Method for detecting target nucleic acid using three probes

Abstract

The present disclosure relates to a composition for detecting a target nucleic acid, the composition comprising three probes, and to a method for detecting a target nucleic acid using same. According to the present disclosure, when a target nucleic acid is present, the three probes form a plurality of hybrids having different Tm values, and thus, the composition for detecting a target nucleic acid according to the present disclosure enables detection of a single target nucleic acid as well as enabling detection of a plurality of target nucleic acids by using a single type of label.

Description

Method for detecting target nucleic acid using three probes

[0001] Cross-reference to related applications

[0002] This application claims the benefit of Republic of Korea Patent Application No. 10-2023-0119778, filed September 8, 2023 with the Korean Intellectual Property Office, the disclosure of which is incorporated herein by reference in its entirety.

[0003] Technology field

[0004] The present disclosure relates to a composition for detecting a target nucleic acid comprising three probes and a method for detecting a target nucleic acid using the same.

[0005] Real-time detection methods are widely used to detect target nucleic acids, allowing for real-time monitoring of target amplification. Real-time detection methods typically utilize labeled probes or primers that specifically hybridize with the target nucleic acid.

[0006] Examples of methods utilizing hybridization between labeled probes and target nucleic acids include the molecular beacon method (Tyagi et al., Nature Biotechnology v. 14 MARCH 1996) using dual-labeled probes with hairpin structures, the HyBeacon method (French DJ et al., Mol. Cell Probes, 15(6):363-374(2001)), the hybridization probe method using two probes, each labeled as a donor and an acceptor (Bernad et al., 147-148 Clin Chem 2000; 46), and the Lux method (U.S. Pat. No. 7,537,886) using single-labeled oligonucleotides. The TaqMan method (U.S. Patent Nos. 5,210,015 and 5,538,848) utilizing a double-labeled probe and cleavage of the probe by the 5'-nuclease activity of DNA polymerase is widely used in the art.

[0007] Examples of methods utilizing labeled primers include the Sunrise primer method (Nazarenko et al., 2516-2521 Nucleic Acids Research, 1997, v.25 no.12, and U.S. Pat. No. 6,117,635), the Scorpion primer method (Whitcombe et al., 804-807, Nature Biotechnology v.17 AUGUST 1999, and U.S. Pat. No. 6,326,145), and the TSG primer method (WO 2011-078441).

[0008] Since the conventional real-time detection technologies described above can detect only one target nucleic acid using one label, the number of target nucleic acids that can be detected simultaneously in one reaction is limited by the number of available labels (e.g., 5 or less).

[0009] Therefore, there is a need for the development of a novel method or approach that can detect multiple target nucleic acids in real time using a single type of label, as well as a single target nucleic acid in real time.

[0010] Numerous references and patents are cited and cited throughout this specification. The disclosures of these references and patents are incorporated herein by reference in their entirety to further clarify the state of the art and the scope of the present invention.

[0011] The present inventors have diligently researched and strived to develop a novel method for detecting target nucleic acids in real time with improved convenience and high efficiency. In particular, they have endeavored to develop a method capable of detecting multiple target nucleic acid sequences using a single type of label. As a result, a novel protocol for detecting target nucleic acids has been established using a reporter probe comprising a nucleotide sequence that hybridizes to a first region of a target nucleic acid and a reporter molecule linked thereto, a first quencher probe comprising a nucleotide sequence that hybridizes to the reporter probe and a first quencher molecule linked thereto, and a second quencher probe comprising a nucleotide sequence that hybridizes to a second region of the target nucleic acid and a second quencher molecule linked thereto. The protocol according to the present disclosure can detect not only a single target nucleic acid but also multiple target nucleic acids.

[0012] Accordingly, an object of the present disclosure is to provide a composition for detecting a target nucleic acid comprising three probes.

[0013] Another object of the present disclosure is to provide a method for detecting a target nucleic acid in a sample using three probes.

[0014] Another object of the present disclosure is to provide a method for detecting n target nucleic acids in a sample.

[0015] Other objects and advantages of the present disclosure will become more apparent from the detailed description below taken together with the appended claims.

[0016] According to one aspect of the present disclosure, a composition for detecting a target nucleic acid is provided, comprising:

[0017] (a) reporter probe;

[0018] The reporter probe comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid,

[0019] The reporter probe has a reporter molecule linked thereto;

[0020] (b) first quencher probe;

[0021] The first quencher probe comprises a nucleotide sequence that hybridizes to the reporter probe,

[0022] The first quencher probe has a first quencher molecule connected thereto,

[0023] When a first hybrid is formed between the reporter probe and the first quencher probe, the first quencher molecule is at a position to quench a signal from the reporter probe; and

[0024] (c) second quencher probe;

[0025] The second quencher probe comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid,

[0026] The second quencher probe has a second quencher molecule connected thereto,

[0027] The first region and the second region of the target nucleic acid are adjacent to each other,

[0028] When both a second hybridization between the reporter probe and the first region of the target nucleic acid and a third hybridization between the second quencher probe and the second region of the target nucleic acid are formed, the second quencher molecule is at a position to quench a signal from the reporter molecule, and

[0029] The first hybrid compound has a melting temperature (Tm) that is different from the Tm of the second hybrid compound and the Tm of the third hybrid compound.

[0030] According to one embodiment of the present disclosure, when the target nucleic acid is present, formation of the second hybrid is superior to formation of the first hybrid.

[0031] According to one embodiment of the present disclosure, the length of the first quencher probe is 1 to 30 nucleotides shorter than the length of the reporter probe.

[0032] According to one embodiment of the present disclosure, the second quencher molecule is positioned immediately adjacent to the reporter molecule or is positioned within 1 to 4 nucleotides from the reporter molecule.

[0033] According to one embodiment of the present disclosure, when the first region of the target nucleic acid is located 5'-upstream of the second region of the target nucleic acid, the reporter molecule is located at the 5'-terminal portion of the reporter probe, and the second quencher molecule is located at the 3'-terminal portion of the second quencher probe.

[0034] According to one embodiment of the present disclosure, when the second region of the target nucleic acid is located 5'-upstream of the first region of the target nucleic acid, the reporter molecule is located at the 3'-terminal portion of the reporter probe, and the second quencher molecule is located at the 5'-terminal portion of the second quencher probe.

[0035] According to one embodiment of the present disclosure, the first quencher molecule and the second quencher molecule are of the same type.

[0036] According to one embodiment of the present disclosure, the composition for detecting a target nucleic acid provides a signal dependent on the presence of the target nucleic acid.

[0037] According to one embodiment of the present disclosure, the signal is provided at a temperature at which one of the second hybrid and the third hybrid maintains its double-stranded state and the other dissociates into a single strand.

[0038] According to one embodiment of the present disclosure, the temperature is dependent on the Tms of the first hybrid, the second hybrid and the third hybrid.

[0039] According to one embodiment of the present disclosure, the composition for detecting a target nucleic acid has a signal-changing temperature range (SChTR) in which a signal changes depending on the presence of a target nucleic acid in an amplification reaction for the target nucleic acid, and two signal-constant temperature ranges (SCoTRs) in which the signal remains constant even when the target nucleic acid is present.

[0040] According to one embodiment of the present disclosure, the signal-change temperature range is higher than a first signal-constant temperature range among the two signal-constant temperature ranges and lower than a second signal-constant temperature range among the two signal-constant temperature ranges.

[0041] According to one embodiment of the present disclosure, in the presence of the target nucleic acid, the second hybrid and the third hybrid maintain their double-stranded state at a temperature within the first signal-constant temperature range.

[0042] According to one embodiment of the present disclosure, in the presence of the target nucleic acid, the second hybrid and the third hybrid are dissociated into single strands at a temperature within the second signal-constant temperature range.

[0043] According to one embodiment of the present disclosure, in the presence of the target nucleic acid, at a temperature within the signal-change temperature range, one of the second hybrid and the third hybrid maintains its double-stranded state, and the other dissociates into two single-stranded molecules.

[0044] According to another aspect of the present disclosure, a method for detecting a target nucleic acid in a sample is provided, comprising:

[0045] (a) a step of incubating a target nucleic acid detection composition comprising a reporter probe, a first quencher probe, and a second quencher probe with the target nucleic acid;

[0046] The reporter probe comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid,

[0047] The above reporter probe has a reporter molecule linked to it,

[0048] The first quencher probe comprises a nucleotide sequence that hybridizes to the reporter probe,

[0049] The first quencher probe has a first quencher molecule connected thereto,

[0050] When a first hybrid is formed between the reporter probe and the first quencher probe, the first quencher molecule is at a position to quench a signal from the reporter probe,

[0051] The second quencher probe comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid,

[0052] The second quencher probe has a second quencher molecule connected thereto,

[0053] The first region and the second region of the target nucleic acid are adjacent to each other,

[0054] When both a second hybridization between the reporter probe and the first region of the target nucleic acid and a third hybridization between the second quencher probe and the second region of the target nucleic acid are formed, the second quencher molecule is at a position to quench a signal from the reporter molecule,

[0055] The first hybrid has a melting temperature (Tm) different from the Tm of the second hybrid and the Tm of the third hybrid;

[0056] (b) a step of measuring the signal; and

[0057] (c) A step of determining the presence of the target nucleic acid from the signal measured in the above step (b).

[0058] According to one embodiment of the present disclosure, the incubation comprises a nucleic acid amplification reaction.

[0059] According to one embodiment of the present disclosure, the signal is measured at a temperature at which one of the second hybrid and the third hybrid maintains its double-stranded state and the other dissociates into a single strand.

[0060] According to one embodiment of the present disclosure, the temperature is dependent on the Tms of the first hybrid, the second hybrid and the third hybrid.

[0061] According to one embodiment of the present disclosure, when the target nucleic acid is present, formation of the second hybrid is superior to formation of the first hybrid.

[0062] According to one embodiment of the present disclosure, the first quencher molecule and the second quencher molecule are of the same type.

[0063] According to another aspect of the present disclosure, a method for detecting n target nucleic acids in a sample is provided, comprising:

[0064] (a) a step of incubating a sample suspected of containing one or more of the n target nucleic acids with n target nucleic acid detection compositions in one reaction vessel, and measuring a signal at n detection temperatures;

[0065] The above n is an integer greater than or equal to 2,

[0066] The above incubation comprises multiple reaction cycles, and the measurement of the signal is performed in one or more of the multiple reaction cycles,

[0067] Each of the above n target nucleic acid detection compositions provides a change in a signal indicating the presence of the corresponding target nucleic acid at a corresponding detection temperature among the above n detection temperatures in the presence of the corresponding target nucleic acid,

[0068] Among the above n target nucleic acid detection compositions, the i target nucleic acid detection composition provides a change in a signal indicating the presence of the i target nucleic acid at the i detection temperature among the n detection temperatures in the presence of the i target nucleic acid, and provides a constant signal at other detection temperatures.

[0069] The above i represents an integer from 1 to n, and the i-th detection temperature is lower than the i+1-th detection temperature.

[0070] Within the temperature range including all of the above n detection temperatures, the composition for detecting the i-th target nucleic acid has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the i-th target nucleic acid and one or two signal-constant temperature ranges (SCoTR) in which the signal is constant even when the i-th target nucleic acid is present.

[0071] The composition for detecting the above target nucleic acid is,

[0072] (i) an UnderSC-type composition having a melting characteristic in which the signal-change temperature range is lower than the signal-constant temperature range;

[0073] (ii) an InterSC-type composition having a melting property in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges, and

[0074] (iii) any one of the OverSC-type compositions having a melting characteristic in the signal-change temperature range higher than the signal-constant temperature range;

[0075] At least one of the above n target nucleic acid detection compositions is a composition comprising the above-described reporter probe, the first quencher probe, and the second quencher probe, and;

[0076] (b) A step of determining the presence of n target nucleic acids from the signals measured in the above step (a), wherein the step of determining the presence of the i-th target nucleic acid is based on the signal measured at the i-th detection temperature.

[0077] The features and advantages of the present disclosure are summarized as follows:

[0078] (a) A first feature of the present disclosure is that one reporter probe and two quencher probes are used to detect a target nucleic acid. The one reporter probe and two quencher probes can form three hybrids when a target nucleic acid is present, specifically, a first hybrid between the reporter probe and the first quencher probe, a second hybrid between the reporter probe and the target nucleic acid, and a third hybrid between the second quencher probe and the target nucleic acid.

[0079] (b) The second feature of the present disclosure is that the Tm of the first hybrid is different from the Tm of the second hybrid and the third hybrid. Due to this feature, the composition for detecting a target nucleic acid according to the present disclosure has a signal-changing temperature range in which the signal changes depending on the presence of the target nucleic acid, and two signal-constant temperature ranges in which the signal is constant even when the target nucleic acid is present. In other words, the composition for detecting a target nucleic acid and the method for detecting a target nucleic acid according to the present disclosure can be used as an InterSC-type composition and an InterSC-type signal generating method.

[0080] (c) Due to the aforementioned features, the composition for detecting a target nucleic acid according to the present disclosure not only enables the detection of a single target nucleic acid, but also enables the detection of multiple target nucleic acids using a single type of label. In particular, it has the advantage of dramatically reducing the analysis time compared to conventional techniques that require melting analysis after target amplification to detect multiple target nucleic acids using a single type of label.

[0081] Figure 1 shows conformational changes of a reporter probe, a first quencher probe, and a second quencher probe in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range, in the absence of a target nucleic acid or before a reaction between a composition for detecting a target nucleic acid according to the present disclosure and the target nucleic acid. Here, the Tm1 of the first hybridization between the reporter probe and the first quencher probe is lower than the Tm2 of the second hybridization between the reporter probe and the first region of the target nucleic acid and the Tm3 of the third hybridization between the second quencher probe and the second region of the target nucleic acid.

[0082] FIG. 2 shows conformational changes of a reporter probe, a first quencher probe, and a second quencher probe after a reaction between a composition for detecting a target nucleic acid according to the present disclosure and a target nucleic acid in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range. Here, the Tm1 of the first hybridization between the reporter probe and the first quencher probe is lower than the Tm2 of the second hybridization between the reporter probe and the first region of the target nucleic acid and the Tm3 of the third hybridization between the second quencher probe and the second region of the target nucleic acid.

[0083] FIG. 3 shows the content ratio and melt curve of the reaction product between the target nucleic acid detection composition according to the present disclosure and the target nucleic acid. Specifically, FIG. 3A shows the content ratio (or abundance ratio) of the first hybrid and the second hybrid (or the third hybrid) and their melt curves in the initial cycle, middle cycle, and late cycle of the target nucleic acid amplification reaction using the target nucleic acid detection composition according to the present disclosure. FIG. 3B shows a plot in which the three melt curves of FIG. 3A are merged. Here, the Tm1 of the first hybrid between the reporter probe and the first quencher probe is lower than the Tm2 of the second hybrid between the reporter probe and the first region of the target nucleic acid and the Tm3 of the third hybrid between the second quencher probe and the second region of the target nucleic acid.

[0084] FIG. 4 shows conformational changes of a reporter probe, a first quencher probe, and a second quencher probe in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range, in the absence of a target nucleic acid or before a reaction between a composition for detecting a target nucleic acid according to the present disclosure and the target nucleic acid. Here, the Tm1 of the first hybridization between the reporter probe and the first quencher probe is lower than the Tm2 of the second hybridization between the reporter probe and the first region of the target nucleic acid and higher than the Tm3 of the third hybridization between the second quencher probe and the second region of the target nucleic acid.

[0085] FIG. 5 shows conformational changes of a reporter probe, a first quencher probe, and a second quencher probe after a reaction between a composition for detecting a target nucleic acid according to the present disclosure and a target nucleic acid in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range. Here, the Tm1 of the first hybridization between the reporter probe and the first quencher probe is lower than the Tm2 of the second hybridization between the reporter probe and the first region of the target nucleic acid and higher than the Tm3 of the third hybridization between the second quencher probe and the second region of the target nucleic acid.

[0086] FIG. 6 shows the content ratio and melt curve of the reaction product between the target nucleic acid detection composition according to the present disclosure and the target nucleic acid. Specifically, FIG. 6A shows the content ratio (or abundance ratio) of the first hybrid and the second hybrid (or the third hybrid) and their melt curves in the initial cycle, middle cycle, and final cycle of the target nucleic acid amplification reaction using the target nucleic acid detection composition according to the present disclosure. FIG. 6B shows a plot in which the three melt curves of FIG. 6A are merged. Here, the Tm1 of the first hybrid between the reporter probe and the first quencher probe is lower than the Tm2 of the second hybrid between the reporter probe and the first region of the target nucleic acid, and is higher than the Tm3 of the third hybrid between the second quencher probe and the second region of the target nucleic acid.

[0087] Figure 7 shows the real-time PCR results in Example 1.

[0088] Figure 8 shows the real-time PCR results in Example 2.

[0089] Figure 9 shows the conformational changes of the reporter probe, the first quencher probe, and the second quencher probe of each of the two compositions used in Example 3, depending on the presence or absence of the corresponding target nucleic acid and the temperature.

[0090] Figure 10 shows the multiplex real-time PCR results in Example 3.

[0091] The present inventors have diligently researched and endeavored to develop a novel method for detecting target nucleic acids in real time with improved convenience and high efficiency. In particular, they have endeavored to develop a method capable of detecting multiple target nucleic acid sequences using a single type of label. As a result, a novel protocol for detecting target nucleic acids has been established using a reporter probe having a reporter molecule linked to a nucleotide sequence that hybridizes to a first region of a target nucleic acid, a first quencher probe having a nucleotide sequence that hybridizes to the reporter probe and a first quencher molecule linked thereto, and a second quencher probe having a nucleotide sequence that hybridizes to a second region of the target nucleic acid and a second quencher molecule linked thereto. The protocol according to the present disclosure can detect not only a single target nucleic acid but also multiple target nucleic acids.

[0092] I. Composition for detecting target nucleic acid

[0093] In one aspect, the present disclosure provides a composition for detecting a target nucleic acid, comprising:

[0094] (a) reporter probe;

[0095] The reporter probe comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid,

[0096] The reporter probe has a reporter molecule linked thereto;

[0097] (b) first quencher probe;

[0098] The first quencher probe comprises a nucleotide sequence that hybridizes to the reporter probe,

[0099] The first quencher probe has a first quencher molecule connected thereto,

[0100] When a first hybrid is formed between the reporter probe and the first quencher probe, the first quencher molecule is at a position to quench a signal from the reporter probe; and

[0101] (c) second quencher probe;

[0102] The second quencher probe comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid,

[0103] The second quencher probe has a second quencher molecule connected thereto,

[0104] The first region and the second region of the target nucleic acid are adjacent to each other,

[0105] When both a second hybridization between the reporter probe and the first region of the target nucleic acid and a third hybridization between the second quencher probe and the second region of the target nucleic acid are formed, the second quencher molecule is at a position to quench a signal from the reporter molecule,

[0106] The first hybrid compound has a melting temperature (Tm) that is different from the Tm of the second hybrid compound and the Tm of the third hybrid compound.

[0107] In describing the components of the present disclosure, terms such as first, second, A, B, (a), (b), (i), (ii), etc. may be used. These terms are only intended to distinguish the components from other components, and the nature, order, or sequence of the components are not limited by the terms.

[0108] Hereinafter, the present invention will be described in detail as follows:

[0109] The composition for detecting a target nucleic acid of the present disclosure comprises one reporter probe and two quencher probes. The reporter probe comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid and has a reporter molecule linked thereto; the first quencher probe comprises a nucleotide sequence that hybridizes to the reporter probe and has a first quencher molecule linked thereto; and the second quencher probe comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid and has a second quencher molecule linked thereto.

[0110] The terms “target nucleic acid,” “target nucleic acid sequence,” or “target sequence,” as used herein, mean a nucleic acid sequence to be detected, which anneals or hybridizes with a probe or primer under hybridization, annealing, or amplification conditions.

[0111] The target nucleic acid sequence includes both double-stranded and single-stranded nucleic acid sequences. The target nucleic acid sequence includes sequences initially present in the nucleic acid sample as well as sequences newly generated in the reaction.

[0112] The target nucleic acid includes all DNA (gDNA and cDNA), RNA molecules, and hybrids thereof (chimeric nucleic acids). The sequence may be double-stranded or single-stranded.

[0113] The target nucleic acid includes any naturally occurring prokaryotic nucleic acid, eukaryotic nucleic acid (e.g., protozoa and parasites, fungi, yeast, higher plants, lower animals, and higher animals including mammals and humans), viral nucleic acid (e.g., herpes virus, HIV, influenza virus, Epstein-Barr virus, hepatitis virus, poliovirus, etc.), or viroid nucleic acid. Furthermore, the target nucleic acid may be any nucleic acid molecule that is or can be produced recombinantly, or any nucleic acid molecule that is or can be synthesized chemically. Accordingly, the target nucleic acid may or may not be found in nature. The target nucleic acid may include a known or unknown sequence.

[0114] In one embodiment, the target nucleic acid may comprise a nucleotide variation.

