Bicyclic compounds for restoring mutant p53 function

Abstract

Mutations in oncogenes and tumor suppressors contribute to the development and progression of cancer. The present disclosure describes compounds and methods to recover wild-type function to p53 mutants. The compounds of the present disclosure can bind to mutant p53 and restore the ability of the p53 mutant to bind DNA and activate downstream effectors involved in tumor suppression. The disclosed compounds can be used to reduce the progression of cancers that contain a p53 mutation.

Description

BICYCLIC COMPOUNDS FOR RESTORING MUTANT P53 FUNCTIONCROSS REFERENCE

[0001] This application claims the benefit of U.S. Provisional Patent Application Number 63 / 537,610, filed September 11, 2023, which is incorporated by reference herein in its entirety.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on September 10, 2024, is named PMV_44727-731601.xml and is 3,841 bytes in size.BACKGROUND

[0003] Cancer, an uncontrolled proliferation of cells, is a multifactorial disease characterized by tumor formation, growth, and in some instances, metastasis. Cells carrying an activated oncogene, damaged genome, or other cancer-promoting alterations can be prevented from replicating through an elaborate tumor suppression network. A central component of this tumor suppression network is p53, one of the most potent tumor suppressors in the cell. Both the wild type and mutant conformations of p53 are implicated in the progression of cancer.INCORPORATION BY REFERENCE

[0004] Each patent, publication, and non-patent literature cited in the application is hereby incorporated by reference in its entirety as if each was incorporated by reference individually.SUMMARY OF THE INVENTION

[0005] In some embodiments, the present disclosure provides a compound of formula Ila, or a pharmaceutically-acceptable salt thereof:wherein:X3is CR9R10, NR9, O, or S;A is a substituted or unsubstituted aromatic 5-membered, 6-membered, 7-membered, or 8-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S;R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -SR16, - NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or -SiR16R17R18;R2is alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independentlysubstituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, or -OC(O)R21;R5is selected from alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; each R9, R10, R16, R17, and R18is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, - C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; and each R21and R22is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H.

[0006] In some embodiments, the present disclosure provides a compound of formula lib, or a pharmaceutically-acceptable salt thereof:wherein:X3is CR9R10, NR9, O, or S;A is ethyndiyl or a substituted or unsubstituted aromatic 5 -membered, 6-membered, 7-membered, or 8-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S;R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -SR16, - NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or -SiR16R17R18;R2is alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, or -OC(O)R21;R5is selected from alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21C(O)R22, or -OC(O)R21; each R9, R10, R16, R17, and R18is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, - C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; and each R21and R22is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H.

[0007] In some embodiments, disclosed herein is a method of inducing apoptosis in a cell, the method comprising contacting the cell with a therapeutically-effective amount of a compound of the disclosure that binds a p53 mutant, wherein the compound increases the ability of the p53 mutant to bind DNA,wherein the cell expresses the p53 mutant.

[0008] In some embodiments, disclosed herein is a method of treating a cancer, the method comprising administering to a subject in need thereof a therapeutically-effective amount of a compound of the disclosure.DETAILED DESCRIPTION

[0009] The present disclosure provides compounds and methods for restoring wild-type function to mutant p53. The compounds of the present disclosure can bind to mutant p53 and restore the ability of the p53 mutant to bind DNA. The restoration of activity of the p53 mutant can allow for the activation of downstream effectors of p53 leading to inhibition of cancer progression. The disclosure further provides methods of treatment of a cancerous lesion or a tumor harboring a p53 mutation.

[0010] Cancer is a collection of related diseases characterized by uncontrolled proliferation of cells with the potential to metastasize throughout the body. Cancer can be classified into five broad categories including, for example: carcinomas, which can arise from cells that cover internal and external parts of the body such as the lung, breast, and colon; sarcomas, which can arise from cells that are located in bone, cartilage, fat, connective tissue, muscle, and other supportive tissues; lymphomas, which can arise in the lymph nodes and immune system tissues; leukemia, which can arise in the bone marrow and accumulate in the bloodstream; and adenomas, which can arise in the thyroid, the pituitary gland, the adrenal gland, and other glandular tissues.

[0011] Although different cancers can develop in virtually any of the body's tissues, and contain unique features, the basic processes that cause cancer can be similar in all forms of the disease. Cancer begins when a cell breaks free from the normal restraints on cell division and begins to grow and divide out of control. Genetic mutations in the cell can preclude the ability of the cell to repair damaged DNA or initiate apoptosis and can result in uncontrolled growth and division of cells.

[0012] The ability of tumor cell populations to multiply is determined not only by the rate of cell proliferation but also by the rate of cell attrition. Programmed cell death, or apoptosis, represents a major mechanism of cellular attrition. Cancer cells can evade apoptosis through a variety of strategies, for example, through the suppression of p53 function, thereby suppressing expression of pro-apoptotic proteins.

[0013] Oncogenes and tumor suppressor genes can regulate the proliferation of cells. Genetic mutations can affect oncogenes and tumor suppressors, potentially activating or suppressing activity abnormally, further facilitating uncontrolled cell division. Whereas oncogenes assist in cellular growth, tumor suppressor genes slow cell division by repairing damaged DNA and activating apoptosis. Cellular oncogenes that can be mutated in cancer include, for example, Cdkl, Cdk2, Cdk3, Cdk4, Cdk6, EGFR, PDGFR, VEGF, HER2, Raf kinase, K-Ras, and myc. Tumor suppressor genes that can be mutated in cancer include, for example, BRCA1, BRCA2, cyclin-dependent kinase inhibitor 1C, Retinoblastoma protein (pRb), PTEN, pl6, p27, p53, and p73.Tumor suppressor p53.

[0014] The tumor suppressor protein p53 is a 393 amino acid transcription factor that can regulate cell growth in response to cellular stresses including, for example, UV radiation, hypoxia, oncogene activation, and DNA damage. p53 has various mechanisms for inhibiting the progression of cancer including, for example, initiation of apoptosis, maintenance of genomic stability, cell cycle arrest, induction of senescence, and inhibition of angiogenesis. Due to the critical role of p53 in tumor suppression, p53 is inactivated in almost all cancers either by direct mutation or through perturbation of associated signaling pathways involved in tumor suppression. Homozygous loss of the p53 gene occurs in almost all types of cancer, including carcinomas of the breast, colon, and lung. The presence of certain p53 mutations in several types of human cancer can correlate with less favorable patient prognosis.

[0015] In the absence of stress signals, p53 levels are maintained at low levels via the interaction of p53 with Mdm2, an E3 ubiquitin ligase. In an unstressed cell, Mdm2 can target p53 for degradation by the proteasome. Under stress conditions, the interaction between Mdm2 and p53 is disrupted, and p53 accumulates. The critical event leading to the activation of p53 is phosphorylation of the N-terminal domain of p53 by protein kinases, thereby transducing upstream stress signals. The phosphorylation of p53 leads to a conformational change, which can promote DNA binding by p53 and allow transcription of downstream effectors. The activation of p53 can induce, for example, the intrinsic apoptotic pathway, the extrinsic apoptotic pathway, cell cycle arrest, senescence, and DNA repair. p53 can activate proteins involved in the above pathways including, for example, Fas / Apol, KILLER / DR5, Bax, Puma, Noxa, Bid, caspase-3, caspase-6, caspase-7, caspase-8, caspase-9, and p21 (WAF1). Additionally, p53 can repress the transcription of a variety of genes including, for example, c-MYC, Cyclin B, VEGF, RAD51, and hTERT.

[0016] Each chain of the p53 tetramer is composed of several functional domains including the transactivation domain (amino acids 1-100), the DNA-binding domain (amino acids 101-306), and the tetramerization domain (amino acids 307-355), which are highly mobile and largely unstructured. Most p53 cancer mutations are located in the DNA-binding core domain of the protein, which contains a central / i-sandwich of anti -parallel / i-shccts that serves as a basic scaffold for the DNA-binding surface. The DNA-binding surface is composed of two / i-tum loops, L2 and L3, which are stabilized by a zinc ion, for example, at Arg 175 and Arg248, and a loop-sheet-helix motif. Altogether, these structural elements form an extended DNA-binding surface that is rich in positively-charged amino acids and makes specific contact with various p53 response elements.

[0017] Due to the prevalence of p53 mutations in virtually every type of cancer, the reactivation of wild type p53 function in a cancerous cell can be an effective therapy. Mutations in p53 located in the DNA- binding domain of the protein or periphery of the DNA-binding surface result in aberrant protein folding required for DNA recognition and binding. Mutations in p53 can occur, for example, at amino acids Vall43, Hisl68, Argl75, Tyr220, Gly245, Arg248, Arg249, Phe270, Arg273, and Arg282. p53 mutations that can abrogate the activity of p53 include, for example, R175H, Y220C, G245S, R248Q, R248W, R273H, and R282H. These p53 mutations can either distort the structure of the DNA-bindingsite or thermodynamically destabilize the folded protein at body temperature. Wild-type function of p53 mutants can be recovered by binding of the p53 mutant to a compound that can shift the foldingunfolding equilibrium towards the folded state, thereby reducing the rate of unfolding and destabilization.

[0018] Non-limiting examples of amino acids include: alanine (A, Ala); arginine (R, Arg); asparagine (N, Asn); aspartic acid (D, Asp); cysteine (C, Cys); glutamic acid (E, Glu); glutamine (Q, Gin); glycine (G, Gly); histidine (H, His); isoleucine (I, He); leucine (L, Leu); lysine (K, Lys); methionine (M, Met); phenylalanine (F, Phe); proline (P, Pro); serine (S, Ser); threonine (T, Thr); tryptophan (W, Trp); tyrosine (Y, Tyr); and valine (V, Vai).Mechanism of compounds of the disclosure.

[0019] The compounds of the present disclosure can selectively bind to a p53 mutant and can recover wild-type activity of the p53 mutant including, for example, DNA binding function and activation of downstream targets involved in tumor suppression. In some embodiments, a compound of the disclosure selectively binds to the p53 Y220C mutant. The Y220C mutant is a temperature sensitive mutant, which binds to DNA at lower temperature and is denatured at body temperature. A compound of the disclosure can stabilize the Y220C mutant to reduce the likelihood of denaturation of the protein at body temperature.

[0020] Located in the periphery of the p53 / i-sandwich connecting / ^-strands S7 and S8, the aromatic ring of Y220 is an integral part of the hydrophobic core of the / i-sandwich. The Y220C mutation can be highly destabilizing, due to the formation of an internal surface cavity. A compound of the disclosure can bind to and occupy this surface crevice to stabilize the / i-sandwich, thereby restoring wild-type p53 DNA- binding activity.

[0021] To determine the ability of a compound of the disclosure to bind and stabilize mutant p53, assays can be employed to detect, for example, a conformational change in the p53 mutant or activation of wildtype p53 targets. Conformational changes in p53 can be measured by, for example, differential scanning fluorimetry (DSF), isothermal titration calorimetry (ITC), nuclear magnetic resonance spectrometry (NMR), or X-ray crystallography. Additionally, antibodies specific for the wild type of mutant conformation of p53 can be used to detect a conformational change via, for example, immunoprecipitation (IP), immunofluorescence (IF), or immunoblotting.

[0022] Methods used to detect the ability of the p53 mutant to bind DNA can include, for example, DNA affinity immunoblotting, modified enzyme-linked immunosorbent assay (ELISA), electrophoretic mobility shift assay (EMSA), fluorescence resonance energy transfer (FRET), homogeneous time- resolved fluorescence (HTRF), and a chromatin immunoprecipitation (ChIP) assay.

[0023] To determine whether a compound described herein is able to reactivate the transcriptional activity of p53, the activation of downstream targets in the p53 signaling cascade can be measured. Activation of p53 effector proteins can be detected by, for example, immunohistochemistry (IHC-P), reverse transcription polymerase chain reaction (RT-PCR), and western blotting. The activation of p53 can also be measured by the induction of apoptosis via the caspase cascade and using methods including, for example, Annexin V staining, TUNEL assays, pro-caspase and caspase levels, and cytochrome clevels. Another consequence of p53 activation is senescence, which can be measured using methods such as / i-galactosidase staining.

[0024] A p53 mutant that can be used to determine the effectiveness of a compound of the disclosure to increase the DNA binding ability of a p53 mutant is a p53 truncation mutant, which contains only amino acids 94-312, encompassing the DNA-binding domain of p53. For example, the sequence of the p53 Y220C mutant used for testing compound efficacy can be:SSSVPSQ KTYQGSYGFR LGFLHSGTAK SVTCTYSPAL NKMFCQLAKT CPVQLWVDST PPPGTRVRAM AIYKQSQHMT EVVRRCPHHERCSDSDGLAP PQHLIRVEGN LRVEYLDDRN TFRHSVVVPC EPPEVGSDCT TIHYNYMCNS SCMGGMNRRP ILTIITLEDS SGNLLGRNSF EVHVCACPGR DRRTEEENLR KKGEPHHELP PGSTKRALSN NT (SEQ ID NO. 1)

[0025] A compound of the disclosure can increase the ability of a p53 mutant to bind DNA by at least or up to about 0.1%, at least or up to about 0.2%, at least or up to about 0.3%, at least or up to about 0.4%, at least or up to about 0.5%, at least or up to about 0.6%, at least or up to about 0.7%, at least or up to about 0.8%, at least or up to about 0.9%, at least or up to about 1%, at least or up to about 2%, at least or up to about 3%, at least or up to about 4%, at least or up to about 5%, at least or up to about 6%, at least or up to about 7%, at least or up to about 8%, at least or up to about 9%, at least or up to about 10%, at least or up to about 11%, at least or up to about 12%, at least or up to about 13%, at least or up to about 14%, at least or up to about 15%, at least or up to about 16%, at least or up to about 17%, at least or up to about 18%, at least or up to about 19%, at least or up to about 20%, at least or up to about 21%, at least or up to about 22%, at least or up to about 23%, at least or up to about 24%, at least or up to about 25%, at least or up to about 26%, at least or up to about 27%, at least or up to about 28%, at least or up to about 29%, at least or up to about 30%, at least or up to about 31%, at least or up to about 32%, at least or up to about 33%, at least or up to about 34%, at least or up to about 35%, at least or up to about 36%, at least or up to about 37%, at least or up to about 38%, at least or up to about 39%, at least or up to about 40%, at least or up to about 41%, at least or up to about 42%, at least or up to about 43%, at least or up to about 44%, at least or up to about 45%, at least or up to about 46%, at least or up to about 47%, at least or up to about 48%, at least or up to about 49%, at least or up to about 50%, at least or up to about 51%, at least or up to about 52%, at least or up to about 53%, at least or up to about 54%, at least or up to about 55%, at least or up to about 56%, at least or up to about 57%, at least or up to about 58%, at least or up to about 59%, at least or up to about 60%, at least or up to about 61%, at least or up to about 62%, at least or up to about 63%, at least or up to about 64%, at least or up to about 65%, at least or up to about 66%, at least or up to about 67%, at least or up to about 68%, at least or up to about 69%, at least or up to about 70%, at least or up to about 71%, at least or up to about 72%, at least or up to about 73%, at least or up to about 74%, at least or up to about 75%, at least or up to about 76%, at least or up to about 77%, at least or up to about 78%, at least or up to about 79%, at least or up to about 80%, at least or up to about 81%, at least orup to about 82%, at least or up to about 83%, at least or up to about 84%, at least or up to about 85%, at least or up to about 86%, at least or up to about 87%, at least or up to about 88%, at least or up to about 89%, at least or up to about 90%, at least or up to about 91%, at least or up to about 92%, at least or up to about 93%, at least or up to about 94%, at least or up to about 95%, at least or up to about 96%, at least or up to about 97%, at least or up to about 98%, at least or up to about 99%, at least or up to about 100%, at least or up to about 125%, at least or up to about 150%, at least or up to about 175%, at least or up to about 200%, at least or up to about 225%, or at least or up to about 250% as compared to the ability of the p53 mutant to bind DNA in the absence of a compound of the disclosure.

[0026] A compound described herein can increase the activity of the p53 mutant that is, for example, at least or up to about 2-fold, at least or up to about 3 -fold, at least or up to about 4-fold, at least or up to about 5-fold, at least or up to about 6-fold, at least or up to about 7-fold, at least or up to about 8-fold, at least or up to about 9-fold, at least or up to about 10-fold, at least or up to about 11-fold, at least or up to about 12-fold, at least or up to about 13 -fold, at least or up to about 14-fold, at least or up to about 15- fold, at least or up to about 16-fold, at least or up to about 17-fold, at least or up to about 18-fold, at least or up to about 19-fold, at least or up to about 20-fold, at least or up to about 25 -fold, at least or up to about 30-fold, at least or up to about 35 -fold, at least or up to about 40-fold, at least or up to about 45- fold, at least or up to about 50-fold, at least or up to about 55 -fold, at least or up to about 60-fold, at least or up to about 65-fold, at least or up to about 70-fold, at least or up to about 75-fold, at least or up to about 80-fold, at least or up to about 85-fold, at least or up to about 90-fold, at least or up to about 95- fold, at least or up to about 100-fold, at least or up to about 110-fold, at least or up to about 120-fold, at least or up to about 130-fold, at least or up to about 140-fold, at least or up to about 150-fold, at least or up to about 160-fold, at least or up to about 170-fold, at least or up to about 180-fold, at least or up to about 190-fold, at least or up to about 200-fold, at least or up to about 250-fold, at least or up to about 300-fold, at least or up to about 350-fold, at least or up to about 400-fold, at least or up to about 450-fold, at least or up to about 500-fold, at least or up to about 550-fold, at least or up to about 600-fold, at least or up to about 650-fold, at least or up to about 700-fold, at least or up to about 750-fold, at least or up to about 800-fold, at least or up to about 850-fold, at least or up to about 900-fold, at least or up to about 950-fold, at least or up to about 1,000-fold, at least or up to about 1,500-fold, at least or up to about 2,000-fold, at least or up to about 3,000-fold, at least or up to about 4,000-fold, at least or up to about5,000-fold, at least or up to about 6,000-fold, at least or up to about 7,000-fold, at least or up to about8,000-fold, at least or up to about 9,000-fold, or at least or up to about 10,000-fold greater than the activity of the p53 mutant in the absence of the compound.

[0027] A compound of the disclosure can be used, for example, to induce apoptosis, cell cycle arrest, or senescence in a cell. In some embodiments, the cell is a cancer cell. In some embodiments, the cell carries a mutation in p53.Compounds of the disclosure.

[0028] In some embodiments, the disclosure provides a compound of formula la and lb, or a pharmaceutically acceptable salt thereof:wherein: each - is independently a single bond or a double bond;X1is CR5, CR5R6, N, NR5, O, S, C=O, C=S, or a carbon atom connected to A;X2is CR7, CR7R8, N, NR7, O, S, C=O, C=S, or a carbon atom connected to A;X3is CR9, CR9R10, N, NR9, O, S, C=O, C=S, or a carbon atom connected to A;X4is CR13, N, or NR13, or a carbon atom connected to A;X5is CR13, N, or NR13, or a carbon atom connected to A; wherein one of X1, X2and X3is a carbon atom connected to A; or one of X4and X5is a carbon atom connected to A;A is ethyndiyl or a substituted or unsubstituted aromatic 5 -membered, 6-membered, 7-membered, or 8-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S;R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -SR16, - NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or -SiR16R17R18;R2is alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, or -OC(O)R21; each R5, R6, R7, R8, R9, R10, R13, R16, R17, and R18is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or - OC(O)R21; and each R21and R22is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H.

[0029] In some embodiments, A is a substituted or unsubstituted aromatic 5 -membered, 6-membered, 7- membered, or 8-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S. In some embodiments, A is an aromatic 5 -membered, or 6-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S. In some embodiments, A is an aromatic 5 -membered, or 6-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S, and the aromatic 5- membered, or 6-membered monocyclic ring system is substituted.

[0030] In some embodiments, A is an aromatic nitrogen containing 5 -membered ring system comprising 0, 1 or 2 additional heteroatoms as ring members, wherein each additional heteroatom is independently selected from O, N, and S.

