CBFA2t3-NAT16 fusion gene, and detection primer and use thereof

Abstract

Provided is a CBFA2T3-NAT16 fusion gene. The fusion of the CBFA2T3-NAT16 gene occurs in intron 1 of CBFA2T3 and the upstream region of the NAT16 gene, and the fusion gene contains a nucleotide sequence as shown in SEQ ID NO. 3. Also provided are a specific detection primer pair and a kit. Further provided are a method for detecting the fusion gene by means of using the fusion gene, the primer pair and the kit, and the use of the fusion gene, the primer pair and the kit in the preparation of a leukemia classification product. The primer pair is a supplement to the original primers for the CBFA2T3 translocation leukemia fusion gene. By means of the CBFA2T3-NAT16 fusion gene, the type of the CBFA2T3 translocation leukemia fusion gene is expanded, and the detection rate of the PCR method for diagnosing the tumor is increased.

Description

A CBFA2T3-NAT16 fusion gene and its detection primers and applications Technical Field The present application relates to the field of medical testing, and in particular to a CBFA2T3-NAT16 fusion gene and its detection primers and applications. Background Art Leukemia is a common blood disease, and its incidence has been rising in recent years, posing a threat to people's lives and health. Among the disease factors of leukemia, the role of genes has attracted more and more attention. Among them, the CBFA2T3 gene is an important gene in the human body, and its mutation is closely related to the occurrence of leukemia. CBFA2T3 (Core-Binding Factor Runt Domain Alpha Subunit 2 Translocated To 3, also known as MTG16, ETO2) belongs to the myeloid translocation gene (MTG) family (ETO2, MTG16) family. The family also includes RUNX1T1 (ETO, MTG8) and CBFA2T2 (MTGR1). These proteins contain four neural homeodomain (NHR) domains and form the ETO complex through the NHR2 domain. ETOs are scaffold proteins that can recruit a series of corepressor proteins such as N-CoR, SMRT, Sin3A, ATN1 and HDACs to produce a complex that inhibits gene transcription. Transcriptional regulation is an extremely complex and strictly controlled process that is essential for many developmental and differentiation processes, and dysregulation of transcriptional regulation can lead to disease or cancer. It is generally believed that although ETO proteins do not bind DNA directly, they exhibit repressive activity by interacting with transcription factors (such as BCL6, PLZF, Gfi-1, and ZNF652), which directly bind to homologous DNA binding sequences located within the promoters of target genes. ETO family members exert transcriptional repression through multiple binding to repressive proteins such as nuclear receptor corepressors (NCORs), silencing mediators of retinoic acid / thyroid hormone receptors (SMRTs), mSin3a, and histone deacetylases (HDACs). CBFA2T3 is an important transcriptional co-regulator in hematopoiesis. CBFA2T3 plays an important role in the self-renewal, lineage commitment and differentiation of hematopoietic stem and progenitor cells. CBFA2T3 translocation can lead to acute myeloid leukemia (t(16;21)(q24;q22)RUNX1-CBFA2T3) or acute megakaryoblastic leukemia (inv