[0115] The term "nucleotide variation" as used herein may refer to a substitution, deletion, or insertion of a single or multiple nucleotides in a DNA sequence at a specific location in a continuous DNA segment. These continuous DNA segments may comprise a gene or some other portion of a chromosome. Such nucleotide variations may be mutations or polymorphic allelic variations. For example, the nucleotide variations detected in the present disclosure include single nucleotide polymorphisms (SNPs), mutations, deletions, insertions, substitutions, and translocations. Examples of nucleotide variations include various variations in the human genome (e.g., variations in the methylenetetrahydrofolate reductase (MTHFR) gene), variations associated with drug resistance in pathogens, and mutations that cause tumorigenesis. The term nucleotide variation as used herein includes all variations at a specific position of a nucleic acid sequence. That is, the term nucleotide variation includes the wild type and all mutant forms thereof at a specific position of a nucleic acid sequence.

[0116] The term "sample" as used herein means a cell, tissue, or fluid from a biological source, or any other medium that can be beneficially evaluated according to the present disclosure, and includes viruses, bacteria, tissues, cells, blood, serum, plasma, lymph, milk, urine, feces, ocular fluid, saliva, semen, brain extracts, spinal fluid, appendix, spleen, and tonsil tissue extracts, amniotic fluid, ascites, and non-biological samples (e.g., food and water). The sample also includes natural-occurring nucleic acid molecules isolated from a biological source, and synthetic nucleic acid molecules.

[0117] The term "primer," as used herein, refers to an oligonucleotide capable of acting as an initiator of synthesis when the conditions that induce the synthesis of a primer extension product complementary to a nucleic acid strand (template) are present: the presence of nucleotides and a polymerization agent, such as DNA polymerase, and an appropriate temperature and pH. The primer must be sufficiently long to prime the synthesis of the extension product in the presence of the polymerization agent. The exact length of the primer will vary depending on many factors, including temperature, application, and the source of the primer.

[0118] The term "probe" as used herein refers to a single-stranded nucleic acid molecule comprising a hybridization site(s) for a target nucleic acid sequence.

[0119] In particular, the probe and primer are single-stranded deoxyribonucleotide molecules. The probe or primer used in the present disclosure may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides. The probe or primer may also include ribonucleotides.

[0120] The term "annealing" or "priming" as used herein means the juxtaposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, which causes a polymerase to polymerize the nucleotides to produce a nucleic acid molecule complementary to the template nucleic acid or a portion thereof.

[0121] The terms "hybridize," "hybridizing," or "hybridization," as used herein, refer to the formation of a double strand by non-covalent association between two complementary single-stranded polynucleotides under specific hybridization conditions or stringent conditions. Hybridization can occur when the complementarity between the two nucleic acid strands is perfect (a perfect match), or even when some bases mismatches are present. The degree of complementarity required for hybridization can vary depending on the hybridization conditions, and can be controlled, in particular, by temperature.

[0122] Hybridization herein can be performed under suitable hybridization conditions, which are generally determined by optimization procedures. Conditions such as temperature, concentration of components, number of hybridization and washing cycles, buffer components, and their pH and ionic strength may vary depending on various factors, including the length and GC content of the oligonucleotides (primers and probes) and the target nucleotide sequence. For example, when using relatively short oligonucleotides, it is preferable to select low stringency conditions. Detailed conditions for hybridization can be found in Joseph Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and M. L. M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc., NY (1999).

[0123] The terms “annealing” and “hybridization” are not different and are used interchangeably in this specification.

[0124] The expression herein that an oligonucleotide (e.g., a reporter probe or a second quencher probe) "comprises a nucleotide sequence that hybridizes" to another oligonucleotide (e.g., a target nucleic acid) means that all or part of the sequence of said oligonucleotide comprises a complementary nucleotide sequence necessary for hybridization with all or part of the sequence of the other oligonucleotide. Furthermore, when referring to hybridization between a portion within an oligonucleotide and another oligonucleotide herein, the portion may be regarded as a separate oligonucleotide and hybridization between the other oligonucleotides may be expressed.

[0125] The term "complementary" as used herein means sufficiently complementary to allow a primer or probe to selectively hybridize to a target nucleic acid under certain annealing conditions or stringent conditions, and includes both "substantially complementary" and "perfectly complementary," specifically, perfectly complementary.

[0126] In contrast, the term "non-complementary" as used herein means sufficiently non-complementary that a primer or probe does not selectively hybridize to a specific sequence under given annealing or stringent conditions, and has a meaning encompassing both "substantially non-complementary" and "perfectly non-complementary," specifically, perfectly non-complementary.

[0127] A reporter probe according to the present disclosure has a reporter molecule linked thereto and comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid.

[0128] A first quencher probe according to the present disclosure has a first quencher molecule linked thereto and includes a nucleotide sequence that hybridizes to the reporter probe. The first quencher probe can hybridize to the reporter probe to form a first hybrid product.

[0129] In one embodiment, when the first quencher probe hybridizes to the reporter probe, the first quencher molecule of the first quencher probe is positioned close to the reporter molecule of the reporter probe such that the first quencher molecule quenches a signal from the reporter molecule. Thus, when the first quencher probe hybridizes to the reporter probe to form a first hybrid, the first quencher molecule quenches a signal from the reporter molecule, and when the first hybrid dissociates into two single strands, the first quencher molecule unquenchs a signal from the reporter.

[0130] In one embodiment, the reporter probe and the first quencher probe have different lengths. For example, the length of the first quencher probe is shorter than the length of the reporter probe. Specifically, the length of the first quencher probe is 1 to 30 nucleotides, 1 to 25 nucleotides, 1 to 20 nucleotides, 1 to 15 nucleotides, 1 to 10 nucleotides, 2 to 30 nucleotides, 2 to 25 nucleotides, 2 to 20 nucleotides, 2 to 15 nucleotides, 2 to 10 nucleotides, 3 to 30 nucleotides, 3 to 25 nucleotides, 3 to 20 nucleotides, 3 to 15 nucleotides, 3 to 10 nucleotides, 2 to 7 nucleotides, or 1 to 5 nucleotides shorter than the length of the reporter probe.

[0131] In one embodiment, the first quencher probe has a base that is non-complementary to the base on the reporter probe or has a universal base. In this way, including a non-complementary base or a universal base on the first quencher probe can cause the Tm of the first hybrid to be lower than the Tm of the second hybrid, even when the first quencher probe has the same or a longer length than the reporter probe. For example, the first quencher probe can have one to five non-complementary bases or universal bases. In one embodiment, the universal base is deoxyinosine, inosine, 7-diaza-2'-deoxyinosine, 2-aza-2'-deoxyinosine, 2'-OMe inosine, 2'-F inosine, deoxy 3-nitropyrrole, 3-nitropyrrole, 2'-OMe 3-nitropyrrole, 2'-F 3-nitropyrrole, 1-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole, deoxy 5-nitropyrrole, 5-nitroindole, 2'-OMe 5-nitroindole, 2'-F 5-nitroindole, deoxy 4-nitrobenzimidazole, 4-nitrobenzimidazole, deoxy 4-aminobenzimidazole, 4-aminobenzimidazole, deoxy Nebularine, 2'-F nebularine, 2'-F 4-nitrobenzimidazole, PNA-5-introindole, PNA-nebularine, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrole, morpholino-5-nitroindole, morpholino-nebularine, morpholino-inosine, morpholino-4-nitrobenzimidazole, morpholino-3-nitropyrrole, phosphoramidate-5-nitroindole, phosphoramidate-nebularine, phosphoramidate-inosine, phosphoramidate-4-nitrobenzimidazole, phosphoramidate-3-nitropyrrole, 2'-O-methoxyethyl inosine, 2'-O-methoxyethyl nebularine, 2'-O-methoxyethyl Including, but not limited to, 5-nitroindole, 2'-0-methoxyethyl 4-nitrobenzimidazole, 2'-0-methoxyethyl 3-nitropyrrole, or combinations thereof. More specifically, the universal base is deoxyinosine, inosine, or a combination thereof.

[0132] Meanwhile, the displacement hybridization reaction between a double-stranded oligonucleotide and a single-stranded oligonucleotide occurs spontaneously (Qingge Li et al., Nucleic Acids Research, 2002, Vol. 30, No. 2, p6-p9). Specifically, a double-stranded oligonucleotide composed of two strands with different lengths spontaneously reacts with a single-stranded oligonucleotide, displacing a relatively shorter strand of the double-stranded oligonucleotide with the single-stranded oligonucleotide, thereby forming a new, thermodynamically more stable double-stranded oligonucleotide. For example, a first hybrid formed between a reporter probe, which is a double-stranded oligonucleotide, and a first quencher probe can spontaneously form a thermodynamically more stable hybrid, i.e., a second hybrid between the reporter probe and the first region of the target nucleic acid, by displacing the first quencher probe, which is a single-stranded oligonucleotide, having a relatively short length.

[0133] In one embodiment, when the target nucleic acid is present, the formation of the second hybrid is preferential over the formation of the first hybrid. Specifically, when the target nucleic acid is absent, the reporter probe and the first quencher probe hybridize with each other to form the first hybrid. Conversely, when the target nucleic acid is present, the first quencher probe of the first hybrid is replaced by the target nucleic acid, forming a second hybrid between the reporter probe and the target nucleic acid.

[0134] A second quencher probe according to the present disclosure has a second quencher molecule linked thereto and comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid.

[0135] When a target nucleic acid is present, the reporter probe hybridizes to a first region of the target nucleic acid to form a second hybrid, and the second quencher probe hybridizes to a second region of the target nucleic acid to form a third hybrid.

[0136] In one embodiment, the reporter probe, the first quencher probe, and / or the second quencher probe are "blocked" at their 3'-ends to prevent extension. Blocking can be accomplished by any conventional method. For example, blocking can be accomplished by adding a chemical moiety, such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate, or an alkane-diol moiety, to the 3'-hydroxyl group of the last nucleotide. Alternatively, blocking can be accomplished by removing the 3'-hydroxyl group of the last nucleotide or by using a nucleotide lacking a 3'-hydroxyl group, such as a dideoxynucleotide.

[0137] In the present disclosure, the first region and the second region of the target nucleic acid are adjacent to each other.

[0138] The term "adjacent" as used herein when referring to a first region and a second region of a target nucleic acid means that the reporter molecule of a reporter probe hybridized to the first region of the target nucleic acid and the second quencher molecule of a second quencher probe hybridized to the second region of the target nucleic acid are sufficiently adjacent to each other to interact with each other. That is, the first region and the second region of the target nucleic acid may be positioned immediately adjacent to each other without spacing apart or in close proximity with some spacing apart, as long as the second quencher molecule of the second quencher probe hybridized to the second region of the target nucleic acid can quench a signal from the reporter molecule of the reporter probe hybridized to the first region of the target nucleic acid.

[0139] In one embodiment, the first region and the second region of the target nucleic acid may be positioned directly adjacent to each other. For example, the first region and the second region of the target nucleic acid may be positioned directly adjacent to each other to form a nick. In another embodiment, the first region and the second region of the target nucleic acid may be positioned directly adjacent to each other. For example, the first region of the target nucleic acid may be positioned 1-30 nucleotides, 1-20 nucleotides, 1-15 nucleotides, 1-10 nucleotides, 1-5 nucleotides, or 1-4 nucleotides apart from the second region of the target nucleic acid. In yet another embodiment, the first region and the second region of the target nucleic acid may overlap each other. For example, 1-10 nucleotides, 1-7 nucleotides, 1-5 nucleotides, 1-3 nucleotides or 1-2 nucleotides may overlap.

[0140] In one embodiment, when the reporter probe and the second quencher probe are hybridized to the target nucleic acid, the second quencher molecule linked to the second quencher probe is positioned in proximity to the reporter molecule linked to the reporter probe hybridized to the target nucleic acid, such that the second quencher molecule can quench a signal from the reporter molecule. Specifically, the second quencher molecule linked to the second quencher probe is positioned immediately adjacent to the reporter molecule linked to the reporter probe or within 1 to 4 nucleotides from the reporter molecule.

[0141] In one embodiment, the reporter molecule of the reporter probe, the first quencher molecule of the first quencher probe, and the second quencher molecule of the second quencher probe are each linked to positions where quenching and unquenching can be induced under specific conditions, taking into account the morphologies of the first hybrid, the second hybrid, and the third hybrid. Specifically, the reporter molecule, the first quencher molecule, and the second quencher molecule are linked to positions that satisfy both of the following conditions.

[0142] (i) when the first hybrid is formed, the first quencher molecule quenches the signal from the reporter molecule, and when the first hybrid is dissociated, the first quencher molecule unquenchs the signal from the reporter molecule; and

[0143] (ii) a position where, when a second hybrid and a third hybrid are formed in the presence of a target nucleic acid, the second quencher molecule quenches a signal from the reporter molecule, and when either of the second hybrid and the third hybrid dissociates, the second quencher molecule unquenchs a signal from the reporter molecule.

[0144] In one embodiment, when the reporter probe and the second quencher probe each hybridize to the first region and the second region of the target nucleic acid, respectively, the second quencher molecule linked to the second quencher probe approaches the reporter molecule of the reporter probe hybridized to the target nucleic acid, and the second quencher molecule linked to the second quencher probe quenches a signal from the reporter molecule linked to the reporter probe.

[0145] In one embodiment, the first region of the target nucleic acid may be located upstream of the 5'-end of the second region of the target nucleic acid. In another embodiment, the first region of the target nucleic acid may be located downstream of the 3'-end of the second region.

[0146] In one embodiment, the reporter molecule is linked to the 3'-terminal portion or the 5'-terminal portion of the reporter probe.

[0147] In one embodiment, the first quencher molecule is linked to the 5'-terminal portion or the 3'-terminal portion of the first probe.

[0148] In one embodiment, the second quencher molecule is linked to the 5'-terminal portion or the 3'-terminal portion of the second quencher probe.

[0149] The term "3'-terminal portion" or "5'-terminal portion" as used herein when referring to a reporter probe, a first quencher probe and / or a second quencher probe means a portion or region comprising a continuous sequence of any length from the 3'-terminus or the 5'-terminus of the probe. For example, the 3'-terminal portion of a probe means a sequence comprising 1-10 nucleotides from its 3'-terminus, specifically, a sequence comprising 1-5 nucleotides, more specifically, a sequence comprising 1-3 nucleotides, and the 5'-terminus of a probe means a sequence comprising 1-10 nucleotides from its 5'-terminus, specifically, a sequence comprising 1-5 nucleotides, more specifically, a sequence comprising 1-3 nucleotides.

[0150] In one embodiment, when the first region of the target nucleic acid is located 5'-upstream of the second region of the target nucleic acid, the reporter molecule is located at the 5'-terminal portion of the reporter probe, and the second quencher molecule is located at the 3'-terminal portion of the second quencher probe.

[0151] In another embodiment, when the second region of the target nucleic acid is located 5'-upstream of the first region of the target nucleic acid, the reporter molecule is located at the 3'-terminal portion of the reporter probe, and the second quencher molecule is located at the 5'-terminal portion of the second quencher probe.

[0152] The reporter molecule and quencher molecule used in the present disclosure are interactive labels.

[0153] As a representative example of an interactive labeling system, a fluorescence resonance energy transfer (FRET) labeling system includes a fluorescent reporter molecule (donor molecule) and a quencher molecule (acceptor molecule). In FRET, the energy donor is fluorescent, but the energy acceptor can be fluorescent or non-fluorescent. In another type of interactive labeling system, the energy donor is non-fluorescent, such as a chromophore, and the energy acceptor is fluorescent. In yet another type of interactive labeling system, the energy donor is luminescent, such as bioluminescent, chemiluminescent, or electrochemiluminescent, and the acceptor is fluorescent. The donor molecule and acceptor molecules may be referred to as reporter molecules and quencher molecules, respectively, in the present disclosure. Interactive labels comprise a pair of labels that provide a detectable signal based on contact-mediated quenching (Salvatore et al., Nucleic Acids Research, 2002 (30) no. 21 e122 and Johansson et al., J. AM. CHEM. SOC 2002 (124) pp 6950-6956). In the present disclosure, the interactive label system encompasses all instances where a signal change is induced by an interaction between at least two molecules (e.g., dyes).

[0154] Reporter molecules and quencher molecules useful as interactive markers may include any molecules known in the art. Examples include: Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rhodamine 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530 / 550 (550), Dil (565), BODIPY TMR (568), BODIPY558 / 568 (568), BODIPY564 / 570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), Texas Red (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), Rphycocyanin (642), C-Phycocyanin (648), TO-PRO™-3 (660), TOTO3 (660), DiD DilC (5) (665), Cy5™ (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705), and Quasar 705 (610). Numbers in parentheses are maximum emission wavelengths in nanometers. Specifically, reporter molecules and quencher molecules include JOE, FAM, TAMRA, ROX, and fluorescein-based labels.

[0155] Suitable reporter-quencher pairs are described in various references, including: Pesce et al., editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, RP, Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996); U.S. Patent Nos. 3,996,345 and 4,351,760.

[0156] In the present disclosure, non-fluorescent black quencher molecules capable of quenching fluorescence of a broad range of wavelengths or a specific wavelength may be utilized. Examples of non-fluorescent black quencher molecules include BHQ and DABCYL.

[0157] In the FRET labeling applied to the present disclosure, the reporter comprises the FRET donor and the quencher comprises the remaining partner (acceptor) of the FRET. For example, a fluorescein dye is used as the reporter and a rhodamine dye is used as the quencher.

[0158] In one embodiment, the first quencher molecule and the second quencher molecule are quencher molecules of the same type. For example, if the first quencher molecule is a non-fluorescent black quencher molecule (e.g., BHQ), the second quencher molecule may use the same type of non-fluorescent black quencher molecule (e.g., BHQ), and if the first quencher molecule is a fluorescent acceptor molecule (e.g., rhodamine dye), the second quencher molecule may also use the same type of fluorescent acceptor molecule (e.g., rhodamine dye).

[0159] The composition for detecting a target nucleic acid comprising the reporter probe, the first quencher probe, and the second quencher probe according to the present disclosure described above reacts with the target nucleic acid to provide a signal dependent on the presence of the target nucleic acid. Specifically, the composition for detecting a target nucleic acid comprising three probes according to the present disclosure provides a signal change indicating the presence of the target nucleic acid as the target nucleic acid is amplified.

[0160] According to one embodiment, the provision of the signal includes "signal generation or extinction" and "signal increase or decrease." As used herein, the provision of the signal means provision of a significant signal, i.e., a signal indicating the presence of a target nucleic acid. For example, a significant signal, i.e., a signal indicating the presence of a target nucleic acid, means a signal having an intensity that exceeds the intensity of a background signal or the intensity of a signal that can be provided in the absence of the target nucleic acid, or a significant signal, i.e., a signal indicating the presence of a target nucleic acid, means a signal having an intensity after subtracting the intensity of a background signal or the intensity of a signal that can be provided in the absence of the target nucleic acid from the intensity of the provided signal.

[0161] The provision of a signal in this invention is interpreted as the provision of a change in signal, and the provision of said change in signal means providing a change in signal in the presence of a target compared to the signal in the absence of a target.

[0162] In one embodiment, the change in signal is provided by a change in the sum of the signal provided from the first hybrid and the signal provided from the second or third hybrid.

[0163] In one embodiment, the reaction with the target nucleic acid may include an amplification reaction, such as a signal amplification reaction and / or a nucleic acid amplification reaction.

[0164] As described above, the composition for detecting a target nucleic acid according to the present disclosure can form a first hybrid, and when a target nucleic acid is present, can form not only the first hybrid, but also a second hybrid and a third hybrid. The first hybrid formed by the composition for detecting a target nucleic acid according to the present disclosure is characterized in that it has a melting temperature (Tm) different from the Tm of the second hybrid and the third hybrid. That is, the Tm of the first hybrid (referred to as Tm1 herein) is different from the Tm of the second hybrid (referred to as Tm2 herein) and the Tm of the third hybrid (referred to as Tm3 herein).

[0165] The term "melting temperature (Tm)" as used herein refers to the melting temperature at which half of a population of double-stranded nucleic acid molecules dissociates into single-stranded molecules. Tm is determined by the length and G / C content of the hybridizing nucleotides. Tm can be calculated by conventional methods such as the Wallace rule (RB Wallace et al., Nucleic Acids Research, 6:3543-3547 (1979)) and the nearest-neighbor method (SantaLucia J. Jr. et al., Biochemistry, 35:3555-3562 (1996)); Sugimoto N. et al., Nucleic Acids Res., 24:4501-4505 (1996)).

[0166] In one embodiment, the signal dependent on the presence of the target nucleic acid is provided at a temperature at which one of the second hybrid and the third hybrid maintains its double-stranded state and the other dissociates into a single strand. That is, the temperature at which the signal is provided is dependent on the Tms of the first hybrid, the second hybrid, and the third hybrid.

[0167] In one embodiment, when the target nucleic acid is present, Tm1 and Tm2 are adjusted such that the formation of the second hybrid is preferred over the formation of the first hybrid. For example, Tm1 is lower than Tm2, ​​and specifically, Tm1 is at least 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, or 15°C lower than Tm2.

[0168] In one embodiment, Tm3 can be higher or lower than Tm1.

[0169] In one embodiment, Tm1 is controllable by the sequence and / or length of the first quencher probe.

[0170] In one embodiment, Tm2 is controllable by the sequence and / or length of the reporter probe.

[0171] In one embodiment, Tm3 is controllable by the sequence and / or length of the second quencher probe.

[0172] The present disclosure provides that if Tm1 is different from both Tm2 and Tm3, Tm2 and Tm3 may be the same or different from each other.

[0173] In one embodiment, the second hybrid and the third hybrid have different Tm's. That is, Tm2 and Tm3 are different from each other, for example, Tm2 and Tm3 are different from each other by at least 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, or 20°C.

