Composition for diagnosing radiosensitivity of breast cancer or prognosing breast cancer

Abstract

In the present invention, the mRNA of genes CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4, or the proteins encoded by these genes, exhibit differential expression levels in radioresistant and radiosensitive breast cancer cells and have a close correlation with the increased survival rate of breast cancer patients. Therefore, an agent for measuring the expression levels of mRNA or proteins encoded by genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 of the present invention can effectively diagnose the radiosensitivity of breast cancer or prognose breast cancer radiotherapy. By determining the necessity of radiotherapy and optimizing the radiation dose, the agent can enhance the efficiency and outcomes of breast cancer radiotherapy.

Description

Composition for diagnosing radiosensitivity of breast cancer or predicting prognosis of breast cancer

[0001] [Cross-reference with related applications]

[0002] This application claims the benefit of priority to Korean Patent Application No. 10-2023-0125814, filed September 20, 2023, the entire contents of which are incorporated herein by reference.

[0003] [Technical Field]

[0004] The present invention relates to a composition for diagnosing the radiosensitivity of breast cancer and its application.

[0005]

[0006] Cancer treatment methods include surgery, chemotherapy, and radiation therapy, and the importance of radiation therapy has grown significantly in recent years. In cases where surgery is not feasible, cases have been reported where radiation therapy alone effectively cured tumors. Furthermore, radiation-based cancer treatment methods continue to evolve, establishing radiation therapy as an effective treatment for tumors without significant pain or discomfort for patients. Statistically, approximately 30-50% of cancer patients receive radiation therapy at some point during their treatment. As the number of cancer patients receiving radiation therapy continues to increase, the importance of radiation therapy in cancer treatment is also growing.

[0007] Radiation therapy, either alone or in combination with chemotherapy, is commonly used to treat various types of cancer. However, the effectiveness of radiation therapy varies depending on the nature of the cancer, the patient, and whether radiation is combined with other treatments. Cancers for which radiation therapy is commonly administered include cervical, pharyngeal, lung, brain, and breast cancers. Although these cancers are primary targets of radiation therapy, they frequently have poor responses to radiation therapy, necessitating strategies to enhance treatment effectiveness. Furthermore, even if radiation therapy is successful and initial responses are favorable, recurrence is common, making developing countermeasures to prevent recurrence crucial for enhancing the effectiveness of radiation therapy.

[0008] Furthermore, issues such as cancer cell acquisition of radiation resistance and damage to normal tissue during high-dose radiation therapy have been identified as reducing the effectiveness of radiation therapy, necessitating research to improve its effectiveness. Currently, radiation therapy, along with surgery and chemotherapy, is used as an effective cancer treatment, targeting cancerous tissue to kill cancer cells.

[0009] Although there are differences in the sensitivity of cancer cells to radiation therapy, if we develop a technology that can predict individual radiation sensitivity before radiation therapy, we will be able to provide the most appropriate radiation therapy for each individual by adjusting the radiation dose to treat cancer.

[0010] Meanwhile, research is actively underway on companion diagnostics, which are approved diagnostics that can select appropriate targeted anticancer drugs and treatment methods based on systematic analysis of individual patient factors. Companion diagnostics can provide a clear clinical basis for prescribing based on a physician's diagnosis and suggest appropriate treatment options to patients. This not only enhances cancer treatment effectiveness but also contributes to the soundness of national health insurance finances by reducing the misuse of targeted anticancer drugs. The companion diagnostics market is currently growing in areas such as breast cancer, lung cancer, colon cancer, stomach cancer, and melanoma, with breast and lung cancer in particular expected to drive market growth.

[0011] Korean Patent Application No. 10-2018-0143493 discloses a technique for diagnosing radioresistant lung cancer or pancreatic cancer by measuring the expression level of PMVK protein or mRNA, but no data is provided regarding breast cancer cell specificity.

[0012] In addition, Korean Patent Application No. 10-2018-0153659 discloses a technique for diagnosing the radiation resistance of cancer cells by measuring the expression level of the ROMO1 gene or protein, but does not present a technique for more accurately diagnosing radiation-sensitive breast cancer using multiple markers.

[0013] Against this backdrop, the inventors of the present invention conducted research on radiosensitivity biomarkers and discovered a novel biomarker for the diagnosis of radiosensitive breast cancer. This biomarker is expected to be useful in breast cancer treatment, as it can predict sensitivity to radiotherapy and prognosis following radiotherapy.

[0014] [Prior Art Literature]

[0015] [Patent Document]

[0016] Republic of Korea Patent Application No. 10-2018-0143493

[0017] Republic of Korea Patent Application No. 10-2018-0153659

[0018]

[0019] The purpose of the present invention is to provide a composition for diagnosing the radiosensitivity of breast cancer.

[0020] In addition, the present invention aims to provide a kit for diagnosing the radiosensitivity of breast cancer.

[0021] In addition, the present invention aims to provide a method for providing information for diagnosing the radiosensitivity of breast cancer.

[0022] In addition, the present invention aims to provide a composition for predicting the prognosis of radiation therapy for breast cancer.

[0023] In addition, the present invention aims to provide a kit for predicting the prognosis of radiation therapy for breast cancer.

[0024] In addition, the present invention aims to provide a method for providing information for predicting the prognosis of radiation therapy for breast cancer.

[0025] In order to achieve the above object, one aspect of the present invention provides a composition for diagnosing breast cancer radiosensitivity, comprising a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1 and SYTL4 genes or proteins encoded by two or more genes.

[0026] In addition, another aspect of the present invention provides a kit for diagnosing radiosensitivity of breast cancer, comprising the composition for diagnosing radiosensitivity of breast cancer.

[0027] In addition, another aspect of the present invention provides a method for providing information for diagnosing radiation sensitivity of breast cancer, comprising the steps of: (a) measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes in a sample isolated from an individual, or proteins encoded by two or more genes; and (b) comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control.

[0028] In addition, another aspect of the present invention provides a composition for predicting the prognosis of radiation therapy for breast cancer, comprising an agent for measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1 and SYTL4 genes or a protein encoded by the genes.

[0029] In addition, another aspect of the present invention provides a kit for predicting the prognosis of radiation therapy for breast cancer, comprising a composition for predicting the prognosis of radiation therapy for breast cancer.

[0030] In addition, another aspect of the present invention provides a method for providing information for predicting the prognosis of radiation therapy for breast cancer, comprising the steps of: (a) measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes in a sample isolated from an individual, or proteins encoded by two or more genes; and (b) comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control.

[0031]

[0032] Hereinafter, the present invention will be described in detail.

