In-vitro blastoid induction and use of blastoid

Abstract

Provided are a blastoid obtained by means of in-vitro induction, and the use of the obtained blastoid.

Description

Induction of blastocyst-like cells in vitro and its application Technical Field

[0001] The present invention belongs to the field of cell differentiation and regenerative medicine, and particularly relates to the construction of blastocyst-like cells. Background Art

[0002] Early embryonic development is a crucial research area in life sciences. Understanding the laws governing early human embryonic development and the regulatory mechanisms governing cell fate determination is crucial for the development of assisted reproductive technologies and the prevention of developmental disorders such as miscarriage and birth defects. However, the limited availability and accessibility of embryos for research, as well as ethical restrictions on human embryo research, have significantly hindered basic research on early embryonic development. Recently, blastocyst-like reconstruction techniques have provided a new avenue for studying early embryos.

[0003] A blastoid is an embryonic structure that is self-assembled from cellular materials, especially stem cells, and has similar structural, molecular, and developmental characteristics to a normal embryo. Thylakoids can, to a certain extent, mimic the formation and developmental processes of real human embryos, providing a good in vitro model for the study of early human embryonic development. Existing human thylakoid constructions suffer from complex construction systems, requiring gradual induction through a multi-step process, and low efficiency. Furthermore, the proportion of hypoblast (HYP) cells in the constructed human thylakoids is low, which to some extent limits the post-implantation development of human thylakoids. Therefore, exploring new methods for constructing human thylakoids and their synthesis mechanisms is of great significance for the application of human thylakoid technology and basic research on early human embryonic development.

[0004] Summary of the Invention

[0005] The present invention is achieved by The present invention overexpresses GATA6 in human naive pluripotent stem cells to induce hypoblast (HYP)-like cells. Human naive pluripotent stem cells overexpressing GATA6 are mixed with wild-type human naive pluripotent stem cells, induced by the addition of doxycycline, and then synthesized using a spontaneous assembly method to form human blastocysts containing three cell types: epi, te, and hyp. Compared to previously generated spontaneous blastocysts, these synthetic blastocysts have higher efficiency, a structure more similar to that of real embryos, and improved post-implantation developmental capacity.

[0006] In a first aspect, the present invention provides a method for inducing the formation of hypoblast (HYP)-like cells, the method comprising the following steps:

[0007] (1) obtaining pluripotent stem cells overexpressing the GATA6 gene; and

[0008] (2) Inducing the pluripotent stem cells that overexpress the GATA6 gene to form HYP-like cells.

[0009] In some embodiments, the pluripotent stem cells are human-derived pluripotent stem cells or non-human mammal-derived pluripotent stem cells.

[0010] In some embodiments, the pluripotent stem cells are naive pluripotent stem cells. In some embodiments, the pluripotent stem cells are human naive pluripotent stem cells.

[0011] In some embodiments, the method further comprises: introducing plasmids containing the GATA6 gene and the rTTA3 gene into wild-type pluripotent stem cells to produce GATA6-overexpressing pluripotent stem cells. rTTA3 and exogenous doxycycline (Dox) co-activate TetO, and the expression of the GATA6 gene can be induced by controlling Dox.

[0012] In some embodiments, the wild-type pluripotent stem cell is a wild-type naive pluripotent stem cell.

[0013] In some embodiments, the wild-type naive pluripotent stem cells are obtained by inducing stem cells.

[0014] In some embodiments, the stem cells are selected from primed stem cells.

[0015] In some embodiments, the primed stem cells are selected from primed stem cells of human or non-human mammalian origin.

[0016] In some embodiments, the primed stem cells are selected from primed embryonic stem cells and / or primed induced pluripotent stem cells.

[0017] In some embodiments, the human embryonic stem cells are commercial human embryonic stem cell lines. In some embodiments, the human embryonic stem cells are stem cells isolated or obtained from human embryos within 14 days of fertilization that have not undergone in vivo development.

[0018] In some embodiments, the wild-type human naive pluripotent stem cells are obtained by inducing primed human embryonic stem cells.

[0019] In some embodiments, the wild-type naive pluripotent stem cells are obtained by inducing and culturing stem cells in a culture medium containing a GSK3 inhibitor.

[0020] In some embodiments, the wild-type naive pluripotent stem cells are obtained by sequentially inducing and culturing the stem cells in a medium containing a first GSK3 inhibitor and a medium containing a second GSK3 inhibitor, wherein the first GSK3 inhibitor and the second GSK3 inhibitor are different.

[0021] In some embodiments, the first GSK3 inhibitor and the second GSK3 inhibitor are each independently selected from CHIR99021, IM-12, SB216763, AT7519, CHIR-98014, TWS119, Tideglusib, SB415286, 6-bromoindirubin-3-oxime, AZD2858, AZD1080, AR-A014418, TDZD-8, LY2090314, WAY-119064, PF-04802367, GSK-3β inhibitor 1, KYI9382, BRD0705, Alsterpaullone, BIO-acetoxime, 1-Azakenpaullone, Indirubin, Indirubin-3'-oxime, One or more of Resibufogenin, 9-ing-41, 5-Bromoindole, CP21R7 or Bikinin.

[0022] In some embodiments, the wild-type naive pluripotent stem cells are obtained by sequentially inducing and culturing the stem cells in a culture medium containing a first GSK3 inhibitor, CHIR99021, and a culture medium containing a second GSK3 inhibitor, IM-12.

[0023] In some embodiments, the concentration of the first GSK3 inhibitor in the culture medium is 0.5-2 μM, preferably 1 μM. In some embodiments, the concentration of the second GSK3 inhibitor in the culture medium is 0.5-2 μM, preferably 1 μM.

[0024] In some embodiments, DMEM / F-12 medium, modified DMEM / F-12 medium, or Neurobasal medium is used as the basal medium for inducing stem cells to form wild-type naive pluripotent stem cells.

[0025] In some embodiments, the basal medium is supplemented with N2, B27, and other auxiliary components and induction factors. Preferably, the other auxiliary components are selected from at least one of KnockOut SR, GlutaMAX non-essential amino acids, trace elements, 2-mercaptoethanol, and bovine serum albumin. Preferably, the induction factor is selected from at least one of a MEK / ERK inhibitor, a BRAF inhibitor, an SRC inhibitor, a ROCK inhibitor, leukemia inhibitory factor, activin A, and a fibroblast growth factor. In some embodiments, the trace element includes an antibiotic. In some embodiments, the antibiotic is a dual-antibody. In some embodiments, the dual-antibody is a penicillin-streptomycin dual-antibody. In some embodiments, the MEK / ERK inhibitor includes PD0325901. In some embodiments, the BRAF inhibitor includes SB5900885. In some embodiments, the SRC inhibitor includes WH-4-023. In some embodiments, the ROCK inhibitor includes Y-27632. In some embodiments, the fibroblast growth factor includes FGF2.

[0026] In some embodiments, the culture medium can be a culture medium that stably maintains the original state of stem cells, such as 5iLA culture medium or PXGL culture medium. In some embodiments, 5iLA culture medium includes five chemical small molecule inhibitors (inhibitors of BRAF, MEK, SRC, GSK3β and ROCK) and leukemia inhibitory factors LIF and Activin A. In some embodiments, PXGL culture medium includes MEK inhibitor PD0325901, WNT signaling pathway antagonist XAV939, protein kinase C inhibitor and LIF.

[0027] In some embodiments, the wild-type human naive pluripotent stem cells are obtained by sequentially inducing and culturing primed human embryonic stem cells in 5iLAF-C medium containing the GSK3 inhibitor CHIR99021 and in 5iLAF medium containing the GSK3 inhibitor IM-12.

[0028] In some embodiments, the stem cells are cultured in a medium containing a first GSK3 inhibitor for 9-13 days before being passaged; on day 3-4 of passage 3 (P3) and subsequent passages, the medium is replaced with a medium containing a second GSK3 inhibitor and cultured for 3-5 days to obtain wild-type naive pluripotent stem cells.

[0029] In some embodiments, the induced stem cells are dissociated prior to passaging. Preferably, the dissociation comprises dissociating the stem cells using an enzymatic or non-enzymatic digestion solution; preferably, the enzyme is selected from Accutase, Dispase, collagenase, or trypsin; and preferably, the non-enzymatic digestion solution is selected from EDTA, NO-ZYME reagent, or non-enzymatic digestion solution.

[0030] In some embodiments, primed embryonic stem cells are cultured in 5iLAF-C medium containing the GSK3 inhibitor CHIR99021 for 9-13 days and then passaged; on day 3-4 of the third passage (P3) and subsequent passages, the 5iLAF-C medium is replaced with 5iLAF medium containing the GSK3 inhibitor IM-12 and cultured for 3-5 days before establishing a cell line to obtain wild-type naive pluripotent stem cells.

