Use of sjtr1 microsatellite sequence for preparation of reagent for detecting schistosomiasis

Abstract

The present disclosure belongs to the field of molecular biological detection, and specifically relates to the detection of schistosomiasis, more specifically to the use of an SjTR1 microsatellite sequence for the preparation of a reagent for detecting schistosomiasis. Provided in the present disclosure is the use of an Schistosoma japonicum Katsurada SjR1 microsatellite sequence for the preparation of a reagent for detecting schistosomiasis. The PCR detection reagent prepared by using a new target discovered by the present disclosure can realize higher sensitivity and specificity as compared to existing targets for Schistosoma japonicum Katsurada, such as SJR2. In particular, in the design process of multiplex PCR, the new target can enable the entire system to obtain better sensitivity and better specificity.

Description

Use of SjTR1 microsatellite sequence in preparing reagents for detecting schistosomiasis Technical Field

[0001] The present disclosure belongs to the field of molecular biological detection, specifically, to the detection of schistosomiasis, and more specifically, to the use of the SjTR1 microsatellite sequence for preparing a reagent for detecting schistosomiasis. Background Art

[0002] Schistosomiasis, commonly known as "big belly disease," is an acute and chronic disease caused by schistosomes. There are six species of schistosomes that infect humans: Schistosoma japonicum, Schistosoma mansoni, Schistosoma haematobium, Schistosoma mekongi, Schistosoma guineensis, and Schistosoma intercalatum. Three species are responsible for the most damage to humans: Schistosoma japonicum, which is prevalent in Asia; Schistosoma mansoni, which is prevalent in Latin America and Central Africa; and Schistosoma haematobium, which is prevalent in North Africa. The primary manifestation of schistosomiasis is dermatitis at the site of infection, accompanied by fever, abdominal pain, diarrhea, and tenderness in the liver area. The source of infection and transmission routes of schistosomiasis are difficult to completely eliminate, and the risk of transmission persists.

[0003] Diagnosis plays a key role in schistosomiasis prevention and control, including controlling and eliminating the source of infection. Common tests include stool and urine specimens, sometimes requiring intestinal or bladder tissue specimens; blood tests are also sometimes used for diagnosis. However, these tests do not indicate the severity of the infection and have limitations.

[0004] Nucleic acid detection has high sensitivity and specificity. Previously established nucleic acid diagnostic technologies are limited to primers and probes developed for existing targets, and their sensitivity and specificity need to be improved. For example, Li, Juan, Zhao, Guang-Hui et al. reported a real-time PCR assay combined with high-resolution melting (HRM) assay targeting a portion of nuclear 18S rDNA to detect, identify, and differentiate four major schistosome species. However, the detection of genomic DNA from schistosomes was limited to a minimum genomic DNA amount of 10 when the Ct value was <30. -5 The sensitivity needs to be improved. Furthermore, the main peak of the melting curves for Schistosoma japonicum and Schistosoma mekongi is the same, at 83.65°C. The difference between the two is that the Schistosoma mekongi melting curve has a secondary peak to the left of the main peak. This makes it difficult to distinguish Schistosoma japonicum from Schistosoma japonicum based on this peak, which can lead to misdiagnosis.

[0005] Therefore, there is a need in the art for a product that can diagnose schistosomiasis more quickly and effectively, with higher sensitivity and better specificity.

[0006] Summary of the Invention

[0007] In view of this, the applicant used the gene sequence of Schistosoma japonicum with accession number NC_002544.1 as the detection target and discovered a new target SjTR1 microsatellite sequence (SiTR1 region) for detecting Schistosoma japonicum. The gene sequence is: MW631938.1. Using the SjTR1 microsatellite sequence of Schistosoma japonicum for the preparation of a test kit for schistosomiasis can diagnose schistosomiasis more quickly and effectively with high sensitivity and good specificity.

[0008] In a first aspect, the present disclosure provides a use of a Schistosoma japonicum SjTR1 microsatellite sequence for preparing a reagent for detecting schistosomiasis.

[0009] Furthermore, the reagent is a PCR reagent; furthermore, the reagent is a multiplex PCR reagent.

[0010] In a second aspect, the present disclosure provides a composition for detecting schistosomiasis, comprising upstream and downstream primers and a probe for detecting the SjTR1 microsatellite sequence of Schistosoma japonicum.