[0016] There are many binding proteins of CBFA2T3. At present, high-throughput sequencing technology (NGS) is the only detection method that can clearly identify unknown translocation sites. However, high-throughput sequencing has high costs, long detection cycles, few detection platforms, and high requirements for sample quality, which is not conducive to popularization and promotion. It is not the preferred detection method for most patients. According to past experience, designing specific PCR primers for known fusion sites, extracting nucleic acids from patient samples, performing PCR amplification and sequencing, and detecting the specific translocation sites of fusion genes are the most accurate, convenient and economical methods. Therefore, discovering new pathogenic fusion sites and then designing PCR primers will help further improve the accuracy of MTG family translocation tumor detection. Summary of the invention In view of the shortcomings of the prior art mentioned above, in order to solve the technical problem of developing detection primers for new leukemia pathogenic fusion sites to further improve the detection accuracy, the present application uses high-throughput sequencing technology to detect the CBFA2T3-NAT16 fusion gene in a case whose bone marrow cell morphology is consistent with the characteristics of leukemia. This fusion genotype is discovered for the first time. The purpose of the present application is to provide a CBFA2T3-NAT16 fusion gene and its detection primers and applications to solve the problems in the prior art. To achieve the above-mentioned purpose and other related purposes, the first aspect of the present application provides a CBFA2T3-NAT16 fusion gene, which is formed by breakage and recombination between intron 1 of the CBFA2T3 gene on chromosome chr16 of the hg19 reference genome and the upstream of the NAT16 gene on chromosome 7. The second aspect of the present application provides a detection primer pair for detecting the aforementioned CBFA2T3-NAT16 fusion gene, the detection primer pair comprising an upstream primer and a downstream primer; the target matching fragment of the upstream primer is the CBFA2T3 gene; the target matching fragment of the downstream primer is the NAT16 gene. The third aspect of the present application provides a detection kit for the CBFA2T3-NAT16 fusion gene, comprising the aforementioned detection primer pair. The fourth aspect of the present application provides a method for detecting a CBFA2T3-NAT16 fusion gene for non-diagnostic purposes, comprising the following steps: 1) Provide samples to be tested; 2) Performing polymerase chain reaction on the sample to be tested using the aforementioned detection primers. The fifth aspect of the present application provides the use of the aforementioned CBFA2T3-NAT16 fusion gene, the aforementioned detection primer pair, or the aforementioned detection kit in the preparation of a leukemia typing product for detection, treatment or prognosis assessment. Compared with the prior art, the beneficial effects of this application are: This application discloses for the first time a new fusion gene CBFA2T3-NAT16, and specifically designs a detection primer pair that can be used to detect new types of leukemia. The primer pair of the present application is a supplement to the original CBFA2T3 translocation leukemia fusion gene primers, expands the types of CBFA2T3 translocation leukemia fusion genes, and increases the detection rate of PCR method for diagnosing the tumor. BRIEF DESCRIPTION OF THE DRAWINGS FIG1 is a bone marrow smear of the leukemia case in Example 1 of the present application, indicating that it is acute myeloid leukemia. FIG. 2 is a sequencing diagram of the CBFA2T3-NAT16 fusion gene successfully detected by applying the primer combination of the present invention (CBFA2T3-F-NAT16-R) to a known CBFA2T3-NAT16 fusion tumor. Figure 3 is the electrophoresis diagram of Example 2, wherein lanes 1 to 30 are 30 cases with clear diagnosis in the control group, wherein lanes 1 to 10 are 10 cases of BCR-ABL fusion gene-positive chronic myeloid leukemia, lanes 11 to 15 are 5 cases of AML1-ETO fusion gene-positive acute myeloid leukemia, lanes 16 to 25 are 10 cases of CBFβ-MYH11 fusion gene-positive acute myeloid leukemia, lanes 26 to 30 are 5 cases of PML-RARa fusion gene-positive acute promyelocytic leukemia, the template of the negative control is ddH2O, and the positive control is the case in which the new fusion site upstream of CBFA2T3 exon1-NAT16 was detected in Example 1. DETAILED DESCRIPTION In order to make the invention purpose, technical scheme and beneficial effect of the present application clearer, the present application is further described below in conjunction with the examples. It should be understood that the examples are only used to explain the present application and are not used to limit the scope of the application. The test methods used in the following examples are conventional methods unless otherwise specified, and those familiar with the technology can easily understand other advantages and effects of the present application from the contents disclosed in this description. After extensive exploration and research, the inventors of this application discovered a CBFA2T3-NAT16 fusion gene and its detection primers and applications, and completed this application on this basis. On the one hand, the present application provides a CBFA2T3-NAT16 fusion gene, which is formed by the breakage and recombination between the 1st intron of the CBFA2T3 gene on chromosome chr16 of the hg19 reference genome (coordinates chr16:88,971,695) and the upstream of the NAT16 gene on chromosome 7 (coordinates chr7:100,825,079). The present application detects the CBFA2T3-NAT16 fusion gene in a case with bone marrow cell morphology consistent with leukemia characteristics through high-throughput sequencing technology, and this fusion gene is disclosed for the first time in leukemia. This site has not been reported in domestic and foreign literature, and the original CBFA2T3 fusion gene amplification primers cannot detect this fusion gene, which will lead to missed diagnosis of leukemia typing. The present application discloses a new fusion gene CBFA2T3-NAT16 for the first time, expanding the types of CBFA2T3 translocation leukemia fusion genes. CBFA2T3 translocation can lead to the occurrence of acute myeloid leukemia (t(16;21)(q24;q22)RUNX1-CBFA2T3) or acute megakaryocytic leukemia (inv

