Anti-exhaustion compositions and methods of use thereof

Abstract

Provided are compositions comprising at least one DNA binding domain (DBD), comprising a sequence isolated or derived from one or more of NR4A1, NR4A2, and NR4A3 and an oligomerization domain.

Description

[0001] ANTI-EXHAUSTION COMPOSITIONS AND METHODS OF USE THEREOF

[0002] CROSS REFERENCE TO RELATED APPLICATIONS

[0003]

[0001] This application claims priority to U.S. Provisional Application No. 63 / 582,819 filed on September 14, 2023, the contents of which are incorporated herein by reference in its entirety.

[0004] BACKGROUND

[0005]

[0002] Exhausted T cells lose their high proliferative capacity and cytotoxicity, eventually leading to cell death. Numerous factors can lead to T cell exhaustion, such as persistent antigen exposure during infection, and constant alloantigen presence following organ transplantation. In addition, some tumors and cancer-associated cells can actively induce T cell exhaustion at the site of the tumor, thus conferring tumor protection from T cell activity. T cell exhaustion is also seen in the context of engineered T cell therapies. Engineered T cells expressing a chimeric antigen receptor (CAR) or T cell receptor (TCR) can undergo exhaustion in the same way that endogenous T cells undergo exhaustion. Thus, there is an unmet need for engineered T cell therapies having increased efficacy as a result of decreased exhaustion and increased response persistence. The disclosure solves this currently unmet need by providing compositions and methods for delaying or reducing T cell exhaustion.

[0006] SUMMARY

[0007]

[0003] The disclosure provides a polypeptide comprising an amino acid sequence that encodes for an engineered, non-naturally occurring, nuclear receptor subfamily 4 group A (NR4a) DNA-binding domain (DBD). Throughout the disclosure, this polypeptide may be referred to as an “NR4A-DBD polypeptide”. In some embodiments, the polypeptide comprises an amino acid sequence that encodes for or forms a structure of the disclosure and specifically binds to nuclear receptor subfamily 4 group A member 1 (NR4A1). In some embodiments, the polypeptide comprises an amino acid sequence that encodes for or forms a structure of the disclosure and specifically binds to nuclear receptor subfamily 4 group A member 2 (NR4A2). In some embodiments, the polypeptide comprises an amino acid sequence that encodes for or forms a structure of the disclosure and specifically binds to nuclear receptor subfamily 4 group A member 3 (NR4A3). In some embodiments, the polypeptide comprises an amino acid sequence that encodes for or forms a structure of the disclosure and specifically binds to one or more of NR4A1, NR4A2, and NR4A3.

[0008]

[0004] The disclosure provides a composition comprising: (a) at least one DNA binding domain (DBD), wherein the DBD comprises a sequence isolated or derived from one or more of NR4A1, NR4A2, and NR4A3; and (b) an oligomerization domain.

[0009]

[0005] In some embodiments of the compositions of the disclosure, the oligomerization domain is positioned at the N-terminus of the DBD. In some embodiments, the oligomerization domain is positioned at the C-terminus of the DBD.

[0010]

[0006] In some embodiments of the compositions of the disclosure, the at least one DBD comprises a sequence isolated or derived from NR4A1. In some embodiments, the at least one DBD comprises a sequence having at least 70% identity to the sequence of SEQ ID NO: 1 or 2. In some embodiments, the at least one DBD comprises a sequence having at least 70% identity to the sequence of SEQ ID NO: 1, 2, 289, or 290. In some embodiments, the at least one DBD comprises a sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79% identity to the sequence of SEQ ID NO: 1, 2, 289, or 290. In some embodiments, the at least one DBD comprises a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the sequence of SEQ ID NO: 1, 2, 289, or 290. In some embodiments, the at least one DBD comprises SEQ ID NO: 1, 2, 289, or 290. In some embodiments, the at least one DBD consists of SEQ ID NO: 1, 2, 289, or 290. In some embodiments, the at least one DBD comprises a sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79% identity to the sequence of SEQ ID NO: 1 or 2. In some embodiments, the at least one DBD comprises a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the sequence of SEQ ID NO: 1 or 2. In some embodiments, the at least one DBD comprises SEQ ID NO: 1 or 2. In some embodiments, the at least one DBD consists of SEQ ID NO: 1 or 2.

[0007] In some embodiments of the compositions of the disclosure, the at least one DBD comprises a sequence isolated or derived from NR4A2. In some embodiments, the at least one DBD comprises a sequence having at least 70% identity to the sequence of SEQ ID NO: 3. In some embodiments, the at least one DBD comprises a sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79% identity to the sequence of SEQ ID NO: 3. In some embodiments, the at least one DBD comprises a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the sequence of SEQ ID NO: 3. In some embodiments, the at least one DBD comprises SEQ ID NO: 3. In some embodiments, the at least one DBD consists of SEQ ID NO: 3.

[0008] In some embodiments of the compositions of the disclosure, the at least one DBD comprises a sequence isolated or derived from NR4A3. In some embodiments, the at least one DBD comprises a sequence having at least 70% identity to the sequence of SEQ ID NO: 4. In some embodiments, the at least one DBD comprises a sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79% identity to the sequence of SEQ ID NO: 4. In some embodiments, the at least one DBD comprises a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the sequence of SEQ ID NO: 4. In some embodiments, the at least one DBD comprises SEQ ID NO: 4. In some embodiments, the at least one DBD consists of SEQ ID NO: 4.

[0011]

[0009] In some embodiments of the compositions of the disclosure, the composition comprises a first DBD, comprising a sequence isolated or derived from a first target, wherein the first target comprises one or more of NR4A1, NR4A2, and NR4A3; and a second DBD, comprising (1) a sequence isolated or derived from one or more of NR4A1, NR4A2, and NR4A3 or (2) a sequence isolated or derived from a second target. In some embodiments, the second DBD is identical to the first DBD. In some embodiments, the second DBD is not identical to the first DBD. In some embodiments, the second target comprises retinoic acid receptor RXR-alpha (RXRa) or wherein the second DBD comprises an RXRa-DBD. In some embodiments, the second DBD comprises a sequence having at least 70% identity to SEQ ID NO: 5. In some embodiments, the second DBD comprises a sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79% identity to SEQ ID NO: 5. In some embodiments, the second DBD comprises a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to SEQ ID NO: 5. In some embodiments, the second DBD comprises SEQ ID NO: 5. In some embodiments, the second DBD consists of SEQ ID NO: 5.

[0012]

[0010] In some embodiments of the compositions of the disclosure, the oligomerization domain comprises a de novo designed protein. In some embodiments, the oligomerization domain comprises a dimer, a trimer, a tetramer, a pentamer, a hexamer, a heptamer. In some embodiments, the oligomerization domain comprises a homodimer, a homotrimer, a homotetramer, a homopentamer, a homohexamer, a homoheptamer. In some embodiments, the oligomerization domain comprises a heterodimer, a heterotrimer, a heterotetramer, a heteropentamer, a heterohexamer, a heteroheptamer. In some embodiments, the oligomerization domain comprises the sequence of SEQ ID NO: 7 or 8, or any portion thereof. In some embodiments, the oligomerization domain comprises the sequence of SEQ ID NO: 7, or any portion thereof. In some embodiments, the oligomerization domain comprises the sequence of SEQ ID NO: 8, or any portion thereof.

[0011] In some embodiments of the compositions of the disclosure, the oligomerization domain comprises a homotrimer. In some embodiments, the oligomerization domain comprises a sequence having at least 70% identity to the sequence of any one or more of SEQ ID NO: 7, 282, 283, 284, 285, 286, 287, and 288. In some embodiments, the oligomerization domain comprises a sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79% identity to the sequence of any one or more of SEQ ID NO: 7, 282, 283, 284, 285, 286, 287, and 288. In some embodiments, the oligomerization domain comprises a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the sequence of any one or more of SEQ ID NO: 7, 282, 283, 284, 285, 286, 287, and 288. In some embodiments, the oligomerization domain comprises the sequence of any one or more of SEQ ID NO: 7, 282, 283, 284, 285, 286, 287, and 288. In some embodiments, the oligomerization domain consists of the sequence of any one or more of SEQ ID NO: 7, 282, 283, 284, 285, 286, 287, and 288.

[0013]

[0012] In some embodiments, the oligomerization domain comprises a sequence having at least 70% identity to the sequence of SEQ ID NO: 7. In some embodiments, the oligomerization domain comprises a sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79% identity to the sequence of SEQ ID NO: 7. In some embodiments, the oligomerization domain comprises a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the sequence of SEQ ID NO: 7. In some embodiments, the oligomerization domain comprises the sequence of SEQ ID NO: 7. In some embodiments, the oligomerization domain consists of the sequence of SEQ ID NO: 7.

[0014]

[0013] In some embodiments, the oligomerization domain comprises a sequence having at least 70% identity to the sequence of SEQ ID NO: 282. In some embodiments, the oligomerization domain comprises a sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79% identity to the sequence of SEQ ID NO: 282. In some embodiments, the oligomerization domain comprises a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the sequence of SEQ ID NO: 282. In some embodiments, the oligomerization domain comprises the sequence of SEQ ID NO: 282. In some embodiments, the oligomerization domain consists of the sequence of SEQ ID NO: 282.

[0015]

[0014] In some embodiments, the oligomerization domain comprises a sequence having at least 70% identity to the sequence of SEQ ID NO: 285. In some embodiments, the oligomerization domain comprises a sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79% identity to the sequence of SEQ ID NO: 285. In some embodiments, the oligomerization domain comprises a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity to the sequence of SEQ ID NO: 285. In some embodiments, the oligomerization domain comprises the sequence of SEQ ID NO: 285. In some embodiments, the oligomerization domain consists of the sequence of SEQ ID NO: 285.

[0016]

[0015] In some embodiments of the compositions of the disclosure, the composition further comprises at least one linker, wherein the linker operably links the at least one DBD and the oligomerization domain. In some embodiments, the linker comprises one or more of an amino acid, a nucleic acid, a synthetic or non-naturally occurring amino acid, a synthetic or non-naturally occurring nucleotide, and a combination thereof. In some embodiments, the linker comprises an amino acid or a synthetic or non-naturally occurring amino acid. In some embodiments, the linker or a sequence thereof is flexible. In some embodiments, the linker or a sequence thereof comprises Glycine (G) and Serine (S). In some embodiments, the linker comprises a sequence of SEQ ID NO: 30-33.