[0011] In some specific embodiments, a composition for detecting schistosomiasis comprises

[0012] Upstream and downstream primers and probes for detecting Schistosoma japonicum SjTR1 microsatellite sequences;

[0013] Upstream and downstream primers and probes for detecting Schistosoma mansoni SM1-7 sequences; and

[0014] Upstream and downstream primers and probes for detecting Schistosoma haematobium Dra1 sequences.

[0015] Furthermore, the composition also includes upstream and downstream primers and probes for detecting the Schistosoma japonicum SJR2 sequence.

[0016] In some specific embodiments, the upstream and downstream primers and probes for detecting the Schistosoma japonicum SJR2 sequence are shown in SEQ ID NOs. 1-3.

[0017] In some specific embodiments, the upstream and downstream primers and probes for detecting the Schistosoma japonicum SjTR1 microsatellite sequence are at least one set shown in SEQ ID NOs. 4 to 6, or SEQ ID NOs. 7 to 9, or SEQ ID NOs. 10 to 12.

[0018] In some specific embodiments, the upstream and downstream primers and probes for detecting the Schistosoma japonicum SjTR1 microsatellite sequence are at least two groups shown in SEQ ID NOs. 4 to 6, or SEQ ID NOs. 7 to 9, or SEQ ID NOs. 10 to 12.

[0019] In some specific embodiments, the upstream and downstream primers and probes for detecting the Schistosoma japonicum SjTR1 microsatellite sequence are as shown in SEQ ID NOs. 4 to 6, 7 to 9, and 10 to 12.

[0020] In some specific embodiments, the upstream and downstream primers and probes for detecting the SM1-7 sequence are shown as SEQ ID NOs. 13 to 15.

[0021] In some specific embodiments, the upstream and downstream primers and probes for detecting the Dra1 sequence are shown as SEQ ID NOs. 16-18.

[0022] Furthermore, the composition also includes an internal standard gene.

[0023] In some specific embodiments, the internal standard gene is a human housekeeping gene.

[0024] Furthermore, the composition also includes an upstream primer, a downstream primer and a probe for detecting an internal standard gene.

[0025] In some specific embodiments, the upstream and downstream primers and probes for detecting the internal standard gene are shown in SEQ ID NOs. 19-21.

[0026] In a third aspect, the present disclosure provides use of the above composition in preparing a schistosomiasis pathogen detection kit.

[0027] In a fourth aspect, the present disclosure provides a kit for detecting schistosomiasis pathogens, wherein the kit comprises the composition of the present disclosure as described above.

[0028] In a fifth aspect, a method for detecting and distinguishing schistosomiasis pathogens is provided, wherein the detection comprises the following steps:

[0029] 1) Extracting or releasing nucleic acid from the sample to be tested;

[0030] 2) performing fluorescent quantitative PCR on the nucleic acid obtained in step 1) using the composition of the present disclosure or the kit of the present disclosure as described above;

[0031] 3) Obtain and analyze the results.

[0032] In a specific embodiment, a method for joint detection and differentiation of schistosomiasis pathogens for non-diagnostic purposes is provided, the method comprising the following steps:

[0033] 1) Extracting or releasing nucleic acid from the sample to be tested;

[0034] 2) performing fluorescent quantitative PCR on the nucleic acid obtained in step 1) using the composition disclosed above or the kit disclosed above;

[0035] 3) Obtain and analyze the results.

[0036] The PCR detection reagent prepared for the new target SjTR1 microsatellite sequence discovered in the present invention can achieve higher sensitivity and specificity than existing targets of Schistosoma japonicum, such as SJR2. In particular, in the design process of multiplex PCR, the new target can enable the entire system to achieve better sensitivity and better specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] FIG1 is a diagram showing the test results of composition 1 of the present disclosure.

[0038] FIG2 is a diagram showing the test results of composition 2 of the present disclosure.

[0039] FIG3 is a diagram showing the test results of composition 3 of the present disclosure.

[0040] FIG4 is a diagram showing the test results of composition 4 of the present disclosure. DETAILED DESCRIPTION

[0041] The present disclosure will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanations of the present disclosure and should not be construed as limiting the scope of protection of the present disclosure. All technologies implemented based on the above content of the present disclosure are included within the scope of protection intended by the present disclosure.

[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the reagents, materials, etc. used in the following examples are all commercially available unless otherwise specified.