[0031] In some embodiments, the HYP-like cells express markers GATA6 and / or GATA4 and / or SOX17 and / or PDGFRA.

[0032] In some embodiments, the wild-type pluripotent stem cells express the pluripotency marker NANOG.

[0033] In some embodiments, in step (2), doxycycline is used for the induction. In some embodiments, the concentration of doxycycline is 0.5-2 μg / mL, preferably 1 μg / mL.

[0034] In some embodiments, the induction time is 10-40 hours, preferably 20-28 hours.

[0035] In a second aspect, the present invention provides HYP-like cells obtained by the method of the first aspect.

[0036] In some embodiments, the HYP-like cells express markers GATA6 and / or GATA4 and / or SOX17 and / or PDGFRA.

[0037] In a third aspect, the present invention provides a method for inducing the formation of blastocyst-like embryos, the method comprising the following steps:

[0038] (1) obtaining GATA6-overexpressing pluripotent stem cells; and

[0039] (2) Inducing cells containing the GATA6-overexpressing pluripotent stem cells to form blastocyst-like cells.

[0040] In some embodiments, the GATA6-overexpressing pluripotent stem cells are mixed with wild-type pluripotent stem cells and then induced to form blastocysts.

[0041] In some embodiments, the ratio of the number of GATA6-overexpressing pluripotent stem cells to the number of wild-type pluripotent stem cells is 1:(5-20), preferably 1:(8-12), and further preferably 1:10.

[0042] In some embodiments, the culture medium used for the mixed culture is a pluripotent stem cell maintenance medium, preferably 5iLA medium or PXGL medium, more preferably 5iLAF medium.

[0043] In some embodiments, the mixed culture time is 48-72 hours, preferably 45-50 hours, for example 48 hours.

[0044] In some embodiments, the mixed culture is a 3D cell culture.

[0045] In some embodiments, the pluripotent stem cells are human-derived pluripotent stem cells or non-human mammal-derived pluripotent stem cells.

[0046] In some embodiments, the pluripotent stem cells are naive pluripotent stem cells.

[0047] In some embodiments, GATA6-overexpressing pluripotent stem cells are prepared by introducing plasmids containing the GATA6 gene and the rTTA3 gene into wild-type pluripotent stem cells. rTTA3 and exogenous doxycycline (Dox) co-activate TetO, and the expression of the GATA6 gene can be induced by controlling Dox.

[0048] In some embodiments, the wild-type pluripotent stem cell is a wild-type naive pluripotent stem cell.

[0049] In some embodiments, the wild-type naive pluripotent stem cells are obtained by inducing stem cells.

[0050] In some embodiments, the stem cells are selected from primed stem cells.

[0051] In some embodiments, the primed stem cells are selected from primed stem cells of human or non-human mammalian origin.

[0052] In some embodiments, the primed stem cells are selected from primed embryonic stem cells and / or primed induced pluripotent stem cells.

[0053] In some embodiments, the human embryonic stem cells are commercial human embryonic stem cell lines. In some embodiments, the human embryonic stem cells are stem cells isolated or obtained from human embryos within 14 days of fertilization that have not undergone in vivo development.

[0054] In some embodiments, the wild-type human naive pluripotent stem cells are obtained by inducing primed human embryonic stem cells.

[0055] In some embodiments, the wild-type naive pluripotent stem cells are obtained by inducing and culturing stem cells in a culture medium containing a GSK3 inhibitor.

[0056] In some embodiments, the wild-type naive pluripotent stem cells are obtained by sequentially inducing and culturing the stem cells in a medium containing a first GSK3 inhibitor and a medium containing a second GSK3 inhibitor, wherein the first GSK3 inhibitor and the second GSK3 inhibitor are different.

[0057] In some embodiments, the first GSK3 inhibitor and the second GSK3 inhibitor are each independently selected from CHIR99021, IM-12, SB216763, AT7519, CHIR-98014, TWS119, Tideglusib, SB415286, 6-bromoindirubin-3-oxime, AZD2858, AZD1080, AR-A014418, TDZD-8, LY2090314, WAY-119064, PF-04802367, GSK-3β inhibitor 1. One or more of KYI9382, BRD0705, Alsterpaullone, BIO-acetoxime, 1-Azakenpaullone, Indirubin, Indirubin-3'-oxime, Resibufogenin, 9-ing-41, 5-Bromoindole, CP21R7, or Bikinin.

[0058] In some embodiments, the wild-type naive pluripotent stem cells are obtained by sequentially inducing and culturing the stem cells in a culture medium containing a first GSK3 inhibitor, CHIR99021, and a culture medium containing a second GSK3 inhibitor, IM-12.

[0059] In some embodiments, the concentration of the first GSK3 inhibitor in the culture medium is 0.5-2 μM, preferably 1 μM. In some embodiments, the concentration of the second GSK3 inhibitor in the culture medium is 0.5-2 μM, preferably 1 μM.

[0060] In some embodiments, DMEM / F-12 medium, modified DMEM / F-12 medium, or Neurobasal medium is used as the basal medium for inducing stem cells to form wild-type naive pluripotent stem cells.

[0061] In some embodiments, the basal medium is supplemented with N2, B27, and other auxiliary components and induction factors. Preferably, the other auxiliary components are selected from at least one of KnockOut SR, GlutaMAX non-essential amino acids, trace elements, 2-mercaptoethanol, and bovine serum albumin. Preferably, the induction factor is selected from at least one of a MEK / ERK inhibitor, a BRAF inhibitor, an SRC inhibitor, a ROCK inhibitor, leukemia inhibitory factor, activin A, and a fibroblast growth factor. In some embodiments, the trace element includes an antibiotic. In some embodiments, the antibiotic is a dual-antibody. In some embodiments, the dual-antibody is a penicillin-streptomycin dual-antibody. In some embodiments, the MEK / ERK inhibitor includes PD0325901. In some embodiments, the BRAF inhibitor includes SB5900885. In some embodiments, the SRC inhibitor includes WH-4-023. In some embodiments, the ROCK inhibitor includes Y-27632. In some embodiments, the fibroblast growth factor includes FGF2.

[0062] In some embodiments, the culture medium can be a culture medium that stably maintains the original state of stem cells, such as 5iLA culture medium or PXGL culture medium. In some embodiments, 5iLA culture medium includes five chemical small molecule inhibitors (inhibitors of BRAF, MEK, SRC, GSK3β and ROCK) and leukemia inhibitory factors LIF and Activin A. In some embodiments, PXGL culture medium includes MEK inhibitor PD0325901, WNT signaling pathway antagonist XAV939, protein kinase C inhibitor and LIF.

[0063] In some embodiments, the wild-type human naive pluripotent stem cells are obtained by sequentially inducing and culturing primed human embryonic stem cells in 5iLAF-C medium containing the GSK3 inhibitor CHIR99021 and in 5iLAF medium containing the GSK3 inhibitor IM-12.

[0064] In some embodiments, the stem cells are cultured in a medium containing a first GSK3 inhibitor for 9-13 days before being passaged; on day 3-4 of passage 3 (P3) and subsequent passages, the medium is replaced with a medium containing a second GSK3 inhibitor and cultured for 3-5 days to obtain wild-type naive pluripotent stem cells.

[0065] In some embodiments, the induced stem cells are dissociated prior to passaging. Preferably, the dissociation comprises dissociating the stem cells using an enzymatic or non-enzymatic digestion solution; preferably, the enzyme is selected from Accutase, Dispase, collagenase, or trypsin; and preferably, the non-enzymatic digestion solution is selected from EDTA, NO-ZYME reagent, or non-enzymatic digestion solution.

[0066] In some embodiments, primed embryonic stem cells are cultured in 5iLAF-C medium containing the GSK3 inhibitor CHIR99021 for 9-13 days and then passaged; on day 3-4 of the third passage (P3) and subsequent passages, the 5iLAF-C medium is replaced with 5iLAF medium containing the GSK3 inhibitor IM-12 and cultured for 3-5 days before establishing a cell line to obtain wild-type naive pluripotent stem cells.

[0067] In some embodiments, the HYP-like cells express markers GATA6 and / or GATA4 and / or SOX17 and / or PDGFRA.

[0068] In some embodiments, the wild-type pluripotent stem cells express the pluripotency marker NANOG.

[0069] In some embodiments, doxycycline is used for the induction. In some embodiments, the concentration of doxycycline is 0.5-2 μg / mL, preferably 1 μg / mL.

[0070] In some embodiments, the induction time is 10-40 hours, preferably 20-28 hours.