[0174] In one embodiment, the second hybrid and the third hybrid have the same Tm, i.e., Tm2 and Tm3 are the same.

[0175] Due to the different Tm between the first hybrid and other hybrids (i.e., the second hybrid and the third hybrid), the composition for detecting a target nucleic acid according to the present disclosure has a temperature range in which the signal changes depending on the presence of the target nucleic acid in a reaction with the target nucleic acid (e.g., an amplification reaction), i.e., a signal-changing temperature range (SChTR), and two temperature ranges in which the signal does not change even if the target nucleic acid is present, i.e., two signal-constant temperature ranges (SCoTRs).

[0176] In one embodiment, the signal-change temperature range of the composition for detecting a target nucleic acid according to the present disclosure is higher than the first signal-constant temperature range among the two signal-constant temperature ranges and lower than the second signal-constant temperature range among the two signal-constant temperature ranges.

[0177] In this regard, the following is a more detailed explanation with reference to specific implementation examples and drawings.

[0178] Implementation Example (i): When Tm1 is lower than Tm2 and Tm3

[0179] Figures 1 and 2 show the predominant conformation of the reporter probe, the first quencher probe and the second quencher probe depending on the presence of the target nucleic acid and the temperature when Tm1 is lower than both Tm2 and Tm3.

[0180] Specifically, FIG. 1 shows conformational changes of a reporter probe, a first quencher probe, and a second quencher probe in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range, before the reaction between the target nucleic acid and the composition for detecting a target nucleic acid according to the present disclosure or before the reaction between the target nucleic acid and the composition for detecting a target nucleic acid according to the present disclosure. FIG. 2 shows conformational changes of a reporter probe, a first quencher probe, and a second quencher probe in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range, after the reaction between the target nucleic acid and the composition for detecting a target nucleic acid according to the present disclosure.

[0181] In one embodiment, when the composition for detecting a target nucleic acid according to the present disclosure has not reacted with the target nucleic acid or the target nucleic acid is absent, at a temperature within the first signal-constant temperature range, the reporter probe and the first quencher probe hybridize with each other to form a first hybrid product (see (i) of FIG. 1). That is, at the temperature, the reporter molecule linked to the reporter probe and the first quencher molecule linked to the first quencher probe come into close proximity to each other, such that the first quencher molecule quenches the signal from the reporter molecule.

[0182] In one embodiment, when the composition for detecting a target nucleic acid according to the present disclosure has not reacted with the target nucleic acid or the target nucleic acid is absent, at a temperature within the signal-change temperature range and the second signal-constant temperature range, the first hybrid between the reporter probe and the first quencher probe dissociates into two single strands (see (ii) and (iii) of FIG. 1 ). That is, at the temperature, the reporter molecule linked to the reporter probe and the first quencher molecule linked to the first quencher probe are separated from each other, so that the first quencher molecule unquenches a signal from the reporter molecule.

[0183] In one embodiment, when the composition for detecting a target nucleic acid according to the present disclosure is not reacted with the target nucleic acid or the target nucleic acid is absent, the second quencher probe exists as a single strand at a temperature within the entire temperature range.

[0184] In one embodiment, when a target nucleic acid is present, at a temperature within a first signal-constant temperature range, the reporter probe and the second quencher probe hybridize to the target nucleic acid to form a second hybrid and a third hybrid, respectively (see (i) of FIG. 2). That is, at the temperature, the reporter molecule linked to the reporter probe and the second quencher molecule linked to the second quencher probe come into close proximity to each other, such that the second quencher molecule quenches a signal from the reporter molecule. Therefore, as shown in (i) of FIG. 1 and (i) of FIG. 2, at a temperature within the first signal-constant temperature range, the reporter molecule linked to the reporter probe is quenched by the first quencher molecule or the second quencher molecule regardless of the presence of the target nucleic acid. Therefore, in the first signal-constant temperature range, the signal is constant without signal change even when the target nucleic acid is present.

[0185] In one embodiment, when a target nucleic acid is present, at a temperature within a second signal-constant temperature range, the reporter probe and the second quencher probe dissociate from the target nucleic acid and each exist as a single strand (see (iii) of FIG. 2). That is, at the temperature, the reporter molecule linked to the reporter probe and the second quencher molecule linked to the second quencher probe are separated from each other, so that the second quencher molecule unquenches the signal from the reporter molecule. Therefore, as shown in (iii) of FIG. 1 and (iii) of FIG. 2, at a temperature within the second signal-constant temperature range, the reporter molecule linked to the reporter probe is separated from both the first quencher molecule and the second quencher molecule and unquenched regardless of the presence of the target nucleic acid. Therefore, in the second signal-constant temperature range, the signal is constant without signal change even when the target nucleic acid is present.

[0186] In one embodiment, when a target nucleic acid is present, the following two forms can coexist: (ii-1) a reporter probe and a second quencher probe hybridize to the target nucleic acid to form a second hybrid and a third hybrid at a temperature within the signal-change temperature range, and (ii-2) a form in which the reporter probe hybridizes to the target nucleic acid to form a second hybrid and the second quencher probe dissociates from the target nucleic acid and exists as a single strand (see (ii) of FIG. 2). Specifically, in the (ii-1) form, the reporter molecule connected to the reporter probe and the second quencher molecule connected to the second quencher probe are close to each other so that the second quencher molecule quenches a signal from the reporter molecule, whereas in the (ii-2) form, the reporter molecule connected to the reporter probe and the second quencher molecule connected to the second quencher probe are spaced apart from each other so that the second quencher molecule unquenchs a signal from the reporter molecule.

[0187] Therefore, as shown in (ii) of FIG. 1 and (ii) of FIG. 2, in the signal-change temperature range, when the target nucleic acid is absent, the reporter molecule linked to the reporter probe is unquenched, whereas in the presence of the target nucleic acid, the second quencher molecule linked to (some) of the second quencher probes quenches the signal from the reporter molecule (i.e., in the form of (ii-1) of FIG. 2). As a result, in the signal-change temperature range, the signal changes depending on the presence of the target nucleic acid.

[0188] Meanwhile, in the case of an intermediate reaction product (e.g., a product of an early or middle cycle) in which the target nucleic acid is being amplified, a reporter probe, a first quencher probe, and a second quencher probe that have not yet participated in the reaction may exist together, and at this time, the three probes exist in the forms (i) to (iii) of FIG. 1, depending on the temperature.

[0189] During the reaction of the composition for detecting a target nucleic acid according to the present disclosure with the target nucleic acid (e.g., target nucleic acid amplification reaction), the contents of the reporter probe, the first quencher probe, and the second quencher probe are constant at the concentrations included in the initial target nucleic acid detection composition. The reporter probe, the first quencher probe, and the second quencher probe included in the composition for detecting a target nucleic acid may exist in the forms of FIGS. 1 and 2 depending on the presence or absence of the target nucleic acid and / or temperature change as described above, and the contents of the reporter probe, the first quencher probe, and the second quencher probe existing in the forms of FIGS. 1 and 2 change depending on the degree of reaction with the target nucleic acid (e.g., the degree of amplification of the target nucleic acid).

[0190] In particular, when the target nucleic acid is absent or before the reaction of the target nucleic acid detection composition according to the present disclosure with the target nucleic acid, the reporter probe forms a first hybrid with the first quencher probe, and when it reacts with the target nucleic acid, the relatively short first quencher probe is displaced by the target nucleic acid, and the reporter probe spontaneously forms a second hybrid that is thermodynamically more stable with the target nucleic acid. In this case, the reporter probe that formed the first hybrid can be considered to be consumed as it forms the second hybrid, i.e., the content of the first hybrid can be considered to have decreased and the content of the second hybrid can be considered to have increased.

[0191] Figure 3 illustrates the content ratio and melt curve of the composition for detecting a target nucleic acid according to the present disclosure and the reaction product with the target nucleic acid. Figure 3A illustrates the content ratio (or abundance ratio) of the first hybrid and the second hybrid (or the third hybrid) and their melt curves in the initial, middle, and final cycles of a target nucleic acid amplification reaction using the composition for detecting a target nucleic acid according to the present disclosure. Figure 3B shows a plot in which the three melt curves of Figure 3A are merged.

[0192] Specifically, the number in the (i) row in FIG. 3A represents the total content ratio of the first hybridization product existing in the form of (i) to (iii) of FIG. 1, and the number in the (ii) row represents the total content ratio of the second hybridization product (or third hybridization product) existing in the form of (i) to (iii) of FIG. 2. The content ratios in the (i) and (ii) rows change as the cycle increases, that is, as the target nucleic acid is amplified. In particular, if the melting curves for each of the early / middle / late cycles are combined into one graph, a graph such as FIG. 3B can be obtained. Through the graph, it can be confirmed that the composition for detecting a target nucleic acid according to the present disclosure has two temperature ranges in which the signal is constant even when the target nucleic acid is present, and a temperature range in which the signal changes as the target nucleic acid is amplified. At this time, the content of the second hybridization product (and / or the third hybridization product) increases as the target nucleic acid is amplified. On the other hand, the content of the first hybridization product decreases as the target nucleic acid is amplified. That is, as the target nucleic acid is amplified, the content ratio between the first hybrid and the second hybrid (and / or the third hybrid) changes, and the signal indicating the presence of the target nucleic acid also changes within the signal-change temperature range due to this change in the content ratio. Therefore, the composition for detecting a target nucleic acid according to the present disclosure can provide a signal dependent on the presence of the target nucleic acid.

[0193] Meanwhile, even if the content ratio between the first hybrid and the second hybrid (and / or the third hybrid) changes as the target nucleic acid is amplified, the signal does not change and remains constant within two signal constant-temperature ranges. Specifically, at a temperature within the first signal constant-temperature range, the reporter probe is quenched by the first quencher probe or the second quencher probe, so that the signal remains constant, and at a temperature within the second signal constant-temperature range, the reporter probe is separated from both the first quencher probe and the second quencher probe and is unquenched, so that the signal remains constant.

[0194] Implementation example (ii): When Tm1 is lower than Tm2 and higher than the Tm3 value.

[0195] Figures 4 and 5 show the predominant conformations of the reporter probe, the first quencher probe, and the second quencher probe depending on the presence of the target nucleic acid and the temperature, when Tm1 is lower than Tm2 and higher than Tm3.

[0196] Specifically, FIG. 4 shows conformational changes of a reporter probe, a first quencher probe, and a second quencher probe in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range, before the reaction between the target nucleic acid and the composition for detecting a target nucleic acid according to the present disclosure or before the reaction between the target nucleic acid and the composition for detecting a target nucleic acid according to the present disclosure. FIG. 5 shows conformational changes of a reporter probe, a first quencher probe, and a second quencher probe in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range, after the reaction between the target nucleic acid and the composition for detecting a target nucleic acid according to the present disclosure.

[0197] In one embodiment, before the reaction of the target nucleic acid detection composition according to the present disclosure with the target nucleic acid or in the absence of the target nucleic acid, at a temperature within the first signal-constant temperature range, the reporter probe and the first quencher probe hybridize with each other to form a first hybrid (see (i) of FIG. 4). That is, at the temperature, the reporter molecule linked to the reporter probe and the first quencher molecule linked to the first quencher probe come into close proximity to each other, such that the first quencher molecule quenches the signal from the reporter molecule.

[0198] In one embodiment, before the reaction of the composition for detecting a target nucleic acid according to the present disclosure with the target nucleic acid or in the absence of the target nucleic acid, at a temperature within the second signal-constant temperature range, the first hybrid between the reporter probe and the first quencher probe dissociates into two single strands (see (iii) of FIG. 4). That is, at the temperature, the reporter molecule linked to the reporter probe and the first quencher molecule linked to the first quencher probe are separated from each other, so that the first quencher molecule unquenches the signal from the reporter molecule.

[0199] In one embodiment, before the composition for detecting a target nucleic acid according to the present disclosure reacts with the target nucleic acid or in the absence of the target nucleic acid, at a temperature within the signal-change temperature range, (ii-1) the reporter probe and the first quencher probe can coexist in a form in which they hybridize with each other to form a first hybrid product and (ii-2) a form in which the first hybrid product between the reporter probe and the first quencher probe dissociates and exists as two single strands (see (ii) of FIG. 4). Specifically, in the form (ii-1), the reporter molecule connected to the reporter probe and the first quencher molecule connected to the first quencher probe are close to each other so that the first quencher molecule quenches the signal from the reporter molecule, whereas in the form (ii-2), the reporter molecule connected to the reporter probe and the first quencher molecule connected to the first quencher probe are spaced apart from each other so that the first quencher molecule unquenchs the signal from the reporter molecule.

[0200] In one embodiment, when the composition for detecting a target nucleic acid according to the present disclosure is not reacted with the target nucleic acid or the target nucleic acid is absent, the second quencher probe exists as a single strand at a temperature within the entire temperature range.

[0201] In one embodiment, when a target nucleic acid is present, at a temperature within a first signal-constant temperature range, the reporter probe and the second quencher probe hybridize to the target nucleic acid to form a second hybrid and a third hybrid, respectively (see (i) of FIG. 5). That is, at the temperature, the reporter molecule linked to the reporter probe and the second quencher molecule linked to the second quencher probe come into close proximity to each other, such that the second quencher molecule quenches a signal from the reporter molecule. Therefore, as shown in (i) of FIG. 4 and (i) of FIG. 5, at a temperature within the first signal-constant temperature range, the reporter molecule linked to the reporter probe is quenched by the first quencher molecule or the second quencher molecule regardless of the presence of the target nucleic acid. Therefore, in the first signal-constant temperature range, the signal is constant without signal change even when the target nucleic acid is present.

[0202] In one embodiment, when a target nucleic acid is present, at a temperature within a second signal-constant temperature range, the reporter probe and the second quencher probe dissociate from the target nucleic acid and each exist as a single strand (see (iii) of FIG. 5). That is, at the temperature, the reporter molecule linked to the reporter probe and the second quencher molecule linked to the second quencher probe are separated from each other, so that the second quencher molecule unquenches the signal from the reporter molecule. Therefore, as shown in (iii) of FIG. 4 and (iii) of FIG. 5, at a temperature within the second signal-constant temperature range, the reporter molecule linked to the reporter probe is separated from both the first quencher molecule and the second quencher molecule and unquenched regardless of the presence of the target nucleic acid. Therefore, in the second signal-constant temperature range, the signal is constant without signal change even when the target nucleic acid is present.

[0203] In one embodiment, when a target nucleic acid is present, at a temperature within the signal-change temperature range, the reporter probe hybridizes to the target nucleic acid to form a second hybrid, and the second quencher probe dissociates from the target nucleic acid and exists as a single strand (see (ii) of FIG. 5 ). That is, at the temperature, the reporter molecule linked to the reporter probe and the second quencher molecule linked to the second quencher probe are spaced apart from each other, so that the second quencher molecule unquenches the signal from the reporter molecule. That is, as shown in (ii) of FIG. 4 and (ii) of FIG. 5 , in the signal-change temperature range, when the target nucleic acid is absent, the first quencher molecule linked to (some) the first quencher probe quenches the signal from the reporter molecule linked to the reporter probe (i.e., in the form of (ii-1) of FIG. 4 ), whereas when the target nucleic acid is present, the first quencher molecule linked to the reporter probe unquenches the signal from the reporter molecule linked to the reporter probe. As a result, the signal changes dependently on the presence of the target nucleic acid in the signal-change temperature range.

[0204] Meanwhile, in the case of an intermediate reaction product (e.g., a product of an early or middle cycle) in which the target nucleic acid is being amplified, a reporter probe, a first quencher probe, and a second quencher probe that have not yet participated in the reaction may exist together, and at this time, the three probes exist in the forms (i) to (iii) of FIG. 4, depending on the temperature.

[0205] During the reaction of the composition for detecting a target nucleic acid according to the present disclosure with the target nucleic acid (e.g., target nucleic acid amplification reaction), the contents of the reporter probe, the first quencher probe, and the second quencher probe are constant at the concentrations included in the initial target nucleic acid detection composition. The reporter probe, the first quencher probe, and the second quencher probe included in the composition for detecting a target nucleic acid may exist in the forms of FIGS. 4 and 5 depending on the presence or absence of the target nucleic acid and / or temperature change as described above, and the contents of the reporter probe, the first quencher probe, and the second quencher probe existing in the forms of FIGS. 4 and 5 change depending on the degree of reaction with the target nucleic acid (e.g., the degree of amplification of the target nucleic acid).

[0206] In particular, when the target nucleic acid is absent or before the reaction of the target nucleic acid detection composition according to the present disclosure with the target nucleic acid, the reporter probe forms a first hybrid with the first quencher probe, and when it reacts with the target nucleic acid, the relatively short first quencher probe is displaced by the target nucleic acid, and the reporter probe spontaneously forms a second hybrid that is thermodynamically more stable with the target nucleic acid. In this case, the reporter probe that formed the first hybrid can be considered to be consumed as it forms the second hybrid, i.e., the content of the first hybrid can be considered to have decreased and the content of the second hybrid can be considered to have increased.

[0207] Figure 6 illustrates the content ratio and melt curve of the composition for detecting a target nucleic acid according to the present disclosure and the reaction product with the target nucleic acid. Figure 6A illustrates the content ratio (or abundance ratio) of the first hybrid and the second hybrid (or the third hybrid) and their melt curves in the initial, middle, and final cycles of a target nucleic acid amplification reaction using the composition for detecting a target nucleic acid according to the present disclosure. Figure 6B shows a plot in which the three melt curves of Figure 6A are merged.

[0208] Specifically, the number in the (i) row in FIG. 6A represents the total content ratio of the first hybridization product existing in the form of (i) to (iii) of FIG. 4, and the number in the (ii) row represents the total content ratio of the second hybridization product (or third hybridization product) existing in the form of (i) to (iii) of FIG. 5. The content ratios in the (i) and (ii) rows change as the cycle increases, that is, as the target nucleic acid is amplified. In particular, if the melting curves for each of the early / middle / late cycles are combined into one graph, a graph such as FIG. 6B can be obtained. Through the graph, it can be confirmed that the composition for detecting a target nucleic acid according to the present disclosure has two temperature ranges in which the signal is constant even when the target nucleic acid is present, and a temperature range in which the signal changes as the target nucleic acid is amplified. At this time, the content of the second hybridization product (and / or the third hybridization product) increases as the target nucleic acid is amplified. On the other hand, the content of the first hybridization product decreases as the target nucleic acid is amplified. That is, as the target nucleic acid is amplified, the content ratio between the first hybrid and the second hybrid (and / or the third hybrid) changes, and the signal indicating the presence of the target nucleic acid also changes within the signal-change temperature range due to this change in the content ratio. Therefore, the composition for detecting a target nucleic acid according to the present disclosure can provide a signal dependent on the presence of the target nucleic acid.

[0209] Meanwhile, even if the content ratio between the first hybrid and the second hybrid (and / or the third hybrid) changes as the target nucleic acid is amplified, the signal does not change and remains constant within two signal constant-temperature ranges. Specifically, at a temperature within the first signal constant-temperature range, the reporter probe is quenched by the first quencher probe or the second quencher probe, so that the signal remains constant, and at a temperature within the second signal constant-temperature range, the reporter probe is separated from both the first quencher probe and the second quencher probe and is unquenched, so that the signal remains constant.

[0210] As shown in FIGS. 3B and 6B, the composition for detecting a target nucleic acid according to the present disclosure has a signal-changing temperature range (SChTR) in which a signal changes depending on the presence of a target nucleic acid in an amplification reaction for the target nucleic acid, and two signal-constant temperature ranges (SCoTRs) in which the signal remains constant even when the target nucleic acid is present. Specifically, the signal-changing temperature range is higher than the first signal-constant temperature range among the two signal-constant temperature ranges, and is lower than the second signal-constant temperature range among the two signal-constant temperature ranges.

[0211] As used herein, "signal-constant temperature range" refers to a temperature range in which a composition for detecting a target nucleic acid provides a constant signal despite the presence of a target nucleic acid. The signal-constant temperature range is a temperature range in which the composition for detecting a target nucleic acid provides a constant signal even after a reaction time has elapsed, which may also be referred to herein as a temperature range in which the composition for detecting a target nucleic acid does not provide a significant signal, or a temperature range in which the composition does not provide a signal indicating the presence of a target nucleic acid.

[0212] As used herein, "constant signal" means that the signal does not substantially change during a reaction between a target nucleic acid and a composition for detecting the target nucleic acid (e.g., a target nucleic acid amplification reaction). That is, the term "constant signal" means all or any signal pattern excluding a significant signal change that occurs due to amplification of the existing target nucleic acid. In particular, the constant signal means no signal change. For example, if the signal does not exceed the intensity of the background signal or the intensity of the signal that can occur in the absence of the target nucleic acid during the amplification reaction, it can be expressed as "the signal is constant." As used herein, the constant signal may be used interchangeably with a signal that does not change or a signal that does not show a change.

[0213] As used herein, the term "signal-change temperature range" refers to a temperature range over which a composition for detecting a target nucleic acid provides a signal that changes dependently on the presence of a target nucleic acid. The signal-change temperature range is a temperature range over which a composition for detecting a target nucleic acid provides a signal that changes over time, and may also be referred to herein as a temperature range over which a composition for detecting a target nucleic acid provides a significant signal, or a temperature range over which a signal indicating the presence of a target nucleic acid is provided.