[0043] In the description of the present disclosure, it should be noted that the terms "first", "second", etc. are only used for descriptive purposes and do not indicate or imply relative importance.

[0044] In light of this, the applicant used the Schistosoma japonicum gene sequence with accession number NC_002544.1 in the GenBank database as a detection target and discovered a new target for detecting Schistosoma japonicum, the SjTR1 microsatellite sequence (SjTR1 region). The gene sequence is MW631938.1 (GenBank database number). The sequence of MW631938.1 is shown in SEQ ID NO. 22, which is TAGGGGGGAATGTCGTGCACAACCTTCTTCCCCATATAAAGATGATGGCGAGATGTTGTGGGTGTAAGTTGATTGGCGGTGATGAGTTGTGCATGAAAAAA.

[0045] In a first aspect, the present disclosure provides a use of a Schistosoma japonicum SjTR1 microsatellite sequence for preparing a reagent for detecting schistosomiasis.

[0046] In one embodiment, the reagent is a PCR reagent.

[0047] In one embodiment, the reagent is a multiplex PCR reagent.

[0048] In some specific embodiments, the reagents comprise primers and / or probes.

[0049] The PCR detection reagent prepared using the new target discovered in the present disclosure can achieve higher sensitivity and specificity compared to existing Schistosoma japonicum targets, such as SJR2. In particular, in the design process of multiplex PCR, the new target can enable the entire system to achieve better sensitivity and better specificity.

[0050] In a second aspect, the present disclosure provides a composition for detecting schistosomiasis, comprising upstream and downstream primers and a probe for detecting the SjTR1 microsatellite sequence of Schistosoma japonicum.

[0051] In some specific embodiments, a composition for detecting schistosomiasis comprises

[0052] Upstream and downstream primers and probes for detecting Schistosoma japonicum SjTR1 microsatellite sequences;

[0053] Upstream and downstream primers and probes for detecting Schistosoma mansoni SM1-7 sequences; and

[0054] Upstream and downstream primers and probes for detecting Schistosoma haematobium Dra1 sequences.

[0055] Furthermore, the composition further comprises an internal standard gene. In some specific embodiments, the internal standard gene is a human housekeeping gene.

[0056] In some embodiments, the composition further comprises an upstream primer, a downstream primer, and a probe for detecting an internal standard gene.

[0057] In some specific embodiments, the composition further includes at least one set of upstream and downstream primers and probes for detecting Schistosoma mansoni SM1-7 sequences, upstream and downstream primers and probes for detecting Schistosoma haematobium Dra1 sequences, upstream and downstream primers and probes for detecting Schistosoma japonicum SJR2 sequences, and upstream and downstream primers and probes for detecting internal standard gene sequences.

[0058] In some embodiments, the probes of the disclosed compositions comprise a fluorescent reporter group. In some embodiments, the probes in the compositions are labeled with a fluorescent reporter group at the 5' end.

[0059] Furthermore, the fluorescent reporter groups of the different probes in the above-mentioned composition of the present disclosure are different from each other and do not interfere with each other.

[0060] In this context, "different and non-interfering" means that the fluorescent reporter groups used in each probe in the composition are different and do not affect each other's detection, that is, they can be detected using different channels. For example, ATTO 425, Quasar 705, FAM, HEX, ROX, and CY5 can be used. These groups have different absorbance values ​​and can be used in different channels, thus preventing interference.

[0061] In some specific embodiments, the fluorescent reporter group of the probe of the SjTR1 microsatellite sequence is FAM; the fluorescent reporter group of the probe of the internal standard gene is HEX (or VIC); the fluorescent reporter group of the probe of the SM1-7 sequence is ROX; and the fluorescent reporter group of the probe of the Dra1 sequence is CY5.

[0062] Furthermore, the composition also includes upstream and downstream primers and probes for detecting the Schistosoma japonicum SJR2 sequence.

[0063] After adding the above primer and probe sequences, the sensitivity of the composition of the present disclosure is higher.

[0064] In some specific embodiments, the fluorescent reporter group of the probe for detecting the Schistosoma japonicum SJR2 sequence may be the same as or different from that of the probe for the SjTR1 microsatellite sequence.

[0065] In some specific embodiments, the upstream and downstream primers and probes for detecting the SJR2 sequence of Schistosoma japonicum are shown in SEQ ID NOs. 1 to 3. SEQ ID NO. 1 is the upstream primer, SEQ ID NO. 2 is the downstream primer, and SEQ ID NO. 3 is the probe.

