Composition and detection method for detecting β-casein a1 type gene and β-casein a2 type gene in milk

Abstract

The present invention relates to a composition and a detection method that can be used to detect whether a β-casein A1 type gene and a β-casein A2 type gene are mixed in milk, and have the effect that the β-casein A1 type gene and the β-casein A2 type gene can be accurately detected even when mixed at a low concentration.

Description

Composition and detection method for detecting β-casein A1 type gene and β-casein A2 type gene of milk

[0001] The present application relates to a composition for detecting β-casein A1 type gene and β-casein A2 type gene in milk and a detection method thereof.

[0002] Milk is the primary source of protein in the modern human diet and is a complete food that provides balanced nutrients. Milk typically contains approximately 30 grams of protein per liter, of which casein is the largest component, accounting for approximately 80%, and β-casein accounts for approximately 37%. β-Casein is further classified into A1, A1 / A2 mixed, and A2 types. If the 67th amino acid of β-casein is histidine, it is called β-casein A1, and if it is proline, it is called β-casein A2. When the 67th amino acid of β-casein is histidine, phosphorylation is induced, producing a peptide consisting of seven amino acids. This peptide is named β-casomorphin-7 peptide (BCM-7). BCM-7 is known to be involved in indigestion, inflammation, and allergies. On the other hand, if the 67th amino acid is proline, that is, if it is the A2 type β-casein, then it is milk in which phosphorylation is not induced and BCM-7 is not produced.

[0003] Korean Patent No. 10-2297680 is a patent for a method for selecting cows that produce high-quality milk with a high β-casein A2 content and appropriate somatic cell count and urea nitrogen content. However, after analyzing the genetic traits of dairy cows capable of producing β-casein A2 milk and selecting cows, several processes are required to produce milk. That is, depending on the trait, several steps are required, such as separate breeding of dairy cows, separate production, separate milk collection, and separate processing. However, there is a possibility of β-casein A1 milk being mixed in during this process, and the methods for detecting β-casein A1 milk are currently ambiguous or time-consuming, making them difficult to apply in practice. Furthermore, a technical method for testing commercially available milk has not been established, limiting the quality control of β-casein A2 milk.

[0004] Therefore, there was a need to develop a method that could detect the presence of β-casein A1 and β-casein A2 in milk.

[0005] The problem that the present application seeks to solve is to provide a composition capable of detecting the presence or absence of mixing of β-casein A1 type gene and β-casein A2 type gene in milk.

[0006] Another problem that the present application seeks to solve is to provide a kit capable of detecting the presence of β-casein A1 type gene and β-casein A2 type gene in milk.

[0007] Another problem that the present application seeks to solve is to provide a method for detecting whether β-casein A1 type gene and β-casein A2 type gene are mixed in milk.

[0008] One embodiment of the present application provides a composition for detecting β-casein A1 type gene and β-casein A2 type gene of milk, comprising: a forward primer consisting of a base sequence of SEQ ID NO: 1; a reverse primer consisting of a base sequence of SEQ ID NO: 2; a probe consisting of a base sequence of SEQ ID NO: 3; and a probe consisting of a base sequence of SEQ ID NO: 4.

[0009] In one embodiment of the present application, the composition further comprises a probe having a base sequence of SEQ ID NO: 5, and is capable of identifying a low concentration of β-casein A1 type gene.

[0010] In one embodiment of the present application, the detection may be by real time polymerase chain reaction (Real time PCR).

[0011] One embodiment of the present application provides a diagnostic kit for detection comprising the composition.

[0012] One embodiment of the present application provides a method for detecting whether a β-casein A1 gene and a β-casein A2 gene are mixed in milk, comprising the step of performing real-time polymerase chain reaction (Real time PCR) using a composition comprising a forward primer consisting of a base sequence of SEQ ID NO: 1, a reverse primer consisting of a base sequence of SEQ ID NO: 2, a probe consisting of a base sequence of SEQ ID NO: 3, and a probe consisting of a base sequence of SEQ ID NO: 4.