[0017]

[0016] In some embodiments of the compositions of the disclosure, the composition further comprises (a) a first linker, wherein the first linker operably links the first DBD and the second DBD; and (b) a second linker, wherein the second linker operably links a DBD of (a) and the oligomerization domain. In some embodiments, the first linker or the second linker comprises one or more of an amino acid, a nucleic acid, a synthetic or non-naturally occurring amino acid, a synthetic or non-naturally occurring nucleotide, and a combination thereof. In some embodiments, the linker comprises an amino acid or a synthetic or non- naturally occurring amino acid. In some embodiments, the linker or a sequence thereof is flexible. In some embodiments, the linker or a sequence thereof comprises Glycine (G) and Serine (S). In some embodiments, the linker comprises a sequence of SEQ ID NO: 30-33.

[0018]

[0017] In some embodiments of the compositions of the disclosure, the composition further comprises a cleavage site. In some embodiments, the cleavage site is a self-cleaving peptide.

[0019]

[0018] In some embodiments of the compositions of the disclosure, the composition further comprises a nuclear localization sequence (NLS). In some embodiments, the NLS comprises a sequence isolated or derived from one or more of an NR4A1 sequence, an NR4A2, an NR4A3 sequence and an RXRa sequence.

[0020]

[0019] In some embodiments of the compositions of the disclosure, the composition further comprises a functional domain. In some embodiments, the functional domain comprises one or more of a degradation domain, a kinase, a phosphatase, and an epigenetic modifier. In some embodiments, the functional domain comprises a degradation domain. In some embodiments, the degradation domain comprises a sequence isolated or derived from a degron, a ligase, an E3 ligase, a ligase-binding domain, or a cullin-binding domain. In some embodiments, the degradation domain comprises a sequence isolated or derived from (a) LNX1 (Ligand of Numb-protein X 1), RNF4 (RING finger protein 4), RNF43 (RING finger protein 43), RNF128 (RING finger protein 128), ZNRF3 (Zinc And Ring Finger 3), MARCHS (Membrane-associated RING-CH protein VIII), LRG1 (Leucine-rich alpha-2 - glycoprotein), NEDD4 (Neural precursor cell expressed developmentally down-regulated protein 4), SOCS2 (Suppressor of cytokine signaling 2), CHIP (Carboxy terminus of HspVO- interacting protein), SPOP (Speckle-type POZ protein), FBXW7 (F- box / WD repeatcontaining protein 7), FBXW1A (F-box / WD repeat-containing protein 1A), FBXL12 (F- box / LRR-repeat protein 12), EEOC (Elongin-C), TRAF6 (TNF receptor-associated factor 6), VHL (von Hippel-Lindau disease tumor suppressor) or any functional fragment thereof; or (b) LNX1, RNF4, RNF43 or any functional fragment thereof; or (c) LNX1 or any functional fragment thereof; or (d) RNF4 or any functional fragment thereof; or (e) RNF43 or any functional fragment thereof; or (f) FBXL12 or any functional fragment thereof. In some embodiments, the degradation domain comprises a sequence isolated or derived from a cullin binding domain. In some embodiments, the cullin-binding domain comprises a sequence isolated or derived from one or more of Sphingosine kinase 1 (ski), elongin-B (ELOB) / elongin-C (EEOC), BTB / POZ domain-containing protein (BTBD), and DNA damage-binding protein 1 (DDB1).

[0021]

[0020] In some embodiments of the compositions of the disclosure, the composition further comprises a functional domain. In some embodiments, the functional domain comprises a sequence isolated or derived from one or more of ABTB1 (Ankyrin repeat and BTB / POZ domain-containing protein 1), ASB1 (Ankyrin repeat and SOCS box protein 1), ASB6 (Ankyrin repeat and SOCS box protein 6), CHIP, GISH (Cytokine-inducible SH2-containing protein), CRBN (Protein cereblon), DCAF15 (DDB1- and CUL4-associated factor 15), DDB2 (DNA damage-binding protein 2), EID1 (EP300-interacting inhibitor of differentiation 1), EEOC, FBW1A, FBXL12, FBXL14 (F-box / LRR- repeat protein 14, FBXL15 (F- box / LRR-repeat protein 15), FBXL2 (F-box / LRR-repeat protein 2), FBX024 (F-box only protein 24), FBX03 (F-box only protein 3), FBXO40 (F-box only protein 40, FBX06 (F-box only protein 6, FBXW5 (F-box / WD repeat-containing protein 5), FBXW7 (F- box / WD repeat-containing protein 7), FCGR3B (Low affinity immunoglobulin gamma Fc region receptor IILB), GAB ARAP (Gamma-aminobutyric acid receptor-associated protein, GABARAPL2 (Gamma-aminobutyric acid receptor-associated protein-like 2), GAN (Gigaxonin), GET4 (Golgi to ER traffic protein 4 homolog), GID8 (Glucose-induced degradation protein 8 homolog), GMCL1 (Germ cell-less protein-like 1), HDAC1 (Histone deacetylase 1), ISG15 (Ubiquitin-like protein ISG15), KBTBD7 (Kelch repeat and BTB domain-containing protein 7), KLHDC2 (Kelch domain- containing protein 2), KLHL11 (Kelch-like protein 11), KLHL12 (Kelch-like protein 12), KLHL23 (Kelch-like protein 23), KLHL40 (Kelch-like protein 40, KLHL6 (Kelch-like protein 6), LAPTM5 (Lysosomal- associated transmembrane protein 5, LDOC1 (Protein LDOC1), LNX1, LY6D (Lymphocyte antigen 6D), LYPD3 (Ly6 / PLAUR domain-containing protein 3), MAGEA2B (Melanoma- associated antigen 2), MAP1LC3A (Microtubule-associated proteins 1A / 1B light chain 3A), MTCH1 (Mitochondrial carrier homolog 1), MYLIP (Myosin regulatory light chain interacting protein), NDFIP2 (E3 ubiquitin-protein ligase NEDD4-like), NEDD4, NHLRC1 (NHL repeat- containing protein 1), OTUB1 (Ubiquitin thioesterase OTUB1), PCGF3 (Polycomb group RING finger protein 3), PIAS3 (E3 SUMO-protein ligase PIAS3), PIAS4 gamma (E3 SUMO-protein ligase PIAS4), PJA1 (E3 ubiquitin-protein ligase Praja-1), PPAR gamma (Peroxisome proliferator- activated receptor alpha), PRR20A (Proline-rich protein 20 A), RAB40AL (Ras-related protein Rab- 40A-like), RNF115 (RING finger protein 115), RNF125 (RING finger protein 125), RNF126(RING finger protein 126), RNF130 (RING finger protein 130), RNF138 (RING finger protein 138), RNF144A (RING finger protein 144A), RNF144B (RING finger protein 144B), RNF150 (RING finger protein 150), RNF166 (RING finger protein 166), RNF181 (RING finger protein 181), RNF182 (RING finger protein 182), RNF183 (RING finger protein 183), RNF185 (RING finger protein 185), RNF24 (RING finger protein 124), RNF4, RNF41 (RING finger protein 41), RNF43, RNF8 (RING finger protein 8), RTL8C (Retrotransposon Gag-like protein 8C), SKP2 (S-phase kinase-associated protein 2), SOCS1 (suppressor of cytokine signaling 1), SOCS2 (suppressor of cytokine signaling 2), SOC S3 (suppressor of cytokine signaling 3), SOCS5 (suppressor of cytokine signaling 5), SPOP, SPSB2 (SPRY domain-containing SOCS box protein 2), SPSB4 (SPRY domain-containing SOCS box protein 4), SQSTM1 (Sequestosome-1), TEX19 (Testis-expressed protein 19), TRAF2 (TNF receptor-associated factor 2), TRAF6, Triml3 (E3 ubiquitin-protein ligase TRIM13), TRIM31 (E3 ubiquitin- protein ligase TRIM31), TRIM39 (E3 ubiquitin-protein ligase TRIM39), TRIM49 (E3 ubiquitin-protein ligase TRIM49), TRIMS (E3 ubiquitin-protein ligase TRIMS), UBC9 (SUMO-conjugating enzyme UBC9), UBE2A (Ubiquitin-conjugating enzyme E2 A), UBE2B (Ubiquitin-conjugating enzyme E2 B), UBE2D1 (Ubiquitin-conjugating enzyme E2 DI), UBE2D4 (Ubiquitin-conjugating enzyme E2 D4), UCHL1 (Ubiquitin carboxyl- terminal hydrolase isozyme El), VHL, and ZER1 (Protein zer-1 homolog).

[0021] In some embodiments of the compositions of the disclosure, the composition comprises a sequence of one or more of SEQ ID NOs: 1-19 and 282-307. In some embodiments, the composition comprises a sequence of SEQ ID NO: 7, 282-290, or 302-305.

[0022]

[0022] The disclosure provides a fusion protein comprising a composition of the disclosure. The disclosure provides a nucleic acid encoding a composition of the disclosure or a fusion protein of the disclosure. In some embodiments, the nucleic acid comprises a regulatory sequence. In some embodiments, the regulatory sequence comprises a promoter, optionally, wherein the promoter is a constitutive promoter or an inducible promoter. In some embodiments, the promoter comprises a minimal promoter. In some embodiments, the promoter comprises a constitutive promoter. In some embodiments, the constitutive promoter comprises a sequence isolated or derived from a mammalian MND promoter. In some embodiments, the promoter comprises an inducible promoter. In some embodiments, the inducible promoter comprises a sequence isolated or derived from a mammalian NFkB promoter. In some embodiments, the inducible promoter comprises a sequence isolated or derived from the sequence of SEQ ID NO: 308. Alternatively, or in addition, the regulatory sequence comprises one or more of an enhancer of any sequence (including the sequence encoding an DBD, an oligomerization domain, a functional domain, a polypeptide, a composition or a fusion protein thereof or any other sequence), a silencer of any sequence (including the sequence encoding an DBD, an oligomerization domain, a functional domain, a polypeptide, a composition or a fusion protein thereof or any other sequence), a repressor of any sequence (including the sequence encoding an DBD, an oligomerization domain, a functional domain, a polypeptide, a composition or a fusion protein thereof or any other sequence), an intron of any gene (including a beta-actin gene), an exon of any gene (including a beta-actin gene), a splice acceptor site of any gene (including a beta-globin gene), an untranslated region, a terminal or inverted repeat sequence, a “TATA box” sequence, a post- transcriptional regulatory element (PRE, including a woodchuck PRE (WPRE)) or any combination thereof.