[0033]

[0034] 1. Composition for diagnosing the radiation sensitivity of breast cancer or predicting the prognosis of radiation therapy for breast cancer

[0035] One aspect of the present invention provides a composition for diagnosing radiosensitivity of breast cancer.

[0036] In addition, another aspect of the present invention provides a composition for predicting the prognosis of radiation therapy for breast cancer.

[0037] The composition for diagnosing the radiation sensitivity of breast cancer of the present invention comprises, as an active ingredient, an agent for measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1 and SYTL4 genes or proteins encoded by two or more genes.

[0038] In addition, the composition for predicting the prognosis of the radiation treatment of breast cancer of the present invention comprises, as an active ingredient, an agent for measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes or proteins encoded by two or more genes.

[0039] CD68 (Cluster of Differentiation 68, NCBI gene ID: 968) protein is a protein expressed in monocyte lineage cells and macrophages. It is generally known as a scavenger receptor that plays a role in removing cell debris, promoting phagocytosis, and mediating macrophage recruitment and activation.

[0040] In the present invention, the CD68 protein refers to not only a wild-type CD68 protein having an amino acid sequence of SEQ ID NO: 1, but also an equivalent that has a different sequence from the wild-type CD68 protein but has the same or similar function or activity as the wild-type CD68 protein, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 1.

[0041] IFI16 (Interferon gamma inducible protein 16, NCBI gene ID: 3428) protein is an interferon-driven myeloid differentiation transcriptional activator that interacts with p53, retinoblastoma-1, and BRCA1, and is known to play a role in cell growth inhibition and intracellular DNA sensing.

[0042] In the present invention, the IFI16 protein refers to not only the wild-type IFI16 protein consisting of the amino acid sequence of SEQ ID NO: 2, but also an equivalent that has a function or activity identical or similar to the wild-type IFI16 protein but has a different sequence from it, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 2.

[0043] TNFR2 (Tumor necrosis factor receptor 2, NCBI gene ID: 7133) protein, also called TNFRSF1B (Tumor necrosis factor receptor superfamily member 1B), is one of the membrane receptors that binds to TNFα and is known to induce transcription of genes related to cell survival, growth, and differentiation.

[0044] In the present invention, the TNFR2 protein refers to not only the wild-type TNFR2 protein consisting of the amino acid sequence of SEQ ID NO: 3, but also an equivalent that has a function or activity identical or similar to the wild-type TNFR2 protein but differs in some sequences, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 3.

[0045] CXCL5 (CXC motif chemokine ligand 5, NCBI gene ID: 6374) protein is a small cytokine belonging to the CXC chemokine family. It is produced by stimulation with the inflammatory cytokines interleukin-1 and tumor necrosis factor-alpha, and is known to regulate neutrophil homeostasis by inhibiting type II interferon-gamma.

[0046] In the present invention, the CXCL5 protein refers to not only the wild-type CXCL5 protein consisting of the amino acid sequence of SEQ ID NO: 4, but also an equivalent that has a part of the sequence different from the wild-type CXCL5 protein but has the same or similar function or activity as the wild-type CXLC5 protein, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 4.

[0047] The LCN2 (Lipocalin 2, NCBI gene ID: 3934) protein, also known as NGAL (neutrophil gelatinase-associated lipocalin), is known to be involved in innate immunity by sequestering iron and preventing its use by bacteria, thereby restricting their growth.

[0048] In the present invention, the LCN2 protein refers to not only the wild-type LCN2 protein consisting of the amino acid sequence of SEQ ID NO: 5, but also an equivalent that has a different sequence from the wild-type LCN2 protein but has the same or similar function or activity as the wild-type LCN2 protein, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 5.

[0049] SERPING1 (Serpin family G member 1, NCBI gene ID: 710) protein is a protease inhibitor belonging to the serpin superfamily, also known as a C1 esterase inhibitor, and is known to regulate physiological pathways including complement activation, blood coagulation, fibrinolysis, and kinin production by inhibiting the activation of the C1 complex.

[0050] In the present invention, the SERPING1 protein refers to not only the wild-type SERPING1 protein consisting of the amino acid sequence of SEQ ID NO: 6, but also an equivalent that has a different sequence from the wild-type SERPING1 protein but has the same or similar function or activity as the wild-type SERPING1 protein, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 6.

[0051] MATN1 (Matrilin 1, NCBI gene ID: 4146) protein is a cartilage matrix protein that is involved in the formation of filamentous networks in the extracellular matrix of various tissues, and mutations in this gene are known to be associated with various hereditary chondrodysplasias.

[0052] In the present invention, the MATN1 protein refers to not only the wild-type MATN1 protein consisting of the amino acid sequence of SEQ ID NO: 7, but also an equivalent that has a function or activity identical or similar to the wild-type MATN1 protein but has a different sequence from the wild-type MATN1 protein, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 7.

[0053] SYTL4 (Synaptotagmin like 4, NCBI gene ID: 94121) protein has an N-terminal Rab27 binding domain and a C-terminal tandem C2 domain, which allows it to bind to Rab GTPases and participate in intracellular membrane trafficking, and is known to regulate the release of nucleolar granules into cells or the secretion of pancreatic and pituitary hormones.

[0054] In the present invention, the SYTL4 protein refers to not only the wild-type SYTL4 protein consisting of the amino acid sequence of SEQ ID NO: 8, but also an equivalent that has a function or activity identical or similar to the wild-type SYTL4 protein but differs in some sequences, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 8.

[0055] The composition for diagnosing the radiosensitivity of breast cancer according to the present invention may contain, as an active ingredient, an agent for measuring the expression level of mRNA of one gene, two genes, three genes, four genes, five genes, six genes, or seven genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes, or proteins encoded by the above genes.

[0056] In addition, the composition for predicting the prognosis of radiation therapy for breast cancer according to the present invention may include, as an active ingredient, an agent for measuring the expression level of mRNA of one gene, two genes, three genes, four genes, five genes, six genes, or seven genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes, or proteins encoded by the genes.

[0057] In a specific embodiment of the present invention, it was confirmed that genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1 and SYTL4 genes or proteins encoded by the genes have differential expression levels in radiosensitive and resistant breast cancer cells and have a close correlation with increased survival rates of breast cancer patients.

[0058] Therefore, a formulation for measuring the expression level of mRNA of one or more genes selected from the group consisting of the CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1 and SYTL4 genes or a protein encoded by one or more genes can diagnose the radiosensitivity of breast cancer more effectively than mRNA of other genes and / or proteins encoded by the genes and combinations thereof, and can predict the prognosis of radiotherapy for breast cancer, thereby determining whether to perform radiotherapy and the optimal dose of radiotherapy, thereby improving the efficiency and treatment results of radiotherapy for breast cancer.