[0013] In one embodiment of the present application, the step of performing the real-time polymerase chain reaction may include a step of initially denaturing the DNA of milk at 90°C to 97°C; and a step of adding the composition, denaturing at 90°C to 97°C, and annealing at 50°C to 60°C, repeatedly performing the steps.

[0014] In one embodiment of the present application, the step of performing the real-time polymerase chain reaction includes, after the initial denaturing step, a step of binding a probe having a base sequence of SEQ ID NO: 5 to a β-casein A2 type gene at 65°C to 75°C to inhibit amplification; and a low concentration of the β-casein A1 type gene can be detected.

[0015] The composition and diagnostic kit of the present application can detect whether β-casein A1 type gene and β-casein A2 type gene are mixed in milk, and have the advantage of being able to detect whether β-casein A1 gene is mixed even when mixed at a low concentration.

[0016] The composition and diagnostic kit of the present application further include a β-casein A2 type gene amplification inhibition probe, so that it has the advantage of being able to detect whether the β-casein A1 type gene is mixed even when mixed at a low concentration.

[0017] Figure 1 shows the results of a β-casein A1 type gene detection reagent in milk not mixed with β-casein A1 type milk of Example 1, Figure 2 shows the results of a β-casein A2 type gene detection reagent, and Figure 3 shows the results of a β-casein A1 type gene and a β-casein A2 type gene detection reagent together.

[0018] Figure 4 shows the results of a β-casein A1 type gene detection reagent and a β-casein A2 type gene detection reagent in milk containing 1 wt% of β-casein A1 type milk of Example 2.

[0019] Figure 5 shows the results of a β-casein A1 type gene detection reagent in milk not containing β-casein A1 type milk of Example 3, Figure 6 shows the results of a β-casein A2 type gene detection reagent, and Figure 7 shows the results of a β-casein A1 type gene and a β-casein A2 type gene detection reagent together.

[0020] Figure 8 shows the results of a β-casein A1 type gene detection reagent in milk containing 1 wt% of β-casein A1 type milk of Example 4, Figure 9 shows the results of a β-casein A2 type gene detection reagent, and Figure 10 shows the results of a β-casein A1 type gene and a β-casein A2 type gene detection reagent together.

[0021] Figure 11 shows the results of the β-casein A1 type gene detection reagent and the β-casein A2 type gene detection reagent in milk not mixed with the β-casein A1 type milk of Comparative Example 1, and Figure 12 shows the results of the β-casein A1 type gene detection reagent and the β-casein A2 type gene detection reagent in milk mixed with 1 wt% of the β-casein A1 type milk.

[0022] Figure 13 shows the results of the β-casein A1 type gene detection reagent and the β-casein A2 type gene detection reagent in milk not mixed with the β-casein A1 type milk of Comparative Example 2, and Figure 14 shows the results of the β-casein A1 type gene detection reagent and the β-casein A2 type gene detection reagent in milk mixed with 1 wt% of the β-casein A1 type milk.

[0023] Hereinafter, the present application will be described in more detail.

[0024] The specific functional descriptions below are merely illustrative examples to explain embodiments according to the concept of the present application, and embodiments according to the concept of the present application may be implemented in various forms and should not be construed as being limited to the embodiments described in this specification.

[0025] Embodiments based on the concepts of this application may be subject to various modifications and take various forms, and thus specific embodiments are described in detail herein. However, this is not intended to limit the embodiments based on the concepts of this application to a specific disclosed form, and it should be understood that all modifications, equivalents, and alternatives fall within the spirit and technical scope of this application.

[0026] The terminology used in this specification is used solely to describe specific embodiments and is not intended to limit the present application. The singular expression "a," "an," and "the" include the plural expressions unless the context clearly dictates otherwise.

[0027] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which this application pertains. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and will not be interpreted in an idealized or overly formal sense unless explicitly defined herein.

[0028] One embodiment of the present application provides a composition capable of detecting β-casein A1 type gene and β-casein A2 type gene in milk and determining whether they are mixed, comprising: a forward primer consisting of a base sequence of SEQ ID NO: 1; a reverse primer consisting of a base sequence of SEQ ID NO: 2; a probe consisting of a base sequence of SEQ ID NO: 3; and a probe consisting of a base sequence of SEQ ID NO: 4.