[0023]

[0023] The disclosure provides a vector comprising a nucleic acid of the disclosure. In some embodiments, the vector is an expression vector. The disclosure provides a vector comprising a nucleic acid sequence of the disclosure. In some embodiments, the vector is an expression vector. In some embodiments, the expression vector is a plasmid, including a mini plasmid. In some embodiments, the expression vector comprises a sequence to induce integration or recombination of the nucleic acid sequence of the disclosure into a target genomic sequence of a target cell. In some embodiments, the vector comprises a transposable element, that when contacted by a transposase, directs the transfer of the nucleic acid sequence from the vector to a target genomic sequence. In some embodiments, the vector comprises one or more “target homologous” sequences at the 5’ and 3’ ends, respectively, of the nucleic acid sequence for insertion. “Target homologous” sequences contain sufficient homology or identify to a target genomic sequence to induce targeted insertion of the nucleic acid sequence of the disclosure by homologous recombination.

[0024]

[0024] The disclosure provides a vector comprising a nucleic acid of the disclosure. In some embodiments, the vector is a delivery vector. In some embodiments of the disclosure, a delivery vector of the disclosure is an expression vector. In some embodiments of the disclosure, a delivery vector of the disclosure is a viral vector. In some embodiments, the vector comprises a sequence isolated or derived from a lentivirus. In some embodiments of the disclosure, a delivery vector of the disclosure is a non-viral vector. In some embodiments of the disclosure, a delivery vector of the disclosure is capable of maintaining the viability of one or more of nucleic acid, amino acid, folded or complexed proteins, virus(es), or cells and transporting same into an interior space or through a membrane of an intended subject.

[0025]

[0025] The disclosure provides a vector comprising a nucleic acid of the disclosure. In some embodiments, the vector is a viral vector. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is a replication-defective vims. In some embodiments, the vector comprises at least one sequence isolated or derived from a vims. In some embodiments, the vector comprises at least one sequence isolated or derived from a gammaretrovirus, lentivirus, adenovirus, and adeno-associated vims (AAV). In some embodiments, the viral vector is a gammaretroviral vector. In some embodiments, the viral vector is a lentiviral vector. In some embodiments, the viral vector is an adenoviral vector. In some embodiments, the viral vector is an AAV. In some embodiments, the AAV comprises at least one sequence isolated or derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9. In some embodiments, the viral vector is a synthetic, recombinant, or chimeric viral vector, in each case, optionally, a non-naturally occurring viral vector.

[0026]

[0026] The disclosure provides a vector comprising a nucleic acid of the disclosure. In some embodiments, the vector is a non-viral vector. Non-limiting examples of non-viral vectors of the disclosure include, naturally occurring and non-naturally occurring, plasmids (e.g., naked DNA in any primary, secondary, or tertiary shape or form), organic particles, inorganic particles (e.g., gold particles), nanoparticles, lipid-based vectors, micelles, endosomes, exosomes, liposomes, polymer based vectors, polymersomes, peptide based vectors, and cellpenetrating peptides.

[0027] The disclosure provides a cell comprising a composition of the disclosure, a fusion protein of the disclosure, a nucleic acid of the disclosure, or a vector of the disclosure.

[0027]

[0028] In some embodiments of a cell of the disclosure, including a cell comprising a composition of the disclosure, the cell is modified or has been modified to express one or more of (a) an exogenous receptor, (b) a safety switch or (c) an armoring moiety. In some embodiments, the cell expresses an endogenous T-cell receptor (TCR), an endogenous B-cell receptor (BCR), or a major histocompatibility complex (MHC) (class I or class II). In some embodiments, the cell expresses an exogenous receptor. In some embodiments, the cell is modified or has been modified to express an exogenous receptor. In some embodiments, the exogenous receptor comprises a synthetic, recombinant, or chimeric, and in each way, a non- naturally occurring antigen receptor. In some embodiments, the exogenous receptor comprises a chimeric antigen receptor (CAR). In some embodiments, the exogenous receptor comprises an engineered T cell receptor (TCR), optionally, the engineered TCR is a non- naturally occurring TCR.

[0028]

[0029] In some embodiments of a cell of the disclosure, including a cell comprising a composition of the disclosure, the cell is modified or has been modified to express one or more of (a) an exogenous receptor, (b) a safety switch or (c) an armoring moiety. In some embodiments, the safety switch comprises an extracellular sequence. In some embodiments, the safety switch comprises a sequence isolated or derived from EGER. In some embodiments, the safety switch comprises the sequence of SEQ ID NO: 34. In some embodiments, the safety switch comprises the sequence of one or more of SEQ ID NO: 35- 49.

[0029]

[0030] In some embodiments of a cell of the disclosure, including a cell comprising a composition of the disclosure, the cell is modified or has been modified to express one or more of (a) an exogenous receptor, (b) a safety switch or (c) an armoring moiety. In some embodiments, the armoring moiety comprises an exogenous signaling moiety. In some embodiments, the exogenous signaling moiety or the armoring moiety is expressed by the cell. In some embodiments, the exogenous signaling moiety or the armoring moiety is secreted by the cell. In some embodiments, the exogenous signaling moiety or the armoring moiety is tethered to the cell. In some embodiments, the exogenous signaling moiety or the armoring moiety comprises one or more of a cytokine, an interferon, a chemokine, and a de novo polypeptide. In some embodiments, the exogenous signaling moiety or the armoring moiety comprises a naturally occurring cytokine or a modified cytokine. In some embodiments, the naturally occurring cytokine or the modified cytokine comprises a sequence isolated or derived from IL-2, IL-7, IL-12, IL-15, IL-18, IL-21, IL-23 or an interferon. In some embodiments, the interferon comprises a sequence isolated or derived from an alpha-interferon, a beta-interferon, a gamma-interferon or an omega-interferon. In some embodiments, the exogenous signaling moiety or the armoring moiety comprises a non- naturally occurring or a de novo polypeptide. In some embodiments, the non-naturally occurring or de novo polypeptide binds to and / or signals through a naturally occurring receptor. In some embodiments, the naturally occurring receptor comprises a receptor for one or more of IL-2, IL-7, IL-12, IL-15, IL-18, IL-21, IL-23 or an interferon. In some embodiments, the exogenous signaling moiety or the armoring moiety comprises a de novo polypeptide capable of binding to or signaling through IL-2 and IL-15. In some embodiments, the de novo polypeptide (a) is capable of binding to or signaling through IL- 2bg and IL- 15 and (b) not capable of binding to or signaling through IL-Ra. In some embodiments, the de novo polypeptide comprises one or more of (a) the sequence of SEQ ID NO: 50-28 lor (b) a sequence having at least 70% identity to a sequence of (a). In some embodiments, the exogenous signaling moiety or the armoring moiety comprises a targeting moiety. In some embodiments, the targeting moiety selectively or specifically targets a component of a target cell. In some embodiments, the targeting moiety selectively or specifically targets a component of a tumor microenvironment (TME). In some embodiments, the targeting moiety selectively or specifically targets one or more of NKG2D (KLRK1), T cell receptor (TCR) V delta 1 , T cell receptor (TCR) V delta 2, T cell receptor (TCR) V gamma 9 , CD8a, CD8b, CD4, CD28, ICOS, CD94, NKG2A (KLRKC1), CD137 (4-1BB), CD96, PVRIG, PD1, PDL1, PDL2, CTLA4, TIGIT, LAG3, TIM3, BTLA, TRAJ12, TRAJ20, TRAJ33, TRAV1-2, CCR4, CCR8, IL7R, IL21R, Nkp30 (NCR3), NKp44 (NCR2), NKp46 (NCR1). In some embodiments, the targeting moiety selectively or specifically targets CD8. In some embodiments, the targeting moiety selectively or specifically targets CD8 alpha. In some embodiments, the signaling moiety comprises a cytokine and a targeting moiety. In some embodiments, the targeting moiety selectively or specifically targets CD8. In some embodiments, the signaling moiety comprises a de novo polypeptide that binds a cytokine receptor and a targeting moiety. In some embodiments, the targeting moiety selectively or specifically targets CD8. In some embodiments, the targeting moiety selectively or specifically targets CD8 alpha.

[0030]

[0031] In some embodiments of a cell of the disclosure, including a cell comprising a composition of the disclosure, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is isolated or derived from a non-human primate. In some embodiments, the cell is isolated or derived from a human. In some embodiments, the cell is an immune cell or a precursor thereof. In some embodiments, the cell is a component of the innate immune system. In some embodiments, the cell is a component of the adaptive immune system. In some embodiments, the cell is a hematopoietic stem cell (HSC). In some embodiments, the cell is an induced pluripotent stem cell (IPSC). In some embodiments, the cell is a T cell, a B-cell, an NK cell, a macrophage or a hybrid of any one or more of the preceding cells. In some embodiments, the T cell is an alpha beta T cell (cc|3 T cell) or a gamma delta T cell (y8 T cell). In some embodiments, the T cell is a naive T cell, a memory precursor T cell, an effector T cell, a regulatory T cell, a helper T cell, or a differentially or terminally differentiated T cell. In some embodiments, the T cell is a naive T cell (Tn) that expresses CD62L, CCR7, and CD45RA. In some embodiments, the T cell is a T stem cell memory cell (Tscm) that expresses CD62L, CCR7, CD45RA and CD45RO. In some embodiments, the T cell is a T central memory cell (Tcm) that expresses CD62L, CCR7, and CD45RO. In some embodiments, the T cell is a T effector memory cell (Tern) that expresses CD45RO. In some embodiments, the T cell is a T effector cell (Teff) that expresses CD45RA.

[0031]

[0032] In some embodiments of a cell of the disclosure, including a cell comprising a composition of the disclosure, the cell is modified in vitro. In some embodiments, the cell is modified ex vivo. In some embodiments, the cell is modified in vivo.

[0032]

[0033] The disclosure provides a pharmaceutical composition comprising: (a) a composition of the disclosure, a fusion protein of the disclosure, a nucleic acid of the disclosure, a vector of the disclosure or a cell of the disclosure; and (b) a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier is a sterile solution, within a tolerate range of physiological pH, optionally, comprising one or more of a preservative, a viscosity agent, and a buffering agent. Alternatively, or in addition, the pharmaceutically acceptable carrier may comprise a naturally occurring element of a eukaryotic or mammalian cell membrane (including intracellular membrane(s)).