[0031] In some embodiments, A is selected from thiadiazolyl, thiazolyl, pyrazolyl and oxadiazolyl, each of which is independently substituted or unsubstituted. In some embodiments, A is l,3,5-thiadiazol-2,4- diyl, l,3,4-oxadiazol-2,5-diyl andl,2,4-oxadiazol-3,5-diyl. In some embodiments, A is 1,2,4-oxadiazol- 3, 5 -diyl.

[0032] In some embodiments, A is ethyndiyl.

[0033] In some embodiments, R2is substituted or unsubstituted alkyl. In some embodiments, R2is substituted or unsubstituted methyl, ethyl, propyl, iso-propyl, butyl, or tert-butyl. In some embodiments, R2is selected from Ci-6 alkyl, C1.4 cyanoalkyl, -C1-2 -alkyl-Cs-e cycloalkyl, and C1-2 haloalkyl. In some embodiments, R2is trifluoroethyl, 2-propyl and -CH2-cyclopropyl.

[0034] In some embodiments, R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -CH2-NHC(O)R24, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -SR16, -NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or - SiR16R17R18.

[0035] In some embodiments, R1is selected from alkyl, alkoxy, aryl, heteroaryl, and heterocyclyl, each of which is independently substituted or unsubstituted. In some embodiments, R1is substituted alkyl. In some embodiments, R1is alkyl substituted with -NR23C(O)R24. In some embodiments, R1is C1-3 alkyl substituted with -NR23C(O)R24. In some embodiments, R1is -CH2-NHC(O)R24, wherein R24is C3-6 cycloalkyl or 5 membered heteroaryl, each of which is independently substituted or unsubstituted. In some embodiments, R1is -CH2-NHC(O)R24, wherein R24is cyclopropyl or pyrazolyl; each of which is independently substituted or unsubstituted. In some embodiments, R1is -CH2-NHC(O)R24, wherein R24is C3-6 cycloalkyl or 5 membered heteroaryl, each of which is independently substituted or unsubstituted.

[0036] In some embodiments, R1is -CH2-NHC(O)R24, wherein R24is C3-6 cycloalkyl or 5 membered heteroaryl, each of which is independently substituted or unsubstituted with C1-6 alkyl. In some embodiments, R1is -CH2-NHC(O)R24, wherein R24is C3-6 cycloalkyl or 5 membered heteroaryl, each of which is independently substituted or unsubstituted with methyl, ethyl, isopropyl, or tert-butyl. In some embodiments, R1is -CH2-NHC(O)R24, wherein R24is cyclopropyl or pyrazolyl; each of which is independently unsubstituted or substituted with C1-6 alkyl. In some embodiments, R1is -CH2-NHC(O)R24, wherein R24is cyclopropyl or pyrazolyl; each of which is independently unsubstituted or substituted with methyl, ethyl, isopropyl, or tert-butyl.

[0037] In some embodiments, R1is a substituted alkyl or alkylene. In some embodiments, R1can be substituted by one or more substituents selected from a hydroxyl group, sulfhydryl group, halogen, amino group, nitro group, nitroso group, cyano group, azido group, sulfoxide group, sulfone group, sulfonamide group, carboxyl group, carboxaldehyde group, imine group, alkyl group, halo-alkyl group, cyclic alkyl group, alkenyl group, halo-alkenyl group, alkynyl group, halo-alkynyl group, alkoxy group, aryl group,aryloxy group, aralkyl group, arylalkoxy group, heterocyclyl group, acyl group, acyloxy group, carbamate group, amide group, urethane group, and ester group.

[0038] In some embodiments, R1is alkyl substituted with an amino group. In some embodiments, R1is methyl substituted with NR16R17. In some embodiments, R1is alkyl substituted with -C(O)NR16R17. In some embodiments, R1is methyl substituted with -C(O)NR16R17. In some embodiments, R1is alkyl substituted with -C(O)OR16. In some embodiments, R1is methyl substituted with COOH.

[0039] In some embodiments, R1is C1-3 alkyl substituted with NR16R17. In some embodiments, R1is methyl substituted with NR16R17, wherein R16is hydrogen, and R17is a substituted phenyl.

[0040] In some embodiments, R1is selected from -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -NR16R17, -NR16C(O)R16, and -OC(O)R16.

[0041] In some embodiments, R1is alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H or halo.

[0042] In some embodiments, R5is selected from alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21.

[0043] In some embodiments, R5is selected from alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21C(O)R22, or -OC(O)R21.

[0044] In some embodiments, R5is -C(O)NR21R22, wherein R22is H; and R21is independently Ce-io aryl, 5-6 membered nitrogen containing heteroaryl, or 5-6 membered heterocyclyl, each of which is independently substituted or unsubstituted. In some embodiments, R5is -C(O)NHR22, wherein R22is 6 membered nitrogen containing heterocyclyl substituted at least with halo.

[0045] In some embodiments, R5is selected from -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, and -OC(O)R21. In some embodiments, R5is selected from selected from - C(O)R21, -C(O)NR21R22, and C1-3 alkyl substituted with -NR16R17. In some embodiments, R5is selected from C2-4 alkenyl, C2-4 alkynyl, and phenyl, each of which is independently substituted or unsubstituted, or H.

[0046] In some embodiments, R21is 6 membered nitrogen-containing heterocyclyl substituted with fluoro. In some embodiments, R21is 6 membered nitrogen-containing heterocyclyl substituted with chloro. In some embodiments, R21is piperidinyl, piperazinyl, morpholinyl, or pyrrolidinyl, each of which is independently substituted or unsubstituted. In some embodiments, R21is piperidinyl unsubstituted or substituted with a substituent selected from dimethylamino, pyrrolidinyl, methoxy, methyl and fluoro.

[0047] In some embodiments, R21is a ring that is:, wherein the ring is substituted or unsubstituted. In some

[0048] In some embodiments, Rais methyl. In some embodiments, R22is H, and R21is a ring that iswherein the ring is substituted or unsubstituted. In some embodiments, R22is H, and R21is a ring that is, wherein the ring is substituted or unsubstituted.

[0049] In some embodiments, R13is C1-4 alkyl, C2-4 alkenyl, each of which is independently substituted or unsubstituted, or H, or halo. In some embodiments, R13is substituted or unsubstituted methyl, ethyl, propyl, iso-propyl, butyl or tert-butyl. In some embodiments, R13is C1-2 haloalkyl. In some embodiments, R13is 2,2,2-trifluoroethyl. In some embodiments, R13is H.

[0050] In some embodiments, each R16and R17is independently alkyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, alkoxy, carboxyl group, amino group, acyl group, acyloxy group, or an amide group, any of which is unsubstituted or substituted, or hydrogen. In some embodiments, R16is hydrogen, and R17is a substituted carboxyl group. In some embodiments, R16is hydrogen, and R17is 5-6 membered nitrogencontaining heterocyclyl that is substituted or unsubstituted.

[0051] In some embodiments, the pattern of dashed bonds can be chosen to provide an aromatic or partially aromatic ring system, for example, a 2-thia-8-azabicyclo[3.3.0]octa-l(5),3,6-triene, a 2-oxa-8- azabicyclo[3.3.0]octa-l(5),3,6-triene, a 2,8-diazabicyclo[3.3.0]octa-l(5),3,6-triene or a 2- azabicyclo[3.3.0]octa-l(5),3,6-triene. In some embodiments, X1is CR5or a carbon atom connected to A. In some embodiments, X2is CR7or a carbon atom connected to A. In some embodiments, X3is S, O, NR9or CR9R10or a carbon atom connected to A. In some embodiments, X4is CR13, or a carbon atom connected to A. In some embodiments, X5is CR13, or a carbon atom connected to A. In some embodiments, X1is a carbon atom connected to A. In some embodiments, X4is a carbon atom connected to A. In some embodiments, X3is S.

[0052] One embodiment relates to compounds of Formula II, or a pharmaceutically acceptable salt thereof:wherein X3is CR9R10, NR9, O, or S;A is ethyndiyl or a substituted or unsubstituted aromatic 5 -membered, or 6-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S;R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, heterocyclyl, or halo, each of which is independently substituted or unsubstituted, H, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, - SR16, -NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or -SiR16R17R18;R2is alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, or -OC(O)R21; each R5, R9, R10, R16, R17, and R18is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, H, halo, -C(O)R21, - C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; and each R21and R22is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H.

[0053] One embodiment relates to compounds of Formula III, or a pharmaceutically acceptable salt thereof:wherein A is a substituted or unsubstituted aromatic 5 -membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S;R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -SR16, - NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or -SiR16R17R18;R2is alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, or -OC(O)R21; each R5, R16, R17, and R18is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; and each R21and R22is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H.

[0054] In some embodiments, the compound is of the formula:or a pharmaceutically-acceptable salt thereof, wherein the variables are as defined above.

[0055] In some embodiments, the compound is of the formula:or a pharmaceutically-acceptable salt thereof, wherein the variables are as defined above.

[0056] Non-limiting examples of compounds of the disclosure include any of the following compounds, or a pharmaceutically-acceptable salt thereof:

[0057] Compounds herein can include all stereoisomers, enantiomers, diastereomers, mixtures, racemates, atropisomers, and tautomers thereof.

[0058] Non-limiting examples of optional substituents include a hydroxyl group, sulfhydryl group, halogen, amino group, nitro group, nitroso group, cyano group, azido group, sulfoxide group, sulfone group, sulfonamide group, carboxyl group, carboxaldehyde group, imine group, alkyl group, halo-alkyl group, alkenyl group, halo-alkenyl group, alkynyl group, halo-alkynyl group, alkoxy group, aryl group, aryloxy group, aralkyl group, arylalkoxy group, heterocyclyl group, acyl group, acyloxy group, carbamate group, amide group, ureido group, epoxy group, and ester group.

[0059] Non-limiting examples of alkyl and alkylene groups include straight, branched, and cyclic alkyl and alkylene groups. An alkyl or alkylene group can be, for example, a Ci, C2, C3, C4, C5, Ce, C7, Cs, C>, C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, C20, C21, C22, C23, C24, C25, C26, C27, C28, C29, C30, C31, C32,C33, C34, C35, C36, C37, C38, C39, C40, C41, C42, C43, C44, C45, C46, C47, C48, C49, or C50 group that is substituted or unsubstituted. In some embodiments, each alkyl is independently Ci-ioalkyl. In some embodiments, each alkyl is independently Ci-ealkyl. In some embodiments, each alkyl is independently Ci-4alkyl. In some embodiments, each alkyl is independently Cijalkyl.

[0060] Non-limiting examples of straight alkyl groups include methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, and decyl.

[0061] Branched alkyl groups include any straight alkyl group substituted with any number of alkyl groups. Non-limiting examples of branched alkyl groups include isopropyl, isobutyl, sec-butyl, and t- butyl.

[0062] Non-limiting examples of substituted alkyl groups includes hydroxymethyl, chloromethyl, trifluoromethyl, trifluoroethyl, aminomethyl, 1 -chloroethyl, 2-hydroxyethyl, 1,2-difluoroethyl, and 3- carboxypropyl.

[0063] Non-limiting examples of cyclic alkyl (also referred to as “cycloalkyl") groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptlyl, and cyclooctyl groups. Cyclic alkyl groups also include fused-, bridged-, and spiro-bicycles and higher fused-, bridged-, and spiro-systems. A cyclic alkyl group can be substituted with any number of straight, branched, or cyclic alkyl groups. Nonlimiting examples of cyclic alkyl groups include cyclopropyl, 2-methyl-cycloprop-l-yl, cycloprop-2-en-1-yl, cyclobutyl, 2,3-dihydroxycyclobut-l-yl, cyclobut-2-en-l-yl, cyclopentyl, cyclopent-2-en-l-yl, cyclopenta-2,4-dien-l-yl, cyclohexyl, cyclohex-2-en-l-yl, cycloheptyl, cyclooctanyl, 2,5- dimethylcyclopent- 1 -yl, 3, 5 -dichlorocyclohex- 1 -yl, 4-hydroxycyclohex- 1 -yl, 3, 3, 5 -trimethylcyclohex- 1 - yl, octahydropentalenyl, octahydro- IH-indenyl, 3a,4,5,6,7,7a-hexahydro-3H-inden-4-yl, decahydroazulenyl, bicyclo-[2.1.1]hexanyl, bicyclo[2.2.1]heptanyl, bicyclo[3.1.1]heptanyl, 1,3- dimethyl[2.2.1]heptan-2-yl, bicyclo[2.2.2]octanyl, and bicyclo[3.3.3]undecanyl. In some embodiments, each cycloalkyl is independently Cs-iocycloalkyl. In some embodiments, each cycloalkyl is independently Ckscycloalkyl. In some embodiments, each cycloalkyl is independently Cs-ecycloalkyl.

[0064] Non-limiting examples of alkenyl and alkenylene groups include straight, branched, and cyclic alkenyl groups. The olefin or olefins of an alkenyl group can be, for example, E, Z, cis, trans, terminal, or exo-methylene. An alkenyl or alkenylene group can be, for example, a C2, C3, C4, C5, Ce, C7, Cs, C>, C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, C20, C21, C22, C23, C24, C25, C26, C27, C28, C29, C30, C31, C32, C33, C34, C35, C36, C37, C38, C39, C40, C41, C42, C43, C44, C45, C46, C47, C48, C49, or C50 group that is substituted or unsubstituted. Non-limiting examples of alkenyl and alkenylene groups include ethenyl, prop-l-en-l-yl, isopropenyl, but-l-en-4-yl; 2-chloroethenyl, 4-hydroxybuten-l-yl, 7-hydroxy-7-methyloct-4-en-2-yl, and 7-hydroxy-7-methyloct-3,5-dien-2-yl. In some embodiments, each alkenyl is independently C2-ioalkenyl. In some embodiments, each alkenyl is independently C2-6alkenyl.

[0065] Non-limiting examples of alkynyl or alkynylene groups include straight, branched, and cyclic alkynyl groups. The triple bond of an alkynyl or alkynylene group can be internal or terminal. An alkynyl or alkynylene group can be, for example, a C2, C3, C4, C5, Ce, C7, Cs, C9, C10, Cn, C12, C13, C14, C15, Cie, C17, C18, C19, C20, C21, C22, C23, C24, C25, C26, C27, C28, C29, C30, C31, C32, C33, C34, C35, C36, C37, C38, C39, C40, C41, C42, C43, C44, C45, C46, C47, C48, C49, or C50 group that is substituted or unsubstituted. Nonlimiting examples of alkynyl or alkynylene groups include ethynyl, prop-2-yn-l-yl, prop-l-yn-l-yl, and2-methyl-hex-4-yn-l-yl; 5 -hydroxy-5 -methylhex-3-yn-l-yl, 6-hydroxy-6-methylhept-3-yn-2-yl, and 5- hydroxy-5-ethylhept-3-yn-l-yl. In some embodiments, each alkynyl is independently C2-ioalkynyl. In some embodiments, each alkynyl is independently C2-ealkynyl.

[0066] A halo-alkyl group can be any alkyl group substituted with any number of halogen atoms, forexample, fluorine, chlorine, bromine, and iodine atoms. A halo-alkenyl group can be any alkenyl group substituted with any number of halogen atoms. A halo-alkynyl group can be any alkynyl group substituted with any number of halogen atoms. In some embodiments, each haloalkyl is independently Cn lohaloalkyl. In some embodiments, each haloalkyl is independently Ci-ehaloalkyl. In some embodiments, each haloalkyl is independently Ci.2haloalkyl.

[0067] An alkoxy group can be, for example, an oxygen atom substituted with any alkyl, alkenyl, or alkynyl group. An ether or an ether group comprises an alkoxy group. Non-limiting examples of alkoxy groups include methoxy, ethoxy, propoxy, isopropoxy, and isobutoxy. In some embodiments, each alkoxy is independently Ci-ioalkoxy. In some embodiments, each alkoxy is independently Ci-ealkoxy. In some embodiments, each alkoxy is independently Ci.2alkoxy.

[0068] An aryl group can be heterocyclic or non-heterocyclic. An aryl group can be monocyclic or polycyclic. An aryl group can be substituted with any number of substituents described herein, for example, hydrocarbyl groups, alkyl groups, alkoxy groups, and halogen atoms. Non-limiting examples of aryl groups include phenyl, toluyl, naphthyl, pyrrolyl, pyridyl, imidazolyl, thiophenyl, and furyl. Nonlimiting examples of substituted aryl groups include 3,4-dimethylphenyl, 4-tert-buty 1 phenyl, 4- cyclopropylphenyl, 4-diethylaminophenyl, 4-(trifluoromethyl)phenyl, 4-(difluoromethoxy)-phenyl, 4- (trifluoromethoxy)phenyl, 3 -chlorophenyl, 4-chlorophenyl, 3,4-dichlorophenyl, 2-fluorophenyl, 2- chlorophenyl, 2-iodophenyl, 3 -iodophenyl, 4-iodophenyl, 2-methylphenyl, 3 -fluorophenyl, 3- methylphenyl, 3 -methoxyphenyl, 4-fluorophenyl, 4-methylphenyl, 4-methoxyphenyl, 2,3-difluorophenyl,3.4-difluorophenyl, 3, 5 -difluorophenyl, 2,3-dichlorophenyl, 3,4-dichlorophenyl, 3, 5 -dichlorophenyl, 2- hydroxyphenyl, 3 -hydroxyphenyl, 4-hydroxyphenyl, 2-methoxyphenyl, 3 -methoxyphenyl, 4- methoxyphenyl, 2,3 -dimethoxyphenyl, 3,4-dimethoxyphenyl, 3,5-dimethoxyphenyl, 2,4-difluorophenyl,2.5 -difluorophenyl, 2,6-difluorophenyl, 2,3,4-trifluorophenyl, 2,3,5-trifluorophenyl, 2,3,6- trifluorophenyl, 2,4,5-trifluorophenyl, 2,4,6-trifluorophenyl, 2,4-dichlorophenyl, 2,5 -dichlorophenyl, 2,6- dichlorophenyl, 3,4-dichlorophenyl, 2,3,4-trichlorophenyl, 2, 3, 5 -trichlorophenyl, 2,3,6-trichlorophenyl,2.4.5-trichlorophenyl, 3,4,5-trichlorophenyl, 2,4,6-trichlorophenyl, 2,3 -dimethylphenyl, 2,4- dimethylphenyl, 2,5 -dimethylphenyl, 2,6-dimethylphenyl, 2,3,4-trimethylphenyl, 2,3,5-trimethylphenyl,2.3.6-trimethylphenyl, 2,4,5 -trimethylphenyl, 2,4,6-trimethylphenyl, 2-ethylphenyl, 3 -ethylphenyl, 4- ethylphenyl, 2,3 -diethylphenyl, 2,4-diethylphenyl, 2,5-diethylphenyl, 2,6-diethylphenyl, 3,4- diethylphenyl, 2,3,4-triethylphenyl, 2,3,5-triethylphenyl, 2,3,6-triethylphenyl, 2,4,5 -triethylphenyl, 2,4,6- triethylphenyl, 2-isopropylphenyl, 3 -isopropylphenyl, and 4-isopropylphenyl.

[0069] Non-limiting examples of substituted aryl groups include 2-aminophenyl, 2-(N- methylamino)phenyl, 2-(A'.A'-dimcthylamino)phcnyl. 2-(A'-cthylamino)phcnyl. 2-(N,N- diethylamino)phenyl, 3 -aminophenyl, 3-(A'-mcthylamino)phcnyl. 3-(A'A'-dimcthylamino)phcnyl. 3-(N- ethylamino)phenyl, 3-(A'.A'-dicthylamino)phcnyl. 4-aminophenyl, 4-(A'-mcthylamino)phcnyl. 4-(A V- dimethylamino)phenyl, 4-(A'-cthylamino)phcnyl. and 4-(A'A'-dicthylamino)phcnyl.

[0070] In some embodiments, each aryl is independently C4.12aryl.In some embodiments, each aryl is independently C4-ioaryl. In some embodiments, each aryl is independently Ce-ioaryl.