[0029] The term "determination" in this application encompasses quantitative and / or qualitative analysis, including detection of presence or absence and concentration measurement. Such methods are well known in the art, and those skilled in the art will be able to select an appropriate method for the implementation of this application. "Determination" in this application refers to deriving a result regarding the presence or absence of a target gene in the milk being tested.

[0030] In this application, "casein" refers to the main protein of milk, a type of phosphorus protein, and is composed of α-, β-, κ-casein, and other trace caseins. Since the average nitrogen content contained in casein is 15.67%, when quantifying casein (or milk protein), the amount of nitrogen is multiplied by a coefficient of 6.38 to obtain the result. Casein has the property of precipitating at pH 4.6, because the average isoelectric point of casein is pH 4.6. When milk is acidified, the calcium and some of the phosphorus in the casein complex become soluble and liberate into whey, and casein precipitates without containing salt.

[0031] The above β-casein is classified into β-casein A1 type and β-casein A2 type, and β-casein A1 type differs from β-casein A2 type by a single amino acid. In order to distinguish the traits of β-casein A1 type and β-casein A2 type in dairy cows, it can be determined whether the 200th base of the CSN2 gene is A or C. Specifically, if the gene sequence is CAT, it is β-casein A1 type expressed as histidine at the 67th amino acid, and if the gene sequence is CTT, it can be determined as β-casein A2 type expressed as proline at the 67th amino acid. This single amino acid difference is crucial for the enzymatic digestion of β-caseins in the intestine, as the presence of histidine at position 67 allows a protein fragment containing seven amino acids, named β-casomorphin-7 (BCM-7), to be generated during enzymatic digestion. Therefore, BCM-7 is a digestion product of β-casein A1 and causes indigestion, inflammation, and allergies. In the case of β-casein A2, position 67 is occupied by proline, which prevents cleavage of the amino acid bond, so BCM-7 is not generated as a digestion product.

[0032] To determine whether the 200th base of the CSN2 gene is A or C, a single nucleotide sequence (SNP) (rs43703011) must be distinguished, thus inducing a specific response. Conventional DNA probes have struggled with discrimination due to their low dTm per base. The probe according to the present application utilizes PNA, rather than DNA, which offers the advantage of improved single-base sequence discrimination.

[0033] For individual analysis of dairy cows, genetic traits of dairy cows can be screened because the β-casein A1 trait and the β-casein A2 trait exist at 100% or 50%, respectively. However, milk with the β-casein A1 trait may be mixed in during the milk production process, and in this case, rather than screening the genetic traits of the individual, it is necessary to distinguish between the β-casein A1 trait and the β-casein A2 trait in the milk. Furthermore, when β-casein A1 type milk is mixed in at a low concentration, the fluorescence value increases as the amount of non-specific binding increases due to the characteristics of the nucleic acid amplification method using a dual-labeled probe, so there is a problem that accuracy is low with only the analysis of the Ct value range, as in Korean Patent No. 10-2297680.

[0034] The present application has the advantage of increasing the accuracy of detection of the β-casein A1 type gene by suppressing the amplification of the β-casein A2 type gene by using a β-casein A2 type gene amplification suppressing PNA probe.

[0035] The primers of the present application may incorporate additional features that do not alter their basic properties. That is, the nucleic acid sequence may be modified using a number of methods known in the art. Examples of such modifications include methylation, capping, substitution of one or more nucleotides with homologs, and modification of nucleotides with uncharged linkers such as phosphonates, phosphotriesters, phosphoramidates, or carbamates, or with charged linkers such as phosphorothioates or phosphorodithioates. The nucleic acids may also have one or more additional covalently bonded moieties, such as nucleases, toxins, antibodies, signal peptides, proteins such as poly-L-lysine, intercalators such as acridine or psoralens, chelating agents such as metals, radioactive metals, and iron-oxidizing metals, and alkylating agents. Additionally, the primer of the present application may comprise a nucleotide analogue, for example, a phosphorothioate, an alkyl phosphorothioate, or a peptide nucleic acid, or may comprise an intercalating agent.