[0033]

[0034] The disclosure provides a use of a composition of the disclosure, a fusion protein of the disclosure, a nucleic acid of the disclosure, a vector of the disclosure or a pharmaceutical composition of the disclosure, for reducing exhaustion in a stimulated cell of the disclosure comprising introducing the composition, fusion protein, nucleic acid, vector or pharmaceutical composition into the cell under conditions sufficient for expression of the composition, the fusion protein, the nucleic acid or the vector. In some embodiments, the introduction is performed in vitro, ex vivo or in vivo. In some embodiments, (a) the cell is an immune cell; and (b) wherein an inducible promoter drives expression of one or more of the composition, fusion protein, and nucleic acid; and optionally, the inducible promoter is capable of being activated by stimulation or following stimulation of the immune cell. In some embodiments, the cell is capable of treating a disease or disorder. In some embodiments, the disease or disorder comprises a proliferative disease. In some embodiments, the disease or disorder comprises cancer. In some embodiments, the disease or disorder comprises an autoimmune disease or disorder. In some embodiments, the disease or disorder comprises an inflammatory disease or disorder.

[0034]

[0035] The disclosure provides a composition of the disclosure, a fusion protein of the disclosure, a nucleic acid of the disclosure, a vector of the disclosure or a cell of the disclosure, or a pharmaceutical composition of the disclosure, for treating a disease or disorder comprising providing the composition, fusion protein, nucleic acid, vector or pharmaceutical composition to a subject in need thereof. In some embodiments, the disease or disorder comprises a proliferative disease. In some embodiments, the disease or disorder comprises cancer. In some embodiments, the disease or disorder comprises an autoimmune disease or disorder. In some embodiments, the disease or disorder comprises an inflammatory disease or disorder.

[0035]

[0036] The disclosure provides a method of preventing exhaustion in a stimulated cell, the method comprising introducing a composition of the disclosure, a fusion protein of the disclosure, a nucleic acid of the disclosure, a vector of the disclosure or a pharmaceutical composition of the disclosure into a cell of the disclosure under conditions sufficient for expression of the composition, the fusion protein, the nucleic acid or the vector. In some embodiments, the introduction is performed in vitro, ex vivo or in vivo. In some embodiments, (a) the cell is an immune cell; and (b) wherein an inducible promoter drives expression of one or more of the composition, fusion protein, and nucleic acid; and optionally, the inducible promoter is capable of being activated by stimulation or following stimulation of the immune cell. In some embodiments, the cell is capable of being antigen- stimulated. In some embodiments, the cell is capable of treating a disease or disorder. In some embodiments, the disease or disorder comprises a proliferative disease. In some embodiments, the disease or disorder comprises cancer. In some embodiments, the disease or disorder comprises an autoimmune disease or disorder. In some embodiments, the disease or disorder comprises an inflammatory disease or disorder.

[0036]

[0037] The disclosure provides a method for treating a disease or disorder, the method comprising administering to a subject in need thereof, a composition of the disclosure, a fusion protein of the disclosure, a nucleic acid of the disclosure, a vector of the disclosure, a cell of the disclosure, or a pharmaceutical composition of the disclosure. In some embodiments, the method comprises administering a therapeutically effective amount of the composition, fusion protein, nucleic acid, vector, cell or pharmaceutical composition. In some embodiments, a route of administration is systemic. In some embodiments, the systemic route of administration comprises an intravenous injection or an intravenous infusion. In some embodiments, a route of administration is local. In some embodiments, the local route of administration comprises an intratumoral injection or an intratumoral infusion. In some embodiments, the disease or disorder comprises a proliferative disease. In some embodiments, the disease or disorder comprises cancer. In some embodiments, the disease or disorder comprises an autoimmune disease or disorder. In some embodiments, the disease or disorder comprises an inflammatory disease or disorder.

[0037]

[0038] Additional embodiments, features, and advantages of the invention will be apparent from the following detailed description and through practice of the invention.

[0038] BRIEF DESCRIPTION OF DRAWINGS

[0039]

[0039] FIG. 1 is a schematic diagram showing an exemplary nucleic acid of the disclosure comprising, within a single vector, a promoter, a chimeric antigen receptor (CAR) and a “regulator” element. As shown in this diagram, an exemplary regulator element comprises a composition of the disclosure comprising at least one DNA-binding domain (DBD) and an oligomerization domain that modulates DNA-binding of transcription factor families.

[0040]

[0040] FIG. 2A is a schematic diagram showing an exemplary tumor killing assay of the disclosure. Briefly, T-cells of the disclosure expressing a chimeric antigen receptor (CAR) are introduced into tumor cells to generate an in vitro coculture. After four passages of the co-culture, tumor killing and cytokine production are measured as shown in the following figures.

[0041]

[0041] FIG. 2B is a graph demonstrating that NR4A-DBD compositions of the disclosure out perform state-of-the-art NR4A knock out cells when compared in a tumor killing assay (as depicted in FIG. 2A). Cells that were mock-transfected as a negative control, transfected with a CAR only, cells modified to knock-out NR4A, cells modified to express an exemplary NR4A-DBD composition of the disclosure, and cells modified to express a second composition were introduced into tumor cells. After four passages, the number of tumor cells present when normalized to the number of target cells present at zero hours (T=0) was plotted against time, expressed in hours. In this study, the effector (E) to target (T) cell ratio was 1 :4. The data show that a greater percentage of target cells were killed when challenged with a cell expressing an NR4A-DBD composition of the disclosure when compared to a cell lacking NR4A as a result of a knockout deletion.

[0042]

[0042] FIG. 2C is a pair of graphs demonstrating that in the assay depicted in FIG 2A and corresponding to the tumor cell killing data of FIG. 2B, cells expressing an NR4A-DBD composition of the disclosure secrete more IFN gamma (left) and IL-2 (right), both markers of T- cell activation, when compared to a cell lacking NR4A as a result of a knockout deletion.

[0043]

[0043] FIG. 2D is a graph showing a replicate of the experiment described in FIG. 2B with T-cells isolated from a second donor.

[0044]

[0044] FIG. 2E is a graph showing a replicate of the experiment described in FIG. 2C with T-cells isolated from a second donor.

[0045]

[0045] FIG. 3A is a schematic diagram and plot showing that exemplary NR4A-DBD constructs of the disclosure are properly expressed in T-cells. Moreover, the plot demonstrates that there is no difference in expressed between preferred constructs (e.g., trimer-AlDBD) versus other exemplary constructs (e.g., AlDBD-trimer). The data presented here were generated using the “reset killing assay” depicted in FIG. 2A with the results presented as an average value of experiments using T-cells from three distinct donors.

[0046]

[0046] FIG. 3B is a plot demonstrating that various exemplary NR4A-DBD constructs of the disclosure function in T cells to effect tumor cell killing, and, moreover, the impact of order of the oligomerization domain and NR4A DBD within each construct. In preferred embodiments, constructs of the disclosure position the oligomerization domain (e.g. “trimer”) to the N-terminus of the NR4A-DBD. The data presented here were generated using the “reset killing assay” depicted in FIG. 2A with the results presented as an average value of experiments using T-cells from three distinct donors. Abbreviations used in FIGs. 3A-3C: “FLAG-AlDBD-trimerl” comprises the sequence of SEQ ID NO: 300; “AlDBD-trimerl” comprises the sequence of SEQ ID NO: 9; “AlDBD-trimerl_V13” comprises the sequence of SEQ ID NO: 293; “AlDBD-trimerl_v5” comprises the sequence of SEQ ID NO: 294;

[0047] “ AlDBD-trimer 1_V16” comprises the sequence of SEQ ID NO: 295; “trimerl-AlDBD” comprises the sequence of SEQ ID NO: 292; “AlDBD-trimerl (codon opt)” comprises a DNA codon optimized nucleotide sequence of the amino acid sequence of SEQ ID NO: 9; “A1DBD- A1DBD” comprises the sequence of SEQ ID NO: 15 (two copies of the NR4A1 DBD connected by a flexible linker); “AlDBD-trimer2” comprises the sequence of SEQ ID NO: 296; “AlDBD-trimer2_vl2” comprises the sequence of SEQ ID NO: 297; “A1DBD- trimer2_v0” comprises the sequence of SEQ ID NO: 298; “AlDBD-trimer2_vl 1” comprises the sequence of SEQ ID NO: 299; “trimer 1 only” comprises the sequence of SEQ ID NO: 7; “CAR-T only” comprises an anti-RORl CAR without an NR4A-DBD construct of the disclosure, and “mock” is a negative control generated by performing the transduction with an empty lentiviral vector.

[0048]

[0047] FIG. 3C is a pair of plots demonstrating that T-cells expressing one of various exemplary oligo-NR4A-DBD constructs of the disclosure activate in the presence of antigen and express cytokines interferon-gamma (IFN-gamma) and interleukin-2 (IL-2). In preferred embodiments, constructs of the disclosure position the oligomerization domain (e.g. “trimer”) to the N-terminus of the NR4A-DBD. The data presented here were generated using the “reset killing assay” depicted in FIG. 2A with the results presented as an average value of experiments using T-cells from three distinct donors.

[0049]

[0048] FIG. 4A is a series of graphs depicting tumor cell killing (see assay described in FIG. 2A) as a function of time (measured in hours). Abbreviations used in FIGs. 4A-B: “Mock” is a negative control generated by performing the transduction with an empty lentiviral vector; “B2M KO Control” describes a T-cell in which sequences encoding the Beta-2- Microglobulin (B2M) protein has been deleted using a gene knock-out strategy; “NR4A3 KO Control” describes a T-cell in which sequences encoding the NR4A3 protein has been deleted using a gene knock-out strategy; “Trimer only control” describes a T-cell expressing the sequence of SEQ ID NO: 7; “Trimer-NR4A-DBD” describes a T-cell expressing the sequence of SEQ ID NO: 292.

[0050]

[0049] FIG. 4B is a series of graphs depicting the cytokine production (see assay described in FIG. 2A) as a function of oligo-NR4A-DBD construct at either the first stimulation (Stiml) or the final stimulation (Stim 4). Data shown in this figure are separated into distinct plots for each cytokine (IFN-gamma and IL-2) and for each of three distinct T-cell donors. The data demonstrate that a preferred embodiment of the oligo-NR4A-DBD constructs of the disclosure, “trimer-NR4A-DBD” (also described as SEQ ID NO: 292), performs best in this assay.