[0059] Specifically, in breast cancer cells, the expression of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, and MATN1 genes can be upregulated by radiation exposure, and the expression of SYTL4 gene can be upregulated or downregulated.

[0060] More specifically, the expression of the CD68, IFI16 and TNFR2 genes is upregulated in radioresistant breast cancer cells, and the expression of the LCN2, SERPING1 and CXCL5 genes is upregulated in radiosensitive breast cancer cells.

[0061] Additionally, when the expression of the CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, and MATN1 genes is upregulated in breast cancer patients, the survival rate of breast cancer patients may increase.

[0062] Therefore, if the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, and MATN1 genes or the protein encoded by two or more genes is high compared to the normal control group, it can be determined that radiosensitivity is present, and if it is low, it can be determined that radiosensitivity is low or radioresistance is present. For example, if the mRNA of two to seven genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, and MATN1 genes and / or the two to seven proteins encoded by the genes are all highly expressed, radiosensitivity can be determined to be high, and if the mRNA of two to seven genes and / or the two to seven proteins encoded by the genes are all low expressed, radiosensitivity can be determined to be low.

[0063] Additionally, if the expression levels of the mRNA of the SYTL4 gene and / or the protein encoded by the gene are significantly higher or lower than those of a normal control group, radiosensitivity can be determined to exist. The SYTL4 gene can be used as an indicator of radiosensitivity and, in combination with the above genetic markers, to predict radiosensitivity.

[0064] Meanwhile, if the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes or the protein encoded by the genes is high compared to the normal control group, the prognosis of radiotherapy for breast cancer can be judged to be positive, and if the expression level is low, the prognosis of radiotherapy for breast cancer can be judged to be negative. For example, if the mRNA of two to eight genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes and / or the two to eight proteins encoded by the genes are all highly expressed, the prognosis of radiotherapy for breast cancer can be judged to be positive, and if the mRNA of two to eight genes and / or the two to eight proteins encoded by the genes are all lowly expressed, the prognosis of radiotherapy for breast cancer can be judged to be negative.

[0065] Meanwhile, the composition for diagnosing the radiation sensitivity of breast cancer and the composition for predicting the prognosis of radiation treatment of breast cancer of the present invention may include an agent for measuring the expression level of mRNA of the LCN2 gene or a protein encoded by the gene.

[0066] In the present invention, "radio-resistance" refers to a state in which cells are not easily affected by radiation exposure and show little change in cell repair or proliferation when exposed to radiation. As the opposite term to radiation resistance, "radio-sensitive" refers to a state in which cells are easily affected by radiation exposure and show changes in cell repair or proliferation when exposed to radiation.

[0067] In the present invention, "radiotherapy" refers to the treatment of cancer through a mechanism that induces cancer cell death by inhibiting cell division through DNA damage by irradiating the cancer cells. The radiation therapy may be performed alone or in combination with surgical treatment, or with anticancer chemotherapy or a radiation sensitizer, for curative, adjuvant, or palliative purposes in solid tumors.

[0068] In the present invention, breast cancer may include invasive ductal carcinoma, invasive lobular carcinoma, ductal carcinoma in situ, lobular carcinoma in situ, Paget's disease of the breast, mucinous carcinoma, medullary carcinoma, inflammatory breast cancer, papillary carcinoma, ductal carcinoma, adenoid cystic carcinoma, secretory carcinoma, apocrine carcinoma, metaplastic carcinoma, estrogen receptor-positive breast cancer, HER2-positive breast cancer, and triple-negative breast cancer.

[0069] In the present invention, “diagnosis” includes determining the susceptibility of an individual to a specific disease or condition, determining whether an individual currently has a specific disease or condition, determining the prognosis of an individual with a specific disease or condition, or therametrics (e.g., monitoring the condition of an individual to provide information about the efficacy of a treatment).

[0070] In the present invention, "prognosis" refers to a prospective or preliminary assessment of the medical outcome of a disease, and includes a positive prognosis (positive prognosis) or a negative prognosis (negative prognosis). The positive prognosis includes improvement or stabilization of the disease, such as a state of no disease, tumor regression, long-term survival possibility, or disease-free survival rate, while the negative prognosis includes progression or mortality of the disease, such as decreased survival rate, recurrence, tumor growth, metastasis, and drug resistance.

[0071] Additionally, in the present invention, “prediction” means to guess in advance about the medical outcome, such as the course of a disease (progression, improvement, recurrence, tumor growth, likelihood of death or survival after drug resistance treatment, etc.) or responsiveness to treatment such as chemotherapy or radiation therapy.

[0072] Specifically, in the present invention, the diagnosis may be a diagnosis of the radiation sensitivity of breast cancer, and the prognosis prediction may be a prognosis prediction of radiation treatment of breast cancer.

[0073] In the present invention, measurement of mRNA expression level means a process of confirming the presence and expression level of mRNA of the gene in a biological sample for the purpose of diagnosing the radiosensitivity of breast cancer and / or predicting the prognosis of radiotherapy of breast cancer, and a primer, probe, or antisense nucleotide that complementarily binds to the gene or mRNA may be used as an agent for measuring the expression level of the mRNA, and the measurement of the expression level of the mRNA may be performed by one or more methods selected from the group consisting of RT-PCR, competitive RTPCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, and DNA chip, but is not limited thereto.

[0074] In addition, in the present invention, the measurement of the protein expression level means a process of confirming the presence and expression level of the protein in a biological sample for the purpose of diagnosing the radiosensitivity of breast cancer and / or predicting the prognosis of radiotherapy of breast cancer, and a polypeptide, compound, antibody or aptamer that can specifically bind to the protein can be used as an agent for measuring the expression level of the protein, and the measurement of the expression level of the protein can be performed using Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, dual luciferase reporter assay, immunoprecipitation assay, complement fixation assay, FACS (Fluorescence activated cell sorter) and protein chip. It can be performed by one or more methods selected from the group consisting of, but is not limited to.

[0075] In the present invention, a "sample" may refer to a sample derived from an individual receiving radiation therapy (radiation irradiation) or for which a decision on whether to receive radiation therapy is required. For example, it refers to a sample capable of specifying the expression level of mRNA of two or more genes selected from the group consisting of the CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes, or a protein encoded by two or more genes, and may include, but is not limited to, cells, tissues, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine of the individual.

[0076] In the present invention, "subject" refers to a subject for which the radiosensitivity or progression potential of breast cancer is to be determined, or the prognosis of radiation therapy is to be predicted. The subject may be any animal susceptible to breast cancer, but is not limited to any species. Specifically, the subject may be a mammal, for example, a human (Homo sapiens).