[0071] A heterocycle can be any ring containing a ring atom that is not carbon, for example, N, O, S, P, Si, B, or any other heteroatom. A heterocycle can be substituted with any number of substituents, for example, alkyl groups and halogen atoms. A heterocycle can be aromatic (heteroaryl) or non-aromatic. Non-limiting examples of heterocycles include pyrrole, pyrrolidine, pyridine, piperidine, succinimide, maleimide, morpholine, imidazole, thiophene, furan, tetrahydrofuran, pyran, and tetrahydropyran.

[0072] Non-limiting examples of heterocycles include: heterocyclic units having a single ring containing one or more heteroatoms, non-limiting examples of which include, diazirinyl, aziridinyl, azetidinyl, pyrazolidinyl, imidazolidinyl, oxazolidinyl, isoxazolinyl, thiazolidinyl, isothiazolinyl, oxathiazolidinonyl, oxazolidinonyl, hydantoinyl, tetrahydrofuranyl, pyrrolidinyl, morpholinyl, piperazinyl, piperidinyl, dihydropyranyl, tetrahydropyranyl, piperidin-2-onyl, 2,3,4,5-tetrahydro-lH-azepinyl, 2,3 -dihydro- 1H- indole, and 1,2,3,4-tetrahydroquinoline; and ii) heterocyclic units having 2 or more rings one of which is a heterocyclic ring, non-limiting examples of which include hexahydro- IH-pyrrolizinyl, 3a, 4, 5, 6, 7,7a- hexahydro-lH-benzo[d]imidazolyl, 3a,4,5,6,7,7a-hexahydro-lH-indolyl, 1,2,3,4-tetrahydroquinolinyl, and decahydro- lH-cycloocta[b]pyrrolyl. In some embodiments, each heterocyclyl is independently Ci- gheterocyclyl. In some embodiments, each heterocyclyl is independently a 3-10 membered ring containing 1-5 heteroatoms selected from N, O, S, or P. In some embodiments, each heterocyclyl is independently a 3-10 membered monocyclic, bicyclic, or spirocyclic ring containing 1-5 heteroatoms selected from N, O, S, or P. In some embodiments, each heterocyclyl is independently a 3-8 membered ring containing 1-5 heteroatoms selected from N, O, S, or P. A heterocyclyl group can also be a heterocyclylalkyl group. In some embodiments, each heterocyclyl is a substituted or unsubstituted aromatic 5-membered, 6-membered, 7-membered, or 8-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S.

[0073] A heterocyclylalkyl group (e.g. “heterocyclylalkyl”) can be a stable 3- to 24-membered partially or fully saturated ring radical comprising 2 to 23 carbon atoms and from one to 8 heteroatoms selected from the group consisting of nitrogen, oxygen, phosphorous, and sulfur. Unless stated otherwise specifically in the specification, the heterocyclylalkyl radical can be a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, which may include fused (when fused with an aryl or a heteroaryl ring, the heterocyclylalkyl is bonded through a non-aromatic ring atom), spirocyclic, or bridged ring systems. The nitrogen, phosphorous, carbon, or sulfur atoms in the heterocyclylalkyl radical may be optionally oxidized. For example, a cyclic phosphane group (e.g., 1-methylphospinane) can be substituted with an oxo group to afford the corresponding phosphine oxide (e.g. 1-methylphospinane 1-oxide), or substituted with a =N-RNradical to afford the corresponding phosphinanimine (e.g. 1 -methyl- 1-phosphinan-l- imine), where RNis any suitable monovalent radical. The nitrogen atom in the heterocyclylalkyl radical can be optionally quatemized.

[0074] Representative heterocyclylalkyls include, but are not limited to, heterocyclylalkyls having from two to fifteen carbon atoms (C2-C15 heterocyclylalkyl), from two to ten carbon atoms (C2-C10 heterocyclylalkyl), from two to eight carbon atoms (C2-C8 heterocyclylalkyl), from two to six carbonatoms (C2-C6 heterocyclylalkyl), from two to five carbon atoms (C2-C5 heterocyclylalkyl), or two to four carbon atoms (C2-C4 heterocyclylalkyl). In some embodiments, the heterocyclylalkyl is a 3 - to 6- membered heterocyclylalkyl. In some embodiments, the cycloalkyl is a 5 - to 6-membered heterocyclylalkyl. Examples of such heterocyclylalkyl radicals include, but are not limited to, aziridinyl, azetidinyl, dioxolanyl, thienyl[l,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, 1,1-dioxo-thiomorpholinyl, l,3-dihydroisobenzofuran-l-yl, 3- oxo-l,3-dihydroisobenzofuran-l-yl, methyl-2-oxo-l,3-dioxol-4-yl, and 2-oxo-l,3-dioxol-4-yl. The term heterocyclylalkyl also includes all ring forms of the carbohydrates, including but not limited to, the monosaccharides, the disaccharides, and the oligosaccharides. It is understood that when referring to the number of carbon atoms in a heterocyclylalkyl, the number of carbon atoms in the heterocyclylalkyl is not the same as the total number of atoms (including the heteroatoms) that make up the heterocyclylalkyl (i.e. skeletal atoms of the heterocyclylalkyl ring). Unless stated otherwise specifically in the specification, a heterocyclylalkyl is optionally substituted, for example, with oxo, halogen, amino, nitrile, nitro, hydroxyl, alkyl, alkenyl, alkynyl, haloalkyl, alkoxy, aryl, cycloalkyl, heterocyclylalkyl, heteroaryl, and the like. In some embodiments, a heterocyclylalkyl is optionally substituted with oxo, halogen, methyl, ethyl, -CN, -CF3, -OH, -OMe, -NH2, or -NO2. In some embodiments, a heterocyclylalkyl is optionally substituted with oxo, halogen, methyl, ethyl, -CN, -CF3, -OH, or -OMe. In some embodiments, the heterocyclylalkyl is optionally substituted with halogen. In some embodiments, each heterocyclylalkyl is independently a 3-10 membered ring containing 1-5 heteroatoms selected from N, O, S, or P. In some embodiments, each heterocyclylalkyl is independently a 3-10 membered monocyclic, bicyclic, or spirocyclic ring containing 1-5 heteroatoms selected from N, O, S, or P. In some embodiments, each heterocyclylalkyl is independently a 3-8 membered ring containing 1-5 heteroatoms selected from N, O, S, or P.

[0075] Non-limiting examples of heteroaryl include: i) heteroaryl rings containing a single ring, nonlimiting examples of which include, 1,2,3,4-tetrazolyl, [l,2,3]triazolyl, [l,2,4]triazolyl, triazinyl, thiazolyl, I / / -imidazolyl, oxazolyl, isoxazolyl, isothiazolyl, furanyl, thiophenyl, pyrimidinyl, 2- phenylpyrimidinyl, pyridinyl, 3-methylpyridinyl, and 4-dimethylaminopyridinyl; and ii) heteroaryl rings containing 2 or more fused rings one of which is a heteroaryl ring, non-limiting examples of which include: 727-purinyl, 927-purinyl, 6-amino-9 / / -purinyl. 5 / / -pyrrolo|3.2-t / |pyrimidinyl. 7 / / -pyrrolo|2.3- t / | pyrimidinyl. pyrido|2.3 / | pyrimidinyl. 4,5,6,7-tetrahydro-l- / / -indolyl, quinoxalinyl, quinazolinyl, quinolinyl, 8-hydroxy-quinolinyl, and isoquinolinyl. In some embodiments, each heteroaryl is independently C hctcroaryl. In some embodiments, each heteroaryl is independently Ck hctcroaryl . In some embodiments, each heteroaryl is independently a 4-10 membered aromatic ring containing 1-5 heteroatoms selected from N, O, S, or P. In some embodiments, each heteroaryl is independently a 4-10 membered monocyclic or bicyclic aromatic ring containing 1-5 heteroatoms selected from N, O, S, or P.In some embodiments, each heteroaryl is independently a 4-8 membered aromatic ring containing 1-5 heteroatoms selected from N, O, S, or P.

[0076] As used herein, the term “hydrogen”, the atomic symbol “H”, implicit hydrogen atoms in chemical structures, and hydrogen atoms encompassed by specific and generic chemical radical terms shall be understood to include all atoms with atomic number 1, including ’H (i.e. “protium”),2H (i.e. “deuterium” or “D”), and3H (i.e. “tritium”). For example, the terms “alkoxy” and “methoxy” shall be understood to be inclusive of the radical -OCDs, and the term “Ci-Cealykl” shall be inclusive of the term “Ci-Cedeuteroalkyl”. Likewise, all references to a given atomic element shall be understood to include all natural and unnatural isotopes of that element.

[0077] In certain embodiments, the compounds disclosed herein have some or all of the ’H atoms replaced with2H atoms. The methods of synthesis for deuterium-containing compounds are known in the art and include, by way of non-limiting example only, the following synthetic methods. Such deuterated forms can be made by the procedure described in U.S. Patent Nos. 5,846,514 and 6,334,997. As described in U.S. Patent Nos. 5,846,514 and 6,334,997, deuteration can improve the metabolic stability and or efficacy, thus increasing the duration of action of drugs. Deuterium substituted compounds are synthesized using various methods such as described in: Dean, Dennis C.; Editor. Recent Advances in the Synthesis and Applications of Radiolabeled Compounds for Drug Discovery and Development. [In: Curr., Pharm. Des., 2000; 6(10)] 2000, 110 pp; George W.; Varma, Rajender S. The Synthesis of Radiolabeled Compounds via Organometallic Intermediates, Tetrahedron, 1989, 45(21), 6601-21; and Evans, E. Anthony. Synthesis of radiolabeled compounds, J. Radioanal. Chem., 1981, 64(1-2), 9-32. Deuterated starting materials are readily available and are subjected to the synthetic methods described herein to provide for the synthesis of deuterium-containing compounds. Deuterium-containing reagents and building blocks are available commercially from chemical vendors, such as Aldrich Chemical Co.

[0078] Compositions comprising the compounds disclosed herein, in some embodiments, can be prepared whereby a proportion of atoms at a given position are of a specific isotope, and said proportion differs from the natural abundance of said isotope. In some embodiments, the present disclosure provides a composition comprising a population of molecules, wherein each molecule has a structure according to a compound provided herein, wherein the population of molecules has a mass of at least 1 pg, wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, at least 97%, at least 99%, at least 99%, at least 99.9%, or at least 99.99%, of the molecules in the population of molecules each independently comprise a deuterium atom.

[0079] In some embodiments, the present disclosure provides a composition comprising a population of molecules having a mass of at least 1 pg, wherein each molecule has a structure according to a compound provided herein, wherein if, in a mass spectrometry experiment, a mass spectrum of the population is obtained, the mass spectrometry experiment determines that at least 10% of the molecules in the population of molecules each independently comprise a deuterium atom.

[0080] Any compound herein can be purified. A compound herein can be least 1% pure, at least 2% pure, at least 3% pure, at least 4% pure, at least 5% pure, at least 6% pure, at least 7% pure, at least 8% pure, atleast 9% pure, at least 10% pure, at least 11% pure, at least 12% pure, at least 13% pure, at least 14% pure, at least 15% pure, at least 16% pure, at least 17% pure, at least 18% pure, at least 19% pure, at least 20% pure, at least 21% pure, at least 22% pure, at least 23% pure, at least 24% pure, at least 25% pure, at least 26% pure, at least 27% pure, at least 28% pure, at least 29% pure, at least 30% pure, at least 31% pure, at least 32% pure, at least 33% pure, at least 34% pure, at least 35% pure, at least 36% pure, at least 37% pure, at least 38% pure, at least 39% pure, at least 40% pure, at least 41% pure, at least 42% pure, at least 43% pure, at least 44% pure, at least 45% pure, at least 46% pure, at least 47% pure, at least 48% pure, at least 49% pure, at least 50% pure, at least 51% pure, at least 52% pure, at least 53% pure, at least 54% pure, at least 55% pure, at least 56% pure, at least 57% pure, at least 58% pure, at least 59% pure, at least 60% pure, at least 61% pure, at least 62% pure, at least 63% pure, at least 64% pure, at least 65% pure, at least 66% pure, at least 67% pure, at least 68% pure, at least 69% pure, at least 70% pure, at least 71% pure, at least 72% pure, at least 73% pure, at least 74% pure, at least 75% pure, at least 76% pure, at least 77% pure, at least 78% pure, at least 79% pure, at least 80% pure, at least 81% pure, at least 82% pure, at least 83% pure, at least 84% pure, at least 85% pure, at least 86% pure, at least 87% pure, at least 88% pure, at least 89% pure, at least 90% pure, at least 91% pure, at least 92% pure, at least 93% pure, at least 94% pure, at least 95% pure, at least 96% pure, at least 97% pure, at least 98% pure, at least 99% pure, at least 99.1% pure, at least 99.2% pure, at least 99.3% pure, at least 99.4% pure, at least 99.5% pure, at least 99.6% pure, at least 99.7% pure, at least 99.8% pure, or at least 99.9% pure.

[0081] In some embodiments, compounds of the disclosure can be used to treat cancer in a subject. A compound of the disclosure can, for example, slow the proliferation of cancer cell lines, or kill cancer cells. In some embodiments, the present disclosure provides a method of treating cancer or a p53 meditated disorder, the method comprising administering to a patient in need thereof a therapeutically effective amount of a compound provided herein.

[0082] Non-limiting examples of cancer that can be treated by a compound of the disclosure include: acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytomas, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancers, brain tumors, such as cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumors, visual pathway and hypothalamic glioma, breast cancer, bronchial adenomas, Burkitt lymphoma, carcinoma of unknown primary origin, central nervous system lymphoma, cerebellar astrocytoma, cervical cancer, childhood cancers, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing's sarcoma, germ cell tumors, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gliomas, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular (liver) cancer, Hodgkin lymphoma, Hypopharyngeal cancer, intraocular melanoma, islet cell carcinoma, Kaposi sarcoma, kidney cancer, laryngeal cancer, lip and oral cavity cancer, liposarcoma, liver cancer, lung cancers, such as non-small cell and small cell lung cancer, lymphomas, leukemias, macroglobulinemia,malignant fibrous histiocytoma of bone / osteosarcoma, medulloblastoma, melanomas, mesothelioma, metastatic squamous neck cancer with occult primary, mouth cancer, multiple endocrine neoplasia syndrome, myelodysplastic syndromes, myeloid leukemia, nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma / malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, pancreatic cancer islet cell, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germinoma, pituitary adenoma, pleuropulmonary blastoma, plasma cell neoplasia, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma, renal pelvis and ureter transitional cell cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcomas, skin cancers, skin carcinoma merkel cell, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, stomach cancer, T-cell lymphoma, throat cancer, thymoma, thymic carcinoma, thyroid cancer, trophoblastic tumor (gestational), cancers of unknown primary site, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom macroglobulinemia, and Wilms tumor.

[0083] In some embodiments, the cancer is breast cancer. In some embodiments, the cancer is lung cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer expresses a mutant p53 protein. In some embodiments, the mutant p53 protein has a mutation at amino acid 220. In some embodiments, the mutant p53 protein is p53 Y220C.

[0084] In some embodiments, compounds of the disclosure can be used to treat small cell lung cancer, pancreatic cancer, prostate cancer, colon cancer, breast cancer, endometrial cancer, ovarian cancer, head and neck cancer, and germ cell cancer.

[0085] In some embodiments, the compounds of the disclosure show non-lethal toxicity. In some embodiments, disclosed herein is a method of inducing apoptosis in a cell, the method comprising contacting the cell with a therapeutically-effective amount of a compound of the disclosure.Pharmaceutically-acceptable salts.

[0086] The disclosure provides the use of pharmaceutically-acceptable salts of any therapeutic compound described herein. Pharmaceutically-acceptable salts include, for example, acid-addition salts and baseaddition salts. The acid that is added to the compound to form an acid-addition salt can be an organic acid or an inorganic acid. A base that is added to the compound to form a base-addition salt can be an organic base or an inorganic base. In some embodiments, a pharmaceutically-acceptable salt is a metal salt. In some embodiments, a pharmaceutically-acceptable salt is an ammonium salt.

[0087] Metal salts can arise from the addition of an inorganic base to a compound of the disclosure. The inorganic base consists of a metal cation paired with a basic counterion, such as, for example, hydroxide, carbonate, bicarbonate, or phosphate. The metal can be an alkali metal, alkaline earth metal, transition metal, or main group metal. In some embodiments, the metal is lithium, sodium, potassium, cesium, cerium, magnesium, manganese, iron, calcium, strontium, cobalt, titanium, aluminum, copper, cadmium, or zinc.

[0088] In some embodiments, a metal salt is a lithium salt, a sodium salt, a potassium salt, a cesium salt, a cerium salt, a magnesium salt, a manganese salt, an iron salt, a calcium salt, a strontium salt, a cobalt salt, a titanium salt, an aluminum salt, a copper salt, a cadmium salt, or a zinc salt.

[0089] Ammonium salts can arise from the addition of ammonia or an organic amine to a compound of the present disclosure. In some embodiments, the organic amine is triethyl amine, diisopropyl amine, ethanol amine, diethanol amine, triethanol amine, morpholine, N-methyhnorpholine, piperidine, N- methylpiperidine, N-ethylpiperidine, dibenzylamine, piperazine, pyridine, pyrazole, imidazole, or pyrazine.

[0090] In some embodiments, an ammonium salt is a triethyl amine salt, a trimethyl amine salt, a diisopropyl amine salt, an ethanol amine salt, a diethanol amine salt, a triethanol amine salt, a morpholine salt, an N-methylmorpholine salt, a piperidine salt, an N-methylpiperidine salt, an N-ethylpiperidine salt, a dibenzylamine salt, a piperazine salt, a pyridine salt, a pyrazole salt, a pyridazine salt, a pyrimidine salt, an imidazole salt, or a pyrazine salt.

[0091] Acid addition salts can arise from the addition of an acid to a compound of the present disclosure. In some embodiments, the acid is organic. In some embodiments, the acid is inorganic. In some embodiments, the acid is hydrochloric acid, hydrobromic acid, hydroiodic acid, nitric acid, nitrous acid, sulfuric acid, sulfurous acid, a phosphoric acid, isonicotinic acid, lactic acid, salicylic acid, tartaric acid, ascorbic acid, gentisic acid, gluconic acid, glucuronic acid, saccharic acid, formic acid, benzoic acid, glutamic acid, pantothenic acid, acetic acid, trifluoroacetic acid, mandelic acid, cinnamic acid, aspartic acid, stearic acid, palmitic acid, glycolic acid, propionic acid, butyric acid, fumaric acid, succinic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, citric acid, oxalic acid, or maleic acid.

[0092] In some embodiments, the salt is a hydrochloride salt, a hydrobromide salt, a hydroiodide salt, a nitrate salt, a nitrite salt, a sulfate salt, a sulfite salt, a phosphate salt, isonicotinate salt, a lactate salt, a salicylate salt, a tartrate salt, an ascorbate salt, a gentisate salt, a gluconate salt, a glucuronate salt, a saccharate salt, a formate salt, a benzoate salt, a glutamate salt, a pantothenate salt, an acetate salt, a trifluoroacetate salt, a mandelate salt, a cinnamate salt, an aspartate salt, a stearate salt, a palmitate salt, a glycolate salt, a propionate salt, a butyrate salt, a fumarate salt, a succinate salt, a methanesulfonate salt, an ethanesulfonate salt, a benzenesulfonate salt, a p-toluenesulfonate salt, a citrate salt, an oxalate salt, or a maleate salt.Pharmaceutical Compositions of the disclosure.

[0093] A pharmaceutical composition of the disclosure can be used, for example, before, during, or after treatment of a subject with, for example, another pharmaceutical agent.

[0094] Subjects can be, for example, elderly adults, adults, adolescents, pre-adolescents, children, toddlers, infants, neonates, and non-human animals. In some embodiments, a subject is a patient.

[0095] A pharmaceutical composition of the disclosure can be a combination of any pharmaceutical compounds described herein with other chemical components, such as carriers, stabilizers, diluents, dispersing agents, suspending agents, thickening agents, and / or excipients. The pharmaceuticalcomposition facilitates administration of the compound to an organism. Pharmaceutical compositions can be administered in therapeutically-effective amounts as pharmaceutical compositions by various forms and routes including, for example, intravenous, subcutaneous, intramuscular, oral, parenteral, ophthalmic, subcutaneous, transdermal, nasal, vaginal, and topical administration.