[0071] In some embodiments, the method further comprises performing an assembly culture after induction. Preferably, the assembly culture is performed in 5iLAF medium. Preferably, the assembly culture is performed for 100-140 hours. Preferably, thylakoids are obtained approximately 120 hours after inoculation. The obtained thylakoids have a large number of HYP cells.

[0072] The present invention synthesizes pre-implantation thylakoids, but uses both iGATA6 induced pluripotent stem cells and wild-type pluripotent stem cells for assembly, and incorporates a large number of HYP cells, significantly enhancing the post-implantation embryonic developmental capacity of this model. Furthermore, the present invention significantly improves the assembly efficiency of blastocysts, reaching as high as 87.8%, compared to the typically 25% or less efficiency of other synthetic embryo models in the prior art.

[0073] In a fourth aspect, the present invention provides a blastocyst-like cell obtained by the method of the third aspect.

[0074] In some embodiments, the blastocyst is a preimplantation blastocyst.

[0075] In some embodiments, the blastocyst is a human blastocyst.

[0076] In some embodiments, the blastocysts contain three types of cell subpopulations: EPI-like cells, HYP-like cells, and TE-like cells.

[0077] In some embodiments, the EPI-like cells express epiblast marker molecules NANOG, OCT4 (POU5F1), and SOX2.

[0078] In some embodiments, the HYP-like cells express hypodermal marker molecules GATA6, GATA4, SOX17, and PDGFRA.

[0079] In some embodiments, the TE-like cells express the trophectoderm marker molecules GATA3, GATA2, and NR2F2.

[0080] In some embodiments, HYP-like cells account for about 6-8% of the total cells in the blastocyst, which is close to the proportion of iGATA6 hnESCs in the starting cells.

[0081] In some embodiments, the HYP-like cell subpopulation contains 68-70% GATA6-overexpressing pluripotent stem cells and 28-32% wild-type pluripotent stem cells, indicating that after iGATA6-overexpressing pluripotent stem cells are induced into HYP-like cells, it will also affect the transformation of some wild-type pluripotent stem cells to HYP cell fate.

[0082] In some embodiments, the blastocyst is a preimplantation blastocyst.

[0083] In a fifth aspect, the present invention provides the use of the HYP-like cells obtained by the method described in the first aspect, the HYP-like cells of the second aspect, the blastocysts obtained by the method described in the third aspect, or the blastocysts of the fourth aspect in preparing cells or organoids for treating early embryonic development-related diseases, or in preparing cell models or organoid models for studying early embryonic development-related diseases, or in studying pre-implantation and post-implantation early embryogenesis, or in screening key genes for early embryonic development defects.

[0084] In a sixth aspect, the present invention provides a pharmaceutical preparation comprising the HYP-like cells obtained by the method of the first aspect, the HYP-like cells of the second aspect, the blastocyst-like cells obtained by the method of the third aspect, or the blastocyst-like cells of the fourth aspect.

[0085] In a seventh aspect, the present invention provides a method for screening therapeutic or preventive drugs, wherein the method comprises the step of contacting the blastocyst-like embryo obtained by the method described in the third aspect or the blastocyst-like embryo obtained by the fourth aspect with a candidate molecule.

[0086] The present invention finds that overexpression of the GATA6 gene can increase the proportion of HYP-like cells in human blastocysts and promote the post-implantation developmental ability of blastocysts.

[0087] The present invention uses iGATA6 induced pluripotent stem cells to induce HYP cells in the spontaneous assembly of human embryo-like cells, which is a synthetic embryo model.

[0088] Compared with the prior art, the construction method of the present invention significantly increases the proportion of HYP cells in human blastocysts and significantly improves the assembly efficiency of human blastocysts; in addition, it also improves the in vitro development ability of human blastocysts to a certain extent.

[0089] Glossary:

[0090] Blastocysts (thylakoids) are embryonic structures derived from self-assembly of cellular material, particularly stem cells, that possess structural, molecular, and developmental characteristics similar to those of normal embryos. Blastocysts can, to a certain extent, mimic the formation and development of a real human embryo, providing an excellent in vitro model for the study of early human embryonic development.

[0091] Mammalian embryonic development is a tightly programmed process of cell lineage specification. After the fertilized egg is formed, the embryo begins cleavage, followed by the initial cell lineage separation during the blastocyst stage. The inner cell mass (ICM) maintains pluripotency, while the outer cells differentiate to form the trophectoderm (TE). The trophectoderm will develop into extraembryonic structures such as the placenta, while the inner cell mass further develops into the epiblast (EPI), which ultimately becomes the fetus, and the hypoblast (HYP), which ultimately becomes the yolk sac. EPI-like cells express epiblast markers NANOG, OCT4 (POU5F1), and SOX2; HYP-like cells express hypoblast markers GATA6, GATA4, SOX17, and PDGFRA; and TE-like cells express trophectoderm markers GATA3, GATA2, and NR2F2.

[0092] The inner cell mass cells and epiblast cells can be cultured in vitro to obtain the original state ( Embryonic stem cells (ESCs) are classified into two distinct states: primordial and primed. Primitive pluripotent stem cells share similar gene expression, epigenetic modifications, and developmental potential with preimplantation embryonic cells, making them a useful model for in vitro embryonic cell research. Primitive pluripotent stem cells can assemble into blastocyst-like cells under appropriate culture conditions.

[0093] Currently, methods for synthesizing mouse thylakoids using pluripotent stem cells have been developed. However, mouse naive ESCs cannot form thylakoids independently and require the support of other cell types. Unlike mouse naive pluripotent stem cells, human naive pluripotent stem cells have the ability to differentiate into trophectoderm cells. This gives human naive pluripotent stem cells a unique advantage in self-assembly when constructing human thylakoids. This means that without the need for support from other cell types, thylakoids with a structure, gene expression characteristics, and cell lineage specification that are highly similar to those of human blastocysts can be generated in vitro using a single human naive pluripotent stem cell line under specific culture conditions.

[0094] Human pluripotent stem cells The culture system for pluripotent stem cells (hnPSCs) can be a 5iLA culture system or a PXGL culture system. The 5iLA culture system includes five chemical small molecule inhibitors (inhibitors of BRAF, MEK, SRC, GSK3β and ROCK) and leukemia inhibitory factors LIF and Activin A. The PXGL culture system includes the MEK inhibitor PD0325901, the WNT signaling pathway antagonist XAV939, and the protein kinase C inhibitor hnPSCs cultured in 5iLA or PXGL could stably maintain the original stem cell state and could be induced to form human thylakoids.

[0095] 5iLAF culture medium will produce different subspecies culture media based on the content or composition differences of induction factors, such as the 5iLAF culture medium and 5iLAF-C culture medium in this application. Of course, it should be understood that for 5iLAF culture medium, its basic composition formula can be adjusted based on actual usage requirements, or reasonably replaced with ingredients with similar effects.

[0096] In some embodiments, the 5iLAF culture medium is selected from 5iLAF-C culture medium containing CHIR99021 and conventional 5iLAF culture medium containing IM-12. The specific composition of the 5iLAF-C culture medium is: DMEM / F-12 culture medium and Neurobasal culture medium as the basal culture medium, and also contains N2 supplement and B27 supplement. The auxiliary components in this culture medium are: KnockOut serum replacement (SR), GlutaMAX additive, MEM Non-Essential Amino Acids Solution, penicillin-streptomycin, 2-mercaptoethanol, and bovine serum albumin (BSA). The induction factors in this culture medium are: PD0325901, CHIR99021, SB590885, WH-4-023, Y-27632, recombinant human leukemia inhibitory factor, activin A, and FGF2. In some embodiments, the volume ratio of the DMEM / F-12 medium and the Neurobasal medium is 1:1. In some embodiments, the added mass of the N2 supplement and the B27 supplement is 1%-2% of the total mass, respectively. Of course, those skilled in the art can reasonably adjust the amount of basal culture medium and the addition amount of N2 and B27 according to actual use requirements to meet the culture requirements under different environments. In some embodiments, the added mass of the N2 supplement is 1% of the total mass, and the added mass of the B27 supplement is 2% of the total mass. In some embodiments, the added amount of auxiliary components and induction factors can be reasonably adjusted according to the type of stem cells actually induced and cultured. In some specific embodiments of the present invention, the amount of auxiliary components added is: based on the total mass of the culture medium, 0.5% of the total mass of KnockOut serum replacement (SR), 1 mM GlutaMAX additive, 1% of the total mass of MEM Non-Essential Amino Acids Solution, 1% of the total mass of penicillin-streptomycin, 0.1 mM 2-mercaptoethanol, and 50 μg / mL of bovine serum albumin (BSA).In some specific embodiments of the present invention, the amount of inducing factors added is: PD0325901 with a final concentration of 1 μM, CHIR99021 with a final concentration of 1 μM, SB590885 with a final concentration of 0.5 μM, WH-4-023 with a final concentration of 1 μM, Y-27632 with a final concentration of 10 μM, recombinant human leukemia inhibitory factor with a final concentration of 20 ng / mL (recombinant human LIF, purchased from Qkine), activin A with a final concentration of 20 ng / mL, and fibroblast growth factor (FGF2) with a final concentration of 8 ng / mL.