[0051]

[0050] FIG. 5A is a plot depicting the efficacy of tumor killing of CAR-T cells expressing one of various exemplary oligo-NR4A-DBD constructs of the disclosure. In this study the CAR and the oligo-NR4A-DBD components are encoded on a single lentiviral vector that is transduced into the T cells. Tumor cell count (H1975 cells labeled with a fluorescent marker; normalized to time “0”) are shown for each condition as a function of time (measured in hours). Abbreviations used in FIGs. 5A-B: “Mock” is a negative control generated by performing the transduction with an empty lentiviral vector; “Constitutive CAR only” describes a T-cell expressing an anti-RORl CAR under the control of a constitutive promoter (MND) in the absence of an oligo-NR4A-DBD construct of the disclosure; “Inducible CAR only” describes a T-cell expressing an anti-RORl CAR under the control of a inducible promoter in the absence of an oligo-NR4A-DBD construct of the disclosure; “Constitutive CAR + NR4A3 KO” describes a T-cell expressing an anti-RORl CAR under the control of a constitutive promoter (MND), in which sequences encoding the NR4A3 protein has been deleted using a gene knock-out strategy; “Constitutive CAR + trimer-NR4A-DBD” describes a T-cell expressing an anti-RORl CAR under the control of a constitutive promoter (MND) and an exemplary oligo-NR4A-DBD of the disclosure that is also under the control of the same MND promoter (and in this study the CAR and trimer-NR4A-DBD construct comprise the sequence of SEQ ID NO: 302; the trimer-NR4A-DBD component comprises the sequence of SEQ ID NO: 292); “Inducible CAR + trimer-NR4A-DBD” describes a T-cell expressing an anti-RORl CAR under the control of a inducible promoter and an exemplary oligo-NR4A- DBD of the disclosure that is also under the control of the same inducible promoter (and in this study the construct comprises the sequence of SEQ ID NO: 302; the trimer-NR4A-DBD component comprises the sequence of SEQ ID NO: 292). For constructs throughout this disclosure, the “inducible promoter” may comprise any inducible promoter. In the data presented in this disclosure, the inducible promoter comprises the sequence of GGGGACTTTCCGCTGGGGACTTTCCGCTGGGGACTTTCCGCTGGGGACTTTCCGC TGGGGACTTTCCGCTGGGGACTTTCCGCTGGGGACTTTCCGCTGGGGACTTTCCG CTGGGGACTTTCCGCTGGGGACTTTCCGCTAACGAGAGGGTATATAATGGAAGCTC GAATTCCAGACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCTAGCGCCGCC ACC (SEQ ID NO: 308).

[0052]

[0051] FIG. 5B is a pair of plots depicting the cytokine production (either IFN-gamma or IL- 2, measured in picograms per milliliter) from the assay described in FIG. 5 A. Taken together, the tumor killing data in FIG. 5A and the cytokine production data shown in this FIG. 5B, demonstrate that a preferred embodiment, “trimer-NR4A-DBD” has greater efficacy than the NR4A knockout and, furthermore, that the combination of “trimer-NR4A-DBD” with an inducible promoter provides a superior and supra-additive synergy, when compared to a combination using the constitutive (MND) promoter.

[0053]

[0052] FIG. 6 is a series of plots showing that the incorporation into a single vector of an exemplary CAR and a preferred construct of the disclosure (“trimer”, also known as trimer- NR4A-DBD and comprising the sequence of SEQ ID NO: 292) reduces T-cell exhaustion (measured as frequency of expression of either PD-1 (PD-1+) or TIGIT (TIGIT+) in CD4- expressing (CD4+ ) cells or CD8-expressing (CD8+) cells. When compared to controls, the “trimer” condition shows superior persistence, expressed as decreased exhaustion. When combined with an inducible promoter, a significant decrease in the frequency of exhaustion markers demonstrates a synergic relationship of the promoter and “trimer” components.

[0054]

[0053] FIG. 7 is a schematic diagram providing a structural comparison of various exemplary oligo-NR4A-DBD constructs of the disclosure. With respect to the top diagram, “MND” is an exemplary constitutive promoter, “R0R1 CAR” describes an exemplary anti- R0R1 CAR used in this study, “NR4A1-DBD” describes exemplary oligo-NR4A-DBD constructs of the disclosure, and “EGFRopf ’ describes an EGFR-derived cell marker (see Table 3). As shown in this figure, the “short variant” comprises a sequence encoding a homotrimer combined with an NR4A1-DBD. The “short variant” may have a sequence comprising one or more of SEQ ID Nos: 1 and 304). As shown in this figure, the “long variant” comprises a sequence encoding a homotrimer combined with an NR4A1-DBD tLBD. The term tLBD describes a truncated ligand binding domain (tLBD) having an extended sequence beyond the C-terminus of the DBD. In “tLBD” constructs, the extended sequence may not be a linker. The “long variant” may have a sequence comprising one or more of SEQ ID Nos: 9, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 305, and 307). As shown in this figure, the “variant of trimer” comprises a sequence encoding a homotrimer combined with an NR4A1-DBD tLBD, wherein the homotrimer contains one or more mutations. The “variant of trimer” construct may have a sequence comprising one or more of SEQ ID Nos: 282, 283, 284, 285, 286, 287, and 288. As shown in this figure, the “mutated DBD” comprises a sequence encoding a homotrimer combined with an NR4 AIDED tLBD, wherein the NR4A-DBD contains one or more mutations. The “mutated DBD” or “mutant” construct may have a sequence comprising one or more of SEQ ID Nos: 290 or 303. As shown in this figure, the “FLAG-tagged long variant” comprises a sequence encoding a homotrimer combined with an NR4A1-DBD, wherein the construct further comprises a FLAG tag. The “FLAG-tagged long variant” construct may have a sequence comprising SEQ ID NO: 300.

[0055]

[0054] FIG. 8A is a pair of graphs depicting cytokine production (either IFN-gamma or IL-2) from stimulated T-cells that express one of various exemplary constructs of the disclosure. The data presented in FIGs. 8A-D are an average of experiments performed with T-cells from three distinct donors, using the reset assay described in FIG. 2A, following day 7 of co- culture with the H1975 cells. As used in FIGs.8A-D, the term “mock” describes a negative control generated by performing the transduction with an empty lentiviral vector; “B2M KO Control” describes a T-cell in which sequences encoding the Beta-2 -Microglobulin (B2M) protein has been deleted using a gene knock-out strategy; “NR4A3 KO Control” describes a T-cell in which sequences encoding the NR4A3 protein has been deleted using a gene knockout strategy; “CAR only” describes a T-cell a T-cell expressing an anti-RORl CAR under the control of a constitutive promoter (MND) in the absence of an oligo-NR4A-DBD construct of the disclosure; “CAR-NR4AlDBDtLBD (Tagged) describes a T cell expressing the anti- RORl CAR and a long NR4A1-DBD of the disclosure, the entire construct including a FLAG tag (SEQ ID NO: 300); the “CAR-trimer- NR4AlDBDtLBD” describes a T cell expressing the anti-RORl CAR and a trimer - long NR4A1-DBD of the disclosure (see for example, SEQ ID NO: 292); the “CAR-trimer- NR4A1DBD (short variant)” describes a T cell expressing the anti-RORl CAR and a trimer - short NR4A1-DBD of the disclosure (see for example, SEQ ID NO: 304); the “CAR-trimer- NR4A1DBD (long variant)” describes a T cell expressing the anti-RORl CAR and a trimer - long NR4A1-DBD of the disclosure (see for example, SEQ ID NO: 305); and the “CAR-trimer- NR4A1DBD (mutated)” describes a T cell expressing the anti-RORl CAR and a trimer - mutated NR4A1-DBD of the disclosure (see for example, SEQ ID NO: 303).

[0056]

[0055] FIGs. 8B-8D is a series of graphs depicting tumor cell killing using T-cells that express one of various exemplary constructs of the disclosure. Taken together, the data shown in FIGs. 8A-D demonstrate that, with respect to a short variant, the long variant is preferred, although both variants are efficacious. Moreover, the mutated variant demonstrates that decreasing DNA binding activity, significantly reduces the ability of the construct to mediate cytokine production or tumor cell killing in this assay.

[0057] DETAILED DESCRIPTION

[0058]

[0056] T cells, a type of lymphocyte, play a central role in the adaptive immune response. One of the functions of T cells is immune-mediated cell death -CD8+ T cells, also known as killer T cells, are themselves cytotoxic, and also recruit other cell types to kill cancer cells and virus-infected host cells. CD4+ T cells, also known as helper T cells, further activate memory B cells and killer T cells through cytokines to enhance the immune response.

[0059] Regulatory T cells, also known as suppressor T cells, allow immune cells to recognize invading cells from “self,” thus preventing an autoimmune response.

[0057] Over time, T cells undergo a physiological change called exhaustion, characterized by progressive loss of function and changes in transcriptional profiles. T cell exhaustion is mediated by a cascade of signaling molecules culminating in transcription factors that regulate the expression of genes that modulate T cell exhaustion. Exhausted T cells lose their high proliferative capacity and cytotoxicity, eventually leading to cell death. Numerous factors can lead to T cell exhaustion, such as persistent antigen exposure during infection, and constant alloantigen presence following organ transplantation. In addition, some tumors and cancer-associated cells can actively induce T cell exhaustion at the site of the tumor, thus conferring tumor protection from T cell activity. T cell exhaustion is also seen in the context of engineered T cell therapies. Engineered T cells expressing a chimeric antigen receptor (CAR) or T cell receptor (TCR) can undergo exhaustion in the same way that endogenous T cells undergo exhaustion.

[0060] Modulation of DNA Binding Activities

[0061]

[0058] Compositions of the disclosure may be used to reprogram cell signaling pathways to autonomously respond to changes in cell state or signaling at the tumor microenvironment to achieve a more durable response. More specifically, compositions of the disclosure regulate the DNA binding activities of intracellular proteins, including transcription factors, within the context of antigen-stimulation to overcome dysfunction. CAR-T cells exhaust from chronic stimulation, which is a form of dysfunction addressed by the compositions of the disclosure. For example, by modulating the ability of pro-exhaustion transcription factors to bind DNA, compositions of the disclosure can inhibit cell exhaustion and promote persistence in a nuanced manner, responsive to changing cellular conditions.

[0062] Nuclear Receptor Subfamily 4 A (NR4A)

[0063]

[0059] Provided herein are Nuclear Receptor Subfamily 4A (NR4A) -binding polypeptides, useful, for example, for reducing or preventing T cell exhaustion. The NR4A subfamily is a family of nuclear receptors that act as transcription factors in a ligand-independent manner. There are three known family members: NR4A1, NR4A2, and NR4A3. Sequence information for the family members of the NR4A subfamily are provided in Table 1.