[0214] In one embodiment, the expression "one temperature range is lower than the other temperature range" used in relation to the signal-change temperature range and the signal-constant temperature range of the target nucleic acid detection composition means that the highest temperature within one temperature range is lower than the lowest temperature within the other temperature range. Conversely, the expression "one temperature range is higher than the other temperature range" means that the lowest temperature within one temperature range is higher than the highest temperature within the other temperature range. For example, the expression that the signal-constant temperature range is higher than the signal-change temperature range means that the lowest temperature within the signal-constant temperature range is higher than the highest temperature within the signal-change temperature range.

[0215] International Application Publication No. WO2022-265463 discloses that various signal generation methods known in the art for detecting target nucleic acids have a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid and one or two signal-constant temperature ranges (SCoTR) in which the signal does not change even when the target nucleic acid is present.

[0216] In addition, WO2022-265463 discloses that various conventional signal generation methods can be classified into the following three types according to the number and order of signal-changing temperature ranges and signal-constant temperature ranges:

[0217] (i) UnderSC-type signal generation method having a melting characteristic in which the signal-change temperature range is lower than the signal-constant temperature range;

[0218] (ii) an InterSC-type signal generation method having a melting characteristic in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges; and

[0219] (iii) An OverSC-type signal generation method having a melting characteristic in which the signal-change temperature range is higher than the signal-constant temperature range.

[0220] Compositions for implementing the above three types of signal generation methods can be classified into UnderSC-type compositions, InterSC-type compositions, and OverSC-type compositions, respectively.

[0221] The composition for detecting a target nucleic acid according to the present disclosure can also be classified as an InterSC-type composition among the three signal generation methods (UnderSC-type, InterSC-type, and OverSC-type) described in WO2022-265463.

[0222] In one embodiment, the signal-change temperature range is determined dependently on (i) the Tm value of the first hybrid compound and (ii) the Tm values ​​of the second hybrid compound and / or the third hybrid compound. Accordingly, the signal-change temperature range and the two signal-constant temperature ranges can be controlled by controlling the Tm of the first hybrid compound and the Tm of the second hybrid compound or the third hybrid compound.

[0223] In one embodiment, in the presence of the target nucleic acid, the second hybrid and the third hybrid maintain their double-stranded state at a temperature within the first signal-constant temperature range. Specifically, most of the second hybrid and most of the third hybrid maintain their double-stranded state. Here, the first hybrid maintains its double-stranded state for the most part.

[0224] In one embodiment, in the presence of the target nucleic acid, the second hybrid and the third hybrid dissociate from the target nucleic acid at a temperature within the second signal-constant temperature range and exist as single strands. Specifically, most of the second hybrid and most of the third hybrid dissociate from the target nucleic acid and exist as single strands. Here, the first hybrid dissociates predominantly into two single strands.

[0225] In one embodiment, in the presence of the target nucleic acid, at least one of the second hybrid and the third hybrid maintains its double-stranded state in the signal-change temperature range.

[0226] In certain embodiments, when Tm1 is lower than Tm2 and Tm3, in the presence of the target nucleic acid, the second and third hybrids maintain their double-stranded states within the signal-change temperature range. Specifically, most of the second hybrids maintain their double-stranded states, and some of the third hybrids maintain their double-stranded states (e.g., form (ii-1) in FIG. 2) and some dissociate from the target nucleic acid and exist as single strands (e.g., form (ii-2) in FIG. 2). Here, the first hybrids mostly dissociate into two single strands.

[0227] In a specific embodiment, when Tm1 is lower than Tm2 and higher than Tm3, in the presence of the target nucleic acid, the second hybrid maintains its double-stranded state and the third hybrid dissociates into single strands within the signal-change temperature range. Specifically, most of the second hybrid maintains its double-stranded state and most of the third hybrid dissociates from the target nucleic acid and exists as single strands. Here, some of the first hybrid maintains its double-stranded state and some dissociates into two single strands.

[0228] The term "a portion" used herein when referring to the form of the first hybrid, the second hybrid and / or the third hybrid at a particular temperature range (or at a particular temperature) means a portion of the total content of the hybrid at the particular temperature range, for example, 5% or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more or 80% or more of the total content.

[0229] The term "most" as used herein when referring to the form of the first hybrid, the second hybrid and / or the third hybrid at a particular temperature range (or at a particular temperature) means most of the total content of the hybrid at the particular temperature range, for example, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of the total content, and has a meaning encompassing substantially all of the hybrid. In one embodiment, the reporter probe, the first quencher probe and the second quencher probe are (i) contained in one container or (ii) contained in separate containers, respectively.

[0230] In one embodiment, the composition for detecting a target nucleic acid may additionally include a primer capable of amplifying a nucleic acid sequence including the first region and the second region of the target nucleic acid.

[0231] The primer may comprise a forward primer (also referred to as an upstream primer or upstream oligonucleotide), a reverse primer (also referred to as a downstream primer or downstream oligonucleotide), or both. The primer may be an oligonucleotide having a structure known in the art and may be synthesized by a method known in the art.

[0232] In one embodiment, the composition for detecting a target nucleic acid may additionally include a polymerase for amplifying the target nucleic acid.

[0233] In one embodiment, the polymerase is a polymerase lacking nuclease activity (e.g., 5' to 3' exonuclease activity).

[0234] In another embodiment, the polymerase is a polymerase having nuclease activity (e.g., 5'->3' exonuclease activity). In such a case, the reporter probe, the first quencher probe, and / or the second quencher probe are resistant to nuclease activity.

[0235] The composition for detecting a target nucleic acid according to the present disclosure is characterized by having a signal-changing temperature range and two signal-constant temperature ranges. Due to these features, by controlling the signal-changing temperature range, not only the detection of a single target nucleic acid but also the detection of multiple target nucleic acids using a single type of label is possible. However, when a polymerase having nuclease activity is used, the reporter probe, the first quencher probe, and / or the second quencher probe can be cleaved by the nuclease activity. The cleavage of the probe induces the release of the reporter molecule, the first quencher molecule, and / or the second quencher molecule linked to the probe, and the reporter molecule is unquenched from the first quencher molecule and / or the second quencher molecule throughout the entire temperature range. In other words, the composition for detecting a target nucleic acid according to the present disclosure changes its signal dependently on the presence of the target nucleic acid throughout the entire temperature range without a signal-constant temperature range. Therefore, when the composition for detecting the target nucleic acid comprises a polymerase having nuclease activity, for example, 5'->3' exonuclease activity, it is preferable that the reporter probe, the first quencher probe, and / or the second quencher probe have resistance to 5'->3' nuclease activity.

[0236] In one embodiment, resistance to activity of a 5' -> 3' exonuclease is conferred by a nucleotide having a backbone having resistance to activity of a 5' -> 3' exonuclease, comprising various phosphorothioate linkages, phosphonate linkages, phosphoroamidate linkages and 2'-carbohydrate modifications, more preferably phosphorothioate linkages, alkyl phosphotriester linkages, aryl phosphotriester linkages, alkyl phosphonate linkages, aryl phosphonate linkages, hydrogen phosphonate linkages, alkyl phosphoroamidate linkages, aryl phosphoroamidate linkages, phosphoroselenate linkages, 2'-O-aminopropyl modifications, 2'-O-alkyl modifications, 2'-O-allyl modifications, 2'-O-butyl modifications, α-anomeric oligodeoxynucleotides and Contains 1-(4'-thio-β-D-ribofuranosyl) modification.

[0237] In one embodiment, various DNA polymerases can be used in the amplification reaction, including the "Klenow" fragment of E. coli DNA polymerase I, thermostable DNA polymerases, Vent® polymerase, and the like. Specifically, the polymerase is a thermostable DNA polymerase obtainable from various bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermus flavus, Thermococcus litoralis, and Pyrococcus furiosus (Pfu). Most of the above polymerases can be isolated from the bacteria themselves or purchased commercially.

[0238] The composition for detecting a target nucleic acid according to the present disclosure may optionally include reagents necessary for performing a target nucleic acid amplification reaction (e.g., a PCR reaction), such as a buffer, a DNA polymerase cofactor, and deoxyribonucleotide-5-triphosphate. Optionally, the composition may also include various polynucleotide molecules, a reverse transcriptase enzyme, various buffers and reagents, and an antibody that inhibits DNA polymerase activity. The composition may also include reagents necessary for performing positive control and negative control reactions. The optimal amount of reagents to be used in a particular reaction can be readily determined by one of ordinary skill in the art having the benefit of the present disclosure. The components of the composition may be present in separate containers, or multiple components may be present in a single container.

[0239] II. Target nucleic acid detection method

[0240] In another aspect, the present disclosure provides a method for detecting a target nucleic acid in a sample, comprising:

[0241] (a) a step of incubating a target nucleic acid detection composition comprising a reporter probe, a first quencher probe, and a second quencher probe with the target nucleic acid;

[0242] The reporter probe comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid,

[0243] The above reporter probe has a reporter molecule linked to it,

[0244] The first quencher probe comprises a nucleotide sequence that hybridizes to the reporter probe,

[0245] The first quencher probe has a first quencher molecule connected thereto,

[0246] When a first hybrid is formed between the reporter probe and the first quencher probe, the first quencher molecule is at a position to quench a signal from the reporter probe,

[0247] The second quencher probe comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid,

[0248] The second quencher probe has a second quencher molecule connected thereto,

[0249] The first region and the second region of the target nucleic acid are adjacent to each other,

[0250] When both a second hybridization between the reporter probe and the first region of the target nucleic acid and a third hybridization between the second quencher probe and the second region of the target nucleic acid are formed, the second quencher molecule is at a position to quench a signal from the reporter molecule,

[0251] The first hybrid has a melting temperature (Tm) different from the Tm of the second hybrid and the Tm of the third hybrid;

[0252] (b) a step of measuring the signal; and

[0253] (c) A step of determining the presence of the target nucleic acid from the signal measured in the above step (b).

[0254] Since the second aspect of the present disclosure utilizes the composition of the first aspect described above, common contents between them are omitted to avoid excessive duplication that would complicate the present specification.

[0255] The method according to the present disclosure is explained step by step as follows.

[0256] Step (a): Incubation

[0257] First, a sample suspected of containing a target nucleic acid is mixed and incubated with a composition for detecting a target nucleic acid, which comprises a reporter probe, a first quencher probe, and a second quencher probe.

[0258] The reporter probe comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid, and the reporter probe has a reporter molecule linked thereto.

[0259] The first quencher probe comprises a nucleotide sequence that hybridizes to the reporter probe, and the first quencher probe has a first quencher molecule linked thereto.

[0260] When a first hybrid is formed between the reporter probe and the first quencher probe, the first quencher molecule is at a position to quench a signal from the reporter probe.

[0261] The second quencher probe comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid, and the second quencher probe has a second quencher molecule linked thereto.

[0262] The first region and the second region of the target nucleic acid are adjacent to each other.

[0263] When both a second hybridization between the reporter probe and the first region of the target nucleic acid and a third hybridization between the second quencher probe and the second region of the target nucleic acid are formed, the second quencher molecule is at a position to quench a signal from the reporter molecule.

[0264] The first hybrid compound has a melting temperature (Tm) that is different from the Tm of the second hybrid compound and the Tm of the third hybrid compound.

[0265] In one embodiment, the first quencher molecule and the second quencher molecule are of the same type.

[0266] In one embodiment, the incubation reaction means a reaction in which a target nucleic acid reacts with the target nucleic acid detection composition to provide a signal dependent on the presence of the target nucleic acid at a temperature selected within the signal-change temperature range of the target nucleic acid detection composition.

[0267] In one embodiment, the step (a) incubation comprises a nucleic acid amplification reaction, specifically, an amplification reaction of a target nucleic acid.

[0268] In one embodiment, the amplification reaction comprises multiple cycles.

[0269] In one embodiment, the amplification of the target nucleic acid can be performed by polymerase chain reaction (PCR), more specifically, real-time polymerase chain reaction (real-time PCR). Polymerase chain reaction is widely used in the art to amplify target nucleic acids, and includes repeated cycles of denaturation of the target nucleic acid, annealing (hybridization) between the target nucleic acid and a primer, and primer extension (U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al., (1985) Science 230, 1350-1354).

[0270] If the target nucleic acid is double-stranded, it is desirable to convert the double-stranded nucleic acid into a single-stranded or partially single-stranded form. Methods for separating the double-stranded nucleic acid include, but are not limited to, heat, alkali, formamide, urea, and glycoxal treatment, enzymatic methods (e.g., helicase action), and binding proteins. For example, strand separation can be achieved by heating at a temperature ranging from 80°C to 105°C. A general method for achieving this treatment is provided by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001).

[0271] Annealing of the primer and target nucleic acid can be performed under suitable hybridization conditions, which are generally determined by optimization procedures. Conditions such as temperature, concentration of components, number of hybridization and washing cycles, buffer components, and their pH and ionic strength can vary depending on various factors, including the length and GC content of the oligonucleotide (primer) and the target nucleic acid. Detailed hybridization conditions can be found in Joseph Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and M. L. M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc., NY (1999).

[0272] The primer annealed to the target nucleic acid is extended by a template-dependent polymerase, which includes the "Klenow" fragment of E. coli DNA polymerase I, a thermostable DNA polymerase, and a bacteriophage T7 DNA polymerase. In one embodiment, the template-dependent polymerase is a thermostable DNA polymerase obtained from a variety of bacterial species.

[0273] When conducting a polymerization reaction, the components required for the reaction may be provided in excess in the reaction vessel. With respect to the components of the extension reaction, excess means an amount of each component such that the ability to achieve the desired extension is not substantially limited by the concentration of said components. In order for the desired reaction to occur, Mg 2+ It is desirable to provide sufficient amounts of necessary cofactors such as dATP, dCTP, dGTP and dTTP to the reaction mixture.

[0274] When using mRNA as a starting material, a reverse transcription step is essential prior to the annealing step, and details thereof are disclosed in the literature [Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and Noonan, KF et al., Nucleic Acids Res. 16:10366 (1988)]. For the reverse transcription reaction, an oligonucleotide dT primer, a random primer, or a target-specific primer capable of hybridizing to the poly A tail of the mRNA can be used.

[0275] According to another embodiment, as a method for amplifying the target nucleic acid, ligase chain reaction (LCR, see Wiedmann M, et al., "Ligase chain reaction (LCR) - overview and applications." PCR Methods and Applications 1994 Feb;3(4):S51-64), gap filling LCR (GLCR, see WO 90 / 01069, European Patent No. 439182 and WO 93 / 00447), Q-beta replicase amplification (Q-beta, see Cahill P, et al., Clin Chem., 37(9):1482-5(1991), US Patent No. 5556751), strand displacement amplification (SDA, see GT Walker et al., Nucleic Acids Res. 20(7):16911696(1992), European Patent No. The amplification method may be, but is not limited to, amplification based on nucleic acid sequence (NASBA; see Compton, J. Nature 350(6313):912(1991)), transcription-mediated amplification (TMA; see Hofmann WP et al., J Clin Virol. 32(4):289-93(2005); U.S. Pat. No. 5888779), rolling circle amplification (RCA; see Hutchison CA et al., Proc. Natl Acad. Sci. USA. 102:1733217336(2005)), recombinase polymerase amplification (RPA), or loop-mediated isothermal amplification (LAMP).

[0276] The amplification method described above can amplify target nucleic acids through repetition of a series of reactions with or without temperature changes. The unit of amplification, which includes repetition of the series of reactions, is expressed as a "cycle." Depending on the amplification method, the unit of the cycle can be expressed as the number of repetitions or time.

[0277] In one embodiment, the above series of reactions may be performed sequentially. For example, in the case of PCR, a denaturation reaction of the target nucleic acid (i.e., template) may be followed by a primer annealing reaction, followed by a primer extension reaction, which may be performed sequentially. In this case, a cycle may be expressed as the number of repetitions.

[0278] In one embodiment, the above series of reactions may be performed simultaneously. For example, in the case of LAMP, an isothermal amplification method, primer annealing may be performed in some templates among multiple templates at the same time, while primer annealing may already be taking place in other templates, resulting in primer extension. In such cases, a cycle may be expressed in terms of time. Specifically, one cycle may be 5 seconds, 10 seconds, 30 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 10 minutes, 20 minutes, 30 minutes, 1 hour, or 2 hours.

[0279] In one embodiment, the incubation may be performed for a number of cycles sufficient to detect a change in signal dependent on the presence of the target nucleic acid. For example, the number of the plurality of cycles is 2 to 100 cycles, 2 to 90 cycles, 2 to 80 cycles, 2 to 70 cycles, 2 to 60 cycles, 2 to 50 cycles, 2 to 40 cycles, 2 to 30 cycles, 2 to 20 cycles, 2 to 10 cycles, 5 to 100 cycles, 5 to 90 cycles, 5 to 80 cycles, 5 to 70 cycles, 5 to 60 cycles, 5 to 50 cycles, 5 to 40 cycles, 5 to 30 cycles, 5 to 20 cycles, 5 to 10 cycles, 10 to 100 cycles, 10 to 90 cycles, 10 to 80 cycles, 10 to 70 cycles, 10 to 60 cycles, 10 to 50 cycles, 10 to 40 cycles, 10 to 30 cycles, It may be 10 to 20 cycles, 20 to 100 cycles, 20 to 90 cycles, 20 to 80 cycles, 20 to 70 cycles, 20 to 60 cycles, 20 to 50 cycles, 20 to 40 cycles or 20 to 30 cycles, and specifically, it may be 10 cycles, 15 cycles, 20 cycles, 25 cycles, 30 cycles, 35 cycles, 40 cycles, 45 cycles or 50 cycles.

[0280] Step (b): Measurement of the signal

[0281] In this step, a signal provided by incubation (specifically, an amplification reaction) between the target nucleic acid and the composition for detecting the target nucleic acid is measured.

[0282] In one embodiment, the measurement of the signal is performed at a temperature selected from the signal-change temperature range (i.e., a detection temperature). Specifically, the measurement of the signal is performed at a temperature at which one of the second hybrid and the third hybrid maintains its double-stranded state and the other dissociates into a single strand.

[0283] In one embodiment, the detection temperature is dependent on the Tms of the first hybrid, the second hybrid and the third hybrid.

[0284] In one embodiment, when a target nucleic acid is present in the sample, formation of the second hybrid is superior to formation of the first hybrid.

[0285] In one embodiment, the measurement of the signal is performed during and / or after the incubation reaction. Specifically, the measurement of the signal may be performed at each cycle of the incubation reaction comprising multiple cycles, at a selected portion of the cycles, or at the end-point of the reaction.

[0286] In one embodiment, the measurement of the signal is performed one or more times.

[0287] In certain embodiments, the measurement of the signal may be performed in at least two cycles.

[0288] In one embodiment, when measuring a signal in multiple cycles in step (b), the first cycle and the last cycle in which the signal is measured may be selected to be separated from each other by at least 1 cycle to 20 cycles. Specifically, the first cycle and the last cycle in which the signal is measured may be selected to be separated from each other by 1 cycle, 2 cycles, 3 cycles, 4 cycles, 5 cycles, 6 cycles, 7 cycles, 8 cycles, 9 cycles, 10 cycles, 11 cycles, 12 cycles, 13 cycles, 14 cycles, 15 cycles, 16 cycles, 17 cycles, 18 cycles, 19 cycles or 20 cycles, and more specifically, may be selected to be separated from each other by 5 cycles, 10 cycles, 15 cycles, 20 cycles or 30 cycles or more.

[0289] In one embodiment, at least one of the cycles in which the signal is measured includes either an intermediate cycle including an exponential phase region or a late cycle including a plateau region. For example, when measuring signals in two cycles, one may be performed in an early cycle including a baseline region, and the other may be performed in either an intermediate or late cycle, or one may be performed in an intermediate cycle, and the other may be performed in either an intermediate or late cycle.

[0290] In one embodiment, the initial cycle includes cycles up to and including the end cycle divided by 3. For example, if the end cycle is 45, since 45 divided by 3 is 15, the initial cycle may be determined as 1 to 20 cycles, 1 to 15 cycles, 1 to 10 cycles, or 1 to 5 cycles. The intermediate cycle may be determined as the end cycle divided by 2 and including cycles. For example, if the end cycle is 45, since 45 divided by 2 is 22.5, the intermediate cycle may be determined as 16 to 30 cycles, 18 to 30 cycles, 20 to 30 cycles, 16 to 27 cycles, 18 to 27 cycles, 20 to 27 cycles, 16 to 25 cycles, 18 to 25 cycles, or 20 to 25 cycles. The terminal cycle may be determined as the final cycle of the amplification reaction or a cycle adjacent to the final cycle. For example, if the final cycle is 45 cycles, the terminal cycle may be between 31 and 45 cycles, 35 and 45 cycles, 38 and 45 cycles, 40 and 45 cycles, or 43 and 45 cycles. The initial cycle, middle cycle, and terminal cycle may vary depending on the number of final cycles of the amplification reaction.

[0291] In another specific embodiment, the measurement of the signal may be performed in one cycle. In one embodiment, the one cycle in which the signal is measured is either an intermediate cycle including an exponential phase region excluding an early cycle including a baseline region, or a late cycle including a plateau region.

[0292] Step (c): Determination of the presence of target nucleic acid

[0293] Finally, the presence of the target nucleic acid is determined from the signal measured in step (b).