[0097] In some embodiments, the specific composition of conventional 5iLAF culture medium containing IM-12 is: DMEM / F-12 medium and Neurobasal medium as basal medium, and further contains N2 supplement and B27 supplement. The auxiliary components in this culture medium are: KnockOut Serum Replacement (SR), GlutaMAX Supplement, MEM Non-Essential Amino Acids Solution, penicillin-streptomycin, 2-mercaptoethanol, and bovine serum albumin (BSA). The induction factors in this culture medium are: PD0325901, IM-12, SB590885, WH-4-023, Y-27632, recombinant human leukemia inhibitory factor, activin A, and FGF2. In some embodiments, the volume ratio of DMEM / F-12 medium to Neurobasal medium in the conventional 5iLAF culture medium containing IM-12 is 1:1. In some embodiments, the amount of N2 supplement and B27 supplement added to the conventional 5iLAF culture medium containing IM-12 is 1%-2% of the total mass, respectively. Of course, those skilled in the art can reasonably adjust the amount of basal culture medium and the amount of N2 and B27 added according to actual use requirements to meet the culture requirements in different environments. In some embodiments, the amount of N2 supplement added is 1% of the total mass, and the amount of B27 supplement added is 2% of the total mass. In some embodiments, the amount of auxiliary components and induction factors added can be reasonably adjusted according to the type of stem cells actually induced and cultured. In some specific embodiments of the present invention, the amount of auxiliary components added is: based on the total mass of the culture medium, 0.5% of the total mass of KnockOut serum replacement (SR), 1 mM GlutaMAX additive, 1% of the total mass of MEM Non-Essential Amino Acids Solution, 1% of the total mass of penicillin-streptomycin, 0.1 mM 2-mercaptoethanol, and 50 μg / mL of bovine serum albumin (BSA).In some specific embodiments of the present invention, the amount of inducing factors added is: PD0325901 with a final concentration of 1 μM, IM-12 with a final concentration of 1 mM, SB590885 with a final concentration of 0.5 mM, WH-4-023 with a final concentration of 1 μM, Y-27632 with a final concentration of 10 μM, recombinant human leukemia inhibitory factor with a final concentration of 20 ng / mL (recombinant human LIF, purchased from Qkine), activin A with a final concentration of 20 ng / mL, and fibroblast growth factor 2 (FGF2) with a final concentration of 8 ng / mL.

[0098] Conventional 5iLAF medium containing IM-12 differs from 5iLAF-C medium in that IM-12 replaces CHIR99021 in 5iLAF-C medium. "Induce" relates to the process or action of causing a specific effect on the phenotype of a cell. This effect can take the form of a phenotypic change, such as differentiation to a different phenotype, or it can maintain the cell in a specific cell state, such as preventing dedifferentiation or promoting cell survival.

[0099] "Pluripotent stem cells" are multipotent cells with the ability to self-renew and self-replicate, and can differentiate into various cell types under certain conditions.

[0100] The term "stem cell" as used herein refers to a multipotent or lineage-uncommitted progenitor cell that has the potential to undergo an unlimited number of mitotic divisions to renew itself or to differentiate into daughter cells of a desired cell type.

[0101] In the present invention, the DMEM / F12 can also be replaced by a mixture of one or more of William's E cell culture medium, Neurobasal Medium cell culture medium, MEM cell culture medium, DMEM cell culture medium, 1640RPMI cell culture medium, or F12 cell culture medium. The DMEM / F12 culture medium comprises a mixture of DMEM and Ham's F-12 in a 1:1 ratio. The DMEM / F12 includes a DMEM / F-12 modified culture medium prepared by adjusting the ingredients according to actual applications. The DMEM / F12 modified culture medium includes but is not limited to DMEM-low sugar-pyruvate-glutamine-free-phenol red-free, DMEM / F-12-GlutaMAX TM, DMEM / F-12-HEPES (DMEM / F-12 with HEPES), DMEM-low glucose-pyruvate-HEPES. The DMEM / F12 is a DMEM / F12+HEPES medium containing L-glutamine, HEPES, and phenol red.

[0102] In the present invention, 3D cell culture refers to three-dimensional cell culture. Taking the common scaffold-based three-dimensional culture model as an example, this model allows for interaction between cells and the matrix, better simulating the actual growth environment of cells in the human body. Cells can migrate and grow within the three-dimensional spatial structure of the carrier, forming a three-dimensional cell-carrier complex. Furthermore, 3D cell culture allows cells to grow in all directions in vitro, similar to how they grow in vivo. Numerous 3D cell culture technologies exist, which can be summarized into three categories: 3D hydrogels, cell aggregation, and culture scaffolds. Hydrogels are composed of cross-linked polymer chains or complex networks of natural or synthetic protein molecules. Because they contain large amounts of water, hydrogels have biophysical properties very similar to those of natural tissue, making them highly effective 3D cell culture substrates. Cell aggregation is the phenomenon of several cells coming together to form a clump. Cell aggregation is related to the physiological characteristics of cells, particularly the physical structure of their cell walls. Culture scaffolds provide a physical support upon which cells can grow and function. BRIEF DESCRIPTION OF THE DRAWINGS

[0103] Figure 1 shows GATA6 overexpression-induced HYP-like cells, where A shows the construction of iGATA6 hnESCs; B and D show the relative expression levels of the target gene GATA6, the pluripotency gene NANOG, and the HYP marker genes GATA4, SOX17, and PDGFRA in iGATA6 hnESCs at different time points under Dox induction.

[0104] Figure 2 shows the construction and characterization of EiG6 synthetic blastocysts, wherein A shows a schematic diagram of the construction of EiG6 synthetic blastocysts; B shows a representative picture of EiG6 synthetic blastocysts in AggreWell on the fifth day after inoculation; C shows the efficiency of EiG6 blastocysts and spontaneous blastocysts using only hnES; DG respectively show the immunofluorescence staining characterization results of EiG6 synthetic blastocysts on the fifth day.

[0105] Figure 3 shows the number and proportion of HYP-like cells in blastocysts. A shows the number of HYP-like cells in each spontaneous thylakoid (ES alone) or EiG6-synthesized thylakoid; B shows the proportion of TE, EPI, and HYP-like cells in EiG6-synthesized thylakoids.

[0106] FIG4 shows the transcriptome characterization and analysis of EiG6 blastocyst-like cells. Among them, A shows the clustering analysis of EiG6 synthetic blastocyst-like single-cell transcriptome sequencing; B shows the expression enrichment of human embryonic epiblast cell marker factors (NANOG, POU5F1, SOX2), hypoblast marker factors (GATA6, SOX17, PDGFRA) and trophectoderm marker factors (GATA3, GATA2, NR2F2) in EiG6 synthetic blastocyst-like cells; C shows the distribution of ZeoR+ and ZeoR- cells in blastocyst-like cell subpopulations; D and E show the joint clustering analysis and correlation analysis of EiG6 synthetic blastocyst-like single-cell transcriptome and early real embryo-like (Petropoulos et al., Cell, 2016; Xiang et al., Nature, 2020) and other human induced blastocyst-like (Yanagida et al., Cell Stem Cell, 2021; Kagawa et al., Nature, 2022;) single-cell sequencing data.

[0107] Figure 5 shows the in vitro post-implantation culture and characterization of EiG6 blastocysts. A shows a schematic diagram of the in vitro post-implantation culture of EiG6 synthetic blastocysts; B shows a representative immunofluorescence staining image of spontaneous EiG6 synthetic thylakoids and spontaneous thylakoids (ES cells formed alone) cultured in vitro after implantation; C shows a single-cell sequencing cluster analysis of EiG6 synthetic blastocysts cultured for 3 days after implantation in vitro; D shows the enrichment of marker molecules of various cell lineages in EiG6 synthetic blastocysts after implantation.

[0108] Figure 6 shows the characterization of blastocysts synthesized at different ratios of WT hnESCs to iGATA6 hnESCs. Panels A and B show the immunofluorescence staining results of blastocysts synthesized at ratios of 5:1 and 20:1, respectively, and panel C shows the statistical results of the number of HYP-like cells in the thylakoids synthesized at different ratios. Specific implementation plan

[0109] In order to make the above-mentioned purpose, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below with reference to the accompanying drawings. In the following description, many specific details are set forth so that a full understanding of the present invention is achieved. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific implementation disclosed below. The techniques involved in the following examples, unless otherwise specified, are conventional techniques in various fields such as cell biology, biochemistry, and molecular biology well known to those skilled in the art.