[0036] In this application, the term “probe” means a nucleic acid fragment corresponding to several to several hundred bases that can specifically bind to DNA or RNA, and can be produced in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, a PNA (Peptide Nucleic Acid), etc., but a PNA probe can be preferably used. PNA (Peptide Nucleic Acid) has excellent gene recognition ability due to its structural characteristics, and has the advantage of maintaining a more stable binding because the binding force of PNA-DNA is stronger than that of DNA-to-DNA.

[0037] The above probes can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. Such probes can be modified using many means known in the art, as long as they are effective in detecting β-casein A1 and β-casein A2. Examples of such modifications include methylation, capping, substitution with one or more homologues of a natural nucleotide, and modification between nucleotides, such as modification with uncharged linkers (e.g., methylphosphonate, phosphotriester, phosphoroamidate, carbamate, etc.) or charged linkers (e.g., phosphorothioate, phosphorodithioate, etc.). The nucleic acid may contain one or more additional covalently linked moieties, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridine, proralene, etc.), chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents.

[0038] Additionally, the probe sequence of the present application can be modified with a label capable of directly or indirectly providing a detectable signal. The probe can include a label detectable using spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (typically used in ELISA), biotin, haptens, and proteins for which antiserum or monoclonal antibodies are available.

[0039] In one embodiment of the present application, the probe may be labeled with a fluorescent dye that acts as a reporter. The probe may also have a second dye that acts as a quencher, and may include a fluorescent dye and a quencher at the 5' end and the 3' end, respectively. When multiple probes are included, the fluorescent dyes included at the 5' end of each probe may all be identical. The reporter dye is measured at a predetermined wavelength, thereby amplifying the target for detection and identification. The probe fluorescence signal in its entirety is suppressed by the quencher dye.

[0040] Additionally, one or more additional probes, such as internal reference controls or other target probes, or other nucleic acids, may be labeled with a unique reporter fluorochrome different from the fluorochrome label associated with the probe. In such cases, by measuring a specific reporter fluorochrome at a predetermined wavelength, simultaneous detection and identification of the amplified target and the one or more additional probes is possible.

[0041] The fluorescent substances are 6-FAM (6-carboxyfluorescein), 5-FAM (5-carboxyfluorescein), Hexachloro-6-carboxyfluorescein, Tetrachloro-6-carboxyfluorescein, HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), Fluorescein chlorotriazinyl, Rhodamine green, Rhodamine red, Tetramethylrhodamine, Fluorescein isothiocyanate (FITC), Oregon green, Alexa fluor, It may be at least one selected from the group consisting of JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-XRhodamine), TET (Tetrachloro-Fluorescein), TRITC (Tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), Texas red, Cy3 (Cyanine-3), and Cy5 (Cyanine-5).

[0042] The above quencher may be at least one selected from the group consisting of BHQ1 (Black hole quencher 1), BHQ2 (Black hole quencher 2), BHQ3 (Black hole quencher 3), TAMRA (6-carboxytetramethyl-rhodamine), NFQ (Nonfluorescent quencher), Dabcyl, Eclipse, DDQ (Deep Dark Quencher), Blackberry Quencher, and Iowa black.

[0043] In this application, the term “real-time polymerase chain reaction (Real-time PCR)” refers to a method of amplifying DNA in real time and simultaneously measuring the amplified amount based on polymerase chain reaction.

[0044] The above real-time polymerase chain reaction can monitor and confirm the increase in PCR amplification products in real time, so there is no need for an additional electrophoresis analysis method, and compared to the existing PCR method that confirms PCR amplification products at the end point, PCR can be interpreted quickly and easily, and the risk of contamination is low. In addition, the method for detecting real-time polymerase chain reaction amplification products uses a probe that is specific to the target sequence and has a fluorescent dye attached, and has the advantage of high detection specificity, so that even similar sequences can be distinguished and detected.

[0045] In one embodiment of the present application, the composition may include a PCR premix; a primer and probe set; and an internal control (IC).