[0096] A pharmaceutical composition can be administered in a local manner, for example, via injection of the compound directly into an organ, optionally in a depot or sustained release formulation or implant. Pharmaceutical compositions can be provided in the form of a rapid release formulation, in the form of an extended release formulation, or in the form of an intermediate release formulation. A rapid release form can provide an immediate release. An extended release formulation can provide a controlled release or a sustained delayed release.

[0097] For oral administration, pharmaceutical compositions can be formulated by combining the active compounds with pharmaceutically-acceptable carriers or excipients. Such carriers can be used to formulate liquids, gels, syrups, elixirs, slurries, or suspensions, for oral ingestion by a subject. Nonlimiting examples of solvents used in an oral dissolvable formulation can include water, ethanol, isopropanol, saline, physiological saline, DMSO, dimethylformamide, potassium phosphate buffer, phosphate buffer saline (PBS), sodium phosphate buffer, 4-2 -hydroxyethyl- 1 -piperazineethanesulfonic acid buffer (HEPES), 3-(N-morpholino)propanesulfonic acid buffer (MOPS), piperazine-N,N'-bis(2- ethane sulfonic acid) buffer (PIPES), and saline sodium citrate buffer (SSC). Non-limiting examples of co-solvents used in an oral dissolvable formulation can include sucrose, urea, cremaphor, DMSO, and potassium phosphate buffer.

[0098] Pharmaceutical preparations can be formulated for intravenous administration. The pharmaceutical compositions can be in a form suitable for parenteral injection as a sterile suspension, solution or emulsion in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Suspensions of the active compounds can be prepared as oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. The suspension can also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. Alternatively, the active ingredient can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

[0099] The active compounds can be administered topically and can be formulated into a variety of topically administrable compositions, such as solutions, suspensions, lotions, gels, pastes, medicated sticks, balms, creams, and ointments. Such pharmaceutical compositions can contain solubilizers, stabilizers, tonicity enhancing agents, buffers and preservatives.

[0100] The compounds of the disclosure can be applied topically to the skin, or a body cavity, for example, oral, vaginal, bladder, cranial, spinal, thoracic, or pelvic cavity of a subject. The compounds of the disclosure can be applied to an accessible body cavity.

[0101] The compounds can also be formulated in rectal compositions such as enemas, rectal gels, rectalfoams, rectal aerosols, suppositories, jelly suppositories, or retention enemas, containing conventional suppository bases such as cocoa butter or other glycerides, as well as synthetic polymers such as polyvinylpyrrolidone, and PEG. In suppository forms of the compositions, a low-melting wax such as a mixture of fatty acid glycerides, optionally in combination with cocoa butter, can be melted.

[0102] In practicing the methods of treatment or use provided herein, therapeutically-effective amounts of the compounds described herein are administered in pharmaceutical compositions to a subject having a disease or condition to be treated. In some embodiments, the subject is a mammal such as a human. A therapeutically-effective amount can vary widely depending on the severity of the disease, the age and relative health of the subject, the potency of the compounds used, and other factors. The compounds can be used singly or in combination with one or more therapeutic agents as components of mixtures.

[0103] Pharmaceutical compositions can be formulated using one or more physiologically-acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active compounds into preparations that can be used pharmaceutically. Formulations can be modified depending upon the route of administration chosen. Pharmaceutical compositions comprising a compound described herein can be manufactured, for example, by mixing, dissolving, emulsifying, encapsulating, entrapping, or compression processes.

[0104] The pharmaceutical compositions can include at least one pharmaceutically-acceptable carrier, diluent, or excipient and compounds described herein as free-base or pharmaceutically-acceptable salt form. Pharmaceutical compositions can contain solubilizers, stabilizers, tonicity enhancing agents, buffers and preservatives.

[0105] Methods for the preparation of compositions comprising the compounds described herein include formulating the compounds with one or more inert, pharmaceutically-acceptable excipients or carriers to form a solid, semi-solid, or liquid composition. Solid compositions include, for example, powders, tablets, dispersible granules, capsules, and cachets. Liquid compositions include, for example, solutions in which a compound is dissolved, emulsions comprising a compound, or a solution containing liposomes, micelles, or nanoparticles comprising a compound as disclosed herein. Semi-solid compositions include, for example, gels, suspensions and creams. The compositions can be in liquid solutions or suspensions, solid forms suitable for solution or suspension in a liquid prior to use, or as emulsions. These compositions can also contain minor amounts of nontoxic, auxiliary substances, such as wetting or emulsifying agents, pH buffering agents, and other pharmaceutically-acceptable additives.

[0106] Non-limiting examples of dosage forms suitable for use in the disclosure include liquid, powder, gel, nanosuspension, nanoparticle, microgel, aqueous or oily suspensions, emulsion, and any combination thereof.

[0107] Non-limiting examples of pharmaceutically-acceptable excipients suitable for use in the disclosure include binding agents, disintegrating agents, anti-adherents, anti-static agents, surfactants, anti-oxidants, coating agents, coloring agents, plasticizers, preservatives, suspending agents, emulsifying agents, anti-microbial agents, spheronization agents, and any combination thereof.

[0108] A composition of the disclosure can be, for example, an immediate release form or a controlled release formulation. An immediate release formulation can be formulated to allow the compounds to act rapidly. Non-limiting examples of immediate release formulations include readily dissolvable formulations. A controlled release formulation can be a pharmaceutical formulation that has been adapted such that release rates and release profiles of the active agent can be matched to physiological and chronotherapeutic requirements or, alternatively, has been formulated to effect release of an active agent at a programmed rate. Non-limiting examples of controlled release formulations include granules, delayed release granules, hydrogels (e.g., of synthetic or natural origin), other gelling agents (e.g., gelforming dietary fibers), matrix-based formulations (e.g., formulations comprising a polymeric material having at least one active ingredient dispersed through), granules within a matrix, polymeric mixtures, and granular masses.

[0109] In some, a controlled release formulation is a delayed release form. A delayed release form can be formulated to delay a compound’s action for an extended period of time. A delayed release form can be formulated to delay the release of an effective dose of one or more compounds, for example, for about 4, about 8, about 12, about 16, or about 24 hours.

[0110] A controlled release formulation can be a sustained release form. A sustained release form can be formulated to sustain, for example, the compound’s action over an extended period of time. A sustained release form can be formulated to provide an effective dose of any compound described herein (e.g., provide a physiologically-effective blood profile) over about 4, about 8, about 12, about 16 or about 24 hours.[oni] Non-limiting examples of pharmaceutically-acceptable excipients can be found, for example, in Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H.A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams and Wilkins 1999), each of which is incorporated by reference in its entirety.

[0112] Multiple therapeutic agents can be administered in any order or simultaneously. In some embodiments, a compound of the disclosure is administered in combination with, before, or after treatment with another therapeutic agent. If simultaneously, the multiple therapeutic agents can be provided in a single, unified form, or in multiple forms, for example, as multiple separate pills. The agents can be packed together or separately, in a single package or in a plurality of packages. One or all of the therapeutic agents can be given in multiple doses. If not simultaneous, the timing between the multiple doses can vary to as much as about a month.

[0113] Therapeutic agents described herein can be administered before, during, or after the occurrence of a disease or condition, and the timing of administering the composition containing a therapeutic agent can vary. For example, the compositions can be used as a prophylactic and can be administered continuously to subjects with a propensity to conditions or diseases in order to lessen a likelihood of the occurrence of the disease or condition. The compositions can be administered to a subject during or as soon as possibleafter the onset of the symptoms. The administration of the therapeutic agents can be initiated within the first 48 hours of the onset of the symptoms, within the first 24 hours of the onset of the symptoms, within the first 6 hours of the onset of the symptoms, or within 3 hours of the onset of the symptoms. The initial administration can be via any route practical, such as by any route described herein using any formulation described herein.

[0114] A compound can be administered as soon as is practical after the onset of a disease or condition is detected or suspected, and for a length of time necessary for the treatment of the disease, such as, for example, from about 1 month to about 3 months. In some embodiments, the length of time a compound can be administered can be about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 1 month, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 2 months, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 3 months, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 4 months, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 5 months, about 21 weeks, about 22 weeks, about 23 weeks, about 24 weeks, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 1 year, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months about 23 months, about 2 years, about 2.5 years, about 3 years, about 3.5 years, about 4 years, about 4.5 years, about 5 years, about 6 years, about 7 years, about 8 years, about 9 years, or about 10 years. The length of treatment can vary for each subject.

[0115] Pharmaceutical compositions described herein can be in unit dosage forms suitable for single administration of precise dosages. In unit dosage form, the formulation is divided into unit doses containing appropriate quantities of one or more compounds. The unit dosage can be in the form of a package containing discrete quantities of the formulation. Non-limiting examples are packaged injectables, vials, or ampoules. Aqueous suspension compositions can be packaged in single-dose non- reclosable containers. Multiple-dose reclosable containers can be used, for example, in combination with or without a preservative. Formulations for injection can be presented in unit dosage form, for example, in ampoules, or in multi -dose containers with a preservative.

[0116] Pharmaceutical compositions provided herein, can be administered in conjunction with other therapies, for example, chemotherapy, radiation, surgery, anti-inflammatory agents, and selected vitamins. The other agents can be administered prior to, after, or concomitantly with the pharmaceutical compositions.

[0117] Depending on the intended mode of administration, the pharmaceutical compositions can be in the form of solid, semi-solid or liquid dosage forms, such as, for example, tablets, suppositories, pills, capsules, powders, liquids, suspensions, lotions, creams, or gels, for example, in unit dosage form suitable for single administration of a precise dosage.

[0118] For solid compositions, nontoxic solid carriers include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, and magnesium carbonate.

[0119] Non-limiting examples of pharmaceutically active agents suitable for combination with compositions of the disclosure include anti-infectives, i.e., aminoglycosides, antiviral agents, antimicrobials, anticholinergics / antispasmodics, antidiabetic agents, antihypertensive agents, antineoplastics, cardiovascular agents, central nervous system agents, coagulation modifiers, hormones, immunologic agents, immunosuppressive agents, and ophthalmic preparations.

[0120] Compounds can be delivered via liposomal technology. The use of liposomes as drug carriers can increase the therapeutic index of the compounds. Liposomes are composed of natural phospholipids and can contain mixed lipid chains with surfactant properties (e.g., egg phosphatidylethanolamine). A liposome design can employ surface ligands for attaching to unhealthy tissue. Non-limiting examples of liposomes include the multilamellar vesicle (MLV), the small unilamellar vesicle (SUV), and the large unilamellar vesicle (LUV). Liposomal physicochemical properties can be modulated to optimize penetration through biological barriers and retention at the site of administration, and to reduce a likelihood of developing premature degradation and toxicity to non-target tissues. Optimal liposomal properties depend on the administration route: large-sized liposomes show good retention upon local injection, small-sized liposomes are better suited to achieve passive targeting. PEGylation reduces the uptake of the liposomes by the liver and spleen, and increases the circulation time, resulting in increased localization at the inflamed site due to the enhanced permeability and retention (EPR) effect.Additionally, liposomal surfaces can be modified to achieve selective delivery of the encapsulated drug to specific target cells. Non-limiting examples of targeting ligands include monoclonal antibodies, vitamins, peptides, and polysaccharides specific for receptors concentrated on the surface of cells associated with the disease.

[0121] Non-limiting examples of dosage forms suitable for use in the disclosure include liquid, elixir, nanosuspension, aqueous or oily suspensions, drops, syrups, and any combination thereof. Non-limiting examples of pharmaceutically-acceptable excipients suitable for use in the disclosure include granulating agents, binding agents, lubricating agents, disintegrating agents, sweetening agents, glidants, antiadherents, anti-static agents, surfactants, anti-oxidants, gums, coating agents, coloring agents, flavoring agents, coating agents, plasticizers, preservatives, suspending agents, emulsifying agents, plant cellulosic material and spheronization agents, and any combination thereof.

[0122] Compositions of the disclosure can be packaged as a kit. In some embodiments, a kit includes written instructions on the administration / use of the composition. The written material can be, for example, a label. The written material can suggest conditions methods of administration. The instructions provide the subject and the supervising physician with the best guidance for achieving the optimal clinical outcome from the administration of the therapy. The written material can be a label. In some embodiments, the label can be approved by a regulatory agency, for example the U.S. Food and Drug Administration (FDA), the European Medicines Agency (EMA), or other regulatory agencies.Combinations

[0123] Combination therapy with a compound of the disclosure and at least one additional therapeutic agent, for example, any additional therapeutic agent described herein, can be used to treat a condition. Insome embodiments, the combination therapy can produce a significantly better therapeutic result than the additive effects achieved by each individual constituent when administered alone at a therapeutic dose. In some embodiments, the dosage of the compound or additional therapeutic agent, for example, any additional therapeutic agent described herein, in combination therapy can be reduced as compared to monotherapy with each agent, while still achieving an overall therapeutic effect. In some embodiments, a compound and an additional therapeutic agent, for example, any additional therapeutic agent described herein, can exhibit a synergistic effect. In some embodiments, the synergistic effect of a compound and additional therapeutic agent, for example, any additional therapeutic agent described herein, can be used to reduce the total amount drugs administered to a subject, which decrease side effects experienced by the subject.

[0124] The compounds of the disclosure can be used in combination with at least one additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein. In some embodiments, the at least one additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, can modulate the same or a different target as the compounds of the disclosure. In some embodiments, the at least one additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, can modulate the same target as the compounds of the disclosure, or other components of the same pathway, or overlapping sets of target enzymes. In some embodiments, the at least one additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, can modulate a different target from the compounds of the disclosure.

[0125] Accordingly, in one aspect, the present disclosure provides a method for treating cancer, the method comprising administering to a subject in need thereof (a) an effective amount of a compound of the disclosure and (b) an effective amount of at least one additional pharmaceutically active agent, for example, any additional therapeutic agent described herein, to provide a combination therapy. In some embodiments, the combination therapy may have an enhanced therapeutic effect compared to the effect of the compound and the at least one additional pharmaceutically active agent each administered alone. According to certain exemplary embodiments, the combination therapy has a synergistic therapeutic effect. According to this embodiment, the combination therapy produces a significantly better therapeutic result (e.g., anti-cancer, cell growth arrest, apoptosis, induction of differentiation, cell death, etc.) than the additive effects achieved by each individual constituent when administered alone at a therapeutic dose.

[0126] Combination therapy includes but is not limited to the combination of compounds of the disclosure with chemotherapeutic agents, therapeutic antibodies, or radiation treatment, to provide a synergistic therapeutic effect. In some embodiments, the compounds of the disclosure are used in combination with one or more anti -cancer (antineoplastic or cytotoxic) chemotherapy drug. Suitable chemotherapeutic agents for use in the combinations of the present disclosure include, but are not limited to, alkylating agents, antibiotic agents, antimetabolic agents, hormonal agents, plant-derived agents, anti- angiogenic agents, differentiation inducing agents, cell growth arrest inducing agents, apoptosis inducing agents, cytotoxic agents, agents affecting cell bioenergetics, biologic agents, e.g., monoclonal antibodies,kinase inhibitors and inhibitors of growth factors and their receptors, gene therapy agents, cell therapy, or any combination thereof. a. Combination treatment with estrogen receptor antagonists

[0127] In some embodiments, a compound of the disclosure is used in combination with an estrogen receptor antagonist. In some embodiments, a compound of the disclosure is used in combination with toremifene (Fareston®), fulvestrant (Faslodex®), or tamoxifen citrate (Soltamox®).

[0128] Fulvestrant is a selective estrogen receptor degrader (SERD) and is indicated for the treatment of hormone receptor positive metastatic breast cancer in postmenopausal women with disease progression following anti -estrogen therapy. Fulvestrant is a complete estrogen receptor antagonist with little to no agonist effects and accelerates the proteasomal degradation of the estrogen receptor. Fulvestrant has poor oral bioavailability and is administered via intramuscular injection. Fulve strant-induced expression of ErbB3 and ErbB4 receptors sensitizes estrogen receptor-positive breast cancer cells to heregulin betal. In some embodiments, a compound of the disclosure is used in combination with fulvestrant. b. Combination treatment with aromatase inhibitors

[0129] In some embodiments, a compound of the disclosure is used in combination with an aromatase inhibitor. Aromatase inhibitors are used in the treatment of breast cancer in post-menopausal women and gynecomastia in men. Aromatase inhibitors can be used off-label to reduce estrogen conversion when using external testosterone. Aromatase inhibitors can also be used for chemoprevention in high-risk women.

[0130] In some embodiments, a compound of the disclosure is used in combination with a non-selective aromatase inhibitor. In some embodiments, a compound of the disclosure is used in combination with a non-selective aromatase inhibitor, such as aminoglutethimide or testolactone (Teslac®). In some embodiments, a compound of the disclosure is used in combination with a selective aromatase inhibitor. In some embodiments, a compound of the disclosure is used in combination with a selective aromatase inhibitor, such as anastrozole (Arimidex®), letrozole (Femara®), exemestane (Aromasin®), vorozole (Rivizor®), formestane (Lentaron®), or fadrozole (Afema®). In some embodiments, a compound of the disclosure is used in combination with exemestane. In some embodiments, a compound of the disclosure is used in combination with an aromatase inhibitor such as 1, 4, 6-androstatrien-3, 17-dione (ATD) or 4- androstene-3 ,6, 17-trione . c. Combination treatment with mTOR inhibitors

[0131] In some embodiments, a compound of the disclosure is used in combination with an mTOR inhibitor. mTOR inhibitors are drugs that inhibit the mechanistic target of rapamycin (mTOR), which is a serine / threonine-specific protein kinase that belongs to the family of phosphatidylinositol-3 kinase (PI3K)-related kinases (PIKKs). mTOR regulates cellular metabolism, growth, and proliferation by forming and signaling through the protein complexes mTORCl and mT0RC2.

[0132] In some embodiments, a compound of the disclosure is used in combination with an mTOR inhibitor, such as rapamycin, temsirolimus (CCI-779), everolimus (RAD001), ridaforolimus (AP-23573). In some embodiments, a compound of the disclosure is used in combination with everolimus (Afmitor®).Everolimus affects the mTORCl protein complex and can lead to hyper-activation of the kinase AKT, which can lead to longer survival in some cell types. Everolimus binds to FKBP12, a protein receptor which directly interacts with mTORCl and inhibits downstream signaling. mRNAs that codify proteins implicated in the cell cycle and in the glycolysis process are impaired or altered as a result, inhibiting tumor growth and proliferation.

[0133] In some embodiments, a compound of the disclosure is used in combination with a mTOR inhibitor and an aromatase inhibitor. For example, a compound of the disclosure is used in combination with everolimus and exemestane. d. Combination treatment with antimetabolites

[0134] Antimetabolites are chemotherapy treatments that are similar to normal substances within the cell. When cells incorporate the antimetabolites into the cellular metabolism, the cells are unable to divide. Antimetabolites are cell-cycle specific and attack cells at specific phases in the cell cycle.

[0135] In some examples, a compound of the disclosure is used in combination with one or more antimetabolites, such as a folic acid antagonist, pyrimidine antagonist, purine antagonist, or an adenosine deaminase inhibitor. In some embodiments, a compound of the disclosure is used in combination with an antimetabolite, such as methotrexate, 5 -fluorouracil, foxuridine, cytarabine, capecitabine, gemcitabine, 6- mercaptopurine, 6-thioguanine, cladribine, fludarabine, nelarabine, or pentostatin. In some embodiments, a compound of the disclosure is used in combination with capecitabine (Xeloda®), gemcitabine (Gemzar®), or cytarabine (Cytosar-U®). e. Combination treatment with plant alkaloids

[0136] In some embodiments, a compound of the disclosure is used in combination with a plant alkaloid. In some embodiments, a compound of the disclosure is used in combination with a plant alkaloid, such as vinca alkaloids, taxanes, podophyllotoxins, or camptothecan analogues. In some embodiments, a compound of the disclosure is used in combination with plant alkaloids, such as vincristine, vinblastine, vinorelbine, paclitaxel, docetaxel, etoposide, tenisopide, irinotecan, or topotecan.