[0110] The following are preferred embodiments of the present invention, and the protection of the present invention is not limited to the following preferred embodiments. It should be noted that for those skilled in the art, several variations and improvements made based on this invention concept all fall within the scope of protection of the present invention.

[0111] The culture media used in the following experiments are as follows:

[0112] (1) 5iLAF culture medium formula:

[0113] 1:1 DMEM / F-12 (Gibco, C11330500CP) and Neurobasal (Gibco, 21103049), 1% N2 supplement (Gibco, 17502048), 2% B27 supplement (Gibco, 17504044), 0.5% KnockOut SR (Gibco, 10828010), 1 mM GlutaMAX (Gibco, 35050061), 1% MEM Non-Essential Amino Acids (Gibco, 11140050), 1% penicillin-streptomycin (Gibco, 10378016), 0.1 mM 2-mercaptoethanol (Gibco, 21985023), 50 μg / mL bovine serum albumin (Sigma, B2064), and the following small molecules or cytokines were added: 1 μM PD0325901 (Selleck, S1036), 1μM IM-12 (Selleck, S7566), 0.5μM SB590885 (Selleck, S2220), 1μM WH-4-023 (Selleck, S7565), 10μM Y-27632 (Selleck, S1049), 20ng / mL recombinant human LIF (Qkine, Qk036), 20ng / mL activin A (Qkine, Qk001), 8ng / mL FGF2 (Healthgen Biotechnology Corp, HYC005M01).

[0114] (2) 5iLAF-C medium formula:

[0115] 1:1 DMEM / F-12 (Gibco, C11330500CP) and Neurobasal (Gibco, 21103049), 1% N2 supplement (Gibco, 17502048), 2% B27 supplement (Gibco, 17504044), 0.5% KnockOut SR (Gibco, 10828010), 1 mM GlutaMAX (Gibco, 35050061), 1% MEM Non-Essential Amino Acids (Gibco, 11140050), 1% penicillin-streptomycin (Gibco, 10378016), 0.1 mM 2-mercaptoethanol (Gibco, 21985023), 50 μg / mL bovine serum albumin (Sigma, B2064), and the following small molecules or cytokines were added: 1 μM PD0325901 (Selleck, S1036), 1μM CHIR99021 (Selleck, S2924), 0.5μM SB590885 (Selleck, S2220), 1μM WH-4-023 (Selleck, S7565), 10μM Y-27632 (Selleck, S1049), 20ng / mL recombinant human LIF (Qkine, Qk036), 20ng / mL activin A (Qkine, Qk001), 8ng / mL FGF2 (Healthgen Biotechnology Corp, HYC005M01);

[0116] (3) IVC1 culture medium formula: DMEM / F12 (Gibco, C11330500CP) was supplemented with 2 mM Glutamax (Gibco, 35050061), 1% ITS-X (Gibco, 51500056), 0.5% penicillin-streptomycin (Gibco, 10378016), 10 μM Y-27632 (Selleck, S1049), 20% fetal bovine serum heat-inactivated at 56°C for 30 minutes (Gibco, 10099141C), 8 nM β-estradiol (Sigma-Aldrich, E8875), 200 ng / mL Progesterone (Sigma-Aldrich, P0130), and 25 μM N-acetyl-L-cysteine ​​(Sigma-Aldrich, A7250).

[0117] (4) IVC2 culture medium formula: DMEM / F12 (Gibco, C11330500CP) was supplemented with 2 mM Glutamax (Gibco, 35050061), 1% ITS-X (Gibco, 51500056), 0.5% penicillin-streptomycin (Gibco, 10378016), 30% fetal bovine serum heat-inactivated at 56°C for 30 minutes (Gibco, 10099141C), 8 nM β-estradiol (Sigma-Aldrich, E8875), 200 ng / mL Progesterone (Sigma-Aldrich, P0130), and 25 μM N-acetyl-L-cysteine ​​(Sigma-Aldrich, A7250).

[0118] The reagents and instruments used in the present invention are all commercially available and can be purchased on the market.

[0119] The detection methods used in the following experiments are as follows:

[0120] The following describes the operations of fluorescence quantitative PCR experiments, immunofluorescence staining, and single-cell transcriptome sequencing in the present invention. The experimental methods involved in the present invention are the same as those described below, and the specific processes involved in these experiments are not repeated here.

[0121] (I) Fluorescence quantitative PCR:

[0122] Total RNA extraction kit: Kangwei Century, CW0581M

[0123] Reverse transcription kit: Applied Biological Materials Inc, G490

[0124] Fluorescence quantitative PCR kit TB Premix Ex Taq TM II:Takara,RR820A

[0125] (1) 2x10 6 After Dox induction, iGATA6 hnESCs were lysed using 1 mL of T RIzon Reagent (Cornwell, CW0580) and reacted at room temperature for 5 minutes.

[0126] (2) Add chloroform in a ratio of 200 μL, cover the tube, shake vigorously for 15 seconds, and let it stand at room temperature for 2 minutes;

[0127] (3) Centrifuge at 12,000 rpm (~13,400 × g) at 4°C for 10 min. The sample will separate into three layers: a red organic phase, an intermediate layer, and an upper colorless aqueous phase. The RNA is mainly in the upper aqueous phase. Transfer the upper aqueous phase to a new RNase-Free centrifuge tube.

[0128] (4) Add an equal volume of 70% ethanol (prepared with RNase-free water) to the resulting aqueous solution and mix thoroughly by inversion.

[0129] (5) Add all the solution obtained in the previous step to the adsorption column (Spin Columns RM) in the collection tube, centrifuge at 12,000 rpm for 20 seconds, discard the waste liquid in the collection tube, and replace the adsorption column in the collection tube;

[0130] (6) Add 700 μL of Buffer RW1 to the adsorption column, centrifuge at 12,000 rpm for 20 seconds, discard the waste liquid in the collection tube, and return the adsorption column to the collection tube;

[0131] (7) Add 500 μL of Buffer RW2 to the adsorption column (check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 20 seconds, discard the waste liquid in the collection tube, and return the adsorption column to the collection tube; repeat once;

[0132] (8) Centrifuge at 12,000 rpm for 2 minutes and discard the waste liquid in the collection tube. Place the adsorption column at room temperature for several minutes and dry it thoroughly. Place the adsorption column in a new RNase-free centrifuge tube, add 30 μL RNase-Free Water to the middle of the adsorption column, place it at room temperature for 1 minute, and centrifuge at 12,000 rpm for 1 minute to collect the RNA solution and measure the RNA concentration;

[0133] (9) 2 μg of the obtained RNA was taken and reverse transcribed using a reverse transcription kit (Applied Biological Materials Inc, G490). 4 μL of 5X All-In-One RT MasterMix was added and the total volume was made up to 20 μL with nuclease-free water. After thorough mixing, the mixture was incubated at 25°C for 10 minutes, 42°C for 45 minutes, and then at 85°C for 5 minutes to obtain the reverse transcribed cDNA.

[0134] (10) Using the fluorescent quantitative PCR kit TB Premix Ex Taq TMqPCR was performed using a Takara II (Takara, RR820A) to quantify the target gene GATA6, the pluripotency marker gene NANOG, and the HYP marker genes GATA4, SOX17, and PDGFRA. GAPDH was used as the internal reference gene, and the primer sequences used are as follows:

[0135] GAPDH-qF:GTCTCCTCTGACTTCAACAGCG(SE1 ID NO:1)

[0136] GAPDH-qR:ACCACCCTGTTGCTGTAGCCAA(SE1 ID NO:2)

[0137] GATA6-qF:GGTAATAGCAATAATTCCATTCC(SE1 ID NO:3)

[0138] GATA6-qR:GCTGTAGGTTGTGTTGTG(SE1 ID NO:4)

[0139] GATA4-qF:CGACACCCCAATCTCGATATG(SE1 ID NO:5)

[0140] GATA4-qR:GTTGCACAGATAGTGACCCGT(SE1 ID NO:6)

[0141] SOX17-qF:GACATGAAGGTGAAGGGCGA(SE1 ID NO:7)

[0142] SOX17-qR:TAGCCCACACCATGAAAGCG(SE1 ID NO:8)

[0143] NANOG-qF: GCAGAAGGCCTCAGCACCTA(SE1 ID NO:9)

[0144] NANOG-qR: AGGTTCCCAGTCGGGTTCA (SE1 ID NO:10)

[0145] PDGFRA-qF: TGCCTGACATTGACCCTGT (SE1 ID NO:11)

[0146] PDGFRA-qR: CCGTCTCAATGGCACTCTC (SE1 ID NO:12).