[0016] (p13q24)CBFA2T3-GLIS2). NAT16 (N-acetyltransferase 16 (putative)) is a protein-coding gene. Diseases associated with NAT16 include von Willebrand disease type 2 and von Willebrand disease type 3. Gene ontology (GO) annotations associated with this gene include N-acetyltransferase activity and peptide α-N-acetyltransferase activity. In the CBFA2T3-NAT16 fusion gene provided in the present application, the starting sequence of intron 1 of the CBFA2T3 gene is located at the genomic coordinates chr16:88,971,695, and the upstream starting sequence of the NAT16 gene is located at the genomic coordinates chr7:100,825,079. In some embodiments, the nucleotide sequence of the CBFA2T3-NAT16 fusion gene is shown in SEQ ID NO: 3. The nucleotide length of the CBFA2T3-NAT16 fusion gene is 327 bp, and the sequence is as follows: On the other hand, the present application provides a detection primer pair for detecting the aforementioned CBFA2T3-NAT16 fusion gene, and the detection primer pair includes an upstream primer and a downstream primer. The target matching fragment of the upstream primer is the CBFA2T3 gene. The target matching fragment of the downstream primer is the NAT16 gene. In some specific embodiments, the target matching fragment of the upstream primer is exon 1 of the CBFA2T3 gene, and the target matching fragment of the downstream primer is the upstream of the NAT16 gene. The primer pair of the present application is a supplement to the original CBFA2T3 translocation leukemia fusion gene primer, expands the types of CBFA2T3 translocation leukemia fusion genes, and increases the detection rate of the PCR method for diagnosing the tumor. In this application, when it comes to numerical intervals (i.e., numerical ranges), unless otherwise specified, the optional numerical distribution within the above numerical interval is considered continuous and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical range, and each numerical value between the two numerical endpoints. Unless otherwise specified, when a numerical interval only refers to integers within the numerical interval, including the two endpoint integers of the numerical range, and each integer between the two endpoints, in this article, is equivalent to directly listing each integer. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges included therein. "Primer" refers to an oligonucleotide, whether naturally occurring in a purified restriction digest or produced synthetically, which can act as a starting point for synthesis when placed under conditions that induce the synthesis of a primer extension product complementary to a nucleic acid strand (e.g., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH). Primers are preferably single-stranded for maximum efficiency in amplification, but may alternatively be double-stranded. If double-stranded, the primer is first treated to separate its strands before being used to prepare an extension product. Preferably, the primer is an oligodeoxyribonucleotide. The primer should be long enough to initiate the synthesis of an extension product in the presence of an inducing agent. The exact length of the primer will depend on many factors, including temperature, primer source, and method of use. The detection primer pair of the present application follows the primer design principle, which is specifically embodied in that: the length of the upstream primer or the downstream primer is 15 to 25 bp; specifically, it can be 15 to 18 bp, 18 to 20 bp, or 20 to 25 bp, etc. The GC content of the upstream primer or the downstream primer is between 40 and 60%; specifically, it can be 40 to 50%, 50 to 55%, or 55 to 60%, etc. The annealing temperature of the upstream primer or the downstream primer is 70 to 75°C; specifically, it can be 70 to 72°C, 72 to 74°C, or 74 to 75°C, etc. In the present application, In a preferred embodiment, the annealing temperature of the upstream primer or the downstream primer is close to 72° C. There should be no complementary sequence between the primers themselves or between the primers, and the amplified band is single and specific. After multiple debugging and verification, the final designed primer sequence is: CBFA2T3-F: AGGATGGAAGAGCTTCACGGG (SEQ ID NO: 1); NAT16-R:GAGCCAGGAAAGTGATGGACAA (SEQ ID NO: 2); On the other hand, the present application provides a detection kit for CBFA2T3-NAT16 fusion gene, comprising the aforementioned detection primer pair. The detection kit provided in the present application also includes RNase Free ddH2O, dNTP Mixture, 10×PCR Buffer (Mg 2++ plus), RNase inhibitor, basic buffer, basic reaction unit, magnesium acetate and other conventional polymerase chain reaction reagents. On the other hand, the present application provides a method for detecting a CBFA2T3-NAT16 fusion gene for non-diagnostic purposes, comprising the following steps: 1) Provide samples to be tested; 2) Performing polymerase chain reaction on the sample to be tested using the aforementioned detection primers. In the detection method provided in the present application, step 1) refers to providing a sample to be tested, wherein the sample to be tested may be a case containing a new fusion site upstream of CBFA2T3 exon1-NAT16, or a case containing other leukemia-related genes, or an unknown case. In the detection method provided in the present application, step 2) refers to using the aforementioned detection primers to perform polymerase chain reaction on the sample to be tested. Wherein, the DNA of the sample to be tested in step 1) is used as a template, and the nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 are used as primers to perform polymerase chain reaction to obtain an amplified product. The amplified product is subjected to agarose gel electrophoresis, and the situation of the CBFA2T3-NAT16 fusion gene in the sample to be tested is judged according