[0064]

[0060] Like other nuclear receptors, they are composed of a central two-zinc DNA-binding domain, a N-terminal transactivation domain, and a C-terminal ligand-binding domain. The ligand-binding domain lacks a classical hydrophobic binding pocket, thus accounting for the NR4A family’s ligand-independent mechanism of action. NR4As are considered immediate- early genes, as their function is controlled by their rapid and transient expression induced by a variety of extracellular signals. NR4As are involved in apoptosis, survival, proliferation, angiogenesis, inflammation, DNA repair, and fatty acid metabolism. NR4As have also been implicated in T cell exhaustion.

[0065]

[0061] Table 1

[0066] DNA Binding Domain Compositions

[0067]

[0062] Provided herein are exemplary compositions comprising a DNA Binding Domain

[0068] (DBD) and an oligomerization domain.

[0069]

[0063] Table 2

[0070]

[0064] Exemplary linkers are shown in Table 4 below.

[0071]

[0065] Table 4

[0066] The disclosure provides cells that express compositions of the disclosure. In some embodiments, cells of the disclosure express or are capable of expressing a safety switch of the disclosure.

[0072]

[0067] In some embodiments, the safety switch may be used as cell marker during, for example, in vitro or ex vivo assays or during manufacturing of a cellular therapy. Exemplary safety switch polypeptides may be derived from a sequence encoding EGER. In some embodiments, the safety switch polypeptide may comprise or consist of a truncated EGER, including, but not limited to, “EGFRt” as described by SEQ ID NO: 34 below and as described in greater detail at least at PCT Publication Nos. WO 2011 / 056894, WO 2022 / 177677 and WO 2022 / 178040 (the contents of each of which are incorporated by reference herein in their entirety). In some embodiments, the safety switch polypeptide may comprise or consist of a truncated EGER, including, but not limited to, “EGFRopf ’ as described by SEQ ID NOs: 35-49 below and as described in greater detail at least at PCT Publication No. WO 2021 / 189008.

[0073]

[0068] In some embodiments, a cell of the disclosure expresses a safety switch constitutively.

[0074]

[0069] In some embodiments, including those in which the safety switch may also be a cell marker, the safety switch may be expressed conditionally by the use of an inducible promoter.

[0075]

[0070] Table 3

[0076] Protein Variants

[0077]

[0074] As used herein, the term “functional variant” refers to a modified form of a polypeptide, fragment, or a member of a class of polypeptides, which maintains the function of the polypeptides. In some embodiments, a functional variant of the disclosure retains a function of the polypeptides even if the activity of the functional variant or the efficacy of the functional variant is modified when compared to the unmodified polypeptides. In some embodiments, a functional variant of the disclosure retains a function of the polypeptides even if the activity of the functional variant or the efficacy of the functional variant is decreased when compared to the unmodified polypeptides.

[0078]

[0075] As used herein, a “fragment” of a polypeptides, or a “truncated polypeptide” may refer to an amino acid sequence of a polypeptides that is shorter than a reference sequence. In some embodiments, the reference sequence comprises or consists of a naturally-occurring sequence. In comparison to a reference sequence, the fragment may comprise an N-terminal or a C-terminal deletion (optionally referred to as a truncation). Alternatively, or in addition, in comparison to a reference sequence, the fragment may comprise an internal deletion at any one or more amino acid positions of the polypeptides. Polypeptides of the disclosure may be provided as a fragment or a truncated version of a reference polypeptides. Moreover, all possible fragments and truncated variants of the polypeptides of the disclosure are contemplated in the embodiments provided in this disclosure.

[0076] As used herein, the term “functional fragment” refers to a polypeptides fragment that retains a function of the polypeptides. Accordingly, in some embodiments, a functional fragment of a bioactive peptide, such as an enzyme, retains the ability to catalyze a biological action, because the functional fragment comprises a catalytic domain of the enzyme. Polypeptides of the disclosure may be provided as a fragment or a truncated version of a reference polypeptides. Moreover, all possible fragments and truncated variants of the polypeptides of the disclosure are contemplated in the embodiments provided in this disclosure. In some embodiments, a functional fragment of the disclosure retains a function of the polypeptides even if the activity of the functional fragment or the efficacy of the functional fragment is modified when compared to the full-length polypeptides. In some embodiments, a functional fragment of the disclosure retains a function of the polypeptides even if the activity of the functional fragment or the efficacy of the functional fragment is decreased when compared to the full-length polypeptides.

[0079] Armoring Moieties

[0080]

[0077] In some embodiments of a cell of the disclosure, including a cell comprising a composition of the disclosure, the cell is modified or has been modified to express one or more of (a) an exogenous receptor, (b) a safety switch or (c) an armoring moiety. In some embodiments, the armoring moiety comprises an exogenous signaling moiety. In some embodiments, the exogenous signaling moiety or the armoring moiety is expressed by the cell. In some embodiments, the exogenous signaling moiety or the armoring moiety is secreted by the cell. In some embodiments, the exogenous signaling moiety or the armoring moiety is tethered to the cell. In some embodiments, the exogenous signaling moiety or the armoring moiety comprises one or more of a cytokine, an interferon, a chemokine, and a de novo polypeptide. In some embodiments, the exogenous signaling moiety or the armoring moiety comprises a naturally occurring cytokine or a modified cytokine. In some embodiments, the naturally occurring cytokine or the modified cytokine comprises a sequence isolated or derived from IL-2, IL-7, IL-12, IL-15, IL-18, IL-21, IL-23 or an interferon. In some embodiments, the interferon comprises a sequence isolated or derived from an alpha-interferon, a beta-interferon, a gamma-interferon or an omega-interferon. In some embodiments, the exogenous signaling moiety or the armoring moiety comprises a non- naturally occurring or a de novo polypeptide. In some embodiments, the non-naturally occurring or de novo polypeptide binds to and / or signals through a naturally occurring receptor. In some embodiments, the naturally occurring receptor comprises a receptor for one or more of IL-2, IL-7, IL-12, IL-15, IL-18, IL-21, IL-23 or an interferon. In some embodiments, the exogenous signaling moiety or the armoring moiety comprises a de novo polypeptide capable of binding to or signaling through IL-2 and IL-15. In some embodiments, the de novo polypeptide (a) is capable of binding to or signaling through IL- 2bg and IL- 15 and (b) not capable of binding to or signaling through IL-Ra. In some embodiments, the de novo polypeptide comprises one or more of (a) the sequence of SEQ ID NO: 50-28 lor (b) a sequence having at least 70% identity to a sequence of (a). In some embodiments, the exogenous signaling moiety or the armoring moiety comprises a targeting moiety. In some embodiments, the targeting moiety selectively or specifically targets a component of a target cell. In some embodiments, the targeting moiety selectively or specifically targets a component of a tumor microenvironment (TME). In some embodiments, the targeting moiety selectively or specifically targets one or more of NKG2D (KLRK1), T cell receptor (TCR) V delta 1 , T cell receptor (TCR) V delta 2, T cell receptor (TCR) V gamma 9 , CD8a, CD8b, CD4, CD28, ICOS, CD94, NKG2A (KLRKC1), CD137 (4-1BB), CD96, PVRIG, PD1, PDL1, PDL2, CTLA4, TIGIT, LAG3, TIM3, BTLA, TRAJ12, TRAJ20, TRAJ33, TRAV1-2, CCR4, CCR8, IL7R, IL21R, Nkp30 (NCR3), NKp44 (NCR2), NKp46 (NCR1). In some embodiments, the targeting moiety selectively or specifically targets CD8. In some embodiments, the targeting moiety selectively or specifically targets CD8 alpha. In some embodiments, the signaling moiety comprises a cytokine and a targeting moiety. In some embodiments, the targeting moiety selectively or specifically targets CD8. In some embodiments, the signaling moiety comprises a de novo polypeptide that binds a cytokine receptor and a targeting moiety. In some embodiments, the targeting moiety selectively or specifically targets CD8. In some embodiments, the targeting moiety selectively or specifically targets CD8 alpha.

[0081]

[0078] Cells of the disclosure may be modified to express a cytokine, including but not limited to a de novo polypeptide (also referred to herein as a “designed cytokine” of the disclosure). Exemplary designed cytokines of the disclosure comprise one or more of sequences of SEQ ID Nos: 50-281 or a sequence having at least 70% identity to a sequence of SEQ ID NO: 50-281. Exemplary designed cytokines of the disclosure include, but are not limited to those designed cytokines disclosed in PCT Publication No. WO 2023 / 137346, the contents of which are incorporated herein by reference in their entirety.

[0082] Pharmaceutical Compositions

[0083]

[0079] Also provided herein are pharmaceutical compositions. The pharmaceutical compositions of the disclosure may comprise any one or more of the peptides, nucleotides, cells, and vectors of the disclosure.

[0084]

[0080] In exemplary embodiments, the pharmaceutical compositions comprise a composition of the disclosure, a nucleic acid of the disclosure, a vector of the disclosure, or a cell expressing of the disclosure.

[0085]

[0081] In some embodiments, expression vectors of the disclosure may be expressed in host cells. Host cells may, for example, be prokaryotic cells, such as bacteria cells; or eukaryotic cells, such as yeast cells, plant cells, or mammalian cells. Examples of mammalian cells suitable for use with the disclosure include human, mouse, rat, pig, rabbit, sheep, and goat cells. In some cases, the cells are synthetic cells.

[0086]

[0082] A host cell may, for example, be selected from the group consisting of cardiac cell, lung cell, muscle cell, epithelial cell, pancreatic cell, skin cell, CNS cell, neuron, myocyte, skeletal muscle cell, smooth muscle cell, liver cell, kidney cell and glial cell.

[0087]

[0083] In some embodiments, the host cell is an immune cell. In some embodiments, the host cell is a white blood cell. In some embodiments, the host cell is a lymphocyte. In some embodiments, the host cell is a T cell. In some embodiments, the host cell is a CD8+ T cell. In some embodiments, the host cell is CD4+ T cell. In some embodiments, the host cell is a regulatory T cell.

[0088]

[0084] In some embodiments, a host cell is a human cell ex vivo. In some embodiments, a host cell is a human cell in vivo.

[0089]

[0085] In some embodiments, the host cell is modified to express an exogenous receptor. In some embodiments, the host cell is modified to express a chimeric antigen receptor (CAR). In some embodiments, the host cell is modified to express an engineered T cell receptor (TCR).