[0066] In some specific embodiments, the sequences of the upstream and downstream primers and probe for detecting the Schistosoma japonicum SjTR1 microsatellite sequence are at least one of the sequences shown in SEQ ID NOs. 4 to 6, the sequences shown in SEQ ID NOs. 7 to 9, or the sequences shown in SEQ ID NOs. 10 to 12. Among them, SEQ ID NO. 4 is the upstream primer, SEQ ID NO. 5 is the downstream primer, and SEQ ID NO. 6 is the probe; SEQ ID NO. 7 is the upstream primer, SEQ ID NO. 8 is the downstream primer, and SEQ ID NO. 9 is the probe; SEQ ID NO. 10 is the upstream primer, SEQ ID NO. 11 is the downstream primer, and SEQ ID NO. 12 is the probe.

[0067] In some specific embodiments, the upstream and downstream primers and probes for detecting the Schistosoma japonicum SjTR1 microsatellite sequence are at least two groups of sequences shown in SEQ ID NOs. 4 to 6, 7 to 9, and 10 to 12.

[0068] In some specific embodiments, the upstream and downstream primers and probes for detecting the Schistosoma japonicum SjTR1 microsatellite sequence include sequences shown in SEQ ID NOs. 4 to 6, sequences shown in SEQ ID NOs. 7 to 9, and sequences shown in SEQ ID NOs. 10 to 12.

[0069] In some specific embodiments, the upstream and downstream primers and probes for detecting the SM1-7 sequence are shown in SEQ ID NOs. 13 to 15, wherein SEQ ID NO. 13 is the upstream primer, SEQ ID NO. 14 is the downstream primer, and SEQ ID NO. 15 is the probe.

[0070] In some specific embodiments, the upstream and downstream primers and probes for detecting Dra1 sequences are shown in SEQ ID NOs. 16 to 18, wherein SEQ ID NO. 16 is the upstream primer, SEQ ID NO. 17 is the downstream primer, and SEQ ID NO. 18 is the probe.

[0071] In some specific embodiments, the upstream and downstream primers and probes for detecting the internal standard gene are shown in SEQ ID NOs. 19 to 21, wherein SEQ ID NO. 19 is the upstream primer, SEQ ID NO. 20 is the downstream primer, and SEQ ID NO. 21 is the probe.

[0072] Further on the basis of the above combination, the composition includes upstream and downstream primers and probes for detecting the SjTR1 microsatellite sequence of Schistosoma japonicum, upstream and downstream primers and probes for detecting the SM1-7 sequence of Schistosoma mansoni, upstream and downstream primers and probes for detecting the Dra1 sequence of Schistosoma haematobium, upstream and downstream primers and probes for detecting the SJR2 sequence of Schistosoma japonicum, and upstream and downstream primers and probes for detecting the internal standard gene sequence.

[0073] Furthermore, in some embodiments, the compositions of the present disclosure may include one or more of the above primer and probe sets. In the present disclosure, a "set" refers to mutually matching upstream and downstream primers and probes for detecting a target.

[0074] The compositions disclosed herein can be combined in any combination to detect any of the five targets. Those skilled in the art can determine the desired combination by combining primer and probe pairs corresponding to the targets to be detected. These combinations are encompassed by the present disclosure.

[0075] For example, it can include any 6 of the above 7 groups of primer sets and probes, it can include any 5 of the above 7 groups of primer pairs and probes, it can include any 4 of the above 7 groups of primer pairs and probes, it can include any 3 of the above 7 groups of primer pairs and probes, it can include any 2 of the above 7 groups of primer pairs and probes, and it can also include any 1 of the above 7 groups of primer pairs and probes.

[0076] In some specific embodiments, the disclosed compositions are used for fluorescent PCR.

[0077] Furthermore, the 3' end of the probe also has a non-fluorescent quencher, such as NFQ and QSY.

[0078] Furthermore, the 3' end of the probe also has a quencher group, such as BHQ1 or BHQ2.

[0079] In a specific embodiment, the 3' end of the probe is BHQ1.

[0080] In a specific embodiment, each component of the composition of the present disclosure is present in a separate package.

[0081] In a particular embodiment, the components of the composition of the present disclosure are present in the same package.

[0082] Furthermore, the components of the composition of the present disclosure are present in a mixed form.

