Pharmaceutical composition for preventing or treating peripheral nerve tumor comprising ILK inhibitor and use thereof

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating peripheral nerve tumor, comprising an integrin-linked kinase (ILK) inhibitor, and a use thereof. The composition according to one aspect has a synergistic anticancer effect when co-administered with a mitogen-activated protein kinase kinase 1 (MEK) inhibitor.

Description

Pharmaceutical composition for preventing or treating peripheral nerve tumors containing ILK inhibitor and use thereof

[0001] The present invention relates to a pharmaceutical composition for preventing or treating peripheral nerve tumors comprising an ILK inhibitor and its use.

[0002] Neurofibromatosis Type 1 (NF1) is an autosomal dominant inherited disorder that causes tumors to form along the peripheral nerves. It occurs in approximately 1 in 3,500 people. These tumors can develop anywhere in the body where nerves are present, and because they are often multiple, they are called "neurofibromatosis."

[0003] Approximately 10% of patients with neurofibromatosis type 1 (NF1) develop plexiform neurofibromas (PNs) into malignant tumors called malignant peripheral nerve sheath tumors (MPNSTs). Malignant progression of benign tumors in NF1 patients progresses rapidly and has a very high mortality rate. When MPNSTs progress to malignant transformation, conventional therapy such as tumor resection is the only treatment. However, depending on the location of the tumor, surgery is often not possible. Therefore, regardless of the stage of cancer progression, the occurrence of MPNSTs is directly related to the patient's life.

[0004] The pathogenesis of malignant peripheral nerve sheath tumors (MPNSTs) in neurofibromatosis type 1 (NF1) is known to involve complete loss of NF1 within the tumor, excessive activation of RAS-MAPK signaling, loss of CDKN2A gene, loss of SUZ12 and EED, which are components of polycomb repressive complex 2 (PRC2), loss of tumor suppressor gene TP53, abnormal activation of PI3K-AKT-mTOR signaling, and abnormal activation of epidermal growth factor receptor (EGFR), platelet-derived growth factor receptor, and vascular endothelial growth factor receptor.

[0005] However, despite various clinical studies on malignant peripheral nerve sheath tumors (MPNSTs) based on their pathogenesis in neurofibromatosis type 1 (NF1), no studies have yielded clear therapeutic results. Representative treatment modalities include radiation therapy, surgical resection, and cytotoxic drugs, but their long-term effectiveness is limited, necessitating the development of new treatment options.

[0006] Therefore, new therapeutic targets and candidate substances using new approaches are needed.

[0007] Accordingly, we discovered a new therapeutic target for neurofibromatosis type 1 (NF1) and malignant peripheral nerve sheath tumor (MPNST), and confirmed the possibility of using the inhibitor of the therapeutic target as a new treatment that shows a synergistic anticancer effect with a MEK inhibitor.

[0008] One aspect is to provide a pharmaceutical composition for preventing or treating peripheral nerve tumors, which comprises an inhibitor of the expression or activity of ILK (Integrin-Linked Kinase).

[0009] Another aspect is to provide a kit for preventing or treating peripheral nerve tumors, comprising an ILK (Integrin-Linked Kinase) inhibitor.

[0010] Another aspect provides the use of a composition comprising an inhibitor of the expression or activity of Integrin-Linked Kinase (ILK) for preventing or treating peripheral nerve tumors.

[0011] Another aspect provides a method for preventing or treating peripheral nerve tumor, comprising administering to a subject in need thereof a composition comprising an effective amount of an inhibitor of expression or activity of Integrin-Linked Kinase (ILK).

[0012] Another aspect provides the use of a composition comprising an inhibitor of the expression or activity of Integrin-Linked Kinase (ILK) for use in the manufacture of a medicament for preventing or treating peripheral nerve tumors.

[0013] One aspect provides a pharmaceutical composition for preventing or treating peripheral nerve tumors, comprising an inhibitor of the expression or activity of ILK (Integrin-Linked Kinase).

[0014] The term "peripheral nerve tumor" as used herein refers to a tumor that arises in the peripheral nervous system, which connects the nerves, muscles, skin, and other extremities of the body, such as the fingers, wrists, and ankles. Peripheral nerve tumors are classified into various types, and while they are primarily benign, they can also be malignant. Some peripheral nerve tumors may be associated with a specific genetic disorder, neurofibromatosis.

[0015] The above peripheral nerve tumor may include neurofibroma, ganglioneuroma, ganglioneuroblastoma, neuroma, neurilemoma, neuroma, peripheral primitive neuroectodermal tumor (PNET), extra-adrenal paraganglioma, neurofibrosarcoma, extra-adrenal neurofibroma, neurofibromatosis type 1 (NF1), neurofibromatosis type 2 (NF2), plexiform neurofibroma (PN), malignant peripheral nerve sheath tumor (MPNST), etc.

[0016] The above-mentioned "malignant peripheral nerve sheath tumor (MPNST)" is a spindle cell sarcoma originating in the peripheral nerves. It is a highly malignant metastatic cancer with a high mortality rate. Surgical resection is required after diagnosis, but even after surgery, approximately 50% of patients have a risk of recurrence. Furthermore, it shows a poor response to chemotherapy and radiation therapy, resulting in a five-year survival rate of only 20-50% for patients with MPNST.

[0017] In one specific example, the malignant peripheral nerve fiber schwannoma may be characterized as being caused by malignant transformation of a plexiform neurofibroma (PN).

[0018] The term "ILK expression or activity inhibitor (Integrin-Linked Kinase inhibitor)" as used herein may directly bind to the ILK gene or protein, bind to a ligand of ILK, or inhibit the binding of ILK to its ligand. Through this, the expression or activity of ILK can be inhibited or suppressed, and ultimately the growth or death of a tumor can be inhibited. The efficacy of an ILK inhibitor is, for example, 50% (half-maximal inhibitor concentration or IC 50 ) can be measured by the concentration of ILK inhibitor.

[0019] The above ligand refers to a substance that forms a complex by binding to a biomolecule such as a receptor protein to perform a biological purpose, and includes a substrate, activator, signaling lipid, neurotransmitter, etc.

[0020] The term "inhibitor" may be used interchangeably with "suppressant," and "inhibition" may also be used interchangeably with "suppression." The terms "inhibition" or "suppression" refer to a decrease in the activity, binding, or expression of a polypeptide.

[0021] The term "prevention" as used herein refers to any action that suppresses or delays cancer by administering a pharmaceutical composition according to the present invention. Furthermore, the term "treatment" as used herein refers to any action that improves or completely cures cancer by administering a pharmaceutical composition according to the present invention.

[0022] According to one specific example, the ILK expression inhibitor may be at least one selected from the group consisting of antisense nucleic acids, siRNA, shRNA, miRNA, and ribozymes that complementarily bind to DNA or mRNA of ILK.

[0023] The term "expression inhibition" as used herein encompasses the inhibition of gene transcription and translation into protein. Furthermore, it encompasses both complete cessation of gene expression and reduced expression.

[0024] As used herein, the term "antisense nucleic acid" means DNA, RNA or a fragment or derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, and capable of binding or hybridizing complementarily to the sequence of the mRNA to inhibit translation of the mRNA into protein.

