific promoter and to assess the fold increase of SIRT6 protein expression achieved by varying the gene copy numbers delivered by the AAV9 vector.

[0261] AAV9 viruses having GAC promoter with the sequence of the native human SIRT6 gene were supplied by Vector Biolabs. The vector comprises SEQ ID NO: 1 molecule defined herein as the native SIRT6 gene sequence which corresponds to the open reading frame (ORF). The viruses were CsCl purified, titer of the stock AAV9- GAC-huSIRT6(isol)-WPRE was 1.2 x 10° GC / mL in PBS 5% Glycerol.

[0262] AAV9-GAC-huSIRT6(isol)-WPRE were injected to C57BL / 6J mouse, either intrathecal (IT) (between Thl3 and LI) at titer of 5X109, 5X1O10or 1X1011GC per mouse or intravenous (i.v.) at a titer of 3X1011. Two weeks after injection, brain tissue and spinal column (SC) tissues were extracted, and SIRT6 protein expression level and distribution were assessed by immune histochemistry (IHC) analysis.

[0263] As shown in Figure 8, microphotographs presenting SIRT6 immunostaining (black dots) in cervical (C) and lumbar (L) segments of spinal cord following IT injection of 5X109(mouse#3), 5X1O10(mouse#10) or 1X1011(mouse#6) GC per mouse or following i.v. injection of 3X1011GC (mouse#7) compared to the control PBS (mouse#l). A significant dose response fold increase in SIRT6 protein expression was observed in both the lumbar and cervical sections of mice #6 and #10. In these mice, the SIRT6 protein levels showed a notable increase compared to the baseline. However, in mice #3, the fold increase of SIRT6 was comparatively reduced, and the elevated expression was primarily observed in the lumbar section. It was also seen that lower viral titers lead to reduced spread of rAAV9 vector in the SC and the brain. Intravenous (i.v.) injection of 3X1011GC showed significantly less expression of SIRT6 protein with detection of SIRT6 elevation mainly in lumbar sections. Nuclear staining of SIRT6 is shown in higher microscope magnification of x20 (Figure 9).

[0264] The same tendency was observed in the brain sections (Figure 10A), where higher titers of rAAV9 resulted in a greater spread of the virus following IT injection (mice #3, #10 and #6, respectively). Mice that received a higher titer of rAAV9 exhibited increased distribution of the virus throughout the brain, leading to a broader transduction of cells (mouse#6). This was evident in the increased expression of SIRT6 protein in various brain regions (olfactory bulb, olfactory cortex, hypothalamus, medulla, parts of the cortex and hippocampus) compared to mice that received a lower titer of rAAV9 or were injected i.v. with a high titer. Immunostaining of SIRT6 protein in hippocampal dentate gyrus (Figures 10B-10F) shows induced expression of SIRT6 in mice #6 (Fig. 10D) and #10 (Fig. 10F) that received high titer of virus by IT injection. The findings suggest that the viral titer plays a crucial role in determining the extent of rAAV9 spread and transduction in the brain. Higher titers are generally associated with enhanced viral dissemination and transgene expression in a wider range of spinal and brain regions.

[0265] In most cases, when cells are infected with rAAV, each infected cell typically receives a single copy of the viral genome containing the desired gene of interest. This is due to the nature of AAV infection and the packaging limit of the viral capsid. However, multiple copies of the gene may be present in certain cells, especially at higher viral titers and therefore it is difficult to determine whether the significant elevation in SIRT6 expression is only due to SIRT6 translation efficiency of the native SEQ ID NO: 1 sequence and GAC plasmid.

Claims

CLAIMS:

1. A recombinant adeno-associated virus (rAAV) vector comprising a nucleic acid comprising (i) a promoter and / or enhancer sequence and (ii) a posttranscriptional regulatory element sequence, operably coupled to a polynucleotide sequence encoding a SIRT6 protein, wherein said polynucleotide sequence encoding a SIRT6 protein is codon-optimized for obtaining molecules with a customized stability, and / or a customized translation efficiency and / or reduced immunogenicity.

2. The rAAV vector of claim 1 wherein said polynucleotide sequence encoding SIRT6 has at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 1.

3. The rAAV vector of claim 1 wherein said nucleic acid further comprises AAV inverted terminal repeats and / or a poly(A) signal sequence.

4. The rAAV vector of any one of the preceding claims, wherein the codon- optimized polynucleotide sequence encoding SIRT6 has at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 6, SEQ ID NOV, or SEQ ID NO: 10.

5. The rAAV vector of any one of the preceding claims wherein said codon- optimized polynucleotide sequence encodes a modified SIRT6 mRNA.

6. The rAAV vector of claim 5, wherein said modified SIRT6 mRNA has a deletion, or an addition in the 3' UTR such that one or more miRNA binding sites are eliminated or introduced to the SIRT6 3' UTR sequence, or wherein the whole 3'UTR sequence is being substituted.

7. The rAAV vector of claim 6, wherein said modified SIRT6 mRNA comprises one or more mutations that prevent phosphorylation and / or ubiquitination of the SIRT6 protein.