[0077] In the present invention, the term "expression level" may be used interchangeably with the terms "expression signature" and "expression profile," and may include the expression level of one or more of the mRNAs of two or more genes selected from the CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes, or the proteins encoded by the two or more genes. The expression level may include an increase in expression or a decrease in expression, and the expression level may be measured from cancer cells isolated from a subject before and / or after radiation treatment. Meanwhile, the expression level may be confirmed by measuring the amount of the mRNA and / or the protein of the gene in the sample.

[0078] In the present invention, a "primer" refers to a nucleic acid sequence having a short free 3'-terminal hydroxyl group, which can form base pairs with a complementary template and serves as a starting point for copying the template strand. The primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. The primer of the present invention can complementarily bind to the biomarker gene or mRNA of the present invention, and can be a sense and antisense nucleic acid having a sequence of 7 to 50 nucleotides, and can incorporate additional features that do not change the basic properties of the primer that acts as a starting point for DNA synthesis. Meanwhile, the primer of the present invention can be chemically synthesized using a phosphoramidite solid support method or other well-known methods, and can be modified using many means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution of one or more natural nucleotides with their analogs, and modifications between nucleotides, such as modification with uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoroamidate, carbamate, etc.) or charged linkers (e.g., phosphorothioate, phosphorodithioate, etc.). The nucleic acids may contain one or more additional covalently linked moieties, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridine, psoralen, etc.), chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. In addition, the primers of the present invention may be modified with labels capable of directly or indirectly providing a detectable signal, such as radioisotopes, fluorescent molecules, biotin, etc.

[0079] In the present invention, "probe" refers to a nucleic acid capable of complementary binding to mRNA of several to several hundred bases in length, produced through an enzymatic chemical separation and purification process or synthesis. The probe of the present invention is a probe capable of complementary binding to the biomarker gene or mRNA of the present invention, and can be used by labeling with a radioactive isotope or enzyme to confirm the presence or absence of mRNA. The probe can be designed and modified using a known method.

[0080] In the present invention, the term "antisense nucleotide" refers to DNA, RNA, or a derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, which binds to the complementary sequence within the mRNA and inhibits the translation of the mRNA into protein. The sequence of the antisense nucleotide refers to a DNA or RNA sequence that is complementary to the mRNA of a biomarker gene of the present invention selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes, and can bind to the mRNA. This can inhibit the translation, translocation into the cytoplasm, maturation, or any other essential activity for the overall biological function of the mRNA. The above antisense nucleotides can be synthesized in vitro by a conventional method and administered into a living body or the antisense nucleotides can be synthesized in a living body. The antisense nucleotides that can be used in the present invention can be produced by a method known in the art with reference to the base sequence and / or amino acid sequence of the biomarker gene and / or protein of the present invention.

[0081] In the present invention, the term "antibody" refers to a globulin-based protein that reacts when an antigen, which is a foreign substance, invades while circulating in the blood or lymph in the immune system of a living body, and refers to a protein that specifically binds to an antigen. For the purpose of the present invention, the antibody refers to an antibody that specifically binds to a biomarker protein of the present invention encoded by a gene selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes, and may include all of a polyclonal antibody, a monoclonal antibody, and a recombinant antibody, and includes not only a complete form having two full-length light chains and two full-length heavy chains, but also a functional fragment of an antibody molecule. A functional fragment of an antibody molecule refers to a fragment that has at least an antigen-binding function, and includes Fab, F(ab'), F(ab') 2, and Fv. The antibody that specifically binds to the biomarker protein of the present invention may be produced by any method known to those skilled in the art, and may be produced, for example, by injecting the biomarker protein as an immunogen into a foreign host. The foreign host includes mammals such as mice, rats, sheep, and rabbits, and the immunogen may be injected intramuscularly, intraperitoneally, or subcutaneously, and may generally be administered together with an adjuvant to increase antigenicity. Thereafter, blood may be collected periodically from the foreign host, and serum showing specificity for the antigen may be collected to isolate antibodies.

[0082] In the present invention, the term "aptamer" refers to a single-stranded oligonucleotide, which is about 20 to 60 nucleotides in size, and a nucleic acid molecule having binding activity to a predetermined target molecule. The aptamer has various three-dimensional structures depending on the sequence, can have high affinity for a specific substance like an antigen-antibody reaction, and can inhibit the activity of a predetermined target molecule by binding to the predetermined target molecule. The aptamer may be RNA, DNA, a modified nucleic acid, or a mixture thereof, and may be linear or cyclic. In the present invention, the aptamer can specifically bind to a biomarker protein of the present invention encoded by a gene selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes, and can be prepared by a person skilled in the art from the base sequence of the biomarker gene of the present invention by a method known in the art.

[0083]

[0084] 2. Kit for diagnosing the radiosensitivity of breast cancer and kit for predicting the prognosis of radiotherapy for breast cancer

[0085] Another aspect of the present invention provides a kit for diagnosing radiosensitivity of breast cancer.

[0086] In addition, another aspect of the present invention provides a kit for predicting the prognosis of radiation therapy for breast cancer.

[0087] The kit for diagnosing the radiosensitivity of breast cancer of the present invention comprises, as an active ingredient, a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1 and SYTL4 genes or proteins encoded by two or more genes.

[0088] In addition, the composition for predicting the prognosis of the radiation treatment of breast cancer of the present invention comprises, as an active ingredient, an agent for measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes or proteins encoded by two or more genes.

[0089] Since the overlapping description is the same as that described above in '1. Composition for diagnosing radiation sensitivity of breast cancer or predicting prognosis of radiation therapy for breast cancer', the description is omitted.

[0090] In the present invention, the term "kit" refers to a tool that can diagnose the radiosensitivity of breast cancer or predict the prognosis of radiotherapy of breast cancer by confirming the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes or proteins encoded by two or more genes. The kit of the present invention may include an agent for measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes or proteins encoded by two or more genes, specifically, a primer, a probe, and an antisense nucleotide that specifically bind to the mRNA of the genes, or a polypeptide, a compound, an antibody, and an aptamer that specifically bind to the protein, and may include one or more other component compositions, solutions, or devices suitable for an analysis method.

[0091] Additionally, the kit may further include a user manual describing optimal reaction performance conditions. The manual may include instructions in the form of a pamphlet or leaflet, a label attached to the kit, and a description on the surface of the package containing the kit, and may include information disclosed or provided through electronic media such as the Internet.

[0092] In the present invention, the kit may be an RT-PCR kit, a microarray chip kit, a DNA kit, an ELISA kit, a protein chip kit, or a rapid kit.