[0025] As used herein, the term "siRNA (small interfering RNA)" refers to a short double-stranded RNA that can induce RNA interference (RNAi) by cleaving a specific mRNA. siRNA comprises a sense RNA strand with a sequence homologous to the mRNA of a target gene and an antisense RNA strand with a sequence complementary to that sequence. Since siRNA can suppress target gene expression, it can be used in gene knockdown methods or gene therapy.

[0026] In one specific example, the siRNA that can be used as an ILK expression inhibitor may be at least one selected from the group consisting of sequences of SEQ ID NOs: 1 to 4.

[0027] As used herein, the term "shRNA (short hairpin RNA)" refers to a single-stranded RNA that is divided into a stem portion that forms a double-stranded portion through hydrogen bonds and a loop portion that has a ring shape. It is processed by proteins such as Dicer to be converted into siRNA and can perform the same function as siRNA.

[0028] As used herein, the term "miRNA (microRNA)" refers to 21 to 23 non-coding RNAs that regulate gene expression post-transcriptionally by promoting the degradation of target RNAs or inhibiting their translation.

[0029] As used herein, the term "ribozyme" refers to an RNA molecule with enzyme-like functionality that recognizes a specific base sequence and cleaves it on its own. A ribozyme may be composed of a region that specifically binds to a complementary base sequence of a target messenger RNA strand and a region that cleaves the target RNA.

[0030] Antisense nucleic acids, siRNA, shRNA, miRNA, ribozymes, etc. that complementarily bind to the DNA or mRNA of the ILK can inhibit any other essential activity of the biological function of the ILK and / or the ILK ligand, such as transcription, translocation into the cytoplasm, maturation, or translation of the ILK and / or the ILK ligand.

[0031] According to one specific example, the ILK activity inhibitor may be a pharmaceutical composition comprising at least one selected from the group consisting of compounds, peptides, peptide mimetics, fusion proteins, antibodies, aptamers, and antibody-drug conjugates (ADCs) that specifically bind to the protein of ILK.

[0032] As used herein, the term “specific” refers to the ability to bind only to a target protein without affecting other proteins within a cell.

[0033] As used herein, the term "peptide" refers to a compound that is a small unit that constitutes a protein and has a structure in which two or more amino acids are linked through peptide bonds.

[0034] As used herein, the term "peptide mimetics" refers to artificial peptide molecules created by mimicking or improving the structure and function of biomolecules. Peptide mimetics include those with structures similar to existing peptide molecules, but with improved stability, bioactivity, and specificity in vivo by modifying or adding certain keywords.

[0035] In this specification, the term "chimeric protein" refers to an artificial recombinant protein that is expressed by linking the genes of one or more other proteins to the protein.

[0036] As used herein, the term "antibody" refers to a substance that specifically binds to an antigen and causes an antigen-antibody reaction. The antibody may include a complete form having two full-length light chains and two full-length heavy chains, as well as a functional fragment of the antibody molecule. The functional fragment of the antibody molecule means a fragment that possesses at least an antigen-binding function, and may be, for example, Fab, F(ab'), F(ab')2, or Fv. In addition, the antibody includes all of polyclonal antibodies, monoclonal antibodies, and recombinant antibodies. In addition, the antibody can be easily produced using techniques well known in the art.

[0037] As used herein, the term "aptamer" refers to a single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) that has a stable tertiary structure in itself and has the characteristic of being able to bind to a target molecule with high affinity and specificity.

[0038] The term "antibody-drug conjugate (ADC)" used in this specification refers to a substance having a form in which a small molecule drug having a specific pharmacological mechanism is loaded onto an antibody having target specificity via a linker.

[0039] Compounds, peptides, peptide mimetics, fusion proteins, antibodies, aptamers, and antibody-drug conjugates (ADCs) that specifically bind to the above ILK protein can inhibit the essential activity for the biological function of ILK.

[0040] In one specific example, the ILK inhibitor may be Cpd 22 or QLT-0267.

[0041] The above Cpd22 (CAS number: 2070015-22-2) is an ILK inhibitor, also called OSU-T315 or ILK-IN-1, and its official name is N-Methyl-3-(1-(4-(piperazin-1-yl)phenyl)-3-(4'-(trifluoromethyl)-[1,1'-biphenyl]-4-yl)-1H-pyrazol-5-yl)propanamide, and is a substance having a structure of the following chemical formula 1.

[0042] [Chemical Formula 1]

[0043]

[0044] The above QLT-0267 (CAS number: 6975-75-3) is an ILK inhibitor, also called ILK-IN-3, and its formal name is 4-((4-methoxyphenyl)diazenyl)-1H-pyrazole-3,5-diamine. It is a substance having a structure of the following chemical formula 2.

[0045] [Chemical Formula 2]

[0046]

[0047] In one specific example, the pharmaceutical composition comprising the ILK inhibitor may further comprise or be administered in combination with an expression or activity inhibitor of at least one selected from the group consisting of SMAD3 (Mothers Against Decapentaplegic Homolog 3), CFL1 (Cofilin-1), PDK3 (Pyruvate Dehydrogenase Kinase 3), PACSIN3 (Protein Kinase C and Casein Kinase Substrate in Neurons 3), and MEK1 (mitogen-activated protein kinase kinase 1).

[0048] The term "administration" as used herein means physically introducing a composition to a subject using any of a variety of methods and delivery systems known to those of ordinary skill in the art.

[0049] The term "combination administration" as used herein refers to treating or managing a disease by using two or more drugs or treatment methods simultaneously. The combination administration may be administered simultaneously, concurrently, sequentially, consecutively, alternately, or separately with the ILK expression or activity inhibitor and one or more expression or activity inhibitors selected from the group consisting of SMAD3, CFL1, PACSIN3, and MEK1.

[0050] Simultaneous administration includes administration at substantially the same time. This form of administration may also be referred to as "concomitant" administration. Concurrent administration includes administering the active agents within the same general period of time, for example, on the same day(s), but not necessarily at the same time. Alternate administration includes administering one agent for a specific period of time, for example, for several days or a week, followed by the other agent(s) for a subsequent period of time, for example, for several days or a week, and then repeating the pattern for one or more cycles. Sequential or sequential administration includes administering one agent for a first period of time (e.g., for several days or a week) using one or more doses, followed by the other agent(s) for a second and / or additional period of time (e.g., for several days or a week) using one or more doses. Overlapping schedules may also be used, which include administering the active agents on different days during the treatment period, but not necessarily in a regular order. For example, variations to these general guidelines may be used depending on the formulation used and the condition of the subject.

[0051] In one specific example, the expression inhibitor may be at least one selected from the group consisting of antisense nucleic acids, siRNA, shRNA, miRNA, and ribozymes that complementarily bind to any one or more DNAs or mRNAs selected from the group consisting of SMAD3 (Mothers Against Decapentaplegic Homolog 3), CFL1 (Cofilin-1), PDK3 (Pyruvate Dehydrogenase Kinase 3), PACSIN3 (Protein Kinase C and Casein Kinase Substrate in Neurons 3), and MEK1 (mitogen-activated protein kinase kinase 1). Specifically, the siRNA may be at least one selected from the group consisting of sequences of SEQ ID NOs: 5 to 24.