[0083] In a third aspect, the present disclosure provides use of the above composition in preparing a schistosomiasis pathogen detection kit.

[0084] Furthermore, the present disclosure provides use of the above-mentioned composition of the present disclosure in preparing a kit for the joint detection and differentiation of schistosomiasis pathogens, wherein the pathogen is at least one of Schistosoma japonicum, Schistosoma mansoni and Schistosoma haematobium.

[0085] In a fourth aspect, the present disclosure provides a kit for detecting schistosomiasis pathogens, wherein the kit comprises the composition of the present disclosure as described above.

[0086] Furthermore, the kit also includes a negative quality control product and a positive quality control product.

[0087] In a specific embodiment, the negative control is at least one of DEPC H2O, physiological saline, and an internal standard gene. The positive control is at least one of Schistosoma japonicum DNA fragments, Schistosoma mansoni DNA fragments, and Schistosoma haematobium DNA fragments.

[0088] Furthermore, the kit also includes dNTP(U)s, PCR buffer and Mg 2+ At least one of .

[0089] Furthermore, the kit further comprises: at least one of a nucleic acid releasing reagent, a nucleic acid extracting reagent, and a DNA polymerase.

[0090] Furthermore, the kit further comprises a nucleic acid releasing reagent, a nucleic acid extracting reagent, dNTP, dUTP, uracil glycosylase (UNG), DNA polymerase, PCR buffer and Mg 2+ At least one of .

[0091] Furthermore, the concentration of the DNA polymerase is 3 U / reaction to 15 U / reaction. For example, the DNA polymerase may be Taq enzyme.

[0092] In a specific embodiment, the kit of the present disclosure includes Taq enzyme, UNG enzyme, Mg 2+ , dNTP(U)s, primers, probes and PCR buffer.

[0093] Common PCR buffers are composed of Tris-HCl, MgCl2, KCl, Triton X-100, etc. The total volume of a single PCR reaction tube is generally 20μl to 200μl.

[0094] In a fifth aspect, a method for detecting and distinguishing schistosomiasis pathogens is provided, wherein the detection comprises the following steps:

[0095] 1) Extracting or releasing nucleic acid from the sample to be tested;

[0096] 2) performing fluorescent quantitative PCR on the nucleic acid obtained in step 1) using the composition of the present disclosure or the kit of the present disclosure as described above;

[0097] 3) Obtain and analyze the results.

[0098] In the present disclosure, the sample used for detection may be blood, tissue fluid, etc., but is not limited thereto.

[0099] Furthermore, the reaction conditions of the fluorescent quantitative PCR are as follows: UNG enzyme reaction, temperature is 40-60°C, time is 30-150 seconds, 1 cycle; Taq enzyme activation, temperature is 94°C, time is 3-6 minutes, 1 cycle; denaturation, temperature is 94°C, time is 5-20 seconds, annealing, temperature is 55°C-60°C, time is 10-60 seconds, 30-50 cycles, and fluorescence is collected.

[0100] The present disclosure also provides a use of a composition for preparing a reagent for detecting and distinguishing schistosomiasis pathogens, the method comprising the following steps:

[0101] 1) Extracting or releasing nucleic acid from the sample to be tested;

[0102] 2) performing fluorescent quantitative PCR on the nucleic acid obtained in step 1) using the composition of the present disclosure or the kit of the present disclosure as described above;

[0103] 3) Obtain and analyze the results.

[0104] In one embodiment, the method can be used for the diagnosis and treatment of a disease, can be used for auxiliary diagnosis of a disease, or can be used for neither diagnosis nor treatment of a disease.

[0105] In one embodiment, the method is not intended for disease diagnosis, i.e., for non-diagnostic purposes. As used herein, the term "non-diagnostic purpose" refers to a method not intended to obtain information about whether an individual is infected with the aforementioned pathogen and suffering from schistosomiasis. For example, the method may be used to detect the presence of the aforementioned pathogen in a test culture (e.g., blood).

[0106] In a specific embodiment, a method for joint detection and differentiation of schistosomiasis pathogens for non-diagnostic purposes is provided, the method comprising the following steps:

[0107] 1) Extracting or releasing nucleic acid from the sample to be tested;

[0108] 2) performing fluorescent quantitative PCR on the nucleic acid obtained in step 1) using the composition disclosed above or the kit disclosed above;

[0109] 3) Obtain and analyze the results.