[0294] In one embodiment, step (c) detects a change in a signal using a signal measured in at least two cycles in step (b) or a signal measured in at least one cycle and a reference signal value, and if the signal changes, it is determined that the target nucleic acid is present. On the other hand, if the signal is constant, it is determined that the target nucleic acid is absent.

[0295] In one embodiment, the signal change can be detected using signals measured in the at least two cycles. For example, an incubation reaction (e.g., PCR) can be performed for 30 cycles, 40 cycles, 45 cycles, or 50 cycles, and a signal can be measured at a detection temperature for each cycle. The signal values ​​measured in each cycle can then be plotted as an amplification curve (a set of data points consisting of RFU and cycles).

[0296] As used herein, the term "amplification curve" refers to a curve obtained through a signal generation reaction of a target analyte (specifically, a target nucleic acid), particularly an amplification reaction. The amplification curve includes a curve obtained when a target nucleic acid is present in a sample during an amplification reaction, and a curve or line obtained when a target nucleic acid is not present in a sample during an amplification reaction.

[0297] In one embodiment, a signal change or a constant signal can be detected as an indicator of amplification of a target nucleic acid.

[0298] The term "indicator indicating amplification" as used herein refers to an indicator that is closely related to the occurrence of amplification of a target nucleic acid, which can be obtained from the signal provided in step (a). The indicator may refer to a value generated depending on the amplification of the target nucleic acid. The indicator may be an indicator that provides a larger value as the amplification of the target nucleic acid increases (i.e., the amount of the target nucleic acid increases), or an indicator that provides a smaller value as the amplification increases. The indicator may be any indicator that indicates amplification.

[0299] In one embodiment, the indicator may include something obtained from an amplification curve or a melting curve. In particular, the indicator may include a value of a signal at a specific cycle in an amplification curve (e.g., RFU), a value of a signal at each cycle, a difference in a signal value between specific cycles, or a difference in a signal value between a reference signal value and a specific cycle, or a height, width, or area of ​​a maximum melting peak in a melting curve. In one embodiment, the indicator may be, but is not limited to, a Ct (cycle threshold) value, △RFU (e.g., a difference in RFU between two cycles or a difference in RFU between a reference RFU and an RFU at a specific cycle, etc.), an RFU ratio (e.g., a ratio of RFU between two cycles or a ratio of RFU between a reference RFU and an RFU at a specific cycle, etc.), and a melting peak height / area / width (e.g., a height / area / width of a maximum peak in a melting curve).

[0300] In one embodiment, the indicator representing amplification is a Ct value or a Cq value. The concepts of Ct value and Cq value are widely known in the art.

[0301] In one embodiment, the indicator representing amplification is the △RFU or RFU ratio of the RFU values ​​obtained in the amplification reaction. For example, the indicator is the difference (subtraction) or ratio between the RFUs of two cycles, or the difference (subtraction) or ratio between the RFU of a reference RFU and the RFU of a specific cycle.

[0302] In one embodiment, the signal change can be detected using the signal measured in the one cycle and the reference signal value.

[0303] The above "reference signal value" may refer to a value that can be used to determine a signal change dependent on the presence of a target nucleic acid through a separate reaction. In one embodiment, the reference signal value may be obtained from a reaction in which the target nucleic acid is absent at the detection temperature (e.g., a negative control reaction). For example, the reference signal value may be the "signal value at the detection temperature" in the absence of the target nucleic acid.

[0304] In one embodiment, the reference signal value may be a threshold value determined in advance from a negative control reaction, taking into account the background signal of the detector, sensitivity, or the characteristics of the label used. The significance of the signal change can be determined using the threshold value. The threshold value may be determined according to a conventional threshold value setting method. For example, the threshold value may be determined by taking into account the background signal, sensitivity, label characteristics, signal variation of the detector, or the error range.

[0305] In one implementation example, when a threshold value is used as the reference signal value, if the signal value measured in step (b) is equal to or greater than the threshold value, it can be determined that the signal has changed.

[0306] III. Method for detecting multiple target nucleic acids

[0307] In another aspect, the present disclosure provides a method of detecting n target nucleic acids in a sample, comprising:

[0308] (a) a step of incubating a sample suspected of containing one or more of the n target nucleic acids with n target nucleic acid detection compositions in one reaction vessel, and measuring a signal at n detection temperatures;

[0309] The above n is an integer greater than or equal to 2,

[0310] The above incubation comprises multiple reaction cycles, and the measurement of the signal is performed in one or more of the multiple reaction cycles,

[0311] Each of the above n target nucleic acid detection compositions provides a change in a signal indicating the presence of the corresponding target nucleic acid at a corresponding detection temperature among the above n detection temperatures in the presence of the corresponding target nucleic acid,

[0312] Among the above n target nucleic acid detection compositions, the i target nucleic acid detection composition provides a change in a signal indicating the presence of the i target nucleic acid at the i detection temperature among the n detection temperatures in the presence of the i target nucleic acid, and provides a constant signal at other detection temperatures.

[0313] The above i represents an integer from 1 to n, and the i-th detection temperature is lower than the i+1-th detection temperature.

[0314] Within the temperature range including all of the above n detection temperatures, the composition for detecting the i-th target nucleic acid has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the i-th target nucleic acid and one or two signal-constant temperature ranges (SCoTR) in which the signal is constant even when the i-th target nucleic acid is present.

[0315] The composition for detecting the above target nucleic acid is,

[0316] (i) an UnderSC-type composition having a melting characteristic in which the signal-change temperature range is lower than the signal-constant temperature range;

[0317] (ii) an InterSC-type composition having a melting property in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges, and

[0318] (iii) any one of the OverSC-type compositions having a melting characteristic in the signal-change temperature range higher than the signal-constant temperature range;

[0319] At least one of the above n target nucleic acid detection compositions is a composition comprising the above-described reporter probe, the first quencher probe, and the second quencher probe, and;

[0320] (b) A step of determining the presence of n target nucleic acids from the signals measured in the above step (a), wherein the step of determining the presence of the i-th target nucleic acid is based on the signal measured at the i-th detection temperature.

[0321] Since the third aspect of the present disclosure utilizes the composition of the first aspect and the method of the second aspect described above, common content between them is omitted to avoid excessive duplication that would complicate the present specification.

[0322] A method for detecting n target nucleic acids according to the present disclosure uses n compositions for detecting n target nucleic acids, wherein the n compositions include a composition for detecting target nucleic acids comprising at least three probes according to the present disclosure, and can be variously combined with UnderSC-type, InterSC-type and OverSC-type compositions that adopt various signal generation methods known in the art for detecting target nucleic acids.

[0323] In particular, the method for detecting n target nucleic acids according to the present disclosure controls the signal-change temperature ranges of n compositions for detecting n target nucleic acids so that only a signal (specifically, a signal change) indicating the presence of the corresponding target nucleic acid is provided at each detection temperature, thereby enabling the presence of a specific target nucleic acid to be confirmed by a signal change detected only at a specific detection temperature.

[0324] Hereinafter, the present disclosure will be described in detail as follows.

[0325] First, a sample suspected of containing one or more of the n target nucleic acids is mixed with n target nucleic acid detection compositions in one reaction vessel and incubated.

[0326] In one embodiment, the n target nucleic acids may comprise nucleotide variations. For example, one of the n target nucleic acids may comprise one type of nucleotide variation, and the other may comprise a different type of nucleotide variation.

[0327] The n target nucleic acids herein may be genes from n different organisms, n different genes from the same organism, or a combination thereof.

[0328] In the present invention, the incubation reaction means any reaction that induces a change in signal dependent on the presence of the corresponding target nucleic acid at the corresponding detection temperature, as each target nucleic acid reacts with the corresponding target nucleic acid detection composition.

[0329] In the present disclosure, incubation comprises multiple cycles.

[0330] In one embodiment, the incubation of step (a) may include an amplification reaction, such as a signal amplification reaction and / or a nucleic acid amplification reaction.

[0331] In one embodiment, the amplification reaction comprises multiple cycles.

[0332] In one embodiment, the incubation of step (a) is performed under conditions that allow target amplification along with signal changes by the composition for detecting target nucleic acids. These conditions include the temperature, salt concentration, and pH of the solution.

[0333] In one embodiment, the incubation of step (a) is performed in a signal amplification process without nucleic acid amplification.

[0334] In one embodiment, the signal may be amplified simultaneously with the amplification of the target nucleic acid. Alternatively, the signal may be amplified without amplification of the target nucleic acid.

[0335] In one embodiment, the signal change occurs in a process that includes signal amplification and amplification of the target nucleic acid.

[0336] Amplification of the target nucleic acid can be described in detail with reference to the description of the second aspect described above.

[0337] In one embodiment, the amplification reaction of the target nucleic acid may be a multiple target nucleic acid sequence amplification reaction.

[0338] The term "multiple target nucleic acid amplification reaction" as used herein refers to a reaction that targets two or more nucleic acids and amplifies them in a single reaction vessel. A multiple target nucleic acid amplification reaction refers to a reaction that amplifies two or more nucleic acids together. For example, a multiple target nucleic acid amplification reaction can amplify two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, twenty or more, thirty or more, forty or more, or fifty or more target nucleic acids together in a single reaction.

[0339] In one embodiment, the method according to the present disclosure comprises using a single type of label in one reaction vessel to produce 2 to 50, 2 to 40, 2 to 30, 2 to 20, 2 to 15, 2 to 12, 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 3 to 50, 3 to 40, 3 to 30, 3 to 20, 3 to 15, 3 to 12, 3 to 10, 3 to 9, 3 to 8, 3 to 7, 3 to 6, 3 to 5, 4 to 50, 4 to 40, 4 to 30, 4 to 20, 4 to 15, 4 to 12, 4 to 10, 4 to 9, 4 to 8, 4 to 7, 4 to 6 or 4 to 5 target nucleic acids can be detected.

[0340] A method according to the present disclosure is used to determine whether at least one of n target nucleic acids is present in a sample. For example, when n is 2, the present disclosure can be used to determine whether at least one of a first target nucleic acid and a second target nucleic acid is present in the sample. As another example, when n is 3, the present disclosure can be used to determine whether at least one of a first target nucleic acid, a second target nucleic acid, and a third target nucleic acid is present in the sample.

[0341] In one embodiment, n is an integer greater than or equal to 2. For example, n may be, but is not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, or 50.

[0342] The present disclosure provides a method for detecting n target nucleic acid detection compositions, wherein a combination of n target nucleic acid detection compositions is used to detect n target nucleic acids (where n is an integer greater than or equal to 2). That is, a combination of first to n target nucleic acid detection compositions is used to detect first to n target nucleic acids.

[0343] As used herein, the term "combination of first through n-th target nucleic acid detection compositions" refers to a compilation or mixture of compositions that are specific for each of the first through n-th target nucleic acids. As used herein, one target nucleic acid detection composition is specific for one corresponding target nucleic acid. The expression "one target nucleic acid detection composition is specific for one corresponding target nucleic acid" means that the target nucleic acid detection composition is involved in the detection of the one corresponding target nucleic acid but is not involved in the detection of other target nucleic acids. In other words, the expression means that the target nucleic acid detection composition interacts with one corresponding target nucleic acid but does not interact with other target nucleic acids.

[0344] In the present invention, the composition for detecting the nth target nucleic acid is specific to the nth target nucleic acid, for example, the composition for detecting the first target nucleic acid is specific to the first target nucleic acid, the composition for detecting the second target nucleic acid is specific to the second target nucleic acid, and the composition for detecting the third target nucleic acid is specific to the third target nucleic acid.

[0345] The combination of the first to nth target nucleic acid detection compositions used herein is used together in a single reaction. That is, the first to nth target nucleic acid detection compositions exist together in a single reaction solution or reaction vessel.

[0346] The term "composition for detecting a target nucleic acid" as used herein means a composition containing components used to detect a target nucleic acid.

[0347] According to the method of the present disclosure, each of the first to nth target nucleic acid detection compositions includes a label that provides a signal dependent on the presence of a corresponding target nucleic acid among the first to nth target nucleic acids, and the signals provided from each of the first to nth target nucleic acid detection compositions are not distinguished from each other by a single detection channel.

[0348] A composition for detecting a target nucleic acid may include various oligonucleotides involved in amplification and / or detection of the target nucleic acid.

[0349] The label herein may be linked to the oligonucleotide or present in a free form. Alternatively, the label may be incorporated into the oligonucleotide during the incubation.

[0350] It should be noted that the above-mentioned labels and oligonucleotides are only mentioned as core elements in the composition for detecting the first to nth target nucleic acids, and that various components may be additionally included in addition to the labels and oligonucleotides.

[0351] Examples of components included in the composition for detecting the target nucleic acid include, but are not limited to, an oligonucleotide set used to amplify or detect the target nucleic acid, a label, a nucleic acid polymerase, a buffer, a polymerase cofactor, and deoxyribonucleotide-5-triphosphate. Optionally, the composition may also include various polynucleotide molecules, a reverse transcriptase, various buffers and reagents, and an antibody that inhibits DNA polymerase activity. The composition may also include reagents necessary for conducting positive control and negative control reactions. The optimal amount of reagents to be used in a particular reaction can be readily determined by one of ordinary skill in the art having the benefit of the present disclosure. The components of the composition may be present in separate containers, or multiple components may be present in a single container.

[0352] According to one embodiment, when n is 2, the first target nucleic acid detection composition is an UnderSC-type or InterSC-type composition, and the second target nucleic acid detection composition is an InterSC-type or OverSC-type composition.

[0353] According to one embodiment, when the above n is 3 or more, the first target nucleic acid detection composition is an UnderSC-type or InterSC-type composition, the n-th target nucleic acid detection composition is an InterSC-type or OverSC-type composition, and the remaining compositions except the first and n-th target nucleic acid detection compositions are InterSC-type compositions.

[0354] The n target nucleic acid detection compositions used in the present disclosure are each one of (i) an UnderSC-type composition, (ii) an InterSC-type composition, and (iii) an OverSC-type composition, and at least one of the n target nucleic acid detection compositions is an InterSC-type composition, wherein the target nucleic acid detection composition comprises three probes according to the present disclosure. For example, when n is 2, at least one of the first target nucleic acid detection composition and the second target nucleic acid detection composition is a target nucleic acid detection composition comprising three probes. Specifically, when n is 2, exemplary combinations of the first target nucleic acid detection composition and the second target nucleic acid detection composition are as shown in Table 1 below. When n is 3, exemplary combinations of the first to third target nucleic acid detection compositions are as shown in Table 2.

[0355] In Tables 1 and 2, “UnderSC,” “InterSC,” and “OverSC” refer to UnderSC-type, InterSC-type, and OverSC-type compositions, respectively.

[0356] n=2 1st target 2nd target 1UnderSC Composition according to the present disclosure 2 Composition according to the present disclosure 3 Composition according to the present disclosure InterSC 4InterSC Composition according to the present disclosure 5 Composition according to the present disclosure OverSC

[0357] n=3 1st target 2nd target 3rd target 1 Composition according to the present disclosure InterSC InterSC 2 Composition according to the present disclosure InterSC OverSC 3 UnderSC Composition according to the present disclosure InterSC 4 UnderSC Composition according to the present disclosure OverSC 5 InterSC Composition according to the present disclosure InterSC 6 InterSC Composition according to the present disclosure OverSC 7 UnderSC InterSC Composition according to the present disclosure 8 InterSC InterSC Composition according to the present disclosure 9 Composition according to the present disclosure InterSC 10 Composition according to the present disclosure OverSC 11 Composition according to the present disclosure InterSC Composition according to the present disclosure 12 UnderSC Composition according to the present disclosure 13 InterSC Composition according to the present disclosure 14 Composition according to the present disclosure Composition according to the present disclosure

[0358] A specific description of the above UnderSC-type, InterSC-type and OverSC-type compositions can be found in WO2022-265463, which is incorporated herein by reference in its entirety.

[0359] In one embodiment, each of the n target nucleic acid detection compositions provides a change in signal indicating the presence of a corresponding target nucleic acid at a corresponding detection temperature among the n detection temperatures.

[0360] For example, the composition for detecting the i-th target nucleic acid among the n target nucleic acids provides a signal change at the i-th detection temperature among the n detection temperatures in the presence of the i-th target nucleic acid, and provides a constant signal at other detection temperatures.

[0361] In one embodiment, i represents an integer from 1 to n, and the i-th detection temperature is lower than the i+1-th detection temperature. In one embodiment, when i is n, the i+1 detection temperature (i.e., the n+1 detection temperature) does not exist. For example, when n is 3, i represents an integer from 1 to 3, a first detection temperature, a second detection temperature, and a third detection temperature exist, and the first detection temperature is lower than the second detection temperature, and the second detection temperature is lower than the third detection temperature.

[0362] In one embodiment, the composition for detecting the i-th target nucleic acid provides a signal change (i.e., a change in the i-th signal) according to the amplification of the target nucleic acid at the i-th detection temperature when the i-th target nucleic acid is present, whereas at detection temperatures other than the i-th detection temperature, the composition does not provide a signal change (i.e., the signal is constant) even if the target nucleic acid is amplified. That is, the composition for detecting the i-th target nucleic acid has a signal-change temperature range in which the signal changes according to the amplification of the i-th target nucleic acid and a signal-constant temperature range in which the signal is constant even when the i-th target nucleic acid is amplified.

[0363] The term "i signal" used herein means a signal provided by a composition for detecting i target nucleic acid at an i detection temperature, and is used interchangeably with "signal at the i detection temperature."

[0364] In one embodiment, when detecting n target nucleic acids, the i signal may mean a signal provided by n target nucleic acid detection compositions including the i target nucleic acid detection composition at the i detection temperature.

[0365] In one embodiment, the composition for detecting the i-th target nucleic acid provides a constant signal without changing the signal at the i-th detection temperature during an incubation reaction (e.g., a target nucleic acid amplification reaction) when the i-th target nucleic acid is not present.

[0366] In one embodiment, the signal-change temperature range is a temperature range in which a difference in signal value (e.g., signal intensity) occurs depending on the presence or absence of a target nucleic acid.

[0367] In one embodiment, the signal-change temperature range is a temperature range in which the signal value changes depending on the degree of amplification of the target nucleic acid (e.g., the amount of amplified target nucleic acid).

[0368] In one embodiment, the signal-constant temperature range is a temperature range in which the signal value does not change regardless of the presence of the target nucleic acid. In other words, the signal-constant temperature range is a temperature range in which there is no difference between the signal value when the target nucleic acid is present and the signal value when the target nucleic acid is not present.

[0369] In one embodiment, the i detection temperature may be selected within the signal change temperature range of the i target nucleic acid detection composition. In this case, the i target nucleic acid detection composition is referred to herein as having the i detection temperature. Furthermore, the i target nucleic acid corresponding to the i target nucleic acid detection composition may be referred to as a target nucleic acid having the i detection temperature.

[0370] In one embodiment, one detection temperature determined by the corresponding target nucleic acid detection composition is assigned to one target nucleic acid.

[0371] In a specific implementation example, when n is 2, the first target nucleic acid detection composition provides a change in signal at a first detection temperature in the presence of the first target nucleic acid, and a constant signal at another detection temperature, i.e., a second detection temperature; and the second target nucleic acid detection composition provides a change in signal at a second detection temperature in the presence of the second target nucleic acid, and a constant signal at another detection temperature, i.e., the first detection temperature.

[0372] In another specific embodiment, when n is 3, the first target nucleic acid detection composition provides a change in signal at a first detection temperature in the presence of the first target nucleic acid, and provides a constant signal at other detection temperatures, i.e., a second detection temperature and a third detection temperature; the second target nucleic acid detection composition provides a change in signal at a second detection temperature in the presence of the second target nucleic acid, and provides a constant signal at other detection temperatures, i.e., a first detection temperature and a third detection temperature; and the third target nucleic acid detection composition provides a change in signal at a third detection temperature in the presence of the third target nucleic acid, and provides a constant signal at other detection temperatures, i.e., a first detection temperature and a second detection temperature.

[0373] In one embodiment, the i detection temperature is selected within the signal-change temperature range of the i target nucleic acid detection composition, and the i detection temperature is not included in the signal-change temperature range of another target nucleic acid detection composition.

[0374] In one embodiment, the signal-change temperature range of any one of the target nucleic acid detection compositions may overlap with the signal-change temperature range of a target nucleic acid detection composition having an adjacent detection temperature, but may not overlap with the signal-change temperature range of a target nucleic acid detection composition having a non-adjacent detection temperature. In this case, the detection temperature of the target nucleic acid detection composition having a signal-change temperature range overlapping with the signal-change temperature range of another target nucleic acid detection composition is selected from a temperature range among the signal-change temperature ranges that does not overlap with the signal-change temperature range of the other target nucleic acid detection composition. By selecting the detection temperature in a temperature range where the signal-change temperature ranges do not overlap, only a signal indicating the presence of one specific target nucleic acid can be provided at one detection temperature.

[0375] In one embodiment, the signal-change temperature range of one of the target nucleic acid detection compositions may overlap with the signal-change temperature range of a target nucleic acid detection composition having an adjacent detection temperature, but neither of the two signal-change temperature ranges is completely contained within the other signal-change temperature range.

[0376] The term "adjacent detection temperature" is used to refer to consecutive detection temperatures among n detection temperatures, for example, the adjacent detection temperature of the i-th detection temperature is the i-1-th detection temperature or the i+1-th detection temperature.