[0052] In one specific example, the activity inhibitor may be at least one selected from the group consisting of compounds, peptides, peptide mimetics, fusion proteins, antibodies, aptamers, and antibody-drug conjugates (ADCs) that specifically bind to at least one protein selected from the group consisting of SMAD3, CFL1, PDK3, PACSIN3, and MEK1.

[0053] The definitions of peripheral nerve tumor, malignant peripheral nerve schwannoma, inhibitor, antisense nucleic acid, siRNA, shRNA, miRNA, ribozyme, peptide, peptide mimetic, fusion protein, antibody, aptamer, and antibody-drug conjugate (ADC) are as described above.

[0054] In one specific example, the MEK1 inhibitor may be at least one selected from the group consisting of selumetinib, trametinib, pimasertib, mirdametinib, refametinib, AZD8330, and E6201.

[0055] The above selumetinib is a selective MEK1 / MEK2 kinase inhibitor, sold under the brand name Koselugo, and is a substance having a structure represented by the following chemical formula 3.

[0056] [Chemical Formula 3]

[0057]

[0058] The above trametinib is an orally active inhibitor that inhibits MEK1 / MEK2 and is a substance having a structure represented by the following chemical formula 4.

[0059] [Chemical Formula 4]

[0060]

[0061] The above-mentioned pimasertib is a selective ATP non-competitive allosteric oral MEK1 / MEK2 inhibitor, and is a substance having a structure represented by the following chemical formula 5.

[0062] [Chemical Formula 5]

[0063]

[0064] The above Mirdametinib is an orally active, selective and ATP non-competitive MEK inhibitor, and is a substance having a structure represented by the following chemical formula 6.

[0065] [Chemical Formula 6]

[0066]

[0067] The above-mentioned Refametinib is a selective, ATP non-competitive allosteric MEK1 / MEK2 inhibitor, and is a substance having a structure represented by the following chemical formula 7.

[0068] [Chemical Formula 7]

[0069]

[0070] The above AZD8330 (CAS number: 869357-68-6) is a MEK1 / MEK2 inhibitor and is a substance having a structure represented by the following chemical formula 8.

[0071] [Chemical Formula 8]

[0072]

[0073] The above E6201 (CAS number: 603987-35-5) is an ATP-competitive dual kinase inhibitor of MEK1 and FLT3, and is a substance having a structure represented by the following chemical formula 9.

[0074] [Chemical Formula 9]

[0075]

[0076] The pharmaceutical composition of the present invention may, for administration, contain a pharmaceutically acceptable carrier, excipient, or diluent in addition to the inhibitor described above. Examples of the carrier, excipient, and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0077] The pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injection solutions, according to conventional methods. Specifically, when formulating, it can be prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants that are commonly used. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, etc. Such solid preparations can be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc., in addition to the above-mentioned active ingredient. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. In addition to liquid paraffin for oral administration, various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives can be added to prepare the formulation. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspending agents can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases can include witepsol, macrosol, Tween 61, cacao butter, laurin butter, and glycerogelatin.

[0078] The pharmaceutical composition according to the present invention can be administered to a subject in need of prevention or treatment of malignant peripheral nerve fiber schwannoma by containing an effective amount of an inhibitor of ILK (Integrin-Linked Kinase) or its ligand.

[0079] The above effective amount may be a "therapeutically effective amount" or a "prophylactically effective amount." The "therapeutically effective amount" refers to any amount that, when the drug or therapeutic agent is used alone or in combination with other therapeutic agents, can exhibit a decrease in the severity of disease symptoms, an increase in the frequency and duration of disease symptom-free periods, or a prevention of damage or disability due to disease affliction. The "prophylactically effective amount" refers to any amount that inhibits the occurrence or recurrence of cancer in a subject. The level of the above effective amount may be determined based on factors such as the severity of the subject's condition, age, sex, activity of the drug, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field.

[0080] The above "subject" includes a human or any non-human animal, wherein the non-human animal may be a vertebrate, such as a primate, dog, cow, horse, pig, rodent, such as a mouse, rat, guinea pig, etc. In the present specification, the "subject" is used interchangeably with "individual" and "patient".

[0081]

[0082] Another aspect provides a kit for preventing or treating malignant peripheral nerve sheath tumor (MPNST) comprising an ILK inhibitor.

[0083] In one specific example, the kit may further comprise an expression or activity inhibitor of at least one selected from the group consisting of SMAD3 (Mothers Against Decapentaplegic Homolog 3), CFL1 (Cofilin-1), PDK3 (Pyruvate Dehydrogenase Kinase 3), PACSIN3 (Protein Kinase C and Casein Kinase Substrate in Neurons 3), and MEK1 (mitogen-activated protein kinase kinase 1).

[0084] The definitions of the above malignant peripheral nerve fiber neuropathy, inhibitors, antisense nucleic acids, siRNA, shRNA, miRNA, ribozymes, peptides, peptide mimetics, fusion proteins, antibodies, aptamers, and antibody-drug conjugates (ADCs) are as described above.

[0085] Another aspect provides the use of a composition comprising an inhibitor of the expression or activity of Integrin-Linked Kinase (ILK) for preventing or treating peripheral nerve tumors.

[0086] Another aspect provides a method for preventing or treating peripheral nerve tumors, comprising administering to a subject in need thereof a composition comprising an effective amount of an inhibitor of expression or activity of Integrin-Linked Kinase (ILK).

[0087] Another aspect provides the use of a composition comprising an inhibitor of the expression or activity of Integrin-Linked Kinase (ILK) for use in the manufacture of a medicament for the prevention or treatment of peripheral nerve tumors.

[0088] The terms and methods described for the above inventions apply equally to each invention.

[0089] A composition for preventing or treating peripheral nerve tumors containing an ILK inhibitor according to one aspect has a synergistic anticancer effect when administered in combination with a MEK inhibitor.

[0090] Figure 1 shows the results of confirming the protein expression levels of p-ERK1 / 2, ERK 1 / 2, p-SMAD3, SMAD3, and p-MEK1, which are major regulators of signal transduction pathways (TGF-β signal transduction pathway, RAS-MEK signal transduction pathway), and the protein levels of candidate kinases PDK3, ILK, PACSIN3, and CFL1, in ipNF95.6, a neurofibromatosis (PN) cell line, and sNF02.2 and sNF96.2, a malignant peripheral nerve sheath tumor (MPNST) cell lines.

[0091] Figure 2 is a graph showing the results of measuring the mRNA expression level of each therapeutic target gene (SMAD3, MEK1, CFL1, ILK, PDK3, PACSIN3) in a neurofibromatosis (PN) cell line (ipNF95.6) and a malignant peripheral nerve schwannoma (MPNST) cell line (sNF02.2, sNF96.2) treated with siRNA of each therapeutic target gene (SMAD3, MEK1, CFL1, ILK, PDK3, PACSIN3).

[0092] Figure 3 is a graph showing the results of measuring the cell viability of neurofibromatosis (PN) cell lines and malignant peripheral nerve sheath tumor (MPNST) cell lines treated with siRNA of target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1).