[0110] Furthermore, the reaction conditions of the fluorescent quantitative PCR are as follows: UNG enzyme reaction, temperature is 40-60°C, time is 30-150 seconds, 1 cycle; Taq enzyme activation, temperature is 94°C, time is 3-6 minutes, 1 cycle; denaturation, temperature is 94°C, time is 5-20 seconds, annealing, temperature is 55-60°C, time is 10-60 seconds, 30-50 cycles, and fluorescence is collected.

[0111] Example 1: Primers and probes used in this disclosure

[0112] The primers and probes used in this disclosure are shown in Table 1 below.

[0113] Table 1

[0114] Example 2: Method for detecting schistosoma japonicum pathogens

[0115] 1. Reagent Preparation

[0116] Based on the number of negative controls, test samples, and positive controls, take the appropriate amount of PCR reaction solution and enzyme mixture according to the ratio (38 μL of PCR reaction solution per person + 2 μL of enzyme mixture per person), mix thoroughly to form PCR mix, and centrifuge at 2000 rpm for 10 seconds before use.

[0117] PCR reaction system:

[0118] Preparation of mixed enzyme:

[0119] The enzyme mixture consists of H-Taq enzyme (15 U / μL) and UNG enzyme (2 U / μL) mixed in a certain ratio (1.7 μL H-Taq enzyme and 0.3 μL UNG enzyme per person).

[0120] 2. Sample processing and loading

[0121] Take 200 μL of the sample to be tested into a 1.5 mL centrifuge tube and use the nucleic acid extraction or purification reagent (S10015) of Shengxiang Biotechnology Co., Ltd. according to its instructions for nucleic acid extraction.

[0122] Pipette 10 μL each of the negative control, the sample nucleic acid extracted above, and the positive control into the corresponding 0.2 mL PCR reaction tubes, add 40 μL PCR Mix to each tube, and cover the tube.

[0123] 3. PCR amplification

[0124] PCR amplification was performed on the SLAN-96P fully automated medical PCR analysis system according to the following protocol:

[0125] 4. Interpretation of test results

[0126] If the sample has a clear S-shaped amplification curve in the FAM, HEX (VIC), ROX, and CY5 channels, and the Ct value is ≤40, it is judged as positive; if the sample has no amplification curve (No Ct) or the Ct value is greater than 40 in the FAM, ROX, and CY5 channels, and the HEX (VIC) internal standard channel is positive (Ct value ≤40), it is judged as negative. The details are as follows:

[0127] Example 3. Test results of the test samples of the disclosed composition

[0128] The primers and probes shown in Example 1 (Composition 1: SEQ ID NOs. 4 to 6, SEQ ID NOs. 13 to 21) were used to simultaneously detect Schistosoma japonicum, Schistosoma mansoni, and Schistosoma haematobium in the sample according to the method of Example 2. The results are shown in FIG1 . As can be seen from FIG1 , Composition 1 is capable of detecting and distinguishing various schistosomes in the sample.

[0129] The primers and probes shown in Example 1 (Composition 2: SEQ ID NOs. 7 to 9, SEQ ID NOs. 13 to 21) were used to simultaneously detect Schistosoma japonicum, Schistosoma mansoni, and Schistosoma haematobium in the sample according to the method of Example 2. The results are shown in FIG2 . As can be seen from FIG2 , Composition 2 is capable of detecting and distinguishing various schistosomes in the sample.

[0130] The primers and probes shown in Example 1 (Composition 3: SEQ ID NOs. 10-21) were used to simultaneously detect Schistosoma japonicum, Schistosoma mansoni, and Schistosoma haematobium in the sample according to the method of Example 2. The results are shown in FIG3 . As can be seen from FIG3 , Composition 3 is capable of detecting and distinguishing various schistosomes in the sample.

[0131] The primers and probes shown in Example 1 (Composition 4: SEQ ID NOs. 1 to 6, SEQ ID NOs. 13 to 21) were used to simultaneously detect Schistosoma japonicum, Schistosoma mansoni, and Schistosoma haematobium in the sample according to the method of Example 2. The results are shown in FIG4 . As can be seen from FIG4 , Composition 4 is capable of detecting and distinguishing various schistosomes in the sample.