[0137] In some embodiments, a compound of the disclosure is used in combination with a taxane, such as paclitaxel (Abraxane® or Taxol®) and docetaxel (Taxotere®). In some embodiments, a compound of the disclosure is used in combination with paclitaxel. In some embodiments, a compound of the disclosure is used in combination with docetaxel. f. Combination treatment with therapeutic antibodies

[0138] In some embodiments, a compound of the disclosure is used in combination with therapeutic antibodies. In some embodiments, a compound of the disclosure is used in combination with naked monoclonal antibodies, such as alemtuzumab (Campath®) or trastuzumab (Herceptin®). In some embodiments, a compound of the disclosure is used in combination with conjugated monoclonal antibodies, such as radiolabeled antibodies or chemolabeled antibodies. In some embodiments, a compound of the disclosure is used in combination with conjugated monoclonal antibodies, such as ibritumomab tiuxetan (Zevalin®), brentuximab vedotin (Adcetris®), ado-trastuzumab emtansine(Kadcyla®), or denileukin diftitox (Ontak®). In some embodiments, a compound of the disclosure is used in combination with bispecific monoclonal antibodies, such as blinatumomab (Blincyto®).

[0139] In some embodiments, a compound of the disclosure is used in combination with an anti-CD20 antibody, such as rituximab (Mabthera® / Rituxan®), obinutuzumab (Gazyva®), ibritumomab tiuxetan, tositumomab, ofatumumab (Genmab®), ocaratuzumab, ocrelizumab, TRU-015, or veltuzumab. Other antibodies that can be used in combination with a compound of the disclosure include antibodies against the programed cell death (PD-1) receptor, for example pembrolizumab (Keytruda®) or nivolumba (Opdivo®). g. Combination treatment with PD-L1 and / or PD-1 antagonists

[0140] The PD-1 pathway comprises the immune cell co-receptor Programmed Death-1 (PD-1) and the PD-1 ligands PD-L1 and PD-L2. The PD-1 pathway mediates local immunosuppression in the tumor microenvironment. PD-1 and PD-L1 antagonists suppress the immune system. In some embodiments, a PD-1 or PD-L1 antagonist is a monoclonal antibody or antigen binding fragment thereof that specifically binds to, blocks, or downregulates PD-1 or PD-L1, respectively. In some embodiments, a PD-1 or PD-L1 antagonist is a compound or biological molecule that specifically binds to, blocks, or downregulates PD-1 or PD-L1, respectively.

[0141] In some embodiments, the compounds of the disclosure are used in combination with a PD-1 or PD-L1 antagonist. In some embodiments, the compounds of the disclosure are used in combination with a PD-1 / PD-L1 antagonist, for example, MK-3475, nivolumab (Opdivo®), pembrolizumab (Keytruda®), humanized antibodies (i.e., h409Al 1, h409A16 and h409A17), AMP-514, BMS-936559, MEDI0680, MEDI4736, MPDL3280A, MSB0010718C, MDX-I I05, MDX-II06, or pidilzumab. In some embodiments, the compounds of the disclosure are used in combination with a PD-1 / PD-L1 antagonist that is an immunoadhesion molecule, such as AMP-224. In some embodiments, the compounds of the disclosure are used in combination with a PD- 1 / PD-L 1 antagonist to treat cancer cells or a tumor that overexpresses PD-1 or PD-L1. In some embodiments, the compounds of the disclosure are used in combination with a PD-1 / PD-L1 antagonist to treat cancer cells or a tumor that overexpresses miR-34. h. Combination treatment with anti-hormone therapy

[0142] Anti-hormone therapy uses an agent to suppress selected hormones or the effects. Anti-hormone therapy is achieved by antagonizing the function of hormones with a hormone antagonist and / or by preventing the production of hormones. In some embodiments, the suppression of hormones can be beneficial to subjects with certain cancers that grow in response to the presence of specific hormones. In some embodiments, a compound of the disclosure is used in combination with a hormone antagonist.

[0143] In some embodiments, a compound of the disclosure is used in combination with anti-androgens, anti-estrogens, aromatase inhibitors, or luteinizing hormone -releasing hormone (LHRH) agonists. In some embodiments, a compound of the disclosure is used in combination with anti-androgens, such as bicalutamide (Casodex®), cyproterone (Androcur®), flutamide (Euflex®), or nilutamide (Anandron®). In some embodiments, a compound of the disclosure is used in combination with anti-estrogens, such as fiilvestrant (Faslodex®), raloxifene (Evista®), or tamoxifen (Novaladex®, Tamofen®). In someembodiments, a compound of the disclosure is used in combination with LHRH agonists, such as buserelin (Suprefact®), goserelin (Zoladex®), or leuprolide (Lupron®, Lupron Depot®, Eligard®). i. Combination treatment with hypomethylating (demethylating) agents (HMAs)

[0144] Treatment of these and other types of cancer may be improved by examining combinations that increase anti-tumor activities and may allow for similar activity at reduced doses compared to single agent treatment, leading to improved patient outcomes, and limiting adverse events. Hypomethylating (demethylating) agents inhibit DNA methylation, which affects cellular function through successive generations of cells without changing the underlying DNA sequence. Hypomethylating agents can block the activity of DNA methyltransferase. Two examples of HMAs for treatment of acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS) patients are decitabine and azacitidine. In some embodiments, a compound of the disclosure is used in combination with hypomethylating agents, such as azacitidine (Vidaza®, Azadine®) or decitabine (Dacogen®). j. Combination treatment with anti-inflammatory agents

[0145] In some embodiments, a compound of the disclosure is used in combination with nonsteroidal anti-inflammatory drugs (NSAIDs), specific COX-2 inhibitors, or corticosteroids. In some embodiments, a compound of the disclosure is used in combination with NSAIDs, such as aspirin, ibuprofen, naproxen, celecoxib, ketorolac, or diclofenac. In some embodiments, a compound of the disclosure is used in combination with specific COX-2 inhibitors, such as celecoxib (Celebrex®), rofecoxib, or etoricoxib. In some embodiments, a compound of the disclosure is used in combination with corticosteroids, such as dexamethasone or glucosteroids (e.g., hydrocortisone and prednisone). k. Combination treatment with HDAC inhibitors

[0146] Histone deacetylase (HDAC) inhibitors are chemical compounds that inhibit histone deacetylase. HDAC inhibitors can induce p21 expression, a regulator of p53 activity. In some embodiments, a compound of the disclosure is used in combination with an HDAC inhibitor. In some embodiments, a compound of the disclosure is used in combination with an HDAC inhibitor, such as vorinostat, romidepsin (Istodax®), chidamide, panobinostat (Farydak®), belinostat (PDX101), panobinostat (LBH589), valproic acid, mocetinostat (MGCD0103), abexinostat (PCI-24781), entinostat (MS-275), SB939, resminostat (4SC-201), givinostat (ITF2357), quisinostat (JNJ-26481585), HBI-8000, kevetrin, CUDC-101, AR-42, CHR-2845, CHR-3996, 4SC-202, CG200745, ACY-1215, ME-344, sulforaphane, or tricho statin A. l. Combination treatment with platinum-based antineoplastic drugs

[0147] Platinum -based antineoplastic drugs are coordinated complex of platinum. In some embodiments, a compound of the disclosure is used in combination with a platinum-based antineoplastic drug, such as cisplatin, oxaliplatin, carboplatin, nedaplatin, triplatin tetranitrate, phenanthriplatin, picoplatin, or satraplatin. In some embodiments, a compound of the disclosure is used in combination with cisplatin or carboplatin. In some embodiments, a compound of the disclosure is used in combination with cisplatinum, platamin, neoplatin, cismaplat, cis-diamminedichloroplatinum(II), or CDDP; Platinol®) andcarboplatin (also known as cis-diammine(l,l-cyclobutanedicarboxylato)platinum(II); tradenames Paraplatin® and Paraplatin-AQ®). m. Combination treatment with kinase inhibitors

[0148] Abnormal activation of protein phosphorylation is frequently either a driver or a direct consequence of cancer. Kinase signaling pathways are involved in the phenotypes of tumor biology, including proliferation, survival, motility, metabolism, angiogenesis, and evasion of antitumor immune responses.

[0149] MEK inhibitors: MEK inhibitors are drugs that inhibit the mitogen -activated protein kinase enzymes MEK1 and / or MEK2. In some embodiments, a compound of the disclosure is used in combination with a MEK1 inhibitor. In some embodiments, a compound of the disclosure is used in combination with a MEK2 inhibitor. In some embodiments, a compound of the disclosure is used in combination with an agent that can inhibit MEK1 and MEK2. In some embodiments, a compound of the disclosure is used in combination with a MEK1 / MEK2 inhibitor, such as trametinib (Mekinist®), cobimetinib, binimetinib, selumetinib (AZD6244), pimasertibe (AS-703026), PD-325901, CI-1040, PD035901, or TAK-733. In some embodiments, a compound of the disclosure is used in combination with trametinib. In some embodiments, a compound of the disclosure is used in combination with cobimetinib.

[0150] BRAF inhibitors: BRAF inhibitors are drugs that inhibit the serine / threonine-protein kinase B-raf (BRAF) protein. In some embodiments, a compound of the disclosure is used in combination with a BRAF inhibitor. In some embodiments, a compound of the disclosure is used in combination with a BRAF inhibitor that can inhibit wild type BRAF. In some embodiments, a compound of the disclosure is used in combination with a BRAF inhibitor that can inhibit mutated BRAF. In some embodiments, a compound of the disclosure is used in combination with a BRAF inhibitor that can inhibit V600E mutated BRAF. In some embodiments, a compound of the disclosure is used in combination with a BRAF inhibitor, such as vemurafenib (Zelboraf®), dabrafenib (Tafmlar®), C-l, NVP-LGX818, or sorafenib (Nexavar®).

[0151] KRAS inhibitors: KRAS is a gene that acts as an on / off switch in cell signaling. In some embodiments, a compound of the disclosure is used in combination with a KRAS inhibitor. In some embodiments, a compound of the disclosure is used in combination with a wild type KRAS inhibitor. In some embodiments, a compound of the disclosure is used in combination with a mutated KRAS inhibitor.

[0152] BTK inhibitors: Bruton’s tyrosine kinase (BTK) is a non-receptor tyrosine kinase of the Tec kinase family that is involved in B-cell receptor signaling. In some embodiments, a compound of the disclosure is used in combination with a BTK inhibitor. In some embodiments, a compound of the disclosure is used in combination with a BTK inhibitor, such as ibrutinib or acalabrutinib.

[0153] CDK inhibitors: CDK4 and CDK6 are cyclin-dependent kinases that control the transition between the G1 and S phases of the cell cycle. CDK4 / CDK6 activity is deregulated and overactive in cancer cells. Selective CDK4 / CDK6 inhibitors can block cell-cycle progression in the mid-Gl phase of the cell cycle, causing arrest and preventing the proliferation of cancer cells. In some embodiments, acompound of the disclosure is used in combination with a CDK4 / CDK6 inhibitor. In some embodiments, a compound of the disclosure is used in combination with a CDK4 / CDK6 inhibitor, such as palbociclib (Ibrance®), ribociclib, trilaciclib, seliciclib, dinaciclib, milciclib, roniciclib, atuveciclib, briciclib, riviciclib, voruciclib, or abemaciclib. In some embodiments, a compound of the disclosure is used in combination with palbociclib. In some embodiments, a compound of the disclosure is used in combination with ribociclib. In some embodiments, a compound of the disclosure is used in combination with abemaciclib.

[0154] In some examples, a compound of the disclosure is used in combination with an inhibitor of CDK4 and / or CDK6 and with an agent that reinforces the cytostatic activity of CDK4 / 6 inhibitors and / or with an agent that converts reversible cytostasis into irreversible growth arrest or cell death. Examples of cancer subtypes include NSCLC, melanoma, neuroblastoma, glioblastoma, liposarcoma, and mantle cell lymphoma. In some examples, a compound of the disclosure is used in combination with at least one additional pharmaceutically active agent that alleviates CDKN2A (cyclin-dependent kinase inhibitor 2A) deletion. In some examples, a compound of the disclosure is used in combination with at least one additional pharmaceutically active agent that alleviates CDK9 (cyclin-dependent kinase 9) abnormality.

[0155] In some embodiments, a compound of the disclosure is used in combination with a CDK2, CDK7, and / or CDK9 inhibitor. In some embodiments, a compound of the disclosure is used in combination with a CDK2, CDK7, or CDK9 inhibitor, such as seliciclib, voruciclib, or milciclib. In some embodiments, a compound of the disclosure is used in combination with a CDK inhibitor, such as dinaciclib, roniciclib (Kisqali®), or briciclib. In some examples, a compound of the disclosure is used in combination with at least one additional pharmaceutically-active agent that alleviates CDKN2A (cyclin-dependent kinase inhibitor 2 A) deletion.

[0156] ATM regulators: A compound of the disclosure can be used in combination with one or more pharmaceutically-active agent that regulates the ATM (upregulate or downregulate). In some embodiments the compounds described herein can synergize with one or more ATM regulators. In some embodiments one or more of the compounds described herein can synergize with all ATM regulators.

[0157] AKT inhibitors: In some embodiments, a compound of the disclosure is used in combination with one or more pharmaceutically-active agent that inhibits the AKT (protein kinase B (PKB)). In some embodiments the compounds described herein can synergize with one or more AKT inhibitors. In some embodiments, the AKT inhibitor is selected from the AKT inhibitor is selected from the group consisting of A6730, B2311, 124018, GSK2110183 (afuresertib), Perifosine (KRX-040I), GDC-0068 (ipatasertib), RX-020I, VQD-002, LY294002, A-443654, A-674563, Akti-1, Akti-2, Akti-1 / 2, AR-42, API-59CJ- OMe, ATI-13148, AZD-5363, erucylphosphocholine, GSK-2141795 (GSK795), MK2206 (CAS # 1032349-93-1), KP372-1, L-418, NL-71-101, PBI-05204, PIA5, PX-3I6, SR13668, triciribine, GSK 690693 (CAS # 937174-76-0), FPA 124 (CAS # 902779-59-3), Miltefosine, capivasertib, PHT-427 (CAS # 1 191951-57-1), 10-DEBC hydrochloride, Akt inhibitor III, Akt inhibitor VIII, MK-2206 dihydrochloride (CAS # 1032350-13-2), SC79, AT7867 (CAS # 857531 -00-1), CCT128930 (CAS # 885499-61-6), A-674563 (CAS # 552325-73-2), AGL 2263, AS-041 164 (5-benzo[l,3]dioxol-5-ylmethylene-thiazolidine-2, 4-dione), BML-257 (CAS # 32387-96-5), XL-418, CAS # 612847-09-3, CAS # 98510-80-6, H-89 (CAS # 127243-85-0), OXY-1 1 1 A, and 3-[l-[[4-(7-phenyl-3H-imidazo[4,5- g]quinoxalin-6-yl)phenyl]methyl]piperidin-4-yl]-lH-benzimidazol-2-one. Also disclosed herein are methods of treating a condition in a subject in need thereof comprising administering an AKT inhibitor. In some embodiments, the AKT inhibitor is selected from MK2206, ipatasertib, and capivasertib, or a pharmaceutically-acceptable salt thereof. In some embodiments, the AKT inhibitor is an inhibitor of Aktl.

[0158] In some embodiments, the AKT inhibitor is:pharmaceutically-acceptable salt thereof

[0159] In some embodiments, the AKT inhibitor is:p , p y p f.

[0161] PI3K inhibitors: In some embodiments, a compound of the disclosure is used in combination with one or more pharmaceutically-active agent that inhibits a phosphoinositide 3-kinase protein. In some embodiments, the PI3K inhibitor is selected from idelalisib, copanlisib, duvelisib, alpelisib, seletalisib, gedatolisib, inavolisib, rigosertib sodium, leniolisib, umbralisib, buparlisib (AN2025), AMG-319, GM - 604, acalisib, bimiralisib, GDC-0084, ACP-319, tenalisib, serabelisib, SF-1126, nemiralisib, fimepinostat, LY-3023414, voxtalisib, dactolisib, eganelisib, parsaclisib, GSK2636771, AZD-8186, and ASN-003. In some embodiments, the PI3K inhibitor is selected from a PI3Ka, PI3K[3, PI3Ky, or PI3K5 inhibitor. Also disclosed herein are methods of treating a condition in a subject in need thereof comprising administering a PI3K110a inhibitor. In some embodiments, the PI3K inhibitor is selected from alpelisib, inavolisib, serabelisib, GSK2636771, eganelisib, idelalisib, or duvelisib.

[0162] In some embodiments, the PI3K inhibitor is:(inavolisib), or a pharmaceutically-acceptable salt thereof.

[0163] In some embodiments, the PI3K inhibitor is:(serabelisib), or a pharmaceutically-acceptable salt thereof.

[0164] In some embodiments, the PI3K inhibitor is:pharmaceutically-acceptable salt thereof.

[0165] In some embodiments, the PI3K inhibitor is:(eganelisib), or a pharmaceutically-acceptable salt thereof.

[0166] In some embodiments, the PI3K inhibitor is:(idelalisib), or a pharmaceutically-acceptable salt thereof.

[0167] In some embodiments, the PI3K inhibitor is:(duvelisib), or a pharmaceutically-acceptable salt thereof.

[0168] In some embodiments, the PI3K inhibitor is(alpelisib), or a pharmaceutically-acceptable salt thereof. n. MDM2 inhibitors.

[0169] In some embodiments, a compound of the disclosure is used in combination with one or more pharmaceutically-active agent that inhibits mouse double minute 2 homolog (MDM2). In some embodiments, the MDM2 inhibitor is Nutlin-1, Nutlin-2, Nutlin-3, RG7112 (RO5045337), idasanutlin (RG7388), AMG-232 (KRT-232), APG-115, BI-907828, CGM097, siremadlin (HDM201), SAR405838 (MI-77301), MK-8242 (SCH 900242), RAIN-32, or milademetan (DS-3032b), or a pharmaceutically- acceptable salt of any of the foregoing:Nutlin- 1 Nutlin-2APG-115 CGM097BI-907828.

[0170] MDM2 inhibitors of the present disclosure also include stereoisomers of MDM2 inhibiting structures disclosed herein, including diastereomers, epimers, and enantiomers thereof. For example, Nutlin-3 includes Nutlin-3a (i.e., ((-)-Nutlin-3), or 4-[[(4S,5R)-4,5-bis(4-chlorophenyl)-2-(4-methoxy-2- propan-2-yloxyphenyl)-4,5-dihydroimidazol-l-yl]-oxomethyl]-2-piperazinone) and Nutlin-3b (i.e., ((+)- Nutlin-3), or 4-[[(4R,5S)-4,5-bis(4-chlorophenyl)-2-(4-methoxy-2 -propan-2 -yloxyphenyl)-4, 5- dihydroimidazol- 1 -yl] -oxomethyl] -2-piperazinone) . o. Combination treatment with other pharmaceutically-active agents

[0171] In some examples, a compound of the disclosure is used in combination with at least one additional pharmaceutically-active agent that alleviates PTEN (phosphatase and tensin homolog) deletion. In some examples, a compound of the disclosure is used in combination with at least one additional pharmaceutically-active agent that alleviates Wip-1 Alpha over expression. In some examples, a compound of the disclosure is used in combination with at least one additional pharmaceutically-activeagent that is a Nucleoside metabolic inhibitor. Examples of nucleoside metabolic inhibitors include capecitabine, gemcitabine and cytarabine (Arae).

[0172] TABLE 1 lists suitable additional pharmaceutically-active agents for use with the methods described herein.TABLE 1Administration of Combination Treatment

[0173] A compound of the disclosure or a pharmaceutical composition comprising a compound of the disclosure and at least one additional pharmaceutically-active agent or a pharmaceutical composition comprising at least one additional pharmaceutically-active agent can be administered simultaneously (i.e., simultaneous administration) or sequentially (i.e., sequential administration).