[0093] Figure 4 is a graph showing the results of measuring apoptosis activity in neurofibromatosis (PN) cell lines and malignant peripheral nerve sheath tumor (MPNST) cell lines treated with siRNA of target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1).

[0094] Figure 5 is a graph showing the results of measuring the cell viability of a cell line treated with siRNA for MEK1 / MAP2K1 alone (siMAP2K1_only) and a cell line treated with siRNA for one of the target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3) and MEK1 together.

[0095] Figure 6 is a graph showing the results of measuring apoptosis activity in a cell line treated with siRNA for MEK1 alone (siMAP2K1_only) and a cell line treated with siRNA for MEK1 and one of the target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3).

[0096] Figure 7 is a graph showing the results of measuring cell viability and apoptosis activity of neurofibromatosis (PN) cell lines (ipNF95.6) that overexpress each therapeutic target gene (SMAD3, ILK, PDK3, MEK1).

[0097] Figure 8 is a graph showing the results of measuring cell proliferation when therapeutic target genes (SMAD3, ILK, PDK3, MEK1) were overexpressed in a neurofibromatosis (PN) cell line (ipNF95.6).

[0098] Figure 9 is a graph showing the cell viability of normal Schwann cell line (ipn02.3), neurofibroma (PN) cell line (ipNF95.6), and malignant peripheral nerve sheath tumor (MPNST) cell lines (sNF02.2, sNF96.2) treated with ILK inhibitor (Cpd22, Sigma-Aldrich) and PDK3 inhibitor (AZD7545, AstraZeneca) at different concentrations, respectively.

[0099] Figure 10 is a graph showing the results of measuring cell viability in each group treated with a PDK3 inhibitor (AZD7545) or an ILK inhibitor (Cpd22) alone and in each group treated with a MEK inhibitor (Selumetinib) and a PDK3 inhibitor (AZD7545) or an ILK inhibitor (Cpd22) together in a normal schwann cell line (ipn02.3), a neurofibroma cell line (ipNF95.6), and a malignant peripheral nerve schwannoma (MPNST) cell line (sNF02.2, sNF96.2).

[0100] The present invention will be described in more detail through the following examples. However, these examples are provided for illustrative purposes only and the scope of the present invention is not limited to these examples.

[0101]

[0102] Example 1. Sample preparation and protein expression level confirmation

[0103] 1.1 Sample preparation (cell culture)

[0104] Neurofibromatosis (PN) and malignant peripheral nerve sheath tumor (MPNST) cell lines were prepared. ipNF95.6 was used as the neurofibromatosis (PN) cell line, and sNF02.2 and sNF96.2 were used as the MPNST cell lines.

[0105] Specifically, the cell line was cultured in a medium containing 10% Fetal Bovine Serum added to Dulbecco's Modified Eagle Medium. o C cultured in an incubator.

[0106] 1.2 Confirming protein expression levels

[0107] The protein expression of kinases and key regulators of the associated signaling pathways that showed significant differences in neurofibromatosis (PN) and malignant peripheral nerve sheath tumor (MPNST) cell lines was confirmed by Western blot.

[0108] Specifically, proteins were extracted from the cell line using RIPA buffer, and the proteins were electrophoresed on a 10.5% SDS-PAGE gel. After transferring the proteins to a nitrocellulose membrane, they were blocked with 5% BSA. The membrane was reacted with a primary antibody that recognizes a specific protein, washed, and then reacted with a secondary antibody conjugated to horseradish peroxidase, followed by washing. The protein amount was analyzed using an ECL reagent and a CHEMI-DOC imaging system.

[0109]

[0110] Example 2. Discovery of a new therapeutic target for malignant peripheral nerve sheath tumors (MPNSTs).

[0111] 2.1 Confirmation of protein expression levels of key regulators and kinases of the signal transduction system

[0112] Using the method of Example 1.2, the protein expression levels of key regulators of the TGF-β signaling pathway (pSMAD3, SMAD3) and the RAS-MEK signaling pathway (p-ERK1 / 2, ERK 1 / 2, and p-MEK1) and the protein levels of candidate kinases PDK3, ILK, PACSIN3, and CFL1 were confirmed in ipNF95.6, a neurofibromatosis (PN) cell line, and sNF02.2 and sNF96.2, a malignant peripheral neurite (MPNST) cell line, and the results are shown in Fig. 1.

[0113] Figure 1 shows the results of confirming the protein expression levels of p-ERK1 / 2, ERK 1 / 2, p-SMAD3, SMAD3, and p-MEK1, which are major regulators of signal transduction pathways (TGF-β signal transduction pathway, RAS-MEK signal transduction pathway), and the protein levels of candidate kinases PDK3, ILK, PACSIN3, and CFL1, in ipNF95.6, a neurofibromatosis (PN) cell line, and sNF02.2 and sNF96.2, a malignant peripheral neurite (MPNST) cell lines.

[0114] As shown in Fig. 1, among the major regulatory factors of the signal transduction system, p-ERK1 / 2, p-SMAD3, and p-MEK1 were expressed more in the malignant peripheral nerve sheath tumor (MPNST) cell lines sNF02.2 and sNF96.2 than in the neurofibromatosis (PN) cell line ipNF95.6, and it was confirmed that the expression level was higher in the sNF96.2 cell line than in the sNF02.2 cell line.

[0115] In addition, for candidate kinases CFL1, ILK, PDK3, and PACSIN3, the expression levels were increased in the malignant peripheral nerve sheath tumor (MPNST) cell lines sNF02.2 and sNF96.2 than in the neurofibromatosis (PN) cell line ipNF95.6, and it was confirmed that the expression levels were higher in the sNF96.2 cell line than in the sNF02.2 cell line.

[0116] This means that among the key regulators of the signal transduction pathway, p-ERK1 / 2, p-SMAD3, and p-MEK1 have significant differences in expression between neurofibromatosis (PN) and malignant peripheral nerve sheath tumor (MPNST) cell lines, suggesting that these regulators have the potential as new therapeutic targets for MPNST. In addition, the candidate kinases CFL1, ILK, PDK3, and PACSIN3 have significant differences in expression between neurofibromatosis (PN) and malignant peripheral nerve sheath tumor (MPNST) cell lines, suggesting that these regulators have the potential as new therapeutic targets for MPNST.

[0117]

[0118] 2.2. Identification of a new therapeutic target for malignant peripheral nerve sheath tumors (MPNSTs)

[0119] In order to evaluate the anticancer effects of SMAD3, MEK1, CFL1, ILK, PDK3, and PACSIN3, which are potential therapeutic targets for neurofibromas (PN) and malignant peripheral nerve sheath tumors (MPNST) discovered in Example 2.1, siRNAs for each therapeutic target gene were designed and knockdown experiments were conducted.

[0120] Specifically, siRNAs were designed for each therapeutic target gene and treated with each siRNA in ipNF95.6, a neurofibromatosis (PN) cell line, and sNF02.2 and sNF96.2, malignant peripheral nerve sheath tumor (MPNST) cell lines. The siRNA sequences for each therapeutic target gene are shown in Table 1.