to the electrophoresis band results; specifically, when a 327bp band appears in the electrophoresis, it indicates that the sample to be tested contains the CBFA2T3-NAT16 fusion gene; when there is no 327bp band in the electrophoresis, it indicates that the sample to be tested does not contain the CBFA2T3-NAT16 fusion gene. In some embodiments, the conditions of the polymerase chain reaction are: 95°C for 3-5 min, 95°C for 20-30 s, 60°C for 30-35 s, 72°C for 1-1.5 min, for a total of 30-35 cycles, and finally extension at 72°C for 5-10 min. In a preferred embodiment of the present application, the PCR amplification conditions are denaturation at 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min, and finally extension at 72°C for 10 min. On the other hand, the present application provides the use of the aforementioned CBFA2T3-NAT16 fusion gene, the aforementioned detection primer pair, or the aforementioned detection kit in the preparation of a product for detecting leukemia typing. When used for leukemia typing, samples from patients diagnosed with leukemia can be used as test samples, and CBFA2T3-NAT16 can be used as the fusion The fusion gene is used as the target gene for detection to confirm whether the patient is CBFA2T3-NAT16 fusion genotyped. The present application is further described below by way of examples, but the scope of the present application is not limited thereby. Example 1 This application uses high-throughput sequencing technology to analyze bone marrow samples in a case where the bone marrow cell morphology is consistent with the characteristics of leukemia (Figure 1), and detects the CBFA2T3-NAT16 fusion gene in the diseased cells. This fusion genotype is discovered for the first time. Mutations in the CBFA2T3 gene are closely related to the occurrence of leukemia. People in this field are familiar with the fusion of the CBFA2T3 gene with a partner gene to cause leukemia, so this fusion gene is identified as a new genotyping target for leukemia. For cases where high-throughput sequencing detected a new fusion site upstream of CBFA2T3 exon1-NAT16 1. DNA Extraction The extraction was performed strictly according to the instructions of TIANamp Blood DNA kit (cat: DP348-03). 1. Take a 1.5ml centrifuge tube, add 200μl sample, 20μl proteinase K, and 200μl GB, and shake to mix; 2. Pyrolysis in a metal bath at 56°C for 15 min, inverting and mixing every 5 min; 3. Cool for 5 minutes after heating; 4. Add 350 μl BD and shake to mix; 5. Transfer to the adsorption column twice, centrifuge at 12000rpm for 1min, and discard the waste liquid; 6. Add 500 μl GDB, centrifuge at 12000 rpm for 1 min, and discard the waste liquid; 7. Add 500 μl PWB, centrifuge at 12000 rpm for 1 min, and discard the waste liquid; repeat the wash once and discard the waste liquid; 8. Transfer the adsorption column to a new 2 ml collection tube and centrifuge at 12000 rpm for 2 min; 9. Add 55 μl TB elution buffer, let stand for 5 minutes, centrifuge at 12000 rpm for 2 minutes, measure the concentration and purity of the collected nucleic acid extract, and store at -80°C for later use. 2. PCR Amplification PCR amplification primers are shown in Table 1: Table 1 Primer sequences The PCR reaction system included: 10 μl GoTaq Colorless Master Mix, a primer concentration of 20 μmol / l, a DNA template of 100 ng, and sterile deionized water added to 20 μl. The PCR amplification conditions were denaturation at 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min, and a final extension at 72°C for 10 min. The PCR products were electrophoresed with 2% agarose at 100 V, and the results were observed and sequenced. Results: After PCR with primers (CBFA2T3-F / NAT16-R), a single specific electrophoresis band was visible. The amplified product was sequenced to obtain the CBFA2T3-NAT16 fusion gene sequence (Figure 2), proving that the designed primer combination was reliable and sensitive. The amplified product, as an isolated nucleotide, can be used as a positive control for detecting the CBFA2T3-NAT16 fusion gene. Example 2 Testing of control group cases Thirty cases in the control group with a clear diagnosis were tested, including 10 cases of chronic myeloid leukemia with positive BCR-ABL fusion gene, 5 cases of acute myeloid leukemia with positive AML1-ETO fusion gene, 10 cases of acute myeloid leukemia with positive CBFβ-MYH11 fusion gene, and 5 cases of acute promyelocytic leukemia with positive PML-RARa fusion gene. Theoretically, there was no CBFA2T3-NAT16 gene fusion in any of them. The primer combination of the present application was used for detection, and the nucleic acid extraction and PCR amplification methods were the same as those in Example 1. Results: As shown in Figure 3, the CBFA2T3-NAT16 fusion gene was not detected using the primer combination designed by the present invention, which proves that the primers designed in this project have high specificity and can distinguish other leukemia types. In summary, this application discloses a new fusion gene CBFA2T3-NAT16 for the first time, expanding the types of CBFA2T3 translocation leukemia fusion genes. The detection primer pair of this application is a supplement to the original CBFA2T3 translocation leukemia fusion gene primers, expanding the types of CBFA2T3 translocation leukemia fusion genes and increasing the detection rate of the PCR method for diagnosing the tumor. The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present application. Anyone familiar with the technology may modify or change the above embodiments without violating the spirit and scope of the present application. Therefore, all equivalent modifications or changes made by a person of ordinary skill in the art without departing from the spirit and technical ideas disclosed by the present invention shall still be covered by the claims of the present application.