[0174] In some embodiments, a compound of the disclosure and the at least one additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, are administered simultaneously, either in the same composition or in separate compositions. When the drugs are administered simultaneously, the compound and the at least one additional pharmaceutically-activeagent, for example, any additional therapeutic agent described herein, may be contained in the same composition (e.g., a composition comprising both the compound and the at least additional pharmaceutically-active agent) or in separate compositions (e.g., the compound is contained in one composition and the at least additional pharmaceutically-active agent is contained in another composition).

[0175] In some embodiments, the compound and the at least one additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, are administered sequentially, z.e., the compound is administered either prior to or after the administration of the additional pharmaceutically-active agent. In some embodiments, the compound is administered before the additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein. In some embodiments, the pharmaceutically-active agent, for example, any additional therapeutic agent described herein, is administered before the compound. The compound and the additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, are contained in separate compositions, which may be contained in the same or different packages.

[0176] In some embodiments, the administration of the compounds and the additional pharmaceutically- active agent, for example, any additional therapeutic agent described herein, are concurrent, z.e., the administration period of the compounds and that of the agent overlap with each other. In some embodiments, the administration of the compounds and the additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, are non-concurrent. For example, in some embodiments, the administration of the compound is terminated before the additional pharmaceutically- active agent, for example, any additional therapeutic agent described herein, is administered. In some embodiments, the administration of the additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, is terminated before the compound is administered. The time period between these two non-concurrent administrations can range from being days apart to being weeks apart.

[0177] The dosing frequency of the compound and the at least one additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, may be adjusted over the course of the treatment, based on the judgment of the administering physician. When administered separately, the compound and the at least one additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, can be administered at different dosing frequency or intervals. For example, the compound can be administered weekly, while the at least one additional pharmaceutically- active agent, for example, any additional therapeutic agent described herein, can be administered more or less frequently. Or, the compound can be administered twice weekly, while the at least one additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, can be administered more or less frequently. In addition, the compound and the at least one additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, can be administered using the same route of administration or using different routes of administration.

[0178] A therapeutically-effective amount of a compound and / or the additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, for use in therapy can vary with the nature of the condition being treated, the length of treatment time desired, the age and the condition of the patient, and can be determined by the attending physician.

[0179] In some embodiments, when a compound of the disclosure is administered in combination with at least one additional pharmaceutically-active agent, for example, any additional therapeutic agent described herein, the dosage of the compound can be given a lower dosage than when the compound is administered alone.Dosing

[0180] Pharmaceutical compositions described herein can be in unit dosage forms suitable for single administration of precise dosages. In unit dosage form, the formulation is divided into unit doses containing appropriate quantities of one or more compounds. The unit dosage can be in the form of a package containing discrete quantities of the formulation. Non-limiting examples are liquids in vials or ampoules. Aqueous suspension compositions can be packaged in single-dose non-reclosable containers. Multiple-dose reclosable containers can be used, for example, in combination with a preservative. Formulations for parenteral injection can be presented in unit dosage form, for example, in ampoules, or in multi-dose containers with a preservative.

[0181] A compound described herein can be present in a composition in a range of from about 1 mg to about 5000 mg; from about 100 mg to about 4000 mg; from about 10 mg to about 3500 mg; from about 5 mg to about 3000 mg, from about 10 mg to about 2500 mg, from about 50 mg to about 2000 mg, from about 100 mg to about 200 mg, from about 1 mg to about 50 mg, from about 50 mg to about 100 mg, from about 100 mg to about 150 mg, from about 150 mg to about 200 mg, from about 200 mg to about 250 mg, from about 250 mg to about 300 mg, from about 300 mg to about 350 mg, from about 350 mg to about 400 mg, from about 400 mg to about 450 mg, from about 450 mg to about 500 mg, from about 500 mg to about 550 mg, from about 550 mg to about 600 mg, from about 600 mg to about 650 mg, from about 650 mg to about 700 mg, from about 700 mg to about 750 mg, from about 750 mg to about 800 mg, from about 800 mg to about 850 mg, from about 850 mg to about 900 mg, from about 900 mg to about 950 mg, or from about 950 mg to about 1000 mg. In some embodiments, the therapeutically- effective amount of the compound is from about 250 mg to about 2500 mg. In some embodiments, the therapeutically-effective amount of the compound is from about 500 mg to about 2000 mg. In some embodiments, the therapeutically-effective amount of the compound is from about 500 mg to about 1000 mg. In some embodiments, the therapeutically-effective amount of the compound is from about 500 mg to about 1500 mg. In some embodiments, the therapeutically-effective amount of the compound is from about 500 mg to about 3000 mg In some embodiments, the therapeutically-effective amount of the compound is from about 1000 mg to about 3000 mg. In some embodiments, the therapeutically-effective amount of the compound is from about 2000 mg to about 3000 mg.

[0182] A compound described herein can be present in a composition in an amount of about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about125 mg, about 150 mg, about 175 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1050 mg, about 1100 mg, about 1150 mg, about 1200 mg, about 1250 mg, about 1300 mg, about 1350 mg, about 1400 mg, about 1450 mg, about 1500 mg, about 1550 mg, about 1600 mg, about 1650 mg, about 1700 mg, about 1750 mg, about 1800 mg, about 1850 mg, about 1900 mg, about 1950 mg, or about 2000 mg. In some embodiments, the therapeutically-effective amount of the compound is about 2250 mg, about 2500 mg, or about 3000 mg. In some embodiments, the therapeutically-effective amount of the compound is about 1,200 mg. In some embodiments, the therapeutically-effective amount of the compound is about 1,500 m. In some embodiments, the therapeutically-effective amount of the compound is about 2,000 mg. In some embodiments, the therapeutically-effective amount of the compound is about 2,500 mg. In some embodiments, the therapeutically-effective amount of the compound is about 3,000 mg. In some embodiments, the therapeutically-effective amount of the compound is about 3,500 mg.

[0183] In some embodiments, a dose can be expressed in terms of an amount of the drug divided by the mass of the subject, for example, milligrams of drug per kilograms of subject body mass. In some embodiments, a compound is administered in an amount ranging from about 5 mg / kg to about 50 mg / kg, 250 mg / kg to about 2000 mg / kg, about 10 mg / kg to about 800 mg / kg, about 50 mg / kg to about 400 mg / kg, about 100 mg / kg to about 300 mg / kg, or about 150 mg / kg to about 200 mg / kg. In some embodiments, the therapeutically-effective amount of the compound is about 50 mg / kg. In some embodiments, the therapeutically-effective amount of the compound is about 40 mg / kg. In some embodiments, the therapeutically-effective amount of the compound is about 30 mg / kg.

[0184] In some embodiments, a dose can be expressed in terms of an amount of the drug divided by the mass of the subject, for example, milligrams of drug per kilograms of subject body mass. In some embodiments, a compound is administered in an amount ranging from about 5 mg / kg to about 50 mg / kg, 250 mg / kg to about 2000 mg / kg, about 10 mg / kg to about 800 mg / kg, about 50 mg / kg to about 400 mg / kg, about 100 mg / kg to about 300 mg / kg, or about 150 mg / kg to about 200 mg / kg.GENERAL SYNTHETIC SCHEMES

[0185] The compounds of this invention can be synthesized according to the following procedure of Scheme I, wherein the substituents are as defined for Formulas I-III, above, except where further noted.

[0186] The following abbreviations are used:RT, rt room temperature, ambient temperatureDCM, CH2CI2 dichloromethaneDIEA, DIPEA, EtNiPr2 diisopropylethylamine, Htinig's baseTEA, Et3N triethylamineH2O waterDMF dimethylformamideDMSO dimethylsulfoxideDMS0- 6 deuterated dimethylsulfoxideAcCN, MeCN, ACN acetonitrileTFA trifluoroacetic acidTFA trifluoroacetic acid anhydrideHC1 hydrochloric acidTHF tetrahydrofuranEtOAc, EA ethyl acetateNa2SC>4 sodium sulfate mg milligram g gram ml, mL milliliter h, hr hour min minutesKC1 potassium chlorideNH4CI ammonium chlorideNH4HCO3 ammonium bicarbonateNH2OH hydroxylamineH2O waterMeOH methanolEtOH ethanolN2nitrogenPd(dppf)Cl2[1,1'-Bis(diphenylphosphino)ferrocene]dichloropalladium(II)Mo(CO)e molybdenum hexacarbonylHATU ( 1 -[Bis(dimethylamino)methylene] - 1H- 1 ,2,3-triazolo[4,5 - b]pyridinium 3-oxide hexafluorophosphateCsCOs cesium carbonateK2CO3potassium carbonateNaOMe sodium methoxidePE petroleum etherLiOH lithium hydroxideSiO2silicaEq., equiv. equivalentsSCHEME I

[0187] The bicyclic compounds of the disclosure can be synthesized according to Scheme I from corresponding 3-bromo-thieno[2,3-b]pyrrole-5-carbonitrile. The bromo compounds are coupled with primary amines, such as with Suzuki coupling using Mo(CO)e and Pd(dppf)C12 to provide the 5-cyano- thieno[2,3-6]pyrrole-3-carboxamides. The 5-cyano-thicno|2.3- / ]pyrrole-3-carboxamides are treated with hydroxylamine to afford the corresponding 5-[(Z)-A-hydroxycarbamimidoyl] compound. Addition of an ester in the presence of CS2CO3 provides the desired compounds.

[0188] The following examples contain detailed descriptions of the methods of preparation of compounds of Formulas la, lb and II -III. These detailed descriptions fall within the scope, and serve to exemplify, the above-described General Synthetic Procedure which form part of the invention. These detailed descriptions are presented for illustrative purposes only and are not intended as a restriction on the scope of the invention. All parts are by weight and temperatures are in Degrees centigrade unless otherwise indicated.NUMBERED EMBODIMENTS

[0189] Embodiment 1. A compound of formula Ila, or a pharmaceutically-acceptable salt thereof:wherein:X3is CR9R10, NR9, O, or S;A is a substituted or unsubstituted aromatic 5-membered, 6-membered, 7-membered, or 8-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S;R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -SR16, - NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or -SiR16R17R18;R2is alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, or -OC(O)R21;R5is selected from alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; each R9, R10, R16, R17, and R18is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, - C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; and each R21and R22is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H.

[0190] Embodiment 2. The compound of embodiment 1, wherein A is an aromatic 5 -membered, or 6- membered monocyclic ring system comprising 1 , 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S.

[0191] Embodiment 3. The compound of embodiment 1, wherein A is an aromatic nitrogen containing 5- membered ring system comprising 0, 1 or 2 additional heteroatoms as ring members, wherein each additional heteroatom is independently selected from O, N, and S.

[0192] Embodiment 4. The compound of embodiment 1, wherein A is l,3,5-thiadiazol-2,4-diyl, 1,3,4- oxadiazol-2,5-diyl, or l,2,4-oxadiazol-3,5-diyl.

[0193] Embodiment 5. The compound of any one of embodiments 1-4, wherein R2is substituted or unsubstituted alkyl.

[0194] Embodiment 6. The compound of any one of embodiments 1-5, wherein R2is selected from Ci-6 alkyl, Ci-4 cyanoalkyl, -C1-2 -alkyl-Cs-e cycloalkyl, and C1-2 haloalkyl.

[0195] Embodiment 7. The compound of any one of embodiments 1-5, wherein R2is selected from trifluoroethyl, 2-propyl and -CEE-cyclopropyl.

[0196] Embodiment 8. The compound of any one of embodiments 1-7, wherein R1is alkyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted.

[0197] Embodiment 9. The compound of any one of embodiments 1-7, wherein R1is substituted alkyl.

[0198] Embodiment 10. The compound of any one of embodiments 1-7, wherein R1is C1-3 alkyl substituted with -NR23C(O)R24.

[0199] Embodiment 11. The compound of any one of embodiments 1-10, wherein R1is -CH2- NHC(O)R24, wherein R24is C3-6 cycloalkyl or 5 membered heteroaryl, each of which is independently substituted or unsubstituted.

[0200] Embodiment 12. The compound of any one of embodiments 1-11, wherein R24is cyclopropyl or pyrazolyl; each of which is independently substituted or unsubstituted.

[0201] Embodiment 13. The compound of any one of embodiments 1-9, wherein R1is methyl substituted with -NR16R17, wherein R16is hydrogen, and R17is a substituted phenyl.

[0202] Embodiment 14. The compound of any one of embodiments 1-9, wherein R5is selected from - C(O)R21, -C(O)NR21R22, and C1-3 alkyl substituted with -NR16R17.

[0203] Embodiment 15. The compound of any one of embodiments 1-14, wherein R22is H; and R21is independently Ce-io aryl, 5-6 membered nitrogen containing heteroaryl, or 5-6 membered heterocyclyl, each of which is independently substituted or unsubstituted.

[0204] Embodiment 16. The compound of any one of embodiments 1-9, 13, and 14, wherein R16is hydrogen, and R17is 5-6 membered nitrogen-containing heterocyclyl that is independently substituted or unsubstituted.

[0205] Embodiment 17. The compound of any one of embodiments 1-16, wherein R21is 6 membered nitrogen-containing heterocyclyl that is independently substituted or unsubstituted .

[0206] Embodiment 18. The compound of any one of embodiments 1-17, wherein R21is 6 membered nitrogen containing heterocyclyl substituted at least with a substituent selected from di(Ci-2 alkyl)amino, 5-membered nitrogen-containing heterocyclyl, C1-2 alkoxy, C1-2 alkyl and halo.

[0207] Embodiment 19. The compound of any one of embodiments 1-17, wherein R21is piperidinyl unsubstituted or substituted with a substituent selected from dimethylamino, pyrrolidinyl, methoxy, methyl and fluoro.

[0208] Embodiment 20. The compound of any one of embodiments 1-17, wherein R21iswherein Rais C1-4 alkyl.

[0209] Embodiment 21. The compound of any one of embodiments 1-20 wherein R5is -C(O)R21and R21is 6 membered nitrogen-containing heterocyclyl that is independently substituted or unsubstituted.

[0210] Embodiment 22. The compound of embodiment 1, having the formula Illawherein A is a substituted or unsubstituted aromatic 5-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S;R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -SR16, - NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or -SiR16R17R18;R2is alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, or -OC(O)R21;R5is selected from alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which isindependently substituted or unsubstituted, or halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; each R16, R17, and R18is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; and each R21and R22is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H.

[0211] Embodiment 23. The compound of embodiment 22, wherein A is thiadiazolyl, thiazolyl, pyrazolyl, or oxadiazolyl, each of which is independently substituted or unsubstituted.

[0212] Embodiment 24. The compound of embodiment 22, wherein A is l,3,5-thiadiazol-2,4-diyl, 1,3,4- oxadiazol-2,5-diyl or l,2,4-oxadiazol-3,5-diyl.

[0213] Embodiment 25. The compound of any one of embodiments 22-24, wherein R2is selected from Ci-2 haloalkyl, Ci-6 alkyl, Ci-4 cyanoalkyl, and -C1-2 -alkyl-Cs-e cycloalkyl.

[0214] Embodiment 26. The compound of any one of embodiments 22-24, wherein R2is selected from trifluoroethyl, 2-propyl and -CEE-cyclopropyl.

[0215] Embodiment 27. The compound of any one of embodiments 22-26, wherein R1is C1-3 alkyl substituted with NR23C(O)R24.

[0216] Embodiment 28. The compound of any one of embodiments 22-27, wherein R1is -CH2- NHC(O)R24, wherein R24is C3-6 cycloalkyl or 5 membered heteroaryl, each of which is independently substituted or unsubstituted.

[0217] Embodiment 29. The compound of any one of embodiments 22-27, wherein R5is selected from - C(O)R21, -C(O)NR21R22, and C1-3 alkyl substituted with -NR16R17.

[0218] Embodiment 30. The compound of any one of embodiments 22-29, wherein R22is H; and R21is 5- 6 membered heterocyclyl, each of which is independently substituted or unsubstituted.

[0219] Embodiment 31. The compound of any one of embodiments 22-27 and 29, wherein R16is hydrogen, and R17is 5-6 membered nitrogen-containing heterocyclyl, each of which is independently substituted or unsubstituted.

[0220] Embodiment 32. The compound of any one of embodiments 22-31, wherein R5is -C(O)R21, andR21is 6 membered nitrogen-containing heterocyclyl, each of which is independently substituted or unsubstituted.

[0221] Embodiment 33. The compound of any one of embodiments 22-32, wherein R21is 6 membered nitrogen-containing heterocyclyl substituted at least with a substituent selected from di(Ci-2 alkyl)amino, 5-membered nitrogen-containing heterocyclyl, C1-2 alkoxy , C1-2 alkyl and halo.

[0222] Embodiment 34. The compound of any one of embodiments 22-33, wherein R21is piperidinyl unsubstituted or substituted with a substituent selected from dimethylamino, pyrrolidinyl, methoxy, methyl and fluoro.

[0223] Embodiment 35. The compound of any one of embodiments 22-32, wherein R21iswherein Rais C1-4 alkyl.

[0224] Embodiment 36. The compound of embodiment 1 or embodiment 22, having the structure:

[0225] Embodiment 37. A compound of formula lib, or a pharmaceutically-acceptable salt thereof:wherein:X3is CR9R10, NR9, O, or S;A is ethyndiyl or a substituted or unsubstituted aromatic 5 -membered, 6-membered, 7-membered, or 8-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S;R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -SR16, - NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or -SiR16R17R18;R2is alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, or -OC(O)R21;R5is selected from alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21C(O)R22, or -OC(O)R21; each R9, R10, R16, R17, and R18is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, - C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; and each R21and R22is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H.

[0226] Embodiment 38. The compound of embodiment 37, wherein A is an aromatic 5-membered, or 6- membered monocyclic ring system comprising 1 , 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S.

[0227] Embodiment 39. The compound of embodiment 37, wherein A is an aromatic nitrogen containing 5 -membered ring system comprising 0, 1 or 2 additional heteroatoms as ring members, wherein each additional heteroatom is independently selected from O, N, and S.

[0228] Embodiment 40. The compound of embodiment 37, wherein A is l,3,5-thiadiazol-2,4-diyl, 1,3,4- oxadiazol-2,5-diyl, or l,2,4-oxadiazol-3,5-diyl.

[0229] Embodiment 41. The compound of embodiment 37, wherein A is ethyndiyl.

[0230] Embodiment 42. The compound of any one of embodiments 37-41, wherein R2is substituted or unsubstituted alkyl.

[0231] Embodiment 43. The compound of any one of embodiments 37-42, wherein R2is selected from Ci-6 alkyl, Ci-4 cyanoalkyl, -C1-2 -alkyl-Cs-e cycloalkyl, and C1-2 haloalkyl.

[0232] Embodiment 44. The compound of any one of embodiments 37-43, wherein R2is selected from trifluoroethyl, 2-propyl and -CtT-cyclopropyl.

[0233] Embodiment 45. The compound of any one of embodiments 37-44, wherein R1is alkyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted.

[0234] Embodiment 46. The compound of any one of embodiments 37-45, wherein R1is substituted alkyl.

[0235] Embodiment 47. The compound of any one of embodiments 37-46, wherein R1is C1-3 alkyl substituted with -NR23C(O)R24.

[0236] Embodiment 48. The compound of any one of embodiments 37-46, wherein R1is -CH2- NHC(O)R24, wherein R24is C3-6 cycloalkyl or 5 membered heteroaryl, each of which is independently substituted or unsubstituted.

[0237] Embodiment 49. The compound of any one of embodiments 37-48, wherein R24is cyclopropyl or pyrazolyl; each of which is independently substituted or unsubstituted.

[0238] Embodiment 50. The compound of any one of embodiments 37-46, wherein R1is methyl substituted with -NR16R17, wherein R16is hydrogen, and R17is a substituted phenyl.

[0239] Embodiment 51. The compound of any one of embodiments 37-50, wherein R5is selected from - C(O)R21, -C(O)NR21R22, and C1-3 alkyl substituted with -NR16R17.

[0240] Embodiment 52. The compound of any one of embodiments 37-51, wherein R22is H; and R21is independently Ce-io aryl, 5-6 membered nitrogen containing heteroaryl, or 5-6 membered heterocyclyl, each of which is independently substituted or unsubstituted.