[0377] In one embodiment, the signal-change temperature range of the i-target nucleic acid detection composition may partially overlap with the signal-change temperature range of the target nucleic acid detection composition having an adjacent detection temperature, but does not overlap with the signal-change temperature range of the target nucleic acid detection composition having a non-adjacent detection temperature.

[0378] In one embodiment, the composition for detecting the i-target nucleic acid comprises a label that provides a signal dependent on the presence of the i-target nucleic acid.

[0379] In one embodiment, the label may be linked to the oligonucleotide or may be present in a free form. Alternatively, the label may be incorporated into the oligonucleotide during the incubation (e.g., a nucleic acid amplification reaction). That is, the composition for detecting a target nucleic acid may initially include an oligonucleotide to which the label is linked, or the label may be incorporated into a newly generated oligonucleotide (e.g., an extended strand) during the incubation reaction, thereby providing a labeled oligonucleotide.

[0380] In one embodiment, the composition for detecting the i-target nucleic acid comprises an incorporating label that is incorporated into the oligonucleotide during incubation and provides a signal dependent on the presence of the i-target nucleic acid.

[0381] In one embodiment, the composition for detecting the i-target nucleic acid provides a label-linked oligonucleotide that serves to provide a signal dependent on the presence of the i-target nucleic acid.

[0382] In one embodiment, the composition for detecting the i-th target nucleic acid initially includes a labeled oligonucleotide that provides a signal dependent on the presence of the i-th target nucleic acid. The reporter probe, the first quencher probe, and the second quencher probe are examples of the labeled oligonucleotides herein.

[0383] Alternatively, the composition for detecting the i-th target nucleic acid may include a label and an oligonucleotide that provide a signal dependent on the presence of the i-th target nucleic acid, and the label may be incorporated into the oligonucleotide during an incubation reaction (e.g., a nucleic acid amplification reaction) to provide a label-linked oligonucleotide that serves to provide a signal dependent on the presence of the i-th target nucleic acid.

[0384] The term "label-linked oligonucleotide" as used herein is an oligonucleotide that is involved in the generation of a detectable signal.

[0385] In one embodiment, the label-linked oligonucleotide may comprise an oligonucleotide (e.g., a probe or a primer) that specifically hybridizes to a target nucleic acid; when the probe or primer hybridized to the target nucleic acid is cleaved to release a fragment, the label-linked oligonucleotide may comprise a capture oligonucleotide that specifically hybridizes to the fragment; when the fragment hybridized to the capture oligonucleotide is extended to form an extended strand, the label-linked oligonucleotide may comprise an oligonucleotide that specifically hybridizes to the extended strand, an oligonucleotide generated by insertion of a label during extension of the fragment, an oligonucleotide that specifically hybridizes to the capture oligonucleotide, and combinations thereof.

[0386] In one embodiment, the label-linked oligonucleotide comprises an oligonucleotide that is involved in actual signal generation. For example, hybridization or non-hybridization of the label-linked oligonucleotide with another oligonucleotide (e.g., the label-linked oligonucleotide or an oligonucleotide comprising a nucleotide sequence complementary to the target nucleic acid) determines signal generation.

[0387] In one embodiment, the oligonucleotide to which the label is linked may be a "probe" known in the art. In one embodiment, the 3'-end of the probe is "blocked" to prevent its extension. Blocking can be achieved using conventional methods.

[0388] In one embodiment, the label-linked oligonucleotide may be comprised of at least one oligonucleotide. In another embodiment, if the label-linked oligonucleotide is comprised of multiple oligonucleotides, the label-linked oligonucleotide may be labeled in various ways. For example, all or some of the multiple oligonucleotides may have at least one label.

[0389] In one embodiment, the label may be a single label or an interactive label.

[0390] For example, the single label includes a fluorescent label, a luminescent label, a chemiluminescent label, an electrochemical label, and a metal label. In one embodiment, the single label provides different signals (e.g., different signal intensities) depending on whether it is present in a double strand or a single strand. In one embodiment, the single label is a fluorescent label. Preferred types and binding sites of the single fluorescent labels used in the present disclosure are disclosed in U.S. Patent Nos. 7,537,886 and 7,348,141, the teachings of which are incorporated herein by reference in their entirety. For example, the single fluorescent labels include JOE, FAM, TAMRA, ROX, and fluorescein-based labels. The single label can be linked to the oligonucleotide by various methods. For example, the label is linked to the probe via a spacer comprising a carbon atom (e.g., a 3-carbon spacer, a 6-carbon spacer, or a 12-carbon spacer).

[0391] In one embodiment, the interaction label may be an interaction label comprising at least one reporter molecule and at least one quencher molecule. Specifically, the interaction label may be an interaction dual label comprising one reporter molecule and one quencher molecule. Alternatively, the interaction label may be an interaction label comprising one reporter molecule and two quencher molecules.

[0392] Reporter molecules and quencher molecules useful in the present disclosure may include any molecules known in the art, for detailed descriptions of which see the section describing reporter molecules and quencher molecules in the first aspect described above.

[0393] In one embodiment, when the label is an interaction label, the interaction label may be an interaction label comprising at least one reporter molecule and at least one quencher molecule, and the interaction labels may be all linked to one oligonucleotide, or may be linked to each of a plurality of oligonucleotides.

[0394] In one embodiment, the insertion label can be used in a process of generating a signal by inserting the label during primer extension (e.g., the Plexor method, Sherrill CB, et al., Journal of the American Chemical Society, 126:4550-45569 (2004)). The insertion label can also be used in signal generation by a duplex formed in a manner dependent on the cleavage of an intermediate oligonucleotide hybridized to the target nucleic acid sequence.

[0395] In one embodiment, the insertion marker may generally be linked to a nucleotide. Additionally, nucleotides having non-natural bases may also be used.

[0396] As used herein, the term "non-natural base" refers to derivatives of natural bases such as adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U), which can form hydrogen-bonded base pairs. The term "non-natural base" as used herein includes bases that have base pairing patterns that are different from those of natural bases as their mother compounds, and are described, for example, in U.S. Patent Nos. 5,432,272, 5,965,364, 6,001,983, and 6,037,120. Base pairing between non-natural bases involves two or three hydrogen bonds, like natural bases. Base pairing between non-natural bases also occurs in specific ways. Specific examples of unnatural bases include the following base pair combinations: iso-C / iso-G, iso-dC / iso-dG, Z / P, V / J, K / X, H / J, Pa / Ds, Pa / Q, Pn / Ds, Pn / Dss, Px / Ds, NaM / 5SICS, 5FM / 5SICS, and M / N (see US Pat. Nos. 5,432,272; 5,965,364; 6,001,983; 6,037,120; 6,140,496; 6,627,456; 6,617,106; and 7,422,850; and Filip Wojciechowski et al., Chem. Soc. Rev., 2011, 40, 5669-5679).

[0397] Conventional methods for detecting multiple target nucleic acids have the disadvantage of requiring the use of different types of fluorescent labels for different target nucleic acids, or requiring additional analysis, such as melting curve analysis, even when using a single type of fluorescent label. In contrast, the method according to the present disclosure utilizes a composition for detecting target nucleic acids that provides a dimer, thereby enabling the real-time detection of multiple target nucleic acids using a single type of label (e.g., one fluorescent label) without the need for additional analysis, such as melting curve analysis.

[0398] In one embodiment, each of the n target nucleic acid detection compositions provides one or more dimers.

[0399] The term "duplex" as used herein refers to a double-stranded nucleic acid molecule formed by hybridization under hybridization conditions of two single-stranded nucleic acid molecules having partially or fully complementary sequences. The two single-strands forming the duplex may exist in an associated form (i.e., a double-stranded molecule) or a dissociated form (i.e., two single-stranded molecules) depending on the temperature (particularly, the detection temperature). In this respect, with respect to the expression "a composition for detecting a target nucleic acid provides a duplex," the term "duplex" may be used to encompass both an associated form of the duplex and a dissociated form of the duplex.

[0400] In one embodiment, the dimer may be referred to as a “hybrid.”

[0401] As described above, the expression "the composition for detecting a target nucleic acid provides a dimer" as used herein may mean providing a dimer in an associated form and / or a dissociated form. Similarly, the expression "the composition for detecting a target nucleic acid generates a dimer during incubation" as used herein may mean generating a dimer in an associated form and / or a dissociated form during the incubation reaction.

[0402] In one embodiment, at least one of the dimers provided by the composition for detecting the target nucleic acid is a dimer that provides a signal. In particular, the dimer is a dimer that provides a signal change. That is, the composition for detecting the i-th target nucleic acid provides a dimer that provides a signal, and specifically, the composition for detecting the i-th target nucleic acid provides a dimer that provides a signal change dependent on the presence of the i-th target nucleic acid.

[0403] The term "signal-providing dimer" as used herein refers to a dimer capable of providing a signal that can be distinguished depending on whether the dimer is in a bound or dissociated state. For example, this means that the bound form of the dimer generates (or extinguishes) a signal, and the dissociated form of the dimer extinguishes (or generates) a signal.

[0404] In one embodiment, the signal-providing dimer may comprise at least one label.

[0405] The term "dimer providing a signal change" as used herein refers to a dimer whose content changes depending on the presence of the target nucleic acid, thereby providing a signal change indicating the presence of the target nucleic acid. For example, the first hybrid, second hybrid, and third hybrid described above are examples of dimers providing a signal change described herein.

[0406] In one embodiment, the dimer providing the signal change comprises a label. Specifically, at least one label is linked to at least one of the two single strands constituting the dimer. For example, the dimer providing the signal change comprises a single label, in which case the single label is linked to either one of the two single strands constituting the dimer. In another example, the dimer providing the signal change comprises an interaction label, in which case the interaction label is linked to both of the two strands constituting the dimer providing the signal change, or one of the interaction labels is linked to either one of the two single strands and the other of the interaction labels is linked to the other of the two single strands.

[0407] In one embodiment, the association and dissociation of the dimer may be caused by temperature.

[0408] In one embodiment, the dimer providing the signal change may be a dimer that is originally included in the composition for detecting a target nucleic acid.

[0409] In one embodiment, when the dimer providing the signal change is initially included in the composition for detecting a target nucleic acid, the dimer may be generated by hybridization between a label-linked oligonucleotide and an oligonucleotide capable of hybridizing with the label-linked oligonucleotide. In the present disclosure, the first hybridization between a reporter probe and a first quencher probe is an example.

[0410] In one embodiment, when the dimer providing the signal change is initially included in the composition for detecting the target nucleic acid, the content of the dimer providing the signal change varies depending on the presence of the target nucleic acid, specifically, the content decreases, thereby providing the signal change. For example, the content of the first hybridization product decreases while generating a second hybridization product between the reporter probe and the target nucleic acid depending on the presence of the target nucleic acid, thereby providing a signal change depending on the presence of the target nucleic acid.

[0411] In one embodiment, the duplex that provides the signal change generated during the incubation reaction may be provided by hybridization between a label-linked oligonucleotide and the target nucleic acid. Examples of the second and third hybrids in the present disclosure include:

[0412] The signal by the formation of a dimer between the label-linked oligonucleotide and the target nucleic acid can be obtained by the Scorpion method (Whitcombe et al., Nature Biotechnology 17:804-807 (1999)), the Sunrise (or Amplifluor) method (Nazarenko et al., Nucleic Acids Research, 25(12):2516-2521 (1997), and U.S. Patent No. 6,117,635), the Lux method (U.S. Patent No. 7,537,886), the Plexor method (Sherrill CB, et al., Journal of the American Chemical Society, 126:4550-4556 (2004)), the molecular beacon method (Tyagi et al., Nature Biotechnology v. 14 MARCH 1996), and the Hybeacon method (French DJ et al., Mol. Cell Probes, 15(6):363-374(2001)), adjacent hybridization probe method (Bernard PS et al., Anal. Biochem., 273:221(1999)), and LNA method (U.S. Patent No. 6,977,295).

[0413] In one embodiment, the signal change is caused by a duplex formed in a manner dependent on the cleavage of an intermediate oligonucleotide that hybridizes specifically to the target nucleic acid.

[0414] The term "mediation oligonucleotide" as used herein is an oligonucleotide that mediates the formation of a duplex that does not include a target nucleic acid.

[0415] In one embodiment, cleavage of the intermediate oligonucleotide itself does not generate a signal, but rather, after hybridization and cleavage of the intermediate oligonucleotide, the fragment (cleavage product) generated by the cleavage participates in a continuous reaction for signal generation.

[0416] In one embodiment, hybridization or cleavage of the intermediate oligonucleotide itself does not generate a signal.

[0417] In one embodiment, the mediating oligonucleotide comprises an oligonucleotide that mediates the formation of a duplex by hybridizing to a target nucleic acid and cleaving it to release a fragment.

[0418] In one embodiment, the fragment mediates the formation of a duplex by extension of the fragment onto a capture oligonucleotide.

[0419] In one embodiment, the intermediate oligonucleotide comprises (i) a targeting moiety comprising a nucleotide sequence that hybridizes to a target nucleic acid and (ii) a tagging moiety comprising a nucleotide sequence that non-hybridizes to the target nucleic acid.

[0420] In one embodiment, the composition for detecting the target nucleic acid comprises a tagging oligonucleotide that hybridizes to the target nucleic acid, and the cleavage reaction dependent on the presence of the target nucleic acid may comprise cleavage of the tagging oligonucleotide. The tagging oligonucleotide corresponds to an example of the aforementioned intermediate oligonucleotide.

[0421] In one embodiment, cleavage of the intermediate oligonucleotide releases a fragment that specifically hybridizes to the capture oligonucleotide and extends onto the capture oligonucleotide. If the capture oligonucleotide comprises a label, the capture oligonucleotide is an example of an oligonucleotide to which a label is linked herein.

[0422] In one embodiment, a mediating oligonucleotide hybridized to a target nucleic acid is cleaved to release a fragment, which specifically hybridizes to a capture oligonucleotide, which extends to produce an extended strand, which causes formation of an extended duplex between the extended strand and the capture oligonucleotide, thereby providing a signal indicating the presence of the target nucleic acid.

[0423] In one embodiment, a third oligonucleotide comprising a nucleotide sequence that hybridizes to the extended strand may be additionally used. When the third oligonucleotide is used, hybridization of the third oligonucleotide and the extended strand forms a different type of duplex, thereby providing a signal indicating the presence of the target nucleic acid (e.g., PCE-SH). In this case, the different type of duplex is the duplex that provides the signal change.

[0424] The signal by the dimer generated in a manner dependent on the cleavage of the above-mentioned intermediate oligonucleotide can be generated by various methods including the PTO cleavage and extension (PTOCE) method (WO 2012 / 096523), the PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization (PCE-SH) method (WO 2013 / 115442), and the PTO Cleavage and Extension-Dependent Non-Hybridization (PCE-NH) method (WO 2014 / 104818).

[0425] In connection with the terms disclosed in the above-mentioned references, corresponding examples of oligonucleotides are as follows: the intermediate oligonucleotide corresponds to a probing and tagging oligonucleotide (PTO), the capture oligonucleotide corresponds to a capturing and templating oligonucleotide (CTO), and the third oligonucleotide corresponds to a signaling oligonucleotide (SO) or a hybridization oligonucleotide (HO). The SO, HO, CTO, the extension strand, or a combination thereof can serve as the oligonucleotide to which the label is linked.

[0426] In one embodiment, the dimer providing the signal change may be a single-type dimer or a multi-type dimer. Specifically, when the dimer providing the signal change is a single-type dimer, the number of the dimers may be 1, and when the dimer providing the signal change is a multi-type dimer, the number of the dimers may be 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20, more specifically, 2, 3, or 4, and even more specifically, 2 or 3.

[0427] In one embodiment, when the dimer providing the signal change is a single-type dimer, the content of the single-type dimer changes depending on the presence of the target nucleic acid, thereby changing the signal.

[0428] In one embodiment, when the dimer is a multi-type dimer, the content ratio between the multi-type dimers changes depending on the presence of the target nucleic acid, thereby changing the signal.

[0429] In one embodiment, the Tm values ​​of the multiple-type dimers are different from each other. For example, the Tm values ​​between the dimers are different from each other by at least 2°C, 3°C, 4°C, 5°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, or 20°C.

[0430] In one embodiment, the content of the dimer means the sum of the amount of the dimer in a state where the two nucleic acid strands constituting the dimer are dissociated (i.e., the dimer in a dissociated form) and the amount of the dimer in a state where the two nucleic acid strands are hybridized (i.e., the dimer in a bound form).

[0431] In one embodiment, at least two of the multi-type duplexers comprise the same single strand. When the multi-type duplexers comprise the same single strand, the same single strand is included in the first duplex that is initially included in the composition for detecting a target nucleic acid, and a new second duplex comprising the same single strand is generated during the incubation reaction. In this case, the same single strand that was included in the first duplex may be considered to be consumed during the incubation reaction to generate the second duplex, and thus, the content of the first duplex comprising the same single strand may be considered to decrease, and the content of the second duplex comprising the same single strand may be considered to increase.

[0432] In one embodiment, the signal-change temperature range of the composition for detecting the i-target nucleic acid can be determined depending on the length and / or sequence of the dimer providing the signal change.

[0433] In one embodiment, when the composition for detecting the i-th target nucleic acid provides a single-type duplex, the composition for detecting the i-th target nucleic acid may have one signal-change temperature range and one signal-constant temperature range. The signal-change range and the signal-constant temperature range may be determined depending on the length and / or sequence of the single-type duplex.

[0434] In one embodiment, when the composition for detecting the i-th target nucleic acid provides multiple types of dimers, specifically, two types of dimers, the composition for detecting the i-th target nucleic acid may have one signal-change temperature range and two signal-constant temperature ranges. The signal-change range and the signal-constant temperature range may be determined depending on the length and / or sequence of the two types of dimers.

[0435] In one embodiment, any one of the n target nucleic acid detection compositions may include an amplification oligonucleotide that serves to amplify the corresponding target nucleic acid. In one embodiment, the amplification oligonucleotide may be identical to the oligonucleotide to which the label is linked.

[0436] In this application, “amplification oligonucleotide” refers to a general term for oligonucleotides that serve to amplify a target nucleic acid.

[0437] In one embodiment, the amplification oligonucleotide may be a 'primer' known in the art.

[0438] The fact that the amplifying oligonucleotide and the labeled oligonucleotide are identical means that one oligonucleotide functions both as an amplifying oligonucleotide that amplifies the target nucleic acid and as a labeled oligonucleotide that generates a signal in the presence of the target nucleic acid. For example, a labeled oligonucleotide can hybridize with the target nucleic acid, extending the target nucleic acid and generating a signal.

[0439] It should be noted that the composition for detecting a target nucleic acid used in the present disclosure does not provide a signal at all temperatures in the presence of the target nucleic acid.

[0440] In one embodiment, even if the signal generation methods of the target nucleic acid detection compositions are the same, target nucleic acid detection compositions containing oligonucleotides of different sequences may be considered different from each other. The different target nucleic acid detection compositions have different detection temperatures.

[0441] In one embodiment, the detection temperature according to the present disclosure can be determined in advance by considering the signal-change temperature ranges of each of the n target nucleic acid detection compositions.

[0442] In one embodiment, the signal-change temperature range of any one of the n target nucleic acid detection compositions can be determined dependently on the length and / or sequence of the dimer. That is, by controlling the Tm value of the dimer, the signal-change temperature range can be determined in advance.

[0443] In one embodiment, when the signal change is caused by a label-linked oligonucleotide (e.g., a molecular beacon) that specifically hybridizes to the target nucleic acid, measurement of the signal can be successfully achieved at a predetermined detection temperature by adjusting the Tm value of the label-linked oligonucleotide.

[0444] In one embodiment, when the signal is generated by a dimer generated in response to the presence of the target nucleic acid, measurement of the signal is successfully achieved at a predetermined temperature by controlling the Tm of the dimer.

[0445] As described above, the detection temperature is determined by considering the signal-change temperature range that depends on the dimer provided by the composition for detecting target nucleic acid.

[0446] In one embodiment, the detection temperature of any one of the n compositions for detecting n target nucleic acids can be predetermined within a signal-change temperature range that does not overlap with the signal-change temperature ranges of the other compositions.

[0447] In one embodiment, the detection temperatures assigned to the composition for detecting target nucleic acid differ from each other by at least 2°C, 3°C, 4°C, 5°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 15°C or 20°C.

[0448] In one embodiment, the n detection temperatures are 45°C to 97°C, 45°C to 96°C, 45°C to 95°C, 45°C to 94°C, 45°C to 93°C, 45°C to 92°C, 45°C to 91°C, 45°C to 90°C, 46°C to 97°C, 46°C to 96°C, 46°C to 95°C, 46°C to 94°C, 46°C to 93°C, 46°C to 92°C, 46°C to 91°C, 46°C to 90°C, 47°C to 97°C, 47°C to 96°C, 47°C to 95°C, 47°C to 94°C, 47°C to 93°C, 47°C to 92°C, 47°C to 91°C, 47℃ to 90℃, 48℃ to 97℃, 48℃ to 96℃, 48℃ to 95℃, 48℃ to 94℃, 48℃ to 93℃, 48℃ to 92℃, 48℃ to 91℃, 48℃ to 90℃, 49℃ to 97℃, 49℃ to 96℃, 49℃ to 95℃, 49℃ to 94℃, 49℃ to 93℃, 49℃ to 92℃, 49℃ to 91℃, 49℃ to 90℃, 50℃ to 97℃, 50℃ to 96℃, 50℃ to 95℃, 50℃ to 94℃, 50℃ to 93℃, 50℃ to 92℃, 50℃ to 91℃ or 50℃ to It can be selected from a temperature range of 90℃.