[0093]

[0094] 3. Method for providing information for diagnosing the radiation sensitivity of breast cancer and method for providing information for predicting the prognosis of radiation therapy for breast cancer.

[0095] Another aspect of the present invention provides a method for providing information for diagnosing the radiosensitivity of breast cancer.

[0096] In addition, another aspect of the present invention provides a method for providing information for predicting the prognosis of radiation therapy for breast cancer.

[0097] The method for providing information for diagnosing the radiation sensitivity of breast cancer of the present invention comprises: (a) a step of measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) a step of comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control.

[0098] In addition, the method for providing information for predicting the prognosis of the radiation treatment of breast cancer of the present invention comprises (a) a step of measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) a step of comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control group.

[0099] Since the overlapping description is the same as that described above in '1. Composition for diagnosing radiation sensitivity of breast cancer or predicting prognosis of radiation therapy of breast cancer', the description is omitted.

[0100] In the method for providing information for diagnosing radiation sensitivity of breast cancer of the present invention, step (a) may include a step of measuring the expression level of mRNA of the LCN2 gene or a protein encoded by the gene.

[0101] Additionally, in the method for providing information for predicting the prognosis of radiation therapy for breast cancer of the present invention, step (a) may include a step of measuring the expression level of mRNA of the LCN2 gene or a protein encoded by the gene.

[0102] In the method for providing information for diagnosing radiation sensitivity of breast cancer of the present invention, in step (b), when the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1 and MATN1 genes or the protein encoded by two or more genes is compared with the expression level of mRNA or protein of a normal control group, if the expression level is higher than that of the normal control group, the breast cancer can be determined to have radiation sensitivity. The above high expression level may include an increase in the expression level of the subject by a similar level or by 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900% and 1000% or more compared to the expression level of a normal control.

[0103] In addition, in the method for providing information for diagnosing radiation sensitivity of breast cancer of the present invention, if the expression level of the mRNA of the SYTL4 gene or the protein encoded by the gene is compared with the expression level of the mRNA or protein of a normal control group in step (b), and the expression level is higher or lower than that of the normal control group, the breast cancer can be determined to have radiation sensitivity. The expression level being high may include that the expression level of the individual is similar to that of a normal control group or is increased by 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900% and 1000% or more, and the expression level being low may include that the expression level of the individual is similar to that of a normal control group or is increased by 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99% This may include a decrease in the ideal.

[0104] Meanwhile, in the method for providing information for predicting the prognosis of radiation therapy for breast cancer of the present invention, in step (b), when the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1 and SYTL4 genes or the protein encoded by two or more genes is compared with the expression level of mRNA or protein of a normal control group, if the expression level is higher than that of the normal control group, the prognosis of radiation therapy for the breast cancer can be determined to be positive. The above high expression level may include an increase in the expression level of the subject by a similar level or by 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900% and 1000% or more compared to the expression level of a normal control.

[0105] Meanwhile, the method for providing information for diagnosing the radiosensitivity of breast cancer of the present invention may further include: (c-1) a step of determining that the breast cancer is radiosensitive when the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, and MATN1 genes or a protein encoded by two or more genes is high compared to a normal control group; and / or (c-2) a step of determining that the breast cancer is radiosensitive when the expression level of mRNA of the SYTL4 gene or a protein encoded by the gene is high or low compared to a normal control group.

[0106] In addition, the method for providing information for predicting the prognosis of radiation therapy for breast cancer of the present invention may further include (c) a step of determining that the prognosis of radiation therapy for breast cancer is positive when the measured mRNA or protein expression level is higher than that of a normal control group.

[0107] In a specific embodiment of the present invention, the overall survival (OS) period was analyzed in TCGA data to identify genes or combinations with a P-value of 0.05 or less, and the HR (Hazard Ratio) value for each gene or combination was identified. The HR represents risk, and in a group with high gene expression, a higher HR value means a worse patient survival rate, and a lower HR value means a better patient survival rate. When the HR is 0.8 or less, 0.7 or less, 0.6 or less, 0.5 or less, or 0.5 or less, the prognosis for radiation therapy for breast cancer in the individual can be determined to be positive.

[0108]

[0109] Another aspect of the present invention provides a method for diagnosing radiosensitivity of breast cancer, comprising the steps of: (a) measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes in a sample isolated from an individual, or proteins encoded by the two or more genes; and (b) comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control.

[0110] Another aspect of the present invention provides a method for predicting the prognosis of radiation therapy for breast cancer, comprising the steps of: (a) measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes in a sample isolated from an individual, or proteins encoded by two or more genes; and (b) comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control.

[0111] Another aspect of the present invention provides a use of a formulation for diagnosing radiosensitivity of breast cancer, the formulation comprising measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1 and SYTL4 genes or proteins encoded by two or more genes.

[0112] Another aspect of the present invention provides a use of a formulation for predicting the prognosis of radiation therapy for breast cancer, the formulation comprising measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1 and SYTL4 genes or proteins encoded by two or more genes.

[0113]

[0114] In the present invention, the mRNA of the CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1 and SYTL4 genes or the proteins encoded by the genes have differential expression levels in radioresistant and radiosensitive breast cancer cells, and are closely correlated with increased survival rates of breast cancer patients. Therefore, the agent for measuring the expression level of the mRNA of a gene selected from the group consisting of the CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1 and SYTL4 genes of the present invention or the protein encoded by the gene can effectively diagnose the radiosensitivity of breast cancer or predict the prognosis of radiotherapy for breast cancer, and thereby determine whether to perform radiotherapy and the optimal dose of radiotherapy, thereby improving the efficiency and treatment results of radiotherapy for breast cancer.

[0115] However, the effects of the present invention are not limited to the effects mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the description below.

[0116]

[0117] Figure 1a shows the results of flow cytometry (FACS) analysis of cell death induced by radiation in human breast cancer cell lines SK-BR3, T47D, MDA-MB-231, and BT-549.

[0118] Figure 1b shows the results of measuring colony forming ability in response to radiation exposure in human breast cancer cell lines SK-BR3, T47D, MDA-MB-231, and BT-549.

[0119] Figure 2 shows the results of analyzing genes whose expression increased or decreased after irradiation with a dose of 8 Gy in human breast cancer cell lines SK-BR3, T47D, MDA-MB-231, and BT-549.

[0120] Figure 3 shows the results of analyzing the changes in protein expression of radiosensitive genes in human breast cancer cell lines SK-BR3, T47D, MDA-MB-231, and BT-549.

[0121] Figure 4 shows the results of analyzing the expression levels of radiosensitive genes using the DESeq2 program in RNAseq results (GSE65505) of 62 breast cancer patients who received radiation therapy.