[0046] In this application, the term “PCR premix” means a reaction mixture prepared in advance before a PCR reaction, into which a DNA sample to be analyzed can be added and a ready-to-use reagent that can be used for PCR reaction immediately.

[0047] The above PCR premix may use a master mix further containing a mixture of dNTPs (dATP, dCTP, dGTP, dTTP, dUTP or variants with similar functions), magnesium chloride (MgCl2), DNA polymerase or buffer solution.

[0048] One embodiment of the present application provides a diagnostic kit capable of detecting the presence or absence of contamination by detecting the β-casein A1 type gene and the β-casein A2 type gene of the milk.

[0049] In this application, the term "kit" means a set of test specimens for screening β-casein A1 type gene and β-casein A2 type gene in milk, which can confirm the presence of a specific SNP in milk, preferably including primers and probes for the target SNP of this application, but is not limited thereto.

[0050] The above diagnostic kit is not limited to a specific form and may be implemented in various forms. In one embodiment, the diagnostic kit may include lyophilized primers contained in a container such as a disposable PCR tube. For example, the kit may include a disposable PCR tube containing a composition using the primer and probe sets of SEQ ID NOs: 1 to 3 in the form of a lyophilized powder.

[0051] The above diagnostic kit may contain a reaction mixture containing the primers and probes, polymerase, and buffer in liquid form, contained in a container such as a PCR tube. This mixture may be stored frozen and thawed for use when needed. The diagnostic kit has the advantage of enhancing the convenience and properties of detection, as it requires no additional steps other than adding a sample.

[0052] One embodiment of the present application provides a method for detecting whether a β-casein A1 gene and a β-casein A2 gene are mixed in milk, comprising the step of performing a real-time polymerase chain reaction (Real-time PCR) method using a composition comprising: a forward primer comprising a base sequence of SEQ ID NO: 1; a reverse primer comprising a base sequence of SEQ ID NO: 2; a probe comprising a base sequence of SEQ ID NO: 3; and a probe comprising a base sequence of SEQ ID NO: 4.

[0053] In the above detection method, the step of performing real-time polymerase chain reaction may include a step of initially denaturing the DNA of the milk at 90° C. to 97° C., more specifically, at 93° C. to 96° C. The initial denaturation step may be performed for 5 seconds to 10 minutes, more specifically, for 10 seconds to 5 minutes, to dissociate the double strands of the DNA.

[0054] In addition, the step of performing the real-time polymerase chain reaction may include, after the initial denaturing step, a step of inhibiting amplification by binding a probe consisting of the base sequence of SEQ ID NO: 5 to the β-casein A2 gene at 65°C to 75°C, more specifically at 68°C to 72°C. The step of inhibiting amplification is performed for 30 seconds to 15 minutes, more specifically at 3 minutes to 10 minutes, thereby inhibiting amplification of the β-casein A2 gene, thereby solving the problem of reduced accuracy due to an increase in fluorescence value when using a dual-labeled probe, and having the advantage of being able to accurately detect even when the β-casein A1 gene is included at a low concentration. At this time, there is an advantage in that detection is possible even when the ratio of β-casein A1 type gene among β-casein A1 type gene and β-casein A2 type gene is mixed at a low concentration of 0.1 or less, 0.01 or less, or 0.001 or less.

[0055] After the step of suppressing the amplification, the method may include a step of adding the composition, denaturing at 90° C. to 97° C., more specifically at 93° C. to 96° C., and repeating annealing at 50° C. to 60° C., more specifically at 54° C. to 58° C., thereby amplifying the gene.

[0056] In the step of amplifying the above gene, denaturation may be performed for 1 to 15 seconds, specifically 3 to 10 seconds, and annealing may be performed for 3 to 30 seconds, specifically 5 to 20 seconds. In the step of performing the above annealing, if the temperature is higher than 60°C, the primers may not anneal, resulting in no PCR product being generated, and if the temperature is lower than 50°C, nonspecific annealing may occur, resulting in no accurate PCR product being generated.