[0132] Example 4: Sensitivity of the disclosed composition

[0133] The artificially synthesized plasmids of Schistosoma japonicum, Schistosoma mansoni, and Schistosoma haematobium were mixed and then gradiently diluted to 1.00E+03 copies / mL, 4.00E+02 copies / mL, 2.00E+02 copies / mL, and 1.00E+02 copies / mL using negative serum samples as test samples. The detection level of 95% was used as the minimum detection limit of this reagent. The results of the analytical sensitivity test showed that the detection limit of the composition 1 of the present disclosure for Schistosoma japonicum / Mansoni / Heghaematobium pathogens was 4.00E+02 copies / mL (see Table 2).

[0134] The detection rate is expressed as "number of detections / number of tests". "Number of tests" refers to the total number of tested samples. For example, if 20 samples are tested, the number of tests is 20; "number of detections" refers to the number of samples that test positive. For example, if 10 samples show a qualified amplification curve, the number of detections is 10.

[0135] Table 2

[0136] Furthermore, the detection limits of the compositions 2 and 3 of the present disclosure for Schistosoma japonicum / Mansoni / Heghamelae pathogens are all 4.00E+02 copies / mL (see Tables 3 and 4).

[0137] Table 3

[0138] Table 4

[0139] The detection limit of composition 4 of the present disclosure for Schistosoma mansoni / Schistosoma haematobium pathogens is 4.00E+02 copies / mL, and the detection limit for Schistosoma japonicum is as low as 2.00E+02 copies / mL (see Table 5).

[0140] Table 5

[0141] Example 5. Specificity of the disclosed composition

[0142] Specificity experiments showed that the method disclosed in the present invention has no cross-reaction to common parasitic pathogens and infectious viruses (Toxoplasma gondii (TOXO), Trichinella spiralis (Trichina), human parvovirus B19 (HPV B19), rubella virus (RV), cytomegalovirus (CMV) and herpes simplex virus (HSV1 / 2) (see Table 6 for sample information).

[0143] Table 6. Statistics of different similar pathogens

[0144] Specificity analysis was performed using the above samples and a mixed plasmid of Schistosoma japonicum, Schistosoma mansoni, and Schistosoma haematobium diluted to 1.00E+06 copies / mL as a control sample.

[0145] Three batches of reagents (composition 4) were tested on a SLAN-96P fully automated medical PCR analysis system. The specificity of the kit was examined by measuring the positive and negative coincidence rates. The test results are shown in Table 7 below:

[0146] Table 7. Statistics of cross-reaction results of three batches of reagents

[0147] Conclusion: Using three batches of reagents, cross-samples were negative for Schistosoma japonicum, demonstrating the high specificity of this kit. Furthermore, it was verified that high concentrations of other pathogens listed above did not affect the nucleic acid detection of Schistosoma japonicum, Schistosoma mansoni, and Schistosoma haematobium.

[0148] Example 6: Anti-interference and stability of the disclosed composition

[0149] To investigate the impact of potential endogenous and exogenous substances in the sample on the test results, a sample of Schistosoma japonicum nucleic acid with a defined concentration was mixed with plasmids from Schistosoma haematobium and Schistosoma mansoni. The mixture was diluted to the minimum detection limit and then divided into several aliquots. Each aliquot was spiked with a specific concentration of endogenous interfering substances (plasma protein, leukocytes, total bilirubin, triglycerides, total IgG, and interferon α); and an exogenous interfering substance (praziquantel). The anti-interference capability of the test kit was evaluated by comparison with a control sample. Composition 1, described in Example 3 of this disclosure, was used for the test. The results are shown in Table 8.

[0150] Table 8. Interference test verification test results

[0151] Comparative Example 1: Effects of the New Targets and Known Targets of the Present Disclosure on Sensitivity

[0152] The artificially synthesized plasmids of Schistosoma japonicum, Schistosoma mansoni, and Schistosoma haematobium were mixed and then gradiently diluted to 1.00E+03 copies / mL, 4.00E+02 copies / mL, 2.00E+02 copies / mL, and 1.00E+02 copies / mL using negative serum samples as test samples. The detection level of 95% was used as the minimum detection limit of this reagent. The results of the analytical sensitivity test showed that the detection limit of composition 5 described in Example 3 of the present disclosure (Composition 5: SEQ ID NO.1~3, SEQ ID NO.13~21) for Schistosoma japonicum / Mansoni / Hematobium pathogens was 1.00E+03 copies / mL (see Table 9).