[0147] (II) Immunofluorescence staining:

[0148] (1) Use a mouth pipette to transfer the EiG6 blastocyst-like structure into a U-bottom culture well containing Dulbecco's phosphate buffered saline (DPBS, BasalMedia, B210KJ) and briefly wash to remove residual culture medium; then transfer it into 4% paraformaldehyde (PFA, Beyotime, P0099) and fix it at room temperature for 30 minutes or at 4°C overnight;

[0149] (2) After washing three times with DPBS to remove residual PFA, the cells were permeabilized with 0.75% Triton X-100 (Sigma, T8787) for 1 hour, and then blocked with blocking buffer containing 3% BSA and 0.1% Triton X-100 (prepared with DPBS) at room temperature for 1 hour;

[0150] (3) The blastocysts were then transferred into blocking buffer containing diluted primary antibodies (anti-SOX2, 1:200 dilution, Invitrogen, 14-9811-80; anti-GATA3, 1:250 dilution, Abcam, ab199428; anti-SOX17, 1:40 dilution, R&D systems, AF1924; anti-GATA4, 1:200 dilution, Cell Signaling Technology, 36966; anti-OCT4, 1:50 dilution, Santa Cruz Biotechnology, sc-5279) and incubated overnight at 4°C.

[0151] (4) Wash the cells three times with DPBS containing 0.1% Triton X-100 to remove residual primary antibody, and then transfer the blastocysts into blocking buffer containing diluted secondary antibodies (Donkey anti-Rat IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594, Invitrogen, A21209; Donkey anti-Goat IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, Invitrogen, A11055; Donkey anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 647, Invitrogen, A31573; Donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555, Invitrogen, A31570; 1:1000 dilution) and incubate at room temperature in the dark for 1 hour.

[0152] (5) After washing with DPBS three times to remove residual secondary antibody, the cells were incubated with nuclear staining solution (DAPI, Sigma, D9542) at room temperature for 20 minutes.

[0153] (6) The stained blastocysts were imaged using a Zeiss LSM800 laser scanning confocal microscope.

[0154] (III) Single-cell transcriptome sequencing:

[0155] (1) Using a mouth pipette, approximately 200 EiG6 blastocysts on the fifth day were picked from the AggreWell and washed once with DPBS. They were then digested with 0.25% trypsin-EDTA (Gibco, 25300054) in a 20% O2, 5% CO2, 37°C incubator for 30 minutes.

[0156] (2) 1 mL of DPBS containing 0.04% BSA was then added for neutralization. After centrifugation at 300 g for 5 minutes, the cell pellet was resuspended in DPBS containing 0.04% BSA and filtered through a 40 μm pore cell strainer. Cell number and density were measured using Countstar Mira FL fluorescence staining, and cell viability was assessed using AOPI fluorescence staining.

[0157] (3) Take 1.7×105 Single-cell transcriptome libraries were constructed from 10× Genomics cells (Chromium Single Cell 3' Reagent Kits, V3.1) according to the instructions. Libraries that passed quality inspection were sent to Novogene for sequencing using the Illumina Novaseq platform, generating paired reads of 150 bp in length.

[0158] (4) The obtained 10×Genomics single-cell RNA-seq data were preprocessed using Trimmomatic software to remove reads containing adapters, low quality, or reads less than 26 bp in length. Bioinformatics analyses such as alignment, annotation, duplicate read removal, and gene expression quantification were then performed using STARsolo and STAR (v.2.7.9a) algorithms.

[0159] Example 1 Preparation of wild-type naive embryonic stem cells

[0160] (1) Obtaining wild-type naive embryonic stem cells (WT hnESCs)

[0161] 2×10 4 Primed human embryonic stem cells (pESCs) were plated on inactivated mouse embryonic fibroblasts (feeders) and induced into naive pluripotent stem cells using 5iLAF-C medium containing the GSK3 inhibitor CHIR99021. The primed human embryonic stem cells were primed STiPS 0-XX1 iPSCs (purchased from the Howard Hughes Medical Institute, USA), and the feeder cells were ICR mouse embryonic fibroblasts (purchased from the Type Culture Collection) treated with Mitomycin C for 3 hours.

[0162] After 9-13 days of induction, the cells were digested with Accutase (Invitrogen, 00455556) and passaged at a ratio of 1:2 (denoted as P1). The resulting cells were naive pluripotent stem cells. Six days after passage, the cells were again passaged at a ratio of 2×10 5 Cells / 35 mm culture dish passage (denoted as P2);

[0163] On the third or fourth day of passage P3 (and later), the 5iLAF-C medium was replaced with 5iLAF medium containing the GSK3 inhibitor IM-12;

[0164] On the fourth day after changing to 5iLAF medium, dome-shaped cell clones were picked for cell line establishment and named WT hnESCs.

[0165] (2) WT nESCs spontaneously form ES blastocysts

[0166] After digestion, stably established WT nESCs were seeded on a culture plate coated with Gelatin (Stemcell, 07903) and cultured at 37°C for 1 hour to remove feeder cells. 4 Feeder-depleted nESCs were seeded in a 24-well AggreWell (Stemcell, 34411) 3D culture system and cultured for 6 days using 5iLAF medium. This yielded 40-60% spontaneous human blastocyst-like structures, termed ES blastocysts. WT nES cell lines capable of spontaneous blastocyst formation were used in subsequent steps.

[0167] Example 2: GATA6 overexpression induces HYP-like cells

[0168] 1. The plasmids PB-TetO-GATA6-Zeo (GATA6 gene accession number NM_005257.6), PB-CAG-IRES-rTTA3-Bsd, and pBase were constructed in-house. PB refers to the PiggyBac backbone; TetO refers to the inducible promoter; PGK, CAG, and IRES are conventional expression promoters; Zeo is the zeocin resistance gene; Bsd is the blasticidin resistance gene; and pBase is a plasmid expressing the PiggyBac transposase, which stably inserts the target gene from the PB plasmid into the host cell genome. rTTA3 and exogenous doxycycline (Dox) co-activate TetO, and by controlling Dox, GATA6 gene expression can be induced.

[0169] 2. Add 2 μg of PB-TetO-GATA6-Zeo, 2 μg of PB-CAG-IRES-rTTA3-Bsd and 2 μg of pBase plasmid to 2x10 5The WT hnESCs obtained in the examples were mixed and electroporated using a Neon electroporator and kit (TheroFisher, MPK10025) at 1300V, 20ms, and 3 pulses. After electroporation, the cells were immediately seeded on feeder cells (inactivated mouse embryonic fibroblasts, feeders) and cultured using 5iLAF medium. After 6-7 days, the cells were passaged at a 1:2 ratio. After 48 hours of cell attachment, 50 μg / mL bleomycin (Invitrogen, R25001) and 3 μg / mL blasticidin (ThermoFisher Scientific, A1113903) were added to the 5iLAF medium for positive cell screening. After 5-7 days of drug screening, surviving clones were picked to establish a cell line, named iGATA6 hnESCs (Figure 1A).

[0170] 3. Fluorescence quantitative PCR was used to verify the overexpression and induction of GATA6. The qPCR results showed that the expression level of GATA6 in iGATA6 hnESCs increased significantly 1 hour after Dox induction (Figure 1B). This shows that the iGATA6 plasmid and rtTA3 plasmid are stably integrated into the iGATA6 hnESCs cell line constructed and screened in this example, and the target gene GATA6 can be conditionally overexpressed with the help of Dox. The expression levels of the hypoblast (HYP) marker genes GATA4, SOX17 and PDGFRA were also significantly enhanced with the increase in GATA6 expression, while the pluripotency marker molecule NANOG of hnESCs was significantly downregulated (Figure 1C and Figure 1D). This shows that GATA6 can induce hnESCs to produce HYP-like cells, and it was found that 24 hours of induction was sufficient to induce the molecular characteristics of HYP cells.

[0171] Example 3: Construction of human synthetic blastocysts

[0172] 1. The WT hnESCs obtained in Example 1 and the iGATA6 hnESCs stably established in Example 2 were digested and seeded onto culture plates coated with Gelatin (Stemcell, 07903). They were cultured at 37°C for 1 hour to remove feeder cells. 4×10 4 WT hnESCs and 4 × 10 3 iGATA6 hnESCs were thoroughly mixed in 1 mL of 5iLAF medium and then seeded in 24-well AggreWell (Stemcell, 34411) for 3D culture; fresh 5iLAF medium was replaced daily.