[0122] Figure 5a shows Kaplan-Meier survival curves for the survival rate of breast cancer patients according to LCN2, SYTL4, or CXCL5 expression.

[0123] Figure 5b shows Kaplan-Meier survival curves for the survival rate of breast cancer patients according to the expression of LCN2 and CXCL5, LCN2 and SYTL4, or SYTL4 and CXCL5.

[0124] Figure 5c shows Kaplan-Meier survival curves for the survival rate of breast cancer patients according to the expression of SYTL4, CXCL5, and TNFR2, or the expression of SYTL4, CXCL5, TNFR2, and MATN1.

[0125] Figure 6a shows the results of cancer cell death according to the presence or absence of radiation exposure after knocking down the expression of a radiosensitive gene with siRNA in the human breast cancer cell line MDA-MB-231.

[0126] Figure 6b shows the results of cancer cell death in the presence or absence of radiation upon knockdown of CXCL5 alone, double knockdown with LCN2 or SYTL4, or triple knockdown of CXCL5, SYTL4, and TNFR2 in the human breast cancer cell line MDA-MB-231.

[0127]

[0128] Hereinafter, the present invention will be described in detail by examples.

[0129] However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[0130]

[0131] Example 1. Selection of radiosensitive or resistant breast cancer cell lines.

[0132] Among human breast cancer cell lines, HER2-positive SK-BR3 (ER- / PR- / HER2+) cell line, hormone-positive luminal A type T47D (ER+ / PR+ / HER2-) cell line, and triple-negative (ER- / PR- / HER2-) breast cancer cell lines MDA-MB-231 and BT-549 cell lines were purchased from ATCC (American Type Culture Collection, USA) and used. They were maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (10,000 U / ml) at 5% CO2 and 37°C. Afterwards, to measure the radiation responsiveness of the breast cancer cell lines, 8 Gy of radiation was irradiated, and after 24 hours, the degree of cell death was analyzed by flow cytometry (FACS) through Annexin V / PI staining.

[0133] As a result, it was confirmed that SK-BR3 and T47D cell lines were radiosensitive, showing a significant increase in cell death due to radiation exposure, and MDA-MB-231 and BT-549 cell lines were radioresistant, showing a less increase in cell death due to radiation exposure (Fig. 1a).

[0134] Next, breast cancer cell lines were seeded in 60 mm dishes at an appropriate cell number, and after 24 hours, they were irradiated at different doses and cultured for 10-14 days under conditions of 5% CO2 and 37°C. After that, the formed cell colonies were washed with phosphate-buffered saline (PBS) and stained with a 100% methanol mixture containing 1% methylene blue. The stained cell colonies (colonies with 50 or more cells) were dried at room temperature and visually counted for each dish.

[0135] As a result, it was confirmed that SK-BR3 and T47D cell lines were radiosensitive, as their survival rates significantly decreased by radiation exposure, and that MDA-MB-231 and BT-549 cell lines were radioresistant, as their survival rates did not significantly decrease by radiation exposure (Fig. 1b).

[0136]

[0137] Example 2. Discovery of genes associated with breast cancer radiation sensitivity.

[0138] To identify genes associated with breast cancer radiosensitivity, genes were selected based on transcriptome and secreted protein analyses in response to radiation exposure. The radiosensitivity of each gene was measured using real-time reverse transcription polymerase chain reaction (RT-PCR). The primers used in this study are listed in Table 1.

[0139] Target SequenceOfficial Gene NameProductlengthDir.Sequence (5'->3')NM_001040059.2CD68136ForwardCGA GCA TCA TTC TTT CAC CAG CT(SEQ ID NO: 9)ReverseATG AGA GGC AGC AAG ATG GAC C(SEQ ID NO: 10)NM_001364867.2IFI16134ForwardGAT GCC TCC ATC AAC ACC AAG C(SEQ ID NO: 11)ReverseCTG TTG CGT TCA GCA CCA TCA C(SEQ ID NO: 12)NM_001066.3TNFRSF1B102ForwardCGT TCT CCA ACA CGA CTT CAT CC(SEQ ID NO: 13)ReverseACG TGC AGA CTG CAT CCA TGC T(SEQ ID NO: 14)NM_005564.5LCN2112ForwardGTG AGC ACC AAC TAC AAC CAG C(SEQ ID NO: 15)ReverseGTT CCG AAG TCA GCT CCT TGG T(SEQ ID NO: 16)NM_000062.3SERPING1157ForwardGCA TCA AAG TGA CGA CCA GCC A(SEQ ID NO: 17)ReverseGTC TCT GTC AGT TCC AGC ACT G(SEQ ID NO: 18)NM_002994.5CXCL5111ForwardCAG ACC ACG CAA GGA GTT CAT C(SEQ ID NO: 19)ReverseTTC CTT CCC GTT CTT CAG GGA G(SEQ ID NO: 20)NM_002379.3MATN192ForwardGGC TTC ACT CTG AAC AGC GAC G(SEQ ID NO: 21)ReverseCCG TCA ATG AGG AAG ACC AGG T(SEQ ID NO: 22)NM_001129896.3SYTL494ForwardGGA GAC AGA AGC AAA TCC GTC C(SEQ ID NO: 23)ReverseGGC GAT GTA ACT TCA CTA GGT GG(SEQ ID NO: 24)NM_022551.3RPS18107ForwardCAC GCC AGT ACA AGA TCC CA (SEQ ID NO: 25)ReverseTTC ACG GAG CTT GTT GTC CA (SEQ ID NO: 26).

[0140] Afterwards, four breast cancer cell lines were irradiated with 0 or 8 Gy of radiation, and the expression of each gene was measured 24 hours later. As a result, the expression of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, and MATN1 was increased by radiation irradiation, and SYTL4 showed a significant increase in MDA-MB-231, whereas its expression was decreased in other cell lines due to radiation irradiation, indicating that expression was increased or decreased depending on the cell line due to radiation irradiation (Fig. 2). Specifically, CD68, IFI16, and TNFR2 showed high expression in the radiation-resistant cell line (MDM-MB-231), and LCN2, SERPING1, and CXCL5 showed increased expression in all four cell lines due to radiation irradiation, and in particular, the increase in expression was significantly higher in the T47D cell line.

[0141]

[0142] Example 3. Confirmation of changes in protein expression of radiation-responsive factors.

[0143] To confirm the protein expression patterns of the radiation-sensitive genes derived from Example 2 in response to radiation exposure, SK-BR3, T47D, MDA-MB-231, and BT-549 cell lines were irradiated with 8 Gy of radiation, and then proteins were extracted 24 hours later and subjected to Western blotting assay. Information on the antibodies used in this Example is provided in Table 2 below.