[0090] Methods of Use

[0091]

[0086] The polypeptides of the disclosure can be used to specifically bind NR4A isoforms, that facilitate certain physiological processes. One such process can be T cell exhaustion. Thus, the polypeptides of the disclosure can be used to specifically bind transcription factors such as NR4A and its isoforms in order to reduce T cell exhaustion.

[0092]

[0087] By targeting pro-exhaustion transcription factors such as NR4A and its isoforms, the polypeptides of the disclosure can be used to reduce exhaustion in immune cells, for example T cells. By reducing exhaustion in T cells, the polypeptides of the disclosure can be used to treat diseases or disorders. Accordingly, in some embodiments provided herein is a method comprising the use of the polypeptides of the disclosure to reduce exhaustion in an immune cell comprising expressing the polypeptides during periods of stimulation of a TCR or CAR expressed by the immune cell.

[0093]

[0088] In some embodiments, provided herein is a method comprising the use of the nucleotides of the disclosure to reduce exhaustion in an immune cell comprising expressing the polypeptides during periods of stimulation of a TCR or CAR expressed by the immune cell. In some embodiments, the nucleotides comprise a regulatory sequence. In some embodiments, the regulatory sequence is a promoter, optionally an inducible promoter.

[0089] In some embodiments, provided herein is a method comprising the use of the vectors of the disclosure to reduce exhaustion in an immune cell comprising expressing the polypeptides during periods of stimulation of a TCR or CAR expressed by the immune cell. In some embodiments, the vector is an expression vector. In some embodiments, the vector is a delivery vector. In some embodiments, the vector is a viral vector. In some embodiments, the vector is a non-viral vector.

[0094]

[0090] In some embodiments, provided herein is a method comprising the use of the cells of the disclosure to reduce exhaustion in an immune cell comprising expressing the polypeptides during periods of stimulation of a TCR or CAR expressed by the immune cell. In some embodiments, the cell is modified to express an exogenous receptor. In some embodiments, the exogenous receptor comprises a chimeric antigen receptor (CAR). In some embodiments, the exogenous receptor comprises an engineered T cell receptor (TCR). In some embodiments, the cell is an immune cell. In some embodiments, the cell is a T cell. In some embodiments, the cell is a NK cell.

[0095]

[0091] In some embodiments, provided herein is a method comprising the use of the compositions of the disclosure to reduce exhaustion in an immune cell comprising expressing the polypeptides during periods of stimulation of a TCR or CAR expressed by the immune cell. In some embodiments, the composition comprises the polypeptides of the disclosure. In some embodiments, the composition comprises the nucleotides of the disclosure. In some embodiments, the composition comprises the vectors of the disclosure. In some embodiments, the composition comprises the cells of the disclosure.

[0096]

[0092] In some embodiments, provided herein is a method comprising the use of the pharmaceutical compositions of the disclosure to reduce exhaustion in an immune cell comprising expressing the polypeptides during periods of stimulation of a TCR or CAR expressed by the immune cell. In some embodiments, the pharmaceutical composition comprises the polypeptides of the disclosure. In some embodiments, the pharmaceutical composition comprises the nucleotides of the disclosure. In some embodiments, the pharmaceutical composition comprises the vectors of the disclosure. In some embodiments, the pharmaceutical composition comprises the cells of the disclosure.

[0097]

[0093] While embodiments of the present invention have been shown and described herein, those skilled in the art will understand that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

CLAIMS1. A composition comprising:(a) at least one DNA binding domain (DBD), wherein the DBD comprises a sequence isolated or derived from one or more of NR4A1, NR4A2, and NR4A3; and(b) an oligomerization domain.

2. The composition of claim 1, wherein the oligomerization domain is positioned at the N-terminus of the DBD.

3. The composition of claim 1, wherein the oligomerization domain is positioned at the C-terminus of the DBD.

4. The composition of any one of claims 1-3, wherein the at least one DBD comprises a sequence isolated or derived from NR4A1.

5. The composition of claim 4, wherein the at least one DBD comprises a sequence having at least 70% identity to the sequence of any one or more of SEQ ID NO: 1, 2, 289, and 290.

6. The composition of any one of claims 1-3, wherein the at least one DBD comprises a sequence isolated or derived from NR4A2.

7. The composition of claim 6, wherein the at least one DBD comprises a sequence having at least 70% identity to the sequence of SEQ ID NO: 3.

8. The composition of claim 1, wherein the at least one DBD comprises a sequence isolated or derived from NR4A3.

9. The composition of claim 8, wherein the at least one DBD comprises a sequence having at least 70% identity to the sequence of SEQ ID NO: 4.

10. The composition of any one of claims 1-9, wherein the composition comprisesa first DBD, comprising a sequence isolated or derived from a first target, wherein the first target comprises one or more of NR4A1, NR4A2, and NR4A3; and a second DBD, comprising (1) a sequence isolated or derived from one or more of NR4A1, NR4A2, and NR4A3, or (2) a sequence isolated or derived from a second target.

11. The composition of claim 10, wherein the second DBD is identical to the first DBD.

12. The composition of claim 10, wherein the second DBD is not identical to the first DBD.

13. The composition of claim 10 or 12, wherein the second target comprises RXRa or wherein the second DBD comprises an RXRa-DBD.

14. The composition of claim 13, wherein the second DBD comprises a sequence having at least 70% identity to SEQ ID NO: 5.

15. The composition of any one of claims 1-14, wherein the oligomerization domain comprises a de novo designed protein.

16. The composition of any one of claims 1-15, where the oligomerization domain comprises a dimer, a trimer, a tetramer, a pentamer, a hexamer, a heptamer.

17. The composition of any one of claims 1-16, where the oligomerization domain comprises a homodimer, a homotrimer, a homotetramer, a homopentamer, a homohexamer, a homoheptamer.

18. The composition of any one of claims 1-16, wherein the oligomerization domain comprises a homotrimer.

19. The composition of claim 18, wherein the oligomerization domain comprises a sequence having at least 70% identity to the sequence of any one or more of SEQ ID NO: 7, 282, 283, 284, 285, 286, 287, and 288.

20. The composition of claim 18, wherein the oligomerization domain comprises a sequence having at least 70% identity to the sequence of SEQ ID NO: 7.

21. The composition of claim 18, wherein the oligomerization domain comprises a sequence having at least 70% identity to the sequence of SEQ ID NO: 282.

22. The composition of claim 18, wherein the oligomerization domain comprises a sequence having at least 70% identity to the sequence of SEQ ID NO: 285.

23. The composition of any one of claims 1-16, where the oligomerization domain comprises a heterodimer, a heterotrimer, a heterotetramer, a heteropentamer, a heterohexamer, a heteroheptamer.

24. The composition of any one of claims 1-23, further comprising at least one linker, wherein the linker operably links the at least one DBD and the oligomerization domain.

25. The composition of any one of claims 10-24, further comprising(a) a first linker, wherein the first linker operably links the first DBD and the second DBD; and(b) a second linker, wherein the second linker operably links a DBD of (a) and the oligomerization domain.

26. The composition of claim 24 or 25, wherein linker comprises one or more of an amino acid, a nucleic acid, a synthetic or non-naturally occurring amino acid, a synthetic or non- naturally occurring nucleotide, and a combination thereof.

27. The composition any one of claims 24-26, wherein linker comprises an amino acid or a synthetic or non-naturally occurring amino acid.

28. The composition any one of claims 24-27, wherein the linker or a sequence thereof is flexible.

29. The composition any one of claims 24-28, wherein the linker or a sequence thereof comprises Glycine (G) and Serine (S).

30. The composition of claim 29, wherein the linker comprises a sequence of SEQ ID NO: 30-33.

31. The composition any one of claims 1-30, further comprising a cleavage site.

32. The composition of claim 31, wherein the cleavage site is a self-cleaving peptide.

33. The composition any one of claims 1-32, further comprising a nuclear localization sequence (NLS).

34. The composition of claim 33, wherein the NLS comprises a sequence isolated or derived from one or more of an NR4A1 sequence, an NR4A2, an NR4A3 sequence and an RXRa sequence.

35. The composition any one of claims 1-34, further comprising a functional domain.

36. The composition of claim 35, wherein the functional domain comprises one or more of a degradation domain, a kinase, a phosphatase, and an epigenetic modifier.

37. The composition of claim 36, wherein the functional domain comprises a degradation domain.

38. The composition of claim 36 or 37, wherein the degradation domain comprises a sequence isolated or derived from a degron, a ligase, an E3 ligase, a ligase-binding domain, or a cullin- binding domain.

39. The composition of claim 36 or 37, wherein the degradation domain comprises a sequence isolated or derived from(a) LNX1, RNF4, RNF43, RNF128, ZNRF3, MARCHS, LRG1, NEDD4, SOCS2, CHIP, SPOP, FBXW7, FBXW1A, FBXL12, EEOC, TRAF6, VHL or any functional fragment thereof; or(b) LNX1, RNF4, RNF43 or any functional fragment thereof; or(c) LNX1 or any functional fragment thereof; or(d) RNF4 or any functional fragment thereof; or(e) RNF43 or any functional fragment thereof; or(f) FBXL12 or any functional fragment thereof.

40. The composition of claim 38, wherein the degradation domain comprises a sequence isolated or derived from a cullin binding domain.

41. The composition of claim 40, wherein the cullin-binding domain comprises a sequence isolated or derived from one or more of ski, elonginB / C, BTB, and DDB1.

42. The composition of claim 35, wherein the functional domain comprises a sequence isolated or derived from one or more of ABTB1, ASB1, ASB6, CHIP, CISH, CRBN, DCAPI 5, DDB2, EID1, EEOC, FBW1A, FBXL12, FBXL14,, FBXL15, FBXL2, FBX024, FBX03, FBXO40, FBX06, FBXW5, FBXW7, FCGR3B, GABARAP, GABARAPL2, GAN, GET4, GID8, GMCL1, HDAC1, ISG15, KBTBD7, KLHDC2, KLHL11, KLHL12, KLHL23, KLHL40, KLHL6, LAPTM5, LDOC1, LNX1, LY6D, LYPD3, MAGEA2B, MAP1LC3A, MTCH1, MYLIP, NDFIP2, NEDD4, NHLRC1, OTUB1, PCGF3, PIAS3, PIAS4 (gamma), PJA1, PPAR gamma, PRR20A, RAB40AL, RNF115, RNF125, RNF126, RNF130, RNF138, RNF144A, RNF144B, RNF150, RNF166, RNF181, RNF182, RNF183, RNF185, RNF24, RNF4, RNF41, RNF43, RNF8, RTL8C, SKP2, SOCS1, SOCS2, SOCS3, SOCS5, SPOP, SPSB2, SPSB4, SQSTM1, TEX19, TRAF2, TRAF6, Triml3, TRIM31, TRIM39, TRIM49, TRIMS, UBC9, UBE2A, UBE2B, UBE2D1, UBE2D4, UCHL1, VHL, and ZER1.