[0153] Table 9

[0154] Comparison of Table 9 with Tables 2-4 reveals that compositions 1, 2, and 3, each designed using primers and probes for novel targets, all achieved a sensitivity of 4.00E+02 copies / mL, while composition 5, designed using primers and probes for known targets, achieved a sensitivity of 1.00E+03 copies / mL. The sensitivity of the primers and probes designed for novel targets in the present disclosure is higher than that for known targets.

[0155] The above describes the embodiments of the present disclosure. However, the present disclosure is not limited to the above embodiments. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present disclosure shall be included in the scope of protection of the present disclosure.

Claims

1. Use of a Schistosoma japonicum SjTR1 microsatellite sequence for preparing a reagent for detecting schistosomiasis.

2. The use according to claim 1, characterized in that The reagent is a PCR reagent.

3. A composition for detecting schistosomiasis, characterized in that: The composition comprises upstream and downstream primers and probes for detecting the SjTR1 microsatellite sequence of Schistosoma japonicum.

4. The composition according to claim 3, characterized in that The upstream and downstream primers and probes for detecting the SjTR1 microsatellite sequence of Schistosoma japonicum include at least one of the primer sets shown in SEQ ID NOs. 4 to 6, the primer sets shown in SEQ ID NOs. 7 to 9, or the primer sets shown in SEQ ID NOs. 10 to 12.

5. The composition according to claim 3 or 4, characterized in that The composition also includes at least one set of upstream and downstream primers and probes for detecting Schistosoma mansoni SM1-7 sequences, upstream and downstream primers and probes for detecting Schistosoma haematobium Dra1 sequences, upstream and downstream primers and probes for detecting Schistosoma japonicum SJR2 sequences, and upstream and downstream primers and probes for detecting internal standard gene sequences.

6. The composition according to any one of claims 3 to 5, characterized in that The upstream and downstream primers and probes for detecting the sequence of Schistosoma mansoni SM1-7 are shown in SEQ ID NOs. 13 to 15; and / or The upstream and downstream primers and probes for detecting Schistosoma haematobium Dra1 sequences are shown in SEQ ID NOs. 16 to 18; and / or The upstream and downstream primers and probes for detecting the SJR2 sequence of Schistosoma japonicum are shown in SEQ ID NOs. 1 to 3; and / or The upstream and downstream primers and probes for detecting the internal standard gene are shown in SEQ ID NOs. 19-21.

7. The composition according to any one of claims 3 to 6, characterized in that The composition comprises upstream and downstream primers and probes for detecting the SjTR1 microsatellite sequence of Schistosoma japonicum, upstream and downstream primers and probes for detecting the SM1-7 sequence of Schistosoma mansoni, upstream and downstream primers and probes for detecting the Dra1 sequence of Schistosoma haematobium, upstream and downstream primers and probes for detecting the SJR2 sequence of Schistosoma japonicum, and upstream and downstream primers and probes for detecting the internal standard gene sequence.

8. The composition according to claim 5, characterized in that The components of the composition are present in the same package.

9. The composition according to any one of claims 5 to 7, characterized in that The internal standard gene is a human housekeeping gene.

10. The composition according to any one of claims 3 to 9, characterized in that The probe comprises a fluorescent reporter group.

11. The composition according to claim 10, characterized in that The fluorescent reporter groups of different probes are different from each other and do not interfere with each other.

12. The composition according to claim 10 or 11, characterized in that The fluorescent reporter group of the probe of the SjTR1 microsatellite sequence is FAM; and / or The fluorescent reporter group of the probe of the internal standard gene is HEX or VIC; and / or The fluorescent reporter group of the probe of SM1-7 sequence is ROX; and / or The fluorescent reporter group of the probe of Dra1 sequence is CY5.

13. Use of the composition according to any one of claims 3 to 12 in preparing a kit for detecting schistosomiasis pathogens.

14. A kit for detecting a schistosomiasis pathogen, the kit comprising the composition according to any one of claims 3 to 12.

15. A method for detecting and distinguishing schistosomiasis pathogens, characterized in that: The detection comprises the following steps: 1) Extracting or releasing nucleic acid from the sample to be tested; 2) performing fluorescent quantitative PCR on the nucleic acid obtained in step 1) using the composition described in any one of claims 3 to 12 or the kit described in claim 14; 3) Obtain and analyze the results.

Images