[0121] 표적 유전자siRNA namesiRNA 서열(5'->3')서열번호ILKsiILK_1SGUCAUGGACACCGUGAUAUUGUACA1siILK_1AUACAAUAUCACGGUGUCCAUGAAU2siILK_2SGAAUCACUCUGGAGAGCUAUGGAA3siILK_2ACCAUAGCUCUCCAGAGUGAUUAU4CFL1siCFL1_2SCAUCAAGGUGUUCAACGACAUGAAG5siCFL1_2AUCAUGUCGUUGAACACCUUGAUAU6siCFL1_3SCAAGGACGCCAUCAAGAAGAAGCUG7siCFL1_3AGCUUCUUCUUGAUGGCGUCCUUAA8SMAD3siSMAD3_1SGAGAAACCAGUGACCACCAGAUGAA9siSMAD3_1ACAUCUGGUGGUCACUGGUUUCUAU10siSMAD3_2SGGAUGCAACCUGAAGAUCUUCAACA11siSMAD3_2AUUGAAGAUCUUCAGGUUGCAUCAU12PDK3siPDK3_1SGCAUCUCUUUCCGCAUGCUUAUUAA13siPDK3_1AAAUAAGCAUGCGGAAAGAGAUGAU14siPDK3_2SGUUGAAGAAUUCAAUGCCAAAGCGC15siPDK3_2AGCUUUGGCAUUGAAUUCUUCAAAU16PACSIN3siPACSIN3_1SGGUUGAGGCUUCCAAGAAAAGCUAC17siPACSIN3_1AAGCUUUUCUUGGAAGCCUCAACAU18siPACSIN3_2SCAGCAGUGAGAAGUUCCAUGAACU19siPACSIN3_2AUUCAUGGAACUUCUCACUGCUAU20MEK1 / MAP2K1siMEK1_1SGGUCAUGGCCAGAAAGCUAAUUCA21siMEK1_1AAAUUAGCUUUCUGGCCAUGACAU22siMEK1_2SGAUCAUAAGGGAGCUGCAGGUUCU23siMEK1_2AAACCUGCAGCUCCCUUAUGAUAU24

[0122]

[0123] The expression of the above target genes was reduced in neurofibromatosis (PN) cell lines (ipNF95.6) and MPNST cell lines (sNF02.2 and sNF96.2) treated with siRNA for each therapeutic target gene, using Reverse Transcription-Quantitative PCR.

[0124] Specifically, neurofibromatosis (PN) and MPNST cell lines were seeded in 6-well plates, and 50 pmol of siRNA designed for each target gene was delivered into the cells using Lipofectamine, followed by incubation for 72 hours. The cells were harvested, and RNA was extracted to confirm successful knockdown of target gene expression. RNA was extracted using TRIzol reagent, and cDNA was synthesized using oligo dT primers and reverse transcriptase enzyme. The synthesized cDNA was then amplified and analyzed using a quantitative PCR system using SYBR green reagent for specific genes.

[0125] The results showing that the expression of the target genes was reduced in the siRNA-treated neurofibromatosis (PN) cell line (ipNF95.6) and malignant peripheral nerve sheath tumor (MPNST) cell lines (sNF02.2 and sNF96.2) of Table 1 are shown in Figure 2.

[0126] Figure 2 is a graph showing the results of measuring the mRNA expression level of each therapeutic target gene (SMAD3, MEK1, CFL1, ILK, PDK3, PACSIN3) in a neurofibromatosis (PN) cell line (ipNF95.6) and a malignant peripheral nerve schwannoma (MPNST) cell line (sNF02.2, sNF96.2) treated with siRNA of each therapeutic target gene (SMAD3, MEK1, CFL1, ILK, PDK3, PACSIN3).

[0127] As shown in Figure 2, the mRNA expression level of each target gene was confirmed to be reduced in cell lines treated with siRNA for each target gene compared to the control group that was not treated with siRNA. This means that the siRNAs shown in Table 1 effectively inhibit the expression of each target gene.

[0128]

[0129] Example 3. Confirmation of anticancer effects of reducing the expression of candidate targets using the RNAi system in neurofibromatosis (PN) and malignant peripheral nerve sheath tumor (MPNST) cell lines.

[0130] 3.1 Confirmation of decreased cell viability

[0131] In accordance with the method of Example 2.2, siRNA for specific target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1) was treated to neurofibromatosis (PN) cell lines and malignant peripheral nerve sheath tumor (MPNST) cell lines, and after 72 hours, a CCK-8 assay was performed to measure cell survival.

[0132] Specifically, neurofibromatosis and MPNST cell lines were planted in a 96-well plate, treated with each siRNA, and 72 hours later, 10 ul of CCK-8 assay reagent from Dojindo laboratories was added to each well and incubated at 37 °C for 3 hours. o After reacting in a C incubator, the absorbance at 450 nm was measured using a microplate reader. Cell viability was analyzed by calculating the measured value.

[0133] The results of measuring the cell viability of cell lines treated with siRNA for the above target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1) are shown in Figure 3.

[0134] Figure 3 is a graph showing the results of measuring the cell viability of neurofibromatosis (PN) cell lines and malignant peripheral nerve sheath tumor (MPNST) cell lines treated with siRNA of target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1).

[0135] As shown in Fig. 3, the cell viability of neurofibroma (PN) cell lines and malignant peripheral schwannoma (MPNST) cell lines treated with siRNA against therapeutic target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1) decreased compared to the cell viability of the PN cell lines and MPNST cell lines (control) that were not treated with siRNA. Except for the case of siRNA against SMAD3, when siRNA against the remaining target genes was treated, the cell viability of the malignant peripheral schwannoma (MPNST) cell lines (sNF02.2, sNF96.2) decreased further compared to the neurofibroma (PN) cell line (ipNF95.6).

[0136] In addition, when siRNA for therapeutic target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1) was treated, it was confirmed that the cell viability of sNF96.2, a malignant peripheral nerve sheath tumor (MPNST) cell line with a more severe degree of malignancy, was further reduced compared to the neurofibromatosis (PN) cell line (ipNF95.6).

[0137] This means that when the expression of the selected therapeutic targets (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1 / MAP2K1) is inhibited by siRNA treatment, a statistically significant anticancer effect is observed in malignant peripheral nerve fiber schwannoma (MPNST) cell lines (sNF02.2, sNF96.2). In particular, it means that a more effective anticancer effect is observed in the more severely malignant sNF96.2 cell line.

[0138]

[0139] 3.2 Confirmation of increased apoptosis activity

[0140] Neurofibromatosis (PN) and malignant peripheral nerve sheath tumor (MPNST) cell lines were treated with siRNA for specific target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1) using the method of Example 2.2, and 72 hours later, a caspase 3 / 7 assay was performed to confirm the activity of apoptosis.

[0141] Specifically, neurofibromatosis and MPNST cell lines were seeded in opaque and white 96-well plates, treated with each siRNA, and 72 hours later, 50 μl of Promega's caspase 3 / 7-glo reagent was added to each well and incubated for 30 minutes. The level of caspase 3 / 7 was measured using a luminometer capable of detecting this fluorescent substance. Apoptosis activity was evaluated by calculating from the measured value.