43. The composition of any one of claims 1-22 or 24-42, wherein the composition comprises a sequence of one or more of SEQ ID Nos: 1-19 and 282-307.

44. The composition of any one of claims 1-22 or 24-42, wherein the composition comprises a sequence of SEQ ID NO: 7, 282-290, or 302-305.

45. A fusion protein comprising a composition of any one of claims 1-44.

46. A nucleic acid encoding a composition of any one of claims 1-44 or the fusion protein of claim 45.

47. The nucleotide of claim 46, comprising a regulatory sequence.

48. The nucleic acid of claim 47, wherein the regulatory sequence comprises a promoter, optionally, wherein the promoter is a constitutive promoter or an inducible promoter.

49. The nucleic acid of claim 48, wherein the promoter comprises a minimal promoter.

50. The nucleic acid of claim 48, wherein the promoter comprises a constitutive promoter.

51. The nucleic acid of claim 50, wherein the constitutive promoter comprises a sequence isolated or derived from a mammalian MND promoter.

52. The nucleic acid of claim 48, wherein the promoter comprises an inducible promoter.

53. The nucleic acid of claim 52, wherein the inducible promoter comprises a sequence isolated or derived from a mammalian NFkB promoter.

54. The nucleic acid of claim 52, wherein the inducible promoter comprises a sequence isolated or derived from the sequence of SEQ ID NO: 308.

55. A vector comprising the nucleic acid of any one of claims 46-54.

56. The vector of claim 55, wherein the vector is an expression vector.

57. The vector of claim 55, wherein the vector is a delivery vector.

58. The vector of any one of claims 55-57, wherein the vector is a viral vector.

59. The vector of claim 55, wherein the vector comprises a sequence isolated or derived from a lentivirus.

60. The vector of any one of claims 55-57, wherein the vector is a non-viral vector.

61. A cell comprising a composition of any one of claims 1-44, a fusion protein of claim45, a nucleic acid of any one of claims 46-54, or a vector of any one of claims 55-60.

62. The cell of claim 61, wherein the cell is modified or has been modified to express one or more of (a) an exogenous receptor, (b) a safety switch or (c) an armoring moiety.

63. The cell of claim 61 or 62, wherein the exogenous receptor comprises a chimeric antigen receptor (CAR).

64. The cell of claim 61 or 62, wherein the exogenous receptor comprises an engineered T cell receptor (TCR).

65. The cell of any one of claim 62-64, wherein the safety switch comprises an extracellular sequence.

66. The cell of any one of claim 62-65, wherein the safety switch comprises a sequence isolated or derived from EGFR.

67. The cell of any one of claim 62-65, wherein the safety switch comprises the sequence of SEQ ID NO: 34.

68. The cell of any one of claim 62-65, wherein the safety switch comprises the sequence of one or more of SEQ ID NO: 35-49.

69. The cell of any one of claim 62-68, wherein the armoring moiety comprises a naturally occurring cytokine or a modified cytokine.

70. The cell of claim 69, wherein the naturally occurring cytokine or the modified cytokine comprises a sequence isolated or derived from IL-2, IL-7, IL-12, IL-15, IL-18, IL- 21, IL-23 or an interferon.

71. The cell of claim 69, wherein the interferon comprises a sequence isolated or derived from an alpha-interferon, a beta-interferon, a gamma-interferon or an omega-interferon.

72. The cell of any one of claim 62-68, wherein the armoring moiety comprises a non- naturally occurring or a de novo polypeptide.

73. The cell of claim 72, wherein the non-naturally occurring or de novo polypeptide binds to and / or signals through a naturally occurring receptor.

74. The cell of claim 73, wherein the naturally occurring receptor comprises a receptor for one or more of IL-2, IL-7, IL-12, IL-15, IL-18, IL-21, IL-23 or an interferon.

75. The cell of any one of claims 62-74, wherein the armoring moiety comprises a de novo polypeptide capable of binding to or signaling through IL-2 and IL-15.

76. The cell of claim 75, wherein the de novo polypeptide (a) is capable of binding to or signaling through IL-2 beta gamma (IL-2bg) and IL- 15 and (b) not capable of binding to or signaling through IL-R alpha (IL-Ra).

77. The cell of any one of claims 72-76, wherein the de novo polypeptide comprises one or more of (a) the sequence of SEQ ID NO: 50-281 or (b) a sequence having at least 70% identity to a sequence of (a).

78. The cell of any one of claims 61-75, wherein the cell an immune cell.

79. The cell of claim 78, wherein the immune cell is a precursor cell.

80. The cell of claim 79, wherein the precursor cell is one or more of a stem cell, an adult stem cell, an embryonic stem cell, a hematopoietic stem cell (HSC), an induced pluripotent stem cell (iPSC), a de-differentiated cell, a transdifferentiated cell.

81. The cell of claim 79 or 80, wherein the precursor cell is not an embryonic stem cell.

82. The cell of any one of claim 78-81, wherein the immune cell is a T cell or a naturalkiller (NK) cell.

83. The cell of claim 82, wherein the T-cell is an alpha-beta T cell.

84. The cell of claim 82, wherein the T-cell is a gamma-delta T cell.

85. The cell of any one of claims 61-84, wherein the cell is modified in vitro.

86. The cell of any one of claims 61-84, wherein the cell is modified ex vivo.

87. The cell of any one of claims 61-84, wherein the cell is modified in vivo.

88. A pharmaceutical composition comprising: a composition of any one of claims 1-44, a fusion protein of claim 45, a nucleic acid of any one or claims 46-54, or a vector of any one of claims 55-60 or a cell of any one of claims 61-87; and a pharmaceutically acceptable carrier.

89. The use of a composition of any one of claims 1-44, a fusion protein of claim 45, a nucleic acid of any one or claims 46-54, a vector of any one of claims 55-60, or a pharmaceutical composition of claim 88, for reducing exhaustion in a stimulated cell of any one of claims 61-87 comprising introducing the composition, fusion protein, nucleic acid, vector or pharmaceutical composition into the cell under conditions sufficient for expression of the composition, the fusion protein, the nucleic acid or the vector.

90. The use of claim 89, wherein the introduction is performed in vitro, ex vivo or in vivo.

91. The use of claim 89 or 90, wherein(a) the cell is an immune cell;(b) wherein an inducible promoter drives expression of one or more of the composition, fusion protein, and nucleic acid; and optionally, wherein the inducible promoter is capable of being activated by stimulation or following stimulation of the immune cell.

92. The use of any one of claims 89-91, wherein the cell is capable of treating a disease or disorder.

93. The use of claim 92, wherein the disease or disorder comprises a proliferative disease.

94. The use of claim 92 or 93, wherein the disease or disorder comprises cancer.

95. The use of claim 92, wherein the disease or disorder comprises an autoimmune disease or disorder.

96. The use of claim 92, wherein the disease or disorder comprises an inflammatory disease or disorder.

97. The use of a composition of any one of claims 1-44, a fusion protein of claim 45, a nucleic acid of any one or claims 46-54, a vector of any one of claims 55-60, a cell of any one of claims 61-87 or a pharmaceutical composition of claim 88, for treating a disease or disorder comprising providing the composition, fusion protein, nucleic acid, vector or pharmaceutical composition to a subject in need thereof.

98. The use of claim 97, wherein the disease or disorder comprises a proliferative disease.

99. The use of claim 97 or 98, wherein the disease or disorder comprises cancer.

100. The use of claim 97, wherein the disease or disorder comprises an autoimmune disease or disorder.

101. The use of claim 97, wherein the disease or disorder comprises an inflammatory disease or disorder.

102. A method of preventing exhaustion in a stimulated cell, the method comprising introducing a composition of any one of claims 1-44, a fusion protein of claim 45, a nucleic acid of any one or claims 46-54, a vector of any one of claims 55-60 or a pharmaceutical composition of claim 88 into a cell of any one of claims 61-87 under conditions sufficient for expression of the composition, the fusion protein, the nucleic acid or the vector.

103. The method of claim 102, wherein the introduction is performed in vitro, ex vivo or in vivo.

104. The method of claim 102 or 103, wherein(a) the cell is an immune cell;(b) wherein an inducible promoter drives expression of one or more of the composition, fusion protein, and nucleic acid; and optionally, wherein the inducible promoter is capable of being activated by stimulation or following stimulation of the immune cell.

105. The method of any one of claims 102-104, wherein the cell is capable of being antigen- stimulated.

106. The method of any one of claims 102-105, wherein the cell is capable of treating a disease or disorder.

107. The method of claim 106, wherein the disease or disorder comprises a proliferative disease.

108. The method of claim 106 or 107, wherein the disease or disorder comprises cancer.

109. The method of claim 106, wherein the disease or disorder comprises an autoimmune disease.

110. The method of claim 106, wherein the disease or disorder comprises an inflammatory disease111. A method for treating a disease or disorder, the method comprising administering to a subject in need thereof, a composition of any one of claims 1-44, a fusion protein of claim 45, a nucleic acid of any one or claims 46-54, a vector of any one of claims 55-60, a cell of any one of claims 61-87 or a pharmaceutical composition of claim 88.

112. The method of claim 111, wherein the method comprises administering a therapeutically effective amount of the composition, fusion protein, nucleic acid, vector, cell or pharmaceutical composition.

113. The method of claim 111 or 112, wherein a route of administration is systemic.

114. The method of claim 113, wherein the systemic route of administration comprises an intravenous injection or an intravenous infusion.

115. The method of claim 111 or 112, wherein a route of administration is local.

116. The method of claim 115, wherein the local route of administration comprises an intratumoral injection or an intratumoral infusion.

117. The method of any one of claims 111-116, wherein the disease or disorder comprises a proliferative disease.

118. The method of claim 117, wherein the disease or disorder comprises cancer.

119. The method of any one of claims 111-116, wherein the disease or disorder comprises an autoimmune disease or disorder.

120. The method of any one of claims 111-116, wherein the disease or disorder comprises an inflammatory disease or disorder.

Images