[0057] In the step of amplifying the above gene, denaturation may be performed for 1 to 15 seconds, specifically 3 to 10 seconds, and annealing may be performed for 3 to 30 seconds, specifically 5 to 20 seconds. In the step of performing the above annealing, if the temperature is higher than 60°C, the primers may not anneal, resulting in no PCR product being generated, and if the temperature is lower than 50°C, nonspecific annealing may occur, resulting in no accurate PCR product being generated.

[0058] Additionally, the milk may be used diluted or undiluted before being instilled onto the sample pad of the diagnostic kit of the present application.

[0059]

[0060] Hereinafter, the present application will be described in more detail through manufacturing examples, working examples, comparative examples, and experimental examples. These examples are intended solely to illustrate the present application, and it will be apparent to those skilled in the art that the scope of the present application is not limited by these examples.

[0061]

[0062] 1. Preparation of primers and probes for SNP detection in CNS2

[0063] Primers and probes capable of detecting β-casein A1 type gene and β-casein A2 type gene in milk were prepared, and each sequence is as shown in Table 1 below, and the combinations used for each example are as shown in Table 2.

[0064] Sequence number Target description Base sequence (5'-3') Label Fluorescent 1 A1 and A2 Forward primer GCCCAGACACAGATCTCTAGTC 2 A1 and A2 Reverse primer CACCACAGGGGTTTGAGTAAGAGG 3 A1 PNA probe CCATCCATAACAGCCCy 54 A2 PNA probe CCATCCCTAACAGCROX 5 A2 Amplification inhibitor PNA probe GCCCATCCCTAACAGCC

[0065] Distinctive Target Combination Examples 1 and 2 A1 SEQ ID NO. 1, 2 and 3 A2 SEQ ID NO. 1, 2 and 4 Examples 3 and 4 A1 SEQ ID NO. 1, 2, 3 and 5 A2 SEQ ID NO. 1, 2, 4 and 5

[0066]

[0067] 2. Gene amplification through real-time polymerase chain reaction

[0068] <Example 1>

[0069] Milk sample 1 without β-casein A1 type milk was prepared, nucleic acid was extracted, and the nucleic acid was amplified using a mixture of primers and probes of sequence numbers 1 to 3 and a mixture of primers and probes of sequence numbers 1 to 2 and 4, and the results were analyzed. The operating conditions of a real-time polymerase chain reaction device (product name: PCR316, manufacturer: MycoBiomed) are as shown in Table 3 below.

[0070] Step Temperature (℃) Time Cycle Initial Denaturation 953 min 1 A2 Gene Binding 705 min 1 Denaturation 955 sec 45 Annealing 5610 sec

[0071] In the above Table 3, DNA double strands were dissociated in the initial denaturation step, and then the denaturation step and annealing step were repeated to amplify and detect the nucleic acids of the β-casein A1 type gene and the β-casein A2 type gene.

[0072] The experiment was performed twice for the above milk sample 1, and the results are shown in Table 4 below, and the second results are shown in Figs. 1 to 3. The results of the β-casein A1 type gene detection reagent are shown in Fig. 1, the results of the β-casein A2 type gene detection reagent are shown in Fig. 2, and the results of the β-casein A1 type and β-casein A2 type detection reagents are shown together in Fig. 3. It was confirmed that the β-casein A2 type was accurately and specifically detected.

[0073] Example 1 Cy5(A1)ROX(A2)A1: 0 wt%, A2: 100 wt%A1: 0 wt%, A2: 100 wt%A1 mixN / D N / D A2 mix 28.75 28.74

[0074]

[0075] <Example 2>

[0076] Milk sample 2 containing 1 wt% of β-casein A1 type milk and 99 wt% of β-casein A2 type milk was prepared, and the same process as Example 1 was performed. The experiment was performed twice and is shown in Table 5 below, and the β-casein A1 type gene detection reagent results and β-casein A2 type gene detection reagent results of the second result are shown in Fig. 4. β-casein A2 type was accurately detected, but β-casein A1 type mixed in at a low concentration (1 wt%) was not detected.