[0144] Primary Antibody Manufacturer Cat. No Host Size (kD) CD68 Santa Cruz sc-200 60 Mouse 75-100 IFI 16 Santa Cruz sc-80 23 Mouse 85-95 TNFR 2 Invitrogen MA5-32 618 Rabbit 60 LCN 2 Invitrogen PA5-79 589 Rabbit 22 SERPING 1 Invitrogen PA5-31 541 Rabbit 100 CXCL 5 Invitrogen 700 656 Rabbit 8 MATN 1 Invitrogen MA5-15 704 Mouse 43 SYTL 4 Invitrogen PA5-35 992 Rabbit 80-90 ACTBSigma A5 3 16 Mouse 42

[0145] The analysis results showed that the expression of CD68, SYTL4, IFI16, Matn1, LCN2, and CXCL5 proteins was significantly increased in the MDA-MB-231 cell line, and that the SERPING1 protein was significantly increased in the SK-BR3 and BT-549 cell lines (Fig. 3). Meanwhile, the expression level of TNFR2 protein was high in all breast cancer cell lines, and the SYTL4 protein, similar to the gene expression, was increased in the MDA-MB-231 cell line and showed a significant decrease in expression by irradiation in the remaining cell lines.

[0146]

[0147] Example 4. Analysis of risk and survival curves according to the expression of a panel of radiation-sensitive genes in breast cancer patients.

[0148] To confirm the expression patterns of the radiosensitivity genes derived in Example 2 in actual breast cancer patients, RNAseq results (GSE65505) from 62 breast cancer patients who received radiation therapy were downloaded and analyzed using the DESeq2 program. The results showed that CD68 was significantly increased by 2.221-fold compared to the normal group, and IFI16 was significantly increased by 1.84-fold compared to the normal group (Fig. 4).

[0149] Thereafter, in order to analyze the effect of the expression of the radiosensitive genes derived from Example 2 on the survival rate of breast cancer patients, the overall survival (OS) was analyzed with GEPIA2 using the publicly available genomic database data, The Cancer Genome Atlas (TCGA), and genes or combinations with a P-value of 0.05 or less were identified, and the results are shown in Table 3 below. In Table 3 below, HR (Hazard Ratio) represents the risk level, and in the group with high gene expression, a higher HR value means a worse survival rate for the patient, and a lower HR value means an increase in the survival rate for the patient. In addition, the survival rate of breast cancer patients according to the expression of the genes or combinations was analyzed and visualized using a Kaplan-Meier survival curve (Figs. 5a to 5c).

[0150] CombinationHRP-valueLCN20.720.049LCN2MATN10.720.05SYTL4VTNCXCL5MATN10.720.048SYTL4VTNCXCL5MATN1LCN20.720.046TNFR2CXCL5IFI160.710.038TNFR2CXCL50.710.037SYLT4VTNCXCL5TNFR20.70.036SYTL4VTNCXCL5CD680.70.036SYLT4VTNCXCL5LCN20.70.032SYTL4CXCL5CD680.70.032SYTL4TNFR2CD680.690.03TNFR2Serping10.690.029SYTL4LCN2TNFR20.690.026LCN2CXCL5MATN10.690.023SYTL4LCN2CXCL5MATN1CD680.680.022SYTL4VTNLCN2CD680.680.019SYTL4VTNCXCL5MATN1CD680.670.019TNFR2CXCL5IFI16Serping10.670.018SYTL4LCN2CXCL5CD680.670.016LCN2CXCL50.670.016TNFR2SYLT4VTNLCN2MATN10.670.015TNFR2SYTL4MATN1CD680.660.018SYTL4VTNLCN2CXCL5CD680.660.014SYTL4CXCL5MATN1CD680.660.013TNFR2CXCL5Serping10.650.011SYLT4LCN2VTNCD68TNFR20.650.011SYTL4LCN2VTNCXCL5MATN1CD680.650.01SYTL4LCN2MATN10.650.0087SYTL4LCN2MATN1TNFR20.640.0083SYTL4LCN2CXCL50.640.0072SYLT4LCN2VTNTNFR20.640.0069SYTL4LCN2CXCL5MATN10.640.0065SYTL4LCN2CD680.630.0062SYTL4LCN2 0.630.0061SYTL4TNFR2LCN2CXCL50.630.0052SYTL4TNFR2LCN2VTNCXCL5CD680.620.0058SYTL4TNFR2LCN2CXCL5MATN10.620.0038SYTL4TNFR2LCN2VTNCXCL5MATN1CD680.610.0045SYTL4TNFR2LCN2VTNCXCL5MATN10.610.0038SYTL4TNFR2LCN2CD680.610.0037SYLT4TNFR2 0.60.0032SYTL4TNFR2LCN2CXCL5MATN1CD680.60.0026SYTL4TNFR2CXCL5CD680.60.0025SYTL4TNFR2CXCL5M ATN1CD680.60.0027SYTL4TNFR2LCN2CXCL5CD680.590.002SYTL4TNFR2VTNLCN2CXCL50.590.0018SYTL4CXCL5 0.590.0017SYTL4TNFR2CXCL50.570.00098SYTL4TNFR2MATN10.560.00077SYTL4CXCL5MATN10.550.00034SYTL4TNFR2CXCL5MATN10.540.00042.

[0151] The analysis results showed that as LCN2 expression increased, the risk of breast cancer patients decreased to 0.72, which increased the survival rate. Meanwhile, the simultaneous increase in the expression of LCN2 and CXCL5, LCN2 and SYTL4, or SYTL4 and CXCL5 genes was shown to reduce the risk to 0.67, 0.63, and 0.59, respectively. In the case of the triple combination of SYTL4 / CXCL5 / TNFR2 genes and the quadruple combination of SYTL4 / CXCL5 / TNFR2 / MATN1 genes, the risk decreased to 0.57 and 0.54, respectively, which showed that the survival rate of breast cancer patients increased.

[0152]

[0153] Example 5. Analysis of cell viability by knockdown of radiation-responsive genes in human breast cancer cells.

[0154] We examined whether knocking down the expression of the radiosensitive genes derived from Example 2 above would alter the survival rate of breast cancer cells exposed to radiation. To this end, after knocking down the expression of the radiosensitive genes using siRNA, the breast cancer cell line MDA-MB-231 was exposed to radiation, and changes in their survival rate were measured.