8. The rAAV vector of claim 7, wherein said one or more mutations is at the amino acid residue S338 (Ser338) of the SIRT6 protein.

9. The rAAV vector of claim 7, wherein said one or more mutations comprises substituting the arginine (Arg, R) and / or leucine (Leu, L) amino acid residues within the RXXL motif of the first D-box-activating domain of the SIRT6 protein with alanine (Ala, A).

10. The rAAV vector of claim 9, wherein said substitution is a substitution from RVGL to AVGA at positions 103-106.

11. The rAAV vector of claim 7, wherein said one or more mutations is in the C- terminal site of SIRT6, between amino acid residues positions 263-334.

12. The rAAV vector of claim 7, wherein said one or more mutations is at the amino acid residue K170 (Lysl70) of the SIRT6 protein.

13. The rAAV vector of claim 12, wherein said mutation is a substitution of lysine to arginine (K170R).

14. The rAAV vector of any one of the preceding claims, wherein the nucleic acid comprises a tissue specific or cell specific promoter.

15. The rAAV vector of claim 14 wherein said tissue specific, or cell specific promoter and / or enhancer is a hepatocyte-specific promoter and / or enhancer, or a neuronal specific promoter and / or enhancer or a muscle specific promoter and / or enhancer.

16. The rAAV vector of claim 14 or 15, wherein said tissue-specific promoter and / or enhancer is selected from a group consisting of ApoE / AATl, Synapsin (SYN), Neuron-Specific Enolase (NSE), Calcium / Calmodulin-Dependent Protein Kinase II promoter (CamKII), Thyl promoter, Nestin promoter, Cytomegalovirus Early Enhancer / Chicken Beta-Actin (GAC), Elongation Factor 1 Alpha (EFla), Phosphoglycerate Kinase 1 (PGK), Ubiquitin C (UBC), and CBA (CMV-Basic) .

17. The rAAV vector of any one of the preceding claims, wherein said promoter and / or enhancer sequence is a viral promoter and / or enhancer sequence.

18. The rAAV vector of any one of the preceding claims, wherein said post- transcriptional regulatory element is Woodchuck hepatitis virus Posttranscriptional Regulatory element (WPRE).

19. The rAAV vector of claim 18, wherein the WPRE comprises the sequence of SEQ ID NO: 11, or variant or homolog thereof.

20. The rAAV vector of any one of the preceding claims wherein said posttranscriptional regulatory element comprises one or more untranslated regions (UTRs), e.g., 3’ and / or 5’ UTR.

21. The rAAV vector according to any one of the preceding claims wherein said rAAV vector is of the serotype AAV2, AAV8, AAV9, AAV10, or AAV-PHP.B.

22. The rAAV vector according to any one of the preceding claims wherein said rAAV vector comprises a polycistronic expression system designed for the simultaneous expression of SIRT6 and one or more additional genes.

23. The rAAV vector according to claim 22 wherein said polycistronic expression system comprises a promoter operably linked to a first nucleic acid sequence encoding SIRT6, followed by internal ribosomal entry sites (IRES) and one or more additional nucleic acid sequences encoding one or additional genes.

24. The rAAV vector according to claim 23 wherein said one or more additional genes are selected from a group consisting of neuroprotective factors, antiinflammatory proteins, and therapeutic agents suitable for the treatment of neurodegenerative disorders.

25. The rAAV vector according to any one of the preceding claims wherein said customized stability, and / or customized translation efficiency is a reduced stability, and / or reduced translation efficiency, or a higher stability, and / or higher translation efficiency.

26. A method for treating a disease or disorder, or for increasing longevity, in a subject in need thereof comprising a step of administering the recombinant adeno- associated virus (rAAV) vector of any one of the preceding claims to said subject wherein said disease or disorder is at least one of a fibrotic condition, a fibrosis- associated condition, a metabolic disorder, a neurological or neurodegenerative disease, age-related frailty, an ophthalmic disease, an auditory system disease, or cancer.

27. The method of claim 26 wherein said fibrotic condition is selected from a group consisting of radiation-induced fibrosis, cardi c fibrosis, pulmonary fibrosis, liver fibrosis, skin fibrosis, fibrotic conditions in the eye, brain fibrosis, and kidney fibrosis.

28. The method of claim 26 wherein said fibrosis-associated conditions are inflammation, endothelial or epithelial to mesenchymal transition, parenchymal injury, scarring, or cirrhosis.

29. The method of claim 26 wherein said cancer is a solid tumor or a hematological cancer.

30. The method of claim 26 wherein said neurological or neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD), Parkinson’s disease (PD), frailty syndrome, dementia, Amyotrophic Lateral Sclerosis (ALS), and Adrenoleukodystrophy (ALD).

31. The method of claim 26 wherein said ophthalmic disease is selected from the group consisting of Glaucoma, Age related Macular Degeneration (AMD), Diabetic Maculae Edema (DME) and Diabetic retinopathy.