[0241] Embodiment 53. The compound of any one of embodiments 37-46, 50, and 51, wherein R16is hydrogen, and R17is 5-6 membered nitrogen-containing heterocyclyl that is independently substituted or unsubstituted.

[0242] Embodiment 54. The compound of any one of embodiments 37-53, wherein R21is 6 membered nitrogen-containing heterocyclyl that is independently substituted or unsubstituted .

[0243] Embodiment 55. The compound of any one of embodiments 37-53, wherein R21is 6 membered nitrogen containing heterocyclyl substituted at least with a substituent selected from di(Ci-2 alkyl)amino, 5-membered nitrogen-containing heterocyclyl, C1-2 alkoxy, C1-2 alkyl and halo.

[0244] Embodiment 56. The compound of any one of embodiments 37-53, wherein R21is piperidinyl unsubstituted or substituted with a substituent selected from dimethylamino, pyrrolidinyl, methoxy, methyl and fluoro.

[0245] Embodiment 57. The compound of any one of embodiments 37-53, wherein R21iswherein Rais C1-4 alkyl.

[0246] Embodiment 58. The compound of any one of embodiments 37-57, wherein R13is C1-4 alkyl, C2-4 alkenyl, each of which is independently substituted or unsubstituted; H, or halo.

[0247] Embodiment 59. The compound of any one of embodiments 37-57, wherein R13is H or C1-2 haloalkyl.

[0248] Embodiment 60. The compound of embodiment 37, wherein A is an aromatic 5-membered monocyclic ring system.

[0249] Embodiment 61. The compound of embodiment 37, wherein A is ethyndiyl, and R1is C1-3 alkyl substituted with -NR16R17.

[0250] Embodiment 62. The compound of embodiment 61, wherein R16is hydrogen, and R17is a substituted phenyl.

[0251] Embodiment 63. The compound of embodiment 37 wherein R5is -C(O)R21and R21is 6 membered nitrogen-containing heterocyclyl that is independently substituted or unsubstituted.

[0252] Embodiment 64. The compound of embodiment 37, having the formula Illbwherein A is ethyndiyl or a substituted or unsubstituted aromatic 5 -membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S;R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independentlysubstituted or unsubstituted, or H, halo, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -SR16, - NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or -SiR16R17R18;R2is alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, or -OC(O)R21;R5is selected from alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21C(O)R22, or -OC(O)R21; each R16, R17, and R18is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; and each R21and R22is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H.

[0253] Embodiment 65. The compound of embodiment 64, wherein A is thiadiazolyl, thiazolyl, pyrazolyl, or oxadiazolyl, each of which is independently substituted or unsubstituted.

[0254] Embodiment 66. The compound of embodiment 64, wherein A is l,3,5-thiadiazol-2,4-diyl, 1,3,4- oxadiazol-2,5-diyl or l,2,4-oxadiazol-3,5-diyl.

[0255] Embodiment 67. The compound of any one of embodiments 64-66, wherein R2is selected from Ci-2 haloalkyl, Ci-6 alkyl, Ci-4 cyanoalkyl, and -C1-2 -alkyl-Cs-e cycloalkyl.

[0256] Embodiment 68. The compound of any one of embodiments 64-66, wherein R2is selected from trifluoroethyl, 2-propyl and -CtT-cyclopropyl.

[0257] Embodiment 69. The compound of any one of embodiments 64-68, wherein R1is C1-3 alkyl substituted with NR23C(O)R24.

[0258] Embodiment 70. The compound of embodiment 37, wherein A is ethynyl, and R1is C1-3 alkyl substituted with -NR16R17,

[0259] Embodiment 71. The compound of any one of embodiments 64-68, wherein R16is hydrogen, and R17is a substituted phenyl.

[0260] Embodiment 72. The compound of any one of embodiments 64-68, wherein R1is -CH2- NHC(O)R24, wherein R24is C3-6 cycloalkyl or 5 membered heteroaryl, each of which is independently substituted or unsubstituted.

[0261] Embodiment 73. The compound of any one of embodiments 64-68, wherein R5is selected from - C(O)R21, -C(O)NR21R22, and C1.3 alkyl substituted with -NR16R17.

[0262] Embodiment 74. The compound of embodiment 73, wherein R22is H; and R21is 5-6 membered heterocyclyl, each of which is independently substituted or unsubstituted.

[0263] Embodiment 75. The compound of embodiment 73, wherein R16is hydrogen, and R17is 5-6 membered nitrogen-containing heterocyclyl, each of which is independently substituted or unsubstituted.

[0264] Embodiment 76. The compound of embodiment 73, wherein R5is -C(O)R21, and R21is 6 membered nitrogen-containing heterocyclyl, each of which is independently substituted or unsubstituted.

[0265] Embodiment 77. The compound of embodiment 74, wherein R21is 6 membered nitrogencontaining heterocyclyl substituted at least with a substituent selected from di(Ci-2 alkyl)amino, 5- membered nitrogen-containing heterocyclyl, C1-2 alkoxy , C1-2 alkyl and halo.

[0266] Embodiment 78. The compound of embodiment 77, wherein R21is piperidinyl unsubstituted or substituted with a substituent selected from dimethylamino, pyrrolidinyl, methoxy, methyl and fluoro.

[0267] Embodiment 79. The compound of embodiment 78, wherein R21is, wherein RaisCi -4 alkyl.

[0268] Embodiment 80. The compound of embodiment 37 or embodiment 64, having the structure:

[0269] Embodiment 81. A pharmaceutical composition comprising a compound of any of embodiments 1-80, or a pharmaceutically-acceptable salt thereof.

[0270] Embodiment 82. A method of treating cancer or a p53 meditated disorder, the method comprising administering to a patient in need thereof a therapeutically effective amount of a compound of any one of embodiments 1 to 80 or a pharmaceutical composition of embodiment 81.

[0271] Embodiment 83. The method of embodiment 82, wherein the cancer is breast cancer.

[0272] Embodiment 84. The method of embodiment 82, wherein the cancer is lung cancer.

[0273] Embodiment 85. The method of embodiment 82, wherein the cancer is ovarian cancer.

[0274] Embodiment 86. The method of embodiment 82, wherein the cancer expresses a mutant p53protein.

[0275] Embodiment 87. The method of embodiment 86, wherein the mutant p53 protein has a mutation at amino acid 220.

[0276] Embodiment 88. The method of embodiment 86, wherein the mutant p53 protein is p53 Y220C.EXAMPLESEXAMPLE 1: N-[(3-{4-Bromo-8-(2,2,2-trifluoroethyl)-2-thia-8-azabicyclo[3.3.0]octa-l(5),3,6-trien- 7-yl}-l,2,4-oxadiazol-5-yl)methyl]-l-(tert-butyl)-4-pyrazolecarboxamideStep 1 -Methyl (Z)-2-azido-3-(4-bromo-3-thienyl)prop-2-enoate

[0277] To a mixture of 4-bromothiophene-3-carbaldehyde (9.00 g, 47.11 mmol, 1.00 eq) in MeOH (90 mL) was added NaOMe (25.45 g, 141.33 mmol, 30% purity, 3.00 eq) at -15 °C, then methyl 2- azidoacetate (16.27 g, 141.33 mmol, 3.00 eq) was added at -15 °C and the mixture was stirred at 25 °C for 16 hrs. The mixture was poured into ice-water (100 mL). The aqueous phase was extracted with EA (3*60 mL). The combined organic phase was washed with brine (3*60 mL), dried with anhydrous Na2SC>4, fdtered and concentrated in vacuum. The residue was purified by column chromatography (SiC PE / EA=l / 0 to 10 / 1) to afford methyl (Z)-2-azido-3-(4-bromo-3-thienyl)prop-2-enoate (8.20 g, 22.77 mmol, 48.33% yield, 80% purity) as a yellow solid. 1H NMR (400 MHz, DMSO-t / 6) 5 = 8.48 (d, J = 2.5 Hz, 1H), 7.80 (S, J = 2.1 Hz, 1H), 6.84 (s, 1H), 3.86 (s, 4H).Step 2 - Methyl 3-hromo-6H-thieno [2, 3-b]pyrrole-5-carboxylate

[0278] Methyl (Z)-2-azido-3-(4-bromo-3-thienyl)prop-2 -enoate (6.80 g, 23.60 mmol, 1.00 eq) dissolved in toluene (204 mL). The mixture was stirred at 110 °C for 2 hr. The mixture was poured into water (200 mL). The aqueous phase was extracted with EA (3*80 mL). The combined organic phase was washed with brine (3*80 mL), dried with anhydrous Na2SC>4, filtered and concentrated in vacuum. The residue was purified by column chromatography (SiC PE / EA =1 / 0 to 1 / 1) to afford methyl 3-bromo-6H- thieno[2,3-b]pyrrole-5-carboxylate (6.00 g, 21.71 mmol, 91.99% yield, 94.12% purity) as a brown solid. LC-MS (ES+, m / z): 257.9, 259.9 [(M-H)+], 'H NMR (400 MHz, DMSO- 6) 5 = 12.53 (br s, 1H), 7.27 (s, 1H), 6.89 (s, 1H), 3.82 (s, 3H).Step 3 -Methyl 3-bromo-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-5-carboxylate

[0279] To a solution of methyl 3-bromo-6H-thieno[2,3-b]pyrrole-5-carboxylate (2.00 g, 7.69 mmol, 1.00 eq) in DMF (20 mL) was added K2CO3 (2.13 g, 15.38 mmol, 2.00 eq) and 2,2,2-trifluoroethyltrifluoromethanesulfonate (2.68 g, 11.53 mmol, 1.50 eq). The mixture was stirred at 25 °C for 1.5 hr. The mixture was poured into water (100 mL). The aqueous phase was extracted with EA (3*50 mL). The combined organic phase was washed with brine (3*50 mL), dried with anhydrous Na2SC>4, fdtered and concentrated in vacuum. The residue was purified by column chromatography (SiCE, PE / EA =1 / 0 to 10 / 1) to afford methyl 3-bromo-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-5-carboxylate (2.00 g, 5.54 mmol, 72.01% yield, 94.718% purity) as yellow solid. 'HNMR (400 MHz, DMSO-t / 6) 5 = 7.42 (s, 1H), 7.13 (s, 1H), 5.51 (q, J = 9.1 Hz, 2H), 3.83 (s, 3H).Step 4 - 3-Bromo-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-5-carboxylic acid

[0280] To a solution of methyl 3-bromo-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-5-carboxylate (1.90 g, 5.55 mmol, 1.00 eq) in THF (16 mL) and H2O (4 mL) was added LiOH.H2O (1.17 g, 27.77 mmol, 5.00 eq). The mixture was stirred at 50 °C for 8 h. The mixture was poured into water (100 mL) and acidified (about pH = 6-7) with saturated citric acid. The aqueous phase was extracted with EA (3*50 mL). The combined organic phase was washed with brine (3*50 mL), dried with anhydrous Na2SC>4, filtered and concentrated in vacuum to afford 3-bromo-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-5-carboxylic acid (1.80 g, crude) as a yellow solid. LC-MS (ES+, m / z): 325.9, 327.8[(M-H)+] .Step 5 - 3-Bromo-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-5-carboxamide

[0281] To a solution of 3-bromo-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-5-carboxylic acid (1.00 g, 3.05 mmol, 1.00 eq) in DMF (20 mL) was added HATU (1.74 g, 4.57 mmol, 1.50 eq) and DIEA (1.97 g, 15.24 mmol, 2.65 mL, 5.00 eq). NH4CI (179.33 mg, 3.35 mmol, 1.10 eq) was added to the mixture. The mixture was stirred at 25 °C for 1 hr. The mixture was poured into water (100 mL). The aqueous phase was extracted with EA (3*50 mL). The combined organic phase was washed with brine (3*50 mL), dried with anhydrous Na2SC>4, filtered and concentrated in vacuum. The residue was purified by column chromatography (SiC>2, PE / EA =1 / 0 to 4 / 1) to afford 3-bromo-6-(2,2,2-trifluoroethyl)thieno[2,3- b]pyrrole-5-carboxamide (0.73 g, 1.78 mmol, 58.5% yield, 80.36% purity) as yellow solid. LC-MS (ES+, m / z): 326.9, 328.9[(M+H)+], 1H NMR (400 MHz, DMSO-d6) 5 = 7.93 (br s, 1H), 7.39 - 7.28 (m, 2H), 7.20 (s, 1H), 5.62 (q, J = 9.3 Hz, 2H)Step 6 - 3-Bromo-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-5-carbonitrile

[0282] To a solution of 3-bromo-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-5-carboxamide (0.90 g, 2.75 mmol, 1.00 eq) in THF (20 mL) was added TEA (696.00 mg, 6.88 mmol, 957.36 pL, 2.50 eq) and TFAA (1.44 g, 6.88 mmol, 956.08 pL, 2.50 eq) at 0 °C. The mixture was stirred at 25 °C for 2 hr. The mixture was poured into water (60 mL). The aqueous phase was extracted with EA (3*25 mL). The combined organic phase was washed with brine (3*25 mL), dried with anhydrous Na2SC>4, filtered and concentrated in vacuum. The residue was purified by column chromatography (SiC>2, PE / EA =1 / 0 to 4 / 1) to afford 3- bromo-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-5-carbonitrile (600.00 mg, 1.75 mmol, 63.50% yield, 90% purity) as yellow solid. 1H NMR (400 MHz, DMSO-d6) 5 = 7.50 (s, 1H), 7.41 (s, 1H), 5.35 (q, J = 9.1 Hz, 2H).Step 7 - 3-Bromo-N'-hydroxy-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-5-carboxamidine

[0283] To a mixture of 3-bromo-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-5-carbonitrile (500.00 mg,1.62 mmol, 1.00 eq) in EtOH (10 mL) was added hydroxylamine (320.57 mg, 4.85 mmol, 50% purity, 3.00 eq) under N2 and the mixture was stirred at 60 °C for 0.5 h. The mixture was poured into H2O (60 mL). The aqueous phase was extracted with EA (3*30 mL). The combined organic phase was washed with brine (3*30 mL), dried with anhydrous Na2SC>4, fdtered and concentrated in vacuum. The residue was purified by silica gel chromatography (column height: 250 mm, diameter: 100 mm, 100-200 mesh silica gel, PE / EA =1 / 0, 20 / 1) to afford 3-bromo-N'-hydroxy-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole- 5-carboxamidine (500 mg, 1.46 mmol, 90.35% yield) as white solid. LC-MS (ES+, m / z): 341.9, 343.9[(M+H)+]1HNMR (400 MHz, DMSO-d6) 5 = 9.74 (s, 1H), 7.26 (s, 1H), 6.83 (s, 1H), 5.88 (s, 2H), 5.54 (q, J = 9.3 Hz, 2H)Step 8 - N-[[3-[3-Bromo-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrol-5-yl]-l,2,4-oxadiazol-5-yl]methyl]- l-tert-butyl-pyrazole-4-carboxamide

[0284] To a mixture of methyl 2-[(l-tert-butylpyrazole-4-carbonyl)amino]acetate (363.66 mg, 1.52 mmol, 1.30 eq), 3-bromo-N'-hydroxy-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-5-carboxamidine (400.00 mg, 1.17 mmol, 1.00 eq) in Tol. (10 mL) was added CS2CO3 (1.52 g, 4.68 mmol, 4.00 eq) under N2 and the mixture was stirred at 110°C for 0.5 h. The mixture was poured into H2O (60 mL). The aqueous phase was extracted with EA (3*30 mL). The combined organic phase was washed with brine (3*30 mL), dried with anhydrous Na2SC>4, filtered and concentrated in vacuum. The residue was purified by silica gel chromatography (column height: 250 mm, diameter: 100 mm, 100-200 mesh silica gel, PE / EA =1 / 0, 3 / 1) to afford N-[[3-[3-bromo-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrol-5-yl]-l,2,4- oxadiazol-5-yl]methyl]-l-tert-butyl-pyrazole-4-carboxamide (480 mg, 903.36 pmol, 77.27% yield) as brown solid. LC-MS (ES+, m / z): 531.2, 533.2[(M+H)+], ’HNMR (400 MHz, DMSO-d6) 5 = 8.97 (t, J = 5.6 Hz, 1H), 8.34 (s, 1H), 7.92 (s, 1H), 7.41 (s, 1H), 7.09 (s, 1H), 5.54 (q, J = 9.0 Hz, 2H), 4.77 (d, J = 5.6 Hz, 2H), 1.54 (s, 9H)EXAMPLE 2: N-[(3-{4-(N-l-methyl-4-piperidylcarbamoyl)-8-(2,2,2-trifluoroethyl)-2-thia-8- azabicyclo[3.3.0]octa-l(5),3,6-trien-7-yl}-l,2,4-oxadiazol-5-yl)methyl]-l-(tert-butyl)-4- pyr azolecarboxamideStep 1 - 5-cyano-N-( 1 -methyl-4-piperidyl)-6-(2, 2, 2-trifluoroethyl)thieno [2, 3-b ]pyrrole-3-carboxamide

[0285] To a mixture of l-methylpiperidin-4-amine (554.12 mg, 4.85 mmol, 5.00 eq), 3-bromo-6-(2,2,2- trifluoroethyl)thieno [2,3 -b]pyrrole-5 -carbonitrile (300.00 mg, 970.54 pmol, 1.00 eq) in DMSO (15 mL) was added TEA (491.04 mg, 4.85 mmol, 675.43 pL, 5.00 eq), Mo(CO)e (102.49 mg, 388.22 pmol, 52.29 pL, 0.40 eq), Pd(dppf)C12.CH2C12 (158.52 mg, 194.11 pmol, 0.20 eq) under N2 and the mixturewas stirred at 130 °C for 2 h. The mixture was poured into sat. EDTA (50 mL) and stirred for 1 h. The aqueous phase was extracted with EA (3*25 mL). The combined organic phase was washed with brine (3*25 mL), dried with anhydrous Na2SC>4, filtered and concentrated under vacuum. The residue was purified by silica gel chromatography (column height: 250 mm, diameter: 100 mm, 100-200 mesh silica gel, DCM(0.003 TEA) / MeOH=l / 0 to 10 / 1) to afford 5-cyano-N-(l-methyl-4-piperidyl)-6-(2,2,2- trifhroroethyl)thieno[2,3-b]pyrrole-3-carboxamide (150 mg, 88% purity, 36.7% yield) as black solid. LC- MS (ES+, m / z): 371.1 [(M+H)+] 'H NMR (400 MHz, DMSO-de) 5 = 8.23 - 8.13 (m, 1H), 8.01 (br d, J = 1.5 Hz, 1H), 7.46 (br d, J = 1.6 Hz, 1H), 5.35 (br d, J = 8.3 Hz, 2H), 3.79 - 3.67 (m, 1H), 2.90 - 2.84 (m, 2H), 2.29 - 2.17 (m, 5H), 1.79 (br s, 2H), 1.62 (br s, 2H)Step 2 - 5-[(Z)-N'-hydroxycarbamimidoyl ]-N-( 1 -methyl-4-piperidyl)-6-(2, 2, 2-trifluoroethyl)thieno[2, 3- b ]pyrrole-3-carboxamide

[0286] To a mixture of 5-cyano-N-(l-methyl-4-piperidyl)-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-3- carboxamide (120.00 mg, 323.98 pmol, 1.00 eq) in EtOH (4 mL) was added hydroxylamine (64.21 mg, 971.94 pmol, 50% purity, 3.00 eq) under N2 and the mixture was stirred at 60 °C for 0.5 h. The mixture was poured into H2O (60 mL). The aqueous phase was extracted with EA (3*30 mL). The combined organic phase was washed with brine (3*30 mL), dried with anhydrous Na2SC>4, fdtered and concentrated in vacuum to afford 5-[(Z)-N'-hydroxycarbamimidoyl]-N-(l-methyl-4-piperidyl)-6-(2,2,2- trifhroroethyl)thieno[2,3-b]pyrrole-3-carboxamide (120 mg, crude) as black solid. LC-MS (ES+, m / z): 404.2 [(M+H)+]Step 3 - 5-[5-[[(l -tert-butylpyrazole-4-carbonyl)amino]methyl]-l,2, 4-oxadiazol-3-yl]-N-(l-methyl-4- piperidyl)-6-(2,2,2-trifluoroethyl)thieno[2,3-b]pyrrole-3-carboxamide