[0142] The results of measuring the apoptosis activity of cell lines treated with siRNA of the above target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1) are shown in Figure 4.

[0143] Figure 4 is a graph showing the results of measuring apoptosis activity in neurofibromatosis (PN) cell lines and malignant peripheral nerve sheath tumor (MPNST) cell lines treated with siRNA of target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1).

[0144] As shown in Fig. 4, the apoptotic activity of neurofibroma (PN) cell lines and malignant peripheral schwannoma (MPNST) cell lines treated with siRNA for specific target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1) increased compared to the apoptotic activity of neurofibroma (PN) cell lines and malignant peripheral schwannoma (MPNST) cell lines (control) that were not treated with siRNA. Except for the case of treatment with siRNA for CFL1, when siRNA for the remaining target genes was treated, the apoptotic activity was further increased in the malignant peripheral schwannoma (MPNST) cell lines (sNF02.2, sNF96.2) compared to the neurofibroma (PN) cell line (ipNF95.6).

[0145] In addition, when siRNA for the above therapeutic target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1) was treated, it was confirmed that apoptosis activity was further increased in the sNF96.2 cell line, which is more malignant among the malignant peripheral nerve sheath tumor (MPNST) cell lines, compared to the neurofibromatosis (PN) cell line (ipNF95.6).

[0146] This means that when the expression levels of the above therapeutic target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1) are inhibited by siRNA treatment, a statistically significant anticancer effect is observed in malignant peripheral nerve sheath tumor (MPNST) cell lines (sNF02.2, sNF96.2). In particular, it means that a more effective anticancer effect is observed in the sNF96.2 cell line, which is a more severe malignancy among malignant peripheral nerve sheath tumor (MPNST) cell lines.

[0147]

[0148] Example 4. Confirmation of enhanced anticancer effect when combined with MEK inhibitors and inhibitors of selected candidate targets in malignant peripheral nerve sheath tumor (MPNST) cell lines.

[0149] 4.1 Confirmation of decreased cell viability

[0150] Neurofibromatosis (PN) cell lines and malignant peripheral nerve sheath tumor (MPNST) cell lines were treated with siRNA for therapeutic target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1), and 72 hours later, a CCK-8 assay capable of measuring cell survival was performed using the method of Example 3.1.

[0151] Specifically, siRNA for MEK1 was treated alone to knockdown (denoted as siMAP2K1_only), or siRNA for MEK1 and siRNA for the therapeutic target genes were treated together to knockdown both specific genes, and cell viability was measured, and the results are shown in Fig. 5.

[0152] Figure 5 is a graph showing the results of measuring the cell viability of a cell line treated with siRNA against MEK1 alone (siMAP2K1_only) and a cell line treated with siRNA against MEK1 and one of the therapeutic target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3).

[0153] As shown in Fig. 5, when siRNA against MEK1 was treated alone (siMAP2K1_only) in neurofibroma (PN) cell lines and malignant peripheral nerve sheath tumor (MPNST) cell lines, and when siRNA against MEK1 and one of the therapeutic target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3) were treated together, cell viability decreased compared to the neurofibroma (PN) cell lines and malignant peripheral nerve sheath tumor (MPNST) cell lines that were not treated with siRNA (control). In addition, when siRNA against MEK1 was treated alone (siMAP2K1_only) and when siRNA against MEK1 was treated together with any one of the therapeutic target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3), cell viability was further reduced in malignant peripheral nerve sheath tumor (MPNST) cell lines (sNF02.2 and sNF96.2) compared to the neurofibromatosis (PN) cell line (ipNF95.6).

[0154] Furthermore, compared to treatment with siRNA for MEK1 alone (siMAP2K1_only), it was confirmed that when siRNA for MEK1 and any one of the target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3) were treated together, the cell viability of all neurofibromatosis (PN) cell lines and malignant peripheral nerve sheath tumor (MPNST) cell lines decreased.

[0155] This means that when the expression of MEK inhibitors (selumetinib), a treatment for neurofibromatosis, and therapeutic target genes (SMAD3, CFL1, ILK, PDK3, or PACSIN3) are simultaneously inhibited, a synergistic anticancer effect is observed. In particular, when siRNA against MEK1 was treated together with any one of the therapeutic target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3), compared to when siRNA against MEK1 was treated alone (siMAP2K1_only), the cell viability of malignant peripheral nerve sheath tumor (MPNST) cell lines (sNF02.2 and sNF96.2) was significantly reduced compared to the neurofibromatosis (PN) cell line (ipNF95.6), which means that the combined administration of inhibitors of therapeutic target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3) and a MEK inhibitor (selumetinib) can be used as a treatment for malignant peripheral nerve sheath tumor (MPNST).

[0156]

[0157] 4.2 Confirmation of increased apoptosis activity

[0158] 72 hours after siRNA treatment for therapeutic target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3, MEK1) in neurofibromatosis (PN) cell lines and malignant peripheral nerve sheath tumor (MPNST) cell lines, a caspase 3 / 7 assay was performed to confirm apoptosis activity using the method of Example 3.2.

[0159] Specifically, siRNA against MEK1 was treated alone to knockdown (denoted as siMAP2K1_only), or siRNA against MEK1 and siRNA against each therapeutic target were treated together to knockdown both specific genes, and apoptosis activity was measured.

[0160] The results of measuring the apoptosis activity of a cell line treated with siRNA against MEK1 alone (siMAP2K1_only) and a cell line treated with siRNA against MEK1 and one of the therapeutic target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3) are shown in Figure 6.

[0161] Figure 6 is a graph showing the results of measuring apoptosis activity in a cell line treated with siRNA for MEK1 alone (siMAP2K1_only) and a cell line treated with siRNA for MEK1 and one of the target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3).

[0162] As shown in Fig. 6, when siRNA against MEK1 was treated alone (siMAP2K1_only) in neurofibroma (PN) cell lines and malignant peripheral nerve sheath tumor (MPNST) cell lines, and when siRNA against MEK1 and one of the therapeutic target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3) were treated together, apoptosis activity increased compared to the neurofibroma (PN) cell lines and malignant peripheral nerve sheath tumor (MPNST) cell lines that were not treated with siRNA (control).

[0163] Compared to treatment with siRNA against MEK1 alone (siMAP2K1_only), apoptosis activity was further increased in neurofibromatosis (PN) cell lines (ipNF95.6) when siRNA against MEK1 was co-treated with any one of the therapeutic target genes, CFL1, ILK, and PACSIN3.

[0164] Compared to treatment with siRNA against MEK1 alone (siMAP2K1_only), apoptosis activity was further increased in malignant peripheral nerve sheath tumor (MPNST) cell lines (sNF02.2) when siRNA against MEK1 / MAP2K1 was treated together with siRNA against SMAD3 or PACSIN3, among the therapeutic target genes.

[0165] Compared to treatment with siRNA for MEK1 alone (siMAP2K1_only), apoptosis activity was further increased in malignant peripheral nerve sheath tumor (MPNST) cell lines (sNF96.2) when siRNA for MEK1 and SMAD3 or ILK, among the therapeutic target genes, were treated together.