[0077] Example 2 Cy5(A1)ROX(A2)A1: 1 wt%, A2: 99 wt%A1: 1 wt%, A2: 99 wt%A1 mixN / D N / D A2 mix 30.22 30.01

[0078]

[0079] <Example 3>

[0080] Milk sample 1 was prepared in the same manner as in Example 1, and nucleic acids were extracted. The nucleic acids were amplified using a mixture of primers and probes of sequence numbers 1 to 3 and 5 and a mixture of primers and probes of sequence numbers 1 to 2 and 4, and the results were analyzed. The operating conditions of the real-time polymerase chain reaction device are as shown in Table 2 above.

[0081] In the above Table 2, in the initial denaturation step, the DNA double strand is dissociated, and in the β-casein A2 type gene binding step, the PNA probe of the above sequence number 5 binds to the β-casein A2 type gene to inhibit amplification. Thereafter, the denaturation step and the annealing step are repeated to amplify and detect the nucleic acids of the β-casein A1 type gene and the β-casein A2 type gene.

[0082] The experiment was performed twice for the above milk sample 1, and the results are shown in Table 6 below, and the second results are shown in Figs. 5 to 7. The results of the β-casein A1 type gene detection reagent are shown in Fig. 5, the results of the β-casein A2 type gene detection reagent are shown in Fig. 6, and the results of the β-casein A1 type and β-casein A2 type detection reagents are shown together in Fig. 7. It was confirmed that the β-casein A2 type was accurately and specifically detected.

[0083] Example 3 Cy5(A1)ROX(A2)A1: 0 wt%, A2: 100 wt%A1: 0 wt%, A2: 100 wt%A1 mixN / D N / D A2 mix 28.97 29.18

[0084]

[0085] <Example 4>

[0086] Milk sample 2 containing 1 wt% of β-casein A1 type milk and 99 wt% of β-casein A2 type milk was prepared, and the same process as Example 3 was performed. β-casein A1 type and β-casein A2 type were accurately and specifically detected, and it was confirmed that accurate detection and analysis were possible even when low concentrations of β-casein A1 type milk were mixed. The experiment was performed twice and is shown in Table 7 below, and the second results are shown in Figs. 8 to 10. Fig. 8 shows the results of the β-casein A1 type gene detection reagent, Fig. 9 shows the results of the β-casein A2 type gene detection reagent, and Fig. 10 shows the results of the β-casein A1 type gene detection reagent and the β-casein A2 type gene detection reagent.

[0087] Example 4 Cy5(A1)ROX(A2)A1: 1 wt%, A2: 99 wt%A1: 1 wt%, A2: 99 wt%A1 mix33.96 34.52 A2 mix 30.07 30.43

[0088]

[0089] <Comparative Example 1>

[0090] The above milk sample 1 and milk sample 2 containing 1 wt% of β-casein A1 type milk and 99 wt% of β-casein A2 type milk were prepared, and after nucleic acid extraction, the same process as Example 1 was performed using a mixture solution of primers and probes of sequence numbers 1 to 2 and 6 and a mixture solution of primers and probes of sequence numbers 1 to 2 and 7 in Table 8 below.

[0091] Sequence number, target description, base sequence (5'-3'), label, fluorescent, 1A1 and A2, forward primer, GCCCAGACACAGCTCTAGTC, 2A1 and A2, reverse primer, CACCACAGGGGTTTGAGTAAGAGG, 6A1, DNA probe, AGAGGCGNCCCCATCCATAACAGCCTCGCCTCTFAM, 7A2, DNA probe, GGAGCCGCCCATCCCTAACAGCCTCGGCTCCTexasRed

[0092] *N is a base sequence that can be modified.

[0093]

[0094] The experiment was conducted twice and is shown in Table 9 below, and the results of the second result using the β-casein A1 type gene detection reagent and the β-casein A2 type gene detection reagent are shown in Figures 11 and 12. Non-specific detection was observed when a DNA probe was used as a probe for detecting β-casein A1 type and β-casein A2 type, and it was impossible to determine whether β-casein A1 type was mixed in.