Claims

1. The CBFA2T3-NAT16 fusion gene according to claim 1, characterized in that The CBFA2T3-NAT16 fusion gene is formed by the breakage and recombination between intron 1 of the CBFA2T3 gene on chromosome chr16 of the hg19 reference genome and the upstream of the NAT16 gene on chromosome 7.

2. The CBFA2T3-NAT16 fusion gene according to claim 1, characterized in that The starting sequence of intron 1 of the CBFA2T3 gene is located at genomic coordinates chr16:88,971,695; And / or, the upstream starting sequence of the NAT16 gene is located at the genomic coordinates chr7:100,825,079.

3. The CBFA2T3-NAT16 fusion gene according to claim 1, characterized in that The CBFA2T3-NAT16 fusion gene comprises the nucleotide sequence shown in SEQ ID NO:

3.

4. A detection primer pair for detecting the CBFA2T3-NAT16 fusion gene according to any one of claims 1 to 3, characterized in that: The detection primer pair comprises an upstream primer and a downstream primer; the target matching fragment of the upstream primer is the CBFA2T3 gene; and the target matching fragment of the downstream primer is the NAT16 gene.

5. The detection primer pair according to claim 4, characterized in that, The length of the upstream primer or the downstream primer is 15-25 bp, the GC content is between 40% and 60%, and the annealing temperature is 70-75°C.

6. The detection primer pair according to claim 4, characterized in that, The nucleotide sequences of the detection primer pair are shown in SEQ ID NO: 1 and SEQ ID NO:

2.

7. A detection kit for CBFA2T3-NAT16 fusion gene, characterized in that: It comprises the detection primer pair as described in any one of claims 4 to 6.

8. A method for detecting the CBFA2T3-NAT16 fusion gene for non-diagnostic purposes, characterized in that: The following steps are involved: 1) Provide samples to be tested; 2) Performing polymerase chain reaction on the sample to be tested using the detection primers as described in any one of claims 4 to 6.

9. The detection method according to claim 8, characterized in that: Agarose gel electrophoresis was performed after the polymerase chain reaction, and the situation of the CBFA2T3-NAT16 fusion gene in the sample to be tested was determined based on the electrophoresis band results.

10. Use of the CBFA2T3-NAT16 fusion gene according to any one of claims 1 to 3, or the detection primer pair according to any one of claims 4 to 6, or the detection kit according to claim 7 in the preparation of a product for detecting leukemia typing.

Images