32. The method of claim 26 wherein said auditory system disease is age-related hearing loss.

33. The method of any one of claims 26 to 32 wherein said subject is a human subject.

34. The method of any one of claims 26 to 33 wherein said method further comprises administering to said subject an additional therapeutic agent.

35. The method of claim 34 wherein said additional therapeutic agent is an anti-cancer agent or anti-cancer therapy.

36. The method of claim 34 wherein said additional therapeutic agent is a neuroprotective factor, an anti-inflammatory agent, or a therapeutic agent suitable for the treatment of neurodegenerative disorders.

37. A recombinant adeno-associated virus (rAAV) vector comprising a nucleic acid comprising (i) a promoter and / or enhancer sequence and (ii) a posttranscriptional regulatory element sequence, operably coupled to a polynucleotide sequence encoding a SIRT6 protein, wherein said polynucleotide sequence encoding a SIRT6 protein is codon-optimized for obtaining molecules with a customized stability, and / or a customized translation efficiency, and / or reduced immunogenicity, for use in a method of treating a disease or disorder, or for increasing longevity, in a subject in need thereof wherein said method comprises a step of administering a therapeutically effective amount of said rAAV vector, wherein said disease or disorder is at least one of a fibrotic condition, a fibrosis- associated condition, a metabolic disorder, a neurological or neurodegenerative disease, age-related frailty, an ophthalmic disease, an auditory system disease, or cancer.

38. The rAAV vector for use according to claim 37 wherein said customized stability, and / or customized translation efficiency is a reduced stability, and / or reduced translation efficiency, or a higher stability, and / or higher translation efficiency.

39. A nucleic acid comprising (i) a promoter and / or enhancer sequence and (ii) a posttranscriptional regulatory element sequence, operably coupled to a polynucleotide sequence encoding a SIRT6 protein, wherein said polynucleotide sequence encoding a SIRT6 protein is codon-optimized for obtaining molecules with a customized stability, and / or a customized translation efficiency and / or reduced immunogenocity.

40. The nucleic acid of claim 39 wherein said polynucleotide sequence encoding a SIRT6 protein comprises a sequence having at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 1.

41. The nucleic acid of claim 39 wherein the codon-optimized polynucleotide sequence encoding SIRT6 has at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:6, SEQ ID NO:9, or SEQ ID NO: 10.

42. The nucleic acid according to any one of claims 39 to 41, wherein said promoter and / or enhancer sequence is a tissue specific or cell specific promoter and / or enhancer sequence.

43. The nucleic acid according to claim 42 wherein said tissue specific or cell specific promoter and / or enhancer is a liver-specific promoter and / or enhancer, a musclespecific promoter and / or enhancer, a neuronal tissue-specific promotor and / or enhancer, an eye tissue-specific promotor and / or enhancer, or an ear tissuespecific promotor and / or enhancer.

44. The nucleic acid of any one of claims 39 to 43, wherein said promoter and / or enhancer sequence is a viral promoter and / or enhancer sequence.

45. The nucleic acid according to any one of claims 39 to 44, further comprising one or more AAV inverted terminal repeats.

46. The nucleic acid of any one of claims 39 to 45 wherein said customized stability, and / or customized translation efficiency is a reduced stability, and / or reduced translation efficiency, or a higher stability, and / or higher translation efficiency.

47. An expression cassette suitable for use in a recombinant AAV vector, comprising a nucleic acid according to any one of claims 39 to 46.

48. A pharmaceutical composition comprising a rAAV vector as claimed in any one of claims 1 to 25 and one or more pharmaceutically or physiologically acceptable carriers, excipients and / or diluents.

49. The pharmaceutical composition of claim 48, for use in the treatment of a disease or disorder, or for increasing longevity, wherein said disease or disorder is at least one of a fibrotic condition, a fibrosis-associated condition, a metabolic disorder, a neurological or neurodegenerative disease, age-related frailty, an ophthalmic disease, an auditory system disease, or cancer.

50. A pharmaceutical composition for use according to claim 49, wherein the fibrotic condition is selected from a group consisting of radiation-induced fibrosis, cardiac fibrosis, pulmonary fibrosis, liver fibrosis, skin fibrosis, fibrotic conditions in the eye, brain fibrosis, and kidney fibrosis.

51. A pharmaceutical composition for use according to claim 49, wherein said fibrosis-associated conditions are inflammation, endothelial or epithelial to mesenchymal transition, parenchymal injury, scarring, or cirrhosis.

52. A pharmaceutical composition for use according to claim 49, wherein said cancer is a solid tumor or a hematological cancer.

53. A pharmaceutical composition for use according to claim 49, wherein said neurological or neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD), Parkinson’s disease (PD), frailty syndrome, dementia, Amyotrophic Lateral Sclerosis (ALS) and Adrenoleukodystrophy (ALD).

54. The pharmaceutical composition for use according to claim 49, wherein said ophthalmic disease is selected from the group consisting of Glaucoma, Age related Macular Degeneration (AMD), Diabetis Macular Edema (DME) and Diabetic retinopathy.

55. The pharmaceutical composition for use according to claim 49, wherein said auditory system disease is age-related hearing loss.

Images