[0166] This suggests that a synergistic anticancer effect is observed when the expression of target genes (SMAD3, CFL1, ILK, PDK3, or PACSIN3) is simultaneously inhibited with a MEK inhibitor (selumetinib), a treatment for neurofibromatosis. Furthermore, this suggests that the combined administration of inhibitors of target genes (SMAD3, CFL1, ILK, PDK3, PACSIN3) and a MEK inhibitor (selumetinib) could be utilized as a treatment for malignant peripheral nerve sheath tumors (MPNSTs).

[0167]

[0168] Experimental Example 1. Confirmation of the effect of overexpression of SMAD3, ILK, PDK3, and MEK1 on tumor malignancy in neurofibromatosis (PN) cell line (ipNF95.6).

[0169] 1.1 Production of vectors in which each therapeutic target gene is cloned

[0170] Vectors were constructed to enable overexpression of each therapeutic target gene (SMAD3, ILK, PDK3, MEK1) in the neurofibromatosis (PN) cell line (ipNF95.6). Specifically, the coding regions of each of the SMAD3, ILK, PDK3, and MEK1 genes were cloned into a mammalian expression vector (pcDNA3.1), and the plasmids containing each gene were transfected into the neurofibromatosis (PN) cell line (ipNF95.6).

[0171] 1.2 Overexpression of each therapeutic target gene in neurofibromatosis (PN) cell line (ipNF95.6) and measurement of cell viability and apoptosis activity

[0172] After overexpressing each therapeutic target gene (SMAD3, ILK, PDK3, MEK1) in a neurofibromatosis (PN) cell line (ipNF95.6), cell viability and apoptosis activity were measured using the same method as in Example 3.

[0173] The results of measuring cell viability and apoptosis activity of neurofibromatosis (PN) cell lines (ipNF95.6) overexpressing each therapeutic target gene (SMAD3, ILK, PDK3, MEK1) are shown in Figure 7.

[0174] Figure 7 is a graph showing the results of measuring cell viability and apoptosis activity of neurofibromatosis (PN) cell lines (ipNF95.6) that overexpress each therapeutic target gene (SMAD3, ILK, PDK3, MEK1).

[0175] As shown in Figure 7, it was confirmed that the cell line overexpressing ILK among the therapeutic target genes (SMAD3, ILK, PDK3, MEK1) showed a statistically significant increase in cell viability, while apoptosis activity decreased, compared to the cell line (control) that did not overexpress ILK.

[0176] This suggests that ILK may be a therapeutic target for neurofibromatosis (PN), as it was confirmed that overexpression of ILK in the PN cell line (ipNF95.6) increased cell viability and decreased apoptosis activity.

[0177] 1.3 Measurement of cell proliferation rate according to cell culture time

[0178] One of the hallmarks of malignant transformation from neurofibromatosis (PN) to malignant peripheral nerve sheath tumor (MPNST) is increased cell proliferation. To assess the progression of MPNST after overexpression of therapeutic target genes (SMAD3, ILK, PDK3, and MEK1) in a neurofibromatosis (PN) cell line (ipNF95.6), cell proliferation was measured.

[0179] Specifically, the vectors cloning each therapeutic target gene (SMAD3, ILK, PDK3, MEK1) produced according to the method of Example 5.1 were transfected into the neurofibromatosis (PN) cell line (ipNF95.6), and the cell proliferation rate was measured according to the cell culture time.

[0180] Cell proliferation rate was determined by seeding neurofibromatosis and MPNST cell lines in 96-well plates, transfecting each cell line with a vector cloning each therapeutic target gene, and measuring the number of viable cells using CCK-8 reagent from Dojindo Laboratories according to the cell culture time. The measured value was used as the basis for analyzing the cell proliferation rate before cell culture.

[0181] The results of measuring cell proliferation when therapeutic target genes (SMAD3, ILK, PDK3, MEK1) were overexpressed in a neurofibromatosis (PN) cell line (ipNF95.6) are shown in Figure 8.

[0182] Figure 8 is a graph showing the results of measuring cell proliferation when therapeutic target genes (SMAD3, ILK, PDK3, MEK1) were overexpressed in a neurofibromatosis (PN) cell line (ipNF95.6).

[0183] As shown in Fig. 8, when any one of the genes ILK, MEK1, SMAD3, and PDK3 was overexpressed in a neurofibromatosis (PN) cell line (ipNF95.6), cell proliferation was confirmed to increase compared to the cell line (control) that did not overexpress the gene. This indicates that the ILK, MEK1, SMAD3, and PDK3 genes are related to the malignancy of neurofibromatosis (PN), implying that these genes can be therapeutic targets for neurofibromatosis (PN) and malignant peripheral nerve sheath tumors (MPNST).

[0184]

[0185] Experimental Example 2. Evaluation of the therapeutic potential of small molecules developed as ILK or PDK3 inhibitors in neurofibromatosis cell lines.

[0186] The cell viability was measured in normal Schwann cell line (ipn02.3), neurofibroma (PN) cell line (ipNF95.6), and malignant peripheral nerve sheath tumor (MPNST) cell lines (sNF02.2, sNF96.2) treated with MEK inhibitor (Selumetinib, AstraZeneca), ILK inhibitor (Cpd22, Sigma-Aldrich), and PDK3 inhibitor (AZD7545, AstraZeneca) at different concentrations, respectively, using the method of Example 3.1, and the results are shown in Fig. 9.

[0187] Figure 9 is a graph showing the cell viability of normal Schwann cell line (ipn02.3), neurofibroma (PN) cell line (ipNF95.6), and malignant peripheral nerve sheath tumor (MPNST) cell lines (sNF02.2, sNF96.2) treated with ILK inhibitor (Cpd22, Sigma-Aldrich) and PDK3 inhibitor (AZD7545, AstraZeneca) at different concentrations, respectively.

[0188] As shown in Fig. 9, when normal Schwann cell line (ipn02.3), neurofibroma (PN) cell line (ipNF95.6), and malignant peripheral schwannoma (MPNST) cell lines (sNF02.2, sNF96.2) were treated with MEK inhibitor (Selumetinib, AstraZeneca), ILK inhibitor (Cpd22), and PDK3 inhibitor (AZD7545) at different concentrations, it was confirmed that the cell viability of the neurofibroma (PN) cell line (ipNF95.6) and malignant peripheral schwannoma (MPNST) cell lines (sNF02.2, sNF96.2) decreased as the concentration of each inhibitor increased.

[0189] In particular, when the neurofibroma (PN) cell line (ipNF95.6) and malignant peripheral neuropathy (MPNST) cell lines (sNF02.2, sNF96.2) were treated with an ILK inhibitor (Cpd22) or a PDK3 inhibitor (AZD7545) at a concentration of 5 μM or 10 μM, it was confirmed that the cell viability of the neurofibroma (PN) cell line (ipNF95.6) and malignant peripheral neuropathy (MPNST) cell lines (sNF02.2, sNF96.2) was significantly reduced.