[0095] Comparative Example 1FAM(A1)TEX(A2)FAM(A1)TEX(A2)A1: 0 wt%, A2: 100 wt%A1: 0 wt%, A2: 100 wt%A1: 1 wt%, A2: 99 wt%A1: 1 wt%, A2: 99 wt%A1 mix25.1726.1525.1326.38A2 mix27.3329.1227.2227.43

[0096]

[0097] Comparative Example 2

[0098] Milk sample 1 and milk sample 2 containing 1 wt% of β-casein A1 type milk and 99 wt% of β-casein A2 type milk were prepared, and after nucleic acid extraction, the same process as Comparative Example 1 was performed using a mixture solution of primers and probes of sequence numbers 1 to 2 and 6 of Table 10 below and a mixture solution of primers and probes of sequence numbers 1 to 2, 5 and 7.

[0099] Sequence number, target description, base sequence (5'-3'), label, fluorescent 1A1 and A2, forward primer, GCCCAGACACAGCTCTAGTC, 2A1 and A2, reverse primer, CACCACAGGGGTTTGAGTAAGAGG6A1, DNA probe, AGAGGCGNCCCCATCCATAACAGCCTCGCCTCTFAM7A2, DNA probe, GGAGCCGCCCATCCCTAACAGCCTCGGCTCCTexasRed5A2, amplification inhibitor, PNA probe, GCCCATCCCTAACAGCC

[0100] *N is a base sequence that can be modified.

[0101]

[0102] The experiment was conducted twice and is shown in Table 11 below, and the results of the second result using the β-casein A1 type gene detection reagent and the β-casein A2 type gene detection reagent are shown in Figures 13 and 14. Even when the amplification suppression PNA probe was used, non-specific detection occurred when a DNA probe was used as a detection probe for β-casein A1 type and β-casein A2 type, and it was impossible to determine whether β-casein A1 type was mixed.

[0103] Comparative Example 2FAM(A1)TEX(A2)FAM(A1)TEX(A2)A1: 0 wt%, A2: 100 wt%A1: 0 wt%, A2: 100 wt%A1: 1 wt%, A2: 99 wt%A1: 1 wt%, A2: 99 wt%A1 mix42.6931.2444.0230.69A2 mix27.2029.0027.1827.52

[0104]

[0105] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A forward primer consisting of the base sequence of sequence number 1; A reverse primer consisting of the base sequence of sequence number 2; A probe consisting of the base sequence of sequence number 3; and A composition for detecting β-casein A1 type gene and β-casein A2 type gene of milk, comprising a probe having a base sequence of sequence number 4.

2. In claim 1, The above composition, Further comprising a probe consisting of a base sequence of sequence number 5, A composition for detecting β-casein A1 type gene and β-casein A2 type gene of milk, capable of determining low concentration of β-casein A1 gene.

3. In claim 1, The above detection is, A composition for detecting β-casein A1 type gene and β-casein A2 type gene of milk by real time polymerase chain reaction (Real time PCR).

4. A diagnostic kit for detecting β-casein A1 type gene and β-casein A2 type gene of milk, comprising the composition of any one of claims 1 to 3.

5. Forward primer consisting of the base sequence of sequence number 1, A reverse primer consisting of the base sequence of sequence number 2, A probe consisting of the base sequence of sequence number 3 and A method for detecting whether milk contains β-casein A1 type gene and β-casein A2 type gene, comprising the step of performing real-time polymerase chain reaction (Real time PCR) using a composition comprising a probe having a base sequence of sequence number 4.

6. In claim 5, The step of performing the above real-time polymerase chain reaction is: A step of initially denaturing the DNA of milk at 90°C to 97°C; and A method for detecting whether milk contains β-casein A1 type gene and β-casein A2 type gene, comprising the steps of adding the above composition, denaturing at 90°C to 97°C, and repeatedly performing annealing at 50°C to 60°C.

7. In claim 6, The step of performing the above real-time polymerase chain reaction is: After the initial denaturing step mentioned above, A step of inhibiting amplification by binding to a β-casein A2 type gene at 65°C to 75°C with a probe having a base sequence of sequence number 5; A method for detecting whether β-casein A1 type gene and β-casein A2 type gene are mixed in milk, which detects low concentration of β-casein A1 type gene.

Images