[0287] To a solution of 5-[(Z)-N'-hydroxycarbamimidoyl]-N-(l-methyl-4-piperidyl)-6-(2,2,2- trifluoroethyl)thieno [2,3 -b]pyrrole-3 -carboxamide (100.00 mg, 247.88 pmol, 1.00 eq) in toluene (5 mL), was added CS2CO3 (323.06 mg, 991.52 pmol, 4.00 eq) and methyl 2-[(l-tert-butylpyrazole-4- carbonyl)amino] acetate (59.31 mg, 247.88 pmol, 1.00 eq). The mixture was stirred at 110 °C for Ihr. The reaction was quenched by addition of water (50 mL) at 25 °C, and diluted with EA (20 mL). The aqueous phase was separated and extracted with EA (3*30 mL). The combined organic layers were washed with brine (2*50 mL), dried over anhydrous Na2SC>4, fdtered and concentrated to give a residue. The residue was purified by prep-HPLC (column: Waters Xbridge BEH Cis 100*30mm* phase: [H2O(10mM NH4HCC>3)-ACN];gradient:25%-55% B over 8.0 min) to afford 5-[5-[[(l-tert-butylpyrazole-4- carbonyl)amino]methyl]-l,2,4-oxadiazol-3-yl]-N-(l-methyl-4-piperidyl)-6-(2,2,2- trifluoroethyl)thieno [2,3 -b]pyrrole-3 -carboxamide (18.7 mg, 31.14 pmol, 12.56% yield, 98.7% purity) as a brown solid. LC-MS (ES+, m / z): 593.3 [(M+H)+] 'H NMR (400 MHz, DMSO-d6) 5 = 8.99 - 8.93 (m, 1H), 8.36 - 8.30 (m, 1H), 8.13 - 8.07 (m, 1H), 7.94 - 7.89 (m, 2H), 7.38 - 7.34 (m, 1H), 5.57 - 5.48 (m, 2H), 4.79 - 4.73 (m, 2H), 3.79 - 3.65 (m, 1H), 2.81 - 2.72 (m, 2H), 2.16 (s, 3H), 1.99 - 1.88 (m, 2H), 1.80 - 1.71 (m, 2H), 1.63 - 1.55 (m, 2H), 1.55 - 1.52 (m, 9H)

[0288] TABLE 2 shows additional compounds with a 2-thia-8-azabicyclo[3.3.0]octa-l(5),3,6-triene core.TABLE 2EXAMPLE 3: In vitro DNA binding activity assay

[0289] DNA binding activity of the compounds was measured using a TR-FRET (Time-Resolved Fluorescence Resonance Energy Transfer) assay in which recombinant His-tag Y220C p53 DBD protein binds to biotin-labeled consensus DNA. Binding of recombinant His-tag Y220C p53 DBD protein and biotin-labeled consensus DNA was registered by the FRET (fluorescence resonance energy transfer) between allophycocyanin (APC) conjugated anti-His tag antibody and Europium-(Eu) conjugated Streptavidin.

[0290] The compounds of (2 mM stock in dimethylsulfoxide) were diluted 3 -fold in series in dimethylsulfoxide. 1.2 pL of a compound solution was added to each well of 384-well polypropylene black plates (NUNC). Thirty pL per well of 181 nM recombinant His-tag Y220C p53 DBD protein (amino acids #94-312; SEQ ID NO: 1) and 6.1 nM of APC conjugated anti-His tag antibody (Columbia Biosciences) in ice-cold Assay Buffer 1 (50 mM Tris-HCl, pH 7.4, 75 mM KC1, 0.75 mM DTT and 0.2 mg / mL BSA) were added. As a background control, 30 pL of Assay Buffer 1 containing 6.1 nM of APC anti-His antibody (No Y220C protein) was also added into a second set of serially diluted compound plates. The samples were spun by centrifuge at 1,200 rpm (Eppendorf 5810R Plate centrifuge) for 1 minute and incubated at room temperature (20 °C) for 15 min. The samples were then further incubated at either 27 °C or 29 °C for 60 min. Five microliters per well of 311 nM biotin labeled consensus DNA (a DNA duplex with 5' to 3' sequence of ATTAGGCATGTCTAGGCATGTCTAGG (SEQ ID NO. 2) and biotin attached to the 3' end of the complementary DNA) and 4.9 nM Europium (Eu) conjugated Streptavidin (Eu-SA, Perkin Elmer) in Assay Buffer 2 (50 mM Tris-HCl, pH 7.4, 75 mM KC1 and 0.2 mg / mL BSA) were added to the wells. The samples were spun by centrifuge at 1,200 rpm for 1 min and incubated at 20 °C for 20 min. Assay signals were monitored by reading excitation at 340 nm, and emission fluorescence at 615 nm and 665 nm on an Envision® reader. Normalized TR-FRET (time- resolved fluorescence resonance energy transfer) assay signal (Rn) was calculated by the formula:Rn = [(A-Ba-C x (D-Bd)) / (D-Bd)] x (De- Bd) wherein:A is the fluorescence intensity of the sample at 665 nm;D is the fluorescence intensity of the sample at 615 nm;Ba and Bd are plate backgrounds at 665 nm and 615 nm, respectively; andDe is the fluorescence intensity of 0.67 nM Eu-SA in the assay buffer at 615 nm.

[0291] The cross-talk factor (C) was determined by the following formula:C = (Ac- Ba) / (Dc-Bd) wherein Ac is the fluorescence intensity of 0.67 nM Europium (Eu) conjugated Streptavidin in the assay buffer at 665 nm. SC150 (substrate concentration to increase DNA binding by 1.5-fold) values were calculated using Prism (GraphPad) or XLfit software (IDBS).TABLE 3 shows the SC150 (pM) values of the compounds.TABLE 3

[0292] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

[0293] The details of one or more embodiments of the disclosure are set forth in the accompanying description above. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred methods and materials are now described. Other features, objects, and advantages of the disclosure will be apparent from thedescription and from the claims. In the specification and the appended claims, the singular forms include plural referents unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A compound of formula Ila, or a pharmaceutically-acceptable salt thereof:wherein:X3is CR9R10, NR9, O, or S;A is a substituted or unsubstituted aromatic 5-membered, 6-membered, 7-membered, or 8-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S;R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -SR16, - NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or -SiR16R17R18;R2is alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, or -OC(O)R21;R5is selected from alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; each R9, R10, R16, R17, and R18is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, - C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; and each R21and R22is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H.

2. The compound of claim 1, wherein A is an aromatic 5 -membered, or 6-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S.

3. The compound of claim 1, wherein A is an aromatic nitrogen containing 5 -membered ring system comprising 0, 1 or 2 additional heteroatoms as ring members, wherein each additional heteroatom is independently selected from O, N, and S.

4. The compound of claim 1, wherein A is l,3,5-thiadiazol-2,4-diyl, l,3,4-oxadiazol-2,5-diyl, or 1 ,2 ,4-oxadiazol-3 , 5 -diyl .

5. The compound of claim 1, wherein R2is substituted or unsubstituted alkyl.

6. The compound of claim 5, wherein R2is selected from Ci-6 alkyl, Ci-4 cyanoalkyl, -C1-2 -alkyl-Cs-e cycloalkyl, and C1-2 haloalkyl.

7. The compound of claim 5, wherein R2is selected from trifluoroethyl, 2-propyl and -CH2- cyclopropyl.

8. The compound of claim 1, wherein R1is alkyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted.

9. The compound of claim 8, wherein R1is substituted alkyl.

10. The compound of claim 7, wherein R1is C1-3 alkyl substituted with -NR23C(O)R24.

11. The compound of claim 10, wherein R1is -CH2-NHC(O)R24, wherein R24is C3-6 cycloalkyl or 5 membered heteroaryl, each of which is independently substituted or unsubstituted.

12. The compound of claim 11, wherein R24is cyclopropyl or pyrazolyl; each of which is independently substituted or unsubstituted.

13. The compound of claim 9, wherein R1is methyl substituted with -NR16R17, wherein R16is hydrogen, and R17is a substituted phenyl.

14. The compound of claim 1, wherein R5is selected from -C(O)R21, -C(O)NR21R22, and C1-3 alkyl substituted with -NR16R17.

15. The compound of claim 14, wherein R22is H; and R21is independently Ce-io aryl, 5-6 membered nitrogen containing heteroaryl, or 5-6 membered heterocyclyl, each of which is independently substituted or unsubstituted.

16. The compound of claim 14, wherein R16is hydrogen, and R17is 5-6 membered nitrogen-containing heterocyclyl that is independently substituted or unsubstituted.

17. The compound of claim 14 wherein R21is 6 membered nitrogen-containing heterocyclyl that is independently substituted or unsubstituted .

18. The compound of claim 14, wherein R21is 6 membered nitrogen containing heterocyclyl substituted at least with a substituent selected from di(Ci-2 alkyl)amino, 5-membered nitrogencontaining heterocyclyl, C1-2 alkoxy, C1-2 alkyl and halo.

19. The compound of claim 14, wherein R21is piperidinyl unsubstituted or substituted with a substituent selected from dimethylamino, pyrrolidinyl, methoxy, methyl and fluoro.The compound of claim 14, wherein R21is, wherein Rais C1-4 alkyl.

21. The compound of claim 1 wherein R5is -C(O)R21and R21is 6 membered nitrogen -containing heterocyclyl that is independently substituted or unsubstituted.

22. The compound of claim 1, having the formula Illawherein A is a substituted or unsubstituted aromatic 5-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S;R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -SR16, - NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or -SiR16R17R18;R2is alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, or -OC(O)R21;R5is selected from alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; each R16, R17, and R18is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; and each R21and R22is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H.

23. The compound of claim 22, wherein A is thiadiazolyl, thiazolyl, pyrazolyl, or oxadiazolyl, each of which is independently substituted or unsubstituted.

24. The compound of claim 22, wherein A is l,3,5-thiadiazol-2,4-diyl, l,3,4-oxadiazol-2,5-diyl or 1 ,2 ,4-oxadiazol-3 , 5 -diyl .

25. The compound of claim 22, wherein R2is selected from C1-2 haloalkyl, C1-6 alkyl, C1-4 cyanoalkyl, and -C1-2 -alkyl-Cs-e cycloalkyl.

26. The compound of claim 22, wherein R2is selected from trifluoroethyl, 2-propyl and -CH2- cyclopropyl.

27. The compound of claim 23, wherein R1is C1-3 alkyl substituted with NR23C(O)R24.

28. The compound of claim 23, wherein R1is -CH2-NHC(O)R24, wherein R24is C3-6 cycloalkyl or 5 membered heteroaryl, each of which is independently substituted or unsubstituted.

29. The compound of claim 23, wherein R5is selected from -C(O)R21, -C(O)NR21R22, and C1-3 alkyl substituted with -NR16R17.

30. The compound of claim 29, wherein R22is H; and R21is 5-6 membered heterocyclyl, each of which is independently substituted or unsubstituted.

31. The compound of claim 29, wherein R16is hydrogen, and R17is 5-6 membered nitrogen-containing heterocyclyl, each of which is independently substituted or unsubstituted.

32. The compound of claim 29, wherein R5is -C(O)R21, and R21is 6 membered nitrogen-containing heterocyclyl, each of which is independently substituted or unsubstituted.

33. The compound of claim 30, wherein R21is 6 membered nitrogen-containing heterocyclyl substituted at least with a substituent selected from di(Ci-2 alkyl)amino, 5-membered nitrogencontaining heterocyclyl, C1-2 alkoxy , C1-2 alkyl and halo.

34. The compound of claim 33, wherein R21is piperidinyl unsubstituted or substituted with a substituent selected from dimethylamino, pyrrolidinyl, methoxy, methyl and fluoro.The compound of claim 34, wherein R21is , wherein Rais Ci-4 alkyl.

36. The compound of claim 1, having the structure:

37. A compound of formula lib, or a pharmaceutically-acceptable salt thereof:wherein:X3is CR9R10, NR9, O, or S;A is ethyndiyl or a substituted or unsubstituted aromatic 5 -membered, 6-membered, 7-membered, or 8-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S;R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -SR16, - NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or -SiR16R17R18;R2is alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, or -OC(O)R21;R5is selected from alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21C(O)R22, or -OC(O)R21; each R9, R10, R16, R17, and R18is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, - C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; and each R21and R22is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H.

38. The compound of claim 37, wherein A is an aromatic 5 -membered, or 6-membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S.

39. The compound of claim 37, wherein A is an aromatic nitrogen containing 5 -membered ring system comprising 0, 1 or 2 additional heteroatoms as ring members, wherein each additional heteroatom is independently selected from O, N, and S.

40. The compound of claim 37, wherein A is l,3,5-thiadiazol-2,4-diyl, l,3,4-oxadiazol-2,5-diyl, or 1 ,2 ,4-oxadiazol-3 , 5 -diyl .

41. The compound of claim 37, wherein A is ethyndiyl.

42. The compound of claim 37, wherein R2is substituted or unsubstituted alkyl.

43. The compound of claim 42, wherein R2is selected from Ci-6 alkyl, Ci-4 cyanoalkyl, -C1-2 -alkyl-Cs-e cycloalkyl, and C1-2 haloalkyl.

44. The compound of claim 42, wherein R2is selected from trifluoroethyl, 2-propyl and -CH2- cyclopropyl.

45. The compound of claim 37, wherein R1is alkyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted.

46. The compound of claim 45, wherein R1is substituted alkyl.

47. The compound of claim 46, wherein R1is C1-3 alkyl substituted with -NR23C(O)R24.

48. The compound of claim 47, wherein R1is -CH2-NHC(O)R24, wherein R24is C3-6 cycloalkyl or 5 membered heteroaryl, each of which is independently substituted or unsubstituted.

49. The compound of claim 48, wherein R24is cyclopropyl or pyrazolyl; each of which is independently substituted or unsubstituted.

50. The compound of claim 46, wherein R1is methyl substituted with -NR16R17, wherein R16is hydrogen, and R17is a substituted phenyl.

51. The compound of claim 37, wherein R5is selected from -C(O)R21, -C(O)NR21R22, and C1-3 alkyl substituted with -NR16R17.

52. The compound of claim 51, wherein R22is H; and R21is independently Ce-io aryl, 5-6 membered nitrogen containing heteroaryl, or 5-6 membered heterocyclyl, each of which is independently substituted or unsubstituted.

53. The compound of claim 51, wherein R16is hydrogen, and R17is 5-6 membered nitrogen-containing heterocyclyl that is independently substituted or unsubstituted.

54. The compound of claim 51 wherein R21is 6 membered nitrogen-containing heterocyclyl that is independently substituted or unsubstituted .

55. The compound of claim 51, wherein R21is 6 membered nitrogen containing heterocyclyl substituted at least with a substituent selected from di(Ci-2 alkyl)amino, 5-membered nitrogencontaining heterocyclyl, C1-2 alkoxy, C1-2 alkyl and halo.

56. The compound of claim 51, wherein R21is piperidinyl unsubstituted or substituted with a substituent selected from dimethylamino, pyrrolidinyl, methoxy, methyl and fluoro.Ra-N57. The compound of claim 51, wherein R21is ' — ' , wherein Rais C1.4 alkyl.

58. The compound of claim 37, wherein R13is C1.4 alkyl, C2-4 alkenyl, each of which is independently substituted or unsubstituted; H, or halo.

59. The compound of claim 37, wherein R13is H or C1-2 haloalkyl.

60. The compound of claim 37, wherein A is an aromatic 5 -membered monocyclic ring system.

61. The compound of claim 37, wherein A is ethyndiyl, and R1is C1-3 alkyl substituted with -NR16R17.

62. The compound of claim 61, wherein R16is hydrogen, and R17is a substituted phenyl.

63. The compound of claim 37 wherein R5is -C(O)R21and R21is 6 membered nitrogen-containing heterocyclyl that is independently substituted or unsubstituted.

64. The compound of claim 37, having the formula Illbwherein A is ethyndiyl or a substituted or unsubstituted aromatic 5 -membered monocyclic ring system comprising 1, 2, or 3 heteroatoms as ring members, wherein each heteroatom is independently selected from O, N, and S;R1is alkyl, alkenyl, alkynyl, alkoxy, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R16, -C(O)OR16, -C(O)NR16R17, -OR16, -SR16, - NR16R17, -NR16C(O)R16, -OC(O)R16, -POR16R17, or -SiR16R17R18;R2is alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, - NR21R22, -NR21C(O)R22, or -OC(O)R21;R5is selected from alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21C(O)R22, or -OC(O)R21; each R16, R17, and R18is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H, halo, -C(O)R21, -C(O)OR21, -C(O)NR21R22, -OR21, -SR21, -NR21R22, -NR21C(O)R22, or -OC(O)R21; and each R21and R22is independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, or heterocyclyl, each of which is independently substituted or unsubstituted, or H.

65. The compound of claim 64, wherein A is thiadiazolyl, thiazolyl, pyrazolyl, or oxadiazolyl, each of which is independently substituted or unsubstituted.

66. The compound of claim 64, wherein A is l,3,5-thiadiazol-2,4-diyl, l,3,4-oxadiazol-2,5-diyl or 1 ,2 ,4-oxadiazol-3 , 5 -diyl .

67. The compound of claim 64, wherein R2is selected from C1-2 haloalkyl, C1-6 alkyl, C1-4 cyanoalkyl, and -C1-2 -alkyl-Cs-e cycloalkyl.

68. The compound of claim 64, wherein R2is selected from trifluoroethyl, 2-propyl and -CH2- cyclopropyl.

69. The compound of claim 65, wherein R1is C1-3 alkyl substituted with NR23C(O)R24.

70. The compound of claim 37, wherein A is ethynyl, and R1is C1-3 alkyl substituted with -NR16R17,71. The compound of claim 70, wherein R16is hydrogen, and R17is a substituted phenyl.

72. The compound of claim 65, wherein R1is -CH2-NHC(O)R24, wherein R24is C3-6 cycloalkyl or 5 membered heteroaryl, each of which is independently substituted or unsubstituted.

73. The compound of claim 65, wherein R5is selected from -C(O)R21, -C(O)NR21R22, and C1-3 alkyl substituted with -NR16R17.

74. The compound of claim 73, wherein R22is H; and R21is 5-6 membered heterocyclyl, each of which is independently substituted or unsubstituted.

75. The compound of claim 73, wherein R16is hydrogen, and R17is 5-6 membered nitrogen-containing heterocyclyl, each of which is independently substituted or unsubstituted.

76. The compound of claim 73, wherein R5is -C(O)R21, and R21is 6 membered nitrogen-containing heterocyclyl, each of which is independently substituted or unsubstituted.

77. The compound of claim 74, wherein R21is 6 membered nitrogen-containing heterocyclyl substituted at least with a substituent selected from di(Ci-2 alkyl)amino, 5-membered nitrogencontaining heterocyclyl, C1-2 alkoxy , C1-2 alkyl and halo.

78. The compound of claim 77, wherein R21is piperidinyl unsubstituted or substituted with a substituent selected from dimethylamino, pyrrolidinyl, methoxy, methyl and fluoro.

79. The compound of claim 78, wherein R21is, wherein Rais C1.4 alkyl.

80. The compound of claim 37, having the structure:

81. A pharmaceutical composition comprising a compound of any of claims 1-80, or a pharmaceutically-acceptable salt thereof.

82. A method of treating cancer or a p53 meditated disorder, the method comprising administering to a patient in need thereof a therapeutically effective amount of a compound of any one of claims 1 to 80 or a pharmaceutical composition of claim 81.

83. The method of claim 82, wherein the cancer is breast cancer.

84. The method of claim 82, wherein the cancer is lung cancer.

85. The method of claim 82, wherein the cancer is ovarian cancer.

86. The method of claim 82, wherein the cancer expresses a mutant p53 protein.

87. The method of claim 86, wherein the mutant p53 protein has a mutation at amino acid 220.

88. The method of claim 86, wherein the mutant p53 protein is p53 Y220C.

Images