[0173] 2. 48 hours after inoculation, Dox was added at a final concentration of 1 μg / mL when the culture medium was changed to induce GATA6 expression and the generation of HYP cells ( Figure 2A );

[0174] 3. 24 hours after adding Dox, replace the culture medium with 5iLAF medium to remove Dox induction;

[0175] 4. By day 5 (~120 hours) after seeding, human blastocyst-like structures could be obtained in more than 80% of the microwells; these structures are referred to as EiG6 blastocysts (Figure 2B). Compared to using only WT hnESCs, the addition of iGATA6 hnESCs significantly increased the efficiency of blastocyst formation (from ~55.5% to approximately ~87.8%; Figure 2C).

[0176] 5. Immunofluorescence staining was performed on day 5 EiG6 blastocysts to identify the expression of human embryo-specific markers, and the stained blastocysts were imaged using a laser scanning confocal microscope (Figure 2D-G). The staining results showed that the EiG6 blastocysts synthesized in this example were very similar to real human embryos. The interior of the structure was composed of epiblast-like cells expressing SOX2 and OCT4, and some hypoblast cells expressing GATA4 and SOX17 were found on the surface of the internal cells. The exterior of the structure was composed of trophectoderm-like cells expressing GATA3.

[0177] Compared to spontaneous blastocysts derived solely from WT hnESCs (ES blastocysts), EiG6 blastocysts contained more HYP-like cells and their proportions were close to those of real human embryos (Figures 3A and 3B). These results indicate that the addition of iGATA6 hnESCs significantly increases the number of HYP cells in blastocysts, making them more accurately mimic real human embryos in vitro.

[0178] 6. Single-cell transcriptome sequencing was performed on the fifth-day EiG6 blastocyst-like embryos. The analysis results showed that there were three main types of cell subpopulations in the EiG6 synthetic blastocyst-like embryos (Figure 4A and Figure 4B). Among them, the cell subpopulation enriched with high expression of epiblast marker molecules NANOG, OCT4 (POU5F1) and SOX2 was called EPI-like cells, the cell subpopulation expressing hypoblast marker molecules GATA6, SOX17 and PDGFRA was called HYP-like cells, and the cells expressing trophectoderm marker molecules such as GATA3, GATA2 and NR2F2 were called TE-like cells. HYP-like cells accounted for approximately 6.98% of the total cells, which is close to the proportion of iGATA6 hnESCs in the starting cells. Because the iGATA6 plasmid tandemly expresses the Zeocin resistance gene (ZeoR), WT and iGATA6 hnESCs can be distinguished by ZeoR expression. ZeoR+ iGATA6 hnESCs accounted for approximately 5.29% of the total cell population, and the vast majority of ZeoR+ cells were induced to become HYP-like cells (Figure 4C). The HYP-like cell subpopulation contained 69.83% ZeoR+ and 30.17% ZeoR- cells, indicating that the induction of iGATA6 hnESCs into HYP-like cells also affects the fate transition of some WT hnESCs toward HYP cells.

[0179] Compared with single-cell data from early human real embryos (Petropoulos et al., Cell, 2016; Xiang et al., Nature, 2020) and other human induced blastocysts (Yanagida et al., Cell Stem Cell, 2021; Kagawa et al., Nature, 2022;), this example further confirmed the molecular characteristics of EPI-like, TE-like, and HYP-like cell subpopulations in EiG6 blastocysts at the transcriptome level. The cells in these blastocysts are very similar to the corresponding cells in real human embryos (Figure 4D-E). These results indicate that the addition and induction of iGATA6 hnESCs can significantly increase the proportion of HYP-like cell components in synthetic blastocysts. Synthetic blastocysts more accurately simulate real blastocysts in humans in terms of morphological structure, cell space composition, and transcriptome molecular characteristics.

[0180] Example 4: Post-implantation culture of human EiG6 synthetic blastocysts in vitro

[0181] Day 5 EiG6 blastocysts were transferred to suspension culture dishes (Greiner, 657160) and cultured in embryonic in vitro culture medium in a vertical CO2 shaker (Zhichu Instruments, ZCLY-180N) to simulate post-implantation embryonic development (Figure 5A). In vitro culture (IVC) medium is divided into IVC1 and IVC2.

[0182] 1. Use a mouth pipette to pick a single EiG6 blastocyst with clear intraembryonic structures and an ectoderm, and not adherent to other blastocysts, and transfer it to a suspension culture dish (Greiner, 657160). Continue incubating with 4 ml of IVC1 medium in a vertical CO2 shaker (Zhichu Instrument, ZCLY-180N) for 24 hours. Culture conditions are 20% O2, 5% CO2, 37°C, and 60 rpm.

[0183] After 24 hours, discard 2 mL of culture medium and add 2 mL of fresh IVC2 medium. Continue culturing under the same conditions as above.

[0184] After 48 hours, discard 2 mL of culture medium and add 2 mL of fresh IVC2 medium. Continue culturing under the same conditions as above.

[0185] 4. After 72 hours, samples were analyzed by immunofluorescence staining and single-cell transcriptome analysis. Immunofluorescence staining was performed as previously described, using the GATA6 antibody anti-GATA6 (1:40 dilution, R&D Systems, AF1700). Single-cell transcriptome sequencing was performed as previously described.

[0186] Immunofluorescence staining results showed that EiG6 blastocysts developed into egg column-like structures after 3 days of culture after implantation in vitro (Figure 5A-B). This structure was mainly characterized by a bipolar structure composed of GATA3+ trophectoderm cells and SOX2+ epiblast cells on the inside, surrounded by GATA6+ visceral endoderm (VE) cells on the outside. In contrast, blastocysts spontaneously formed from WT hnESCs without iGATA6 (ES blastocysts) failed to form the outer VE-like cell structure due to the lack of HYP components (Figure 5B, bottom).

[0187] Single-cell transcriptome sequencing results showed that cells in clusters 1 and 4 of the EiG6 blastocyst-like embryo expressed embryonic epiblast markers, with cluster 4 cells beginning to express the primed epiblast marker ZIC2, indicating that the epiblast-like cells in the EiG6 blastocyst-like embryo further developed from the naive state to the primed state in vitro. Cluster 2 expressed endodermal markers such as APOA2 and APOB, but did not express the endoderm marker TBXT, indicating that the epiblast-like cells in the EiG6 blastocyst-like embryo further developed into endodermal structures in vitro. Cells in cluster 3 began to express trophectoderm markers of human post-implantation embryos, such as TEAD3, TACSTD2, and CGA (Figure 5C-D).

[0188] These results indicate that the HYP cell fraction derived from iGATA6 hnESCs effectively promoted the postimplantation developmental capacity of EiG6-synthesized blastocysts.

[0189] Example 5: Construction of human synthetic blastocysts using different ratios of WT hnESCs and iGATA6 hnESCs

[0190] The WT hnESCs obtained in Example 1 and the iGATA6 hnESCs stably established in Example 2 were digested and seeded onto culture plates coated with Gelatin (Stemcell, 07903). The cells were cultured at 37°C for 1 hour to remove feeder cells. Human synthetic blastocysts were constructed by mixing the two cell types in the following ratios:

[0191] (1) Take 4×10 4 WT hnESCs and 8×10 3 10 iGATA6 hnESCs were thoroughly mixed in 1 mL of 5iLAF medium and then seeded in a 24-well AggreWell (Stemcell, 34411) for 3D culture (i.e., WT hnESCs: iGATA6 hnESCs = 5:1);

[0192] (2) Take 4×10 4 WT hnESCs and 2×10 3 10 iGATA6 hnESCs were thoroughly mixed in 1 mL of 5iLAF medium and then seeded in a 24-well AggreWell (Stemcell, 34411) for 3D culture (i.e., WT hnESCs: iGATA6 hnESCs = 20:1).

[0193] The remaining steps of the construction method are the same as those shown in Example 3.

[0194] Laser scanning confocal microscopy staining revealed that when blastocysts were assembled using a 5:1 ratio of WT hnESCs:iGATA6 hnESCs, HYP-like cells appeared in the trophectoderm (TE) (Figure 6A). However, when blastocysts were assembled using a 20:1 ratio of WT hnESCs:iGATA6 hnESCs, the number of HYP-like cells was significantly reduced (Figure 6B). Furthermore, the number of HYP-like cells in thylakoids assembled using different WT hnESCs:iGATA6 hnESCs ratios also varied (Figure 6C).

[0195] The present invention enhances the HYP component of synthetic blastocysts by adding an iGATA6 transgenic cell line to a system where hnESCs spontaneously form blastocysts. The optimized construction method of the present invention, using a 10:1 ratio of WT hnESCs to iGATA6 hnESCs, yields iGATA6 synthetic blastocysts that closely mimic the morphology, cell lineage composition, and transcriptome characteristics of real human blastocysts.