[0449] For example, the highest detection temperature among the above detection temperatures (i.e., the nth detection temperature) is 70°C to 97°C, 70°C to 95°C, 70°C to 93°C, 70°C to 90°C, 73°C to 97°C, 73°C to 95°C, 73°C to 93°C, 73°C to 90°C, 75°C to 97°C, 75°C to 95°C, 75°C to 93°C, 75°C to 90°C, 78°C to 97°C, 78°C to 95°C, 78°C to 93°C, 78°C to 90°C, 80°C to 97°C, 80°C to 95°C, 80°C to 93°C, 80°C to 90°C, 83°C to 97°C, 83°C to 95°C, It can be selected from the temperature range of 83°C to 93, 83°C to 90, 85°C to 97°C, 85°C to 95°C, 85°C to 93°C or 85°C to 90°C.

[0450] For example, among the n detection temperatures, the lowest detection temperature (i.e., the first detection temperature) may be selected from a temperature range of 45 to 70°C, 45°C to 68°C, 45°C to 65°C, 45°C to 63°C, 45°C to 60°C, 45°C to 58°C, 45°C to 55°C, 48°C to 70°C, 48°C to 68°C, 48°C to 65°C, 48°C to 63°C, 48°C to 60°C, 48°C to 58°C, 48°C to 55°C, 50°C to 70°C, 50°C to 68°C, 50°C to 65°C, 50°C to 63°C, 50°C to 60°C, 50°C to 58°C, 50°C to 55°C.

[0451] For example, among the n detection temperatures, the intermediate detection temperatures (e.g., the second detection temperature to the n-1 detection temperature) are 55°C to 85°C, 55°C to 83°C, 55°C to 80°C, 55°C to 78°C, 55°C to 75°C, 55°C to 73°C, 55°C to 70°C, 55°C to 68°C, 55°C to 65°C, 55°C to 63°C, 55°C to 60°C, 58°C to 85°C, 58°C to 83°C, 58°C to 80°C, 58°C to 78°C, 58°C to 75°C, 58°C to 73°C, 58°C to 70°C, 58°C to 68°C, 58°C to 65°C, 58°C to 63°C, 58℃ to 60℃, 60℃ to 85℃, 60℃ to 83℃, 60℃ to 80℃, 60℃ to 78℃, 60℃ to 75℃, 60℃ to 73℃, 60℃ to 70℃, 60℃ to 68℃, 60℃ to 65℃, 60℃ to 63℃, 63℃ to 85, 63℃ to 83℃, 63℃ to 80℃, 63℃ to 78℃, 63℃ to 75℃, 63℃ to 73, 63℃ to 70, 63℃ to 68, 63℃ to 65℃, 65℃ to 85℃, 65℃ to 83℃, 65℃ to 80℃, 65℃ to 78℃, 65℃ to 75℃, The temperature range may be selected from 65°C to 73°C, 65°C to 70°C, 65°C to 68°C, 68°C to 85°C, 68°C to 83°C, 68°C to 80°C, 68°C to 78°C, 68°C to 75°C, 68°C to 73°C, 68°C to 70°C, 70°C to 85°C, 70°C to 83°C, 70°C to 80°C, 70°C to 78°C, 70°C to 75°C or 70°C to 73°C.

[0452] In one embodiment, n target nucleic acids are each assigned to n detection temperatures, and then n compositions for detecting n target nucleic acids suitable for the detection temperatures are prepared, and then step (a) can be performed.

[0453] In one embodiment, when n is 3, the first detection temperature may be selected from a temperature range of 50°C to 60°C, the second detection temperature may be selected from a temperature range of 65°C to 75°C, and the third detection temperature may be selected from a temperature range of 80°C to 95°C.

[0454] In step (a), the signal is measured at n detection temperatures during incubation.

[0455] In one embodiment, measurement of the signal can be performed at each cycle, selected cycles, or at the end-point of the reaction.

[0456] In one embodiment, the measurement of the signal can be performed in at least one cycle. For example, the signal can be measured at n detection temperatures in one selected cycle, or can be measured at n detection temperatures in two selected cycles, respectively. For example, when n is 3 and the signal is measured in 1 cycle and 30 cycles, the signal (i.e., the first signal, the second signal, and the third signal) is measured at the first detection temperature, the second detection temperature, and the third detection temperature in 1 cycle, and the signal is measured at the first detection temperature, the second detection temperature, and the third detection temperature in 30 cycles.

[0457] In one embodiment, the measurement of the signal can be performed in at least two cycles.

[0458] In one embodiment, the signal change can be detected using the signal measured in the at least two cycles. For example, nucleic acid amplification can be performed for 30 cycles, 40 cycles, 45 cycles, or 50 cycles of PCR, and signals can be measured at n detection temperatures for each cycle. Then, the signal values ​​measured at each detection temperature in the plurality of cycles can be plotted as an amplification curve (a set of data points consisting of RFU and cycle) at each detection temperature. As a specific example, when n is 3, when each target nucleic acid is present, an amplification curve at a first detection temperature, an amplification curve at a second detection temperature, and an amplification curve at a third detection temperature can be obtained, and the change in the signal can be identified from the amplification curves.

[0459] The method according to the present disclosure utilizes the fact that the composition for detecting a target nucleic acid provides a signal change dependent on the presence of the target nucleic acid only at a corresponding detection temperature. In one embodiment, the method according to the present disclosure can detect the signal change using signal values ​​measured at the detection temperature in at least two cycles. In another embodiment, the method according to the present disclosure can detect the signal change using a signal value at the detection temperature measured in one cycle (i.e., the signal value measured in step (a)) and a reference signal value (e.g., a signal value at the detection temperature measured in the absence of the target nucleic acid).

[0460] The method of detecting a signal change can be described in detail with reference to the description of the second aspect described above.

[0461] In one implementation, there are n reference signal values ​​for n detected temperatures.

[0462] In one embodiment, the "signal value at the detection temperature (e.g., the i-th detection temperature)" measured when the target nucleic acid (e.g., the i-th target nucleic acid) is not present can be obtained through a separate negative control reaction.

[0463] In one embodiment, the reference signal value can be obtained by performing a negative control reaction simultaneously or separately from the method according to the present disclosure.

[0464] In one embodiment, the reference signal value can be obtained through a negative control reaction. According to a specific embodiment, the reference signal value at the ith detection temperature can be obtained by mixing a sample (e.g., distilled water) that does not contain the ith target nucleic acid with n target nucleic acid detection compositions, amplifying the nucleic acid, and measuring the signal at the ith detection temperature. At this time, the signal measurement can be performed in any cycle. Specifically, a signal value measured in any one of the early cycles of the negative control reaction can be used as the reference signal value, or a signal value measured in any one of the late cycles of the negative control reaction can be used as the reference signal value. More specifically, a signal value measured in the same cycle as the cycle in which the signal is measured in step (a) can be used as the reference signal value.

[0465] In one embodiment, the reference signal value can be obtained through a positive control reaction. According to a specific embodiment, the signal can be obtained by mixing a sample containing the i target nucleic acid with a composition for detecting the i target nucleic acid (specifically, n compositions for detecting n target nucleic acids) to amplify the nucleic acid and measuring the signal at the i detection temperature.

[0466] When a reference signal value is obtained through the above positive control reaction, the cycle in which the signal value is detected may be a cycle in the baseline region of the positive control reaction. The baseline region refers to a region in which a signal (e.g., a fluorescent signal) remains substantially constant during the initial cycle of an amplification reaction (e.g., PCR). Since the level of the amplification product in this region is not sufficient to be detected, most of the fluorescent signal in this region is due to a background signal including the fluorescent signal of the reaction sample itself and the fluorescent signal of the measurement system itself. That is, a signal value measured in a cycle in the baseline region of the positive control reaction will be substantially the same as a reference signal value obtained from a reaction in which the target nucleic acid is absent (e.g., a negative control reaction).

[0467] In one embodiment, a signal change can be detected through the difference between the reference signal value and the signal value measured in step (a).

[0468] In one embodiment, the reference signal value may be a threshold value determined in advance from a negative control reaction, taking into account the background signal and sensitivity of the detector, or the characteristics of the label used. The significance of the signal change can be determined using the threshold value. The threshold value can be determined using a known threshold value setting method. For example, the threshold value can be determined by taking into account the background signal, sensitivity, label characteristics, signal deviation or error range of the detector, etc.

[0469] In one implementation example, when a threshold value is used as the reference signal value, if the signal value measured in step (a) is equal to or greater than the threshold value, it can be determined that the signal has changed.

[0470] In one embodiment, signal measurement at each of the n detection temperatures can be performed using a single type of detector.

[0471] In one embodiment, the single type of detector is one detector. In one embodiment, the signals generated from the labels of the oligonucleotides linked to each label included in the n target nucleic acid detection composition are not distinguished from each target nucleic acid by the single type of detector.

[0472] As used herein, a single or one type of fluorescent label means a fluorescent label having identical or substantially identical signal characteristics (e.g., optical characteristics, emission wavelength, and electrical signal). For example, FAM and CAL Fluor 610 provide different types of signals.

[0473] As used herein, a single or one type of fluorescent label means that the signals from the fluorescent labels are indistinguishable from each other using a detection channel. This single or one type of fluorescent label is not dependent on the chemical structure of the fluorescent label. Therefore, even if two fluorescent labels have different chemical structures, they are considered to be of one type if they are indistinguishable using a detection channel.

[0474] According to the present disclosure, signals generated from n target nucleic acid detection compositions that commonly include one type of fluorescent label are not distinguished by one detection channel.

[0475] The term "detection channel" as used herein refers to a means for detecting a signal from a single type of fluorescent label. Thermocyclers available in the art, such as the ABI 7500 (Applied Biosystems), QuantStudio (Applied Biosystems), CFX96 (Bio-Rad Laboratories), Cobas z 480 (Roche), LightCycler (Roche), etc., include several channels (e.g., photodiodes) for detecting signals from several different types of fluorescent labels, and such channels correspond to detection channels herein.

[0476] The detection channel used in the present disclosure includes a means for measuring a signal. For example, the detection channel may be a photodiode capable of detecting a fluorescent signal of a specific wavelength.

[0477] In one embodiment, the signals measured at each of the n detection temperatures are not distinguished from each other by the single type of detector.

[0478] Step (b): Determination of the presence of target nucleic acid

[0479] Finally, in step (a), signal changes are detected from signals measured at n detection temperatures and the presence of n target nucleic acids is determined.

[0480] In one embodiment, the presence of the i-th target nucleic acid is determined by a change in a signal detected at the i-th detection temperature. For example, a change in a signal is detected from a signal measured at the i-th detection temperature, and the presence of the i-th target nucleic acid is determined.

[0481] In one implementation, if a change in signal is detected at the i detection temperature, it can be determined that the i target nucleic acid is present.

[0482] In one implementation example, if the signal is constant at the i detection temperature, it can be determined that the i target nucleic acid is absent.

[0483] In one implementation, the signal change can be detected using a signal measured in at least two cycles, or using a signal measured in at least one cycle and a reference signal value.

[0484] Determining the presence of a target nucleic acid from the signal measured at each detection temperature can be performed by various methods known in the art, including the method of detecting the signal change described above.

[0485] In a specific embodiment, when n is 2 and the measurement of signals is performed at 10 cycles and 30 cycles, the presence of the first target nucleic acid can be determined from the signals measured at the first detection temperature (the first signal at the 10 cycle and the first signal at the 30 cycle), and the presence of the second target nucleic acid can be determined from the signals measured at the second detection temperature (the second signal at the 10 cycle and the second signal at the 30 cycle).

[0486] In one embodiment, the method according to the present disclosure can be performed together with a negative control reaction. The signal value measured in the negative control reaction can be used as a reference signal value. For example, in a reaction including a composition for detecting an i-th target nucleic acid, a signal measured in one cycle (e.g., the last cycle) at an i-th detection temperature can be compared with a signal measured in the same cycle (e.g., the last cycle) at the same detection temperature (i.e., the i-th detection temperature) in a negative control reaction, thereby detecting a change in the signal (i.e., determining the presence or absence of a change in the signal).

[0487] In a specific embodiment, n is 3, and when measuring the signal at 30 cycles, the presence of the first target nucleic acid can be determined from a signal measured at a first detection temperature (i.e., a first signal at 30 cycles) and a first reference signal value (e.g., a signal at the first detection temperature measured at 30 cycles of the negative control reaction), the presence of the second target nucleic acid can be determined from a signal measured at a second detection temperature (i.e., a second signal at 30 cycles) and a second reference signal value (e.g., a signal at the second detection temperature measured at 30 cycles of the negative control reaction), and the presence of the third target nucleic acid can be determined from a signal measured at a third detection temperature (i.e., a third signal at 30 cycles) and a third reference signal value (e.g., a signal at the third detection temperature measured at 30 cycles of the negative control reaction).

[0488] In one embodiment, the method according to the present disclosure can be performed in conjunction with a positive control reaction. The signal value measured in the positive control reaction can be used as a reference signal value. For example, a first signal measured in cycle 30, which is a signal measured in one cycle, for example, cycle 30, at the i-th detection temperature, can be compared with a signal measured in a cycle prior to cycle 30, for example, cycle 1, at the i-th detection temperature of the positive control reaction to detect a change in the signal.

[0489] In one embodiment, when performing signal measurement in one cycle in step (a) and detecting a signal change using a reference signal value obtained through a positive control reaction, in order to obtain the reference signal value, the measurement of the signal in the positive control reaction may be performed in a cycle at least 30 cycles, 20 cycles, 10 cycles, or 5 cycles prior to the cycle in which the signal is measured in step (a).

[0490] In a specific embodiment, n is 3, and when measuring signals at 30 cycles, the presence of the first target nucleic acid can be determined from a signal measured at a first detection temperature (i.e., a first signal at 30 cycles) and a first reference signal value (e.g., a signal at the first detection temperature measured at 1 cycle of the first target nucleic acid positive control reaction), the presence of the second target nucleic acid can be determined from a signal measured at a second detection temperature (i.e., a second signal at 30 cycles) and a second reference signal value (e.g., a signal at the second detection temperature measured at 1 cycle of the second target nucleic acid positive control reaction), and the presence of the third target nucleic acid can be determined from a signal measured at a third detection temperature (i.e., a third signal at 30 cycles) and a third reference signal value (e.g., a signal at the third detection temperature measured at 1 cycle of the third target nucleic acid positive control reaction).

[0491] Hereinafter, the present invention will be described in more detail through examples. These examples are intended to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention, as set forth in the appended claims, is not limited by these examples.

[0492] Example

[0493] It was confirmed that target nucleic acid detection is possible using a composition for detecting target nucleic acids comprising three probes according to the present disclosure. In particular, it was confirmed through Examples 1 and 2 that the Tms of three hybrids (i.e., a first hybrid, a second hybrid, and a third hybrid) formed by the three probes and the target nucleic acid can be arbitrarily controlled and used in various embodiments.

[0494] Example 1: Detection of a single target nucleic acid 1 (when Tm1 is lower than Tm2 and Tm3)

[0495] Example 1-1. Preparation of target nucleic acid and oligonucleotide

[0496] The genomic DNA of Chlamydia trachomatis (CT) (Accession No.: ATCC VR-1500, Coram Deo Lab Co., Ltd.) was used as a template for the target nucleic acid. The detection temperature of the CT target nucleic acid was set to 60°C, and the first region and the second region were selected in the 3' to 5' direction on the target nucleic acid template. Then, the sequences and lengths of the reporter probe, the first quencher probe, and the second quencher probe were designed so that Tm1 was 54.8°C, Tm2 was 72.5°C, and Tm3 was 67.3°C. Specifically, the reporter probe included a sequence complementary to the first region of the target nucleic acid, and a reporter molecule (Cal Fluor Red 610) was linked to the 3'-terminus thereof. The first quencher probe included a sequence complementary to the 5'-terminal portion of the reporter probe, and a first quencher molecule (BHQ-2) was linked to the 5'-terminus thereof. The second quencher probe contained a sequence complementary to the second region of the target nucleic acid and was linked to a second quencher molecule (BHQ-2) at its 5'-end. The 3'-ends of the first and second quencher probes were blocked with Spacer C3 to prevent elongation by DNA polymerase.

[0497] A primer pair for amplifying a region including the first region and the second region of the CT target nucleic acid and three probes for detecting the CT target nucleic acid were prepared as shown in Table 3.

[0498] Sequence number Oligotype sequence (5' - 3') 1CT-Target nucleic acid (amplification product) GAGTTTTAAAATGGGAAATTCTGGTTTTTATTTGTATAACACTGAAAACTGCGTCTTTGCTGATAATATCAAAGTTGGGCAAATGACAGAGCCGCTCAAGGACCAGCAAATAATCCTTGGGACAACATCAACACCTGTCGCAGCCAAAATGACAGCTTCTGATGGAATATCTTTAACAGTCTCCAATAATTCATCAACCAATGCTTCTATTACAATTGG 2CT-Forward primer GAGTTTTAAAATGGGAAATTCTGGT 3CT-Reverse primer CCAATTGTAATAGAAGCATTGGTTG 4CT-Reporter probe TGGGCAAATGACAGAGCCGC[T(Cal Fluor Red 610)] 5CT-First quencher probe [G(BHQ-2)] CGGCTCTGTC [Spacer C3] 6CT-Second Quencher probe[A(BHQ-2)]AGGACCAGCAAATAATCCTTGG[Spacer C3]

[0499] Underline: first region of target nucleic acid;

[0500] Bold: Second region of target nucleic acid

[0501] Example 1-2. Real-time polymerase chain reaction

[0502] Real-time polymerase chain reaction was performed using the above oligonucleotides. Klentaq1 polymerase was used to extend the forward and reverse primers.

[0503] Each of the target nucleic acid (Tube 1: 10 pg of CT genomic DNA) and distilled water (Tube 2: negative control) contained 4 pmoles of CT-forward primer (SEQ ID NO: 2), 20 pmoles of CT-reverse primer (SEQ ID NO: 3), 1 pmole of CT-reporter probe (SEQ ID NO: 4), 5 pmoles of CT-first quencher probe (SEQ ID NO: 5), 5 pmoles of CT-second quencher probe (SEQ ID NO: 6), 2 μl of 10 X NEB Thermal buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 0.1% Triton X-100 ® A 20 μL reaction mixture was prepared by adding 6 mM MgSO4, 1.12 mM dNTP mix, and 10 U Klentaq1 polymerase (X-100).

[0504] Next, tubes 1 and 2 containing the reaction mixtures were placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 95°C for 15 minutes, followed by 50 cycles of 60°C for 60 seconds, 50°C for 5 seconds, 72°C for 30 seconds, and 95°C for 10 seconds.

[0505] The signal measurements were performed at (i) 50°C, a temperature within the first signal-constant temperature range, (ii) 60°C, a temperature within the signal-changing temperature range, and (iii) 95°C, a temperature within the second signal-constant temperature range, for each cycle.

[0506] As a result, as shown in Fig. 7, amplification curves for tube 1 and tube 2 were obtained at each of the three temperatures.

[0507] For tube 1, a signal change was detected only at 60°C, which is within the signal-change temperature range, and no signal change was detected at 50°C and 95°C, which are within the first and second signal-constant temperature ranges. Therefore, tube 1 was determined to contain CT.

[0508] In contrast, tube 2, the negative control, showed no signal change at any of the three temperatures. Therefore, tube 2 was determined to not contain CT.

[0509] These results indicate that target nucleic acid detection is possible using the composition for detecting target nucleic acids according to the present disclosure. Furthermore, as described above, the composition for detecting target nucleic acids according to the present disclosure was confirmed to be an InterSC-type target nucleic acid detection composition.

[0510] As described above, the target nucleic acid detection method according to the present disclosure can detect a signal (i.e., a change in signal) indicating the presence of a target nucleic acid using a reference signal value obtained from a negative control reaction. If the signal values ​​at 50°C, 60°C, and 95°C are below a threshold value (RFU - 200) based on the signal value of the negative control reaction (i.e., RFU: 0), the signal is considered to have changed.

[0511] As a result, as shown in Table 4, in the case of tube 1, a signal change was observed only at 60°C with a Ct value of 26.85, and no signal change was observed at 50°C and 95°C. On the other hand, in tube 2, which was the negative control, no signal change was observed at 50°C, 60°C, and 95°C.

[0512] Tube Ct (Cycle threshold)50℃60℃95℃1N / A26.85N / A2N / AN / AN / A

[0513] Tube 1: 10 pg of CT genomic DNA;

[0514] Tube 2: Negative control;

[0515] N / A: Not Applicable

[0516] Example 2: Detection of a single target nucleic acid 2 (when Tm1 is lower than Tm2 and higher than Tm3)

[0517] Example 2-1. Preparation of target nucleic acid and oligonucleotide

[0518] The genomic DNA of Neisseria gonorrhoeae (NG) (Accession No.: ATCC 700825, Coram Deo Lab Co., Ltd.) was used as a template for the target nucleic acid. The detection temperature of the NG target nucleic acid was set to 74°C, and the first region and the second region were selected in the 3' to 5' direction on the target nucleic acid template. Then, the sequences and lengths of the reporter probe, the first quencher probe, and the second quencher probe were designed so that Tm1 was 76.4°C, Tm2 was 80.8°C, and Tm3 was 71.1°C. Specifically, the reporter probe included a sequence complementary to the first region of the target nucleic acid, and a reporter molecule (Cal Fluor Red 610) was linked to the 3'-end thereof. The first quencher probe contained a sequence complementary to the 5'-terminal portion of the reporter probe and had a first quencher molecule (BHQ-2) linked to its 5'-terminus. The second quencher probe contained a sequence complementary to the second region of the target nucleic acid and had a second quencher molecule (BHQ-2) linked to its 5'-terminus. The 3'-terminals of the first and second quencher probes were blocked with Spacer C3 to prevent elongation by DNA polymerase.