[0190] This means that MEK inhibitor (Selumetinib), which is currently being used as a treatment for neurofibromatosis (PN), as well as ILK inhibitor (Cpd22) and PDK3 inhibitor (AZD7545), have the potential to be used as new treatments for neurofibromatosis (PN) and malignant peripheral nerve sheath tumor (MPNST).

[0191]

[0192] Experimental Example 3. Confirmation of increased anticancer effect when co-administered with a small molecule compound, ILK inhibitor (Cpd22) or PDK3 inhibitor (AZD7545), and MEK inhibitor (Selumetinib).

[0193] The cell viability of normal schwann cell lines (ipn02.3), neurofibroma cell lines (ipNF95.6), and malignant peripheral schwannoma (MPNST) cell lines (sNF02.2, sNF96.2) was measured using the method of Example 3 when PDK3 inhibitor (AZD7545) or ILK inhibitor (Cpd22) was treated alone, and when MEK inhibitor (Selumetinib) and PDK3 inhibitor (AZD7545) or ILK inhibitor (Cpd22) were treated together.

[0194] Specifically, the cell viability of each group treated with 1 μM of PDK3 inhibitor (AZD7545) or 2 μM of ILK inhibitor (Cpd22) alone and each group treated with 1 μM of MEK inhibitor (Selumetinib) and 1 μM of PDK3 inhibitor (AZD7545) or 2 μM of ILK inhibitor (Cpd22) together was measured, and the results are shown in Fig. 10.

[0195] Figure 10 is a graph showing the results of measuring cell viability in each group treated with a PDK3 inhibitor (AZD7545) or an ILK inhibitor (Cpd22) alone and in each group treated with a MEK inhibitor (Selumetinib) and a PDK3 inhibitor (AZD7545) or an ILK inhibitor (Cpd22) together in a normal schwann cell line (ipn02.3), a neurofibroma cell line (ipNF95.6), and a malignant peripheral nerve schwannoma (MPNST) cell line (sNF02.2, sNF96.2).

[0196] As shown in Figure 10, when MEK inhibitor (Selumetinib) was treated alone in malignant peripheral nerve sheath tumor (MPNST) cell lines (sNF02.2, sNF96.2), no anticancer effect was observed, whereas when a new therapeutic target PDK3 inhibitor (AZD7545) or ILK inhibitor (Cpd22) was treated together with MEK inhibitor (Selumetinib), cell viability was confirmed to decrease.

[0197] This suggests that co-treatment with a PDK3 inhibitor (AZD7545) or an ILK inhibitor (Cpd22) and a MEK inhibitor (Selumetinib) has an anticancer effect on malignant peripheral nerve sheath tumors (MPNST). Furthermore, this suggests that PDK3 inhibitors and ILK inhibitors have high potential as new treatments for MPNST.

Claims

1. A pharmaceutical composition for preventing or treating peripheral nerve tumors, comprising an inhibitor of ILK (Integrin-Linked Kinase) expression or activity.

2. In claim 1, A pharmaceutical composition wherein the ILK expression inhibitor is at least one selected from the group consisting of antisense nucleic acid, siRNA, shRNA, miRNA, and ribozyme that complementarily bind to DNA or mRNA of ILK.

3. In claim 2, A pharmaceutical composition, wherein the siRNA is at least one selected from the group consisting of sequences of SEQ ID NOs: 1 to 4.

4. In claim 1, A pharmaceutical composition, wherein the ILK activity inhibitor is at least one selected from the group consisting of compounds, peptides, peptide mimetics, fusion proteins, antibodies, aptamers, and antibody-drug conjugates (ADCs) that specifically bind to the ILK protein.

5. In claim 1, A pharmaceutical composition wherein the ILK inhibitor is Cpd 22 or QLT-0267.

6. In claim 1, The pharmaceutical composition further comprises at least one expression or activity inhibitor selected from the group consisting of SMAD3 (Mothers Against Decapentaplegic Homolog 3), CFL1 (Cofilin-1), PDK3 (Pyruvate Dehydrogenase Kinase 3), PACSIN3 (Protein Kinase C and Casein Kinase Substrate in Neurons 3), and MEK1 (mitogen-activated protein kinase kinase 1).

7. A pharmaceutical composition according to claim 1, wherein the pharmaceutical composition is administered in combination with one or more expression or activity inhibitors selected from the group consisting of SMAD3, CFL1, PDK3, PACSIN3, and MEK1.

8. In claim 6, A pharmaceutical composition, wherein the expression inhibitor is at least one selected from the group consisting of antisense nucleic acids, siRNA, shRNA, miRNA, and ribozymes that complementarily bind to at least one DNA or mRNA selected from the group consisting of SMAD3, CFL1, PDK3, PACSIN3, and MEK1.

9. In claim 6, A pharmaceutical composition, wherein the above-mentioned active inhibitor is at least one selected from the group consisting of compounds, peptides, peptide mimetics, fusion proteins, antibodies, aptamers, and antibody-drug conjugates (ADCs) that specifically bind to at least one protein selected from the group consisting of SMAD3, CFL1, PDK3, PACSIN3, and MEK1.

10. In claim 6, A pharmaceutical composition, wherein the MEK1 inhibitor is at least one selected from the group consisting of selumetinib, trametinib, pimasertib, mirdametinib, refametinib, AZD8330, and E6201.

11. In claim 8, A pharmaceutical composition, wherein the siRNA is at least one selected from the group consisting of sequences of SEQ ID NOs: 5 to 24.

12. In claim 1, A pharmaceutical composition, wherein the peripheral nerve tumor is any one selected from the group consisting of neurofibroma, ganglioneuroma, ganglioneuroblastoma, neuroma, neurilemoma, neuroma, peripheral primitive neuroectodermal tumor (PNET), extra-adrenal paraganglioma, neurofibrosarcoma, extra-adrenal neurofibroma, neurofibromatosis type 1 (NF1), neurofibromatosis type 2 (NF2), plexiform neurofibroma (PN), and malignant peripheral nerve sheath tumor (MPNST).

13. In claim 12, A pharmaceutical composition, wherein the above malignant peripheral nerve sheath tumor (MPNST) is characterized by being caused by malignant transformation of plexiform neurofibroma (PN).

14. A kit for preventing or treating peripheral nerve tumors containing an inhibitor of ILK (Integrin-Linked Kinase) expression or activity.

15. In claim 14, The kit further comprises at least one expression or activity inhibitor selected from the group consisting of SMAD3 (Mothers Against Decapentaplegic Homolog 3), CFL1 (Cofilin-1), PDK3 (Pyruvate Dehydrogenase Kinase 3), PACSIN3 (Protein Kinase C and Casein Kinase Substrate in Neurons 3), and MEK1 (mitogen-activated protein kinase kinase 1).

16. Use of a composition comprising an inhibitor of the expression or activity of ILK (Integrin-Linked Kinase) for preventing or treating peripheral nerve tumor.

17. A method for preventing or treating peripheral nerve tumor, comprising administering to a subject in need thereof a composition containing an effective amount of an inhibitor of expression or activity of ILK (Integrin-Linked Kinase).

18. Use of a composition comprising an inhibitor of the expression or activity of ILK (Integrin-Linked Kinase) for use in the manufacture of a medicament for the prevention or treatment of peripheral nerve tumors.

Images