[0196] Compared with the reported induced blastocysts, the synthetic iGATA6 blastocysts have higher efficiency, a structure more similar to real embryos, and better post-implantation development ability.

[0197] The induction and assembly of iGATA6 hnESCs and the 5iLAF assembly medium are key technical aspects of the present invention. The present invention has been described in detail above using general instructions and specific embodiments. However, modifications or improvements can be made to the present invention, such as synthesizing alternative ratios of WT hnESCs and iGATA6 hnESCs, as will be apparent to those skilled in the art. Therefore, any such modifications or improvements, without departing from the spirit of the present invention, are considered within the scope of the present invention.

Claims

1. A method for inducing the formation of hypoblast (HYP)-like cells, the method comprising the following steps: (1) obtaining pluripotent stem cells overexpressing the GATA6 gene; and (2) Inducing the pluripotent stem cells that overexpress the GATA6 gene to form HYP-like cells. 2 . The method according to claim 1 , wherein the HYP-like cells express the markers GATA6 and / or GATA4 and / or SOX17 and / or PDGFRA.

3. The method according to claim 1, wherein the induction is performed using doxycycline, Preferably, the induction time is 10-40h, preferably 20-28h.

4. The method according to claim 1, wherein the pluripotent stem cells are human pluripotent stem cells or non-human mammalian pluripotent stem cells, Preferably, the pluripotent stem cells are naive pluripotent stem cells.

5. The method according to claim 1, wherein the method further comprises: GATA6-overexpressing pluripotent stem cells were prepared by introducing plasmids containing the GATA6 gene and the rTTA3 gene into wild-type pluripotent stem cells. Preferably, the wild-type pluripotent stem cells are wild-type naive pluripotent stem cells, Preferably, the wild-type naive pluripotent stem cells are obtained by inducing stem cells, More preferably, the stem cells are selected from primed stem cells, More preferably, the primed stem cells are selected from primed stem cells of human or non-human mammalian origin. More preferably, the primed stem cells are selected from primed embryonic stem cells and / or primed induced pluripotent stem cells. Preferably, the wild-type naive pluripotent stem cells are obtained by inducing and culturing stem cells in a culture medium containing a GSK3 inhibitor. Preferably, the wild-type naive pluripotent stem cells are obtained by inducing and culturing the stem cells in a medium containing a first GSK3 inhibitor and a medium containing a second GSK3 inhibitor in sequence, wherein the first GSK3 inhibitor and the second GSK3 inhibitor are different. More preferably, the first GSK3 inhibitor and the second GSK3 inhibitor are each independently selected from CHIR99021, IM-12, SB216763, AT7519, CHIR-98014, TWS119, Tideglusib, SB415286, 6-bromoindirubin-3-oxime, AZD2858, AZD1080, AR-A014418, TDZD-8, One or more of LY2090314, WAY-119064, PF-04802367, GSK-3βinhibitor 1, KYI9382, BRD0705, Alsterpaullone, BIO-acetoxime, 1-Azakenpaullone, Indirubin, Indirubin-3'-oxime, Resibufogenin, 9-ing-41, 5-Bromoindole, CP21R7 or Bikinin, More preferably, the wild-type naive pluripotent stem cells are obtained by sequentially inducing and culturing the stem cells in a culture medium containing a first GSK3 inhibitor, CHIR99021, and a culture medium containing a second GSK3 inhibitor, IM-12.

6. HYP-like cells obtained by the method of any one of claims 1 to 5. The HYP-like cells according to claim 6 , wherein the HYP-like cells express markers GATA6 and / or GATA4 and / or SOX17 and / or PDGFRA.

8. A method for inducing the formation of blastocyst-like cells, the method comprising the following steps: (1) obtaining GATA6-overexpressing pluripotent stem cells; and (2) Inducing cells containing the GATA6-overexpressing pluripotent stem cells to form blastocysts.

9. The method according to claim 8, wherein in step (2), the GATA6-overexpressing pluripotent stem cells are mixed with wild-type pluripotent stem cells to induce the formation of blastocyst-like cells, Preferably, the ratio of the number of GATA6-overexpressing pluripotent stem cells to the number of wild-type pluripotent stem cells is 1:(5-20), preferably 1:(8-12), Preferably, the medium used in the mixed culture is a pluripotent stem cell maintenance medium, preferably a 5iLA medium or a PXGL medium, more preferably a 5iLAF medium. Preferably, the mixed culture time is 48-72h, preferably 45-50h. Preferably, the mixed culture is 3D cell culture.

10. The method according to claim 8, wherein the induction is performed using doxycycline, Preferably, the concentration of doxycycline is 0.5-2 μg / mL. Preferably, the induction time is 10-40h, preferably 20-28h.

11. The method according to claim 8, wherein the pluripotent stem cells are human pluripotent stem cells or non-human mammalian pluripotent stem cells, Preferably, the pluripotent stem cells are naive pluripotent stem cells.

12. The method according to claim 8, wherein the method further comprises: GATA6-overexpressing pluripotent stem cells were prepared by introducing plasmids containing the GATA6 gene and the rTTA3 gene into wild-type pluripotent stem cells. Preferably, the wild-type pluripotent stem cells are wild-type naive pluripotent stem cells, Preferably, the wild-type naive pluripotent stem cells are obtained by inducing stem cells, More preferably, the stem cells are selected from primed stem cells, More preferably, the primed stem cells are selected from primed embryonic stem cells and / or primed induced pluripotent stem cells. Preferably, the wild-type naive pluripotent stem cells are obtained by inducing and culturing stem cells in a culture medium containing a GSK3 inhibitor. Preferably, the wild-type naive pluripotent stem cells are obtained by inducing and culturing the stem cells in a medium containing a first GSK3 inhibitor and a medium containing a second GSK3 inhibitor in sequence, wherein the first GSK3 inhibitor and the second GSK3 inhibitor are different. More preferably, the first GSK3 inhibitor and the second GSK3 inhibitor are each independently selected from CHIR99021, IM-12, SB216763, AT7519, CHIR-98014, TWS119, Tideglusib, SB415286, 6-bromoindirubin-3-oxime, AZD2858, AZD1080, AR-A014418, TDZD-8, LY2090314, WAY-119064, PF-04802367, GSK-3βinhibitor 1. One or more of KYI9382, BRD0705, Alsterpaullone, BIO-acetoxime, 1-Azakenpaullone, Indirubin, Indirubin-3'-oxime, Resibufogenin, 9-ing-41, 5-Bromoindole, CP21R7 or Bikinin, More preferably, the wild-type naive pluripotent stem cells are obtained by sequentially inducing and culturing the stem cells in a culture medium containing a first GSK3 inhibitor, CHIR99021, and a culture medium containing a second GSK3 inhibitor, IM-12.

13. The method according to claim 8, wherein the method further comprises: After induction, the assembly culture was performed. Preferably, the culture medium used in the assembly culture is a pluripotent stem cell maintenance medium, preferably a 5iLA medium or a PXGL medium, more preferably a 5iLAF medium. Preferably, the assembly culture time is 100-140 hours.

14. Blastocysts obtained by the method according to any one of claims 8 to 13.

15. The blastocyst-like embryo according to claim 14, wherein the blastocyst-like embryo is a preimplantation blastocyst-like embryo, Preferably, the blastocyst is a human blastocyst. Preferably, the blastocyst-like cells contain three cell subpopulations: EPI-like cells, HYP-like cells and TE-like cells. More preferably, in the blastocyst-like embryo, HYP-like cells account for about 6-8% of the total cells. More preferably, the EPI-like cells express epiblast marker molecules NANOG, OCT4 and SOX2. More preferably, the HYP-like cells express hypodermal marker molecules GATA6, SOX17 and PDGFRA, More preferably, the TE-like cells express trophectoderm marker molecules GATA3, GATA2 and NR2F2.

16. Use of the HYP-like cells obtained by the method of any one of claims 1 to 5, the HYP-like cells described in claim 6 or 6, the blastocyst-like cells obtained by the method of any one of claims 8 to 13, or the blastocyst-like cells described in claim 14 or 15 in preparing cells or organoids for treating diseases related to early embryonic development, or in preparing cell models or organoid models for studying diseases related to early embryonic development, or in studying pre-implantation and early post-implantation embryogenesis, or in screening key genes for early embryonic development defects.

17. A pharmaceutical preparation comprising HYP-like cells obtained by the method of any one of claims 1 to 5, HYP-like cells according to claim 6 or 6, blastocysts obtained by the method of any one of claims 8 to 13, or blastocysts according to claim 14 or 15.

18. A method for screening a therapeutic or preventive drug, wherein the method comprises: A step of contacting the blastocyst obtained by the method of any one of claims 8 to 13 or the blastocyst according to claim 14 or 15 with a candidate molecule.

Images