[0155] Specifically, each siRNA was transfected into breast cancer cell lines using Lipofectamine™ RNAiMAX transfection reagent (ThermoFisher scientific, USA) in a 96-well plate, and then irradiated with 8 Gy of radiation. After 24 hours, Annexin V / PI (BD Pharmingen) reagent was treated, and cell death was analyzed by FACS, and the results were graphically depicted. Information on the siRNAs used in this example is shown in Table 4 below.

[0156] Official Gene NameNCBI Gene IDDirectionSequence (5'->3')Scramble RNASenseCCUCGUGCCGUUCCAUCAGGUAG(SEQ ID NO: 27)Anti-senseCUACCUGAUGGAACGGCACGAGG(SEQ ID NO: 28)LCN23934SenseUGUCCCAAUCGACCAGUGUAU(SEQ ID NO: 29)Anti-senseAUACACUGGUCGAUUGGGACA(SEQ ID NO: 30)TNFRSF1B8784SenseGCCUUGGGUCUACUAAUAAUA(SEQ ID NO: 31)Anti-senseUAUUAUUAGUAGACCCAAGGC(SEQ ID NO: 32)MATN14146SenseCGGCUUUAAGAUGUUUGCUGU(SEQ ID NO: 33)Anti-senseACAGCAAACAUCUUAAAGCCG(SEQ ID NO: 34)CXCL56374SenseUGAAUUGUAGGUGACUAUUAU(SEQ ID NO: 35)Anti-senseAUAAUAGUCACCUACAAUUCA(SEQ ID NO: 36)SYTL494121SenseGAUGAGGGUGAGAUGAUAUUU(SEQ ID NO: 37) Anti-senseAAAUAUCAUCUCACCCUCAUC(SEQ ID NO: 38)

[0157] As a result, when each gene was knocked down compared to the control group with a non-specific sequence of scrambled RNA treatment (siSCR), a significant decrease in cell viability was observed in the MDA-MB-231 cell line due to single gene knockdown of MATN1, CXCL5, and SYTL4, while no significant change was observed in the single gene knockdown of LCN2 and TNFR2 (Fig. 6a). When cell death was observed after concurrent irradiation under the same conditions, a significant decrease in cell death was observed when CXCL5, SYTL4, and TNFR2 genes were knocked down compared to the control group, confirming that these genes are radiosensitive genes for breast cancer. In addition, LCN2 and MATN1 gene knockdown also showed a decrease in cell death induced by radiation. In addition, to confirm the radiosensitization effect according to the joint knockdown of genes, CXCL5 was knocked down alone, double knockdown of CXCL5 / LCN2 or CXCL5 / SYTL4, or triple knockdown of CXCL5 / SYTL4 / TNFR2 was treated, and then radiation was irradiated, and after 24 hours, cell death was measured by FACS analysis. As a result, the double knockdown of CXCL5 / LCN2 or CXCL5 / SYTL4, or triple knockdown of CXCL5 / SYTL4 / TNFR2 treatment group showed a more significant cell death inhibition effect than the CXCL5 knockdown alone (Fig. 6b).

[0158]

[0159] Through the above experiments, we confirmed that measuring the expression of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 can effectively predict the sensitivity of breast cancer cells to radiotherapy and the prognosis following radiotherapy. Therefore, it is expected that confirming the activity of the above-mentioned radiosensitivity gene panel and using it in conjunction with radiotherapy will lead to more effective treatment of breast cancer.

[0160]

[0161] Although representative embodiments of the present invention have been described above as examples, the scope of the present invention is not limited to the specific embodiments described above, and those skilled in the art will be able to make appropriate changes within the scope described in the claims of the present application.

Claims

1. A composition for diagnosing the radiosensitivity of breast cancer, comprising a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes or proteins encoded by two or more genes.

2. In claim 1, A composition for diagnosing the radiosensitivity of breast cancer, comprising a preparation for measuring the expression level of mRNA of the LCN2 gene or a protein encoded by the gene.

3. In claim 1, A composition for diagnosing the radiosensitivity of breast cancer, wherein the agent for measuring the expression level of mRNA of the gene is at least one selected from the group consisting of a primer, a probe, and an antisense nucleotide that specifically bind to the mRNA of the gene.

4. In claim 2, A composition for diagnosing the radiosensitivity of breast cancer, wherein the agent for measuring the expression level of the protein is at least one selected from the group consisting of a polypeptide, a compound, an antibody, and an aptamer that specifically binds to the protein.

5. A kit for diagnosing radiosensitivity of breast cancer, comprising a composition according to any one of claims 1 to 4.

6. In claim 5, The above kit is a kit for diagnosing the radiosensitivity of breast cancer, which is an RT-PCR kit, a microarray chip kit, a DNA kit, an ELISA kit, a protein chip kit or a rapid kit. 7.(a) a step of measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1 and SYTL4 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) A method for providing information for diagnosing radiation sensitivity of breast cancer, comprising the step of comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control group.

8. In claim 7, A method for providing information for diagnosing radiation sensitivity of breast cancer, wherein the step (a) comprises a step of measuring the expression level of mRNA of the LCN2 gene or a protein encoded by the gene.

9. A composition for predicting the prognosis of radiation therapy for breast cancer, comprising a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1, and SYTL4 genes or proteins encoded by two or more genes.

10. In claim 9, A composition for predicting the prognosis of radiation therapy for breast cancer, comprising a preparation for measuring the expression level of mRNA of the LCN2 gene or a protein encoded by the gene.

11. In claim 9, A composition for predicting the prognosis of radiation therapy for breast cancer, wherein the agent for measuring the expression level of mRNA of the gene is at least one selected from the group consisting of a primer, a probe, and an antisense nucleotide that specifically bind to the mRNA of the gene.

12. In claim 9, A composition for predicting the prognosis of radiation therapy for breast cancer, wherein the agent for measuring the expression level of the protein is at least one selected from the group consisting of antibodies and aptamers that specifically bind to the protein.

13. A kit for predicting the prognosis of radiation therapy for breast cancer, comprising a composition according to any one of claims 9 to 12.

14. In claim 13, The above kit is a kit for predicting the prognosis of radiation therapy for breast cancer, which is an RT-PCR kit, a microarray chip kit, a DNA kit, an ELISA kit, a protein chip kit, or a rapid kit. 15.(a) A step of measuring the expression level of mRNA of two or more genes selected from the group consisting of CD68, IFI16, TNFR2, CXCL5, LCN2, SERPING1, MATN1 and SYTL4 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) A method for providing information for predicting the prognosis of radiation therapy for breast cancer, comprising the step of comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control group.

16. In claim 15, A method for providing information for predicting the prognosis of radiation therapy for breast cancer, wherein the step (a) includes a step of measuring the expression level of mRNA of the LCN2 gene or a protein encoded by the gene.

Images