[0519] A primer pair for amplifying a region including the first region and the second region of the NG target nucleic acid and three probes for detecting the NG target nucleic acid were prepared as shown in Table 5.

[0520] Sequence number Oligotype sequence (5' - 3') 7NG - Target nucleic acid TACGCCTGCTACTTTCACGCTGGAAAGTAATCAGATGAAACCAGTTCCGGCTGTTGTCGGCAAGCCGGGGTCGGATGTGTATTATGCCGGTCTGAATTACAAAAATGGCGGCTTTTTCGGAAATTATGCCCTTAAATATGCGAAACACGCCAATGAGGGGCATGATGCTTTCTTTTTGTTCTTGCTCGGCAGAGCGAGTGATACCGATCCATTG 8NG - Forward primer TACGCCTGCTACTTTCACGC 9NG - Reverse primer CAATGGATCGGTATCACTCGC 10NG - Reporter probe CCAGTTCCGGCTGTTGTCGGCAAGCCGGGGTCG [G (Cal Fluor Red 610)] 11NG - First quencher probe [C (BHQ-2)] CGACCCCGGCTTGCCGACAACA [Spacer C3]12NG-2nd quencher probe [T(BHQ-2)]GTGTATTATGCCGGTCTGAATTACAAAAATGG [Spacer C3]

[0521] Underline: first region of target nucleic acid;

[0522] Bold: Second region of target nucleic acid

[0523] Example 2-2. Real-time polymerase chain reaction

[0524] Real-time polymerase chain reaction was performed using the above oligonucleotides. Klentaq1 polymerase was used to extend the forward and reverse primers.

[0525] Target nucleic acid (Tube 1: 7 pg of NG genomic DNA) and distilled water (Tube 2: negative control) each contained 2 pmoles of NG-forward primer (SEQ ID NO: 8), 20 pmoles of NG-reverse primer (SEQ ID NO: 9), 1 pmole of NG-reporter probe (SEQ ID NO: 10), 5 pmoles of NG-first quencher probe (SEQ ID NO: 11), 5 pmoles of NG-second quencher probe (SEQ ID NO: 12), 2 μl of 10X NEB Thermal buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 0.1% Triton X-10). ® A 20 μL reaction mixture was prepared by adding 6 mM MgSO4, 1.12 mM dNTP mix, and 10 U Klentaq1 polymerase (X-100).

[0526] Next, tubes 1 and 2 containing the reaction mixtures were placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 95°C for 15 minutes, followed by 50 cycles of 60°C for 60 seconds, 72°C for 30 seconds, 74°C for 5 seconds, and 95°C for 10 seconds.

[0527] The signal measurements were performed at (i) 60°C, a temperature within the first signal-constant temperature range, (ii) 74°C, a temperature within the signal-changing temperature range, and (iii) 95°C, a temperature within the second signal-constant temperature range, for each cycle.

[0528] As a result, as shown in Fig. 8, amplification curves for tube 1 and tube 2 were obtained at each of the three temperatures.

[0529] For tube 1, a signal change was detected only at 74°C within the signal-change temperature range, and no signal change was detected at 60°C and 95°C within the first and second signal-constant temperature ranges. Therefore, tube 1 was determined to contain NG.

[0530] In contrast, tube 2, the negative control, showed no signal change at any of the three temperatures. Therefore, tube 2 was determined to not contain NG.

[0531] These results indicate that target nucleic acid detection is possible using the composition for detecting target nucleic acids according to the present disclosure. In addition, it was confirmed that the composition for detecting target nucleic acids according to the present disclosure is an InterSC-type target nucleic acid detection composition, as described above. In particular, the results of Example 2 together with the results of Example 1 indicate that the Tms of the three hybrids (i.e., the first hybrid, the second hybrid, and the third hybrid) formed by the three probes and the target nucleic acids can be arbitrarily controlled and used in various embodiments.

[0532] As described above, the target nucleic acid detection method according to the present disclosure can detect a signal (i.e., a change in signal) indicating the presence of a target nucleic acid using a reference signal value obtained from a negative control reaction. If the signal values ​​at 60°C, 74°C, and 95°C are greater than or equal to RFU 200, which is a threshold based on the signal value of the negative control reaction (i.e., RFU: 0), the signal is considered to have changed.

[0533] As a result, as shown in Table 6, in the case of tube 1, a signal change was observed only at 74°C with a Ct value of 28.55, and no signal change was observed at 60°C and 95°C. On the other hand, in tube 2, which was the negative control, no signal change was observed at 60°C, 74°C, and 95°C.

[0534] Tube Ct (Cycle threshold)60℃74℃95℃1N / A28.55N / A2N / AN / AN / A

[0535] Tube 1: 7 pg of NG genomic DNA;

[0536] Tube 2: Negative control;

[0537] N / A: Not Applicable

[0538] Example 3. Detection of multiple target nucleic acids

[0539] According to the present disclosure, by controlling the signal-change temperature ranges of a plurality of target nucleic acid detection compositions, a plurality of target nucleic acids can be detected using a single type of label in a single reaction vessel.

[0540] In this example, it was confirmed whether a plurality of target nucleic acids (specifically, two target nucleic acids) can be detected with a single type of label in one reaction vessel using a composition for detecting target nucleic acids according to the present disclosure.

[0541] Example 3-1. Preparation of target nucleic acid and oligonucleotide

[0542] The genomic DNA of Chlamydia trachomatis (CT) (Accession No.: ATCC VR-1500, Coram Deo Lab Co., Ltd.) used in Example 1 was used as a template for the first target nucleic acid, and the genomic DNA of Neisseria gonorrhoeae (NG) (Accession No.: ATCC 700825, Coram Deo Lab Co., Ltd.) used in Example 2 was used as a template for the second target nucleic acid.

[0543] Next, the first detection temperature for detecting a change in a signal indicating the presence of the first target nucleic acid, CT, was set to 60°C, and the second detection temperature for detecting a change in a signal indicating the presence of the second target nucleic acid, NG, was set to 74°C, and then the first region and the second region were selected in the 3' to 5' direction on each target nucleic acid template. Then, as an oligonucleotide for the composition for detecting the first target nucleic acid, the sequences and lengths of the CT-reporter probe, the CT-first quencher probe, and the CT-second quencher probe were designed so that Tm1 was 54.8°C, Tm2 was 72.5°C, and Tm3 was 67.3°C, and these are the same oligonucleotides as Table 3 of Example 1-1. As an oligonucleotide for a composition for detecting a second target nucleic acid, the sequences and lengths of the NG-reporter probe, the NG-first quencher probe, and the NG-second quencher probe were designed so that Tm1 was 76.7°C, Tm2 was 81.0°C, and Tm3 was 71.3°C, and these are the same oligonucleotides as Table 5 of Example 2-1.

[0544] FIG. 9 shows the predominant conformation of the reporter probe, the first quencher probe, and the second quencher probe of each of the two compositions used in the present example, depending on the presence or absence of the corresponding target nucleic acid and the temperature. Specifically, 50°C is a temperature within the first signal-constant temperature range of both target nucleic acid detection compositions. 60°C is a first detection temperature, which is a temperature within the signal-change temperature range of the first target nucleic acid detection composition and a temperature within the first signal-constant temperature range of the second target nucleic acid detection composition. 74°C is a second detection temperature, which is a temperature within the second signal-constant temperature range of the first target nucleic acid detection composition and a temperature within the signal-change temperature range of the second target nucleic acid detection composition. 95°C is a temperature within the second signal-constant temperature range of both target nucleic acid detection compositions.

[0545] As shown in FIG. 9, the reporter molecule linked to the reporter probe included in the composition for detecting the first target nucleic acid is (i) quenched by the first quencher molecule and / or the second quencher molecule regardless of the presence of the first target nucleic acid at 50°C, (ii) unquenched when the first target nucleic acid is absent at 60°C and quenched by the second quencher molecule when the first target nucleic acid is present, and (iii) unquenched at 74°C and 95°C regardless of the presence of the first target nucleic acid. That is, the composition for detecting the first target nucleic acid provides a signal change dependent on the presence of the first target nucleic acid only at the first detection temperature of 60°C, and provides a constant signal at other temperatures even when the first target nucleic acid is present.

[0546] As shown in FIG. 9, the reporter molecule linked to the reporter probe included in the composition for detecting the second target nucleic acid is (i) quenched by the first quencher molecule and / or the second quencher molecule regardless of the presence of the second target nucleic acid at 50°C and 60°C, (ii) quenched by the first quencher molecule when the second target nucleic acid is absent at 74°C and unquenched when the second target nucleic acid is present, and (iii) unquenched at 95°C regardless of the presence of the second target nucleic acid. That is, the composition for detecting the second target nucleic acid provides a signal change dependent on the presence of the second target nucleic acid only at the second detection temperature of 74°C, and provides a constant signal at other temperatures even when the second target nucleic acid is present.

[0547] Example 3-2. Multiplex real-time polymerase chain reaction

[0548] Real-time polymerase chain reaction was performed using the above oligonucleotides in a single reaction vessel. Klentaq1 polymerase was used for extension of the forward and reverse primers.

[0549] Target nucleic acid Tube 1: 10 pg of CT genomic DNA; Tube 2: 7 pg of NG genomic DNA; Tube 3: 10 pg of CT genomic DNA and 7 pg of NG genomic DNA) and distilled water (Tube 4: negative control) each contained 4 pmoles of CT-forward primer (SEQ ID NO: 2), 20 pmoles of CT-reverse primer (SEQ ID NO: 3), 1 pmole of CT-reporter probe (SEQ ID NO: 4), 5 pmoles of CT-first quencher probe (SEQ ID NO: 5), 5 pmoles of CT-second quencher probe (SEQ ID NO: 6), 2 pmoles of NG-forward primer (SEQ ID NO: 8), 20 pmoles of NG-reverse primer (SEQ ID NO: 9), 1 pmole of NG-reporter probe (SEQ ID NO: 10), 5 pmoles of NG-first quencher probe (SEQ ID NO: 11), 5 pmoles of NG-second quencher probe (SEQ ID NO: 12), 2 μl of 10 ® A 20 μL reaction mixture was prepared by adding 6 mM MgSO4, 1.12 mM dNTP mix, and 10 U Klentaq1 polymerase (X-100).

[0550] Next, tubes 1 to 4 containing the reaction mixture were each placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 95°C for 15 minutes, followed by 50 cycles of 60°C for 60 seconds, 72°C for 30 seconds, 74°C for 5 seconds, and 95°C for 10 seconds.

[0551] The signal measurements were performed at (i) the first detection temperature of 60°C and (ii) the second detection temperature of 74°C for each cycle.

[0552] As a result, as shown in Fig. 10, amplification curves for tubes 1 to 4 were obtained at each of the two temperatures.

[0553] For tube 1, a change in signal was detected only at the first detection temperature, and no change in signal was detected at the second detection temperature. Therefore, tube 1 was determined to contain only CT.

[0554] For tube 2, a change in signal was detected only at the second detection temperature, and no change in signal was detected at the first detection temperature. Therefore, tube 2 was determined to contain only NG.

[0555] For tube 3, a change in signal was detected at both the first and second detection temperatures. Therefore, tube 3 was determined to contain both CT and NG.

[0556] In contrast, tube 4, the negative control, showed no signal changes at either the first or second detection temperatures. Therefore, tube 4 was determined to not contain CT or NG.

[0557] These results indicate that the composition for detecting target nucleic acids according to the present disclosure, which is an InterSC-type composition, can detect multiple target nucleic acids in real time using a single type of label in a single reaction vessel. Furthermore, the composition for detecting target nucleic acids according to the present disclosure can be used in various combinations with UnderSC-type, InterSC-type, and OverSC-type compositions that employ various signal generation methods known in the art for detecting target nucleic acids, thereby indicating that the composition can detect multiple target nucleic acids in real time using a single type of label in a single reaction vessel.

[0558] As described above, the target nucleic acid detection method according to the present disclosure can detect a signal indicating the presence of a target nucleic acid (i.e., a change in signal) using a reference signal value obtained from a negative control reaction. If the signal value at the first detection temperature is equal to or lower than RFU -200, which is a threshold based on the signal value of the negative control reaction (i.e., RFU: 0), the signal is considered to have changed, and if the signal value at the second detection temperature is equal to or higher than RFU 200, which is a threshold based on the signal value of the negative control reaction (i.e., RFU: 0), the signal is considered to have changed.

[0559] As a result, as shown in Table 7, in the case of tube 1, a signal change was confirmed with a Ct value of 26.88 only at 60°C, in the case of tube 2, a signal change was confirmed with a Ct value of 28.74 only at 60°C, and in the case of tube 3, a signal change was confirmed with Ct values ​​of 26.40 and 28.44 at both 60°C and 74°C, respectively. On the other hand, in tube 4, which is the negative control, no signal change was confirmed at either 60°C or 74°C.

[0560] Tube Ct (Cycle Threshold) First detection temperature (60℃) Second detection temperature (74℃) 126.88N / A2N / A28.74326.4028.444N / AN / A

[0561] Tube 1: 10 pg of CT genomic DNA

[0562] Tube 2: 7 pg of NG genomic DNA

[0563] Tube 3: 10 pg of CT genomic DNA and 7 pg of NG genomic DNA

[0564] Tube 4: Negative control

[0565] N / A: Not Applicable

[0566] In summary, the composition for detecting a target nucleic acid comprising three probes according to the present disclosure can not only detect a target nucleic acid, but also, by using the target nucleic acid detection method according to the present disclosure alone or in combination with other signal generation methods (e.g., UnerSC, InterSC and / or OverSC signal generation methods), it is possible to detect a plurality of target nucleic acids using the same type of label in one reaction vessel with only a single detector.

[0567] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A composition for detecting a target nucleic acid, comprising: (a) reporter probe; The reporter probe comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid, The reporter probe has a reporter molecule linked thereto; (b) first quencher probe; The first quencher probe comprises a nucleotide sequence that hybridizes to the reporter probe, The first quencher probe has a first quencher molecule connected thereto, When a first hybrid is formed between the reporter probe and the first quencher probe, the first quencher molecule is at a position to quench a signal from the reporter probe; and (c) second quencher probe; The second quencher probe comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid, The second quencher probe has a second quencher molecule connected thereto, The first region and the second region of the target nucleic acid are adjacent to each other, When both a second hybridization between the reporter probe and the first region of the target nucleic acid and a third hybridization between the second quencher probe and the second region of the target nucleic acid are formed, the second quencher molecule is at a position to quench a signal from the reporter molecule, and The first hybrid compound has a melting temperature (Tm) that is different from the Tm of the second hybrid compound and the Tm of the third hybrid compound.

2. A composition according to claim 1, characterized in that, when the target nucleic acid is present, the formation of the second hybrid is superior to the formation of the first hybrid.

3. A composition according to claim 2, characterized in that the length of the first quencher probe is 1 to 30 nucleotides shorter than the length of the reporter probe.

4. A composition according to claim 1, wherein the second quencher molecule is positioned immediately adjacent to the reporter molecule or is positioned within 1 to 4 nucleotides from the reporter molecule.

5. A composition characterized in that, in the first paragraph, when the first region of the target nucleic acid is located upstream in the 5'-direction of the second region of the target nucleic acid, the reporter molecule is located at the 5'-terminal portion of the reporter probe, and the second quencher molecule is located at the 3'-terminal portion of the second quencher probe.

6. A composition characterized in that, in the first paragraph, when the second region of the target nucleic acid is located upstream in the 5'-direction of the first region of the target nucleic acid, the reporter molecule is located at the 3'-terminal portion of the reporter probe, and the second quencher molecule is located at the 5'-terminal portion of the second quencher probe.

7. A composition according to claim 1, wherein the first quencher molecule and the second quencher molecule are of the same type.

8. A composition according to claim 1, characterized in that the composition for detecting the target nucleic acid provides a signal dependent on the presence of the target nucleic acid.

9. A composition according to claim 8, wherein the signal is provided at a temperature at which one of the second hybrid and the third hybrid maintains its double-stranded state and the other dissociates into a single strand.

10. A composition according to claim 9, wherein the temperature is dependent on the Tms of the first hybrid, the second hybrid and the third hybrid.

11. In the first paragraph, the composition for detecting a target nucleic acid is characterized in that it has a signal-changing temperature range (SChTR) in which a signal changes depending on the presence of the target nucleic acid in an amplification reaction for the target nucleic acid, and two signal-constant temperature ranges (SCoTRs) in which the signal is constant even when the target nucleic acid is present.

12. A composition according to claim 11, wherein the signal-change temperature range is higher than the first signal-constant temperature range among the two signal-constant temperature ranges and lower than the second signal-constant temperature range among the two signal-constant temperature ranges.

13. A composition according to claim 12, characterized in that, in the presence of the target nucleic acid, the second hybrid and the third hybrid maintain their double-stranded state at a temperature within the first signal-specific temperature range.

14. A composition according to claim 12, characterized in that, in the presence of the target nucleic acid, the second hybrid and the third hybrid are dissociated into single strands at a temperature within the second signal-specific temperature range.

15. A composition according to claim 12, wherein, in the presence of the target nucleic acid, at a temperature within the signal-change temperature range, one of the second hybrid and the third hybrid maintains its double-stranded state, and the other dissociates into two single strands.

16. A method for detecting a target nucleic acid in a sample, comprising: (a) a step of incubating a target nucleic acid detection composition comprising a reporter probe, a first quencher probe, and a second quencher probe with the target nucleic acid; The reporter probe comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid, The above reporter probe has a reporter molecule linked to it, The first quencher probe comprises a nucleotide sequence that hybridizes to the reporter probe, The first quencher probe has a first quencher molecule connected thereto, When a first hybrid is formed between the reporter probe and the first quencher probe, the first quencher molecule is at a position to quench a signal from the reporter probe, The second quencher probe comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid, The second quencher probe has a second quencher molecule connected thereto, The first region and the second region of the target nucleic acid are adjacent to each other, When both a second hybridization between the reporter probe and the first region of the target nucleic acid and a third hybridization between the second quencher probe and the second region of the target nucleic acid are formed, the second quencher molecule is at a position to quench a signal from the reporter molecule, The first hybrid has a melting temperature (Tm) different from the Tm of the second hybrid and the Tm of the third hybrid; (b) a step of measuring the signal; and (c) A step of determining the presence of the target nucleic acid from the signal measured in the above step (b).

17. A method according to claim 16, characterized in that the incubation comprises a nucleic acid amplification reaction.

18. A method according to claim 16, characterized in that the signal is measured at a temperature at which one of the second hybrid and the third hybrid maintains its double-stranded state and the other dissociates into a single strand.

19. A method according to claim 18, characterized in that the temperature is dependent on the Tms of the first hybrid, the second hybrid and the third hybrid.

20. A method according to claim 16, characterized in that, when the target nucleic acid is present, the formation of the second hybrid is superior to the formation of the first hybrid.

21. A method according to claim 16, wherein the first quencher molecule and the second quencher molecule are of the same type.

22. A method for detecting n target nucleic acids in a sample, comprising: (a) a step of incubating a sample suspected of containing one or more of the n target nucleic acids with n target nucleic acid detection compositions in one reaction vessel, and measuring a signal at n detection temperatures; The above n is an integer greater than or equal to 2, The above incubation comprises multiple reaction cycles, and the measurement of the signal is performed in one or more of the multiple reaction cycles, Each of the above n target nucleic acid detection compositions provides a change in a signal indicating the presence of the corresponding target nucleic acid at a corresponding detection temperature among the above n detection temperatures in the presence of the corresponding target nucleic acid, Among the above n target nucleic acid detection compositions, the i target nucleic acid detection composition provides a change in a signal indicating the presence of the i target nucleic acid at the i detection temperature among the n detection temperatures in the presence of the i target nucleic acid, and provides a constant signal at other detection temperatures. The above i represents an integer from 1 to n, and the i-th detection temperature is lower than the i+1-th detection temperature. Within the temperature range including all of the above n detection temperatures, the composition for detecting the i-th target nucleic acid has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the i-th target nucleic acid and one or two signal-constant temperature ranges (SCoTR) in which the signal is constant even when the i-th target nucleic acid is present. The composition for detecting the above target nucleic acid is, (i) an UnderSC-type composition having a melting characteristic in which the signal-change temperature range is lower than the signal-constant temperature range; (ii) an InterSC-type composition having a melting property in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges, and (iii) any one of the OverSC-type compositions having a melting characteristic in the signal-change temperature range higher than the signal-constant temperature range; At least one of the above n target nucleic acid detection compositions is a composition according to any one of claims 1 to 15, and; (b) A step of determining the presence of n target nucleic acids from the signals measured in the above step (a), wherein the step of determining the presence of the i-th target nucleic acid is based on the signal measured at the i-th detection temperature.

Images